Sample records for identifying bovine prion

  1. Classical Bovine Spongiform Encephalopathy by Transmission of H-Type Prion in Homologous Prion Protein Context

    PubMed Central

    Andréoletti, Olivier; Lacroux, Caroline; Prieto, Irene; Lorenzo, Patricia; Larska, Magdalena; Baron, Thierry; Espinosa, Juan-Carlos

    2011-01-01

    Bovine spongiform encephalopathy (BSE) and BSE-related disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profiles of abnormal protease-resistant prion protein (PrPres), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molecular and neuropathologic properties during transmission in transgenic mice expressing homologous bovine prion protein. Unexpectedly, in several inoculated animals, strain features emerged that were highly similar to those of classical BSE agent. These findings demonstrate the capability of an atypical bovine prion to acquire classical BSE–like properties during propagation in a homologous bovine prion protein context and support the view that the epidemic BSE agent could have originated from such a cattle prion. PMID:21888788

  2. Guinea Pig Prion Protein Supports Rapid Propagation of Bovine Spongiform Encephalopathy and Variant Creutzfeldt-Jakob Disease Prions.

    PubMed

    Watts, Joel C; Giles, Kurt; Saltzberg, Daniel J; Dugger, Brittany N; Patel, Smita; Oehler, Abby; Bhardwaj, Sumita; Sali, Andrej; Prusiner, Stanley B

    2016-11-01

    The biochemical and neuropathological properties of bovine spongiform encephalopathy (BSE) and variant Creutzfeldt-Jakob disease (vCJD) prions are faithfully maintained upon transmission to guinea pigs. However, primary and secondary transmissions of BSE and vCJD in guinea pigs result in long incubation periods of ∼450 and ∼350 days, respectively. To determine if the incubation periods of BSE and vCJD prions could be shortened, we generated transgenic (Tg) mice expressing guinea pig prion protein (GPPrP). Inoculation of Tg(GPPrP) mice with BSE and vCJD prions resulted in mean incubation periods of 210 and 199 days, respectively, which shortened to 137 and 122 days upon serial transmission. In contrast, three different isolates of sporadic CJD prions failed to transmit disease to Tg(GPPrP) mice. Many of the strain-specified biochemical and neuropathological properties of BSE and vCJD prions, including the presence of type 2 protease-resistant PrP Sc , were preserved upon propagation in Tg(GPPrP) mice. Structural modeling revealed that two residues near the N-terminal region of α-helix 1 in GPPrP might mediate its susceptibility to BSE and vCJD prions. Our results demonstrate that expression of GPPrP in Tg mice supports the rapid propagation of BSE and vCJD prions and suggest that Tg(GPPrP) mice may serve as a useful paradigm for bioassaying these prion isolates. Variant Creutzfeldt-Jakob disease (vCJD) and bovine spongiform encephalopathy (BSE) prions are two of the prion strains most relevant to human health. However, propagating these strains in mice expressing human or bovine prion protein has been difficult because of prolonged incubation periods or inefficient transmission. Here, we show that transgenic mice expressing guinea pig prion protein are fully susceptible to vCJD and BSE prions but not to sporadic CJD prions. Our results suggest that the guinea pig prion protein is a better, more rapid substrate than either bovine or human prion protein for

  3. The Risk of Prion Infection through Bovine Grafting Materials.

    PubMed

    Kim, Yeoungsug; Rodriguez, Angel Emmanuel; Nowzari, Hessam

    2016-12-01

    Bovine-derived grafting materials are frequently used in a variety of bone augmentation techniques. The aim of this paper is to assess the unique safety issue of bovine-derived grafting materials that is rarely addressed in dental literature: risk of bovine spongiform encephalopathy (BSE). The validity of the current BSE diagnostic methods, surveillance and epidemiological trends in affected countries, and BSE infectivity in bovine bone before and after manufacturing processing were reviewed and analyzed. Prion screening has significant limits. Humans are not safe from the infection of prion disease of other species. Prions can and do break the species barrier. There is evidence there may be tens of thousands of infectious carriers in the western countries alone. This raises concern about the potential for perpetuation of infection via medical procedures. The limited ability to screen prions within the animal genome, along with a long latency period to manifestation of the disease (1 to over 50 years) in infected patients, provides a framework for discussing posible long-term risks of the xenografts that are used so extensively in dentistry. We suggest abolishing the use of bovine bone. © 2016 Wiley Periodicals, Inc.

  4. Use of bovine recombinant prion protein and real-time quaking-induced conversion to detect cattle transmissible mink encephalopathy prions and discriminate classical and atypical L- and H-Type bovine spongiform encephalopathy.

    PubMed

    Hwang, Soyoun; Greenlee, Justin J; Nicholson, Eric M

    2017-01-01

    Prions are amyloid-forming proteins that cause transmissible spongiform encephalopathies through a process involving conversion from the normal cellular prion protein to the pathogenic misfolded conformation (PrPSc). This conversion has been used for in vitro assays including serial protein misfolding amplification and real-time quaking induced conversion (RT-QuIC). RT-QuIC can be used for the detection of prions in a variety of biological tissues from humans and animals. Extensive work has been done to demonstrate that RT-QuIC is a rapid, specific, and highly sensitive prion detection assay. RT-QuIC uses recombinant prion protein to detect minute amounts of PrPSc. RT-QuIC has been successfully used to detect PrPSc from different prion diseases with a variety of substrates including hamster, human, sheep, bank vole, bovine and chimeric forms of prion protein. However, recombinant bovine prion protein has not been used to detect transmissible mink encephalopathy (TME) or to differentiate types of bovine spongiform encephalopathy (BSE) in samples from cattle. We evaluated whether PrPSc from TME and BSE infected cattle can be detected with RT-QuIC using recombinant bovine prion proteins, and optimized the reaction conditions to specifically detect cattle TME and to discriminate between classical and atypical BSE by conversion efficiency. We also found that substrate composed of the disease associated E211K mutant protein can be effective for the detection of TME in cattle and that wild type prion protein appears to be a practical substrate to discriminate between the different types of BSEs.

  5. NMR structure of the bovine prion protein

    PubMed Central

    López García, Francisco; Zahn, Ralph; Riek, Roland; Wüthrich, Kurt

    2000-01-01

    The NMR structures of the recombinant 217-residue polypeptide chain of the mature bovine prion protein, bPrP(23–230), and a C-terminal fragment, bPrP(121–230), include a globular domain extending from residue 125 to residue 227, a short flexible chain end of residues 228–230, and an N-terminal flexibly disordered “tail” comprising 108 residues for the intact protein and 4 residues for bPrP(121–230), respectively. The globular domain contains three α-helices comprising the residues 144–154, 173–194, and 200–226, and a short antiparallel β-sheet comprising the residues 128–131 and 161–164. The best-defined parts of the globular domain are the central portions of the helices 2 and 3, which are linked by the only disulfide bond in bPrP. Significantly increased disorder and mobility is observed for helix 1, the loop 166–172 leading from the β-strand 2 to helix 2, the end of helix 2 and the following loop, and the last turn of helix 3. Although there are characteristic local differences relative to the conformations of the murine and Syrian hamster prion proteins, the bPrP structure is essentially identical to that of the human prion protein. On the other hand, there are differences between bovine and human PrP in the surface distribution of electrostatic charges, which then appears to be the principal structural feature of the “healthy” PrP form that might affect the stringency of the species barrier for transmission of prion diseases between humans and cattle. PMID:10899999

  6. Conserved properties of human and bovine prion strains on transmission to guinea pigs

    PubMed Central

    Safar, Jiri G.; Giles, Kurt; Lessard, Pierre; Letessier, Frederic; Patel, Smita; Serban, Ana; DeArmond, Stephen J.; Prusiner, Stanley B.

    2011-01-01

    The first transmissions of human prion diseases to rodents used guinea pigs (Gps, Cavia porcellus). Later, transgenic (Tg) mice expressing human or chimeric human/mouse PrP replaced Gps, but the small size of the mouse limits some investigations. To investigate the fidelity of strain-specific prion transmission to Gps, we inoculated “type 1” and “type 2” prion strains into Gps: we measured the incubation times and determined the strain-specified size of the unglycosylated, protease-resistant (r) PrPSc fragment. Prions passaged once in Gps from cases of sporadic (s) Creutzfeldt–Jakob disease (CJD) and Gerstmann-Sträussler-Scheinker (GSS) disease caused by the P102L mutation were used as well as human prions from a variant (v) CJD case, bovine prions from bovine spongiform encephalopathy (BSE), and mouse-passaged scrapie prions. Variant CJD and BSE prions transmitted to all the inoculated Gps with incubation times of 367 ± 4 d and 436 ± 28 d, respectively. On second passage in Gps, vCJD and BSE prions caused disease in 287 ± 4 d and 310 ± 4 d, while sCJD and GSS prions transmitted in 237 ± 4 d and 279 ± 19 d, respectively. Although hamster Sc237 prions transmitted to 2 of 3 Gps after 574 and 792 d, mouse-passaged RML and 301V prion strains, the latter derived from BSE prions, failed to transmit disease to Gps. Those Gps inoculated with vCJD or BSE prions exhibited “type 2” unglycosylated, rPrPSc (19 kDa) while those receiving sCJD or GSS prions displayed “type 1” prions (21 kDa), as determined by Western blotting. Such strain-specific properties were maintained in Gps as well as mice expressing a chimeric human/mouse transgene. Gps may prove particularly useful in further studies of novel human prions such as those causing vCJD. PMID:21727894

  7. Emergence of a novel bovine spongiform encephalopathy (BSE) prion from an atypical H-type BSE

    PubMed Central

    Masujin, Kentaro; Okada, Hiroyuki; Miyazawa, Kohtaro; Matsuura, Yuichi; Imamura, Morikazu; Iwamaru, Yoshifumi; Murayama, Yuichi; Yokoyama, Takashi

    2016-01-01

    The H-type of atypical bovine spongiform encephalopathy (H-BSE) was serially passaged in bovinized transgenic (TgBoPrP) mice. At the fourth passage, most challenged mice showed a typical H-BSE phenotype with incubation periods of 223 ± 7.8 days. However, a different phenotype of BSE prion with shorter incubation periods of 109 ± 4 days emerged in a minor subset of the inoculated mice. The latter showed distinct clinical signs, brain pathology, and abnormal prion protein profiles as compared to H-BSE and other known BSE strains in mice. This novel prion was transmitted intracerebrally to cattle, with incubation periods of 14.8 ± 1.5 months, with phenotypes that differed from those of other bovine prion strains. These data suggest that intraspecies transmission of H-BSE in cattle allows the emergence of a novel BSE strain. Therefore, the continuation of feed ban programs may be necessary to exclude the recycling of H-BSE prions, which appear to arise spontaneously, in livestock. Such measures should help to reduce the risks from both novel and known strains of BSE. PMID:26948374

  8. Sequence variations of the bovine prion protein gene (PRNP) in native Korean Hanwoo cattle

    PubMed Central

    Choi, Sangho

    2012-01-01

    Bovine spongiform encephalopathy (BSE) is one of the fatal neurodegenerative diseases known as transmissible spongiform encephalopathies (TSEs) caused by infectious prion proteins. Genetic variations correlated with susceptibility or resistance to TSE in humans and sheep have not been reported for bovine strains including those from Holstein, Jersey, and Japanese Black cattle. Here, we investigated bovine prion protein gene (PRNP) variations in Hanwoo cattle [Bos (B.) taurus coreanae], a native breed in Korea. We identified mutations and polymorphisms in the coding region of PRNP, determined their frequency, and evaluated their significance. We identified four synonymous polymorphisms and two non-synonymous mutations in PRNP, but found no novel polymorphisms. The sequence and number of octapeptide repeats were completely conserved, and the haplotype frequency of the coding region was similar to that of other B. taurus strains. When we examined the 23-bp and 12-bp insertion/deletion (indel) polymorphisms in the non-coding region of PRNP, Hanwoo cattle had a lower deletion allele and 23-bp del/12-bp del haplotype frequency than healthy and BSE-affected animals of other strains. Thus, Hanwoo are seemingly less susceptible to BSE than other strains due to the 23-bp and 12-bp indel polymorphisms. PMID:22705734

  9. Spontaneous Generation of Infectious Prion Disease in Transgenic Mice

    PubMed Central

    Castilla, Joaquín; Pintado, Belén; Gutiérrez-Adan, Alfonso; Andréoletti, Olivier; Aguilar-Calvo, Patricia; Arroba, Ana-Isabel; Parra-Arrondo, Beatriz; Ferrer, Isidro; Manzanares, Jorge; Espinosa, Juan-Carlos

    2013-01-01

    We generated transgenic mice expressing bovine cellular prion protein (PrPC) with a leucine substitution at codon 113 (113L). This protein is homologous to human protein with mutation 102L, and its genetic link with Gerstmann–Sträussler–Scheinker syndrome has been established. This mutation in bovine PrPC causes a fully penetrant, lethal, spongiform encephalopathy. This genetic disease was transmitted by intracerebral inoculation of brain homogenate from ill mice expressing mutant bovine PrP to mice expressing wild-type bovine PrP, which indicated de novo generation of infectious prions. Our findings demonstrate that a single amino acid change in the PrPC sequence can induce spontaneous generation of an infectious prion disease that differs from all others identified in hosts expressing the same PrPC sequence. These observations support the view that a variety of infectious prion strains might spontaneously emerge in hosts displaying random genetic PrPC mutations. PMID:24274622

  10. Strategies for identifying new prions in yeast

    PubMed Central

    MacLea, Kyle S

    2011-01-01

    The unexpected discovery of two prions, [URE3] and [PSI+], in Saccharomyces cerevisiae led to questions about how many other proteins could undergo similar prion-based structural conversions. However, [URE3] and [PSI+] were discovered by serendipity in genetic screens. Cataloging the full range of prions in yeast or in other organisms will therefore require more systematic search methods. Taking advantage of some of the unique features of prions, various researchers have developed bioinformatic and experimental methods for identifying novel prion proteins. These methods have generated long lists of prion candidates. The systematic testing of some of these prion candidates has led to notable successes; however, even in yeast, where rapid growth rate and ease of genetic manipulation aid in testing for prion activity, such candidate testing is laborious. Development of better methods to winnow the field of prion candidates will greatly aid in the discovery of new prions, both in yeast and in other organisms, and help us to better understand the role of prions in biology. PMID:22052351

  11. Experimental Infection of Cattle With a Novel Prion Derived From Atypical H-Type Bovine Spongiform Encephalopathy.

    PubMed

    Okada, Hiroyuki; Masujin, Kentaro; Miyazawa, Kohtaro; Iwamaru, Yoshihumi; Imamura, Morikazu; Matsuura, Yuichi; Arai, Shozo; Fukuda, Shigeo; Murayama, Yuichi; Yokoyama, Takashi

    2017-11-01

    H-type bovine spongiform encephalopathy (H-BSE) is an atypical form of BSE in cattle. During passaging of H-BSE in transgenic bovinized (TgBoPrP) mice, a novel phenotype of BSE, termed BSE-SW emerged and was characterized by a short incubation time and host weight loss. To investigate the biological and biochemical properties of the BSE-SW prion, a transmission study was conducted in cattle, which were inoculated intracerebrally with brain homogenate from BSE-SW-infected TgBoPrP mice. The disease incubation period was approximately 15 months. The animals showed characteristic neurological signs of dullness, and severe spongiform changes and a widespread, uniform distribution of disease-associated prion protein (PrP Sc ) were observed throughout the brain of infected cattle. Immunohistochemical PrP Sc staining of the brain revealed the presence of intraglial accumulations and plaque-like deposits. No remarkable differences were identified in vacuolar lesion scores, topographical distribution patterns, and staining types of PrP Sc in the brains of BSE-SW- vs H-BSE-infected cattle. PrP Sc deposition was detected in the ganglia, vagus nerve, spinal nerve, cauda equina, adrenal medulla, and ocular muscle. Western blot analysis revealed that the specific biochemical properties of the BSE-SW prion, with an additional 10- to 12-kDa fragment, were well maintained after transmission. These findings indicated that the BSE-SW prion has biochemical properties distinct from those of H-BSE in cattle, although clinical and pathologic features of BSW-SW in cattle are indistinguishable from those of H-BSE. The results suggest that the 2 infectious agents, BSE-SW and H-BSE, are closely related strains.

  12. A prion primer

    PubMed Central

    Cashman, N R

    1997-01-01

    By biological and medical criteria, prions are infectious agents; however, many of their properties differ profoundly from those of conventional microbes. Prions are "encoded" by alterations in protein conformation rather than in nucleic acid or amino acid sequence. New epidemic prion diseases (bovine spongiform encephalopathy and new variant Creutzfeldt-Jakob disease) have recently emerged under the active surveillance of the modern world. The risk of contracting prion disease from blood products or other biologicals is now a focus of worldwide concern. Much has been discovered about prions and prion diseases, but much remains to be done. PMID:9371069

  13. Human prion diseases: surgical lessons learned from iatrogenic prion transmission.

    PubMed

    Bonda, David J; Manjila, Sunil; Mehndiratta, Prachi; Khan, Fahd; Miller, Benjamin R; Onwuzulike, Kaine; Puoti, Gianfranco; Cohen, Mark L; Schonberger, Lawrence B; Cali, Ignazio

    2016-07-01

    The human prion diseases, or transmissible spongiform encephalopathies, have captivated our imaginations since their discovery in the Fore linguistic group in Papua New Guinea in the 1950s. The mysterious and poorly understood "infectious protein" has become somewhat of a household name in many regions across the globe. From bovine spongiform encephalopathy (BSE), commonly identified as mad cow disease, to endocannibalism, media outlets have capitalized on these devastatingly fatal neurological conditions. Interestingly, since their discovery, there have been more than 492 incidents of iatrogenic transmission of prion diseases, largely resulting from prion-contaminated growth hormone and dura mater grafts. Although fewer than 9 cases of probable iatrogenic neurosurgical cases of Creutzfeldt-Jakob disease (CJD) have been reported worldwide, the likelihood of some missed cases and the potential for prion transmission by neurosurgery create considerable concern. Laboratory studies indicate that standard decontamination and sterilization procedures may be insufficient to completely remove infectivity from prion-contaminated instruments. In this unfortunate event, the instruments may transmit the prion disease to others. Much caution therefore should be taken in the absence of strong evidence against the presence of a prion disease in a neurosurgical patient. While the Centers for Disease Control and Prevention (CDC) and World Health Organization (WHO) have devised risk assessment and decontamination protocols for the prevention of iatrogenic transmission of the prion diseases, incidents of possible exposure to prions have unfortunately occurred in the United States. In this article, the authors outline the historical discoveries that led from kuru to the identification and isolation of the pathological prion proteins in addition to providing a brief description of human prion diseases and iatrogenic forms of CJD, a brief history of prion disease nosocomial transmission

  14. Human prion diseases: surgical lessons learned from iatrogenic prion transmission

    PubMed Central

    Bonda, David J.; Manjila, Sunil; Mehndiratta, Prachi; Khan, Fahd; Miller, Benjamin R.; Onwuzulike, Kaine; Puoti, Gianfranco; Cohen, Mark L.; Schonberger, Lawrence B.; Cali, Ignazio

    2016-01-01

    The human prion diseases, or transmissible spongiform encephalopathies, have captivated our imaginations since their discovery in the Fore linguistic group in Papua New Guinea in the 1950s. The mysterious and poorly understood “infectious protein” has become somewhat of a household name in many regions across the globe. From bovine spongiform encephalopathy (BSE), commonly identified as mad cow disease, to endocannibalism, media outlets have capitalized on these devastatingly fatal neurological conditions. Interestingly, since their discovery, there have been more than 492 incidents of iatrogenic transmission of prion diseases, largely resulting from prion-contaminated growth hormone and dura mater grafts. Although fewer than 9 cases of probable iatrogenic neurosurgical cases of Creutzfeldt-Jakob disease (CJD) have been reported worldwide, the likelihood of some missed cases and the potential for prion transmission by neurosurgery create considerable concern. Laboratory studies indicate that standard decontamination and sterilization procedures may be insufficient to completely remove infectivity from prion-contaminated instruments. In this unfortunate event, the instruments may transmit the prion disease to others. Much caution therefore should be taken in the absence of strong evidence against the presence of a prion disease in a neurosurgical patient. While the Centers for Disease Control and Prevention (CDC) and World Health Organization (WHO) have devised risk assessment and decontamination protocols for the prevention of iatrogenic transmission of the prion diseases, incidents of possible exposure to prions have unfortunately occurred in the United States. In this article, the authors outline the historical discoveries that led from kuru to the identification and isolation of the pathological prion proteins in addition to providing a brief description of human prion diseases and iatrogenic forms of CJD, a brief history of prion disease nosocomial

  15. Production of cattle lacking prion protein

    PubMed Central

    Richt, Jürgen A; Kasinathan, Poothappillai; Hamir, Amir N; Castilla, Joaquin; Sathiyaseelan, Thillai; Vargas, Francisco; Sathiyaseelan, Janaki; Wu, Hua; Matsushita, Hiroaki; Koster, Julie; Kato, Shinichiro; Ishida, Isao; Soto, Claudio; Robl, James M; Kuroiwa, Yoshimi

    2010-01-01

    Prion diseases are caused by propagation of misfolded forms of the normal cellular prion protein PrPC, such as PrPBSE in bovine spongiform encephalopathy (BSE) in cattle and PrPCJD in Creutzfeldt-Jakob disease (CJD) in humans1. Disruption of PrPC expression in mice, a species that does not naturally contract prion diseases, results in no apparent developmental abnormalities2–5. However, the impact of ablating PrPC function in natural host species of prion diseases is unknown. Here we report the generation and characterization of PrPC-deficient cattle produced by a sequential gene-targeting system6. At over 20 months of age, the cattle are clinically, physiologically, histopathologically, immunologically and reproductively normal. Brain tissue homogenates are resistant to prion propagation in vitro as assessed by protein misfolding cyclic amplification7. PrPC-deficient cattle may be a useful model for prion research and could provide industrial bovine products free of prion proteins. PMID:17195841

  16. A comparison of classical and H-type bovine spongiform encephalopathy associated with E211K prion protein polymorphism in wild type and EK211 cattle following intracranial inoculation

    USDA-ARS?s Scientific Manuscript database

    In 2006, a case of H-type bovine spongiform encephalopathy (BSE-H) was diagnosed in a cow that was associated with a heritable polymorphism in the bovine prion protein gene (PRNP) resulting in a lysine for glutamine amino acid substitution at codon 211 (called E211K) of the prion protein. Although t...

  17. Genetics of Prion Disease in Cattle

    PubMed Central

    Murdoch, Brenda M.; Murdoch, Gordon K.

    2015-01-01

    Bovine spongiform encephalopathy (BSE) is a prion disease that is invariably fatal in cattle and has been implicated as a significant human health risk. As a transmissible disease of livestock, it has impacted food safety, production practices, global trade, and profitability. Genetic polymorphisms that alter the prion protein in humans and sheep are associated with transmissible spongiform encephalopathy susceptibility or resistance. In contrast, there is no strong evidence that nonsynonymous mutations in the bovine prion gene (PRNP) are associated with classical BSE (C-BSE) disease susceptibility, though two bovine PRNP insertion/deletion polymorphisms, in the putative region, are associated with susceptibility to C-BSE. However, these associations do not explain the full extent of BSE susceptibility, and loci outside of PRNP appear to be associated with disease incidence in some cattle populations. This article provides a review of the current state of genetic knowledge regarding prion diseases in cattle. PMID:26462233

  18. Resistance of Bovine Spongiform Encephalopathy (BSE) Prions to Inactivation

    PubMed Central

    Giles, Kurt; Glidden, David V.; Beckwith, Robyn; Seoanes, Rose; Peretz, David; DeArmond, Stephen J.; Prusiner, Stanley B.

    2008-01-01

    Distinct prion strains often exhibit different incubation periods and patterns of neuropathological lesions. Strain characteristics are generally retained upon intraspecies transmission, but may change on transmission to another species. We investigated the inactivation of two related prions strains: BSE prions from cattle and mouse-passaged BSE prions, termed 301V. Inactivation was manipulated by exposure to sodium dodecyl sulfate (SDS), variations in pH, and different temperatures. Infectivity was measured using transgenic mouse lines that are highly susceptible to either BSE or 301V prions. Bioassays demonstrated that BSE prions are up to 1,000-fold more resistant to inactivation than 301V prions while Western immunoblotting showed that short acidic SDS treatments reduced protease-resistant PrPSc from BSE prions and 301V prions at similar rates. Our findings argue that despite being derived from BSE prions, mouse 301V prions are not necessarily a reliable model for cattle BSE prions. Extending these comparisons to human sporadic Creutzfeldt-Jakob disease and hamster Sc237 prions, we found that BSE prions were 10- and 106-fold more resistant to inactivation, respectively. Our studies contend that any prion inactivation procedures must be validated by bioassay against the prion strain for which they are intended to be used. PMID:19008948

  19. Genetics Home Reference: prion disease

    MedlinePlus

    ... from eating beef products containing PrP Sc from cattle with prion disease . In cows, this form of the disease is known as bovine spongiform encephalopathy (BSE) or, more commonly, "mad cow disease." Another example of an acquired human prion ...

  20. Prion diseases in humans: an update.

    PubMed

    Butler, Rob

    2006-10-01

    The year 2006 marks 20 years from the first identified bovine spongiform encephalitis in cows and 10 years from the first description of variant Creutzfeldt-Jakob disease in humans. The threatened epidemic in humans now appears unlikely, but psychiatrists need to be aware of recent developments in prion diseases.

  1. Prion Protein Devoid of the Octapeptide Repeat Region Delays Bovine Spongiform Encephalopathy Pathogenesis in Mice.

    PubMed

    Hara, Hideyuki; Miyata, Hironori; Das, Nandita Rani; Chida, Junji; Yoshimochi, Tatenobu; Uchiyama, Keiji; Watanabe, Hitomi; Kondoh, Gen; Yokoyama, Takashi; Sakaguchi, Suehiro

    2018-01-01

    Conformational conversion of the cellular isoform of prion protein, PrP C , into the abnormally folded, amyloidogenic isoform, PrP Sc , is a key pathogenic event in prion diseases, including Creutzfeldt-Jakob disease in humans and scrapie and bovine spongiform encephalopathy (BSE) in animals. We previously reported that the octapeptide repeat (OR) region could be dispensable for converting PrP C into PrP Sc after infection with RML prions. We demonstrated that mice transgenically expressing mouse PrP with deletion of the OR region on the PrP knockout background, designated Tg(PrPΔOR)/ Prnp 0 / 0 mice, did not show reduced susceptibility to RML scrapie prions, with abundant accumulation of PrP Sc ΔOR in their brains. We show here that Tg(PrPΔOR)/ Prnp 0 / 0 mice were highly resistant to BSE prions, developing the disease with markedly elongated incubation times after infection with BSE prions. The conversion of PrPΔOR into PrP Sc ΔOR was markedly delayed in their brains. These results suggest that the OR region may have a crucial role in the conversion of PrP C into PrP Sc after infection with BSE prions. However, Tg(PrPΔOR)/ Prnp 0 / 0 mice remained susceptible to RML and 22L scrapie prions, developing the disease without elongated incubation times after infection with RML and 22L prions. PrP Sc ΔOR accumulated only slightly less in the brains of RML- or 22L-infected Tg(PrPΔOR)/ Prnp 0 / 0 mice than PrP Sc in control wild-type mice. Taken together, these results indicate that the OR region of PrP C could play a differential role in the pathogenesis of BSE prions and RML or 22L scrapie prions. IMPORTANCE Structure-function relationship studies of PrP C conformational conversion into PrP Sc are worthwhile to understand the mechanism of the conversion of PrP C into PrP Sc We show here that, by inoculating Tg(PrPΔOR)/ Prnp 0 / 0 mice with the three different strains of RML, 22L, and BSE prions, the OR region could play a differential role in the conversion of

  2. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most

  3. Genotype-dependent Molecular Evolution of Sheep Bovine Spongiform Encephalopathy (BSE) Prions in Vitro Affects Their Zoonotic Potential*

    PubMed Central

    Krejciova, Zuzana; Barria, Marcelo A.; Jones, Michael; Ironside, James W.; Jeffrey, Martin; González, Lorenzo; Head, Mark W.

    2014-01-01

    Prion diseases are rare fatal neurological conditions of humans and animals, one of which (variant Creutzfeldt-Jakob disease) is known to be a zoonotic form of the cattle disease bovine spongiform encephalopathy (BSE). What makes one animal prion disease zoonotic and others not is poorly understood, but it appears to involve compatibility between the prion strain and the host prion protein sequence. Concerns have been raised that the United Kingdom sheep flock may have been exposed to BSE early in the cattle BSE epidemic and that serial BSE transmission in sheep might have resulted in adaptation of the agent, which may have come to phenotypically resemble scrapie while maintaining its pathogenicity for humans. We have modeled this scenario in vitro. Extrapolation from our results suggests that if BSE were to infect sheep in the field it may, with time and in some sheep genotypes, become scrapie-like at the molecular level. However, the results also suggest that if BSE in sheep were to come to resemble scrapie it would lose its ability to affect humans. PMID:25100723

  4. Prions and prion diseases: fundamentals and mechanistic details.

    PubMed

    Ryou, Chongsuk

    2007-07-01

    Prion diseases, often called transmissible spongiform encephalopathies (TSEs), are infectious diseases that accompany neurological dysfunctions in many mammalian hosts. Prion diseases include Creutzfeldt-Jakob disease (CJD) in humans, bovine spongiform encephalopathy (BSE, "mad cow disease") in cattle, scrapie in sheep, and chronic wasting disease (CWD) in deer and elks. The cause of these fatal diseases is a proteinaceous pathogen termed prion that lacks functional nucleic acids. As demonstrated in the BSE outbreak and its transmission to humans, the onset of disease is not limited to a certain species but can be transmissible from one host species to another. Such a striking nature ofprions has generated huge concerns in public health and attracted serious attention in the scientific communities. To date, the potential transmission ofprions to humans via foodbome infectiorn and iatrogenic routes has not been alleviated. Rather, the possible transmission of human to human or cervids to human aggravates the terrifying situation across the globe. In this review, basic features about prion diseases including clinical and pathological characteristics, etiology, and transmission of diseases are described. Based on recently accumulated evidences, the molecular and biochemical aspects of prions, with an emphasis on the molecular interactions involved in prion conversion that is critical during prion replication and pathogenesis, are also addressed.

  5. Ovine recombinant PrP as an inhibitor of ruminant prion propagation in vitro.

    PubMed

    Workman, Rob G; Maddison, Ben C; Gough, Kevin C

    2017-07-04

    Prion diseases are fatal and incurable neurodegenerative diseases of humans and animals. Despite years of research, no therapeutic agents have been developed that can effectively manage or reverse disease progression. Recently it has been identified that recombinant prion proteins (rPrP) expressed in bacteria can act as inhibitors of prion replication within the in vitro prion replication system protein misfolding cyclic amplification (PMCA). Here, within PMCA reactions amplifying a range of ruminant prions including distinct Prnp genotypes/host species and distinct prion strains, recombinant ovine VRQ PrP displayed consistent inhibition of prion replication and produced IC50 values of 122 and 171 nM for ovine scrapie and bovine BSE replication, respectively. These findings illustrate the therapeutic potential of rPrPs with distinct TSE diseases.

  6. Biochemical Characterization of Prions.

    PubMed

    Fiorini, Michele; Bongianni, Matilde; Monaco, Salvatore; Zanusso, Gianluigi

    2017-01-01

    Prion disease or transmissible spongiform encephalopathies are characterized by the presence of the abnormal form of the prion protein (PrP Sc ). The pathological and transmissible properties of PrP Sc are enciphered in its secondary and tertiary structures. Since it's well established that different strains of prions are linked to different conformations of PrP Sc , biochemical characterization of prions seems a preliminary but reliable approach to detect, analyze, and compare prion strains. Experimental biochemical procedures might be helpful in distinguishing PrP Sc physicochemical properties and include resistance to proteinase K (PK) digestion, insolubility in nonionic detergents, PK-resistance under denaturing conditions and sedimentation properties in sucrose gradients. This biochemical approach has been extensively applied in human prion disorders and subsequently expanded for PrP Sc characterization in animals. In particular, in sporadic Creutzfedlt-Jakob disease (sCJD) PrP Sc is characterized by two main glycotypes conventionally named Type 1 and Type 2, based on the apparent gel migration at 21 and 19kDa of the PrP Sc PK-resistant fragment. An additional PrP Sc type was identified in sCJD characterized by an unglycosylated dominant glycoform pattern and in 2010 a variably protease-sensitive prionopathy (VPSPr) was reported showing a PrP Sc with an electrophoretic ladder like pattern. Additionally, the presence of PrP Sc truncated fragments completes the electrophoretic characterization of different prion strains. By two-dimensional (2D) electrophoretic analysis additional PrP Sc pattern was identified, since this procedure provides information about the isoelectric point and the different peptides length related to PK cleavage, as well as to glycosylation extent or GPI anchor presence. We here provide and extensive review on PrP Sc biochemical analysis in human and animal prion disorders. Further, we show that PrP Sc glycotypes observed in CJD share

  7. Atypical scrapie prions from sheep and lack of disease in transgenic mice overexpressing human prion protein.

    PubMed

    Wadsworth, Jonathan D F; Joiner, Susan; Linehan, Jacqueline M; Balkema-Buschmann, Anne; Spiropoulos, John; Simmons, Marion M; Griffiths, Peter C; Groschup, Martin H; Hope, James; Brandner, Sebastian; Asante, Emmanuel A; Collinge, John

    2013-11-01

    Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants.

  8. Atypical Scrapie Prions from Sheep and Lack of Disease in Transgenic Mice Overexpressing Human Prion Protein

    PubMed Central

    Joiner, Susan; Linehan, Jacqueline M.; Balkema-Buschmann, Anne; Spiropoulos, John; Simmons, Marion M.; Griffiths, Peter C.; Groschup, Martin H.; Hope, James; Brandner, Sebastian; Asante, Emmanuel A.; Collinge, John

    2013-01-01

    Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants. PMID:24188521

  9. In Vitro Approach To Identify Key Amino Acids in Low Susceptibility of Rabbit Prion Protein to Misfolding

    PubMed Central

    Eraña, Hasier; Fernández-Borges, Natalia; Elezgarai, Saioa R.; Harrathi, Chafik; Charco, Jorge M.; Chianini, Francesca; Dagleish, Mark P.; Ortega, Gabriel; Millet, Óscar

    2017-01-01

    ABSTRACT Prion diseases, or transmissible spongiform encephalopathies (TSEs), are a group of rare progressive neurodegenerative disorders caused by an abnormally folded prion protein (PrPSc). This is capable of transforming the normal cellular prion protein (PrPC) into new infectious PrPSc. Interspecies prion transmissibility studies performed by experimental challenge and the outbreak of bovine spongiform encephalopathy that occurred in the late 1980s and 1990s showed that while some species (sheep, mice, and cats) are readily susceptible to TSEs, others are apparently resistant (rabbits, dogs, and horses) to the same agent. To study the mechanisms of low susceptibility to TSEs of certain species, the mouse-rabbit transmission barrier was used as a model. To identify which specific amino acid residues determine high or low susceptibility to PrPSc propagation, protein misfolding cyclic amplification (PMCA), which mimics PrPC-to-PrPSc conversion with accelerated kinetics, was used. This allowed amino acid substitutions in rabbit PrP and accurate analysis of misfolding propensities. Wild-type rabbit recombinant PrP could not be misfolded into a protease-resistant self-propagating isoform in vitro despite seeding with at least 12 different infectious prions from diverse origins. Therefore, rabbit recombinant PrP mutants were designed to contain every single amino acid substitution that distinguishes rabbit recombinant PrP from mouse recombinant PrP. Key amino acid residue substitutions were identified that make rabbit recombinant PrP susceptible to misfolding, and using these, protease-resistant misfolded recombinant rabbit PrP was generated. Additional studies characterized the mechanisms by which these critical amino acid residue substitutions increased the misfolding susceptibility of rabbit PrP. IMPORTANCE Prion disorders are invariably fatal, untreatable diseases typically associated with long incubation periods and characteristic spongiform changes associated

  10. Experimental sheep BSE prions generate the vCJD phenotype when serially passaged in transgenic mice expressing human prion protein.

    PubMed

    Joiner, Susan; Asante, Emmanuel A; Linehan, Jacqueline M; Brock, Lara; Brandner, Sebastian; Bellworthy, Susan J; Simmons, Marion M; Hope, James; Collinge, John; Wadsworth, Jonathan D F

    2018-03-15

    The epizootic prion disease of cattle, bovine spongiform encephalopathy (BSE), causes variant Creutzfeldt-Jakob disease (vCJD) in humans following dietary exposure. While it is assumed that all cases of vCJD attributed to a dietary aetiology are related to cattle BSE, sheep and goats are susceptible to experimental oral challenge with cattle BSE prions and farmed animals in the UK were undoubtedly exposed to BSE-contaminated meat and bone meal during the late 1980s and early 1990s. Although no natural field cases of sheep BSE have been identified, it cannot be excluded that some BSE-infected sheep might have entered the European human food chain. Evaluation of the zoonotic potential of sheep BSE prions has been addressed by examining the transmission properties of experimental brain isolates in transgenic mice that express human prion protein, however to-date there have been relatively few studies. Here we report that serial passage of experimental sheep BSE prions in transgenic mice expressing human prion protein with methionine at residue 129 produces the vCJD phenotype that mirrors that seen when the same mice are challenged with vCJD prions from patient brain. These findings are congruent with those reported previously by another laboratory, and thereby strongly reinforce the view that sheep BSE prions could have acted as a causal agent of vCJD within Europe. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Molecular Barriers to Zoonotic Transmission of Prions

    PubMed Central

    Barria, Marcelo A.; Balachandran, Aru; Morita, Masanori; Kitamoto, Tetsuyuki; Barron, Rona; Manson, Jean; Knight, Richard; Ironside, James W.

    2014-01-01

    The risks posed to human health by individual animal prion diseases cannot be determined a priori and are difficult to address empirically. The fundamental event in prion disease pathogenesis is thought to be the seeded conversion of normal prion protein to its pathologic isoform. We used a rapid molecular conversion assay (protein misfolding cyclic amplification) to test whether brain homogenates from specimens of classical bovine spongiform encephalopathy (BSE), atypical BSE (H-type BSE and L-type BSE), classical scrapie, atypical scrapie, and chronic wasting disease can convert normal human prion protein to the abnormal disease-associated form. None of the tested prion isolates from diseased animals were as efficient as classical BSE in converting human prion protein. However, in the case of chronic wasting disease, there was no absolute barrier to conversion of the human prion protein. PMID:24377702

  12. The expanding universe of prion diseases.

    PubMed

    Watts, Joel C; Balachandran, Aru; Westaway, David

    2006-03-01

    Prions cause fatal and transmissible neurodegenerative disease. These etiological infectious agents are formed in greater part from a misfolded cell-surface protein called PrP(C). Several mammalian species are affected by the diseases, and in the case of "mad cow disease" (BSE) the agent has a tropism for humans, with negative consequences for agribusiness and public health. Unfortunately, the known universe of prion diseases is expanding. At least four novel prion diseases--including human diseases variant Creutzfeldt-Jakob disease (vCJD) and sporadic fatal insomnia (sFI), bovine amyloidotic spongiform encephalopathy (BASE), and Nor98 of sheep--have been identified in the last ten years, and chronic wasting disease (CWD) of North American deer (Odocoileus Specis) and Rocky Mountain elk (Cervus elaphus nelsoni) is undergoing a dramatic spread across North America. While amplification (BSE) and dissemination (CWD, commercial sourcing of cervids from the wild and movement of farmed elk) can be attributed to human activity, the origins of emergent prion diseases cannot always be laid at the door of humankind. Instead, the continued appearance of new outbreaks in the form of "sporadic" disease may be an inevitable outcome in a situation where the replicating pathogen is host-encoded.

  13. Porcine prion protein amyloid.

    PubMed

    Hammarström, Per; Nyström, Sofie

    2015-01-01

    Mammalian prions are composed of misfolded aggregated prion protein (PrP) with amyloid-like features. Prions are zoonotic disease agents that infect a wide variety of mammalian species including humans. Mammals and by-products thereof which are frequently encountered in daily life are most important for human health. It is established that bovine prions (BSE) can infect humans while there is no such evidence for any other prion susceptible species in the human food chain (sheep, goat, elk, deer) and largely prion resistant species (pig) or susceptible and resistant pets (cat and dogs, respectively). PrPs from these species have been characterized using biochemistry, biophysics and neurobiology. Recently we studied PrPs from several mammals in vitro and found evidence for generic amyloidogenicity as well as cross-seeding fibril formation activity of all PrPs on the human PrP sequence regardless if the original species was resistant or susceptible to prion disease. Porcine PrP amyloidogenicity was among the studied. Experimentally inoculated pigs as well as transgenic mouse lines overexpressing porcine PrP have, in the past, been used to investigate the possibility of prion transmission in pigs. The pig is a species with extraordinarily wide use within human daily life with over a billion pigs harvested for human consumption each year. Here we discuss the possibility that the largely prion disease resistant pig can be a clinically silent carrier of replicating prions.

  14. Prion gene haplotypes of U.S. cattle

    PubMed Central

    Clawson, Michael L; Heaton, Michael P; Keele, John W; Smith, Timothy PL; Harhay, Gregory P; Laegreid, William W

    2006-01-01

    Background Bovine spongiform encephalopathy (BSE) is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD) and haplotype networks within the bovine prion gene (PRNP) is important for 1) testing rare or common PRNP variation for an association with BSE and 2) interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes. Results A 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb). PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb). Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS) which characterize variation within and across PRNP. Conclusion The number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle. PMID:17092337

  15. An overview of animal prion diseases

    PubMed Central

    2011-01-01

    Prion diseases are transmissible neurodegenerative conditions affecting human and a wide range of animal species. The pathogenesis of prion diseases is associated with the accumulation of aggregates of misfolded conformers of host-encoded cellular prion protein (PrPC). Animal prion diseases include scrapie of sheep and goats, bovine spongiform encephalopathy (BSE) or mad cow disease, transmissible mink encephalopathy, feline spongiform encephalopathy, exotic ungulate spongiform encephalopathy, chronic wasting disease of cervids and spongiform encephalopathy of primates. Although some cases of sporadic atypical scrapie and BSE have also been reported, animal prion diseases have basically occurred via the acquisition of infection from contaminated feed or via the exposure to contaminated environment. Scrapie and chronic wasting disease are naturally sustaining epidemics. The transmission of BSE to human has caused more than 200 cases of variant Cruetzfeldt-Jacob disease and has raised serious public health concerns. The present review discusses the epidemiology, clinical neuropathology, transmissibility and genetics of animal prion diseases. PMID:22044871

  16. Epithelial and endothelial expression of the green fluorescent protein reporter gene under the control of bovine prion protein (PrP) gene regulatory sequences in transgenic mice

    NASA Astrophysics Data System (ADS)

    Lemaire-Vieille, Catherine; Schulze, Tobias; Podevin-Dimster, Valérie; Follet, Jérome; Bailly, Yannick; Blanquet-Grossard, Françoise; Decavel, Jean-Pierre; Heinen, Ernst; Cesbron, Jean-Yves

    2000-05-01

    The expression of the cellular form of the prion protein (PrPc) gene is required for prion replication and neuroinvasion in transmissible spongiform encephalopathies. The identification of the cell types expressing PrPc is necessary to understanding how the agent replicates and spreads from peripheral sites to the central nervous system. To determine the nature of the cell types expressing PrPc, a green fluorescent protein reporter gene was expressed in transgenic mice under the control of 6.9 kb of the bovine PrP gene regulatory sequences. It was shown that the bovine PrP gene is expressed as two populations of mRNA differing by alternative splicing of one 115-bp 5' untranslated exon in 17 different bovine tissues. The analysis of transgenic mice showed reporter gene expression in some cells that have been identified as expressing PrP, such as cerebellar Purkinje cells, lymphocytes, and keratinocytes. In addition, expression of green fluorescent protein was observed in the plexus of the enteric nervous system and in a restricted subset of cells not yet clearly identified as expressing PrP: the epithelial cells of the thymic medullary and the endothelial cells of both the mucosal capillaries of the intestine and the renal capillaries. These data provide valuable information on the distribution of PrPc at the cellular level and argue for roles of the epithelial and endothelial cells in the spread of infection from the periphery to the brain. Moreover, the transgenic mice described in this paper provide a model that will allow for the study of the transcriptional activity of the PrP gene promoter in response to scrapie infection.

  17. A naturally occurring variant of the human prion protein completely prevents prion disease.

    PubMed

    Asante, Emmanuel A; Smidak, Michelle; Grimshaw, Andrew; Houghton, Richard; Tomlinson, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Richard-Londt, Angela; Linehan, Jacqueline M; Brandner, Sebastian; Alpers, Michael; Whitfield, Jerome; Mead, Simon; Wadsworth, Jonathan D F; Collinge, John

    2015-06-25

    Mammalian prions, transmissible agents causing lethal neurodegenerative diseases, are composed of assemblies of misfolded cellular prion protein (PrP). A novel PrP variant, G127V, was under positive evolutionary selection during the epidemic of kuru--an acquired prion disease epidemic of the Fore population in Papua New Guinea--and appeared to provide strong protection against disease in the heterozygous state. Here we have investigated the protective role of this variant and its interaction with the common, worldwide M129V PrP polymorphism. V127 was seen exclusively on a M129 PRNP allele. We demonstrate that transgenic mice expressing both variant and wild-type human PrP are completely resistant to both kuru and classical Creutzfeldt-Jakob disease (CJD) prions (which are closely similar) but can be infected with variant CJD prions, a human prion strain resulting from exposure to bovine spongiform encephalopathy prions to which the Fore were not exposed. Notably, mice expressing only PrP V127 were completely resistant to all prion strains, demonstrating a different molecular mechanism to M129V, which provides its relative protection against classical CJD and kuru in the heterozygous state. Indeed, this single amino acid substitution (G→V) at a residue invariant in vertebrate evolution is as protective as deletion of the protein. Further study in transgenic mice expressing different ratios of variant and wild-type PrP indicates that not only is PrP V127 completely refractory to prion conversion but acts as a potent dose-dependent inhibitor of wild-type prion propagation.

  18. MAD COW DISEASE: New Recruits for French Prion Research.

    PubMed

    Casassus, B

    2000-12-01

    As panic over "mad cow disease" engulfs France and threatens to spread to other countries in Western Europe, French research minister Roger-Gérard Schwartzenberg last week unveiled detailed plans for spending $27 million the government has earmarked for prion disease research in 2001. Next year's budget for studying prions--infectious, abnormal proteins linked to bovine spongiform encephalopathy and its human form, variant Creutzfeldt-Jakob disease--will triple France's current prion research spending.

  19. The Expanding Universe of Prion Diseases

    PubMed Central

    Watts, Joel C; Balachandran, Aru; Westaway, David

    2006-01-01

    Prions cause fatal and transmissible neurodegenerative disease. These etiological infectious agents are formed in greater part from a misfolded cell-surface protein called PrPC. Several mammalian species are affected by the diseases, and in the case of “mad cow disease” (BSE) the agent has a tropism for humans, with negative consequences for agribusiness and public health. Unfortunately, the known universe of prion diseases is expanding. At least four novel prion diseases—including human diseases variant Creutzfeldt-Jakob disease (vCJD) and sporadic fatal insomnia (sFI), bovine amyloidotic spongiform encephalopathy (BASE), and Nor98 of sheep—have been identified in the last ten years, and chronic wasting disease (CWD) of North American deer (Odocoileus Specis) and Rocky Mountain elk (Cervus elaphus nelsoni) is undergoing a dramatic spread across North America. While amplification (BSE) and dissemination (CWD, commercial sourcing of cervids from the wild and movement of farmed elk) can be attributed to human activity, the origins of emergent prion diseases cannot always be laid at the door of humankind. Instead, the continued appearance of new outbreaks in the form of “sporadic” disease may be an inevitable outcome in a situation where the replicating pathogen is host-encoded. PMID:16609731

  20. Species-barrier-independent prion replication in apparently resistant species

    NASA Astrophysics Data System (ADS)

    Hill, Andrew F.; Joiner, Susan; Linehan, Jackie; Desbruslais, Melanie; Lantos, Peter L.; Collinge, John

    2000-08-01

    Transmission of prions between mammalian species is thought to be limited by a "species barrier," which depends on differences in the primary structure of prion proteins in the infecting inoculum and the host. Here we demonstrate that a strain of hamster prions thought to be nonpathogenic for conventional mice leads to prion replication to high levels in such mice but without causing clinical disease. Prions pathogenic in both mice and hamsters are produced. These results demonstrate the existence of subclinical forms of prion infection with important public health implications, both with respect to iatrogenic transmission from apparently healthy humans and dietary exposure to cattle and other species exposed to bovine spongiform encephalopathy prions. Current definitions of the species barrier, which have been based on clinical end-points, need to be fundamentally reassessed.

  1. The prion diseases of animals

    USDA-ARS?s Scientific Manuscript database

    Prion diseases or transmissible spongiform encephalopathies (TSEs) are fatal neurodegenerative diseases that affect several species of animals and include bovine spongiform encephalopathy (BSE), scrapie in sheep and goats, chronic wasting disease (CWD) in cervids, and transmissible mink encephalopat...

  2. Current and future molecular diagnostics for prion diseases.

    PubMed

    Lehto, Marty T; Peery, Harry E; Cashman, Neil R

    2006-07-01

    It is now widely held that the infectious agents underlying the transmissible spongiform encephalopathies are prions, which are primarily composed of a misfolded, protease-resistant isoform of the host prion protein. Untreatable prion disorders include some human diseases, such as Creutzfeldt-Jakob disease, and diseases of economically important animals, such as bovine spongiform encephalopathy (cattle) and chronic wasting disease (deer and elk). Detection and diagnosis of prion disease (and presymptomatic incubation) is contingent upon developing novel assays, which exploit properties uniquely possessed by this misfolded protein complex, rather than targeting an agent-specific nucleic acid. This review highlights some of the conventional and disruptive technologies developed to respond to this challenge.

  3. Genetic predictions of prion disease susceptibility in carnivore species based on variability of the prion gene coding region.

    PubMed

    Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A; Arnemo, Jon M; Tryland, Morten; Girling, Simon; Miller, Michael W; Tranulis, Michael A; Goldmann, Wilfred

    2012-01-01

    Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrP(C)) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrP(C) protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter.

  4. Genetic Predictions of Prion Disease Susceptibility in Carnivore Species Based on Variability of the Prion Gene Coding Region

    PubMed Central

    Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A.; Arnemo, Jon M.; Tryland, Morten; Girling, Simon; Miller, Michael W.; Tranulis, Michael A.; Goldmann, Wilfred

    2012-01-01

    Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrPC) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrPC protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter. PMID:23236380

  5. Prions spread via the autonomic nervous system from the gut to the central nervous system in cattle incubating bovine spongiform encephalopathy.

    PubMed

    Hoffmann, Christine; Ziegler, Ute; Buschmann, Anne; Weber, Artur; Kupfer, Leila; Oelschlegel, Anja; Hammerschmidt, Baerbel; Groschup, Martin H

    2007-03-01

    To elucidate the still-unknown pathogenesis of bovine spongiform encephalopathy (BSE), an oral BSE challenge and sequential kill study was carried out on 56 calves. Relevant tissues belonging to the peripheral and central nervous system, as well as to the lymphoreticular tract, from necropsied animals were analysed by highly sensitive immunohistochemistry and immunoblotting techniques to reveal the presence of BSE-associated pathological prion protein (PrPSc) depositions. Our results demonstrate two routes involving the autonomic nervous system through which BSE prions spread by anterograde pathways from the gastrointestinal tract (GIT) to the central nervous system (CNS): (i) via the coeliac and mesenteric ganglion complex, splanchnic nerves and the lumbal/caudal thoracic spinal cord (representing the sympathetic GIT innervation); and (ii) via the Nervus vagus (parasympathetic GIT innervation). The dorsal root ganglia seem to be subsequently affected, so it is likely that BSE prion invasion of the non-autonomic peripheral nervous system (e.g. sciatic nerve) is a secondary retrograde event following prion replication in the CNS. Moreover, BSE-associated PrPSc was already detected in the brainstem of an animal 24 months post-infection, which is 8 months earlier than reported previously. These findings are important for the understanding of BSE pathogenesis and for the development of new diagnostic strategies for this infectious disease.

  6. Evaluation of rapid post-mortem test kits for bovine spongiform encephalopathy (BSE) screening in Japan: Their analytical sensitivity to atypical BSE prions.

    PubMed

    Hagiwara, Ken'ichi; Iwamaru, Yoshifumi; Tabeta, Naoko; Yokoyama, Takashi; Tobiume, Minoru

    2017-03-04

    A classical type of bovine spongiform encephalopathy (C-BSE), recognized in 1987, had a large impact on public health due to its zoonotic link to variant Creutzfeldt-Jakob disease by the human consumption of dietary products contaminated with the C-BSE prion. Thus, a number of countries implemented BSE surveillance using rapid post-mortem test kits that were approved for detection of the C-BSE prion in the cattle brain. However, as atypical BSE (L- and H-BSE) cases emerged in subsequent years, the efficacy of the kits for the detection of atypical BSE prions became a matter of concern. In response to this, laboratories in the European Union and Canada evaluated the kits used in their countries. Here, we carried out an evaluation study of NippiBL®, a kit currently used for BSE screening in Japan. By applying the kit to cattle brains of field cases of C-BSE and L-BSE, and an experimental case of H-BSE, we showed its comparable sensitivities to C, L-, and H-BSE prions, and satisfactory performance required by the European Food Safety Authority. In addition to NippiBL®, two kits (TeSeE® and FRELISA®) formerly used in Japan were effective for detection of the L-BSE prion, although the two kits were unable to be tested for the H-BSE prion due to the discontinuation of domestic sales during this study. These results indicate that BSE screening in Japan is as effective as those in other countries, and it is unlikely that cases of atypical BSE have been overlooked.

  7. Structural characterization of POM6 Fab and mouse prion protein complex identifies key regions for prions conformational conversion.

    PubMed

    Baral, Pravas Kumar; Swayampakula, Mridula; Aguzzi, Adriano; James, Michael N G

    2018-05-01

    Conversion of the cellular prion protein PrP C into its pathogenic isoform PrP S c is the hallmark of prion diseases, fatal neurodegenerative diseases affecting many mammalian species including humans. Anti-prion monoclonal antibodies can arrest the progression of prion diseases by stabilizing the cellular form of the prion protein. Here, we present the crystal structure of the POM6 Fab fragment, in complex with the mouse prion protein (moPrP). The prion epitope of POM6 is in close proximity to the epitope recognized by the purportedly toxic antibody fragment, POM1 Fab also complexed with moPrP. The POM6 Fab recognizes a larger binding interface indicating a likely stronger binding compared to POM1. POM6 and POM1 exhibit distinct biological responses. Structural comparisons of the bound mouse prion proteins from the POM6 Fab:moPrP and POM1 Fab:moPrP complexes reveal several key regions of the prion protein that might be involved in initiating mis-folding events. The structural data of moPrP:POM6 Fab complex are available in the PDB under the accession number www.rcsb.org/pdb/search/structidSearch.do?structureId=6AQ7. © 2018 Federation of European Biochemical Societies.

  8. Ethical issues in human prion diseases.

    PubMed

    Tabrizi, S J; Elliott, C L; Weissmann, C

    2003-01-01

    Prion diseases or transmissible spongiform encephalopathies are a group of closely related transmissible neurodegenerative conditions of humans and animals, all of which are incurable. In recent years, they have captured public attention with the emergence of the bovine spongiform encephalopathy (BSE) epidemic in Europe, and more recently with the appearance of variant CJD (vCJD) in humans, a novel form of Creutzfeldt-Jakob disease (CJD) that is linked to dietary exposure to BSE. In this chapter, we outline ethical questions posed by research, diagnostic procedures and therapy in the field of prion diseases.

  9. Bank Vole Prion Protein As an Apparently Universal Substrate for RT-QuIC-Based Detection and Discrimination of Prion Strains.

    PubMed

    Orrú, Christina D; Groveman, Bradley R; Raymond, Lynne D; Hughson, Andrew G; Nonno, Romolo; Zou, Wenquan; Ghetti, Bernardino; Gambetti, Pierluigi; Caughey, Byron

    2015-06-01

    Prions propagate as multiple strains in a wide variety of mammalian species. The detection of all such strains by a single ultrasensitive assay such as Real Time Quaking-induced Conversion (RT-QuIC) would facilitate prion disease diagnosis, surveillance and research. Previous studies have shown that bank voles, and transgenic mice expressing bank vole prion protein, are susceptible to most, if not all, types of prions. Here we show that bacterially expressed recombinant bank vole prion protein (residues 23-230) is an effective substrate for the sensitive RT-QuIC detection of all of the different prion types that we have tested so far--a total of 28 from humans, cattle, sheep, cervids and rodents, including several that have previously been undetectable by RT-QuIC or Protein Misfolding Cyclic Amplification. Furthermore, comparison of the relative abilities of different prions to seed positive RT-QuIC reactions with bank vole and not other recombinant prion proteins allowed discrimination of prion strains such as classical and atypical L-type bovine spongiform encephalopathy, classical and atypical Nor98 scrapie in sheep, and sporadic and variant Creutzfeldt-Jakob disease in humans. Comparison of protease-resistant RT-QuIC conversion products also aided strain discrimination and suggested the existence of several distinct classes of prion templates among the many strains tested.

  10. Comparison of cattle and sheep colonic permeabilities to horseradish peroxidase and hamster scrapie prion protein in vitro

    PubMed Central

    McKie, A; Zammit, P; Naftalin, R

    1999-01-01

    BACKGROUND—Paracellular permeability to solutes across the descending colon is much higher in cattle than sheep. This is a possible route for transmission of infective materials, such as scrapie prion.
AIMS—To compare the permeabilities of labelled scrapie prion protein and other macromolecules in bovine and ovine descending colons in vitro.
METHODS—Using fresh slaughterhouse material, transepithelial fluxes of macromolecules across colonic mucosae mounted in Ussing chambers were measured by monitoring transport of either enzyme activity or radioactivity.
RESULTS—The comparative bovine to ovine permeability ratio of the probes increased with molecular weight: from 3.1 (0.13) for PEG400 to 10.67 (0.20) (p<0.001) for PEG4000; and from 1.64 (0.17) for microperoxidase to 7.03 (0.20) (p<0.001) for horseradish peroxidase (HRP). The permeability of 125I-labelled inactivated Syrian hamster scrapie prion protein (ShaPrPsc) was 7.02 (0.33)-fold higher in bovine than ovine colon (p<0.0025). In each species, the probe permeabilities decreased according to the formula: P = Po.exp(−K.ra). The "ideal" permeabilities, Po are similar, however, K(ovine) = 2.46 (0.20) cm/h/nm exceeds K(bovine) = 0.85 (0.15) cm/h/nm (p<0.001) indicating that bovine colon has a higher proportion of wide pores than ovine. Image analysis confirmed that HRP permeated through the bovine mucosal layer via a pericryptal paracellular route much more rapidly than in sheep.
CONCLUSIONS—These data may imply that scrapie prion is transmitted in vivo more easily across the low resistance bovine colonic barrier than in other species.


Keywords: cattle; sheep; colon; paracellular permeability; horseradish peroxidase; hamster scrapie prion protein PMID:10562587

  11. Characterization of Variant Creutzfeldt-Jakob Disease Prions in Prion Protein-humanized Mice Carrying Distinct Codon 129 Genotypes*

    PubMed Central

    Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W.; Mohri, Shirou; Kitamoto, Tetsuyuki

    2013-01-01

    To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype. PMID:23792955

  12. Characterization of variant Creutzfeldt-Jakob disease prions in prion protein-humanized mice carrying distinct codon 129 genotypes.

    PubMed

    Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W; Mohri, Shirou; Kitamoto, Tetsuyuki

    2013-07-26

    To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype.

  13. Comparative prion disease gene expression profiling using the prion disease mimetic, cuprizone

    PubMed Central

    Moody, Laura R; Herbst, Allen J; Yoo, Han Sang; Vanderloo, Joshua P

    2009-01-01

    Identification of genes expressed in response to prion infection may elucidate biomarkers for disease, identify factors involved in agent replication, mechanisms of neuropathology and therapeutic targets. Although several groups have sought to identify gene expression changes specific to prion disease, expression profiles rife with cell population changes have consistently been identified. Cuprizone, a neurotoxicant, qualitatively mimics the cell population changes observed in prion disease, resulting in both spongiform change and astrocytosis. The use of cuprizone-treated animals as an experimental control during comparative expression profiling allows for the identification of transcripts whose expression increases during prion disease and remains unchanged during cuprizone-triggered neuropathology. In this study, expression profiles from the brains of mice preclinically and clinically infected with Rocky Mountain Laboratory (RML) mouse-adapted scrapie agent and age-matched controls were profiled using Affymetrix gene arrays. In total, 164 genes were differentially regulated during prion infection. Eighty-three of these transcripts have been previously undescribed as differentially regulated during prion disease. A 0.4% cuprizone diet was utilized as a control for comparative expression profiling. Cuprizone treatment induced spongiosis and astrocyte proliferation as indicated by glial fibrillary acidic protein (Gfap) transcriptional activation and immunohistochemistry. Gene expression profiles from brain tissue obtained from cuprizone-treated mice identified 307 differentially regulated transcript changes. After comparative analysis, 17 transcripts unaffected by cuprizone treatment but increasing in expression from preclinical to clinical prion infection were identified. Here we describe the novel use of the prion disease mimetic, cuprizone, to control for cell population changes in the brain during prion infection. PMID:19535908

  14. Proteolysis suppresses spontaneous prion generation in yeast.

    PubMed

    Okamoto, Atsushi; Hosoda, Nao; Tanaka, Anri; Newnam, Gary P; Chernoff, Yury O; Hoshino, Shin-Ichi

    2017-12-08

    Prions are infectious proteins that cause fatal neurodegenerative disorders including Creutzfeldt-Jakob and bovine spongiform encephalopathy (mad cow) diseases. The yeast [ PSI + ] prion is formed by the translation-termination factor Sup35, is the best-studied prion, and provides a useful model system for studying such diseases. However, despite recent progress in the understanding of prion diseases, the cellular defense mechanism against prions has not been elucidated. Here, we report that proteolytic cleavage of Sup35 suppresses spontaneous de novo generation of the [ PSI + ] prion. We found that during yeast growth in glucose media, a maximum of 40% of Sup35 is cleaved at its N-terminal prion domain. This cleavage requires the vacuolar proteases PrA-PrB. Cleavage occurs in a manner dependent on translation but independently of autophagy between the glutamine/asparagine-rich (Q/N-rich) stretch critical for prion formation and the oligopeptide-repeat region required for prion maintenance, resulting in the removal of the Q/N-rich stretch from the Sup35 N terminus. The complete inhibition of Sup35 cleavage, by knocking out either PrA ( pep4 Δ) or PrB ( prb1 Δ), increased the rate of de novo formation of [ PSI + ] prion up to ∼5-fold, whereas the activation of Sup35 cleavage, by overproducing PrB, inhibited [ PSI + ] formation. On the other hand, activation of the PrB pathway neither cleaved the amyloid conformers of Sup35 in [ PSI + ] strains nor eliminated preexisting [ PSI + ]. These findings point to a mechanism antagonizing prion generation in yeast. Our results underscore the usefulness of the yeast [ PSI + ] prion as a model system to investigate defense mechanisms against prion diseases and other amyloidoses. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Limited amplification of chronic wasting disease prions in the peripheral tissues of intracerebrally inoculated cattle

    USDA-ARS?s Scientific Manuscript database

    Chronic wasting disease (CWD) is a fatal neurodegenerative disease, classified as a prion disease or transmissible spongiform encephalopathy (TSE) similar to bovine spongiform encephalopathy (BSE). Cervids affected by CWD accumulate an abnormal protease resistant prion protein throughout the central...

  16. Detection of BSE prions by RT-QuIC in cattle with subclinical BSE

    USDA-ARS?s Scientific Manuscript database

    Bovine spongiform encephalopathy (BSE) belongs to a group of fatal prion diseases that result from the misfolding of the cellular prion protein (PrPC) into a pathogenic form (PrPSc) that accumulates in the brain and some lymphoid tissues. In vitro assays such as serial protein misfolding amplificati...

  17. Prions: Protein Rebels with a Cause!

    ERIC Educational Resources Information Center

    Marshall, Karen E.; Serpell, Louise C.

    2017-01-01

    Traditionally we consider infection to arise from viruses, bacteria and parasites. Prions are infectious proteins without any nucleic acids, and therefore do not represent living things. Despite this, they have the ability to replicate themselves and cause diseases such as mad cow disease (bovine spongiform encepthalopathy) and human…

  18. Molecular dynamics studies on the buffalo prion protein.

    PubMed

    Zhang, Jiapu; Wang, Feng; Chatterjee, Subhojyoti

    2016-01-01

    It was reported that buffalo is a low susceptibility species resisting to transmissible spongiform encephalopathies (TSEs) (same as rabbits, horses, and dogs). TSEs, also called prion diseases, are invariably fatal and highly infectious neurodegenerative diseases that affect a wide variety of species (except for rabbits, dogs, horses, and buffalo), manifesting as scrapie in sheep and goats; bovine spongiform encephalopathy (BSE or "mad-cow" disease) in cattle; chronic wasting disease in deer and elk; and Creutzfeldt-Jakob diseases, Gerstmann-Sträussler-Scheinker syndrome, fatal familial insomnia, and Kulu in humans etc. In molecular structures, these neurodegenerative diseases are caused by the conversion from a soluble normal cellular prion protein (PrP(C)), predominantly with α-helices, into insoluble abnormally folded infectious prions (PrP(Sc)), rich in β-sheets. In this article, we studied the molecular structure and structural dynamics of buffalo PrP(C) (BufPrP(C)), in order to understand the reason why buffalo is resistant to prion diseases. We first did molecular modeling of a homology structure constructed by one mutation at residue 143 from the NMR structure of bovine and cattle PrP(124-227); immediately we found that for BufPrP(C)(124-227), there are five hydrogen bonds (HBs) at Asn143, but at this position, bovine/cattle do not have such HBs. Same as that of rabbits, dogs, or horses, our molecular dynamics studies also revealed there is a strong salt bridge (SB) ASP178-ARG164 (O-N) keeping the β2-α2 loop linked in buffalo. We also found there is a very strong HB SER170-TYR218 linking this loop with the C-terminal end of α-helix H3. Other information, such as (i) there is a very strong SB HIS187-ARG156 (N-O) linking α-helices H2 and H1 (if mutation H187R is made at position 187, then the hydrophobic core of PrP(C) will be exposed (L.H. Zhong (2010). Exposure of hydrophobic core in human prion protein pathogenic mutant H187R. Journal of

  19. Life cycle of cytosolic prions.

    PubMed

    Hofmann, Julia; Vorberg, Ina

    2013-01-01

    Prions are self-templating protein aggregates that were originally identified as the causative agent of prion diseases in mammals, but have since been discovered in other kingdoms. Mammalian prions represent a unique class of infectious agents that are composed of misfolded prion protein. Prion proteins usually exist as soluble proteins but can refold and assemble into highly ordered, self-propagating prion polymers. The prion concept is also applicable to a growing number of non-Mendelian elements of inheritance in lower eukaryotes. While prions identified in mammals are clearly pathogens, prions in lower eukaryotes can be either detrimental or beneficial to the host. Prion phenotypes in fungi are transmitted vertically from mother to daughter cells during cell division and horizontally during mating or abortive mating, but extracellular phases have not been reported. Recent findings now demonstrate that in a mammalian cell environment, protein aggregates derived from yeast prion domains exhibit a prion life cycle similar to mammalian prions propagated ex vivo. This life cycle includes a soluble state of the protein, an induction phase by exogenous prion fibrils, stable replication of prion entities, vertical transmission to progeny and natural horizontal transmission to neighboring cells. Our data reveal that mammalian cells contain all co-factors required for cytosolic prion propagation and dissemination. This has important implications for understanding prion-like properties of disease-related protein aggregates. In light of the growing number of identified functional amyloids, cell-to-cell propagation of cytosolic protein conformers might not only be relevant for the spreading of disease-associated proteins, but might also be of more general relevance under non-disease conditions.

  20. Prion Diseases as Transmissible Zoonotic Diseases

    PubMed Central

    Lee, Jeongmin; Kim, Su Yeon; Hwang, Kyu Jam; Ju, Young Ran; Woo, Hee-Jong

    2013-01-01

    Prion diseases, also called transmissible spongiform encephalopathies (TSEs), lead to neurological dysfunction in animals and are fatal. Infectious prion proteins are causative agents of many mammalian TSEs, including scrapie (in sheep), chronic wasting disease (in deer and elk), bovine spongiform encephalopathy (BSE; in cattle), and Creutzfeldt–Jakob disease (CJD; in humans). BSE, better known as mad cow disease, is among the many recently discovered zoonotic diseases. BSE cases were first reported in the United Kingdom in 1986. Variant CJD (vCJD) is a disease that was first detected in 1996, which affects humans and is linked to the BSE epidemic in cattle. vCJD is presumed to be caused by consumption of contaminated meat and other food products derived from affected cattle. The BSE epidemic peaked in 1992 and decreased thereafter; this decline is continuing sharply owing to intensive surveillance and screening programs in the Western world. However, there are still new outbreaks and/or progression of prion diseases, including atypical BSE, and iatrogenic CJD and vCJD via organ transplantation and blood transfusion. This paper summarizes studies on prions, particularly on prion molecular mechanisms, BSE, vCJD, and diagnostic procedures. Risk perception and communication policies of the European Union for the prevention of prion diseases are also addressed to provide recommendations for appropriate government policies in Korea. PMID:24159531

  1. H-type bovine spongiform encephalopathy associated with E211K prion protein polymorphism: clinical and pathologic features in wild-type and E211K cattle following intracranial inoculation

    USDA-ARS?s Scientific Manuscript database

    In 2006 an H-type bovine spongiform encephalopathy (BSE) case was reported in an animal with an unusual polymorphism (E211K) in the prion protein gene. Although the prevalence of this polymorphism is low, cattle carrying the K211 allele are predisposed to rapid onset of H-type BSE when exposed. The ...

  2. Prion Replication Elicits Cytopathic Changes in Differentiated Neurosphere Cultures

    PubMed Central

    Iwamaru, Yoshifumi; Takenouchi, Takato; Imamura, Morikazu; Shimizu, Yoshihisa; Miyazawa, Kohtaro; Mohri, Shirou; Yokoyama, Takashi

    2013-01-01

    The molecular mechanisms of prion-induced cytotoxicity remain largely obscure. Currently, only a few cell culture models have exhibited the cytopathic changes associated with prion infection. In this study, we introduced a cell culture model based on differentiated neurosphere cultures isolated from the brains of neonatal prion protein (PrP)-null mice and transgenic mice expressing murine PrP (dNP0 and dNP20 cultures). Upon exposure to mouse Chandler prions, dNP20 cultures supported the de novo formation of abnormal PrP and the resulting infectivity, as assessed by bioassays. Furthermore, this culture was susceptible to various prion strains, including mouse-adapted scrapie, bovine spongiform encephalopathy, and Gerstmann-Sträussler-Scheinker syndrome prions. Importantly, a subset of the cells in the infected culture that was mainly composed of astrocyte lineage cells consistently displayed late-occurring, progressive signs of cytotoxicity as evidenced by morphological alterations, decreased cell viability, and increased lactate dehydrogenase release. These signs of cytotoxicity were not observed in infected dNP0 cultures, suggesting the requirement of endogenous PrP expression for prion-induced cytotoxicity. Degenerated cells positive for glial fibrillary acidic protein accumulated abnormal PrP and exhibited features of apoptotic death as assessed by active caspase-3 and terminal deoxynucleotidyltransferase nick-end staining. Furthermore, caspase inhibition provided partial protection from prion-mediated cell death. These results suggest that differentiated neurosphere cultures can provide an in vitro bioassay for mouse prions and permit the study of the molecular basis for prion-induced cytotoxicity at the cellular level. PMID:23740992

  3. Use of bovine recombinant prion protein and real-time quaking-induced conversion to detect transmissible mink encephalopathy prions and discriminate classical and atypical L- and H-type bovine spongiform encephalopathy

    USDA-ARS?s Scientific Manuscript database

    Prions are amyloid-forming proteins that cause transmissible spongiform encephalopathies through a process involving conversion from normal cellular prion protein to pathogenic misfolded conformation. This conversion has been used for in vitro assays including serial protein misfolding amplification...

  4. Yeast Prions and Human Prion-like Proteins: Sequence Features and Prediction Methods

    PubMed Central

    Cascarina, Sean; Ross, Eric D.

    2014-01-01

    Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis (ALS). This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms. PMID:24390581

  5. Yeast prions and human prion-like proteins: sequence features and prediction methods.

    PubMed

    Cascarina, Sean M; Ross, Eric D

    2014-06-01

    Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis. This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms.

  6. Classifying prion and prion-like phenomena.

    PubMed

    Harbi, Djamel; Harrison, Paul M

    2014-01-01

    The universe of prion and prion-like phenomena has expanded significantly in the past several years. Here, we overview the challenges in classifying this data informatically, given that terms such as "prion-like", "prion-related" or "prion-forming" do not have a stable meaning in the scientific literature. We examine the spectrum of proteins that have been described in the literature as forming prions, and discuss how "prion" can have a range of meaning, with a strict definition being for demonstration of infection with in vitro-derived recombinant prions. We suggest that although prion/prion-like phenomena can largely be apportioned into a small number of broad groups dependent on the type of transmissibility evidence for them, as new phenomena are discovered in the coming years, a detailed ontological approach might be necessary that allows for subtle definition of different "flavors" of prion / prion-like phenomena.

  7. Retinal function and morphology are altered in cattle infected with the prion disease transmissible mink encephalopathy.

    PubMed

    Smith, J D; Greenlee, J J; Hamir, A N; Richt, J A; Greenlee, M H West

    2009-09-01

    Transmissible spongiform encephalopathies (TSEs) are a group of diseases that result in progressive and invariably fatal neurologic disease in both animals and humans. TSEs are characterized by the accumulation of an abnormal protease-resistant form of the prion protein in the central nervous system. Transmission of infectious TSEs is believed to occur via ingestion of prion protein-contaminated material. This material is also involved in the transmission of bovine spongiform encephalopathy ("mad cow disease") to humans, which resulted in the variant form of Creutzfeldt-Jakob disease. Abnormal prion protein has been reported in the retina of TSE-affected cattle, but despite these observations, the specific effect of abnormal prion protein on retinal morphology and function has not been assessed. The objective of this study was to identify and characterize potential functional and morphologic abnormalities in the retinas of cattle infected with a bovine-adapted isolate of transmissible mink encephalopathy. We used electroretinography and immunohistochemistry to examine retinas from 10 noninoculated and 5 transmissible mink encephalopathy-inoculated adult Holstein steers. Here we show altered retinal function, as evidenced by prolonged implicit time of the electroretinogram b-wave, in transmissible mink encephalopathy-infected cattle before the onset of clinical illness. We also demonstrate disruption of rod bipolar cell synaptic terminals, indicated by decreased immunoreactivity for the alpha isoform of protein kinase C and vesicular glutamate transporter 1, and activation of Müller glia, as evidenced by increased glial fibrillary acidic protein and glutamine synthetase expression, in the retinas of these cattle at the time of euthanasia due to clinical deterioration. This is the first study to identify both functional and morphologic alterations in the retinas of TSE-infected cattle. Our results support future efforts to focus on the retina for the development of

  8. Detection and Control of Prion Diseases in Food Animals

    PubMed Central

    Hedlin, Peter; Taschuk, Ryan; Potter, Andrew; Griebel, Philip; Napper, Scott

    2012-01-01

    Transmissible spongiform encephalopathies (TSEs), or prion diseases, represent a unique form of infectious disease based on misfolding of a self-protein (PrPC) into a pathological, infectious conformation (PrPSc). Prion diseases of food animals gained notoriety during the bovine spongiform encephalopathy (BSE) outbreak of the 1980s. In particular, disease transmission to humans, to the generation of a fatal, untreatable disease, elevated the perspective on livestock prion diseases from food production to food safety. While the immediate threat posed by BSE has been successfully addressed through surveillance and improved management practices, another prion disease is rapidly spreading. Chronic wasting disease (CWD), a prion disease of cervids, has been confirmed in wild and captive populations with devastating impact on the farmed cervid industries. Furthermore, the unabated spread of this disease through wild populations threatens a natural resource that is a source of considerable economic benefit and national pride. In a worst-case scenario, CWD may represent a zoonotic threat either through direct transmission via consumption of infected cervids or through a secondary food animal, such as cattle. This has energized efforts to understand prion diseases as well as to develop tools for disease detection, prevention, and management. Progress in each of these areas is discussed. PMID:23738120

  9. PrionHome: a database of prions and other sequences relevant to prion phenomena.

    PubMed

    Harbi, Djamel; Parthiban, Marimuthu; Gendoo, Deena M A; Ehsani, Sepehr; Kumar, Manish; Schmitt-Ulms, Gerold; Sowdhamini, Ramanathan; Harrison, Paul M

    2012-01-01

    Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions), prionoids (i.e., proteins that propagate like prions between individual cells), and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant), and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments). We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic sequences, showing

  10. PrionHome: A Database of Prions and Other Sequences Relevant to Prion Phenomena

    PubMed Central

    Harbi, Djamel; Parthiban, Marimuthu; Gendoo, Deena M. A.; Ehsani, Sepehr; Kumar, Manish; Schmitt-Ulms, Gerold; Sowdhamini, Ramanathan; Harrison, Paul M.

    2012-01-01

    Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions), prionoids (i.e., proteins that propagate like prions between individual cells), and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant), and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments). We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic sequences, showing

  11. The Prion Concept and Synthetic Prions.

    PubMed

    Legname, Giuseppe; Moda, Fabio

    2017-01-01

    Transmissible spongiform encephalopathies or prion diseases are a group of fatal neurodegenerative diseases caused by unconventional infectious agents, known as prions (PrP Sc ). Prions derive from a conformational conversion of the normally folded prion protein (PrP C ), which acquires pathological and infectious features. Moreover, PrP Sc is able to transmit the pathological conformation to PrP C through a mechanism that is still not well understood. The generation of synthetic prions, which behave like natural prions, is of fundamental importance to study the process of PrP C conversion and to assess the efficacy of therapeutic strategies to interfere with this process. Moreover, the ability of synthetic prions to induce pathology in animals confirms that the pathological properties of the prion strains are all enciphered in abnormal conformations, characterizing these infectious agents. © 2017 Elsevier Inc. All rights reserved.

  12. Food Safety: Bovine Spongiform Encephalopathy (Mad Cow Disease).

    PubMed

    Acheson, David W. K.

    2002-01-01

    Bovine spongiform encephalopathy is just one of a group of diseases known as transmissible spongiform encephalopathies. Only recently has it become recognized that transmissible spongiform encephalopathies are likely due to proteins known as prions. Although it has been recognized that transmissible spongiform encephalopathies may readily spread within species, the recent observations that bovine spongiform encephalopathy in cattle may have originated from another transmissible spongiform encephalopathy in sheep, known as scrapie, is cause for concern. Further, bovine spongiform encephalopathy has now been strongly linked with a universally fatal human neurologic disease known as new variant Creutzfeldt-Jakob disease. Currently the only approach to preventing bovine spongiform encephalopathy, and subsequent new variant Creutzfeldt-Jakob disease in humans, from ingestion of bovine spongiform encephalopathy-infected material is to avoid consumption of contaminated food. Little can be done to treat food that will destroy prions and leave a palatable product. At this stage we are continuing to learn about transmissible spongiform encephalopathies and their implications on human health. This is an ever-changing situation and has an unpredictable element in terms of the extent of the current outbreaks in England and other parts of Europe.

  13. Detection of prions in blood from patients with variant Creutzfeldt-Jakob disease

    PubMed Central

    Concha-Marambio, Luis; Pritzkow, Sandra; Moda, Fabio; Tagliavini, Fabrizio; Ironside, James W.; Schulz, Paul E.; Soto, Claudio

    2017-01-01

    Human prion diseases are infectious and invariably fatal neurodegenerative diseases. They include sporadic Creutzfeldt-Jakob disease (sCJD), the most common form, and variant CJD (vCJD), which is caused by interspecies transmission of prions from cattle infected by bovine spongiform encephalopathy. Development of a biochemical assay for the sensitive, specific, early, and noninvasive detection of prions (PrPSc) in the blood of patients affected by prion disease is a top medical priority to increase the safety of the blood supply. vCJD has already been transmitted from human to human by blood transfusion, and the number of asymptomatic carriers of vCJD in the U.K. alone is estimated to be 1 in 2000 people. We used the protein misfolding cyclic amplification (PMCA) technique to analyze blood samples from 14 cases of vCJD and 153 controls, including patients affected by sCJD and other neurodegenerative or neurological disorders as well as healthy subjects. Our results showed that PrPSc could be detected with 100% sensitivity and specificity in blood samples from vCJD patients. Detection was possible in any of the blood fractions analyzed and could be done with as little as a few microliters of sample volume. The PrPSc concentration in blood was estimated to be ~0.5 pg/ml. Our findings suggest that PMCA may be useful for premortem noninvasive diagnosis of vCJD and to identify prion contamination of the blood supply. Further studies are needed to fully validate the technology. PMID:28003548

  14. Overexpression of the Hspa13 (Stch) gene reduces prion disease incubation time in mice.

    PubMed

    Grizenkova, Julia; Akhtar, Shaheen; Hummerich, Holger; Tomlinson, Andrew; Asante, Emmanuel A; Wenborn, Adam; Fizet, Jérémie; Poulter, Mark; Wiseman, Frances K; Fisher, Elizabeth M C; Tybulewicz, Victor L J; Brandner, Sebastian; Collinge, John; Lloyd, Sarah E

    2012-08-21

    Prion diseases are fatal neurodegenerative disorders that include bovine spongiform encephalopathy (BSE) and scrapie in animals and Creutzfeldt-Jakob disease (CJD) in humans. They are characterized by long incubation periods, variation in which is determined by many factors including genetic background. In some cases it is possible that incubation time may be directly correlated to the level of gene expression. To test this hypothesis, we combined incubation time data from five different inbred lines of mice with quantitative gene expression profiling in normal brains and identified five genes with expression levels that correlate with incubation time. One of these genes, Hspa13 (Stch), is a member of the Hsp70 family of ATPase heat shock proteins, which have been previously implicated in prion propagation. To test whether Hspa13 plays a causal role in determining the incubation period, we tested two overexpressing mouse models. The Tc1 human chromosome 21 (Hsa21) transchromosomic mouse model of Down syndrome is trisomic for many Hsa21 genes including Hspa13 and following Chandler/Rocky Mountain Laboratory (RML) prion inoculation, shows a 4% reduction in incubation time. Furthermore, a transgenic model with eightfold overexpression of mouse Hspa13 exhibited highly significant reductions in incubation time of 16, 15, and 7% following infection with Chandler/RML, ME7, and MRC2 prion strains, respectively. These data further implicate Hsp70-like molecular chaperones in protein misfolding disorders such as prion disease.

  15. Yeast Prions: Structure, Biology, and Prion-Handling Systems

    PubMed Central

    Shewmaker, Frank P.; Bateman, David A.; Edskes, Herman K.; Gorkovskiy, Anton; Dayani, Yaron; Bezsonov, Evgeny E.

    2015-01-01

    SUMMARY A prion is an infectious protein horizontally transmitting a disease or trait without a required nucleic acid. Yeast and fungal prions are nonchromosomal genes composed of protein, generally an altered form of a protein that catalyzes the same alteration of the protein. Yeast prions are thus transmitted both vertically (as genes composed of protein) and horizontally (as infectious proteins, or prions). Formation of amyloids (linear ordered β-sheet-rich protein aggregates with β-strands perpendicular to the long axis of the filament) underlies most yeast and fungal prions, and a single prion protein can have any of several distinct self-propagating amyloid forms with different biological properties (prion variants). Here we review the mechanism of faithful templating of protein conformation, the biological roles of these prions, and their interactions with cellular chaperones, the Btn2 and Cur1 aggregate-handling systems, and other cellular factors governing prion generation and propagation. Human amyloidoses include the PrP-based prion conditions and many other, more common amyloid-based diseases, several of which show prion-like features. Yeast prions increasingly are serving as models for the understanding and treatment of many mammalian amyloidoses. Patients with different clinical pictures of the same amyloidosis may be the equivalent of yeasts with different prion variants. PMID:25631286

  16. PrionScan: an online database of predicted prion domains in complete proteomes.

    PubMed

    Espinosa Angarica, Vladimir; Angulo, Alfonso; Giner, Arturo; Losilla, Guillermo; Ventura, Salvador; Sancho, Javier

    2014-02-05

    Prions are a particular type of amyloids related to a large variety of important processes in cells, but also responsible for serious diseases in mammals and humans. The number of experimentally characterized prions is still low and corresponds to a handful of examples in microorganisms and mammals. Prion aggregation is mediated by specific protein domains with a remarkable compositional bias towards glutamine/asparagine and against charged residues and prolines. These compositional features have been used to predict new prion proteins in the genomes of different organisms. Despite these efforts, there are only a few available data sources containing prion predictions at a genomic scale. Here we present PrionScan, a new database of predicted prion-like domains in complete proteomes. We have previously developed a predictive methodology to identify and score prionogenic stretches in protein sequences. In the present work, we exploit this approach to scan all the protein sequences in public databases and compile a repository containing relevant information of proteins bearing prion-like domains. The database is updated regularly alongside UniprotKB and in its present version contains approximately 28000 predictions in proteins from different functional categories in more than 3200 organisms from all the taxonomic subdivisions. PrionScan can be used in two different ways: database query and analysis of protein sequences submitted by the users. In the first mode, simple queries allow to retrieve a detailed description of the properties of a defined protein. Queries can also be combined to generate more complex and specific searching patterns. In the second mode, users can submit and analyze their own sequences. It is expected that this database would provide relevant insights on prion functions and regulation from a genome-wide perspective, allowing researches performing cross-species prion biology studies. Our database might also be useful for guiding experimentalists

  17. Yeast prions: structure, biology, and prion-handling systems.

    PubMed

    Wickner, Reed B; Shewmaker, Frank P; Bateman, David A; Edskes, Herman K; Gorkovskiy, Anton; Dayani, Yaron; Bezsonov, Evgeny E

    2015-03-01

    A prion is an infectious protein horizontally transmitting a disease or trait without a required nucleic acid. Yeast and fungal prions are nonchromosomal genes composed of protein, generally an altered form of a protein that catalyzes the same alteration of the protein. Yeast prions are thus transmitted both vertically (as genes composed of protein) and horizontally (as infectious proteins, or prions). Formation of amyloids (linear ordered β-sheet-rich protein aggregates with β-strands perpendicular to the long axis of the filament) underlies most yeast and fungal prions, and a single prion protein can have any of several distinct self-propagating amyloid forms with different biological properties (prion variants). Here we review the mechanism of faithful templating of protein conformation, the biological roles of these prions, and their interactions with cellular chaperones, the Btn2 and Cur1 aggregate-handling systems, and other cellular factors governing prion generation and propagation. Human amyloidoses include the PrP-based prion conditions and many other, more common amyloid-based diseases, several of which show prion-like features. Yeast prions increasingly are serving as models for the understanding and treatment of many mammalian amyloidoses. Patients with different clinical pictures of the same amyloidosis may be the equivalent of yeasts with different prion variants. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Transmission of scrapie prions to primate after an extended silent incubation period.

    PubMed

    Comoy, Emmanuel E; Mikol, Jacqueline; Luccantoni-Freire, Sophie; Correia, Evelyne; Lescoutra-Etchegaray, Nathalie; Durand, Valérie; Dehen, Capucine; Andreoletti, Olivier; Casalone, Cristina; Richt, Juergen A; Greenlee, Justin J; Baron, Thierry; Benestad, Sylvie L; Brown, Paul; Deslys, Jean-Philippe

    2015-06-30

    Classical bovine spongiform encephalopathy (c-BSE) is the only animal prion disease reputed to be zoonotic, causing variant Creutzfeldt-Jakob disease (vCJD) in humans and having guided protective measures for animal and human health against animal prion diseases. Recently, partial transmissions to humanized mice showed that the zoonotic potential of scrapie might be similar to c-BSE. We here report the direct transmission of a natural classical scrapie isolate to cynomolgus macaque, a highly relevant model for human prion diseases, after a 10-year silent incubation period, with features similar to those reported for human cases of sporadic CJD. Scrapie is thus actually transmissible to primates with incubation periods compatible with their life expectancy, although fourfold longer than BSE. Long-term experimental transmission studies are necessary to better assess the zoonotic potential of other prion diseases with high prevalence, notably Chronic Wasting Disease of deer and elk and atypical/Nor98 scrapie.

  19. Transmission of scrapie prions to primate after an extended silent incubation period

    PubMed Central

    Comoy, Emmanuel E.; Mikol, Jacqueline; Luccantoni-Freire, Sophie; Correia, Evelyne; Lescoutra-Etchegaray, Nathalie; Durand, Valérie; Dehen, Capucine; Andreoletti, Olivier; Casalone, Cristina; Richt, Juergen A.; Greenlee, Justin J.; Baron, Thierry; Benestad, Sylvie L.; Brown, Paul; Deslys, Jean-Philippe

    2015-01-01

    Classical bovine spongiform encephalopathy (c-BSE) is the only animal prion disease reputed to be zoonotic, causing variant Creutzfeldt-Jakob disease (vCJD) in humans and having guided protective measures for animal and human health against animal prion diseases. Recently, partial transmissions to humanized mice showed that the zoonotic potential of scrapie might be similar to c-BSE. We here report the direct transmission of a natural classical scrapie isolate to cynomolgus macaque, a highly relevant model for human prion diseases, after a 10-year silent incubation period, with features similar to those reported for human cases of sporadic CJD. Scrapie is thus actually transmissible to primates with incubation periods compatible with their life expectancy, although fourfold longer than BSE. Long-term experimental transmission studies are necessary to better assess the zoonotic potential of other prion diseases with high prevalence, notably Chronic Wasting Disease of deer and elk and atypical/Nor98 scrapie. PMID:26123044

  20. The Priority position paper: Protecting Europe's food chain from prions.

    PubMed

    Requena, Jesús R; Kristensson, Krister; Korth, Carsten; Zurzolo, Chiara; Simmons, Marion; Aguilar-Calvo, Patricia; Aguzzi, Adriano; Andreoletti, Olivier; Benestad, Sylvie L; Böhm, Reinhard; Brown, Karen; Calgua, Byron; Del Río, José Antonio; Espinosa, Juan Carlos; Girones, Rosina; Godsave, Sue; Hoelzle, Ludwig E; Knittler, Michael R; Kuhn, Franziska; Legname, Giuseppe; Laeven, Paul; Mabbott, Neil; Mitrova, Eva; Müller-Schiffmann, Andreas; Nuvolone, Mario; Peters, Peter J; Raeber, Alex; Roth, Klaus; Schmitz, Matthias; Schroeder, Björn; Sonati, Tiziana; Stitz, Lothar; Taraboulos, Albert; Torres, Juan María; Yan, Zheng-Xin; Zerr, Inga

    2016-05-03

    Bovine spongiform encephalopathy (BSE) created a global European crisis in the 1980s and 90s, with very serious health and economic implications. Classical BSE now appears to be under control, to a great extent as a result of a global research effort that identified the sources of prions in meat and bone meal (MBM) and developed new animal-testing tools that guided policy. Priority ( www.prionpriority.eu ) was a European Union (EU) Framework Program 7 (FP7)-funded project through which 21 European research institutions and small and medium enterprises (SMEs) joined efforts between 2009 and 2014, to conduct coordinated basic and applied research on prions and prion diseases. At the end of the project, the Priority consortium drafted a position paper ( www.prionpriority.eu/Priority position paper) with its main conclusions. In the present opinion paper, we summarize these conclusions. With respect to the issue of re-introducing ruminant protein into the feed-chain, our opinion is that sustaining an absolute ban on feeding ruminant protein to ruminants is essential. In particular, the spread and impact of non-classical forms of scrapie and BSE in ruminants is not fully understood and the risks cannot be estimated. Atypical prion agents will probably continue to represent the dominant form of prion diseases in the near future in Europe. Atypical L-type BSE has clear zoonotic potential, as demonstrated in experimental models. Similarly, there are now data indicating that the atypical scrapie agent can cross various species barriers. More epidemiological data from large cohorts are necessary to reach any conclusion on the impact of its transmissibility on public health. Re-evaluations of safety precautions may become necessary depending on the outcome of these studies. Intensified searching for molecular determinants of the species barrier is recommended, since this barrier is key for important policy areas and risk assessment. Understanding the structural basis for

  1. The Priority position paper: Protecting Europe's food chain from prions

    PubMed Central

    Kristensson, Krister; Korth, Carsten; Zurzolo, Chiara; Simmons, Marion; Aguilar-Calvo, Patricia; Aguzzi, Adriano; Andreoletti, Olivier; Benestad, Sylvie L.; Böhm, Reinhard; Brown, Karen; Calgua, Byron; del Río, José Antonio; Espinosa, Juan Carlos; Girones, Rosina; Godsave, Sue; Hoelzle, Ludwig E.; Knittler, Michael R.; Kuhn, Franziska; Legname, Giuseppe; Laeven, Paul; Mitrova, Eva; Müller-Schiffmann, Andreas; Nuvolone, Mario; Peters, Peter J.; Raeber, Alex; Roth, Klaus; Schmitz, Matthias; Schroeder, Björn; Sonati, Tiziana; Stitz, Lothar; Taraboulos, Albert; Torres, Juan María; Yan, Zheng-Xin; Zerr, Inga

    2016-01-01

    ABSTRACT Bovine spongiform encephalopathy (BSE) created a global European crisis in the 1980s and 90s, with very serious health and economic implications. Classical BSE now appears to be under control, to a great extent as a result of a global research effort that identified the sources of prions in meat and bone meal (MBM) and developed new animal-testing tools that guided policy. Priority (www.prionpriority.eu) was a European Union (EU) Framework Program 7 (FP7)-funded project through which 21 European research institutions and small and medium enterprises (SMEs) joined efforts between 2009 and 2014, to conduct coordinated basic and applied research on prions and prion diseases. At the end of the project, the Priority consortium drafted a position paper (www.prionpriority.eu/Priority position paper) with its main conclusions. In the present opinion paper, we summarize these conclusions. With respect to the issue of re-introducing ruminant protein into the feed-chain, our opinion is that sustaining an absolute ban on feeding ruminant protein to ruminants is essential. In particular, the spread and impact of non-classical forms of scrapie and BSE in ruminants is not fully understood and the risks cannot be estimated. Atypical prion agents will probably continue to represent the dominant form of prion diseases in the near future in Europe. Atypical L-type BSE has clear zoonotic potential, as demonstrated in experimental models. Similarly, there are now data indicating that the atypical scrapie agent can cross various species barriers. More epidemiological data from large cohorts are necessary to reach any conclusion on the impact of its transmissibility on public health. Re-evaluations of safety precautions may become necessary depending on the outcome of these studies. Intensified searching for molecular determinants of the species barrier is recommended, since this barrier is key for important policy areas and risk assessment. Understanding the structural basis

  2. The complexity and implications of yeast prion domains

    PubMed Central

    2011-01-01

    Prions are infectious proteins with altered conformations converted from otherwise normal host proteins. While there is only one known mammalian prion protein, PrP, a handful of prion proteins have been identified in the yeast Saccharomyces cerevisiae. Yeast prion proteins usually have a defined region called prion domain (PrD) essential for prion properties, which are typically rich in glutamine (Q) and asparagine (N). Despite sharing several common features, individual yeast PrDs are generally intricate and divergent in their compositional characteristics, which potentially implicates their prion phenotypes, such as prion-mediated transcriptional regulations. PMID:22156731

  3. Progress and problems in the biology, diagnostics, and therapeutics of prion diseases

    PubMed Central

    Aguzzi, Adriano; Heikenwalder, Mathias; Miele, Gino

    2004-01-01

    The term “prion” was introduced by Stanley Prusiner in 1982 to describe the atypical infectious agent that causes transmissible spongiform encephalopathies, a group of infectious neurodegenerative diseases that include scrapie in sheep, Creutzfeldt-Jakob disease in humans, chronic wasting disease in cervids, and bovine spongiform encephalopathy in cattle. Over the past twenty years, the word “prion” has been taken to signify various subtly different concepts. In this article, we refer to the prion as the transmissible principle underlying prion diseases, without necessarily implying any specific biochemical or structural identity. When Prusiner started his seminal work, the study of transmissible spongiform encephalopathies was undertaken by only a handful of scientists. Since that time, the “mad cow” crisis has put prion diseases on the agenda of both politicians and the media. Significant progress has been made in prion disease research, and many aspects of prion pathogenesis are now understood. And yet the diagnostic procedures available for prion diseases are not nearly as sensitive as they ought to be, and no therapeutic intervention has been shown to reliably affect the course of the diseases. This article reviews recent progress in the areas of pathogenesis of, diagnostics of, and therapy for prion diseases and highlights some conspicuous problems that remain to be addressed in each of these fields. PMID:15254579

  4. Meat and bone meal and mineral feed additives may increase the risk of oral prion disease transmission

    USGS Publications Warehouse

    Johnson, C.J.; McKenzie, D.; Pedersen, J.A.; Aiken, Judd M.

    2011-01-01

    Ingestion of prion-contaminated materials is postulated to be a primary route of prion disease transmission. Binding of prions to soil (micro)particles dramatically enhances peroral disease transmission relative to unbound prions, and it was hypothesized that micrometer-sized particles present in other consumed materials may affect prion disease transmission via the oral route of exposure. Small, insoluble particles are present in many substances, including soil, human foods, pharmaceuticals, and animal feeds. It is known that meat and bone meal (MBM), a feed additive believed responsible for the spread of bovine spongiform encephalopathy (BSE), contains particles smaller than 20 ??m and that the pathogenic prion protein binds to MBM. The potentiation of disease transmission via the oral route by exposure to MBM or three micrometer-sized mineral feed additives was determined. Data showed that when the disease agent was bound to any of the tested materials, the penetrance of disease was increased compared to unbound prions. Our data suggest that in feed or other prion-contaminated substances consumed by animals or, potentially, humans, the addition of MBM or the presence of microparticles could heighten risks of prion disease acquisition. Copyright ?? 2011 Taylor & Francis Group, LLC.

  5. Meat and bone meal and mineral feed additives may increase the risk of oral prion disease transmission

    USGS Publications Warehouse

    Johnson, Christopher J.; McKenzie, Debbie; Pedersen, Joel A.; Aiken, Judd M.

    2011-01-01

    Ingestion of prion-contaminated materials is postulated to be a primary route of prion disease transmission. Binding of prions to soil (micro)particles dramatically enhances peroral disease transmission relative to unbound prions, and it was hypothesized that micrometer-sized particles present in other consumed materials may affect prion disease transmission via the oral route of exposure. Small, insoluble particles are present in many substances, including soil, human foods, pharmaceuticals, and animal feeds. It is known that meat and bone meal (MBM), a feed additive believed responsible for the spread of bovine spongiform encephalopathy (BSE), contains particles smaller than 20 μm and that the pathogenic prion protein binds to MBM. The potentiation of disease transmission via the oral route by exposure to MBM or three micrometer-sized mineral feed additives was determined. Data showed that when the disease agent was bound to any of the tested materials, the penetrance of disease was increased compared to unbound prions. Our data suggest that in feed or other prion-contaminated substances consumed by animals or, potentially, humans, the addition of MBM or the presence of microparticles could heighten risks of prion disease acquisition.

  6. Transmission of scrapie prions to primate after an extended silent incubation period

    USDA-ARS?s Scientific Manuscript database

    Classical bovine spongiform encephalopathy (c-BSE) is an animal prion disease that also causes variant Creutzfeldt-Jakob disease in humans. Over the past decades, c-BSE's zoonotic potential has been the driving force in establishing extensive protective measures for animal and human health. In compl...

  7. Evidence that bank vole PrP is a universal acceptor for prions.

    PubMed

    Watts, Joel C; Giles, Kurt; Patel, Smita; Oehler, Abby; DeArmond, Stephen J; Prusiner, Stanley B

    2014-04-01

    Bank voles are uniquely susceptible to a wide range of prion strains isolated from many different species. To determine if this enhanced susceptibility to interspecies prion transmission is encoded within the sequence of the bank vole prion protein (BVPrP), we inoculated Tg(M109) and Tg(I109) mice, which express BVPrP containing either methionine or isoleucine at polymorphic codon 109, with 16 prion isolates from 8 different species: humans, cattle, elk, sheep, guinea pigs, hamsters, mice, and meadow voles. Efficient disease transmission was observed in both Tg(M109) and Tg(I109) mice. For instance, inoculation of the most common human prion strain, sporadic Creutzfeldt-Jakob disease (sCJD) subtype MM1, into Tg(M109) mice gave incubation periods of ∼200 days that were shortened slightly on second passage. Chronic wasting disease prions exhibited an incubation time of ∼250 days, which shortened to ∼150 days upon second passage in Tg(M109) mice. Unexpectedly, bovine spongiform encephalopathy and variant CJD prions caused rapid neurological dysfunction in Tg(M109) mice upon second passage, with incubation periods of 64 and 40 days, respectively. Despite the rapid incubation periods, other strain-specified properties of many prion isolates--including the size of proteinase K-resistant PrPSc, the pattern of cerebral PrPSc deposition, and the conformational stability--were remarkably conserved upon serial passage in Tg(M109) mice. Our results demonstrate that expression of BVPrP is sufficient to engender enhanced susceptibility to a diverse range of prion isolates, suggesting that BVPrP may be a universal acceptor for prions.

  8. Immunology of Prion Protein and Prions.

    PubMed

    Mabbott, Neil A

    2017-01-01

    Many natural prion diseases are acquired peripherally, such as following the oral consumption of contaminated food or pasture. After peripheral exposure many prion isolates initially accumulate to high levels within the host's secondary lymphoid tissues. The replication of prions within these tissues is essential for their efficient spread to the brain where they ultimately cause neurodegeneration. This chapter describes our current understanding of the critical tissues, cells, and molecules which the prions exploit to mediate their efficient propagation from the site of exposure (such as the intestine) to the brain. Interactions between the immune system and prions are not only restricted to the secondary lymphoid tissues. Therefore, an account of how the activation status of the microglial in the brain can also influence progression of prion disease pathogenesis is provided. Prion disease susceptibility may also be influenced by additional factors such as chronic inflammation, coinfection with other pathogens, and aging. Finally, the potential for immunotherapy to provide a means of safe and effective prophylactic or therapeutic intervention in these currently untreatable diseases is considered. © 2017 Elsevier Inc. All rights reserved.

  9. The Structural Architecture of an Infectious Mammalian Prion Using Electron Cryomicroscopy.

    PubMed

    Vázquez-Fernández, Ester; Vos, Matthijn R; Afanasyev, Pavel; Cebey, Lino; Sevillano, Alejandro M; Vidal, Enric; Rosa, Isaac; Renault, Ludovic; Ramos, Adriana; Peters, Peter J; Fernández, José Jesús; van Heel, Marin; Young, Howard S; Requena, Jesús R; Wille, Holger

    2016-09-01

    The structure of the infectious prion protein (PrPSc), which is responsible for Creutzfeldt-Jakob disease in humans and bovine spongiform encephalopathy, has escaped all attempts at elucidation due to its insolubility and propensity to aggregate. PrPSc replicates by converting the non-infectious, cellular prion protein (PrPC) into the misfolded, infectious conformer through an unknown mechanism. PrPSc and its N-terminally truncated variant, PrP 27-30, aggregate into amorphous aggregates, 2D crystals, and amyloid fibrils. The structure of these infectious conformers is essential to understanding prion replication and the development of structure-based therapeutic interventions. Here we used the repetitive organization inherent to GPI-anchorless PrP 27-30 amyloid fibrils to analyze their structure via electron cryomicroscopy. Fourier-transform analyses of averaged fibril segments indicate a repeating unit of 19.1 Å. 3D reconstructions of these fibrils revealed two distinct protofilaments, and, together with a molecular volume of 18,990 Å3, predicted the height of each PrP 27-30 molecule as ~17.7 Å. Together, the data indicate a four-rung β-solenoid structure as a key feature for the architecture of infectious mammalian prions. Furthermore, they allow to formulate a molecular mechanism for the replication of prions. Knowledge of the prion structure will provide important insights into the self-propagation mechanisms of protein misfolding.

  10. Amyloid cores in prion domains: Key regulators for prion conformational conversion.

    PubMed

    Fernández, María Rosario; Batlle, Cristina; Gil-García, Marcos; Ventura, Salvador

    2017-01-02

    Despite the significant efforts devoted to decipher the particular protein features that encode for a prion or prion-like behavior, they are still poorly understood. The well-characterized yeast prions constitute an ideal model system to address this question, because, in these proteins, the prion activity can be univocally assigned to a specific region of their sequence, known as the prion forming domain (PFD). These PFDs are intrinsically disordered, relatively long and, in many cases, of low complexity, being enriched in glutamine/asparagine residues. Computational analyses have identified a significant number of proteins having similar domains in the human proteome. The compositional bias of these regions plays an important role in the transition of the prions to the amyloid state. However, it is difficult to explain how composition alone can account for the formation of specific contacts that position correctly PFDs and provide the enthalpic force to compensate for the large entropic cost of immobilizing these domains in the initial assemblies. We have hypothesized that short, sequence-specific, amyloid cores embedded in PFDs can perform these functions and, accordingly, act as preferential nucleation centers in both spontaneous and seeded aggregation. We have shown that the implementation of this concept in a prediction algorithm allows to score the prion propensities of putative PFDs with high accuracy. Recently, we have provided experimental evidence for the existence of such amyloid cores in the PFDs of Sup35, Ure2, Swi1, and Mot3 yeast prions. The fibrils formed by these short stretches may recognize and promote the aggregation of the complete proteins inside cells, being thus a promising tool for targeted protein inactivation.

  11. Soil humic substances hinder the propagation of prions

    NASA Astrophysics Data System (ADS)

    Leita, Liviana; Giachin, Gabriele; Margon, Alja; Narkiewicz, Joanna; Legname, Giuseppe

    2013-04-01

    Prions are infectious pathogens causing fatal neurodegenerative disorders, known as transmissible spongiform encephalopathies (TSEs), or prion diseases, which affect different mammalian species. TSEs include scrapie in sheep, bovine spongiform encephalopathy (BSE) in cattle, chronic wasting disease (CWD) in mule deer, elk, and moose (cervids), and Creutzfeldt-Jakob disease (CJD) in humans. The prominent, if not only, component of prions is a misfolded conformer (PrPSc) of a constitutive sialoglycoprotein, the cellular prion protein (PrPC). A notable feature of prion diseases is horizontal transmission between grazing animals, implying that contaminated soil may serve to propagate the disease. In this respect, it has been reported that grazing animals ingest from tens to hundreds grams of soil per day, either incidentally through the diet, or deliberately in answering salt needs, and that mule deer can develop CWD after grazing in locations that previously housed infected animals. Prions may enter the environment through different routes, including animal excreta and secreta which mainly contribute to soil contamination. Recent studies have proven that prions can be retained in soil, which could act as a carrier of infectivity even several years after the contamination. However, within the large spread of potentially infected lands, prion diseases have become endemic only in geographically limited regions. The reasons for this geographical distribution remain unknown, but it suggests a role of the different kinds of soil in either enhancing or attenuating prion infectivity. The extent of prion transmission from the contaminated environment is unknown. Several studies have tried to address the issue of prion interaction with soil, but, at the present, different approaches show several drawbacks and technical difficulties, as soil is a complex, multi-component system of both mineral and organic interacting substances. Most research has focused on the adsorption

  12. Prions and prion-like proteins.

    PubMed

    Fraser, Paul E

    2014-07-18

    Prions are self-replicating protein aggregates and are the primary causative factor in a number of neurological diseases in mammals. The prion protein (PrP) undergoes a conformational transformation leading to aggregation into an infectious cellular pathogen. Prion-like protein spreading and transmission of aggregates between cells have also been demonstrated for other proteins associated with Alzheimer disease and Parkinson disease. This protein-only phenomenon may therefore have broader implications in neurodegenerative disorders. The minireviews in this thematic series highlight the recent advances in prion biology and the roles these unique proteins play in disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. MEAT AND BONE MEAL AND MINERAL FEED ADDITIVES MAY INCREASE THE RISK OF ORAL PRION DISEASE TRANSMISSION

    PubMed Central

    Johnson, Christopher J.; McKenzie, Debbie; Pedersen, Joel A.; Aiken, Judd M.

    2011-01-01

    Ingestion of prion-contaminated materials is postulated to be a primary route of prion disease transmission. Binding of prions to soil (micro)particles dramatically enhances peroral disease transmission relative to unbound prions, and it was hypothesized that micrometer–sized particles present in other consumed materials may affect prion disease transmission via the oral route of exposure. Small, insoluble particles are present in many substances, including soil, human foods, pharmaceuticals, and animal feeds. It is known that meat and bone meal (MBM), a feed additive believed responsible for the spread of bovine spongiform encephalopathy (BSE), contains particles smaller than 20 μm and that the pathogenic prion protein binds to MBM. The potentiation of disease transmission via the oral route by exposure to MBM or three micrometer-sized mineral feed additives was determined. Data showed that when the disease agent was bound to any of the tested materials, the penetrance of disease was increased compared to unbound prions. Our data suggest that in feed or other prion–contaminated substances consumed by animals or, potentially, humans, the addition of MBM or the presence of microparticles could heighten risks of prion disease acquisition. PMID:21218345

  14. Biology and Genetics of Prions Causing Neurodegeneration

    PubMed Central

    Prusiner, Stanley B.

    2014-01-01

    Prions are proteins that acquire alternative conformations that become self-propagating. Transformation of proteins into prions is generally accompanied by an increase in β-sheet structure and a propensity to aggregate into oligomers. Some prions are beneficial and perform cellular functions, whereas others cause neurodegeneration. In mammals, more than a dozen proteins that become prions have been identified and a similar number has been found in fungi. In both mammals and fungi, variations in the prion conformation encipher the biological properties of distinct prion strains. Increasing evidence argues that prions cause many neurodegenerative diseases (NDs), including Alzheimer’s, Parkinson’s, Creutzfeldt-Jakob, and Lou Gehrig’s diseases, as well as the tauopathies. The majority of NDs are sporadic, and 10% to 20% are inherited. The late onset of heritable NDs, like their sporadic counterparts, may reflect the stochastic nature of prion formation; the pathogenesis of such illnesses seems to require prion accumulation to exceed some critical threshold before neurological dysfunction manifests. PMID:24274755

  15. Prions in Yeast

    PubMed Central

    Liebman, Susan W.; Chernoff, Yury O.

    2012-01-01

    The concept of a prion as an infectious self-propagating protein isoform was initially proposed to explain certain mammalian diseases. It is now clear that yeast also has heritable elements transmitted via protein. Indeed, the “protein only” model of prion transmission was first proven using a yeast prion. Typically, known prions are ordered cross-β aggregates (amyloids). Recently, there has been an explosion in the number of recognized prions in yeast. Yeast continues to lead the way in understanding cellular control of prion propagation, prion structure, mechanisms of de novo prion formation, specificity of prion transmission, and the biological roles of prions. This review summarizes what has been learned from yeast prions. PMID:22879407

  16. Molecular modelling indicates that the pathological conformations of prion proteins might be beta-helical.

    PubMed Central

    Downing, D T; Lazo, N D

    1999-01-01

    Creutzfeldt-Jakob disease, kuru, scrapie and bovine spongiform encephalopathy are diseases of the mammalian central nervous system that involve the conversion of a cellular protein into an insoluble extracellular isoform. Spectroscopic studies have shown that the precursor protein contains mainly alpha-helical and random-coil conformations, whereas the prion isoform is largely in the beta conformation. The pathogenic prion is resistant to denaturation and protease digestion and can promote the conversion of the precursor protein to the pathogenic form. These properties have yet to be explained in terms of the structural conformations of the proteins. In the present study, molecular modelling showed that prion proteins could adopt the beta-helical conformation, which has been established for a number of fibrous proteins and has been suggested previously as the basis of amyloid fibrils. The beta-helical conformation provides explanations for the biophysical and biochemical stability of prions, their ability to form templates for the transmission of pathological conformation, and the existence of phenotypical strains of the prion diseases. PMID:10510313

  17. Cellular Aspects of Prion Replication In Vitro

    PubMed Central

    Grassmann, Andrea; Wolf, Hanna; Hofmann, Julia; Graham, James; Vorberg, Ina

    2013-01-01

    Prion diseases or transmissible spongiform encephalopathies (TSEs) are fatal neurodegenerative disorders in mammals that are caused by unconventional agents predominantly composed of aggregated misfolded prion protein (PrP). Prions self-propagate by recruitment of host-encoded PrP into highly ordered β-sheet rich aggregates. Prion strains differ in their clinical, pathological and biochemical characteristics and are likely to be the consequence of distinct abnormal prion protein conformers that stably replicate their alternate states in the host cell. Understanding prion cell biology is fundamental for identifying potential drug targets for disease intervention. The development of permissive cell culture models has greatly enhanced our knowledge on entry, propagation and dissemination of TSE agents. However, despite extensive research, the precise mechanism of prion infection and potential strain effects remain enigmatic. This review summarizes our current knowledge of the cell biology and propagation of prions derived from cell culture experiments. We discuss recent findings on the trafficking of cellular and pathologic PrP, the potential sites of abnormal prion protein synthesis and potential co-factors involved in prion entry and propagation. PMID:23340381

  18. [A review of the current research on prions. The evidence suggests the possibility of transmission of the mad cow disease to humans].

    PubMed

    Grandien, M; Wahren, B

    1998-11-25

    Further evidence of the transmissibility of bovine spongiform encephalopathy (BSE) across the species barrier from cow to man has been derived from epidemiological analysis and the characterisation of prion strains. Recent research has shown the persistence of prions after experimental transmission to resistant murine species, and subclinical persistence in cows. The accumulation of pathological prion proteins in tonsils and appendix has been demonstrated prior to clinical confirmation of the presence of the new variant of Creutzfeldt-Jakob disease. Current prion research is focused on the involvement of B lymphocytes as carriers, on the species barrier and cellular receptors, and on macromolecules involved in the conformational change from normal to pathological prion proteins.

  19. Inactivation of Prions and Amyloid Seeds with Hypochlorous Acid

    PubMed Central

    Kraus, Allison; Phillips, Katie; Contreras, Luis; Zanusso, Gianluigi; Caughey, Byron

    2016-01-01

    Hypochlorous acid (HOCl) is produced naturally by neutrophils and other cells to kill conventional microbes in vivo. Synthetic preparations containing HOCl can also be effective as microbial disinfectants. Here we have tested whether HOCl can also inactivate prions and other self-propagating protein amyloid seeds. Prions are deadly pathogens that are notoriously difficult to inactivate, and standard microbial disinfection protocols are often inadequate. Recommended treatments for prion decontamination include strongly basic (pH ≥~12) sodium hypochlorite bleach, ≥1 N sodium hydroxide, and/or prolonged autoclaving. These treatments are damaging and/or unsuitable for many clinical, agricultural and environmental applications. We have tested the anti-prion activity of a weakly acidic aqueous formulation of HOCl (BrioHOCl) that poses no apparent hazard to either users or many surfaces. For example, BrioHOCl can be applied directly to skin and mucous membranes and has been aerosolized to treat entire rooms without apparent deleterious effects. Here, we demonstrate that immersion in BrioHOCl can inactivate not only a range of target microbes, including spores of Bacillus subtilis, but also prions in tissue suspensions and on stainless steel. Real-time quaking-induced conversion (RT-QuIC) assays showed that BrioHOCl treatments eliminated all detectable prion seeding activity of human Creutzfeldt-Jakob disease, bovine spongiform encephalopathy, cervine chronic wasting disease, sheep scrapie and hamster scrapie; these findings indicated reductions of ≥103- to 106-fold. Transgenic mouse bioassays showed that all detectable hamster-adapted scrapie infectivity in brain homogenates or on steel wires was eliminated, representing reductions of ≥~105.75-fold and >104-fold, respectively. Inactivation of RT-QuIC seeding activity correlated with free chlorine concentration and higher order aggregation or destruction of proteins generally, including prion protein. Brio

  20. Biochemical Characterization of Prion Strains in Bank Voles

    PubMed Central

    Pirisinu, Laura; Marcon, Stefano; Di Bari, Michele Angelo; D’Agostino, Claudia; Agrimi, Umberto; Nonno, Romolo

    2013-01-01

    Prions exist as different strains exhibiting distinct disease phenotypes. Currently, the identification of prion strains is still based on biological strain typing in rodents. However, it has been shown that prion strains may be associated with distinct PrPSc biochemical types. Taking advantage of the availability of several prion strains adapted to a novel rodent model, the bank vole, we investigated if any prion strain was actually associated with distinctive PrPSc biochemical characteristics and if it was possible to univocally identify strains through PrPSc biochemical phenotypes. We selected six different vole-adapted strains (three human-derived and three animal-derived) and analyzed PrPSc from individual voles by epitope mapping of protease resistant core of PrPSc (PrPres) and by conformational stability and solubility assay. Overall, we discriminated five out of six prion strains, while two different scrapie strains showed identical PrPSc types. Our results suggest that the biochemical strain typing approach here proposed was highly discriminative, although by itself it did not allow us to identify all prion strains analyzed. PMID:25437201

  1. The effects of glutamine/asparagine content on aggregation and heterologous prion induction by yeast prion-like domains.

    PubMed

    Shattuck, Jenifer E; Waechter, Aubrey C; Ross, Eric D

    2017-07-04

    Prion-like domains are low complexity, intrinsically disordered domains that compositionally resemble yeast prion domains. Many prion-like domains are involved in the formation of either functional or pathogenic protein aggregates. These aggregates range from highly dynamic liquid droplets to highly ordered detergent-insoluble amyloid-like aggregates. To better understand the amino acid sequence features that promote conversion to stable, detergent-insoluble aggregates, we used the prediction algorithm PAPA to identify predicted aggregation-prone prion-like domains with a range of compositions. While almost all of the predicted aggregation-prone domains formed foci when expressed in cells, the ability to form the detergent-insoluble aggregates was highly correlated with glutamine/asparagine (Q/N) content, suggesting that high Q/N content may specifically promote conversion to the amyloid state in vivo. We then used this data set to examine cross-seeding between prion-like proteins. The prion protein Sup35 requires the presence of a second prion, [PIN + ], to efficiently form prions, but this requirement can be circumvented by the expression of various Q/N-rich protein fragments. Interestingly, almost all of the Q/N-rich domains that formed SDS-insoluble aggregates were able to promote prion formation by Sup35, highlighting the highly promiscuous nature of these interactions.

  2. Molecular mechanisms of chronic wasting disease prion propagation

    PubMed Central

    Moreno, Julie A.; Telling, Glenn C.

    2018-01-01

    Prion disease epidemics, which have been unpredictable recurrences, are of significant concern for animal and human health. Examples include kuru, once the leading cause of death among the Fore people in Papua New Guinea and caused by mortuary feasting; bovine spongiform encephalopathy (BSE) and its subsequent transmission to humans in the form of variant Creutzfeldt-Jakob disease (vCJD); and repeated examples of large-scale prion disease epidemics in animals caused by contaminated vaccines. The etiology of chronic wasting disease (CWD), a relatively new and burgeoning prion epidemic in deer, elk, and moose (members of the cervid family), is more enigmatic. The disease was first described in captive and later in wild mule deer and subsequently in free-ranging as well as captive Rocky Mountain elk, white-tailed deer, and most recently moose. It is therefore the only recognized prion disorder of both wild and captive animals. In addition to its expanding range of hosts, CWD continues to spread to new geographical areas, including recent cases in Norway. The unparalleled efficiency of the contagious transmission of the disease combined with high densities of deer in certain areas of North America complicates strategies for controlling CWD and raises concerns about its potential spread to new species. Because there is a high prevalence of CWD in deer and elk, which are commonly hunted and consumed by humans, the possibility of zoonotic transmission is particularly concerning. Here we review the current status of naturally occurring CWD and describe advances in our understanding of its molecular pathogenesis, as shown by studies of CWD prions in novel in vivo and in vitro systems. PMID:28193766

  3. Differential effects of divalent cations on elk prion protein fibril formation and stability

    USDA-ARS?s Scientific Manuscript database

    Misfolding of the normally folded prion protein of mammals (PrPC) into infectious fibrils causes a variety of different diseases, from scrapie in sheep to bovine spongiform encephalopathy in cattle to chronic wasting disease (CWD) in deer and elk. The misfolded form of PrPC, termed PrPSc, or in this...

  4. Detection of PrP(Sc) in peripheral tissues of clinically affected cattle after oral challenge with bovine spongiform encephalopathy

    USDA-ARS?s Scientific Manuscript database

    Bovine spongiform encephalopathy (BSE) is a fatal neurodegenerative prion disease that affects cattle and can be transmitted to human beings as new variant Creutzfeldt-Jakob disease (vCJD). A protease-resistant, disease-associated isoform of the prion protein (PrP**Sc) accumulates in the central ner...

  5. In vitro replication highlights the mutability of prions.

    PubMed

    Vanni, Ilaria; Di Bari, Michele Angelo; Pirisinu, Laura; D'Agostino, Claudia; Agrimi, Umberto; Nonno, Romolo

    2014-01-01

    Prions exist as strains, which are thought to reflect PrP(Sc) conformational variants. Prion strains can mutate and it has been proposed that prion mutability depends on an intrinsic heterogeneity of prion populations that would behave as quasispecies. We investigated in vitro prion mutability of 2 strains, by following PrP(Sc) variations of populations serially propagated in PMCA under constant environmental pressure. Each strain was propagated either at low dilution of the seed, i.e., by large population passages, or at limiting dilution, mimicking bottleneck events. In both strains, PrP(Sc) conformational variants were identified only after large population passages, while repeated bottleneck events caused a rapid decline in amplification rates. These findings support the view that mutability is an intrinsic property of prions.

  6. Yeast prions assembly and propagation: contributions of the prion and non-prion moieties and the nature of assemblies.

    PubMed

    Kabani, Mehdi; Melki, Ronald

    2011-01-01

    Yeast prions are self-perpetuating protein aggregates that are at the origin of heritable and transmissible non-Mendelian phenotypic traits. Among these, [PSI+], [URE3] and [PIN+] are the most well documented prions and arise from the assembly of Sup35p, Ure2p and Rnq1p, respectively, into insoluble fibrillar assemblies. Fibril assembly depends on the presence of N- or C-terminal prion domains (PrDs) which are not homologous in sequence but share unusual amino-acid compositions, such as enrichment in polar residues (glutamines and asparagines) or the presence of oligopeptide repeats. Purified PrDs form amyloid fibrils that can convert prion-free cells to the prion state upon transformation. Nonetheless, isolated PrDs and full-length prion proteins have different aggregation, structural and infectious properties. In addition, mutations in the "non-prion" domains (non-PrDs) of Sup35p, Ure2p and Rnq1p were shown to affect their prion properties in vitro and in vivo. Despite these evidences, the implication of the functional non-PrDs in fibril assembly and prion propagation has been mostly overlooked. In this review, we discuss the contribution of non-PrDs to prion assemblies, and the structure-function relationship in prion infectivity in the light of recent findings on Sup35p and Ure2p assembly into infectious fibrils from our laboratory and others.

  7. Yeast and Fungal Prions: Amyloid-Handling Systems, Amyloid Structure, and Prion Biology.

    PubMed

    Wickner, R B; Edskes, H K; Gorkovskiy, A; Bezsonov, E E; Stroobant, E E

    2016-01-01

    Yeast prions (infectious proteins) were discovered by their outré genetic properties and have become important models for an array of human prion and amyloid diseases. A single prion protein can become any of many distinct amyloid forms (called prion variants or strains), each of which is self-propagating, but with different biological properties (eg, lethal vs mild). The folded in-register parallel β sheet architecture of the yeast prion amyloids naturally suggests a mechanism by which prion variant information can be faithfully transmitted for many generations. The yeast prions rely on cellular chaperones for their propagation, but can be cured by various chaperone imbalances. The Btn2/Cur1 system normally cures most variants of the [URE3] prion that arise. Although most variants of the [PSI+] and [URE3] prions are toxic or lethal, some are mild in their effects. Even the most mild forms of these prions are rare in the wild, indicating that they too are detrimental to yeast. The beneficial [Het-s] prion of Podospora anserina poses an important contrast in its structure, biology, and evolution to the yeast prions characterized thus far. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Prions, From Structure to Epigenetics and Neuronal Functions

    NASA Astrophysics Data System (ADS)

    Lindquist, Susan

    2012-02-01

    Prions are a unique type of protein that can misfold and convert other proteins to the same shape. The well-characterized yeast prion [PSI+] is formed from an inactive amyloid fiber conformation of the translation-termination factor, Sup35. This altered conformation is passed from mother cells to daughters, acting as a template to perpetuate the prion state and providing a mechanism of protein-based inheritance. We employed a variety of methods to determine the structure of Sup35 amyloid fibrils. First, using fluorescent tags and cross-linking we identified specific segments of the protein monomer that form intermolecular contacts in a ``Head-to-Head,'' ``Tail-to-Tail'' fashion while a central region forms intramolecular contacts. Then, using peptide arrays we mapped the region responsible for the prion transmission barrier between two different yeast species. We have also used optical tweezers to reveal that the non-covalent intermolecular contacts between monomers are unusually strong, and maintain fibril integrity even under forces that partially unfold individual monomers and extend fibril length. Based on the handful of known yeast prion proteins we predicted sequences that could be responsible for prion-like amyloid folding. Our screen identified 19 new candidate prions, whose protein-folding properties and diverse cellular functions we have characterized using a combination of genetic and biochemical techniques. Prion-driven phenotypic diversity increases under stress, and can be amplified by the dynamic maturation of prion-initiating states. These qualities allow prions to act as ``bet-hedging'' devices that facilitate the adaptation of yeast to stressful environments, and might speed the evolution of new traits. Together with Kandel and Si, we have also found that a regulatory protein that plays an important role in synaptic plasticity behaves as a prion in yeast. Cytoplasmic polyAdenylation element binding protein, CPEB, maintains synapses by promoting

  9. The [RNQ+] prion

    PubMed Central

    Stein, Kevin C

    2011-01-01

    The formation of fibrillar amyloid is most often associated with protein conformational disorders such as prion diseases, Alzheimer disease and Huntington disease. Interestingly, however, an increasing number of studies suggest that amyloid structures can sometimes play a functional role in normal biology. Several proteins form self-propagating amyloids called prions in the budding yeast Saccharomyces cerevisiae. These unique elements operate by creating a reversible, epigenetic change in phenotype. While the function of the non-prion conformation of the Rnq1 protein is unclear, the prion form, [RNQ+], acts to facilitate the de novo formation of other prions to influence cellular phenotypes. The [RNQ+] prion itself does not adversely affect the growth of yeast, but the overexpression of Rnq1p can form toxic aggregated structures that are not necessarily prions. The [RNQ+] prion is also involved in dictating the aggregation and toxicity of polyglutamine proteins ectopically expressed in yeast. Thus, the [RNQ+] prion provides a tractable model that has the potential to reveal significant insight into the factors that dictate how amyloid structures are initiated and propagated in both physiological and pathological contexts. PMID:22052347

  10. A role for astroglia in prion diseases.

    PubMed

    Aguzzi, Adriano; Liu, Yingjun

    2017-12-04

    In this issue of JEM, Krejciova et al. (https://doi.org/10.1084/jem.20161547) report that astrocytes derived from human iPSCs can replicate human CJD prions. These observations provide a new, potentially very valuable model for studying human prions in cellula and for identifying antiprion compounds that might serve as clinical candidates. Furthermore, they add to the evidence that astrocytes may not be just innocent bystanders in prion diseases. © 2017 Aguzzi and Liu.

  11. Mammalian prions

    PubMed Central

    Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel

    2013-01-01

    Upon prion infection, abnormal prion protein (PrPSc) self-perpetuate by conformational conversion of α-helix-rich PrPC into β sheet enriched form, leading to formation and deposition of PrPSc aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrPSc and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region. PMID:23232499

  12. Transmission of chronic wasting disease identifies a prion strain causing cachexia and heart infection in hamsters.

    PubMed

    Bessen, Richard A; Robinson, Cameron J; Seelig, Davis M; Watschke, Christopher P; Lowe, Diana; Shearin, Harold; Martinka, Scott; Babcock, Alex M

    2011-01-01

    Chronic wasting disease (CWD) is an emerging prion disease of free-ranging and captive cervids in North America. In this study we established a rodent model for CWD in Syrian golden hamsters that resemble key features of the disease in cervids including cachexia and infection of cardiac muscle. Following one to three serial passages of CWD from white-tailed deer into transgenic mice expressing the hamster prion protein gene, CWD was subsequently passaged into Syrian golden hamsters. In one passage line there were preclinical changes in locomotor activity and a loss of body mass prior to onset of subtle neurological symptoms around 340 days. The clinical symptoms included a prominent wasting disease, similar to cachexia, with a prolonged duration. Other features of CWD in hamsters that were similar to cervid CWD included the brain distribution of the disease-specific isoform of the prion protein, PrP(Sc), prion infection of the central and peripheral neuroendocrine system, and PrP(Sc) deposition in cardiac muscle. There was also prominent PrP(Sc) deposition in the nasal mucosa on the edge of the olfactory sensory epithelium with the lumen of the nasal airway that could have implications for CWD shedding into nasal secretions and disease transmission. Since the mechanism of wasting disease in prion diseases is unknown this hamster CWD model could provide a means to investigate the physiological basis of cachexia, which we propose is due to a prion-induced endocrinopathy. This prion disease phenotype has not been described in hamsters and we designate it as the 'wasting' or WST strain of hamster CWD.

  13. Melanin or a Melanin-Like Substance Interacts with the N-Terminal Portion of Prion Protein and Inhibits Abnormal Prion Protein Formation in Prion-Infected Cells

    PubMed Central

    Hamanaka, Taichi; Nishizawa, Keiko; Sakasegawa, Yuji; Oguma, Ayumi; Teruya, Kenta; Kurahashi, Hiroshi; Hara, Hideyuki; Sakaguchi, Suehiro

    2017-01-01

    ABSTRACT Prion diseases are progressive fatal neurodegenerative illnesses caused by the accumulation of transmissible abnormal prion protein (PrP). To find treatments for prion diseases, we searched for substances from natural resources that inhibit abnormal PrP formation in prion-infected cells. We found that high-molecular-weight components from insect cuticle extracts reduced abnormal PrP levels. The chemical nature of these components was consistent with that of melanin. In fact, synthetic melanin produced from tyrosine or 3-hydroxy-l-tyrosine inhibited abnormal PrP formation. Melanin did not modify cellular or cell surface PrP levels, nor did it modify lipid raft or cellular cholesterol levels. Neither did it enhance autophagy or lysosomal function. Melanin was capable of interacting with PrP at two N-terminal domains. Specifically, it strongly interacted with the PrP region of amino acids 23 to 50 including a positively charged amino acid cluster and weakly interacted with the PrP octarepeat peptide region of residues 51 to 90. However, the in vitro and in vivo data were inconsistent with those of prion-infected cells. Abnormal PrP formation in protein misfolding cyclic amplification was not inhibited by melanin. Survival after prion infection was not significantly altered in albino mice or exogenously melanin-injected mice compared with that of control mice. These data suggest that melanin, a main determinant of skin color, is not likely to modify prion disease pathogenesis, even though racial differences in the incidence of human prion diseases have been reported. Thus, the findings identify an interaction between melanin and the N terminus of PrP, but the pathophysiological roles of the PrP-melanin interaction remain unclear. IMPORTANCE The N-terminal region of PrP is reportedly important for neuroprotection, neurotoxicity, and abnormal PrP formation, as this region is bound by many factors, such as metal ions, lipids, nucleic acids, antiprion compounds

  14. Inactivation of prion proteins via covalent grafting with methoxypoly(ethylene glycol).

    PubMed

    Scott, Mark D

    2006-01-01

    Transmissible spongiform encephalopathies (TSE) such as bovine spongiform encephalitis (BSE), Creutzfeld-Jakob disease (CJD) as well as other proteinaceous infectious particles (prions) mediated diseases have emerged as a significant concern in transfusion medicine. This concern is derived from both the disease causing potential of prion contaminated blood products but also due to tremendous impact of the active deferral of current and potential blood donors due to their extended stays in BSE prevalent countries (e.g., the United Kingdom). To date, there are no effective means by which infectious prion proteins can be inactivated in cellular and acellular blood products. Based on current work on the covalent grafting of methoxypoly(ethylene glycol) [mPEG] to proteins, viruses, and anuclear, and nucleated cells, it is hypothesized that the conversion of the normal PrP protein to its mutant conformation can be prevented by the covalent grafting of mPEG to the mutant protein. Inactivation of infective protein particles (prions) in both cellular blood products as well as cell free solutions (e.g., clotting factors) could be of medical/commercial value. It is hypothesized that consequent to the covalent modification of donor-derived prions with mPEG the requisite nucleation of the normal and mutant PrP proteins is inhibited due to the increased solubility of the modified mutant PrP and that the conformational conversion arising from the mutant PrP is prevented due to obscuration of protein charge by the heavily hydrated and neutral mPEG polymers, as well as by direct steric hindrance of the interaction due to the highly mobile polymer graft.

  15. Mechanisms of triggering H1 helix in prion proteins unfolding revealed by molecular dynamic simulation

    NASA Astrophysics Data System (ADS)

    Tseng, Chih-Yuan; Lee, H. C.

    2006-03-01

    In template-assistance model, normal Prion protein (PrP^C), the pathogen to cause several prion diseases such as Creutzfeldt-Jakob (CJD) in human, Bovine Spongiform Encephalopathy (BSE) in cow, and scrapie in sheep, converts to infectious prion (PrP^Sc) through a transient interaction with PrP^Sc. Furthermore, conventional studies showed S1-H1-S2 region in PrP^C to be the template of S1-S2 β-sheet in PrP^Sc, and Prion protein's conformational conversion may involve an unfolding of H1 and refolding into β-sheet. Here we prepare several mouse prion peptides that contain S1-H1-S2 region with specific different structures, which are corresponding to specific interactions, to investigate possible mechanisms to trigger H1 α-helix unfolding process via molecular dynamic simulation. Three properties, conformational transition, salt-bridge in H1, and hydrophobic solvent accessible surface (SAS) are analyzed. From these studies, we found the interaction that triggers H1 unfolding to be the one that causes dihedral angle at residue Asn^143 changes. Whereas interactions that cause S1 segment's conformational changes play a minor in this process. These studies offers an additional evidence for template-assistance model.

  16. Application of “omics” to Prion Biomarker Discovery

    PubMed Central

    Huzarewich, Rhiannon L. C. H.; Siemens, Christine G.; Booth, Stephanie A.

    2010-01-01

    The advent of genomics and proteomics has been a catalyst for the discovery of biomarkers able to discriminate biological processes such as the pathogenesis of complex diseases. Prompt detection of prion diseases is particularly desirable given their transmissibility, which is responsible for a number of human health risks stemming from exogenous sources of prion protein. Diagnosis relies on the ability to detect the biomarker PrPSc, a pathological isoform of the host protein PrPC, which is an essential component of the infectious prion. Immunochemical detection of PrPSc is specific and sensitive enough for antemortem testing of brain tissue, however, this is not the case in accessible biological fluids or for the detection of recently identified novel prions with unique biochemical properties. A complementary approach to the detection of PrPSc itself is to identify alternative, “surrogate” gene or protein biomarkers indicative of disease. Biomarkers are also useful to track the progress of disease, especially important in the assessment of therapies, or to identify individuals “at risk”. In this review we provide perspective on current progress and pitfalls in the use of “omics” technologies to screen body fluids and tissues for biomarker discovery in prion diseases. PMID:20224650

  17. Survey of public perceptions of prion disease risks in Canada: what does the public care about?

    PubMed

    Lemyre, L; Gibson, S; Markon, M P L; Lee, J E C; Brazeau, I; Carroll, A; Boutette, P; Krewski, D

    2009-01-01

    A national public survey on public perceptions of prion disease risk in Canada was conducted from October to December 2007. The survey aimed at documenting the public's perceptions of prion diseases, within the broader context of food safety, in establishing parameters of risk acceptability. It also documented the public's perceptions of prion diseases in delineating social values and ethics that can guide Canada's future policies on prion disease risk management. In addition, the survey served to establish baseline data against which to monitor the evolution of the public's views on and understanding of this important risk issue. In total, 1517 Canadians were randomly selected to be representative of the adult population by region, age, and gender, as per the 2001 Census. This study presents descriptive findings from the survey regarding perceived risk, perceived control, uncertainty, sources of information, trust and knowledge, and beliefs pertaining to bovine spongiform encephalopathy (BSE). The survey data reveal that Canadians do not perceive mad cow disease as a salient risk but consider it more of an economic, political, social, and foreign trade issue than a public health one. Canadians are somewhat prepared to pay a premium to have a safer food supply, but not to the same extent that they desire extra measures pertaining to BSE risk management. In the context of increasing accountability in risk management decisions about food safety and population health issues, it is important to understand the way Canadians perceive such matters and identify their information needs and the factors that influence the acceptability of risks and of risk management policies.

  18. Ex vivo mammalian prions are formed of paired double helical prion protein fibrils.

    PubMed

    Terry, Cassandra; Wenborn, Adam; Gros, Nathalie; Sells, Jessica; Joiner, Susan; Hosszu, Laszlo L P; Tattum, M Howard; Panico, Silvia; Clare, Daniel K; Collinge, John; Saibil, Helen R; Wadsworth, Jonathan D F

    2016-05-01

    Mammalian prions are hypothesized to be fibrillar or amyloid forms of prion protein (PrP), but structures observed to date have not been definitively correlated with infectivity and the three-dimensional structure of infectious prions has remained obscure. Recently, we developed novel methods to obtain exceptionally pure preparations of prions from mouse brain and showed that pathogenic PrP in these high-titre preparations is assembled into rod-like assemblies. Here, we have used precise cell culture-based prion infectivity assays to define the physical relationship between the PrP rods and prion infectivity and have used electron tomography to define their architecture. We show that infectious PrP rods isolated from multiple prion strains have a common hierarchical assembly comprising twisted pairs of short fibres with repeating substructure. The architecture of the PrP rods provides a new structural basis for understanding prion infectivity and can explain the inability to systematically generate high-titre synthetic prions from recombinant PrP. © 2016 The Authors.

  19. Discovery of Novel Anti-prion Compounds Using In Silico and In Vitro Approaches

    PubMed Central

    Hyeon, Jae Wook; Choi, Jiwon; Kim, Su Yeon; Govindaraj, Rajiv Gandhi; Jam Hwang, Kyu; Lee, Yeong Seon; An, Seong Soo A.; Lee, Myung Koo; Joung, Jong Young; No, Kyoung Tai; Lee, Jeongmin

    2015-01-01

    Prion diseases are associated with the conformational conversion of the physiological form of cellular prion protein (PrPC) to the pathogenic form, PrPSc. Compounds that inhibit this process by blocking conversion to the PrPSc could provide useful anti-prion therapies. However, no suitable drugs have been identified to date. To identify novel anti-prion compounds, we developed a combined structure- and ligand-based virtual screening system in silico. Virtual screening of a 700,000-compound database, followed by cluster analysis, identified 37 compounds with strong interactions with essential hotspot PrP residues identified in a previous study of PrPC interaction with a known anti-prion compound (GN8). These compounds were tested in vitro using a multimer detection system, cell-based assays, and surface plasmon resonance. Some compounds effectively reduced PrPSc levels and one of these compounds also showed a high binding affinity for PrPC. These results provide a promising starting point for the development of anti-prion compounds. PMID:26449325

  20. Prions and lymphoid organs

    PubMed Central

    O’Connor, Tracy; Aguzzi, Adriano

    2013-01-01

    Prion colonization of secondary lymphoid organs (SLOs) is a critical step preceding neuroinvasion in prion pathogenesis. Follicular dendritic cells (FDCs), which depend on both tumor necrosis factor receptor 1 (TNFR1) and lymphotoxin β receptor (LTβR) signaling for maintenance, are thought to be the primary sites of prion accumulation in SLOs. However, prion titers in RML-infected TNFR1−/− lymph nodes and rates of neuroinvasion in TNFR1−/− mice remain high despite the absence of mature FDCs. Recently, we discovered that TNFR1-independent prion accumulation in lymph nodes relies on LTβR signaling. Loss of LTβR signaling in TNFR1−/− lymph nodes coincided with the de-differentiation of high endothelial venules (HEVs)—the primary sites of lymphocyte entry into lymph nodes. These findings suggest that HEVs are the sites through which prions initially invade lymph nodes from the bloodstream. Identification of HEVs as entry portals for prions clarifies a number of previous observations concerning peripheral prion pathogenesis. However, a number of questions still remain: What is the mechanism by which prions are taken up by HEVs? Which cells are responsible for delivering prions to lymph nodes? Are HEVs the main entry site for prions into lymph nodes or do alternative routes also exist? These questions and others are considered in this article. PMID:23357827

  1. Melanin or a Melanin-Like Substance Interacts with the N-Terminal Portion of Prion Protein and Inhibits Abnormal Prion Protein Formation in Prion-Infected Cells.

    PubMed

    Hamanaka, Taichi; Nishizawa, Keiko; Sakasegawa, Yuji; Oguma, Ayumi; Teruya, Kenta; Kurahashi, Hiroshi; Hara, Hideyuki; Sakaguchi, Suehiro; Doh-Ura, Katsumi

    2017-03-15

    Prion diseases are progressive fatal neurodegenerative illnesses caused by the accumulation of transmissible abnormal prion protein (PrP). To find treatments for prion diseases, we searched for substances from natural resources that inhibit abnormal PrP formation in prion-infected cells. We found that high-molecular-weight components from insect cuticle extracts reduced abnormal PrP levels. The chemical nature of these components was consistent with that of melanin. In fact, synthetic melanin produced from tyrosine or 3-hydroxy-l-tyrosine inhibited abnormal PrP formation. Melanin did not modify cellular or cell surface PrP levels, nor did it modify lipid raft or cellular cholesterol levels. Neither did it enhance autophagy or lysosomal function. Melanin was capable of interacting with PrP at two N-terminal domains. Specifically, it strongly interacted with the PrP region of amino acids 23 to 50 including a positively charged amino acid cluster and weakly interacted with the PrP octarepeat peptide region of residues 51 to 90. However, the in vitro and in vivo data were inconsistent with those of prion-infected cells. Abnormal PrP formation in protein misfolding cyclic amplification was not inhibited by melanin. Survival after prion infection was not significantly altered in albino mice or exogenously melanin-injected mice compared with that of control mice. These data suggest that melanin, a main determinant of skin color, is not likely to modify prion disease pathogenesis, even though racial differences in the incidence of human prion diseases have been reported. Thus, the findings identify an interaction between melanin and the N terminus of PrP, but the pathophysiological roles of the PrP-melanin interaction remain unclear. IMPORTANCE The N-terminal region of PrP is reportedly important for neuroprotection, neurotoxicity, and abnormal PrP formation, as this region is bound by many factors, such as metal ions, lipids, nucleic acids, antiprion compounds, and

  2. Insights into intragenic and extragenic effectors of prion propagation using chimeric prion proteins

    PubMed Central

    Kalastavadi, Tejas; Tank, Elizabeth MH

    2008-01-01

    The study of fungal prion proteins affords remarkable opportunities to elucidate both intragenic and extragenic effectors of prion propagation. The yeast prion protein Sup35 and the self-perpetuating [PSI+] prion state is one of the best characterized fungal prions. While there is little sequence homology among known prion proteins, one region of striking similarity exists between Sup35p and the mammalian prion protein PrP. This region is comprised of roughly five octapeptide repeats of similar composition. The expansion of the repeat region in PrP is associated with inherited prion diseases. In order to learn more about the effects of PrP repeat expansions on the structural properties of a protein that undergoes a similar transition to a self-perpetuating aggregate, we generated chimeric Sup35-PrP proteins. Using both in vivo and in vitro systems we described the effect of repeat length on protein misfolding, aggregation, amyloid formation and amyloid stability. We found that repeat expansions in the chimeric prion proteins increase the propensity to initiate prion propagation and enhance the formation of amyloid fibers without significantly altering fiber stability. PMID:19098443

  3. Generation of Infectious Prions and Detection with the Prion-Infected Cell Assay.

    PubMed

    Vella, Laura J; Coleman, Bradley; Hill, Andrew F

    2017-01-01

    Cell lines propagating prions are an efficient and useful means for studying the cellular and molecular mechanisms implicated in prion disease. Utilization of cell-based models has led to the finding that PrP C and PrP Sc are released from cells in association with extracellular vesicles known as exosomes. Exosomes have been shown to act as vehicles for infectivity, transferring infectivity between cell lines and providing a mechanism for prion spread between tissues. Here, we describe the methods for generating a prion-propagating cell line with prion-infected brain homogenate, cell lysate, conditioned media, and exosomes and also detection of protease-resistant PrP with the prion-infected cell assay.

  4. Chronic wasting disease prions are not transmissible to transgenic mice overexpressing human prion protein.

    PubMed

    Sandberg, Malin K; Al-Doujaily, Huda; Sigurdson, Christina J; Glatzel, Markus; O'Malley, Catherine; Powell, Caroline; Asante, Emmanuel A; Linehan, Jacqueline M; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

    2010-10-01

    Chronic wasting disease (CWD) is a prion disease that affects free-ranging and captive cervids, including mule deer, white-tailed deer, Rocky Mountain elk and moose. CWD-infected cervids have been reported in 14 USA states, two Canadian provinces and in South Korea. The possibility of a zoonotic transmission of CWD prions via diet is of particular concern in North America where hunting of cervids is a popular sport. To investigate the potential public health risks posed by CWD prions, we have investigated whether intracerebral inoculation of brain and spinal cord from CWD-infected mule deer transmits prion infection to transgenic mice overexpressing human prion protein with methionine or valine at polymorphic residue 129. These transgenic mice have been utilized in extensive transmission studies of human and animal prion disease and are susceptible to BSE and vCJD prions, allowing comparison with CWD. Here, we show that these mice proved entirely resistant to infection with mule deer CWD prions arguing that the transmission barrier associated with this prion strain/host combination is greater than that observed with classical BSE prions. However, it is possible that CWD may be caused by multiple prion strains. Further studies will be required to evaluate the transmission properties of distinct cervid prion strains as they are characterized.

  5. An insight into the complex prion-prion interaction network in the budding yeast Saccharomyces cerevisiae.

    PubMed

    Du, Zhiqiang; Valtierra, Stephanie; Li, Liming

    2014-01-01

    The budding yeast Saccharomyces cerevisiae is a valuable model system for studying prion-prion interactions as it contains multiple prion proteins. A recent study from our laboratory showed that the existence of Swi1 prion ([SWI(+)]) and overproduction of Swi1 can have strong impacts on the formation of 2 other extensively studied yeast prions, [PSI(+)] and [PIN(+)] ([RNQ(+)]) (Genetics, Vol. 197, 685-700). We showed that a single yeast cell is capable of harboring at least 3 heterologous prion elements and these prions can influence each other's appearance positively and/or negatively. We also showed that during the de novo [PSI(+)] formation process upon Sup35 overproduction, the aggregation patterns of a preexisting inducer ([RNQ(+)] or [SWI(+)]) can undergo significant remodeling from stably transmitted dot-shaped aggregates to aggregates that co-localize with the newly formed Sup35 aggregates that are ring/ribbon/rod- shaped. Such co-localization disappears once the newly formed [PSI(+)] prion stabilizes. Our finding provides strong evidence supporting the "cross-seeding" model for prion-prion interactions and confirms earlier reports that the interactions among different prions and their prion proteins mostly occur at the initiation stages of prionogenesis. Our results also highlight a complex prion interaction network in yeast. We believe that elucidating the mechanism underlying the yeast prion-prion interaction network will not only provide insight into the process of prion de novo generation and propagation in yeast but also shed light on the mechanisms that govern protein misfolding, aggregation, and amyloidogenesis in higher eukaryotes.

  6. De novo generation of infectious prions with bacterially expressed recombinant prion protein.

    PubMed

    Zhang, Zhihong; Zhang, Yi; Wang, Fei; Wang, Xinhe; Xu, Yuanyuan; Yang, Huaiyi; Yu, Guohua; Yuan, Chonggang; Ma, Jiyan

    2013-12-01

    The prion hypothesis is strongly supported by the fact that prion infectivity and the pathogenic conformer of prion protein (PrP) are simultaneously propagated in vitro by the serial protein misfolding cyclic amplification (sPMCA). However, due to sPMCA's enormous amplification power, whether an infectious prion can be formed de novo with bacterially expressed recombinant PrP (rPrP) remains to be satisfactorily resolved. To address this question, we performed unseeded sPMCA with rPrP in a laboratory that has never been exposed to any native prions. Two types of proteinase K (PK)-resistant and self-perpetuating recombinant PrP conformers (rPrP-res) with PK-resistant cores of 17 or 14 kDa were generated. A bioassay revealed that rPrP-res(17kDa) was highly infectious, causing prion disease in wild-type mice with an average survival time of about 172 d. In contrast, rPrP-res(14kDa) completely failed to induce any disease. Our findings reveal that sPMCA is sufficient to initiate various self-perpetuating PK-resistant rPrP conformers, but not all of them possess in vivo infectivity. Moreover, generating an infectious prion in a prion-free environment establishes that an infectious prion can be formed de novo with bacterially expressed rPrP.

  7. A systematic investigation of production of synthetic prions from recombinant prion protein.

    PubMed

    Schmidt, Christian; Fizet, Jeremie; Properzi, Francesca; Batchelor, Mark; Sandberg, Malin K; Edgeworth, Julie A; Afran, Louise; Ho, Sammy; Badhan, Anjna; Klier, Steffi; Linehan, Jacqueline M; Brandner, Sebastian; Hosszu, Laszlo L P; Tattum, M Howard; Jat, Parmjit; Clarke, Anthony R; Klöhn, Peter C; Wadsworth, Jonathan D F; Jackson, Graham S; Collinge, John

    2015-12-01

    According to the protein-only hypothesis, infectious mammalian prions, which exist as distinct strains with discrete biological properties, consist of multichain assemblies of misfolded cellular prion protein (PrP). A critical test would be to produce prion strains synthetically from defined components. Crucially, high-titre 'synthetic' prions could then be used to determine the structural basis of infectivity and strain diversity at the atomic level. While there have been multiple reports of production of prions from bacterially expressed recombinant PrP using various methods, systematic production of high-titre material in a form suitable for structural analysis remains a key goal. Here, we report a novel high-throughput strategy for exploring a matrix of conditions, additives and potential cofactors that might generate high-titre prions from recombinant mouse PrP, with screening for infectivity using a sensitive automated cell-based bioassay. Overall, approximately 20,000 unique conditions were examined. While some resulted in apparently infected cell cultures, this was transient and not reproducible. We also adapted published methods that reported production of synthetic prions from recombinant hamster PrP, but again did not find evidence of significant infectious titre when using recombinant mouse PrP as substrate. Collectively, our findings are consistent with the formation of prion infectivity from recombinant mouse PrP being a rare stochastic event and we conclude that systematic generation of prions from recombinant PrP may only become possible once the detailed structure of authentic ex vivo prions is solved. © 2015 The Authors.

  8. A systematic investigation of production of synthetic prions from recombinant prion protein

    PubMed Central

    Schmidt, Christian; Fizet, Jeremie; Properzi, Francesca; Batchelor, Mark; Sandberg, Malin K.; Edgeworth, Julie A.; Afran, Louise; Ho, Sammy; Badhan, Anjna; Klier, Steffi; Linehan, Jacqueline M.; Brandner, Sebastian; Hosszu, Laszlo L. P.; Tattum, M. Howard; Jat, Parmjit; Clarke, Anthony R.; Klöhn, Peter C.; Wadsworth, Jonathan D. F.; Jackson, Graham S.; Collinge, John

    2015-01-01

    According to the protein-only hypothesis, infectious mammalian prions, which exist as distinct strains with discrete biological properties, consist of multichain assemblies of misfolded cellular prion protein (PrP). A critical test would be to produce prion strains synthetically from defined components. Crucially, high-titre ‘synthetic' prions could then be used to determine the structural basis of infectivity and strain diversity at the atomic level. While there have been multiple reports of production of prions from bacterially expressed recombinant PrP using various methods, systematic production of high-titre material in a form suitable for structural analysis remains a key goal. Here, we report a novel high-throughput strategy for exploring a matrix of conditions, additives and potential cofactors that might generate high-titre prions from recombinant mouse PrP, with screening for infectivity using a sensitive automated cell-based bioassay. Overall, approximately 20 000 unique conditions were examined. While some resulted in apparently infected cell cultures, this was transient and not reproducible. We also adapted published methods that reported production of synthetic prions from recombinant hamster PrP, but again did not find evidence of significant infectious titre when using recombinant mouse PrP as substrate. Collectively, our findings are consistent with the formation of prion infectivity from recombinant mouse PrP being a rare stochastic event and we conclude that systematic generation of prions from recombinant PrP may only become possible once the detailed structure of authentic ex vivo prions is solved. PMID:26631378

  9. Prion protein immunocytochemistry helps to establish the true incidence of prion diseases.

    PubMed

    Lantos, P L; McGill, I S; Janota, I; Doey, L J; Collinge, J; Bruce, M T; Whatley, S A; Anderton, B H; Clinton, J; Roberts, G W

    1992-11-23

    Creutzfeldt-Jakob disease (CJD) and Gerstmann-Strüssler-Scheinker disease (GSSD) are transmissible spongiform encephalopathies or prion diseases affecting man. It has been reported that prion diseases may occur without the histological hallmarks of spongiform encephalopathies: vacuolation of the cerebral grey matter, neuronal loss and astrocytosis. These cases without characteristic neuropathology may go undiagnosed and consequently the true incidence of transmissible dementias is likely to have been under-estimated. Immunocytochemistry using antibodies to prion protein gives positive staining of these cases, albeit the pattern of immunostaining differs from that seen in typical forms. Accumulation of prion protein is a molecular hallmark of prion diseases, and thus a reproducible, speedy and cost-efficient immunocytochemical screening of unusual dementias may help to establish the true incidence of prion diseases.

  10. Infectious particles, stress, and induced prion amyloids

    PubMed Central

    2013-01-01

    Transmissible encephalopathies (TSEs) are believed by many to arise by spontaneous conversion of host prion protein (PrP) into an infectious amyloid (PrP-res, PrPSc) without nucleic acid. Many TSE agents reside in the environment, with infection controlled by public health measures. These include the disappearance of kuru with the cessation of ritual cannibalism, the dramatic reduction of epidemic bovine encephalopathy (BSE) by removal of contaminated feed, and the lack of endemic scrapie in geographically isolated Australian sheep with susceptible PrP genotypes. While prion protein modeling has engendered an intense focus on common types of protein misfolding and amyloid formation in diverse organisms and diseases, the biological characteristics of infectious TSE agents, and their recognition by the host as foreign entities, raises several fundamental new directions for fruitful investigation such as: (1) unrecognized microbial agents in the environmental metagenome that may cause latent neurodegenerative disease, (2) the evolutionary social and protective functions of different amyloid proteins in diverse organisms from bacteria to mammals, and (3) amyloid formation as a beneficial innate immune response to stress (infectious and non-infectious). This innate process however, once initiated, can become unstoppable in accelerated neuronal aging. PMID:23633671

  11. Protecting effect of PrP codons M142 and K222 in goats orally challenged with bovine spongiform encephalopathy prions.

    PubMed

    Fast, C; Goldmann, W; Berthon, P; Tauscher, K; Andréoletti, O; Lantier, I; Rossignol, C; Bossers, A; Jacobs, J G; Hunter, N; Groschup, M H; Lantier, F; Langeveld, J P M

    2017-09-19

    Breeding towards genetic resistance to prion disease is effective in eliminating scrapie. In sheep, classical forms of scrapie have been eradicated almost completely in several countries by breeding programs using a prion protein (PrP) gene (PRNP) amino acid polymorphism. For goats, field and experimental studies have provided evidence for several amino acid polymorphisms that are associated with resistance to scrapie, but only limited data are available concerning the susceptibility of caprine PRNP genotypes to BSE. In this study, goat kids representing five PRNP genotypes based on three polymorphisms (M142, Q211 and K222 and the wild type I142, R211 and Q222) were orally challenged with bovine or goat BSE. Wild type goats were killed with clinical signs between 24-28 months post inoculation (mpi) to both challenges, and goats with genotype R/Q211 succumbed between 29-36 mpi. I/M142 goats developed clinical signs at 44-45 mpi and M/M142 goats remained healthy until euthanasia at 48 mpi. None of the Q/K222 goats showed definite clinical signs. Taken together the highest attack ratios were seen in wild type and R/Q211 goats, and the lowest in I/M142, M/M142 and Q/K222. In all genotype groups, one or more goats remained healthy within the incubation period in both challenges and without detectable PrP deposition in the tissues. Our data show that both the K222 and M142 polymorphisms lengthen the incubation period significantly compared to wild type animals, but only K222 was associated with a significant increase in resistance to BSE infection after oral exposure to both BSE sources.

  12. Recombinant human prion protein inhibits prion propagation in vitro.

    PubMed

    Yuan, Jue; Zhan, Yi-An; Abskharon, Romany; Xiao, Xiangzhu; Martinez, Manuel Camacho; Zhou, Xiaochen; Kneale, Geoff; Mikol, Jacqueline; Lehmann, Sylvain; Surewicz, Witold K; Castilla, Joaquín; Steyaert, Jan; Zhang, Shulin; Kong, Qingzhong; Petersen, Robert B; Wohlkonig, Alexandre; Zou, Wen-Quan

    2013-10-09

    Prion diseases are associated with the conformational conversion of the cellular prion protein (PrP(C)) into the pathological scrapie isoform (PrP(Sc)) in the brain. Both the in vivo and in vitro conversion of PrP(C) into PrP(Sc) is significantly inhibited by differences in amino acid sequence between the two molecules. Using protein misfolding cyclic amplification (PMCA), we now report that the recombinant full-length human PrP (rHuPrP23-231) (that is unglycosylated and lacks the glycophosphatidylinositol anchor) is a strong inhibitor of human prion propagation. Furthermore, rHuPrP23-231 also inhibits mouse prion propagation in a scrapie-infected mouse cell line. Notably, it binds to PrP(Sc), but not PrP(C), suggesting that the inhibitory effect of recombinant PrP results from blocking the interaction of brain PrP(C) with PrP(Sc). Our findings suggest a new avenue for treating prion diseases, in which a patient's own unglycosylated and anchorless PrP is used to inhibit PrP(Sc) propagation without inducing immune response side effects.

  13. Horizontal Transmission of Cytosolic Sup35 Prions by Extracellular Vesicles.

    PubMed

    Liu, Shu; Hossinger, André; Hofmann, Julia P; Denner, Philip; Vorberg, Ina M

    2016-07-12

    Prions are infectious protein particles that replicate by templating their aggregated state onto soluble protein of the same type. Originally identified as the causative agent of transmissible spongiform encephalopathies, prions in yeast (Saccharomyces cerevisiae) are epigenetic elements of inheritance that induce phenotypic changes of their host cells. The prototype yeast prion is the translation termination factor Sup35. Prions composed of Sup35 or its modular prion domain NM are heritable and are transmitted vertically to progeny or horizontally during mating. Interestingly, in mammalian cells, protein aggregates derived from yeast Sup35 NM behave as true infectious entities that employ dissemination strategies similar to those of mammalian prions. While transmission is most efficient when cells are in direct contact, we demonstrate here that cytosolic Sup35 NM prions are also released into the extracellular space in association with nanometer-sized membrane vesicles. Importantly, extracellular vesicles are biologically active and are taken up by recipient cells, where they induce self-sustained Sup35 NM protein aggregation. Thus, in mammalian cells, extracellular vesicles can serve as dissemination vehicles for protein-based epigenetic information transfer. Prions are proteinaceous infectious particles that propagate by templating their quaternary structure onto nascent proteins of the same kind. Prions in yeast act as heritable epigenetic elements that can alter the phenotype when transmitted to daughter cells or during mating. Prion activity is conferred by so-called prion domains often enriched in glutamine and asparagine residues. Interestingly, many mammalian proteins also contain domains with compositional similarity to yeast prion domains. We have recently provided a proof-of-principle demonstration that a yeast prion domain also retains its prion activity in mammalian cells. We demonstrate here that cytosolic prions composed of a yeast prion domain are

  14. Incunabular Immunological Events in Prion Trafficking

    PubMed Central

    Michel, Brady; Meyerett-Reid, Crystal; Johnson, Theodore; Ferguson, Adam; Wyckoff, Christy; Pulford, Bruce; Bender, Heather; Avery, Anne; Telling, Glenn; Dow, Steven; Zabel, Mark D.

    2012-01-01

    While prions probably interact with the innate immune system immediately following infection, little is known about this initial confrontation. Here we investigated incunabular events in lymphotropic and intranodal prion trafficking by following highly enriched, fluorescent prions from infection sites to draining lymph nodes. We detected biphasic lymphotropic transport of prions from the initial entry site upon peripheral prion inoculation. Prions arrived in draining lymph nodes cell autonomously within two hours of intraperitoneal administration. Monocytes and dendritic cells (DCs) required Complement for optimal prion delivery to lymph nodes hours later in a second wave of prion trafficking. B cells constituted the majority of prion-bearing cells in the mediastinal lymph node by six hours, indicating intranodal prion reception from resident DCs or subcapsulary sinus macrophages or directly from follicular conduits. These data reveal novel, cell autonomous prion lymphotropism, and a prominent role for B cells in intranodal prion movement. PMID:22679554

  15. Dissociation of recombinant prion autocatalysis from infectivity.

    PubMed

    Noble, Geoffrey P; Supattapone, Surachai

    2015-01-01

    Within the mammalian prion field, the existence of recombinant prion protein (PrP) conformers with self-replicating (ie. autocatalytic) activity in vitro but little to no infectious activity in vivo challenges a key prediction of the protein-only hypothesis of prion replication--that autocatalytic PrP conformers should be infectious. To understand this dissociation of autocatalysis from infectivity, we recently performed a structural and functional comparison between a highly infectious and non-infectious pair of autocatalytic recombinant PrP conformers derived from the same initial prion strain. (1) We identified restricted, C-terminal structural differences between these 2 conformers and provided evidence that these relatively subtle differences prevent the non-infectious conformer from templating the conversion of native PrP(C) substrates containing a glycosylphosphatidylinositol (GPI) anchor. (1) In this article we discuss a model, consistent with these findings, in which recombinant PrP, lacking post-translational modifications and associated folding constraints, is capable of adopting a wide variety of autocatalytic conformations. Only a subset of these recombinant conformers can be adopted by post-translationally modified native PrP(C), and this subset represents the recombinant conformers with high specific infectivity. We examine this model's implications for the generation of highly infectious recombinant prions and the protein-only hypothesis of prion replication.

  16. Generating Bona Fide Mammalian Prions with Internal Deletions

    PubMed Central

    Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human

    2016-01-01

    ABSTRACT Mammalian prions are PrP proteins with altered structures causing transmissible fatal neurodegenerative diseases. They are self-perpetuating through formation of beta-sheet-rich assemblies that seed conformational change of cellular PrP. Pathological PrP usually forms an insoluble protease-resistant core exhibiting beta-sheet structures but no more alpha-helical content, loosing the three alpha-helices contained in the correctly folded PrP. The lack of a high-resolution prion structure makes it difficult to understand the dynamics of conversion and to identify elements of the protein involved in this process. To determine whether completeness of residues within the protease-resistant domain is required for prions, we performed serial deletions in the helix H2 C terminus of ovine PrP, since this region has previously shown some tolerance to sequence changes without preventing prion replication. Deletions of either four or five residues essentially preserved the overall PrP structure and mutant PrP expressed in RK13 cells were efficiently converted into bona fide prions upon challenge by three different prion strains. Remarkably, deletions in PrP facilitated the replication of two strains that otherwise do not replicate in this cellular context. Prions with internal deletion were self-propagating and de novo infectious for naive homologous and wild-type PrP-expressing cells. Moreover, they caused transmissible spongiform encephalopathies in mice, with similar biochemical signatures and neuropathologies other than the original strains. Prion convertibility and transfer of strain-specific information are thus preserved despite shortening of an alpha-helix in PrP and removal of residues within prions. These findings provide new insights into sequence/structure/infectivity relationship for prions. IMPORTANCE Prions are misfolded PrP proteins that convert the normal protein into a replicate of their own abnormal form. They are responsible for invariably fatal

  17. The inhibition of prions through blocking prion conversion by permanently charged branched polyamines of low cytotoxicity.

    PubMed

    Lim, Yong-beom; Mays, Charles E; Kim, Younghwan; Titlow, William B; Ryou, Chongsuk

    2010-03-01

    Branched polyamines are effective in inhibiting prions in a cationic surface charge density dependent manner. However, toxicity associated with branched polyamines, in general, often hampers the successful application of the compounds to treat prion diseases. Here, we report that constitutively maintained cationic properties in branched polyamines reduced the intrinsic toxicity of the compounds while retaining the anti-prion activities. In prion-infected neuroblastoma cells, quaternization of amines in polyethyleneimine (PEI) and polyamidoamine (PAMAM) dendrimers markedly increased the nontoxic concentration ranges of the compounds and still supported, albeit reduced, an appreciable level of anti-prion activity in clearing prions from the infected cells. Furthermore, quaternized PEI was able to degrade prions at acidic pH conditions and inhibit the in vitro prion propagation facilitated by conversion of the normal prion protein isoform to its misfolded counterpart, although such activities were decreased by quaternization. Quaternized PAMAM was least effective in degrading prions but efficiently inhibited prion conversion with the same efficacy as unmodified PAMAM. Our results suggest that quaternization represents an effective strategy for developing nontoxic branched polyamines with potent anti-prion activity. This study highlights the importance of polyamine structural control for developing polyamine-based anti-prion agents and understanding of an action mechanism of quaternized branched polyamines. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  18. Potential approaches for heterologous prion protein treatment of prion diseases

    PubMed Central

    Seelig, Davis M.; Goodman, Patricia A.; Skinner, Pamela J.

    2016-01-01

    ABSTRACT Prion diseases, or transmissible spongiform encephalopathies (TSEs) are progressive, fatal neurodegenerative diseases with no effective treatment. The pathology of these diseases involves the conversion of a protease sensitive form of the cellular prion protein (PrPC) into a protease resistant infectious form (PrPres). The efficiency of this conversion is predicated upon a number of factors, most notably a strong homology between cellular PrPC and PrPres. In our recently published study, we infected mice with the RML-Chandler strain of scrapie and treated them with heterologous hamster prion proteins. This treatment was seen to reduce clinical signs of prion disease, to delay the onset of clinical symptoms and to prolong survival. In this current article we discuss potential mechanisms of action of treatment with heterologous prion proteins. We also discuss potential extensions of these studies using a heterologous rabbit PrP-based treatment strategy or a peptide based strategy, and improvement of treatment delivery including a lentiviral-based system. PMID:26636482

  19. Increased infectivity of anchorless mouse scrapie prions in transgenic mice overexpressing human prion protein.

    PubMed

    Race, Brent; Phillips, Katie; Meade-White, Kimberly; Striebel, James; Chesebro, Bruce

    2015-06-01

    Prion protein (PrP) is found in all mammals, mostly as a glycoprotein anchored to the plasma membrane by a C-terminal glycosylphosphatidylinositol (GPI) linkage. Following prion infection, host protease-sensitive prion protein (PrPsen or PrPC) is converted into an abnormal, disease-associated, protease-resistant form (PrPres). Biochemical characteristics, such as the PrP amino acid sequence, and posttranslational modifications, such as glycosylation and GPI anchoring, can affect the transmissibility of prions as well as the biochemical properties of the PrPres generated. Previous in vivo studies on the effects of GPI anchoring on prion infectivity have not examined cross-species transmission. In this study, we tested the effect of lack of GPI anchoring on a species barrier model using mice expressing human PrP. In this model, anchorless 22L prions derived from tg44 mice were more infectious than 22L prions derived from C57BL/10 mice when tested in tg66 transgenic mice, which expressed wild-type anchored human PrP at 8- to 16-fold above normal. Thus, the lack of the GPI anchor on the PrPres from tg44 mice appeared to reduce the effect of the mouse-human PrP species barrier. In contrast, neither source of prions induced disease in tgRM transgenic mice, which expressed human PrP at 2- to 4-fold above normal. Prion protein (PrP) is found in all mammals, usually attached to cells by an anchor molecule called GPI. Following prion infection, PrP is converted into a disease-associated form (PrPres). While most prion diseases are species specific, this finding is not consistent, and species barriers differ in strength. The amino acid sequence of PrP varies among species, and this variability affects prion species barriers. However, other PrP modifications, including glycosylation and GPI anchoring, may also influence cross-species infectivity. We studied the effect of PrP GPI anchoring using a mouse-to-human species barrier model. Experiments showed that prions produced by

  20. Increasing Prion Propensity by Hydrophobic Insertion

    PubMed Central

    Petri, Michelina; Flores, Noe; Rogge, Ryan A.; Cascarina, Sean M.; Ross, Eric D.

    2014-01-01

    Prion formation involves the conversion of proteins from a soluble form into an infectious amyloid form. Most yeast prion proteins contain glutamine/asparagine-rich regions that are responsible for prion aggregation. Prion formation by these domains is driven primarily by amino acid composition, not primary sequence, yet there is a surprising disconnect between the amino acids thought to have the highest aggregation propensity and those that are actually found in yeast prion domains. Specifically, a recent mutagenic screen suggested that both aromatic and non-aromatic hydrophobic residues strongly promote prion formation. However, while aromatic residues are common in yeast prion domains, non-aromatic hydrophobic residues are strongly under-represented. Here, we directly test the effects of hydrophobic and aromatic residues on prion formation. Remarkably, we found that insertion of as few as two hydrophobic residues resulted in a multiple orders-of-magnitude increase in prion formation, and significant acceleration of in vitro amyloid formation. Thus, insertion or deletion of hydrophobic residues provides a simple tool to control the prion activity of a protein. These data, combined with bioinformatics analysis, suggest a limit on the number of strongly prion-promoting residues tolerated in glutamine/asparagine-rich domains. This limit may explain the under-representation of non-aromatic hydrophobic residues in yeast prion domains. Prion activity requires not only that a protein be able to form prion fibers, but also that these fibers be cleaved to generate new independently-segregating aggregates to offset dilution by cell division. Recent studies suggest that aromatic residues, but not non-aromatic hydrophobic residues, support the fiber cleavage step. Therefore, we propose that while both aromatic and non-aromatic hydrophobic residues promote prion formation, aromatic residues are favored in yeast prion domains because they serve a dual function, promoting both

  1. Inherited prion disease A117V is not simply a proteinopathy but produces prions transmissible to transgenic mice expressing homologous prion protein.

    PubMed

    Asante, Emmanuel A; Linehan, Jacqueline M; Smidak, Michelle; Tomlinson, Andrew; Grimshaw, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Powell, Caroline; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

    2013-01-01

    Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP) gene (PRNP) and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS) caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc)), pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((Ctm)PrP). Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc) was demonstrated in the brains of recipient transgenic mice. This PrP(Sc) rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (Ctm)PrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.

  2. Enhanced neuroinvasion by smaller, soluble prions.

    PubMed

    Bett, Cyrus; Lawrence, Jessica; Kurt, Timothy D; Orru, Christina; Aguilar-Calvo, Patricia; Kincaid, Anthony E; Surewicz, Witold K; Caughey, Byron; Wu, Chengbiao; Sigurdson, Christina J

    2017-04-21

    Infectious prion aggregates can propagate from extraneural sites into the brain with remarkable efficiency, likely transported via peripheral nerves. Yet not all prions spread into the brain, and the physical properties of a prion that is capable of transit within neurons remain unclear. We hypothesized that small, diffusible aggregates spread into the CNS via peripheral nerves. Here we used a structurally diverse panel of prion strains to analyze how the prion conformation impacts transit into the brain. Two prion strains form fibrils visible ultrastructurally in the brain in situ, whereas three strains form diffuse, subfibrillar prion deposits and no visible fibrils. The subfibrillar strains had significantly higher levels of soluble prion aggregates than the fibrillar strains. Primary neurons internalized both the subfibrillar and fibril-forming prion strains by macropinocytosis, and both strain types were transported from the axon terminal to the cell body in vitro. However in mice, only the predominantly soluble, subfibrillar prions, and not the fibrillar prions, were efficiently transported from the tongue to the brain. Sonicating a fibrillar prion strain increased the solubility and enabled prions to spread into the brain in mice, as evident by a 40% increase in the attack rate, indicating that an increase in smaller particles enhances prion neuroinvasion. Our data suggest that the small, highly soluble prion particles have a higher capacity for transport via nerves. These findings help explain how prions that predominantly assemble into subfibrillar states can more effectively traverse into and out of the CNS, and suggest that promoting fibril assembly may slow the neuron-to-neuron spread of protein aggregates.

  3. Generating Bona Fide Mammalian Prions with Internal Deletions.

    PubMed

    Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel

    2016-08-01

    Mammalian prions are PrP proteins with altered structures causing transmissible fatal neurodegenerative diseases. They are self-perpetuating through formation of beta-sheet-rich assemblies that seed conformational change of cellular PrP. Pathological PrP usually forms an insoluble protease-resistant core exhibiting beta-sheet structures but no more alpha-helical content, loosing the three alpha-helices contained in the correctly folded PrP. The lack of a high-resolution prion structure makes it difficult to understand the dynamics of conversion and to identify elements of the protein involved in this process. To determine whether completeness of residues within the protease-resistant domain is required for prions, we performed serial deletions in the helix H2 C terminus of ovine PrP, since this region has previously shown some tolerance to sequence changes without preventing prion replication. Deletions of either four or five residues essentially preserved the overall PrP structure and mutant PrP expressed in RK13 cells were efficiently converted into bona fide prions upon challenge by three different prion strains. Remarkably, deletions in PrP facilitated the replication of two strains that otherwise do not replicate in this cellular context. Prions with internal deletion were self-propagating and de novo infectious for naive homologous and wild-type PrP-expressing cells. Moreover, they caused transmissible spongiform encephalopathies in mice, with similar biochemical signatures and neuropathologies other than the original strains. Prion convertibility and transfer of strain-specific information are thus preserved despite shortening of an alpha-helix in PrP and removal of residues within prions. These findings provide new insights into sequence/structure/infectivity relationship for prions. Prions are misfolded PrP proteins that convert the normal protein into a replicate of their own abnormal form. They are responsible for invariably fatal neurodegenerative

  4. Effects of a naturally occurring amino acid substitution in bovine PrP: a model for inherited prion disease in a natural host species

    USDA-ARS?s Scientific Manuscript database

    The most common hereditary prion disease is human Creutzfeldt-Jakob disease (CJD) associated with a mutation in the prion gene (PRNP) resulting in a glutamic acid to lysine substitution at position 200 (E200K) in the prion protein. Models of E200K CJD in transgenic mice have proven interesting but h...

  5. Idiopathic Brainstem Neuronal Chromatolysis (IBNC): a novel prion protein related disorder of cattle?

    PubMed Central

    Jeffrey, Martin; Perez, Belinda Baquero; Martin, Stuart; Terry, Linda; González, Lorenzo

    2008-01-01

    Background The epidemic form of Bovine Spongiform Encephalopathy (BSE) is generally considered to have been caused by a single prion strain but at least two strain variants of cattle prion disorders have recently been recognized. An additional neurodegenerative condition, idiopathic brainstem neuronal chromatolysis and hippocampal sclerosis (IBNC), a rare neurological disease of adult cattle, was also recognised in a sub-set of cattle submitted under the BSE Orders in which lesions of BSE were absent. Between the years of 1988 and 1991 IBNC occurred in Scotland with an incidence of 7 cases per 100,000 beef suckler cows over the age of 6 years. Results When the brains of 15 IBNC cases were each tested by immunohistochemistry, all showed abnormal labelling for prion protein (PrP). Immunohistological labelling for PrP was also present in the retina of a single case available for examination. The pattern of PrP labelling in brain is distinct from that seen in other ruminant prion diseases and is absent from brains with other inflammatory conditions and from normal control brains. Brains of IBNC cattle do not reveal abnormal PrP isoforms when tested by the commercial BioRad or Idexx test kits and do not reveal PrPres when tested by Western blotting using stringent proteinase digestion methods. However, some weakly protease resistant isoforms of PrP may be detected when tissues are examined using mild proteinase digestion techniques. Conclusion The study shows that a distinctive neurological disorder of cattle, which has some clinical similarities to BSE, is associated with abnormal PrP labelling in brain but the pathology and biochemistry of IBNC are distinct from BSE. The study is important either because it raises the possibility of a significant increase in the scope of prion disease or because it demonstrates that widespread and consistent PrP alterations may not be confined to prion diseases. Further studies, including transmission experiments, are needed to

  6. Oral Transmission of L-Type Bovine Spongiform Encephalopathy Agent among Cattle.

    PubMed

    Okada, Hiroyuki; Iwamaru, Yoshifumi; Imamura, Morikazu; Miyazawa, Kohtaro; Matsuura, Yuichi; Masujin, Kentaro; Murayama, Yuichi; Yokoyama, Takashi

    2017-02-01

    To determine oral transmissibility of the L-type bovine spongiform encephalopathy (BSE) prion, we orally inoculated 16 calves with brain homogenates of the agent. Only 1 animal, given a high dose, showed signs and died at 88 months. These results suggest low risk for oral transmission of the L-BSE agent among cattle.

  7. The risk of transmitting prion disease by blood or plasma products.

    PubMed

    Knight, Richard

    2010-12-01

    Various experimental studies have shown infectivity in blood in relation to bovine spongiform encephalitis (BSE) and variant Creutzfeldt-Jakob disease (vCJD). Human to human transmission vCJD infection has been reported via transfusion of non-leukocyte-reduced red cells and, probably, via factor VIII concentrates. A number of precautionary measures are in place but uncertainties remain, especially concerning the number of BSE-infected people in the population. Additional measures such as prion filtration need consideration. Copyright © 2010 Elsevier Ltd. All rights reserved.

  8. Studies of the transmissibility of the agent of bovine spongiform encephalopathy to the domestic chicken

    PubMed Central

    2011-01-01

    Background Transmission of the prion disease bovine spongiform encephalopathy (BSE) occurred accidentally to cattle and several other mammalian species via feed supplemented with meat and bone meal contaminated with infected bovine tissue. Prior to United Kingdom controls in 1996 on the feeding of mammalian meat and bone meal to farmed animals, the domestic chicken was potentially exposed to feed contaminated with the causal agent of BSE. Although confirmed prion diseases are unrecorded in avian species a study was undertaken to transmit BSE to the domestic chicken by parenteral and oral inoculations. Transmissibility was assessed by clinical monitoring, histopathological examinations, detection of a putative disease form of an avian prion protein (PrP) in recipient tissues and by mouse bioassay of tissues. Occurrence of a progressive neurological syndrome in the primary transmission study was investigated by sub-passage experiments. Results No clinical, pathological or bioassay evidence of transmission of BSE to the chicken was obtained in the primary or sub-passage experiments. Survival data showed no significant differences between control and treatment groups. Neurological signs observed, not previously described in the domestic chicken, were not associated with significant pathology. The diagnostic techniques applied failed to detect a disease associated form of PrP. Conclusion Important from a risk assessment perspective, the present study has established that the domestic chicken does not develop a prion disease after large parenteral exposures to the BSE agent or after oral exposures equivalent to previous exposures via commercial diets. Future investigations into the potential susceptibility of avian species to mammalian prion diseases require species-specific immunochemical techniques and more refined experimental models. PMID:22093239

  9. Prevalence of the prion protein gene E211K variant in U.S. cattle

    PubMed Central

    Heaton, Michael P; Keele, John W; Harhay, Gregory P; Richt, Jürgen A; Koohmaraie, Mohammad; Wheeler, Tommy L; Shackelford, Steven D; Casas, Eduardo; King, D Andy; Sonstegard, Tad S; Van Tassell, Curtis P; Neibergs, Holly L; Chase, Chad C; Kalbfleisch, Theodore S; Smith, Timothy PL; Clawson, Michael L; Laegreid, William W

    2008-01-01

    Background In 2006, an atypical U.S. case of bovine spongiform encephalopathy (BSE) was discovered in Alabama and later reported to be polymorphic for glutamate (E) and lysine (K) codons at position 211 in the bovine prion protein gene (Prnp) coding sequence. A bovine E211K mutation is important because it is analogous to the most common pathogenic mutation in humans (E200K) which causes hereditary Creutzfeldt – Jakob disease, an autosomal dominant form of prion disease. The present report describes a high-throughput matrix-associated laser desorption/ionization-time-of-flight mass spectrometry assay for scoring the Prnp E211K variant and its use to determine an upper limit for the K211 allele frequency in U.S. cattle. Results The K211 allele was not detected in 6062 cattle, including those from five commercial beef processing plants (3892 carcasses) and 2170 registered cattle from 42 breeds. Multiple nearby polymorphisms in Prnp coding sequence of 1456 diverse purebred cattle (42 breeds) did not interfere with scoring E211 or K211 alleles. Based on these results, the upper bounds for prevalence of the E211K variant was estimated to be extremely low, less than 1 in 2000 cattle (Bayesian analysis based on 95% quantile of the posterior distribution with a uniform prior). Conclusion No groups or breeds of U.S. cattle are presently known to harbor the Prnp K211 allele. Because a carrier was not detected, the number of additional atypical BSE cases with K211 will also be vanishingly low. PMID:18625065

  10. Lichens: Unexpected anti-prion agents?

    USGS Publications Warehouse

    Rodriguez, Cynthia M.; Bennett, James P.; Johnson, Christopher J.

    2012-01-01

    The prion diseases sheep scrapie and cervid chronic wasting disease are transmitted, in part, via an environmental reservoir of infectivity; prions released from infected animals persist in the environment and can cause disease years later. Central to controlling disease transmission is the identification of methods capable of inactivating these agents on the landscape. We have found that certain lichens, common, ubiquitous, symbiotic organisms, possess a serine protease capable of degrading prion protein (PrP) from prion-infected animals. The protease functions against a range of prion strains from various hosts and reduces levels of abnormal PrP by at least two logs. We have now tested more than 20 lichen species from several geographical locations and from various taxa and found that approximately half of these species degrade PrP. Critical next steps include examining the effect of lichens on prion infectivity and cloning the protease responsible for PrP degradation. The impact of lichens on prions in the environment remains unknown. We speculate that lichens could have the potential to degrade prions when they are shed from infected animals onto lichens or into environments where lichens are abundant. In addition, lichens are frequently consumed by cervids and many other animals and the effect of dietary lichens on prion disease transmission should also be considered.

  11. Prion Infected Meat-and-Bone Meal Is Still Infectious after Biodiesel Production

    PubMed Central

    Bruederle, Cathrin E.; Hnasko, Robert M.; Kraemer, Thomas; Garcia, Rafael A.; Haas, Michael J.; Marmer, William N.; Carter, John Mark

    2008-01-01

    The epidemic of bovine spongiform encephalopathy (BSE) has led to a world-wide drop in the market for beef by-products, such as Meat-and-Bone Meal (MBM), a fat-containing but mainly proteinaceaous product traditionally used as an animal feed supplement. While normal rendering is insufficient, the production of biodiesel from MBM has been suggested to destroy infectivity from transmissible spongiform encephalopathies (TSEs). In addition to producing fuel, this method simultaneously generates a nutritious solid residue. In our study we produced biodiesel from MBM under defined conditions using a modified form of alkaline methanolysis. We evaluated the presence of prion in the three resulting phases of the biodiesel reaction (Biodiesel, Glycerol and Solid Residue) in vitro and in vivo. Analysis of the reaction products from 263K scrapie infected MBM led to no detectable immunoreactivity by Western Blot. Importantly, and in contrast to the biochemical results the solid MBM residue from the reaction retained infectivity when tested in an animal bioassay. Histochemical analysis of hamster brains inoculated with the solid residue showed typical spongiform degeneration and vacuolation. Re-inoculation of these brains into a new cohort of hamsters led to onset of clinical scrapie symptoms within 75 days, suggesting that the specific infectivity of the prion protein was not changed during the biodiesel process. The biodiesel reaction cannot be considered a viable prion decontamination method for MBM, although we observed increased survival time of hamsters and reduced infectivity greater than 6 log orders in the solid MBM residue. Furthermore, results from our study compare for the first time prion detection by Western Blot versus an infectivity bioassay for analysis of biodiesel reaction products. We could show that biochemical analysis alone is insufficient for detection of prion infectivity after a biodiesel process. PMID:18698417

  12. A closer look at prion strains

    PubMed Central

    Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto

    2013-01-01

    Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrPSc), a pathogenic isoform of the host-encoded cellular prion protein (PrPC). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrPSc conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrPSc biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves. PMID:23357828

  13. Yeast prions assembly and propagation

    PubMed Central

    2011-01-01

    Yeast prions are self-perpetuating protein aggregates that are at the origin of heritable and transmissible non-Mendelian phenotypic traits. Among these, [PSI+], [URE3] and [PIN+] are the most well documented prions and arise from the assembly of Sup35p, Ure2p and Rnq1p, respectively, into insoluble fibrillar assemblies. Fibril assembly depends on the presence of N- or C-terminal prion domains (PrDs) which are not homologous in sequence but share unusual amino-acid compositions, such as enrichment in polar residues (glutamines and asparagines) or the presence of oligopeptide repeats. Purified PrDs form amyloid fibrils that can convert prion-free cells to the prion state upon transformation. Nonetheless, isolated PrDs and full-length prion proteins have different aggregation, structural and infectious properties. In addition, mutations in the “non-prion” domains (non-PrDs) of Sup35p, Ure2p and Rnq1p were shown to affect their prion properties in vitro and in vivo. Despite these evidences, the implication of the functional non-PrDs in fibril assembly and prion propagation has been mostly overlooked. In this review, we discuss the contribution of non-PrDs to prion assemblies, and the structure-function relationship in prion infectivity in the light of recent findings on Sup35p and Ure2p assembly into infectious fibrils from our laboratory and others. PMID:22052349

  14. Clinically Unsuspected Prion Disease Among Patients With Dementia Diagnoses in an Alzheimer's Disease Database.

    PubMed

    Maddox, Ryan A; Blase, J L; Mercaldo, N D; Harvey, A R; Schonberger, L B; Kukull, W A; Belay, E D

    2015-12-01

    Brain tissue analysis is necessary to confirm prion diseases. Clinically unsuspected cases may be identified through neuropathologic testing. National Alzheimer's Coordinating Center (NACC) Minimum and Neuropathologic Data Set for 1984 to 2005 were reviewed. Eligible patients had dementia, underwent autopsy, had available neuropathologic data, belonged to a currently funded Alzheimer's Disease Center (ADC), and were coded as having an Alzheimer's disease clinical diagnosis or a nonprion disease etiology. For the eligible patients with neuropathology indicating prion disease, further clinical information, collected from the reporting ADC, determined whether prion disease was considered before autopsy. Of 6000 eligible patients in the NACC database, 7 (0.12%) were clinically unsuspected but autopsy-confirmed prion disease cases. The proportion of patients with dementia with clinically unrecognized but autopsy-confirmed prion disease was small. Besides confirming clinically suspected cases, neuropathology is useful to identify unsuspected clinically atypical cases of prion disease. © The Author(s) 2015.

  15. Physiological and environmental control of yeast prions

    PubMed Central

    Chernova, Tatiana A.; Wilkinson, Keith D.; Chernoff, Yury O.

    2014-01-01

    Prions are self-perpetuating protein isoforms that cause fatal and incurable neurodegenerative disease in mammals. Recent evidence indicates that a majority of human proteins involved in amyloid and neural inclusion disorders possess at least some prion properties. In lower eukaryotes, such as yeast, prions act as epigenetic elements, which increase phenotypic diversity by altering a range of cellular processes. While some yeast prions are clearly pathogenic, it is also postulated that prion formation could be beneficial in variable environmental conditions. Yeast and mammalian prions have similar molecular properties. Crucial cellular factors and conditions influencing prion formation and propagation were uncovered in the yeast models. Stress-related chaperones, protein quality control deposits, degradation pathways and cytoskeletal networks control prion formation and propagation in yeast. Environmental stresses trigger prion formation and loss, supposedly acting via influencing intracellular concentrations of the prion-inducing proteins, and/or by localizing prionogenic proteins to the prion induction sites via heterologous ancillary helpers. Physiological and environmental modulation of yeast prions points to new opportunities for pharmacological intervention and/or prophylactic measures targeting general cellular systems rather than the properties of individual amyloids and prions. PMID:24236638

  16. Identification of Major Signaling Pathways in Prion Disease Progression Using Network Analysis

    PubMed Central

    Newaz, Khalique; Sriram, K.; Bera, Debajyoti

    2015-01-01

    Prion diseases are transmissible neurodegenerative diseases that arise due to conformational change of normal, cellular prion protein (PrPC) to protease-resistant isofrom (rPrPSc). Deposition of misfolded PrpSc proteins leads to an alteration of many signaling pathways that includes immunological and apoptotic pathways. As a result, this culminates in the dysfunction and death of neuronal cells. Earlier works on transcriptomic studies have revealed some affected pathways, but it is not clear which is (are) the prime network pathway(s) that change during the disease progression and how these pathways are involved in crosstalks with each other from the time of incubation to clinical death. We perform network analysis on large-scale transcriptomic data of differentially expressed genes obtained from whole brain in six different mouse strain-prion strain combination models to determine the pathways involved in prion diseases, and to understand the role of crosstalks in disease propagation. We employ a notion of differential network centrality measures on protein interaction networks to identify the potential biological pathways involved. We also propose a crosstalk ranking method based on dynamic protein interaction networks to identify the core network elements involved in crosstalk with different pathways. We identify 148 DEGs (differentially expressed genes) potentially related to the prion disease progression. Functional association of the identified genes implicates a strong involvement of immunological pathways. We extract a bow-tie structure that is potentially dysregulated in prion disease. We also propose an ODE model for the bow-tie network. Predictions related to diseased condition suggests the downregulation of the core signaling elements (PI3Ks and AKTs) of the bow-tie network. In this work, we show using transcriptomic data that the neuronal dysfunction in prion disease is strongly related to the immunological pathways. We conclude that these

  17. The many shades of prion strain adaptation.

    PubMed

    Baskakov, Ilia V

    2014-01-01

    In several recent studies transmissible prion disease was induced in animals by inoculation with recombinant prion protein amyloid fibrils produced in vitro. Serial transmission of amyloid fibrils gave rise to a new class of prion strains of synthetic origin. Gradual transformation of disease phenotypes and PrP(Sc) properties was observed during serial transmission of synthetic prions, a process that resembled the phenomenon of prion strain adaptation. The current article discusses the remarkable parallels between phenomena of prion strain adaptation that accompanies cross-species transmission and the evolution of synthetic prions occurring within the same host. Two alternative mechanisms underlying prion strain adaptation and synthetic strain evolution are discussed. The current article highlights the complexity of the prion transmission barrier and strain adaptation and proposes that the phenomenon of prion adaptation is more common than previously thought.

  18. BSE Case Associated with Prion Protein Gene Mutation

    PubMed Central

    Richt, Jürgen A.; Hall, S. Mark

    2008-01-01

    Bovine spongiform encephalopathy (BSE) is a transmissible spongiform encephalopathy (TSE) of cattle and was first detected in 1986 in the United Kingdom. It is the most likely cause of variant Creutzfeldt-Jakob disease (CJD) in humans. The origin of BSE remains an enigma. Here we report an H-type BSE case associated with the novel mutation E211K within the prion protein gene (Prnp). Sequence analysis revealed that the animal with H-type BSE was heterozygous at Prnp nucleotides 631 through 633. An identical pathogenic mutation at the homologous codon position (E200K) in the human Prnp has been described as the most common cause of genetic CJD. This finding represents the first report of a confirmed case of BSE with a potential pathogenic mutation within the bovine Prnp gene. A recent epidemiological study revealed that the K211 allele was not detected in 6062 cattle from commercial beef processing plants and 42 cattle breeds, indicating an extremely low prevalence of the E211K variant (less than 1 in 2000) in cattle. PMID:18787697

  19. Risk of transmission of bovine spongiform encephalopathy to humans in the United States: report of the Council on Scientific Affairs. American Medical Association.

    PubMed

    Tan, L; Williams, M A; Khan, M K; Champion, H C; Nielsen, N H

    The risk of possible transmission of bovine spongiform encephalopathy (BSE) in the United States is a substantial public health concern. To systematically review the current scientific literature and discuss legislation and regulations that have been implemented to prevent the disease. Literature review using the MEDLINE, EMBASE, and Lexis/Nexis databases for 1975 through 1997 on the terms bovine spongiform encephalopathy, prion diseases, prions, and Creutzfeldt-Jakob syndrome. The Internet was used to identify regulatory actions and health surveillance. MEDLINE, EMBASE, and Lexis/Nexis databases were searched from 1975 through 1997 for English-language articles that provided information on assessment of transmission risk. Unique circumstances in the United Kingdom caused the emergence and propagation of BSE in cattle, including widespread use of meat and bonemeal cattle feed derived from scrapie-infected sheep and the adoption of a new type of processing that did not reduce the amount of infectious prions prior to feeding. Many of these circumstances do not exist in the United States. In the United Kingdom, new variant Creutzfeldt-Jakob disease probably resulted from the ingestion of BSE-contaminated processed beef. The United Kingdom and the European Union now have strong regulations in place to stop the spread of BSE. While BSE has not been observed in the United States, the US government has surveillance and response plans in effect. Current risk of transmission of BSE in the United States is minimal because (1) BSE has not been shown to exist in this country; (2) adequate regulations exist to prevent entry of foreign sources of BSE into the United States; (3) adequate regulations exist to prevent undetected cases of BSE from uncontrolled amplification within the US cattle population; and (4) adequate preventive guidelines exist to prevent high-risk bovine materials from contaminating products intended for human consumption.

  20. Analysis of the [RNQ+] Prion Reveals Stability of Amyloid Fibers as the Key Determinant of Yeast Prion Variant Propagation*

    PubMed Central

    Kalastavadi, Tejas; True, Heather L.

    2010-01-01

    Variation in pathology of human prion disease is believed to be caused, in part, by distinct conformations of aggregated protein resulting in different prion strains. Several prions also exist in yeast and maintain different self-propagating structures, referred to as prion variants. Investigation of the yeast prion [PSI+] has been instrumental in deciphering properties of prion variants and modeling the physical basis of their formation. Here, we describe the generation of specific variants of the [RNQ+] prion in yeast transformed with fibers formed in vitro in different conditions. The fibers of the Rnq1p prion-forming domain (PFD) that induce different variants in vivo have distinct biochemical properties. The physical basis of propagation of prion variants has been previously correlated to rates of aggregation and disaggregation. With [RNQ+] prion variants, we found that the prion variant does not correlate with the rate of aggregation as anticipated but does correlate with stability. Interestingly, we found that there are differences in the ability of the [RNQ+] prion variants to faithfully propagate themselves and to template the aggregation of other proteins. Incorporating the mechanism of variant formation elucidated in this study with that previously proposed for [PSI+] variants has provided a framework to separate general characteristics of prion variant properties from those specific to individual prion proteins. PMID:20442412

  1. Disrupting the cortical actin cytoskeleton points to two distinct mechanisms of yeast [PSI+] prion formation

    PubMed Central

    Speldewinde, Shaun H.; Tuite, Mick F.

    2017-01-01

    Mammalian and fungal prions arise de novo; however, the mechanism is poorly understood in molecular terms. One strong possibility is that oxidative damage to the non-prion form of a protein may be an important trigger influencing the formation of its heritable prion conformation. We have examined the oxidative stress-induced formation of the yeast [PSI+] prion, which is the altered conformation of the Sup35 translation termination factor. We used tandem affinity purification (TAP) and mass spectrometry to identify the proteins which associate with Sup35 in a tsa1 tsa2 antioxidant mutant to address the mechanism by which Sup35 forms the [PSI+] prion during oxidative stress conditions. This analysis identified several components of the cortical actin cytoskeleton including the Abp1 actin nucleation promoting factor, and we show that deletion of the ABP1 gene abrogates oxidant-induced [PSI+] prion formation. The frequency of spontaneous [PSI+] prion formation can be increased by overexpression of Sup35 since the excess Sup35 increases the probability of forming prion seeds. In contrast to oxidant-induced [PSI+] prion formation, overexpression-induced [PSI+] prion formation was only modestly affected in an abp1 mutant. Furthermore, treating yeast cells with latrunculin A to disrupt the formation of actin cables and patches abrogated oxidant-induced, but not overexpression-induced [PSI+] prion formation, suggesting a mechanistic difference in prion formation. [PIN+], the prion form of Rnq1, localizes to the IPOD (insoluble protein deposit) and is thought to influence the aggregation of other proteins. We show Sup35 becomes oxidized and aggregates during oxidative stress conditions, but does not co-localize with Rnq1 in an abp1 mutant which may account for the reduced frequency of [PSI+] prion formation. PMID:28369054

  2. Generic amyloidogenicity of mammalian prion proteins from species susceptible and resistant to prions.

    PubMed

    Nyström, Sofie; Hammarström, Per

    2015-05-11

    Prion diseases are lethal, infectious diseases associated with prion protein (PrP) misfolding. A large number of mammals are susceptible to both sporadic and acquired prion diseases. Although PrP is highly conserved and ubiquitously expressed in all mammals, not all species exhibit prion disease. By employing full length recombinant PrP from five known prion susceptible species (human, cattle, cat, mouse and hamster) and two species considered to be prion resistant (pig and dog) the amyloidogenicity of these PrPs has been delineated. All the mammalian PrPs, even from resistant species, were swiftly converted from the native state to amyloid-like structure when subjected to a native condition conversion assay. The PrPs displayed amyloidotypic tinctorial and ultrastructural hallmarks. Self-seeded conversion of the PrPs displayed significantly decreased lag phases demonstrating that nucleation dependent polymerization is a dominating mechanism in the fibrillation process. Fibrils from Aβ1-40, Aβ1-42, Lysozyme, Insulin and Transthyretin did not accelerate conversion of HuPrP whereas fibrils from HuPrP90-231 and HuPrP121-231 as well as full length PrPs of all PrPs efficiently seeded conversion showing specificity of the assay requiring the C-terminal PrP sequence. Our findings have implications for PrP misfolding and could have ramifications in the context of prion resistant species and silent carriers.

  3. Ultraviolet-ozone treatment reduces levels of disease-associated prion protein and prion infectivity

    USGS Publications Warehouse

    Johnson, C.J.; Gilbert, P.; McKenzie, D.; Pedersen, J.A.; Aiken, Judd M.

    2009-01-01

    Background. Transmissible spongiform encephalopathies (TSEs) are a group of fatal neurodegenerative diseases caused by novel infectious agents referred to as prions. Prions appear to be composed primarily, if not exclusively, of a misfolded isoform of the cellular prion protein. TSE infectivity is remarkably stable and can resist many aggressive decontamination procedures, increasing human, livestock and wildlife exposure to TSEs. Findings. We tested the hypothesis that UV-ozone treatment reduces levels of the pathogenic prion protein and inactivates the infectious agent. We found that UV-ozone treatment decreased the carbon and prion protein content in infected brain homogenate to levels undetectable by dry-ashing carbon analysis or immunoblotting, respectively. After 8 weeks of ashing, UV-ozone treatment reduced the infectious titer of treated material by a factor of at least 105. A small amount of infectivity, however, persisted despite UV-ozone treatment. When bound to either montmorillonite clay or quartz surfaces, PrPTSE was still susceptible to degradation by UV-ozone. Conclusion. Our findings strongly suggest that UV-ozone treatment can degrade pathogenic prion protein and inactivate prions, even when the agent is associated with surfaces. Using larger UV-ozone doses or combining UV-ozone treatment with other decontaminant methods may allow the sterilization of TSE-contaminated materials. ?? 2009 Aiken et al; licensee BioMed Central Ltd.

  4. Unraveling the key to the resistance of canids to prion diseases

    PubMed Central

    Fernández-Borges, Natalia; Sánchez-Martín, Manuel A.; Pumarola, Martí

    2017-01-01

    One of the characteristics of prions is their ability to infect some species but not others and prion resistant species have been of special interest because of their potential in deciphering the determinants for susceptibility. Previously, we developed different in vitro and in vivo models to assess the susceptibility of species that were erroneously considered resistant to prion infection, such as members of the Leporidae and Equidae families. Here we undertake in vitro and in vivo approaches to understand the unresolved low prion susceptibility of canids. Studies based on the amino acid sequence of the canine prion protein (PrP), together with a structural analysis in silico, identified unique key amino acids whose characteristics could orchestrate its high resistance to prion disease. Cell- and brain-based PMCA studies were performed highlighting the relevance of the D163 amino acid in proneness to protein misfolding. This was also investigated by the generation of a novel transgenic mouse model carrying this substitution and these mice showed complete resistance to disease despite intracerebral challenge with three different mouse prion strains (RML, 22L and 301C) known to cause disease in wild-type mice. These findings suggest that dog D163 amino acid is primarily, if not totally, responsible for the prion resistance of canids. PMID:29131852

  5. Molecular Basis for Transmission Barrier and Interference between Closely Related Prion Proteins in Yeast*

    PubMed Central

    Afanasieva, Evgenia G.; Kushnirov, Vitaly V.; Tuite, Mick F.; Ter-Avanesyan, Michael D.

    2011-01-01

    Replicating amyloids, called prions, are responsible for transmissible neurodegenerative diseases in mammals and some heritable phenotypes in fungi. The transmission of prions between species is usually inhibited, being highly sensitive to small differences in amino acid sequence of the prion-forming proteins. To understand the molecular basis of this prion interspecies barrier, we studied the transmission of the [PSI+] prion state from Sup35 of Saccharomyces cerevisiae to hybrid Sup35 proteins with prion-forming domains from four other closely related Saccharomyces species. Whereas all the hybrid Sup35 proteins could adopt a prion form in S. cerevisiae, they could not readily acquire the prion form from the [PSI+] prion of S. cerevisiae. Expression of the hybrid Sup35 proteins in S. cerevisiae [PSI+] cells often resulted in frequent loss of the native [PSI+] prion. Furthermore, all hybrid Sup35 proteins showed different patterns of interaction with the native [PSI+] prion in terms of co-polymerization, acquisition of the prion state, and induced prion loss, all of which were also dependent on the [PSI+] variant. The observed loss of S. cerevisiae [PSI+] can be related to inhibition of prion polymerization of S. cerevisiae Sup35 and formation of a non-heritable form of amyloid. We have therefore identified two distinct molecular origins of prion transmission barriers between closely sequence-related prion proteins: first, the inability of heterologous proteins to co-aggregate with host prion polymers, and second, acquisition by these proteins of a non-heritable amyloid fold. PMID:21454674

  6. Central nervous system gene expression changes in a transgenic mouse model for bovine spongiform encephalopathy

    PubMed Central

    2011-01-01

    Gene expression analysis has proven to be a very useful tool to gain knowledge of the factors involved in the pathogenesis of diseases, particularly in the initial or preclinical stages. With the aim of finding new data on the events occurring in the Central Nervous System in animals affected with Bovine Spongiform Encephalopathy, a comprehensive genome wide gene expression study was conducted at different time points of the disease on mice genetically modified to model the bovine species brain in terms of cellular prion protein. An accurate analysis of the information generated by microarray technique was the key point to assess the biological relevance of the data obtained in terms of Transmissible Spongiform Encephalopathy pathogenesis. Validation of the microarray technique was achieved by RT-PCR confirming the RNA change and immunohistochemistry techniques that verified that expression changes were translated into variable levels of protein for selected genes. Our study reveals changes in the expression of genes, some of them not previously associated with prion diseases, at early stages of the disease previous to the detection of the pathological prion protein, that might have a role in neuronal degeneration and several transcriptional changes showing an important imbalance in the Central Nervous System homeostasis in advanced stages of the disease. Genes whose expression is altered at early stages of the disease should be considered as possible therapeutic targets and potential disease markers in preclinical diagnostic tool development. Genes non-previously related to prion diseases should be taken into consideration for further investigations. PMID:22035425

  7. Prion replication without host adaptation during interspecies transmissions.

    PubMed

    Bian, Jifeng; Khaychuk, Vadim; Angers, Rachel C; Fernández-Borges, Natalia; Vidal, Enric; Meyerett-Reid, Crystal; Kim, Sehun; Calvi, Carla L; Bartz, Jason C; Hoover, Edward A; Agrimi, Umberto; Richt, Jürgen A; Castilla, Joaquín; Telling, Glenn C

    2017-01-31

    Adaptation of prions to new species is thought to reflect the capacity of the host-encoded cellular form of the prion protein (PrP C ) to selectively propagate optimized prion conformations from larger ensembles generated in the species of origin. Here we describe an alternate replicative process, termed nonadaptive prion amplification (NAPA), in which dominant conformers bypass this requirement during particular interspecies transmissions. To model susceptibility of horses to prions, we produced transgenic (Tg) mice expressing cognate PrP C Although disease transmission to only a subset of infected TgEq indicated a significant barrier to EqPrP C conversion, the resulting horse prions unexpectedly failed to cause disease upon further passage to TgEq. TgD expressing deer PrP C was similarly refractory to deer prions from diseased TgD infected with mink prions. In both cases, the resulting prions transmitted to mice expressing PrP C from the species of prion origin, demonstrating that transmission barrier eradication of the originating prions was ephemeral and adaptation superficial in TgEq and TgD. Horse prions produced in vitro by protein misfolding cyclic amplification of mouse prions using horse PrP C also failed to infect TgEq but retained tropism for wild-type mice. Concordant patterns of neuropathology and prion deposition in susceptible mice infected with NAPA prions and the corresponding prion of origin confirmed preservation of strain properties. The comparable responses of both prion types to guanidine hydrochloride denaturation indicated this occurs because NAPA precludes selection of novel prion conformations. Our findings provide insights into mechanisms regulating interspecies prion transmission and a framework to reconcile puzzling epidemiological features of certain prion disorders.

  8. Prion replication without host adaptation during interspecies transmissions

    PubMed Central

    Bian, Jifeng; Khaychuk, Vadim; Angers, Rachel C.; Fernández-Borges, Natalia; Meyerett-Reid, Crystal; Kim, Sehun; Calvi, Carla L.; Bartz, Jason C.; Hoover, Edward A.; Agrimi, Umberto; Richt, Jürgen A.; Castilla, Joaquín; Telling, Glenn C.

    2017-01-01

    Adaptation of prions to new species is thought to reflect the capacity of the host-encoded cellular form of the prion protein (PrPC) to selectively propagate optimized prion conformations from larger ensembles generated in the species of origin. Here we describe an alternate replicative process, termed nonadaptive prion amplification (NAPA), in which dominant conformers bypass this requirement during particular interspecies transmissions. To model susceptibility of horses to prions, we produced transgenic (Tg) mice expressing cognate PrPC. Although disease transmission to only a subset of infected TgEq indicated a significant barrier to EqPrPC conversion, the resulting horse prions unexpectedly failed to cause disease upon further passage to TgEq. TgD expressing deer PrPC was similarly refractory to deer prions from diseased TgD infected with mink prions. In both cases, the resulting prions transmitted to mice expressing PrPC from the species of prion origin, demonstrating that transmission barrier eradication of the originating prions was ephemeral and adaptation superficial in TgEq and TgD. Horse prions produced in vitro by protein misfolding cyclic amplification of mouse prions using horse PrPC also failed to infect TgEq but retained tropism for wild-type mice. Concordant patterns of neuropathology and prion deposition in susceptible mice infected with NAPA prions and the corresponding prion of origin confirmed preservation of strain properties. The comparable responses of both prion types to guanidine hydrochloride denaturation indicated this occurs because NAPA precludes selection of novel prion conformations. Our findings provide insights into mechanisms regulating interspecies prion transmission and a framework to reconcile puzzling epidemiological features of certain prion disorders. PMID:28096357

  9. Distinct Amino Acid Compositional Requirements for Formation and Maintenance of the [PSI+] Prion in Yeast

    PubMed Central

    MacLea, Kyle S.; Paul, Kacy R.; Ben-Musa, Zobaida; Waechter, Aubrey; Shattuck, Jenifer E.; Gruca, Margaret

    2014-01-01

    Multiple yeast prions have been identified that result from the structural conversion of proteins into a self-propagating amyloid form. Amyloid-based prion activity in yeast requires a series of discrete steps. First, the prion protein must form an amyloid nucleus that can recruit and structurally convert additional soluble proteins. Subsequently, maintenance of the prion during cell division requires fragmentation of these aggregates to create new heritable propagons. For the Saccharomyces cerevisiae prion protein Sup35, these different activities are encoded by different regions of the Sup35 prion domain. An N-terminal glutamine/asparagine-rich nucleation domain is required for nucleation and fiber growth, while an adjacent oligopeptide repeat domain is largely dispensable for prion nucleation and fiber growth but is required for chaperone-dependent prion maintenance. Although prion activity of glutamine/asparagine-rich proteins is predominantly determined by amino acid composition, the nucleation and oligopeptide repeat domains of Sup35 have distinct compositional requirements. Here, we quantitatively define these compositional requirements in vivo. We show that aromatic residues strongly promote both prion formation and chaperone-dependent prion maintenance. In contrast, nonaromatic hydrophobic residues strongly promote prion formation but inhibit prion propagation. These results provide insight into why some aggregation-prone proteins are unable to propagate as prions. PMID:25547291

  10. Prions are affected by evolution at two levels.

    PubMed

    Wickner, Reed B; Kelly, Amy C

    2016-03-01

    Prions, infectious proteins, can transmit diseases or be the basis of heritable traits (or both), mostly based on amyloid forms of the prion protein. A single protein sequence can be the basis for many prion strains/variants, with different biological properties based on different amyloid conformations, each rather stably propagating. Prions are unique in that evolution and selection work at both the level of the chromosomal gene encoding the protein, and on the prion itself selecting prion variants. Here, we summarize what is known about the evolution of prion proteins, both the genes and the prions themselves. We contrast the one known functional prion, [Het-s] of Podospora anserina, with the known disease prions, the yeast prions [PSI+] and [URE3] and the transmissible spongiform encephalopathies of mammals.

  11. Protease resistance of infectious prions is suppressed by removal of a single atom in the cellular prion protein.

    PubMed

    Leske, Henning; Hornemann, Simone; Herrmann, Uli Simon; Zhu, Caihong; Dametto, Paolo; Li, Bei; Laferriere, Florent; Polymenidou, Magdalini; Pelczar, Pawel; Reimann, Regina Rose; Schwarz, Petra; Rushing, Elisabeth Jane; Wüthrich, Kurt; Aguzzi, Adriano

    2017-01-01

    Resistance to proteolytic digestion has long been considered a defining trait of prions in tissues of organisms suffering from transmissible spongiform encephalopathies. Detection of proteinase K-resistant prion protein (PrPSc) still represents the diagnostic gold standard for prion diseases in humans, sheep and cattle. However, it has become increasingly apparent that the accumulation of PrPSc does not always accompany prion infections: high titers of prion infectivity can be reached also in the absence of protease resistant PrPSc. Here, we describe a structural basis for the phenomenon of protease-sensitive prion infectivity. We studied the effect on proteinase K (PK) resistance of the amino acid substitution Y169F, which removes a single oxygen atom from the β2-α2 loop of the cellular prion protein (PrPC). When infected with RML or the 263K strain of prions, transgenic mice lacking wild-type (wt) PrPC but expressing MoPrP169F generated prion infectivity at levels comparable to wt mice. The newly generated MoPrP169F prions were biologically indistinguishable from those recovered from prion-infected wt mice, and elicited similar pathologies in vivo. Surprisingly, MoPrP169F prions showed greatly reduced PK resistance and density gradient analyses showed a significant reduction in high-density aggregates. Passage of MoPrP169F prions into mice expressing wt MoPrP led to full recovery of protease resistance, indicating that no strain shift had taken place. We conclude that a subtle structural variation in the β2-α2 loop of PrPC affects the sensitivity of PrPSc to protease but does not impact prion replication and infectivity. With these findings a specific structural feature of PrPC can be linked to a physicochemical property of the corresponding PrPSc.

  12. Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure.

    PubMed

    Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald

    2015-01-01

    Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.

  13. Prion pathogenesis and secondary lymphoid organs (SLO): tracking the SLO spread of prions to the brain.

    PubMed

    Mabbott, Neil A

    2012-01-01

    Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrP (Sc), an abnormally folded isoform of the cellular prion protein (PrP (C)), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases.

  14. Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wan, William; Stöhr, Jan; Kendall, Amy

    2015-09-01

    Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled themore » complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.« less

  15. The tip of the iceberg: RNA-binding proteins with prion-like domains in neurodegenerative disease

    PubMed Central

    King, Oliver D.; Gitler, Aaron D.; Shorter, James

    2012-01-01

    Prions are self-templating protein conformers that are naturally transmitted between individuals and promote phenotypic change. In yeast, prion-encoded phenotypes can be beneficial, neutral or deleterious depending upon genetic background and environmental conditions. A distinctive and portable ‘prion domain’ enriched in asparagine, glutamine, tyrosine and glycine residues unifies the majority of yeast prion proteins. Deletion of this domain precludes prionogenesis and appending this domain to reporter proteins can confer prionogenicity. An algorithm designed to detect prion domains has successfully identified 19 domains that can confer prion behavior. Scouring the human genome with this algorithm enriches a select group of RNA-binding proteins harboring a canonical RNA recognition motif (RRM) and a putative prion domain. Indeed, of 210 human RRM-bearing proteins, 29 have a putative prion domain, and 12 of these are in the top 60 prion candidates in the entire genome. Startlingly, these RNA-binding prion candidates are inexorably emerging, one by one, in the pathology and genetics of devastating neurodegenerative disorders, including: amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U), Alzheimer’s disease and Huntington’s disease. For example, FUS and TDP-43, which rank 1st and 10th among RRM-bearing prion candidates, form cytoplasmic inclusions in the degenerating motor neurons of ALS patients and mutations in TDP-43 and FUS cause familial ALS. Recently, perturbed RNA-binding proteostasis of TAF15, which is the 2nd ranked RRM-bearing prion candidate, has been connected with ALS and FTLD-U. We strongly suspect that we have now merely reached the tip of the iceberg. We predict that additional RNA-binding prion candidates identified by our algorithm will soon surface as genetic modifiers or causes of diverse neurodegenerative conditions. Indeed, simple prion-like transfer mechanisms involving the

  16. Rebels with a cause: molecular features and physiological consequences of yeast prions.

    PubMed

    Garcia, David M; Jarosz, Daniel F

    2014-02-01

    Prions are proteins that convert between structurally and functionally distinct states, at least one of which is self-perpetuating. The prion fold templates the conversion of native protein, altering its structure and function, and thus serves as a protein-based element of inheritance. Molecular chaperones ensure that these prion aggregates are divided and faithfully passed from mother cells to their daughters. Prions were originally identified as the cause of several rare neurodegenerative diseases in mammals, but the last decade has brought great progress in understanding their broad importance in biology and evolution. Most prion proteins regulate information flow in signaling networks, or otherwise affect gene expression. Consequently, switching into and out of prion states creates diverse new traits – heritable changes based on protein structure rather than nucleic acid. Despite intense study of the molecular mechanisms of this paradigm-shifting, epigenetic mode of inheritance, many key questions remain. Recent studies in yeast that support the view that prions are common, often beneficial elements of inheritance that link environmental stress to the appearance of new traits.

  17. Disinfectants and Prions

    USDA-ARS?s Scientific Manuscript database

    Prions are novel pathogens that are believed to be composed solely of protein. They are capable of converting a normal cellular protein into the infectious isoform and thereby propagating an infection. Prion infections are characterized by a long asymptomatic incubation period followed by a relative...

  18. Controlling the prion propensity of glutamine/asparagine-rich proteins.

    PubMed

    Paul, Kacy R; Ross, Eric D

    2015-01-01

    The yeast Saccharomyces cerevisiae can harbor a number of distinct prions. Most of the yeast prion proteins contain a glutamine/asparagine (Q/N) rich region that drives prion formation. Prion-like domains, defined as regions with high compositional similarity to yeast prion domains, are common in eukaryotic proteomes, and mutations in various human proteins containing prion-like domains have been linked to degenerative diseases, including amyotrophic lateral sclerosis. Here, we discuss a recent study in which we utilized two strategies to generate prion activity in non-prion Q/N-rich domains. First, we made targeted mutations in four non-prion Q/N-rich domains, replacing predicted prion-inhibiting amino acids with prion-promoting amino acids. All four mutants formed foci when expressed in yeast, and two acquired bona fide prion activity. Prion activity could be generated with as few as two mutations, suggesting that many non-prion Q/N-rich proteins may be just a small number of mutations from acquiring aggregation or prion activity. Second, we created tandem repeats of short prion-prone segments, and observed length-dependent prion activity. These studies demonstrate the considerable progress that has been made in understanding the sequence basis for aggregation of prion and prion-like domains, and suggest possible mechanisms by which new prion domains could evolve.

  19. Biosafety of Prions.

    PubMed

    Bistaffa, Edoardo; Rossi, Martina; De Luca, Chiara M G; Moda, Fabio

    2017-01-01

    Prions are the infectious agents that cause devastating and untreatable disorders known as Transmissible Spongiform Encephalopathies (TSEs). The pathologic events and the infectious nature of these transmissible agents are not completely understood yet. Due to the difficulties in inactivating prions, working with them requires specific recommendations and precautions. Moreover, with the advent of innovative technologies, such as the Protein Misfolding Cyclic Amplification (PMCA) and the Real Time Quaking-Induced Conversion (RT-QuIC), prions could be amplified in vitro and the infectious features of the amplified products need to be carefully assessed. © 2017 Elsevier Inc. All rights reserved.

  20. Controlling the prion propensity of glutamine/asparagine-rich proteins

    PubMed Central

    Paul, Kacy R; Ross, Eric D

    2015-01-01

    ABSTRACT The yeast Saccharomyces cerevisiae can harbor a number of distinct prions. Most of the yeast prion proteins contain a glutamine/asparagine (Q/N) rich region that drives prion formation. Prion-like domains, defined as regions with high compositional similarity to yeast prion domains, are common in eukaryotic proteomes, and mutations in various human proteins containing prion-like domains have been linked to degenerative diseases, including amyotrophic lateral sclerosis. Here, we discuss a recent study in which we utilized two strategies to generate prion activity in non-prion Q/N-rich domains. First, we made targeted mutations in four non-prion Q/N-rich domains, replacing predicted prion-inhibiting amino acids with prion-promoting amino acids. All four mutants formed foci when expressed in yeast, and two acquired bona fide prion activity. Prion activity could be generated with as few as two mutations, suggesting that many non-prion Q/N-rich proteins may be just a small number of mutations from acquiring aggregation or prion activity. Second, we created tandem repeats of short prion-prone segments, and observed length-dependent prion activity. These studies demonstrate the considerable progress that has been made in understanding the sequence basis for aggregation of prion and prion-like domains, and suggest possible mechanisms by which new prion domains could evolve. PMID:26555096

  1. Propagation of prion strains through specific conformers of the prion protein.

    PubMed Central

    Scott, M R; Groth, D; Tatzelt, J; Torchia, M; Tremblay, P; DeArmond, S J; Prusiner, S B

    1997-01-01

    Two prion strains with identical incubation periods in mice exhibited distinct incubation periods and different neuropathological profiles upon serial transmission to transgenic mice expressing chimeric Syrian hamster/mouse (MH2M) prion protein (PrP) genes [Tg(MH2M) mice] and subsequent transmission to Syrian hamsters. After transmission to Syrian hamsters, the Me7 strain was indistinguishable from the previously established Syrian hamster strain Sc237, despite having been derived from an independent ancestral source. This apparent convergence suggests that prion diversity may be limited. The Me7 mouse strain could also be transmitted directly to Syrian hamsters, but when derived in this way, its properties were distinct from those of Me7 passaged through Tg(MH2M) mice. The Me7 strain did not appear permanently altered in either case, since the original incubation period could be restored by effectively reversing the series of passages. Prion diversity enciphered in the conformation of the scrapie isoform of PrP (PrP(Sc)) (G. C. Telling et al., Science 274:2079-2082, 1996) seems to be limited by the sequence of the PrP substrates serially converted into PrP(Sc), while prions are propagated through interactions between the cellular and scrapie isoforms of PrP. PMID:9371560

  2. Role of Prion Replication in the Strain-dependent Brain Regional Distribution of Prions*

    PubMed Central

    Hu, Ping Ping; Morales, Rodrigo; Duran-Aniotz, Claudia; Moreno-Gonzalez, Ines; Khan, Uffaf; Soto, Claudio

    2016-01-01

    One intriguing feature of prion diseases is their strain variation. Prion strains are differentiated by the clinical consequences they generate in the host, their biochemical properties, and their potential to infect other animal species. The selective targeting of these agents to specific brain structures have been extensively used to characterize prion strains. However, the molecular basis dictating strain-specific neurotropism are still elusive. In this study, isolated brain structures from animals infected with four hamster prion strains (HY, DY, 139H, and SSLOW) were analyzed for their content of protease-resistant PrPSc. Our data show that these strains have different profiles of PrP deposition along the brain. These patterns of accumulation, which were independent of regional PrPC production, were not reproduced by in vitro replication when different brain regions were used as substrate for the misfolding-amplification reaction. On the contrary, our results show that in vitro replication efficiency depended exclusively on the amount of PrPC present in each part of the brain. Our results suggest that the variable regional distribution of PrPSc in distinct strains is not determined by differences on prion formation, but on other factors or cellular pathways. Our findings may contribute to understand the molecular mechanisms of prion pathogenesis and strain diversity. PMID:27056328

  3. Live-cell FRET imaging reveals clustering of the prion protein at the cell surface induced by infectious prions.

    PubMed

    Tavares, Evandro; Macedo, Joana A; Paulo, Pedro M R; Tavares, Catarina; Lopes, Carlos; Melo, Eduardo P

    2014-07-01

    Prion diseases are associated to the conversion of the prion protein into a misfolded pathological isoform. The mechanism of propagation of protein misfolding by protein templating remains largely unknown. Neuroblastoma cells were transfected with constructs of the prion protein fused to both CFP-GPI-anchored and to YFP-GPI-anchored and directed to its cell membrane location. Live-cell FRET imaging between the prion protein fused to CFP or YFP was measured giving consistent values of 10±2%. This result was confirmed by fluorescence lifetime imaging microscopy and indicates intermolecular interactions between neighbor prion proteins. In particular, considering that a maximum FRET efficiency of 17±2% was determined from a positive control consisting of a fusion CFP-YFP-GPI-anchored. A stable cell clone expressing the two fusions containing the prion protein was also selected to minimize cell-to-cell variability. In both, stable and transiently transfected cells, the FRET efficiency consistently increased in the presence of infectious prions - from 4±1% to 7±1% in the stable clone and from 10±2% to 16±1% in transiently transfected cells. These results clearly reflect an increased clustering of the prion protein on the membrane in the presence of infectious prions, which was not observed in negative control using constructs without the prion protein and upon addition of non-infected brain. Our data corroborates the recent view that the primary site for prion conversion is the cell membrane. Since our fluorescent cell clone is not susceptible to propagate infectivity, we hypothesize that the initial event of prion infectivity might be the clustering of the GPI-anchored prion protein. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Neuropathological findings in cattle with clinically suspect but histologically unconfirmed bovine spongiform encephalopathy (BSE).

    PubMed

    McGill, I S; Wells, G A

    1993-04-01

    Neuropathological observations were made in 200 clinically suspected cases of bovine spongiform encephalopathy (BSE) in which pathognomonic vacuolar changes were absent. Routine histological and immunocytochemical techniques were applied to formalin-fixed, paraffin-embedded sections of the central nervous system. Significant neuropathological findings were detected in 85 (42.5 per cent) cases. The most frequent lesion, detected in 46 (23 per cent) cases, was a focal white matter vacuolation principally affecting the substantia nigra, but its clinical significance was unclear. Listeriosis was diagnosed in 17 (8.5 per cent) cases. In three of seven cases of non-suppurative encephalitis, lesions suggested sporadic bovine encephalomyelitis, a disease not previously reported in the UK. Suppurative thromboembolic or granulomatous lesions accounted for other inflammatory changes. Neuroectodermal tumours were present in five cases (2.5 per cent); three were identical in form and considered to be atypical ependymoma. Cerebrocortical necrosis, oedema or both were detected in four cases. The remaining cases (4.5 per cent), comprised those in which the changes were minor and of doubtful significance. Incidental pathological findings included occasional degenerating or vacuolated neurones, which occurred in the red nucleus in 105 brains, in the habenular nucleus in 71 brains, and singly at other sites in 17 brains. In sections of 37 brains immunostained with antiserum to prion protein (PrP), no evidence of PrP accumulation was found, providing some evidence that the series did not contain bovine prion disease cases which, based on the histological diagnosis, had given a false negative result. It is suggested that, of 115 cases (57.5 per cent) which lacked significant histological lesions, some were suffering from metabolic disorders. The study identified diseases and lesions which feature in the differential diagnosis of BSE. Their more accurate diagnosis may become

  5. Recombinant human prion protein fragment 90-231, a useful model to study prion neurotoxicity.

    PubMed

    Corsaro, Alessandro; Thellung, Stefano; Villa, Valentina; Nizzari, Mario; Aceto, Antonio; Florio, Tullio

    2012-01-01

    Transmissible spongiform encephalopathies (TSE), or prion diseases, are a group of fatal neurodegenerative disorders of animals and humans. Human diseases include Creutzfeldt-Jakob (CJD) and Gerstmann-Straussler-Scheinker (GSSD) diseases, fatal familial insomnia, and Kuru. Human and animal TSEs share a common histopathology with a pathognomonic triad: spongiform vacuolation of the grey matter, neuronal death, glial proliferation, and, more inconstantly, amyloid deposition. According to the "protein only" hypothesis, TSEs are caused by a unique post-translational conversion of normal, host-encoded, protease-sensitive prion protein (PrP(sen) or PrP(C)) to an abnormal disease-associated isoform (PrP(res) or PrP(Sc)). To investigate the molecular mechanism of neurotoxicity induced by PrP(Sc) we developed a protocol to obtain millimolar amounts of soluble recombinant polypeptide encompassing the amino acid sequence 90-231 of human PrP (hPrP90-231). This protein corresponds to the protease-resistant prion protein fragment that originates after amino-terminal truncation. Importantly, hPrP90-231 has a flexible backbone that, similar to PrP(C), can undergo to structural rearrangement. This peptide, structurally resembling PrP(C), can be converted in a PrP(Sc)-like conformation, and thus represents a valuable model to study prion neurotoxicity. In this article we summarized our experimental evidence on the molecular and structural mechanisms responsible of hPrP90-231 neurotoxicity on neuroectodermal cell line SHSY5Y and the effects of some PrP pathogen mutations identified in familial TSE.

  6. Prion diseases and adult neurogenesis: how do prions counteract the brain's endogenous repair machinery?

    PubMed

    Relaño-Ginés, Aroa; Lehmann, Sylvain; Crozet, Carole

    2014-01-01

    Scientific advances in stem cell biology and adult neurogenesis have raised the hope that neurodegenerative disorders could benefit from stem cell-based therapy. Adult neurogenesis might be part of the physiological regenerative process, however it might become impaired by the disease's mechanism and therefore contribute to neurodegeneration. In prion disorders this endogenous repair system has rarely been studied. Whether adult neurogenesis plays a role or not in brain repair or in the propagation of prion pathology remains unclear. We have recently investigated the status of adult neural stem cells isolated from prion-infected mice. We were able to show that neural stem cells accumulate and replicate prions thus resulting in an alteration of their neuronal destiny. We also reproduced these results in adult neural stem cells, which were infected in vitro. The fact that endogenous adult neurogenesis could be altered by the accumulation of misfolded prion protein represents another great challenge. Inhibiting prion propagation in these cells would thus help the endogenous neurogenesis to compensate for the injured neuronal system. Moreover, understanding the endogenous modulation of the neurogenesis system would help develop effective neural stem cell-based therapies.

  7. Experimental Interspecies Transmission Studies of the Transmissible Spongiform Encephalopathies to Cattle: Comparison to Bovine Spongiform Encephalopathy in Cattle

    USDA-ARS?s Scientific Manuscript database

    Prion diseases or transmissible spongiform encephalopathies (TSEs) of animals include scrapie of sheep and goats; transmissible mink encephalopathy (TME); chronic wasting disease (CWD) of deer, elk and moose; and bovine spongiform encephalopathy (BSE) of cattle. Since the emergence of BSE and its pr...

  8. Accelerating Yeast Prion Biology using Droplet Microfluidics

    NASA Astrophysics Data System (ADS)

    Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David

    2012-02-01

    Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.

  9. The celecoxib derivatives AR-12 and AR-14 induce autophagy and clear prion-infected cells from prions.

    PubMed

    Abdulrahman, Basant A; Abdelaziz, Dalia; Thapa, Simrika; Lu, Li; Jain, Shubha; Gilch, Sabine; Proniuk, Stefan; Zukiwski, Alexander; Schatzl, Hermann M

    2017-12-14

    Prion diseases are fatal infectious neurodegenerative disorders that affect both humans and animals. The autocatalytic conversion of the cellular prion protein (PrP C ) into the pathologic isoform PrP Sc is a key feature in prion pathogenesis. AR-12 is an IND-approved derivative of celecoxib that demonstrated preclinical activity against several microbial diseases. Recently, AR-12 has been shown to facilitate clearance of misfolded proteins. The latter proposes AR-12 to be a potential therapeutic agent for neurodegenerative disorders. In this study, we investigated the role of AR-12 and its derivatives in controlling prion infection. We tested AR-12 in prion infected neuronal and non-neuronal cell lines. Immunoblotting and confocal microscopy results showed that AR-12 and its analogue AR-14 reduced PrP Sc levels after only 72 hours of treatment. Furthermore, infected cells were cured of PrP Sc after exposure of AR-12 or AR-14 for only two weeks. We partially attribute the influence of the AR compounds on prion propagation to autophagy stimulation, in line with our previous findings that drug-induced stimulation of autophagy has anti-prion effects in vitro and in vivo. Taken together, this study demonstrates that AR-12 and the AR-14 analogue are potential new therapeutic agents for prion diseases and possibly protein misfolding disorders involving prion-like mechanisms.

  10. Functional diversification of hsp40: distinct j-protein functional requirements for two prions allow for chaperone-dependent prion selection.

    PubMed

    Harris, Julia M; Nguyen, Phil P; Patel, Milan J; Sporn, Zachary A; Hines, Justin K

    2014-07-01

    Yeast prions are heritable amyloid aggregates of functional yeast proteins; their propagation to subsequent cell generations is dependent upon fragmentation of prion protein aggregates by molecular chaperone proteins. Mounting evidence indicates the J-protein Sis1 may act as an amyloid specificity factor, recognizing prion and other amyloid aggregates and enabling Ssa and Hsp104 to act in prion fragmentation. Chaperone interactions with prions, however, can be affected by variations in amyloid-core structure resulting in distinct prion variants or 'strains'. Our genetic analysis revealed that Sis1 domain requirements by distinct variants of [PSI+] are strongly dependent upon overall variant stability. Notably, multiple strong [PSI+] variants can be maintained by a minimal construct of Sis1 consisting of only the J-domain and glycine/phenylalanine-rich (G/F) region that was previously shown to be sufficient for cell viability and [RNQ+] prion propagation. In contrast, weak [PSI+] variants are lost under the same conditions but maintained by the expression of an Sis1 construct that lacks only the G/F region and cannot support [RNQ+] propagation, revealing mutually exclusive requirements for Sis1 function between these two prions. Prion loss is not due to [PSI+]-dependent toxicity or dependent upon a particular yeast genetic background. These observations necessitate that Sis1 must have at least two distinct functional roles that individual prions differentially require for propagation and which are localized to the glycine-rich domains of the Sis1. Based on these distinctions, Sis1 plasmid-shuffling in a [PSI+]/[RNQ+] strain permitted J-protein-dependent prion selection for either prion. We also found that, despite an initial report to the contrary, the human homolog of Sis1, Hdj1, is capable of [PSI+] prion propagation in place of Sis1. This conservation of function is also prion-variant dependent, indicating that only one of the two Sis1-prion functions may have

  11. Functional Diversification of Hsp40: Distinct J-Protein Functional Requirements for Two Prions Allow for Chaperone-Dependent Prion Selection

    PubMed Central

    Patel, Milan J.; Sporn, Zachary A.; Hines, Justin K.

    2014-01-01

    Yeast prions are heritable amyloid aggregates of functional yeast proteins; their propagation to subsequent cell generations is dependent upon fragmentation of prion protein aggregates by molecular chaperone proteins. Mounting evidence indicates the J-protein Sis1 may act as an amyloid specificity factor, recognizing prion and other amyloid aggregates and enabling Ssa and Hsp104 to act in prion fragmentation. Chaperone interactions with prions, however, can be affected by variations in amyloid-core structure resulting in distinct prion variants or ‘strains’. Our genetic analysis revealed that Sis1 domain requirements by distinct variants of [PSI +] are strongly dependent upon overall variant stability. Notably, multiple strong [PSI +] variants can be maintained by a minimal construct of Sis1 consisting of only the J-domain and glycine/phenylalanine-rich (G/F) region that was previously shown to be sufficient for cell viability and [RNQ +] prion propagation. In contrast, weak [PSI +] variants are lost under the same conditions but maintained by the expression of an Sis1 construct that lacks only the G/F region and cannot support [RNQ +] propagation, revealing mutually exclusive requirements for Sis1 function between these two prions. Prion loss is not due to [PSI +]-dependent toxicity or dependent upon a particular yeast genetic background. These observations necessitate that Sis1 must have at least two distinct functional roles that individual prions differentially require for propagation and which are localized to the glycine-rich domains of the Sis1. Based on these distinctions, Sis1 plasmid-shuffling in a [PSI +]/[RNQ +] strain permitted J-protein-dependent prion selection for either prion. We also found that, despite an initial report to the contrary, the human homolog of Sis1, Hdj1, is capable of [PSI +] prion propagation in place of Sis1. This conservation of function is also prion-variant dependent, indicating that only one of the two Sis1-prion

  12. Ophthalmic Surgery in Prion Diseases

    PubMed Central

    Hamaguchi, Tsuyoshi; Noguchi-Shinohara, Moeko; Nakamura, Yosikazu; Sato, Takeshi; Kitamoto, Tetsuyuki; Mizusawa, Hidehiro

    2007-01-01

    Eleven (1.8%) of 597 patients underwent ophthalmic surgery within 1 month before the onset of prion disease or after the onset. All ophthalmologists reused surgical instruments that had been incompletely sterilized to eliminate infectious prion protein. Ophthalmologists should be aware of prion diseases as a possible cause of visual symptoms and use disposable instruments whenever possible. PMID:17370537

  13. Covalent surface modification of prions: a mass spectrometry-based means of detecting distinctive structural features of prion strains

    USDA-ARS?s Scientific Manuscript database

    Prions (PrPSc) are molecular pathogens that are able to convert the isosequential normal cellular prion protein (PrPC) into a prion. The only demonstrated differences between PrPC and PrPSc is conformational, they are isoforms. A given host can be infected by more than one kind or strain of prion. F...

  14. Kuru prions and sporadic Creutzfeldt–Jakob disease prions have equivalent transmission properties in transgenic and wild-type mice

    PubMed Central

    Wadsworth, Jonathan D. F.; Joiner, Susan; Linehan, Jacqueline M.; Desbruslais, Melanie; Fox, Katie; Cooper, Sharon; Cronier, Sabrina; Asante, Emmanuel A.; Mead, Simon; Brandner, Sebastian; Hill, Andrew F.; Collinge, John

    2008-01-01

    Kuru provides our principal experience of an epidemic human prion disease and primarily affected the Fore linguistic group of the Eastern Highlands of Papua New Guinea. Kuru was transmitted by the practice of consuming dead relatives as a mark of respect and mourning (transumption). To date, detailed information of the prion strain type propagated in kuru has been lacking. Here, we directly compare the transmission properties of kuru prions with sporadic, iatrogenic, and variant Creutzfeldt–Jakob disease (CJD) prions in Prnp-null transgenic mice expressing human prion protein and in wild-type mice. Molecular and neuropathological data from these transmissions show that kuru prions are distinct from variant CJD and have transmission properties equivalent to those of classical (sporadic) CJD prions. These findings are consistent with the hypothesis that kuru originated from chance consumption of an individual with sporadic CJD. PMID:18316717

  15. Lesion of the Olfactory Epithelium Accelerates Prion Neuroinvasion and Disease Onset when Prion Replication Is Restricted to Neurons

    PubMed Central

    Crowell, Jenna; Wiley, James A.; Bessen, Richard A.

    2015-01-01

    Natural prion diseases of ruminants are moderately contagious and while the gastrointestinal tract is the primary site of prion agent entry, other mucosae may be entry sites in a subset of infections. In the current study we examined prion neuroinvasion and disease induction following disruption of the olfactory epithelium in the nasal mucosa since this site contains environmentally exposed olfactory sensory neurons that project directly into the central nervous system. Here we provide evidence for accelerated prion neuroinvasion and clinical onset from the olfactory mucosa after disruption and regeneration of the olfactory epithelium and when prion replication is restricted to neurons. In transgenic mice with neuron restricted replication of prions, there was a reduction in survival when the olfactory epithelium was disrupted prior to intranasal inoculation and there was >25% decrease in the prion incubation period. In a second model, the neurotropic DY strain of transmissible mink encephalopathy was not pathogenic in hamsters by the nasal route, but 50% of animals exhibited brain infection and/or disease when the olfactory epithelium was disrupted prior to intranasal inoculation. A time course analysis of prion deposition in the brain following loss of the olfactory epithelium in models of neuron-restricted prion replication suggests that neuroinvasion from the olfactory mucosa is via the olfactory nerve or brain stem associated cranial nerves. We propose that induction of neurogenesis after damage to the olfactory epithelium can lead to prion infection of immature olfactory sensory neurons and accelerate prion spread to the brain. PMID:25822718

  16. Yeast prions are useful for studying protein chaperones and protein quality control.

    PubMed

    Masison, Daniel C; Reidy, Michael

    2015-01-01

    Protein chaperones help proteins adopt and maintain native conformations and play vital roles in cellular processes where proteins are partially folded. They comprise a major part of the cellular protein quality control system that protects the integrity of the proteome. Many disorders are caused when proteins misfold despite this protection. Yeast prions are fibrous amyloid aggregates of misfolded proteins. The normal action of chaperones on yeast prions breaks the fibers into pieces, which results in prion replication. Because this process is necessary for propagation of yeast prions, even small differences in activity of many chaperones noticeably affect prion phenotypes. Several other factors involved in protein processing also influence formation, propagation or elimination of prions in yeast. Thus, in much the same way that the dependency of viruses on cellular functions has allowed us to learn much about cell biology, the dependency of yeast prions on chaperones presents a unique and sensitive way to monitor the functions and interactions of many components of the cell's protein quality control system. Our recent work illustrates the utility of this system for identifying and defining chaperone machinery interactions.

  17. Role of Prion Replication in the Strain-dependent Brain Regional Distribution of Prions.

    PubMed

    Hu, Ping Ping; Morales, Rodrigo; Duran-Aniotz, Claudia; Moreno-Gonzalez, Ines; Khan, Uffaf; Soto, Claudio

    2016-06-10

    One intriguing feature of prion diseases is their strain variation. Prion strains are differentiated by the clinical consequences they generate in the host, their biochemical properties, and their potential to infect other animal species. The selective targeting of these agents to specific brain structures have been extensively used to characterize prion strains. However, the molecular basis dictating strain-specific neurotropism are still elusive. In this study, isolated brain structures from animals infected with four hamster prion strains (HY, DY, 139H, and SSLOW) were analyzed for their content of protease-resistant PrP(Sc) Our data show that these strains have different profiles of PrP deposition along the brain. These patterns of accumulation, which were independent of regional PrP(C) production, were not reproduced by in vitro replication when different brain regions were used as substrate for the misfolding-amplification reaction. On the contrary, our results show that in vitro replication efficiency depended exclusively on the amount of PrP(C) present in each part of the brain. Our results suggest that the variable regional distribution of PrP(Sc) in distinct strains is not determined by differences on prion formation, but on other factors or cellular pathways. Our findings may contribute to understand the molecular mechanisms of prion pathogenesis and strain diversity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Spontaneous generation of rapidly transmissible prions in transgenic mice expressing wild-type bank vole prion protein.

    PubMed

    Watts, Joel C; Giles, Kurt; Stöhr, Jan; Oehler, Abby; Bhardwaj, Sumita; Grillo, Sunny K; Patel, Smita; DeArmond, Stephen J; Prusiner, Stanley B

    2012-02-28

    Currently, there are no animal models of the most common human prion disorder, sporadic Creutzfeldt-Jakob disease (CJD), in which prions are formed spontaneously from wild-type (WT) prion protein (PrP). Interestingly, bank voles (BV) exhibit an unprecedented promiscuity for diverse prion isolates, arguing that bank vole PrP (BVPrP) may be inherently prone to adopting misfolded conformations. Therefore, we constructed transgenic (Tg) mice expressing WT BVPrP. Tg(BVPrP) mice developed spontaneous CNS dysfunction between 108 and 340 d of age and recapitulated the hallmarks of prion disease, including spongiform degeneration, pronounced astrogliosis, and deposition of alternatively folded PrP in the brain. Brain homogenates of ill Tg(BVPrP) mice transmitted disease to Tg(BVPrP) mice in ∼35 d, to Tg mice overexpressing mouse PrP in under 100 d, and to WT mice in ∼185 d. Our studies demonstrate experimentally that WT PrP can spontaneously form infectious prions in vivo. Thus, Tg(BVPrP) mice may be useful for studying the spontaneous formation of prions, and thus may provide insight into the etiology of sporadic CJD.

  19. Automated decontamination of surface-adherent prions.

    PubMed

    Schmitt, A; Westner, I M; Reznicek, L; Michels, W; Mitteregger, G; Kretzschmar, H A

    2010-09-01

    At present there is no routinely available decontamination procedure in washer-disinfectors to allow the reliable inactivation and/or elimination of prions present on reusable surgical instruments. This means that is not possible to provide assurance for preventing iatrogenic transmission of prion diseases. We need effective procedures in prion decontamination that can be integrated into the usual routine of reprocessing surgical instruments. This article reports on the evaluation of an automated process designed to decontaminate prions in washer-disinfectors using a quantitative, highly sensitive in vivo assay for surface-adherent 22L prions. The automated process showed great advantages when compared with conventional alkaline cleaning. In contrast, the new process was as effective as autoclaving at 134 degrees C for 2h and left no detectable prion infectivity, even for heavily contaminated surfaces. This indicates a reduction of surface-adherent prion infectivity of >7 log units. Due to its compatibility with even delicate surgical instruments, the process can be integrated into the large scale reprocessing of instruments in a central sterile supply department. The system could potentially make an important contribution to the prevention of iatrogenic transmission of prions. Copyright 2010 The Hospital Infection Society. Published by Elsevier Ltd. All rights reserved.

  20. Direct Detection of Soil-Bound Prions

    PubMed Central

    Genovesi, Sacha; Leita, Liviana; Sequi, Paolo; Andrighetto, Igino; Sorgato, M. Catia; Bertoli, Alessandro

    2007-01-01

    Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrPSc) of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challanged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures. PMID:17957252

  1. Mammalian amyloidogenic proteins promote prion nucleation in yeast.

    PubMed

    Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O

    2018-03-02

    Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Whole Blood Gene Expression Profiling in Preclinical and Clinical Cattle Infected with Atypical Bovine Spongiform Encephalopathy

    PubMed Central

    Xerxa, Elena; Barbisin, Maura; Chieppa, Maria Novella; Krmac, Helena; Vallino Costassa, Elena; Vatta, Paolo; Simmons, Marion; Caramelli, Maria; Casalone, Cristina; Corona, Cristiano

    2016-01-01

    Prion diseases, such as bovine spongiform encephalopathies (BSE), are transmissible neurodegenerative disorders affecting humans and a wide variety of mammals. Variant Creutzfeldt-Jakob disease (vCJD), a prion disease in humans, has been linked to exposure to BSE prions. This classical BSE (cBSE) is now rapidly disappearing as a result of appropriate measures to control animal feeding. Besides cBSE, two atypical forms (named H- and L-type BSE) have recently been described in Europe, Japan, and North America. Here we describe the first wide-spectrum microarray analysis in whole blood of atypical BSE-infected cattle. Transcriptome changes in infected animals were analyzed prior to and after the onset of clinical signs. The microarray analysis revealed gene expression changes in blood prior to the appearance of the clinical signs and during the progression of the disease. A set of 32 differentially expressed genes was found to be in common between clinical and preclinical stages and showed a very similar expression pattern in the two phases. A 22-gene signature showed an oscillating pattern of expression, being differentially expressed in the preclinical stage and then going back to control levels in the symptomatic phase. One gene, SEL1L3, was downregulated during the progression of the disease. Most of the studies performed up to date utilized various tissues, which are not suitable for a rapid analysis of infected animals and patients. Our findings suggest the intriguing possibility to take advantage of whole blood RNA transcriptional profiling for the preclinical identification of prion infection. Further, this study highlighted several pathways, such as immune response and metabolism that may play an important role in peripheral prion pathogenesis. Finally, the gene expression changes identified in the present study may be further investigated as a fingerprint for monitoring the progression of disease and for developing targeted therapeutic interventions. PMID

  3. Double-Edge Sword of Sustained ROCK Activation in Prion Diseases through Neuritogenesis Defects and Prion Accumulation

    PubMed Central

    Alleaume-Butaux, Aurélie; Nicot, Simon; Pietri, Mathéa; Baudry, Anne; Dakowski, Caroline; Tixador, Philippe; Ardila-Osorio, Hector; Haeberlé, Anne-Marie; Bailly, Yannick; Peyrin, Jean-Michel; Launay, Jean-Marie; Kellermann, Odile; Schneider, Benoit

    2015-01-01

    In prion diseases, synapse dysfunction, axon retraction and loss of neuronal polarity precede neuronal death. The mechanisms driving such polarization defects, however, remain unclear. Here, we examined the contribution of RhoA-associated coiled-coil containing kinases (ROCK), key players in neuritogenesis, to prion diseases. We found that overactivation of ROCK signaling occurred in neuronal stem cells infected by pathogenic prions (PrPSc) and impaired the sprouting of neurites. In reconstructed networks of mature neurons, PrPSc-induced ROCK overactivation provoked synapse disconnection and dendrite/axon degeneration. This overactivation of ROCK also disturbed overall neurotransmitter-associated functions. Importantly, we demonstrated that beyond its impact on neuronal polarity ROCK overactivity favored the production of PrPSc through a ROCK-dependent control of 3-phosphoinositide-dependent kinase 1 (PDK1) activity. In non-infectious conditions, ROCK and PDK1 associated within a complex and ROCK phosphorylated PDK1, conferring basal activity to PDK1. In prion-infected neurons, exacerbated ROCK activity increased the pool of PDK1 molecules physically interacting with and phosphorylated by ROCK. ROCK-induced PDK1 overstimulation then canceled the neuroprotective α-cleavage of normal cellular prion protein PrPC by TACE α-secretase, which physiologically precludes PrPSc production. In prion-infected cells, inhibition of ROCK rescued neurite sprouting, preserved neuronal architecture, restored neuronal functions and reduced the amount of PrPSc. In mice challenged with prions, inhibition of ROCK also lowered brain PrPSc accumulation, reduced motor impairment and extended survival. We conclude that ROCK overactivation exerts a double detrimental effect in prion diseases by altering neuronal polarity and triggering PrPSc accumulation. Eventually ROCK emerges as therapeutic target to combat prion diseases. PMID:26241960

  4. Soluble Aβ aggregates can inhibit prion propagation.

    PubMed

    Sarell, Claire J; Quarterman, Emma; Yip, Daniel C-M; Terry, Cassandra; Nicoll, Andrew J; Wadsworth, Jonathan D F; Farrow, Mark A; Walsh, Dominic M; Collinge, John

    2017-11-01

    Mammalian prions cause lethal neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD) and consist of multi-chain assemblies of misfolded cellular prion protein (PrP C ). Ligands that bind to PrP C can inhibit prion propagation and neurotoxicity. Extensive prior work established that certain soluble assemblies of the Alzheimer's disease (AD)-associated amyloid β-protein (Aβ) can tightly bind to PrP C , and that this interaction may be relevant to their toxicity in AD. Here, we investigated whether such soluble Aβ assemblies might, conversely, have an inhibitory effect on prion propagation. Using cellular models of prion infection and propagation and distinct Aβ preparations, we found that the form of Aβ assemblies which most avidly bound to PrP in vitro also inhibited prion infection and propagation. By contrast, forms of Aβ which exhibit little or no binding to PrP were unable to attenuate prion propagation. These data suggest that soluble aggregates of Aβ can compete with prions for binding to PrP C and emphasize the bidirectional nature of the interplay between Aβ and PrP C in Alzheimer's and prion diseases. Such inhibitory effects of Aβ on prion propagation may contribute to the apparent fall-off in the incidence of sporadic CJD at advanced age where cerebral Aβ deposition is common. © 2017 The Authors.

  5. Development of a nanoparticle-based surface-modified fluorescence assay for the detection of prion proteins.

    PubMed

    Henry, James; Anand, Ashish; Chowdhury, Mustafa; Coté, Gerard; Moreira, Rosana; Good, Theresa

    2004-11-01

    A nanoparticle-based immunoassay for the detection of recombinant bovine prion protein (PrP) was developed as a step in the development of screening tools for the prevention of the spread of transmissible spongiform encephalopathies. The assay is based on the competitive binding between PrP and a peptide-fluorophore to a nanoparticle-labeled antibody which is specific for a conserved prion sequence. The fluorophore, when bound to the antibody, is subject to surfaced-modified fluorescence, enabling detection of changes in the concentration of bound fluorophore in the presence of prion protein. Important factors considered during the development of the assay were ease of use, robustness, and detection level. The effects of pH and nanoparticle conjugation chemistry on surface-modified fluorescence observed in the assay were explored. Effects of concentrations of antibody and fluorophore on reproducibility and detection limits were examined. At present, the detection limits of the system are approximately equal to the antibody-peptide fluorophore equilibrium dissociation constant, which is near one nanomolar concentration. Improved assay performance could be obtained by optimization of the nanoparticle surface resonance effects. The simplicity of the assay and ease of use may make the type of assay described in this report attractive for screening purposes in the food industry.

  6. Cell Biology Approaches to Studying Prion Diseases.

    PubMed

    Priola, Suzette A

    2017-01-01

    During the course of prion infection, the normally soluble and protease-sensitive mammalian prion protein (PrP C ) is refolded into an insoluble, partially protease-resistant, and infectious form called PrP Sc . The conformational conversion of PrP C to PrP Sc is a critical event during prion infection and is essential for the production of prion infectivity. This chapter briefly summarizes the ways in which cell biological approaches have enhanced our understanding of how PrP contributes to different aspects of prion pathogenesis.

  7. Metal Dyshomeostasis and Their Pathological Role in Prion and Prion-Like Diseases: The Basis for a Nutritional Approach

    PubMed Central

    Toni, Mattia; Massimino, Maria L.; De Mario, Agnese; Angiulli, Elisa; Spisni, Enzo

    2017-01-01

    Metal ions are key elements in organisms' life acting like cofactors of many enzymes but they can also be potentially dangerous for the cell participating in redox reactions that lead to the formation of reactive oxygen species (ROS). Any factor inducing or limiting a metal dyshomeostasis, ROS production and cell injury may contribute to the onset of neurodegenerative diseases or play a neuroprotective action. Transmissible spongiform encephalopathies (TSEs), also known as prion diseases, are a group of fatal neurodegenerative disorders affecting the central nervous system (CNS) of human and other mammalian species. The causative agent of TSEs is believed to be the scrapie prion protein PrPSc, the β sheet-rich pathogenic isoform produced by the conformational conversion of the α-helix-rich physiological isoform PrPC. The peculiarity of PrPSc is its ability to self-propagate in exponential fashion in cells and its tendency to precipitate in insoluble and protease-resistance amyloid aggregates leading to neuronal cell death. The expression “prion-like diseases” refers to a group of neurodegenerative diseases that share some neuropathological features with prion diseases such as the involvement of proteins (α-synuclein, amyloid β, and tau) able to precipitate producing amyloid deposits following conformational change. High social impact diseases such as Alzheimer's and Parkinson's belong to prion-like diseases. Accumulating evidence suggests that the exposure to environmental metals is a risk factor for the development of prion and prion-like diseases and that metal ions can directly bind to prion and prion-like proteins affecting the amount of amyloid aggregates. The diet, source of metal ions but also of natural antioxidant and chelating agents such as polyphenols, is an aspect to take into account in addressing the issue of neurodegeneration. Epidemiological data suggest that the Mediterranean diet, based on the abundant consumption of fresh vegetables and

  8. Prions and lymphoid organs: solved and remaining mysteries.

    PubMed

    O'Connor, Tracy; Aguzzi, Adriano

    2013-01-01

    Prion colonization of secondary lymphoid organs (SLOs) is a critical step preceding neuroinvasion in prion pathogenesis. Follicular dendritic cells (FDCs), which depend on both tumor necrosis factor receptor 1 (TNFR1) and lymphotoxin β receptor (LTβR) signaling for maintenance, are thought to be the primary sites of prion accumulation in SLOs. However, prion titers in RML-infected TNFR1 (-/-) lymph nodes and rates of neuroinvasion in TNFR1 (-/-) mice remain high despite the absence of mature FDCs. Recently, we discovered that TNFR1-independent prion accumulation in lymph nodes relies on LTβR signaling. Loss of LTβR signaling in TNFR1 (-/-) lymph nodes coincided with the de-differentiation of high endothelial venules (HEVs)-the primary sites of lymphocyte entry into lymph nodes. These findings suggest that HEVs are the sites through which prions initially invade lymph nodes from the bloodstream. Identification of HEVs as entry portals for prions clarifies a number of previous observations concerning peripheral prion pathogenesis. However, a number of questions still remain: What is the mechanism by which prions are taken up by HEVs? Which cells are responsible for delivering prions to lymph nodes? Are HEVs the main entry site for prions into lymph nodes or do alternative routes also exist? These questions and others are considered in this article.

  9. Chronic Lymphocytic Inflammation Specifies the Organ Tropism of Prions

    NASA Astrophysics Data System (ADS)

    Heikenwalder, Mathias; Zeller, Nicolas; Seeger, Harald; Prinz, Marco; Klöhn, Peter-Christian; Schwarz, Petra; Ruddle, Nancy H.; Weissmann, Charles; Aguzzi, Adriano

    2005-02-01

    Prions typically accumulate in nervous and lymphoid tissues. Because proinflammatory cytokines and immune cells are required for lymphoid prion replication, we tested whether inflammatory conditions affect prion pathogenesis. We administered prions to mice with five inflammatory diseases of the kidney, pancreas, or liver. In all cases, chronic lymphocytic inflammation enabled prion accumulation in otherwise prion-free organs. Inflammatory foci consistently correlated with lymphotoxin up-regulation and ectopic induction of FDC-M1+ cells expressing the normal cellular prion protein PrPC. By contrast, inflamed organs of mice lacking lymphotoxin-α or its receptor did not accumulate the abnormal isoform PrPSc, nor did they display infectivity upon prion inoculation. By expanding the tissue distribution of prions, chronic inflammatory conditions may act as modifiers of natural and iatrogenic prion transmission.

  10. Quantifying the relative amounts of PrP polymorphisms present in prions isolated from heterozygous prion-infected animals

    USDA-ARS?s Scientific Manuscript database

    Prions cause protein misfolding diseases, such as transmissible spongiform encephalopathy. They propagate infections by converting a normal cellular prion protein into a prion (PrPSc). PrPC and PrPSc are isosequential and differ only in their respective conformations. PrPC is monomeric and sensit...

  11. Detection of Chronic Wasting Disease Prions in Salivary, Urinary, and Intestinal Tissues of Deer: Potential Mechanisms of Prion Shedding and Transmission▿

    PubMed Central

    Haley, Nicholas J.; Mathiason, Candace K.; Carver, Scott; Zabel, Mark; Telling, Glenn C.; Hoover, Edward A.

    2011-01-01

    Efficient horizontal transmission is a signature trait of chronic wasting disease (CWD) in cervids. Infectious prions shed into excreta appear to play a key role in this facile transmission, as has been demonstrated by bioassays of cervid and transgenic species and serial protein misfolding cyclic amplification (sPMCA). However, the source(s) of infectious prions in these body fluids has yet to be identified. In the present study, we analyzed tissues proximate to saliva, urine, and fecal production by sPMCA in an attempt to elucidate this unique aspect of CWD pathogenesis. Oropharyngeal, urogenital, and gastrointestinal tissues along with blood and obex from CWD-exposed cervids (comprising 27 animals and >350 individual samples) were analyzed and scored based on the apparent relative CWD burden. PrPCWD-generating activity was detected in a range of tissues and was highest in the salivary gland, urinary bladder, and distal intestinal tract. In the same assays, blood from the same animals and unseeded normal brain homogenate controls (n = 116 of 117) remained negative. The PrP-converting activity in peripheral tissues varied from 10−11- to 100-fold of that found in brain of the same animal. Deer with highest levels of PrPCWD amplification in the brain had higher and more widely disseminated prion amplification in excretory tissues. Interestingly, PrPCWD was not demonstrable in these excretory tissues by conventional Western blotting, suggesting a low prion burden or the presence of protease-sensitive infectious prions destroyed by harsh proteolytic treatments. These findings offer unique insights into the transmission of CWD in particular and prion infection and trafficking overall. PMID:21525361

  12. Quantitating PrP polymorphisms present in prions from heterozygous scrapie-infected sheep

    USDA-ARS?s Scientific Manuscript database

    Scrapie is a prion (PrPSc) disease of sheep. The incubation period of sheep scrapie is strongly influenced by polymorphisms at positions 136, 154, and 171 of a sheep’s normal cellular prion protein (PrPC). Chymotrypsin was used to digest sheep recombinant PrP to identify a set of characteristic pept...

  13. Prion-based memory of heat stress in yeast

    PubMed Central

    Chernova, Tatiana A.; Wilkinson, Keith D.

    2017-01-01

    ABSTRACT Amyloids and amyloid-based prions are self-perpetuating protein aggregates which can spread by converting a normal protein of the same sequence into a prion form. They are associated with diseases in humans and mammals, and control heritable traits in yeast and other fungi. Some amyloids are implicated in biologically beneficial processes. As prion formation generates reproducible memory of a conformational change, prions can be considered as molecular memory devices.  We have demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature. This prion promotes conversion of other proteins into prions and can persist in a fraction of cells for a significant number of cell generations after stress, thus maintaining the memory of stress in a population of surviving cells. Acquisition of an amino acid substitution required for Lsb2 to form a prion coincides with acquisition of increased thermotolerance in the evolution of Saccharomyces yeast. Thus the ability to form an Lsb2 prion in response to stress coincides with yeast adaptation to growth at higher temperatures. These findings intimately connect prion formation to the cellular response to environmental stresses. PMID:28521568

  14. Prion-based memory of heat stress in yeast.

    PubMed

    Chernova, Tatiana A; Chernoff, Yury O; Wilkinson, Keith D

    2017-05-04

    Amyloids and amyloid-based prions are self-perpetuating protein aggregates which can spread by converting a normal protein of the same sequence into a prion form. They are associated with diseases in humans and mammals, and control heritable traits in yeast and other fungi. Some amyloids are implicated in biologically beneficial processes. As prion formation generates reproducible memory of a conformational change, prions can be considered as molecular memory devices.  We have demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature. This prion promotes conversion of other proteins into prions and can persist in a fraction of cells for a significant number of cell generations after stress, thus maintaining the memory of stress in a population of surviving cells. Acquisition of an amino acid substitution required for Lsb2 to form a prion coincides with acquisition of increased thermotolerance in the evolution of Saccharomyces yeast. Thus the ability to form an Lsb2 prion in response to stress coincides with yeast adaptation to growth at higher temperatures. These findings intimately connect prion formation to the cellular response to environmental stresses.

  15. Prions: Beyond a Single Protein

    PubMed Central

    Das, Alvin S.

    2016-01-01

    SUMMARY Since the term protein was first coined in 1838 and protein was discovered to be the essential component of fibrin and albumin, all cellular proteins were presumed to play beneficial roles in plants and mammals. However, in 1967, Griffith proposed that proteins could be infectious pathogens and postulated their involvement in scrapie, a universally fatal transmissible spongiform encephalopathy in goats and sheep. Nevertheless, this novel hypothesis had not been evidenced until 1982, when Prusiner and coworkers purified infectious particles from scrapie-infected hamster brains and demonstrated that they consisted of a specific protein that he called a “prion.” Unprecedentedly, the infectious prion pathogen is actually derived from its endogenous cellular form in the central nervous system. Unlike other infectious agents, such as bacteria, viruses, and fungi, prions do not contain genetic materials such as DNA or RNA. The unique traits and genetic information of prions are believed to be encoded within the conformational structure and posttranslational modifications of the proteins. Remarkably, prion-like behavior has been recently observed in other cellular proteins—not only in pathogenic roles but also serving physiological functions. The significance of these fascinating developments in prion biology is far beyond the scope of a single cellular protein and its related disease. PMID:27226089

  16. Prions, prionoids and pathogenic proteins in Alzheimer disease.

    PubMed

    Ashe, Karen H; Aguzzi, Adriano

    2013-01-01

    Like patients with prion disease, Alzheimer patients suffer from a fatal, progressive form of dementia. There is growing evidence that amyloid-β (Aβ) aggregates may be transmissible similar to prions, at least under extreme experimental conditions. However, unlike mice infected with prion protein (PrP) prions, those inoculated with Aβ do not die. The transmission of Aβ and PrP thus differs conspicuously in the neurological effects they induce in their hosts, the difference being no less than a matter of life and death. Far from being a mere academic nuance, this distinction between Aβ and PrP begs the crucial questions of what, exactly, controls prion toxicity and how prion toxicity relates to prion infectivity.

  17. Protective Effect of Val129-PrP against Bovine Spongiform Encephalopathy but not Variant Creutzfeldt-Jakob Disease

    PubMed Central

    Fernández-Borges, Natalia; Espinosa, Juan Carlos; Marín-Moreno, Alba; Aguilar-Calvo, Patricia; Asante, Emmanuel A.; Kitamoto, Tetsuyuki; Mohri, Shirou; Andréoletti, Olivier

    2017-01-01

    Bovine spongiform encephalopathy (BSE) is the only known zoonotic prion that causes variant Creutzfeldt-Jakob disease (vCJD) in humans. The major risk determinant for this disease is the polymorphic codon 129 of the human prion protein (Hu-PrP), where either methionine (Met129) or valine (Val129) can be encoded. To date, all clinical and neuropathologically confirmed vCJD cases have been Met129 homozygous, with the exception of 1 recently reported Met/Val heterozygous case. Here, we found that transgenic mice homozygous for Val129 Hu-PrP show severely restricted propagation of the BSE prion strain, but this constraint can be partially overcome by adaptation of the BSE agent to the Met129 Hu-PrP. In addition, the transmission of vCJD to transgenic mice homozygous for Val129 Hu-PrP resulted in a prion with distinct strain features. These observations may indicate increased risk for vCJD secondary transmission in Val129 Hu-PrP–positive humans with the emergence of new strain features. PMID:28820136

  18. Alzheimer's Disease and Prion Protein

    PubMed Central

    Zhou, Jiayi; Liu, Bingqian

    2013-01-01

    Summary Alzheimer's disease (AD) is a devastating neurodegenerative disease with progressive loss of memory and cognitive function, pathologically hallmarked by aggregates of the amyloid-beta (Aβ) peptide and hyperphosphorylated tau in the brain. Aggregation of Aβ under the form of amyloid fibrils has long been considered central to the pathogenesis of AD. However, recent evidence has indicated that soluble Aβ oligomers, rather than insoluble fibrils, are the main neurotoxic species in AD. The cellular prion protein (PrPC) has newly been identified as a cell surface receptor for Aβ oligomers. PrPC is a cell surface glycoprotein that plays a key role in the propagation of prions, proteinaceous infectious agents that replicate by imposing their abnormal conformation to PrPC molecules. In AD, PrPC acts to transduce the neurotoxic signals arising from Aβ oligomers, leading to synaptic failure and cognitive impairment. Interestingly, accumulating evidence has also shown that aggregated Aβ or tau possesses prion-like activity, a property that would allow them to spread throughout the brain. In this article, we review recent findings regarding the function of PrPC and its role in AD, and discuss potential therapeutic implications of PrPC-based approaches in the treatment of AD. PMID:25343100

  19. Polymorphism of prion protein gene in Arctic fox (Vulpes lagopus).

    PubMed

    Wan, Jiayu; Bai, Xue; Liu, Wensen; Xu, Jing; Xu, Ming; Gao, Hongwei

    2009-07-01

    Prion diseases are fatal neurodegenerative disorders of humans and certain other mammals. Prion protein gene (Prnp) is associated with susceptibility and species barrier to prion diseases. No natural and experimental prion diseases have been documented to date in Arctic fox. In the present study, coding region of Prnp from 135 Arctic foxes were cloned and screened for polymorphisms. Our results indicated that the Arctic fox Prnp open reading frame (ORF) contains 771 nucleotides encoding 257 amino acids. Four single nucleotide polymorphisms (SNPs) (G312C, A337G, C541T, and A723G) were identified. SNPs G312C and A723G produced silent mutations, but SNPs A337G and C541T resulted in a M-V change at codon 113 and R-C at codon 181, respectively. The Arctic fox Prnp amino acid sequence was similar to that of the dog (XM 542906). In short, this study provides preliminary information about genotypes of Prnp in Arctic fox.

  20. Prion pathogenesis and secondary lymphoid organs (SLO)

    PubMed Central

    Mabbott, Neil A.

    2012-01-01

    Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrPSc, an abnormally folded isoform of the cellular prion protein (PrPC), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases. PMID:22895090

  1. PLAAC: a web and command-line application to identify proteins with prion-like amino acid composition.

    PubMed

    Lancaster, Alex K; Nutter-Upham, Andrew; Lindquist, Susan; King, Oliver D

    2014-09-01

    Prions are self-templating protein aggregates that stably perpetuate distinct biological states and are of keen interest to researchers in both evolutionary and biomedical science. The best understood prions are from yeast and have a prion-forming domain with strongly biased amino acid composition, most notably enriched for Q or N. PLAAC is a web application that scans protein sequences for domains with P: rion- L: ike A: mino A: cid C: omposition. Users can upload sequence files, or paste sequences directly into a textbox. PLAAC ranks the input sequences by several summary scores and allows scores along sequences to be visualized. Text output files can be downloaded for further analyses, and visualizations saved in PDF and PNG formats. http://plaac.wi.mit.edu/. The Ruby-based web framework and the command-line software (implemented in Java, with visualization routines in R) are available at http://github.com/whitehead/plaac under the MIT license. All software can be run under OS X, Windows and Unix. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  2. PRION-1 scales analysis supports use of functional outcome measures in prion disease

    PubMed Central

    Mead, S.; Ranopa, M.; Gopalakrishnan, G.S.; Thompson, A.G.B.; Rudge, P.; Wroe, S.; Kennedy, A.; Hudson, F.; MacKay, A.; Darbyshire, J.H.; Walker, A.S.

    2011-01-01

    Objectives: Human prion diseases are heterogeneous but invariably fatal neurodegenerative disorders with no known effective therapy. PRION-1, the largest clinical trial in prion disease to date, showed no effect of the potential therapeutic quinacrine on survival. Although there are several limitations to the usefulness of survival as an outcome measure, there have been no comprehensive studies of alternatives. Methods: To address this we did comparative analyses of neurocognitive, psychiatric, global, clinician-rated, and functional scales, focusing on validity, variability, and impact on statistical power over 77 person-years follow-up in 101 symptomatic patients in PRION-1. Results: Quinacrine had no demonstrable benefit on any of the 8 scales (p > 0.4). All scales had substantial numbers of patients with the worst possible score at enrollment (Glasgow Coma Scale score being least affected) and were impacted by missing data due to disease progression. These effects were more significant for cognitive/psychiatric scales than global, clinician-rated, or functional scales. The Barthel and Clinical Dementia Rating scales were the most valid and powerful in simulated clinical trials of an effective therapeutic. A combination of selected subcomponents from these 2 scales gave somewhat increased power, compared to use of survival, to detect clinically relevant effects in future clinical trials of feasible size. Conclusions: Our findings have implications for the choice of primary outcome measure in prion disease clinical trials. Prion disease presents the unusual opportunity to follow patients with a neurodegenerative disease through their entire clinical course, and this provides insights relevant to designing outcome measures in related conditions. PMID:22013183

  3. Disease Transmission by Misfolded Prion-Protein Isoforms, Prion-Like Amyloids, Functional Amyloids and the Central Dogma.

    PubMed

    Daus, Martin L

    2016-01-04

    In 1982, the term "prions" (proteinaceous infectious particles) was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE) was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid) can store and transmit information similarly to DNA was initially even denoted as being "heretical" but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the "protein-only hypothesis" expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed.

  4. The cellular prion protein identifies bipotential cardiomyogenic progenitors.

    PubMed

    Hidaka, Kyoko; Shirai, Manabu; Lee, Jong-Kook; Wakayama, Takanari; Kodama, Itsuo; Schneider, Michael D; Morisaki, Takayuki

    2010-01-08

    The paucity of specific surface markers for cardiomyocytes and their progenitors has impeded the development of embryonic or pluripotent stem cell-based transplantation therapy. Identification of relevant surface markers may also enhance our understanding of the mechanisms underlying differentiation. Here, we show that cellular prion protein (PrP) serves as an effective surface marker for isolating nascent cardiomyocytes as well as cardiomyogenic progenitors. Embryonic stem (or embryo-derived) cells were analyzed using flow cytometry to detect surface expression of PrP and intracellular myosin heavy chain (Myhc) proteins. Sorted cells were then analyzed for their differentiation potential. PrP+ cells from beating embryoid bodies (EBs) frequently included nascent Myhc+ cardiomyocytes. Cultured PrP+ cells further differentiated, giving rise to cardiac troponin I+ definitive cardiomyocytes with either an atrial or a ventricular identity. These cells were electrophysiologically functional and able to survive in vivo after transplantation. Combining PrP with a second marker, platelet-derived growth factor receptor (PDGFR)alpha, enabled us to identify an earlier cardiomyogenic population from prebeating EBs, the PrP+PDGFRalpha+ (PRa) cells. The Myhc- PRa cells expressed cardiac transcription factors, such as Nkx2.5, T-box transcription factor 5, and Isl1 (islet LIM homeobox 1), although they were not completely committed. In mouse embryos, PRa cells in cardiac crescent at the 1 to 2 somite stage were Myhc+, whereas they were Myhc- at headfold stages. PRa cells clonally expanded in methlycellulose cultures. Furthermore, single Myhc- PRa cell-derived colonies contained both cardiac and smooth muscle cells. Thus, PrP demarcates a population of bipotential cardiomyogenic progenitor cells that can differentiate into cardiac or smooth muscle cells.

  5. Selective propagation of mouse-passaged scrapie prions with long incubation period from a mixed prion population using GT1-7 cells.

    PubMed

    Miyazawa, Kohtaro; Masujin, Kentaro; Okada, Hiroyuki; Ushiki-Kaku, Yuko; Matsuura, Yuichi; Yokoyama, Takashi

    2017-01-01

    In our previous study, we demonstrated the propagation of mouse-passaged scrapie isolates with long incubation periods (L-type) derived from natural Japanese sheep scrapie cases in murine hypothalamic GT1-7 cells, along with disease-associated prion protein (PrPSc) accumulation. We here analyzed the susceptibility of GT1-7 cells to scrapie prions by exposure to infected mouse brains at different passages, following interspecies transmission. Wild-type mice challenged with a natural sheep scrapie case (Kanagawa) exhibited heterogeneity of transmitted scrapie prions in early passages, and this mixed population converged upon one with a short incubation period (S-type) following subsequent passages. However, when GT1-7 cells were challenged with these heterologous samples, L-type prions became dominant. This study demonstrated that the susceptibility of GT1-7 cells to L-type prions was at least 105 times higher than that to S-type prions and that L-type prion-specific biological characteristics remained unchanged after serial passages in GT1-7 cells. This suggests that a GT1-7 cell culture model would be more useful for the economical and stable amplification of L-type prions at the laboratory level. Furthermore, this cell culture model might be used to selectively propagate L-type scrapie prions from a mixed prion population.

  6. Increased expression of p62/SQSTM1 in prion diseases and its association with pathogenic prion protein.

    PubMed

    Homma, Takujiro; Ishibashi, Daisuke; Nakagaki, Takehiro; Satoh, Katsuya; Sano, Kazunori; Atarashi, Ryuichiro; Nishida, Noriyuki

    2014-03-28

    Prion diseases are neurodegenerative disorders characterized by the aggregation of abnormally folded prion protein (PrP(Sc)). In this study, we focused on the mechanism of clearance of PrP(Sc), which remains unclear. p62 is a cytosolic protein known to mediate both the formation and degradation of aggregates of abnormal proteins. The levels of p62 protein increased in prion-infected brains and persistently infected cell cultures. Upon proteasome inhibition, p62 co-localized with PrP(Sc), forming a large aggregate in the perinuclear region, hereafter referred to as PrP(Sc)-aggresome. These aggregates were surrounded with autophagosome marker LC3 and lysosomes in prion-infected cells. Moreover, transient expression of the phosphomimic form of p62, which has enhanced ubiquitin-binding activity, reduced the amount of PrP(Sc) in prion-infected cells, indicating that the activation of p62 could accelerate the clearance of PrP(Sc). Our findings would thus suggest that p62 could be a target for the therapeutic control of prion diseases.

  7. Low copper and high manganese levels in prion protein plaques

    USGS Publications Warehouse

    Johnson, Christopher J.; Gilbert, P.U.P.A.; Abrecth, Mike; Baldwin, Katherine L.; Russell, Robin E.; Pedersen, Joel A.; McKenzie, Debbie

    2013-01-01

    Accumulation of aggregates rich in an abnormally folded form of the prion protein characterize the neurodegeneration caused by transmissible spongiform encephalopathies (TSEs). The molecular triggers of plaque formation and neurodegeneration remain unknown, but analyses of TSE-infected brain homogenates and preparations enriched for abnormal prion protein suggest that reduced levels of copper and increased levels of manganese are associated with disease. The objectives of this study were to: (1) assess copper and manganese levels in healthy and TSE-infected Syrian hamster brain homogenates; (2) determine if the distribution of these metals can be mapped in TSE-infected brain tissue using X-ray photoelectron emission microscopy (X-PEEM) with synchrotron radiation; and (3) use X-PEEM to assess the relative amounts of copper and manganese in prion plaques in situ. In agreement with studies of other TSEs and species, we found reduced brain levels of copper and increased levels of manganese associated with disease in our hamster model. We also found that the in situ levels of these metals in brainstem were sufficient to image by X-PEEM. Using immunolabeled prion plaques in directly adjacent tissue sections to identify regions to image by X-PEEM, we found a statistically significant relationship of copper-manganese dysregulation in prion plaques: copper was depleted whereas manganese was enriched. These data provide evidence for prion plaques altering local transition metal distribution in the TSE-infected central nervous system.

  8. Statistical Mechanics of Prion Diseases

    NASA Astrophysics Data System (ADS)

    Slepoy, A.; Singh, R. R.; Pázmándi, F.; Kulkarni, R. V.; Cox, D. L.

    2001-07-01

    We present a two-dimensional, lattice based, protein-level statistical mechanical model for prion diseases (e.g., mad cow disease) with concomitant prion protein misfolding and aggregation. Our studies lead us to the hypothesis that the observed broad incubation time distribution in epidemiological data reflect fluctuation dominated growth seeded by a few nanometer scale aggregates, while much narrower incubation time distributions for innoculated lab animals arise from statistical self-averaging. We model ``species barriers'' to prion infection and assess a related treatment protocol.

  9. Ethics in Prion Disease

    PubMed Central

    Bechtel, Kendra; Geschwind, Michael D.

    2013-01-01

    This paper is intended to discuss some of the scientific and ethical issues that are created by increased research efforts towards earlier diagnosis, as well as to treatment of, human prion diseases (and related dementias), including the resulting consequences for individuals, their families, and society. Most patients with prion disease currently are diagnosed when they are about 2/3 of the way through their disease course (Geschwind, Kuo et al. 2010; Paterson, Torres-Chae et al. 2012), when the disease has progressed so far that even treatments that stop the disease process would probably have little benefit. Although there are currently no treatments available for prion diseases, we and others have realized that we must diagnose patients earlier and with greater accuracy so that future treatments have hope of success. As approximately 15% of prion diseases have a autosomal dominant genetic etiology, this further adds to the complexity of ethical issues, particularly regarding when to conduct genetic testing, release of genetic results, and when or if to implement experimental therapies. Human prion diseases are both infectious and transmissible; great care is required to balance the needs of the family and individual with both public health needs and strained hospital budgets. It is essential to proactively examine and address the ethical issues involved, as well as to define and in turn provide best standards of care. PMID:23906487

  10. Bile Acids Reduce Prion Conversion, Reduce Neuronal Loss, and Prolong Male Survival in Models of Prion Disease

    PubMed Central

    Cortez, Leonardo M.; Campeau, Jody; Norman, Grant; Kalayil, Marian; Van der Merwe, Jacques; McKenzie, Debbie

    2015-01-01

    ABSTRACT Prion diseases are fatal neurodegenerative disorders associated with the conversion of cellular prion protein (PrPC) into its aberrant infectious form (PrPSc). There is no treatment available for these diseases. The bile acids tauroursodeoxycholic acid (TUDCA) and ursodeoxycholic acid (UDCA) have been recently shown to be neuroprotective in other protein misfolding disease models, including Parkinson's, Huntington's and Alzheimer's diseases, and also in humans with amyotrophic lateral sclerosis. Here, we studied the therapeutic efficacy of these compounds in prion disease. We demonstrated that TUDCA and UDCA substantially reduced PrP conversion in cell-free aggregation assays, as well as in chronically and acutely infected cell cultures. This effect was mediated through reduction of PrPSc seeding ability, rather than an effect on PrPC. We also demonstrated the ability of TUDCA and UDCA to reduce neuronal loss in prion-infected cerebellar slice cultures. UDCA treatment reduced astrocytosis and prolonged survival in RML prion-infected mice. Interestingly, these effects were limited to the males, implying a gender-specific difference in drug metabolism. Beyond effects on PrPSc, we found that levels of phosphorylated eIF2α were increased at early time points, with correlated reductions in postsynaptic density protein 95. As demonstrated for other neurodegenerative diseases, we now show that TUDCA and UDCA may have a therapeutic role in prion diseases, with effects on both prion conversion and neuroprotection. Our findings, together with the fact that these natural compounds are orally bioavailable, permeable to the blood-brain barrier, and U.S. Food and Drug Administration-approved for use in humans, make these compounds promising alternatives for the treatment of prion diseases. IMPORTANCE Prion diseases are fatal neurodegenerative diseases that are transmissible to humans and other mammals. There are no disease-modifying therapies available, despite decades

  11. The non-octarepeat copper binding site of the prion protein is a key regulator of prion conversion

    NASA Astrophysics Data System (ADS)

    Giachin, Gabriele; Mai, Phuong Thao; Tran, Thanh Hoa; Salzano, Giulia; Benetti, Federico; Migliorati, Valentina; Arcovito, Alessandro; Longa, Stefano Della; Mancini, Giordano; D'Angelo, Paola; Legname, Giuseppe

    2015-10-01

    The conversion of the prion protein (PrPC) into prions plays a key role in transmissible spongiform encephalopathies. Despite the importance for pathogenesis, the mechanism of prion formation has escaped detailed characterization due to the insoluble nature of prions. PrPC interacts with copper through octarepeat and non-octarepeat binding sites. Copper coordination to the non-octarepeat region has garnered interest due to the possibility that this interaction may impact prion conversion. We used X-ray absorption spectroscopy to study copper coordination at pH 5.5 and 7.0 in human PrPC constructs, either wild-type (WT) or carrying pathological mutations. We show that mutations and pH cause modifications of copper coordination in the non-octarepeat region. In the WT at pH 5.5, copper is anchored to His96 and His111, while at pH 7 it is coordinated by His111. Pathological point mutations alter the copper coordination at acidic conditions where the metal is anchored to His111. By using in vitro approaches, cell-based and computational techniques, we propose a model whereby PrPC coordinating copper with one His in the non-octarepeat region converts to prions at acidic condition. Thus, the non-octarepeat region may act as the long-sought-after prion switch, critical for disease onset and propagation.

  12. Prion 2005: Between Fundamentals and Society's Needs.

    PubMed

    Treiber, Carina

    2006-01-25

    Prion diseases for the most part affect individuals older than 60 years of age and share features with other diseases characterized by protein deposits in the brain, such as Alzheimer's disease and Parkinson's disease. The international conference "Prion 2005: Between Fundamentals and Society's Needs," organized by the German Transmissible Spongiform Encephalopathies Research Platform, aimed to integrate and coordinate the research efforts of participants to better achieve prevention, treatment, control, and management of prion diseases, including Creutzfeldt-Jakob disease and fatal familial insomnia in humans. Several main topics were discussed, such as the molecular characteristics of prion strains, the cell biology of cellular and pathogenic forms of the prion proteins, the pathogenesis of the diseases they cause, emerging problems, and promising approaches for therapy and new diagnostic tools. The presentations at the Prion 2005 conference provided new insights in both basic and applied research, which will have broad implications for society's needs.

  13. Selective propagation of mouse-passaged scrapie prions with long incubation period from a mixed prion population using GT1-7 cells

    PubMed Central

    Masujin, Kentaro; Okada, Hiroyuki; Ushiki-Kaku, Yuko; Matsuura, Yuichi; Yokoyama, Takashi

    2017-01-01

    In our previous study, we demonstrated the propagation of mouse-passaged scrapie isolates with long incubation periods (L-type) derived from natural Japanese sheep scrapie cases in murine hypothalamic GT1-7 cells, along with disease-associated prion protein (PrPSc) accumulation. We here analyzed the susceptibility of GT1-7 cells to scrapie prions by exposure to infected mouse brains at different passages, following interspecies transmission. Wild-type mice challenged with a natural sheep scrapie case (Kanagawa) exhibited heterogeneity of transmitted scrapie prions in early passages, and this mixed population converged upon one with a short incubation period (S-type) following subsequent passages. However, when GT1-7 cells were challenged with these heterologous samples, L-type prions became dominant. This study demonstrated that the susceptibility of GT1-7 cells to L-type prions was at least 105 times higher than that to S-type prions and that L-type prion-specific biological characteristics remained unchanged after serial passages in GT1-7 cells. This suggests that a GT1-7 cell culture model would be more useful for the economical and stable amplification of L-type prions at the laboratory level. Furthermore, this cell culture model might be used to selectively propagate L-type scrapie prions from a mixed prion population. PMID:28636656

  14. Resistance of Soil-Bound Prions to Rumen Digestion

    PubMed Central

    Saunders, Samuel E.; Bartelt-Hunt, Shannon L.; Bartz, Jason C.

    2012-01-01

    Before prion uptake and infection can occur in the lower gastrointestinal system, ingested prions are subjected to anaerobic digestion in the rumen of cervids and bovids. The susceptibility of soil-bound prions to rumen digestion has not been evaluated previously. In this study, prions from infectious brain homogenates as well as prions bound to a range of soils and soil minerals were subjected to in vitro rumen digestion, and changes in PrP levels were measured via western blot. Binding to clay appeared to protect noninfectious hamster PrPc from complete digestion, while both unbound and soil-bound infectious PrPSc proved highly resistant to rumen digestion. In addition, no change in intracerebral incubation period was observed following active rumen digestion of unbound hamster HY TME prions and HY TME prions bound to a silty clay loam soil. These results demonstrate that both unbound and soil-bound prions readily survive rumen digestion without a reduction in infectivity, further supporting the potential for soil-mediated transmission of chronic wasting disease (CWD) and scrapie in the environment. PMID:22937149

  15. Nanomedicine for prion disease treatment: new insights into the role of dendrimers.

    PubMed

    McCarthy, James M; Appelhans, Dietmar; Tatzelt, Jörg; Rogers, Mark S

    2013-01-01

    Despite their devastating impact, no effective therapeutic yet exists for prion diseases at the symptomatic stage in humans or animals. Progress is hampered by the difficulty in identifying compounds that affect PrP (Sc) and the necessity of any potential therapeutic to gain access to the CNS. Synthetic polymers known as dendrimers are a particularly promising candidate in this area. Studies with cell culture models of prion disease and prion infected brain homogenate have demonstrated that numerous species of dendrimers eliminate PrP (Sc) in a dose and time dependent fashion and specific glycodendrimers are capable of crossing the CNS. However, despite their potential a number of important questions remained unanswered such as what makes an effective dendrimer and how dendrimers eliminate prions intracellularly. In a number of recent studies we have tackled these questions and revealed for the first time that a specific dendrimer can inhibit the intracellular conversion of PrP (C) to PrP (Sc) and that a high density of surface reactive groups is a necessity for dendrimers in vitro anti-prion activity. Understanding how a therapeutic works is a vital component in maximising its activity and these studies therefore represent a significant development in the race to find effective treatments for prion diseases.

  16. RML prions act through Mahogunin and Attractin-independent pathways.

    PubMed

    Gunn, Teresa M; Carlson, George A

    2013-01-01

    While the conversion of the normal form of prion protein to a conformationally distinct pathogenic form is recognized to be the primary cause of prion disease, it is not clear how this leads to spongiform change, neuronal dysfunction and death. Mahogunin ring finger-1 (Mgrn1) and Attractin (Atrn) null mutant mice accumulate vacuoles throughout the brain that appear very similar to those associated with prion disease, but they do not accumulate the protease-resistant scrapie form of the prion protein or become sick. A study demonstrating an interaction between cytosolically-exposed prion protein and MGRN1 suggested that disruption of MGRN1 function may contribute to prion disease pathogenesis, but we recently showed that neither loss of MGRN1 nor MGRN1 overexpression influences the onset or progression of prion disease following intracerebral inoculation with Rocky Mountain Laboratory prions. Here, we show that loss of ATRN also has no effect on prion disease onset or progression and discuss possible mechanisms that could cause vacuolation of the central nervous system in Mgrn1 and Atrn null mutant mice and whether the same pathways might contribute to this intriguing phenotype in prion disease.

  17. Biological and biochemical characterization of mice expressing prion protein devoid of the octapeptide repeat region after infection with prions.

    PubMed

    Yamaguchi, Yoshitaka; Miyata, Hironori; Uchiyama, Keiji; Ootsuyama, Akira; Inubushi, Sachiko; Mori, Tsuyoshi; Muramatsu, Naomi; Katamine, Shigeru; Sakaguchi, Suehiro

    2012-01-01

    Accumulating lines of evidence indicate that the N-terminal domain of prion protein (PrP) is involved in prion susceptibility in mice. In this study, to investigate the role of the octapeptide repeat (OR) region alone in the N-terminal domain for the susceptibility and pathogenesis of prion disease, we intracerebrally inoculated RML scrapie prions into tg(PrPΔOR)/Prnp(0/0) mice, which express mouse PrP missing only the OR region on the PrP-null background. Incubation times of these mice were not extended. Protease-resistant PrPΔOR, or PrP(Sc)ΔOR, was easily detectable but lower in the brains of these mice, compared to that in control wild-type mice. Consistently, prion titers were slightly lower and astrogliosis was milder in their brains. However, in their spinal cords, PrP(Sc)ΔOR and prion titers were abundant and astrogliosis was as strong as in control wild-type mice. These results indicate that the role of the OR region in prion susceptibility and pathogenesis of the disease is limited. We also found that the PrP(Sc)ΔOR, including the pre-OR residues 23-50, was unusually protease-resistant, indicating that deletion of the OR region could cause structural changes to the pre-OR region upon prion infection, leading to formation of a protease-resistant structure for the pre-OR region.

  18. Soil clay content underlies prion infection odds

    USGS Publications Warehouse

    David, Walter W.; Walsh, D.P.; Farnsworth, Matthew L.; Winkelman, D.L.; Miller, M.W.

    2011-01-01

    Environmental factors-especially soil properties-have been suggested as potentially important in the transmission of infectious prion diseases. Because binding to montmorillonite (an aluminosilicate clay mineral) or clay-enriched soils had been shown to enhance experimental prion transmissibility, we hypothesized that prion transmission among mule deer might also be enhanced in ranges with relatively high soil clay content. In this study, we report apparent influences of soil clay content on the odds of prion infection in free-ranging deer. Analysis of data from prion-infected deer herds in northern Colorado, USA, revealed that a 1% increase in the clay-sized particle content in soils within the approximate home range of an individual deer increased its odds of infection by up to 8.9%. Our findings suggest that soil clay content and related environmental properties deserve greater attention in assessing risks of prion disease outbreaks and prospects for their control in both natural and production settings. ?? 2011 Macmillan Publishers Limited. All rights reserved.

  19. Soil clay content underlies prion infection odds

    PubMed Central

    David Walter, W.; Walsh, Daniel P.; Farnsworth, Matthew L.; Winkelman, Dana L.; Miller, Michael W.

    2011-01-01

    Environmental factors—especially soil properties—have been suggested as potentially important in the transmission of infectious prion diseases. Because binding to montmorillonite (an aluminosilicate clay mineral) or clay-enriched soils had been shown to enhance experimental prion transmissibility, we hypothesized that prion transmission among mule deer might also be enhanced in ranges with relatively high soil clay content. In this study, we report apparent influences of soil clay content on the odds of prion infection in free-ranging deer. Analysis of data from prion-infected deer herds in northern Colorado, USA, revealed that a 1% increase in the clay-sized particle content in soils within the approximate home range of an individual deer increased its odds of infection by up to 8.9%. Our findings suggest that soil clay content and related environmental properties deserve greater attention in assessing risks of prion disease outbreaks and prospects for their control in both natural and production settings. PMID:21326232

  20. Soil clay content underlies prion infection odds.

    PubMed

    David Walter, W; Walsh, Daniel P; Farnsworth, Matthew L; Winkelman, Dana L; Miller, Michael W

    2011-02-15

    Environmental factors-especially soil properties-have been suggested as potentially important in the transmission of infectious prion diseases. Because binding to montmorillonite (an aluminosilicate clay mineral) or clay-enriched soils had been shown to enhance experimental prion transmissibility, we hypothesized that prion transmission among mule deer might also be enhanced in ranges with relatively high soil clay content. In this study, we report apparent influences of soil clay content on the odds of prion infection in free-ranging deer. Analysis of data from prion-infected deer herds in northern Colorado, USA, revealed that a 1% increase in the clay-sized particle content in soils within the approximate home range of an individual deer increased its odds of infection by up to 8.9%. Our findings suggest that soil clay content and related environmental properties deserve greater attention in assessing risks of prion disease outbreaks and prospects for their control in both natural and production settings.

  1. Proximity of SCG10 and prion protein in membrane rafts.

    PubMed

    Iwamaru, Yoshifumi; Kitani, Hiroshi; Okada, Hiroyuki; Takenouchi, Takato; Shimizu, Yoshihisa; Imamura, Morikazu; Miyazawa, Kohtaro; Murayama, Yuichi; Hoover, Edward A; Yokoyama, Takashi

    2015-12-10

    The conversion of normal cellular prion protein (PrPC) into its pathogenic isoform (PrPSc) is an essential event in prion pathogenesis. In culture models, membrane rafts are suggested to play a critical role in PrPSc formation. To identify the candidate molecules capable of interacting with PrPC and facilitating PrPSc formation in membrane rafts, we applied a novel biochemical labelling method termed 'enzyme-mediated activation of radical sources (EMARS)'. EMARS was applied to the Lubrol WX insoluble detergent-resistant membrane fractions from mouse neuroblastoma (N2a) cells in which the surface PrPC was labeled with HRP-conjugated anti-PrP antibody. Two-dimensional Western blots of these preparations revealed biotinylated spots of approximately 20 kDa with an isoelectric point of 8.0-9.0. Liquid chromatography-tandem mass spectrometry analysis resulted in the identification of peptides containing SCG10, the neuron-specific microtubule regulator. Proximity of SCG10 and PrPC was confirmed using proximity ligation assay and co-immunoprecipitation assay. Transfection of persistently 22L prion infected N2a cells with SCG10 small interfering RNA reduced SCG10 expression but did not prevent PrPSc accumulation, indicating that SCG10 appears to be unrelated to PrPSc formation of 22L prion. Immunofluorescence and Western blot analyses showed reduced levels of SCG10 in the hippocampus of prion-infected mice, suggesting a possible association between SCG10 levels and the prion neuropathogenesis. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  2. Brain-water diffusion coefficients reflect the severity of inherited prion disease

    PubMed Central

    Hyare, H.; Wroe, S.; Siddique, D.; Webb, T.; Fox, N. C.; Stevens, J.; Collinge, J.; Yousry, T.; Thornton, J. S.

    2010-01-01

    Objective: Inherited prion diseases are progressive neurodegenerative conditions, characterized by cerebral spongiosis, gliosis, and neuronal loss, caused by mutations within the prion protein (PRNP) gene. We wished to assess the potential of diffusion-weighted MRI as a biomarker of disease severity in inherited prion diseases. Methods: Twenty-five subjects (mean age 45.2 years) with a known PRNP mutation including 19 symptomatic patients, 6 gene-positive asymptomatic subjects, and 7 controls (mean age 54.1 years) underwent conventional and diffusion-weighted MRI. An index of normalized brain volume (NBV) and region of interest (ROI) mean apparent diffusion coefficient (ADC) for the head of caudate, putamen, and pulvinar nuclei were recorded. ADC histograms were computed for whole brain (WB) and gray matter (GM) tissue fractions. Clinical assessment utilized standardized clinical scores. Mann-Whitney U test and regression analyses were performed. Results: Symptomatic patients exhibited an increased WB mean ADC (p = 0.006) and GM mean ADC (p = 0.024) compared to controls. Decreased NBV and increased mean ADC measures significantly correlated with clinical measures of disease severity. Using a stepwise multivariate regression procedure, GM mean ADC was an independent predictor of Clinician's Dementia Rating score (p = 0.001), Barthel Index of activities of daily living (p = 0.001), and Rankin disability score (p = 0.019). Conclusions: Brain volume loss in inherited prion diseases is accompanied by increased cerebral apparent diffusion coefficient (ADC), correlating with increased disease severity. The association between gray matter ADC and clinical neurologic status suggests this measure may prove a useful biomarker of disease activity in inherited prion diseases. GLOSSARY ADAS-Cog = Alzheimer's Disease Assessment Scale–Cognitive subscale; ADC = apparent diffusion coefficient; ADL = Barthel Activities of Daily Living scale; BET = brain extraction tool; BPRS

  3. A stretch of residues within the protease-resistant core is not necessary for prion structure and infectivity

    PubMed Central

    Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Igel-Egalon, Angelique; Barbereau, Clément; Chapuis, Jérôme; Ciric, Danica; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel

    2017-01-01

    ABSTRACT Mapping out regions of PrP influencing prion conversion remains a challenging issue complicated by the lack of prion structure. The portion of PrP associated with infectivity contains the α-helical domain of the correctly folded protein and turns into a β-sheet-rich insoluble core in prions. Deletions performed so far inside this segment essentially prevented the conversion. Recently we found that deletion of the last C-terminal residues of the helix H2 was fully compatible with prion conversion in the RK13-ovPrP cell culture model, using 3 different infecting strains. This was in agreement with preservation of the overall PrPC structure even after removal of up to one-third of this helix. Prions with internal deletion were infectious for cells and mice expressing the wild-type PrP and they retained prion strain-specific characteristics. We thus identified a piece of the prion domain that is neither necessary for the conformational transition of PrPC nor for the formation of a stable prion structure. PMID:28281924

  4. A stretch of residues within the protease-resistant core is not necessary for prion structure and infectivity.

    PubMed

    Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Igel-Egalon, Angelique; Barbereau, Clément; Chapuis, Jérôme; Ciric, Danica; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel

    2017-01-02

    Mapping out regions of PrP influencing prion conversion remains a challenging issue complicated by the lack of prion structure. The portion of PrP associated with infectivity contains the α-helical domain of the correctly folded protein and turns into a β-sheet-rich insoluble core in prions. Deletions performed so far inside this segment essentially prevented the conversion. Recently we found that deletion of the last C-terminal residues of the helix H2 was fully compatible with prion conversion in the RK13-ovPrP cell culture model, using 3 different infecting strains. This was in agreement with preservation of the overall PrP C structure even after removal of up to one-third of this helix. Prions with internal deletion were infectious for cells and mice expressing the wild-type PrP and they retained prion strain-specific characteristics. We thus identified a piece of the prion domain that is neither necessary for the conformational transition of PrP C nor for the formation of a stable prion structure.

  5. Chimeric elk/mouse prion proteins in transgenic mice.

    PubMed

    Tamgüney, Gültekin; Giles, Kurt; Oehler, Abby; Johnson, Natrina L; DeArmond, Stephen J; Prusiner, Stanley B

    2013-02-01

    Chronic wasting disease (CWD) of deer and elk is a highly communicable neurodegenerative disorder caused by prions. Investigations of CWD are hampered by slow bioassays in transgenic (Tg) mice. Towards the development of Tg mice that will be more susceptible to CWD prions, we created a series of chimeric elk/mouse transgenes that encode the N terminus of elk PrP (ElkPrP) up to residue Y168 and the C terminus of mouse PrP (MoPrP) beyond residue 169 (mouse numbering), designated Elk3M(SNIVVK). Between codons 169 and 219, six residues distinguish ElkPrP from MoPrP: N169S, T173N, V183I, I202V, I214V and R219K. Using chimeric elk/mouse PrP constructs, we generated 12 Tg mouse lines and determined incubation times after intracerebral inoculation with the mouse-passaged RML scrapie or Elk1P CWD prions. Unexpectedly, one Tg mouse line expressing Elk3M(SNIVVK) exhibited incubation times of <70 days when inoculated with RML prions; a second line had incubation times of <90 days. In contrast, mice expressing full-length ElkPrP had incubation periods of >250 days for RML prions. Tg(Elk3M,SNIVVK) mice were less susceptible to CWD prions than Tg(ElkPrP) mice. Changing three C-terminal mouse residues (202, 214 and 219) to those of elk doubled the incubation time for mouse RML prions and rendered the mice resistant to Elk1P CWD prions. Mutating an additional two residues from mouse to elk at codons 169 and 173 increased the incubation times for mouse prions to >300 days, but made the mice susceptible to CWD prions. Our findings highlight the role of C-terminal residues in PrP that control the susceptibility and replication of prions.

  6. Acquisition of Drug Resistance and Dependence by Prions

    PubMed Central

    Oelschlegel, Anja M.; Weissmann, Charles

    2013-01-01

    We have reported that properties of prion strains may change when propagated in different environments. For example, when swainsonine-sensitive 22L prions were propagated in PK1 cells in the presence of swainsonine, drug-resistant variants emerged. We proposed that prions constitute quasi- populations comprising a range of variants with different properties, from which the fittest are selected in a particular environment. Prion populations developed heterogeneity even after biological cloning, indicating that during propagation mutation-like processes occur at the conformational level. Because brain-derived 22L prions are naturally swainsonine resistant, it was not too surprising that prions which had become swa sensitive after propagation in cells could revert to drug resistance. Because RML prions, both after propagation in brain or in PK1 cells, are swainsonine sensitive, we investigated whether it was nonetheless possible to select swainsonine-resistant variants by propagation in the presence of the drug. Interestingly, this was not possible with the standard line of PK1 cells, but in certain PK1 sublines not only swainsonine-resistant, but even swainsonine-dependent populations (i.e. that propagated more rapidly in the presence of the drug) could be isolated. Once established, they could be passaged indefinitely in PK1 cells, even in the absence of the drug, without losing swainsonine dependence. The misfolded prion protein (PrPSc) associated with a swainsonine-dependent variant was less rapidly cleared in PK1 cells than that associated with its drug-sensitive counterpart, indicating that likely structural differences of the misfolded PrP underlie the properties of the prions. In summary, propagation of prions in the presence of an inhibitory drug may not only cause the selection of drug-resistant prions but even of stable variants that propagate more efficiently in the presence of the drug. These adaptations are most likely due to conformational changes of

  7. Prion Amplification and Hierarchical Bayesian Modeling Refine Detection of Prion Infection

    NASA Astrophysics Data System (ADS)

    Wyckoff, A. Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J.; Pulford, Bruce; Wild, Margaret; Antolin, Michael; Vercauteren, Kurt; Zabel, Mark

    2015-02-01

    Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.

  8. Prion amplification and hierarchical Bayesian modeling refine detection of prion infection.

    PubMed

    Wyckoff, A Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J; Pulford, Bruce; Wild, Margaret; Antolin, Michael; VerCauteren, Kurt; Zabel, Mark

    2015-02-10

    Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.

  9. Increased Abundance of M Cells in the Gut Epithelium Dramatically Enhances Oral Prion Disease Susceptibility.

    PubMed

    Donaldson, David S; Sehgal, Anuj; Rios, Daniel; Williams, Ifor R; Mabbott, Neil A

    2016-12-01

    Many natural prion diseases of humans and animals are considered to be acquired through oral consumption of contaminated food or pasture. Determining the route by which prions establish host infection will identify the important factors that influence oral prion disease susceptibility and to which intervention strategies can be developed. After exposure, the early accumulation and replication of prions within small intestinal Peyer's patches is essential for the efficient spread of disease to the brain. To replicate within Peyer's patches, the prions must first cross the gut epithelium. M cells are specialised epithelial cells within the epithelia covering Peyer's patches that transcytose particulate antigens and microorganisms. M cell-development is dependent upon RANKL-RANK-signalling, and mice in which RANK is deleted only in the gut epithelium completely lack M cells. In the specific absence of M cells in these mice, the accumulation of prions within Peyer's patches and the spread of disease to the brain was blocked, demonstrating a critical role for M cells in the initial transfer of prions across the gut epithelium in order to establish host infection. Since pathogens, inflammatory stimuli and aging can modify M cell-density in the gut, these factors may also influence oral prion disease susceptibility. Mice were therefore treated with RANKL to enhance M cell density in the gut. We show that prion uptake from the gut lumen was enhanced in RANKL-treated mice, resulting in shortened survival times and increased disease susceptibility, equivalent to a 10-fold higher infectious titre of prions. Together these data demonstrate that M cells are the critical gatekeepers of oral prion infection, whose density in the gut epithelium directly limits or enhances disease susceptibility. Our data suggest that factors which alter M cell-density in the gut epithelium may be important risk factors which influence host susceptibility to orally acquired prion diseases.

  10. Selfish prion of Rnq1 mutant in yeast.

    PubMed

    Kurahashi, Hiroshi; Shibata, Shoichiro; Ishiwata, Masao; Nakamura, Yoshikazu

    2009-05-01

    [PIN(+)] is a prion form of Rnq1 in Saccharomyces cerevisiae and is necessary for the de novo induction of a second prion, [PSI(+)]. We previously isolated a truncated form of Rnq1, named Rnq1Delta100, as a [PSI(+)]-eliminating factor in S. cerevisiae. Rnq1Delta100 deletes the N-terminal non-prion domain of Rnq1, and eliminates [PSI(+)] in [PIN(+)] yeast. Here we found that [PIN(+)] is transmissible to Rnq1Delta100 in the absence of full-length Rnq1, forming a novel prion variant [RNQ1Delta100(+)]. [RNQ1Delta100(+)] has similar [PIN(+)] properties as it stimulates the de novo induction of [PSI(+)] and is eliminated by the null hsp104Delta mutation, but not by Hsp104 overproduction. In contrast, [RNQ1Delta100(+)] inherits the inhibitory activity and hampers the maintenance of [PSI(+)] though less efficiently than [PIN(+)] made of Rnq1-Rnq1Delta100 co-aggregates. Interestingly, [RNQ1Delta100(+)] prion was eliminated by de novo [PSI(+)] induction. Thus, the [RNQ1Delta100(+)] prion demonstrates selfish activity to eliminate a heterologous prion in S. cerevisiae, showing the first instance of a selfish prion variant in living organisms.

  11. Physical, chemical and kinetic factors affecting prion infectivity

    PubMed Central

    Properzi, Francesca; Badhan, Anjna; Klier, Steffi; Schmidt, Christian; Klöhn, Peter C.; Wadsworth, Jonathan D. F.; Clarke, Anthony R.; Jackson, Graham S.; Collinge, John

    2016-01-01

    ABSTRACT The mouse-adapted scrapie prion strain RML is one of the most widely used in prion research. The introduction of a cell culture-based assay of RML prions, the scrapie cell assay (SCA) allows more rapid and precise prion titration. A semi-automated version of this assay (ASCA) was applied to explore a range of conditions that might influence the infectivity and properties of RML prions. These include resistance to freeze-thaw procedures; stability to endogenous proteases in brain homogenate despite prolonged exposure to varying temperatures; distribution of infective material between pellet and supernatant after centrifugation, the effect of reducing agents and the influence of detergent additives on the efficiency of infection. Apparent infectivity is increased significantly by interaction with cationic detergents. Importantly, we have also elucidated the relationship between the duration of exposure of cells to RML prions and the transmission of infection. We established that the infection process following contact of cells with RML prions is rapid and followed an exponential time course, implying a single rate-limiting process. PMID:27282252

  12. Physical, chemical and kinetic factors affecting prion infectivity.

    PubMed

    Properzi, Francesca; Badhan, Anjna; Klier, Steffi; Schmidt, Christian; Klöhn, Peter C; Wadsworth, Jonathan D F; Clarke, Anthony R; Jackson, Graham S; Collinge, John

    2016-05-03

    The mouse-adapted scrapie prion strain RML is one of the most widely used in prion research. The introduction of a cell culture-based assay of RML prions, the scrapie cell assay (SCA) allows more rapid and precise prion titration. A semi-automated version of this assay (ASCA) was applied to explore a range of conditions that might influence the infectivity and properties of RML prions. These include resistance to freeze-thaw procedures; stability to endogenous proteases in brain homogenate despite prolonged exposure to varying temperatures; distribution of infective material between pellet and supernatant after centrifugation, the effect of reducing agents and the influence of detergent additives on the efficiency of infection. Apparent infectivity is increased significantly by interaction with cationic detergents. Importantly, we have also elucidated the relationship between the duration of exposure of cells to RML prions and the transmission of infection. We established that the infection process following contact of cells with RML prions is rapid and followed an exponential time course, implying a single rate-limiting process.

  13. Sod1 deficiency reduces incubation time in mouse models of prion disease.

    PubMed

    Akhtar, Shaheen; Grizenkova, Julia; Wenborn, Adam; Hummerich, Holger; Fernandez de Marco, Mar; Brandner, Sebastian; Collinge, John; Lloyd, Sarah E

    2013-01-01

    Prion infections, causing neurodegenerative conditions such as Creutzfeldt-Jakob disease and kuru in humans, scrapie in sheep and BSE in cattle are characterised by prolonged and variable incubation periods that are faithfully reproduced in mouse models. Incubation time is partly determined by genetic factors including polymorphisms in the prion protein gene. Quantitative trait loci studies in mice and human genome-wide association studies have confirmed that multiple genes are involved. Candidate gene approaches have also been used and identified App, Il1-r1 and Sod1 as affecting incubation times. In this study we looked for an association between App, Il1-r1 and Sod1 representative SNPs and prion disease incubation time in the Northport heterogeneous stock of mice inoculated with the Chandler/RML prion strain. No association was seen with App, however, significant associations were seen with Il1-r1 (P = 0.02) and Sod1 (P<0.0001) suggesting that polymorphisms at these loci contribute to the natural variation observed in incubation time. Furthermore, following challenge with Chandler/RML, ME7 and MRC2 prion strains, Sod1 deficient mice showed highly significant reductions in incubation time of 20, 13 and 24%, respectively. No differences were detected in Sod1 expression or activity. Our data confirm the protective role of endogenous Sod1 in prion disease.

  14. A closer look at prion strains: characterization and important implications.

    PubMed

    Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto

    2013-01-01

    Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrP (Sc) ), a pathogenic isoform of the host-encoded cellular prion protein (PrP (C) ). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrP (Sc) conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrP (Sc) biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves.

  15. The influence of PRNP polymorphisms on human prion disease susceptibility: an update.

    PubMed

    Kobayashi, Atsushi; Teruya, Kenta; Matsuura, Yuichi; Shirai, Tsuyoshi; Nakamura, Yoshikazu; Yamada, Masahito; Mizusawa, Hidehiro; Mohri, Shirou; Kitamoto, Tetsuyuki

    2015-08-01

    Two normally occurring polymorphisms of the human PRNP gene, methionine (M)/valine (V) at codon 129 and glutamic acid (E)/lysine (K) at codon 219, can affect the susceptibility to prion diseases. It has long been recognized that 129M/M homozygotes are overrepresented in sporadic Creutzfeldt-Jakob disease (CJD) patients and variant CJD patients, whereas 219E/K heterozygotes are absent in sporadic CJD patients. In addition to these pioneering findings, recent progress in experimental transmission studies and worldwide surveillance of prion diseases have identified novel relationships between the PRNP polymorphisms and the prion disease susceptibility. For example, although 219E/K heterozygosity confers resistance against the development of sporadic CJD, this genotype is not entirely protective against acquired forms (iatrogenic CJD and variant CJD) or genetic forms (genetic CJD and Gerstmann-Sträussler-Scheinker syndrome) of prion diseases. In addition, 129M/V heterozygotes predispose to genetic CJD caused by a pathogenic PRNP mutation at codon 180. These findings show that the effects of the PRNP polymorphisms may be more complicated than previously thought. This review aims to summarize recent advances in our knowledge about the influence of the PRNP polymorphisms on the prion disease susceptibility.

  16. Disease Transmission by Misfolded Prion-Protein Isoforms, Prion-Like Amyloids, Functional Amyloids and the Central Dogma

    PubMed Central

    Daus, Martin L.

    2016-01-01

    In 1982, the term “prions” (proteinaceous infectious particles) was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE) was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid) can store and transmit information similarly to DNA was initially even denoted as being “heretical” but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the “protein-only hypothesis” expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed. PMID:26742083

  17. Unique properties of the classical bovine spongiform encephalopathy strain and its emergence from H-type bovine spongiform encephalopathy substantiated by VM transmission studies.

    PubMed

    Bencsik, Anna; Leboidre, Mikael; Debeer, Sabine; Aufauvre, Claire; Baron, Thierry

    2013-03-01

    In addition to classical bovine spongiform encephalopathy (C-BSE), which is recognized as being at the origin of the human variant form of Creutzfeldt-Jakob disease, 2 rare phenotypes of BSE (H-type BSE [H-BSE] and L-type BSE [L-BSE]) were identified in 2004. H-type BSE and L-BSE are considered to be sporadic forms of prion disease in cattle because they differ from C-BSE with respect to incubation period, vacuolar pathology in the brain, and biochemical properties of the protease-resistant prion protein (PrP) in natural hosts and in some mouse models that have been tested. Recently, we showed that H-BSE transmitted to C57Bl/6 mice resulted in a dissociation of the phenotypic features, that is, some mice showed an H-BSE phenotype, whereas others had a C-BSE phenotype. Here, these 2 phenotypes were further studied in VM mice and compared with cattle C-BSE, H-BSE, and L-BSE. Serial passages from the C-BSE-like phenotype on VM mice retained similarities with C-BSE. Moreover, our results indicate that strains 301V and 301C derived from C-BSE transmitted to VM and C57Bl/6 mice, respectively, are fundamentally the same strain. These VM transmission studies confirm the unique properties of the C-BSE strain and support the emergence of a strain that resembles C-BSE from H-BSE.

  18. Detecting and quantifying prions: Mass spectrometry-based approaches

    USDA-ARS?s Scientific Manuscript database

    Prions are novel pathogens that cause a set of rare fatal neurological diseases know as transmissible spongiform encephalopathies. Examples of these diseases include Creutzfeldt-Jakob disease, scrapie and chronic wasting disease. Prions are able to recruit a normal cellular prion protein and convert...

  19. A Sequence-Dependent DNA Condensation Induced by Prion Protein

    PubMed Central

    2018-01-01

    Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis. PMID:29657864

  20. A Sequence-Dependent DNA Condensation Induced by Prion Protein.

    PubMed

    Bera, Alakesh; Biring, Sajal

    2018-01-01

    Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis.

  1. Animal models for testing anti-prion drugs.

    PubMed

    Fernández-Borges, Natalia; Elezgarai, Saioa R; Eraña, Hasier; Castilla, Joaquín

    2013-01-01

    Prion diseases belong to a group of fatal infectious diseases with no effective therapies available. Throughout the last 35 years, less than 50 different drugs have been tested in different experimental animal models without hopeful results. An important limitation when searching for new drugs is the existence of appropriate models of the disease. The three different possible origins of prion diseases require the existence of different animal models for testing anti-prion compounds. Wild type, over-expressing transgenic mice and other more sophisticated animal models have been used to evaluate a diversity of compounds which some of them were previously tested in different in vitro experimental models. The complexity of prion diseases will require more pre-screening studies, reliable sporadic (or spontaneous) animal models and accurate chemical modifications of the selected compounds before having an effective therapy against human prion diseases. This review is intended to put on display the more relevant animal models that have been used in the search of new antiprion therapies and describe some possible procedures when handling chemical compounds presumed to have anti-prion activity prior to testing them in animal models.

  2. Identification of Alprenolol Hydrochloride as an Anti-prion Compound Using Surface Plasmon Resonance Imaging.

    PubMed

    Miyazaki, Yukiko; Ishikawa, Takeshi; Kamatari, Yuji O; Nakagaki, Takehiro; Takatsuki, Hanae; Ishibashi, Daisuke; Kuwata, Kazuo; Nishida, Noriyuki; Atarashi, Ryuichiro

    2018-04-27

    Prion diseases are transmissible neurodegenerative disorders of humans and animals, which are characterized by the aggregation of abnormal prion protein (PrP Sc ) in the central nervous system. Although several small compounds that bind to normal PrP (PrP C ) have been shown to inhibit structural conversion of the protein, an effective therapy for human prion disease remains to be established. In this study, we screened 1200 existing drugs approved by the US Food and Drug Administration (FDA) for anti-prion activity using surface plasmon resonance imaging (SPRi). Of these drugs, 31 showed strong binding activity to recombinant human PrP, and three of these reduced the accumulation of PrP Sc in prion-infected cells. One of the active compounds, alprenolol hydrochloride, which is used clinically as a β-adrenergic blocker for hypertension, also reduced the accumulation of PrP Sc in the brains of prion-infected mice at the middle stage of the disease when the drug was administered orally with their daily water from the day after infection. Docking simulation analysis suggested that alprenolol hydrochloride fitted into the hotspot within mouse PrP C , which is known as the most fragile structure within the protein. These findings provide evidence that SPRi is useful in identifying effective drug candidates for neurodegenerative diseases caused by abnormal protein aggregation, such as prion diseases.

  3. New insights into structural determinants of prion protein folding and stability.

    PubMed

    Benetti, Federico; Legname, Giuseppe

    2015-01-01

    Prions are the etiological agent of fatal neurodegenerative diseases called prion diseases or transmissible spongiform encephalopathies. These maladies can be sporadic, genetic or infectious disorders. Prions are due to post-translational modifications of the cellular prion protein leading to the formation of a β-sheet enriched conformer with altered biochemical properties. The molecular events causing prion formation in sporadic prion diseases are still elusive. Recently, we published a research elucidating the contribution of major structural determinants and environmental factors in prion protein folding and stability. Our study highlighted the crucial role of octarepeats in stabilizing prion protein; the presence of a highly enthalpically stable intermediate state in prion-susceptible species; and the role of disulfide bridge in preserving native fold thus avoiding the misfolding to a β-sheet enriched isoform. Taking advantage from these findings, in this work we present new insights into structural determinants of prion protein folding and stability.

  4. The physical basis of how prion conformations determine strain phenotypes

    NASA Astrophysics Data System (ADS)

    Tanaka, Motomasa; Collins, Sean R.; Toyama, Brandon H.; Weissman, Jonathan S.

    2006-08-01

    A principle that has emerged from studies of protein aggregation is that proteins typically can misfold into a range of different aggregated forms. Moreover, the phenotypic and pathological consequences of protein aggregation depend critically on the specific misfolded form. A striking example of this is the prion strain phenomenon, in which prion particles composed of the same protein cause distinct heritable states. Accumulating evidence from yeast prions such as [PSI+] and mammalian prions argues that differences in the prion conformation underlie prion strain variants. Nonetheless, it remains poorly understood why changes in the conformation of misfolded proteins alter their physiological effects. Here we present and experimentally validate an analytical model describing how [PSI+] strain phenotypes arise from the dynamic interaction among the effects of prion dilution, competition for a limited pool of soluble protein, and conformation-dependent differences in prion growth and division rates. Analysis of three distinct prion conformations of yeast Sup35 (the [PSI+] protein determinant) and their in vivo phenotypes reveals that the Sup35 amyloid causing the strongest phenotype surprisingly shows the slowest growth. This slow growth, however, is more than compensated for by an increased brittleness that promotes prion division. The propensity of aggregates to undergo breakage, thereby generating new seeds, probably represents a key determinant of their physiological impact for both infectious (prion) and non-infectious amyloids.

  5. Fungal prion HET-s as a model for structural complexity and self-propagation in prions.

    PubMed

    Wan, William; Stubbs, Gerald

    2014-04-08

    The highly ordered and reproducible structure of the fungal prion HET-s makes it an excellent model system for studying the inherent properties of prions, self-propagating infectious proteins that have been implicated in a number of fatal diseases. In particular, the HET-s prion-forming domain readily folds into a relatively complex two-rung β-solenoid amyloid. The faithful self-propagation of this fold involves a diverse array of inter- and intramolecular structural features. These features include a long flexible loop connecting the two rungs, buried polar residues, salt bridges, and asparagine ladders. We have used site-directed mutagenesis and X-ray fiber diffraction to probe the relative importance of these features for the formation of β-solenoid structure, as well as the cumulative effects of multiple mutations. Using fibrillization kinetics and chemical stability assays, we have determined the biophysical effects of our mutations on the assembly and stability of the prion-forming domain. We have found that a diversity of structural features provides a level of redundancy that allows robust folding and stability even in the face of significant sequence alterations and suboptimal environmental conditions. Our findings provide fundamental insights into the structural interactions necessary for self-propagation. Propagation of prion structure seems to require an obligatory level of complexity that may not be reproducible in short peptide models.

  6. Primary transmission of chronic wasting disease versus scrapie prions from small ruminants to transgenic mice expressing ovine and cervid prion protein

    USDA-ARS?s Scientific Manuscript database

    Identifying transmissible spongiform encephalopathy (TSE) reservoirs that could lead to disease re-emergence is imperative to U.S. scrapie eradication efforts. Transgenic mice expressing the cervid (TgElk) or ovine (Tg338) prion protein have aided characterization of chronic wasting disease (CWD) an...

  7. Increased Abundance of M Cells in the Gut Epithelium Dramatically Enhances Oral Prion Disease Susceptibility

    PubMed Central

    Sehgal, Anuj; Rios, Daniel

    2016-01-01

    Many natural prion diseases of humans and animals are considered to be acquired through oral consumption of contaminated food or pasture. Determining the route by which prions establish host infection will identify the important factors that influence oral prion disease susceptibility and to which intervention strategies can be developed. After exposure, the early accumulation and replication of prions within small intestinal Peyer’s patches is essential for the efficient spread of disease to the brain. To replicate within Peyer’s patches, the prions must first cross the gut epithelium. M cells are specialised epithelial cells within the epithelia covering Peyer’s patches that transcytose particulate antigens and microorganisms. M cell-development is dependent upon RANKL-RANK-signalling, and mice in which RANK is deleted only in the gut epithelium completely lack M cells. In the specific absence of M cells in these mice, the accumulation of prions within Peyer’s patches and the spread of disease to the brain was blocked, demonstrating a critical role for M cells in the initial transfer of prions across the gut epithelium in order to establish host infection. Since pathogens, inflammatory stimuli and aging can modify M cell-density in the gut, these factors may also influence oral prion disease susceptibility. Mice were therefore treated with RANKL to enhance M cell density in the gut. We show that prion uptake from the gut lumen was enhanced in RANKL-treated mice, resulting in shortened survival times and increased disease susceptibility, equivalent to a 10-fold higher infectious titre of prions. Together these data demonstrate that M cells are the critical gatekeepers of oral prion infection, whose density in the gut epithelium directly limits or enhances disease susceptibility. Our data suggest that factors which alter M cell-density in the gut epithelium may be important risk factors which influence host susceptibility to orally acquired prion diseases

  8. Disturbed vesicular trafficking of membrane proteins in prion disease.

    PubMed

    Uchiyama, Keiji; Miyata, Hironori; Sakaguchi, Suehiro

    2013-01-01

    The pathogenic mechanism of prion diseases remains unknown. We recently reported that prion infection disturbs post-Golgi trafficking of certain types of membrane proteins to the cell surface, resulting in reduced surface expression of membrane proteins and abrogating the signal from the proteins. The surface expression of the membrane proteins was reduced in the brains of mice inoculated with prions, well before abnormal symptoms became evident. Prions or pathogenic prion proteins were mainly detected in endosomal compartments, being particularly abundant in recycling endosomes. Some newly synthesized membrane proteins are delivered to the surface from the Golgi apparatus through recycling endosomes, and some endocytosed membrane proteins are delivered back to the surface through recycling endosomes. These results suggest that prions might cause neuronal dysfunctions and cell loss by disturbing post-Golgi trafficking of membrane proteins via accumulation in recycling endosomes. Interestingly, it was recently shown that delivery of a calcium channel protein to the cell surface was impaired and its function was abrogated in a mouse model of hereditary prion disease. Taken together, these results suggest that impaired delivery of membrane proteins to the cell surface is a common pathogenic event in acquired and hereditary prion diseases.

  9. Chronic wasting disease prion infection of differentiated neurospheres.

    PubMed

    Iwamaru, Yoshifumi; Mathiason, Candace K; Telling, Glenn C; Hoover, Edward A

    2017-07-04

    A possible strategy to develop more diverse cell culture systems permissive to infection with naturally occurring prions is to exploit culture of neurospheres from transgenic mice expressing the normal prion protein (PrP) of the native host species. Accordingly, we developed differentiated neurosphere cultures from the cervid PrP-expressing mice to investigate whether this in vitro system would support replication of non-adapted cervid-origin chronic wasting disease (CWD) prions. Here we report the successful amplification of disease-associated PrP in differentiated neurosphere cultures within 3 weeks after exposure to CWD prions from both white-tailed deer or elk. This neurosphere culture system provides a new in vitro tool that can be used to assess non-adapted CWD prion propagation and transmission.

  10. Prion search and cellular prion protein expression in stranded dolphins.

    PubMed

    Di Guardo, G; Cocumelli, C; Meoli, R; Barbaro, K; Terracciano, G; Di Francesco, C E; Mazzariol, S; Eleni, C

    2012-01-01

    The recent description of a prion disease (PD) case in a free-ranging bottlenose dolphin (Tursiops truncatus) prompted us to carry out an extensive search for the disease-associated isoform (PrPSc) of the cellular prion protein (PrPC) in the brain and in a range of lymphoid tissues from 23 striped dolphins (Stenella coeruleoalba), 5 bottlenose dolphins and 2 Risso s dolphins (Grampus griseus) found stranded between 2007 and 2012 along the Italian coastline. Three striped dolphins and one bottlenose dolphin showed microscopic lesions of encephalitis, with no evidence of spongiform brain lesions being detected in any of the 30 free-ranging cetaceans investigated herein. Nevertheless, we could still observe a prominent PrPC immunoreactivity in the brain as well as in lymphoid tissues from these dolphins. Although immunohistochemical and Western blot investigations yielded negative results for PrPSc deposition in all tissues from the dolphins under study, the reported occurrence of a spontaneous PD case in a wild dolphin is an intriguing issue and a matter of concern for both prion biology and intra/inter-species transmissibility, as well as for cetacean conservation medicine.

  11. Prion Disease Induces Alzheimer Disease-Like Neuropathologic Changes

    PubMed Central

    Tousseyn, Thomas; Bajsarowicz, Krystyna; Sánchez, Henry; Gheyara, Ania; Oehler, Abby; Geschwind, Michael; DeArmond, Bernadette; DeArmond, Stephen J.

    2016-01-01

    We examined the brains of 266 patients with prion diseases (PrionD) and found that 46 (17%) had Alzheimer disease (AD)-like changes. To explore potential mechanistic links between PrionD and AD, we exposed human brain aggregates (Hu BrnAggs) to brain homogenate from a patient with sporadic Creutzfeldt-Jakob disease (CJD) and found that the neurons in the Hu BrnAggs produced many β-amyloid (β42) inclusions, whereas uninfected, control-exposed Hu BrnAggs did not. Western blots of 20-pooled CJD-infected BrnAggs verified higher Aβ42 levels than controls. We next examined the CA1 region of the hippocampus from 14 patients with PrionD and found that 5 patients had low levels of scrapie-associated prion protein (PrPSc), many Aβ42 intraneuronal inclusions, low APOE-4, and no significant nerve cell loss. Seven patients had high levels of PrPSc, low Aβ42, high APOE-4 and 40% nerve cell loss, suggesting that APOE-4 and PrPSc together cause neuron loss in PrionD. There were also increased levels of hyperphosphorylated tau protein (Hτ) and Hτ-positive neuropil threads and neuron bodies in both PrionD and AD groups. The brains of 6 age-matched control patients without dementia did not contain Aβ42 deposits; however, there were rare Hτ-positive threads in 5 controls and 2 controls had a few Hτ-positive nerve cell bodies. We conclude that PrionD may trigger biochemical changes similar to AD and suggest that PrionD are diseases of PrPSc, Aβ42, APOE-4 and abnormal tau. PMID:26226132

  12. Attachment of Pathogenic Prion Protein to Model Oxide Surfaces

    PubMed Central

    Jacobson, Kurt H.; Kuech, Thomas R.; Pedersen, Joel A.

    2014-01-01

    Prions are the infectious agents in the class of fatal neurodegenerative diseases known as transmissible spongiform encephalopathies, which affect humans, deer, sheep, and cattle. Prion diseases of deer and sheep can be transmitted via environmental routes, and soil is has been implicated in the transmission of these diseases. Interaction with soil particles is expected to govern the transport, bioavailability and persistence of prions in soil environments. A mechanistic understanding of prion interaction with soil components is critical for understanding the behavior of these proteins in the environment. Here, we report results of a study to investigate the interactions of prions with model oxide surfaces (Al2O3, SiO2) using quartz crystal microbalance with dissipation monitoring and optical waveguide light mode spectroscopy. The efficiency of prion attachment to Al2O3 and SiO2 depended strongly on pH and ionic strength in a manner consistent with electrostatic forces dominating interaction with these oxides. The N-terminal portion of the protein appeared to facilitate attachment to Al2O3 under globally electrostatically repulsive conditions. We evaluated the utility of recombinant prion protein as a surrogate for prions in attachment experiments and found that its behavior differed markedly from that of the infectious agent. Our findings suggest that prions preferentially associate with positively charged mineral surfaces in soils (e.g., iron and aluminum oxides). PMID:23611152

  13. Cross-species transmission of CWD prions.

    PubMed

    Kurt, Timothy D; Sigurdson, Christina J

    2016-01-01

    Prions cause fatal neurodegenerative diseases in humans and animals and can be transmitted zoonotically. Chronic wasting disease (CWD) is a highly transmissible prion disease of wild deer and elk that affects cervids over extensive regions of the United States and Canada. The risk of cross-species CWD transmission has been experimentally evaluated in a wide array of mammals, including non-human primates and mouse models expressing human cellular prion protein. Here we review the determinants of cross-species CWD transmission, and propose a model that may explain a structural barrier for CWD transmission to humans.

  14. Fate of Prions in Soil: A Review

    PubMed Central

    Smith, Christen B.; Booth, Clarissa J.; Pedersen, Joel A.

    2011-01-01

    Prions are the etiological agents of transmissible spongiform encephalopathies (TSEs), a class of fatal neurodegenerative diseases affecting humans and other mammals. The pathogenic prion protein is a misfolded form of the host-encoded prion protein and represents the predominant, if not sole, component of the infectious agent. Environmental routes of TSE transmission are implicated in epizootics of sheep scrapie and chronic wasting disease (CWD) of deer, elk, and moose. Soil represents a plausible environmental reservoir of scrapie and CWD agents, which can persist in the environment for years. Attachment to soil particles likely influences the persistence and infectivity of prions in the environment. Effective methods to inactivate TSE agents in soil are currently lacking, and the effects of natural degradation mechanisms on TSE infectivity are largely unknown. An improved understanding of the processes affecting the mobility, persistence, and bioavailability of prions in soil is needed for the management of TSE-contaminated environments. PMID:21520752

  15. PrPC expression and prion seeding activity in the alimentary tract and lymphoid tissue of deer

    PubMed Central

    Davenport, Kristen A.; Hoover, Clare E.; Bian, Jifeng; Telling, Glenn C.; Mathiason, Candace K.; Hoover, Edward A.

    2017-01-01

    The agent responsible for prion diseases is a misfolded form of a normal protein (PrPC). The prion hypothesis stipulates that PrPC must be present for the disease to manifest. Cervid populations across the world are infected with chronic wasting disease, a horizontally-transmissible prion disease that is likely spread via oral exposure to infectious prions (PrPCWD). Though PrPCWD has been identified in many tissues, there has been little effort to characterize the overall PrPC expression in cervids and its relationship to PrPCWD accumulation. We used immunohistochemistry (IHC), western blot and enzyme-linked immunosorbent assay to describe PrPC expression in naïve white-tailed deer. We used real-time, quaking-induced conversion (RT-QuIC) to detect prion seeding activity in CWD-infected deer. We assessed tissues comprising the alimentary tract, alimentary-associated lymphoid tissue and systemic lymphoid tissue from 5 naïve deer. PrPC was expressed in all tissues, though expression was often very low compared to the level in the CNS. IHC identified specific cell types wherein PrPC expression is very high. To compare the distribution of PrPC to PrPCWD, we examined 5 deer with advanced CWD infection. Using RT-QuIC, we detected prion seeding activity in all 21 tissues. In 3 subclinical deer sacrificed 4 months post-inoculation, we detected PrPCWD consistently in alimentary-associated lymphoid tissue, irregularly in alimentary tract tissues, and not at all in the brain. Contrary to our hypothesis that PrPC levels dictate prion accumulation, PrPC expression was higher in the lower gastrointestinal tissues than in the alimentary-associated lymphoid system and was higher in salivary glands than in the oropharyngeal lymphoid tissue. These data suggest that PrPC expression is not the sole driver of prion accumulation and that alimentary tract tissues accumulate prions before centrifugal spread from the brain occurs. PMID:28880938

  16. Early Host Responses to Prion Infection: Development of In Vivo and In Vitro Assays

    DTIC Science & Technology

    2006-05-01

    in plasma glycoproteins that are induced by prion infection in mice. The unusual nature of prion disease prompted a systems approach to identify... pheochromocytoma cells (13, 14), spontaneously im- mortalized hamster brain cells (15), the T-antigen immortalized GT1 hypothalamic neuron line (16), and T-antigen...PK- digested (+) or undigested (-) samples are indicated. (MW markers? Nothing unusual here so probably not necessary.)

  17. Detection and partial discrimination of atypical and classical bovine spongiform encephalopathies in cattle and primates using real-time quaking-induced conversion assay.

    PubMed

    Levavasseur, Etienne; Biacabe, Anne-Gaëlle; Comoy, Emmanuel; Culeux, Audrey; Grznarova, Katarina; Privat, Nicolas; Simoneau, Steve; Flan, Benoit; Sazdovitch, Véronique; Seilhean, Danielle; Baron, Thierry; Haïk, Stéphane

    2017-01-01

    The transmission of classical bovine spongiform encephalopathy (C-BSE) through contaminated meat product consumption is responsible for variant Creutzfeldt-Jakob disease (vCJD) in humans. More recent and atypical forms of BSE (L-BSE and H-BSE) have been identified in cattle since the C-BSE epidemic. Their low incidence and advanced age of onset are compatible with a sporadic origin, as are most cases of Creutzfeldt-Jakob disease (CJD) in humans. Transmissions studies in primates and transgenic mice expressing a human prion protein (PrP) indicated that atypical forms of BSE may be associated with a higher zoonotic potential than classical BSE, and require particular attention for public health. Recently, methods designed to amplify misfolded forms of PrP have emerged as promising tools to detect prion strains and to study their diversity. Here, we validated real-time quaking-induced conversion assay for the discrimination of atypical and classical BSE strains using a large series of bovine samples encompassing all the atypical BSE cases detected by the French Centre of Reference during 10 years of exhaustive active surveillance. We obtained a 100% sensitivity and specificity for atypical BSE detection. In addition, the assay was able to discriminate atypical and classical BSE in non-human primates, and also sporadic CJD and vCJD in humans. The RT-QuIC assay appears as a practical means for a reliable detection of atypical BSE strains in a homologous or heterologous PrP context.

  18. Mammalian prions: tolerance to sequence changes-how far?

    PubMed

    Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel

    2013-01-01

    Upon prion infection, abnormal prion protein (PrP (Sc) ) self-perpetuate by conformational conversion of α-helix-rich PrP (C) into β sheet enriched form, leading to formation and deposition of PrP (Sc) aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrP (Sc) and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region.

  19. Sex effects in mouse prion disease incubation time.

    PubMed

    Akhtar, Shaheen; Wenborn, Adam; Brandner, Sebastian; Collinge, John; Lloyd, Sarah E

    2011-01-01

    Prion disease incubation time in mice is determined by many factors including PrP expression level, Prnp alleles, genetic background, prion strain and route of inoculation. Sex differences have been described in age of onset for vCJD and in disease duration for both vCJD and sporadic CJD and have also been shown in experimental models. The sex effects reported for mouse incubation times are often contradictory and detail only one strain of mice or prions, resulting in broad generalisations and a confusing picture. To clarify the effect of sex on prion disease incubation time in mice we have compared male and female transmission data from twelve different inbred lines of mice inoculated with at least two prion strains, representing both mouse-adapted scrapie and BSE. Our data show that sex can have a highly significant difference on incubation time. However, this is limited to particular mouse and prion strain combinations. No sex differences were seen in endogenous PrP(C) levels nor in the neuropathological markers of prion disease: PrP(Sc) distribution, spongiosis, neuronal loss and gliosis. These data suggest that when comparing incubation times between experimental groups, such as testing the effects of modifier genes or therapeutics, single sex groups should be used.

  20. Discovery of small molecules binding to the normal conformation of prion by combining virtual screening and multiple biological activity evaluation methods

    NASA Astrophysics Data System (ADS)

    Li, Lanlan; Wei, Wei; Jia, Wen-Juan; Zhu, Yongchang; Zhang, Yan; Chen, Jiang-Huai; Tian, Jiaqi; Liu, Huanxiang; He, Yong-Xing; Yao, Xiaojun

    2017-12-01

    Conformational conversion of the normal cellular prion protein, PrPC, into the misfolded isoform, PrPSc, is considered to be a central event in the development of fatal neurodegenerative diseases. Stabilization of prion protein at the normal cellular form (PrPC) with small molecules is a rational and efficient strategy for treatment of prion related diseases. However, few compounds have been identified as potent prion inhibitors by binding to the normal conformation of prion. In this work, to rational screening of inhibitors capable of stabilizing cellular form of prion protein, multiple approaches combining docking-based virtual screening, steady-state fluorescence quenching, surface plasmon resonance and thioflavin T fluorescence assay were used to discover new compounds interrupting PrPC to PrPSc conversion. Compound 3253-0207 that can bind to PrPC with micromolar affinity and inhibit prion fibrillation was identified from small molecule databases. Molecular dynamics simulation indicated that compound 3253-0207 can bind to the hotspot residues in the binding pocket composed by β1, β2 and α2, which are significant structure moieties in conversion from PrPC to PrPSc.

  1. A brief history of prions

    PubMed Central

    Zabel, Mark D.; Reid, Crystal

    2015-01-01

    Proteins were described as distinct biological molecules and their significance in cellular processes was recognized as early as the 18th century. At the same time, Spanish shepherds observed a disease that compelled their Merino sheep to pathologically scrape against fences, a defining clinical sign that led to the disease being named scrapie. In the late 19th century, Robert Koch published his postulates for defining causative agents of disease. In the early 20th century, pathologists Creutzfeldt and Jakob described a neurodegenerative disease that would later be included with scrapie into a group of diseases known as transmissible spongiform encephalopathies (TSEs). Later that century, mounting evidence compelled a handful of scientists to betray the prevailing biological dogma governing pathogen replication that Watson and Crick so convincingly explained by cracking the genetic code just two decades earlier. Because TSEs seemed to defy these new rules, J.S. Griffith theorized mechanisms by which a pathogenic protein could encipher its own replication blueprint without a genetic code. Stanley Prusiner called this proteinaceous infectious pathogen a prion. Here we offer a concise account of the discovery of prions, the causative agent of TSEs, in the wider context of protein biochemistry and infectious disease. We highlight the discovery of prions in yeast and discuss the implication of prions as epigenomic carriers of biological and pathological information. We also consider expanding the prion hypothesis to include other proteins whose alternate isoforms confer new biological or pathological properties. PMID:26449713

  2. Mechanical Deformation Mechanisms and Properties of Prion Fibrils Probed by Atomistic Simulations

    NASA Astrophysics Data System (ADS)

    Choi, Bumjoon; Kim, Taehee; Ahn, Eue Soo; Lee, Sang Woo; Eom, Kilho

    2017-03-01

    Prion fibrils, which are a hallmark for neurodegenerative diseases, have recently been found to exhibit the structural diversity that governs disease pathology. Despite our recent finding concerning the role of the disease-specific structure of prion fibrils in determining their elastic properties, the mechanical deformation mechanisms and fracture properties of prion fibrils depending on their structures have not been fully characterized. In this work, we have studied the tensile deformation mechanisms of prion and non-prion amyloid fibrils by using steered molecular dynamics simulations. Our simulation results show that the elastic modulus of prion fibril, which is formed based on left-handed β-helical structure, is larger than that of non-prion fibril constructed based on right-handed β-helix. However, the mechanical toughness of prion fibril is found to be less than that of non-prion fibril, which indicates that infectious prion fibril is more fragile than non-infectious (non-prion) fibril. Our study sheds light on the role of the helical structure of amyloid fibrils, which is related to prion infectivity, in determining their mechanical deformation mechanisms and properties.

  3. Secretin receptor involvement in prion-infected cells and animals.

    PubMed

    Kimura, Tomohiro; Nishizawa, Keiko; Oguma, Ayumi; Nishimura, Yuki; Sakasegawa, Yuji; Teruya, Kenta; Nishijima, Ichiko; Doh-ura, Katsumi

    2015-07-08

    The cellular mechanisms behind prion biosynthesis and metabolism remain unclear. Here we show that secretin signaling via the secretin receptor regulates abnormal prion protein formation in prion-infected cells. Animal studies demonstrate that secretin receptor deficiency slightly, but significantly, prolongs incubation time in female but not male mice. This gender-specificity is consistent with our finding that prion-infected cells are derived from females. Therefore, our results provide initial insights into the reasons why age of disease onset in certain prion diseases is reported to occur slightly earlier in females than males. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  4. Infectious prions and proteinopathies.

    PubMed

    Barron, Rona M

    2017-01-02

    Transmissible spongiform encephalopathies (TSEs) are caused by an infectious agent that is thought to consist of only misfolded and aggregated prion protein (PrP). Unlike conventional micro-organisms, the agent spreads and propagates by binding to and converting normal host PrP into the abnormal conformer, increasing the infectious titre. Synthetic prions, composed of refolded fibrillar forms of recombinant PrP (rec-PrP) have been generated to address whether PrP aggregates alone are indeed infectious prions. In several reports, the development of TSE disease has been described following inoculation and passage of rec-PrP fibrils in transgenic mice and hamsters. However in studies described here we show that inoculation of rec-PrP fibrils does not always cause clinical TSE disease or increased infectious titre, but can seed the formation of PrP amyloid plaques in PrP-P101L knock-in transgenic mice (101LL). These data are reminiscent of the "prion-like" spread of misfolded protein in other models of neurodegenerative disease following inoculation of transgenic mice with pre-formed amyloid seeds. Protein misfolding, even when the protein is PrP, does not inevitably lead to the development of an infectious TSE disease. It is possible that most in vivo and in vitro produced misfolded PrP is not infectious and that only a specific subpopulation is associated with infectivity and neurotoxicity.

  5. High-resolution structure of infectious prion protein: the final frontier

    PubMed Central

    Diaz-Espinoza, Rodrigo; Soto, Claudio

    2014-01-01

    Prions are the proteinaceous infectious agents responsible for the transmission of prion diseases. The main or sole component of prions is the misfolded prion protein (PrPSc), which is able to template the conversion of the host’s natively folded form of the protein (PrPC). The detailed mechanism of prion replication and the high-resolution structure of PrPSc are unknown. The currently available information on PrPSc structure comes mostly from low-resolution biophysical techniques, which have resulted in quite divergent models. Recent advances in the production of infectious prions, using very pure recombinant protein, offer new hope for PrPSc structural studies. This review highlights the importance of, challenges for and recent progress toward elucidating the elusive structure of PrPSc, arguably the major pending milestone to reach in understanding prions. PMID:22472622

  6. The Transcription Terminator Rho: A First Bacterial Prion.

    PubMed

    Pallarès, Irantzu; Ventura, Salvador

    2017-06-01

    Traditionally associated with neurodegenerative diseases, prions are increasingly recognized for their potential to confer beneficial traits on eukaryotic organisms. The discovery of the first bacterial prion suggests that the sustained mechanism of prion assembly is an ancient molecular tool aimed at providing fast and persistent adaptation to changing environments. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Infrared Microspectroscopy: A Multiple-Screening Platform for Investigating Single-Cell Biochemical Perturbations upon Prion Infection

    PubMed Central

    2011-01-01

    Prion diseases are a group of fatal neurodegenerative disorders characterized by the accumulation of prions in the central nervous system. The pathogenic prion (PrPSc) possesses the capability to convert the host-encoded cellular isoform of the prion protein, PrPC, into nascent PrPSc. The present work aims at providing novel insight into cellular response upon prion infection evidenced by synchrotron radiation infrared microspectroscopy (SR-IRMS). This non-invasive, label-free analytical technique was employed to investigate the biochemical perturbations undergone by prion infected mouse hypothalamic GT1-1 cells at the cellular and subcellular level. A decrement in total cellular protein content upon prion infection was identified by infrared (IR) whole-cell spectra and validated by bicinchoninic acid assay and single-cell volume analysis by atomic force microscopy (AFM). Hierarchical cluster analysis (HCA) of IR data discriminated between infected and uninfected cells and allowed to deduce an increment of lysosomal bodies within the cytoplasm of infected GT1-1 cells, a hypothesis further confirmed by SR-IRMS at subcellular spatial resolution and fluorescent microscopy. The purpose of this work, therefore, consists of proposing IRMS as a powerful multiscreening platform, drawing on the synergy with conventional biological assays and microscopy techniques in order to increase the accuracy of investigations performed at the single-cell level. PMID:22778865

  8. Infrared microspectroscopy: a multiple-screening platform for investigating single-cell biochemical perturbations upon prion infection.

    PubMed

    Didonna, Alessandro; Vaccari, Lisa; Bek, Alpan; Legname, Giuseppe

    2011-03-16

    Prion diseases are a group of fatal neurodegenerative disorders characterized by the accumulation of prions in the central nervous system. The pathogenic prion (PrP(Sc)) possesses the capability to convert the host-encoded cellular isoform of the prion protein, PrP(C), into nascent PrP(Sc). The present work aims at providing novel insight into cellular response upon prion infection evidenced by synchrotron radiation infrared microspectroscopy (SR-IRMS). This non-invasive, label-free analytical technique was employed to investigate the biochemical perturbations undergone by prion infected mouse hypothalamic GT1-1 cells at the cellular and subcellular level. A decrement in total cellular protein content upon prion infection was identified by infrared (IR) whole-cell spectra and validated by bicinchoninic acid assay and single-cell volume analysis by atomic force microscopy (AFM). Hierarchical cluster analysis (HCA) of IR data discriminated between infected and uninfected cells and allowed to deduce an increment of lysosomal bodies within the cytoplasm of infected GT1-1 cells, a hypothesis further confirmed by SR-IRMS at subcellular spatial resolution and fluorescent microscopy. The purpose of this work, therefore, consists of proposing IRMS as a powerful multiscreening platform, drawing on the synergy with conventional biological assays and microscopy techniques in order to increase the accuracy of investigations performed at the single-cell level.

  9. Lions and prions and deer demise.

    PubMed

    Miller, Michael W; Swanson, Heather M; Wolfe, Lisa L; Quartarone, Fred G; Huwer, Sherri L; Southwick, Charles H; Lukacs, Paul M

    2008-01-01

    Contagious prion diseases--scrapie of sheep and chronic wasting disease of several species in the deer family--give rise to epidemics that seem capable of compromising host population viability. Despite this prospect, the ecological consequences of prion disease epidemics in natural populations have received little consideration. Using a cohort study design, we found that prion infection dramatically lowered survival of free-ranging adult (>2-year-old) mule deer (Odocoileus hemionus): estimated average life expectancy was 5.2 additional years for uninfected deer but only 1.6 additional years for infected deer. Prion infection also increased nearly fourfold the rate of mountain lions (Puma concolor) preying on deer, suggesting that epidemics may alter predator-prey dynamics by facilitating hunting success. Despite selective predation, about one fourth of the adult deer we sampled were infected. High prevalence and low survival of infected deer provided a plausible explanation for the marked decline in this deer population since the 1980s. Remarkably high infection rates sustained in the face of intense predation show that even seemingly complete ecosystems may offer little resistance to the spread and persistence of contagious prion diseases. Moreover, the depression of infected populations may lead to local imbalances in food webs and nutrient cycling in ecosystems in which deer are important herbivores.

  10. Cellular mechanisms responsible for cell-to-cell spreading of prions.

    PubMed

    Vilette, Didier; Courte, Josquin; Peyrin, Jean Michel; Coudert, Laurent; Schaeffer, Laurent; Andréoletti, Olivier; Leblanc, Pascal

    2018-05-14

    Prions are infectious agents that cause fatal neurodegenerative diseases. Current evidence indicates that they are essentially composed of an abnormally folded protein (PrP Sc ). These abnormal aggregated PrP Sc species multiply in infected cells by recruiting and converting the host PrP C protein into new PrP Sc . How prions move from cell to cell and progressively spread across the infected tissue is of crucial importance and may provide experimental opportunity to delay the progression of the disease. In infected cells, different mechanisms have been identified, including release of infectious extracellular vesicles and intercellular transfer of PrP Sc -containing organelles through tunneling nanotubes. These findings should allow manipulation of the intracellular trafficking events targeting PrP Sc in these particular subcellular compartments to experimentally address the relative contribution of these mechanisms to in vivo prion pathogenesis. In addition, such information may prompt further experimental strategies to decipher the causal roles of protein misfolding and aggregation in other human neurodegenerative diseases.

  11. Synthetic Prions Provide Clues for Understanding Prion Diseases.

    PubMed

    Imberdis, Thibaut; Harris, David A

    2016-04-01

    This Commentary highlights the article by Makarava et al that discusses the formation of synthetic prions and the role of substrate levels in their evolution. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  12. Prions amplify through degradation of the VPS10P sorting receptor sortilin.

    PubMed

    Uchiyama, Keiji; Tomita, Mitsuru; Yano, Masashi; Chida, Junji; Hara, Hideyuki; Das, Nandita Rani; Nykjaer, Anders; Sakaguchi, Suehiro

    2017-06-01

    Prion diseases are a group of fatal neurodegenerative disorders caused by prions, which consist mainly of the abnormally folded isoform of prion protein, PrPSc. A pivotal pathogenic event in prion disease is progressive accumulation of prions, or PrPSc, in brains through constitutive conformational conversion of the cellular prion protein, PrPC, into PrPSc. However, the cellular mechanism by which PrPSc is progressively accumulated in prion-infected neurons remains unknown. Here, we show that PrPSc is progressively accumulated in prion-infected cells through degradation of the VPS10P sorting receptor sortilin. We first show that sortilin interacts with PrPC and PrPSc and sorts them to lysosomes for degradation. Consistently, sortilin-knockdown increased PrPSc accumulation in prion-infected cells. In contrast, overexpression of sortilin reduced PrPSc accumulation in prion-infected cells. These results indicate that sortilin negatively regulates PrPSc accumulation in prion-infected cells. The negative role of sortilin in PrPSc accumulation was further confirmed in sortilin-knockout mice infected with prions. The infected mice had accelerated prion disease with early accumulation of PrPSc in their brains. Interestingly, sortilin was reduced in prion-infected cells and mouse brains. Treatment of prion-infected cells with lysosomal inhibitors, but not proteasomal inhibitors, increased the levels of sortilin. Moreover, sortilin was reduced following PrPSc becoming detectable in cells after infection with prions. These results indicate that PrPSc accumulation stimulates sortilin degradation in lysosomes. Taken together, these results show that PrPSc accumulation of itself could impair the sortilin-mediated sorting of PrPC and PrPSc to lysosomes for degradation by stimulating lysosomal degradation of sortilin, eventually leading to progressive accumulation of PrPSc in prion-infected cells.

  13. Prion-Seeding Activity in Cerebrospinal Fluid of Deer with Chronic Wasting Disease

    PubMed Central

    Haley, Nicholas J.; Van de Motter, Alexandra; Carver, Scott; Henderson, Davin; Davenport, Kristen; Seelig, Davis M.; Mathiason, Candace; Hoover, Edward

    2013-01-01

    Transmissible spongiform encephalopathies (TSEs), or prion diseases, are a uniformly fatal family of neurodegenerative diseases in mammals that includes chronic wasting disease (CWD) of cervids. The early and ante-mortem identification of TSE-infected individuals using conventional western blotting or immunohistochemistry (IHC) has proven difficult, as the levels of infectious prions in readily obtainable samples, including blood and bodily fluids, are typically beyond the limits of detection. The development of amplification-based seeding assays has been instrumental in the detection of low levels of infectious prions in clinical samples. In the present study, we evaluated the cerebrospinal fluid (CSF) of CWD-exposed (n=44) and naïve (n=4) deer (n=48 total) for CWD prions (PrPd) using two amplification assays: serial protein misfolding cyclic amplification with polytetrafluoroethylene beads (sPMCAb) and real-time quaking induced conversion (RT-QuIC) employing a truncated Syrian hamster recombinant protein substrate. Samples were evaluated blindly in parallel with appropriate positive and negative controls. Results from amplification assays were compared to one another and to obex immunohistochemistry, and were correlated to available clinical histories including CWD inoculum source (e.g. saliva, blood), genotype, survival period, and duration of clinical signs. We found that both sPMCAb and RT-QuIC were capable of amplifying CWD prions from cervid CSF, and results correlated well with one another. Prion seeding activity in either assay was observed in approximately 50% of deer with PrPd detected by IHC in the obex region of the brain. Important predictors of amplification included duration of clinical signs and time of first tonsil biopsy positive results, and ultimately the levels of PrPd identified in the obex by IHC. Based on our findings, we expect that both sPMCAb and RT-QuIC may prove to be useful detection assays for the detection of prions in CSF. PMID

  14. Structure-based view on [PSI(+)] prion properties.

    PubMed

    Bondarev, Stanislav A; Zhouravleva, Galina A; Belousov, Mikhail V; Kajava, Andrey V

    2015-01-01

    Yeast [PSI(+)] prion is one of the most suitable and well characterized system for the investigation of the prion phenomenon. However, until recently, the lack of data on the 3D arrangement of Sup35p prion fibrils hindered progress in this area. The recent arrival in this field of new experimental techniques led to the parallel and in-register superpleated β-structure as a consensus model for Sup35p fibrils. Here, we analyzed the effect of amino acid substitutions of the Sup35 protein through the prism of this structural model. Application of a newly developed computational approach, called ArchCandy, gives us a better understanding of the effect caused by mutations on the fibril forming potential of Sup35 protein. This bioinformatics tool can be used for the design of new mutations with desired modification of prion properties. Thus, we provide examples of how today, having progress toward elucidation of the structural arrangement of Sup35p fibrils, researchers can advance more efficiently to a better understanding of prion [PSI(+)] stability and propagation.

  15. Molecular pathogenesis of sporadic prion diseases in man

    PubMed Central

    Safar, Jiri G.

    2012-01-01

    The yeast, fungal and mammalian prions determine heritable and infectious traits that are encoded in alternative conformations of proteins. They cause lethal sporadic, familial and infectious neurodegenerative conditions in man, including Creutzfeldt-Jakob disease (CJD), Gerstmann-Sträussler-Scheinker syndrome (GSS), kuru, sporadic fatal insomnia (SFI) and likely variable protease-sensitive prionopathy (VPSPr). The most prevalent of human prion diseases is sporadic (s)CJD. Recent advances in amplification and detection of prions led to considerable optimism that early and possibly preclinical diagnosis and therapy might become a reality. Although several drugs have already been tested in small numbers of sCJD patients, there is no clear evidence of any agent’s efficacy. Therefore, it remains crucial to determine the full spectrum of sCJD prion strains and the conformational features in the pathogenic human prion protein governing replication of sCJD prions. Research in this direction is essential for the rational development of diagnostic as well as therapeutic strategies. Moreover, there is growing recognition that fundamental processes involved in human prion propagation – intercellular induction of protein misfolding and seeded aggregation of misfolded host proteins – are of far wider significance. This insight leads to new avenues of research in the ever-widening spectrum of age-related human neurodegenerative diseases that are caused by protein misfolding and that pose a major challenge for healthcare. PMID:22421210

  16. Saccharomyces cerevisiae: a sexy yeast with a prion problem.

    PubMed

    Kelly, Amy C; Wickner, Reed B

    2013-01-01

    Yeast prions are infectious proteins that spread exclusively by mating. The frequency of prions in the wild therefore largely reflects the rate of spread by mating counterbalanced by prion growth slowing effects in the host. We recently showed that the frequency of outcross mating is about 1% of mitotic doublings with 23-46% of total matings being outcrosses. These findings imply that even the mildest forms of the [PSI+], [URE3] and [PIN+] prions impart > 1% growth/survival detriment on their hosts. Our estimate of outcrossing suggests that Saccharomyces cerevisiae is far more sexual than previously thought and would therefore be more responsive to the adaptive effects of natural selection compared with a strictly asexual yeast. Further, given its large effective population size, a growth/survival detriment of > 1% for yeast prions should strongly select against prion-infected strains in wild populations of Saccharomyces cerevisiae.

  17. Structural domains and main-chain flexibility in prion proteins.

    PubMed

    Blinov, N; Berjanskii, M; Wishart, D S; Stepanova, M

    2009-02-24

    In this study we describe a novel approach to define structural domains and to characterize the local flexibility in both human and chicken prion proteins. The approach we use is based on a comprehensive theory of collective dynamics in proteins that was recently developed. This method determines the essential collective coordinates, which can be found from molecular dynamics trajectories via principal component analysis. Under this particular framework, we are able to identify the domains where atoms move coherently while at the same time to determine the local main-chain flexibility for each residue. We have verified this approach by comparing our results for the predicted dynamic domain systems with the computed main-chain flexibility profiles and the NMR-derived random coil indexes for human and chicken prion proteins. The three sets of data show excellent agreement. Additionally, we demonstrate that the dynamic domains calculated in this fashion provide a highly sensitive measure of protein collective structure and dynamics. Furthermore, such an analysis is capable of revealing structural and dynamic properties of proteins that are inaccessible to the conventional assessment of secondary structure. Using the collective dynamic simulation approach described here along with a high-temperature simulations of unfolding of human prion protein, we have explored whether locations of relatively low stability could be identified where the unfolding process could potentially be facilitated. According to our analysis, the locations of relatively low stability may be associated with the beta-sheet formed by strands S1 and S2 and the adjacent loops, whereas helix HC appears to be a relatively stable part of the protein. We suggest that this kind of structural analysis may provide a useful background for a more quantitative assessment of potential routes of spontaneous misfolding in prion proteins.

  18. The Neutral Sphingomyelinase Pathway Regulates Packaging of the Prion Protein into Exosomes*

    PubMed Central

    Guo, Belinda B.; Bellingham, Shayne A.; Hill, Andrew F.

    2015-01-01

    Prion diseases are a group of transmissible, fatal neurodegenerative disorders associated with the misfolding of the host-encoded prion protein, PrPC, into a disease-associated form, PrPSc. The transmissible prion agent is principally formed of PrPSc itself and is associated with extracellular vesicles known as exosomes. Exosomes are released from cells both in vitro and in vivo, and have been proposed as a mechanism by which prions spread intercellularly. The biogenesis of exosomes occurs within the endosomal system, through formation of intraluminal vesicles (ILVs), which are subsequently released from cells as exosomes. ILV formation is known to be regulated by the endosomal sorting complexes required for transport (ESCRT) machinery, although an alternative neutral sphingomyelinase (nSMase) pathway has been suggested to also regulate this process. Here, we investigate a role for the nSMase pathway in exosome biogenesis and packaging of PrP into these vesicles. Inhibition of the nSMase pathway using GW4869 revealed a role for the nSMase pathway in both exosome formation and PrP packaging. In agreement, targeted knockdown of nSMase1 and nSMase2 in mouse neurons using lentivirus-mediated RNAi also decreases exosome release, demonstrating the nSMase pathway regulates the biogenesis and release of exosomes. We also demonstrate that PrPC packaging is dependent on nSMase2, whereas the packaging of disease-associated PrPSc into exosomes occurs independently of nSMase2. These findings provide further insight into prion transmission and identify a pathway which directly assists exosome-mediated transmission of prions. PMID:25505180

  19. Isolation of Novel Synthetic Prion Strains by Amplification in Transgenic Mice Coexpressing Wild-Type and Anchorless Prion Proteins

    PubMed Central

    Raymond, Gregory J.; Race, Brent; Hollister, Jason R.; Offerdahl, Danielle K.; Moore, Roger A.; Kodali, Ravindra; Raymond, Lynne D.; Hughson, Andrew G.; Rosenke, Rebecca; Long, Dan; Dorward, David W.

    2012-01-01

    Mammalian prions are thought to consist of misfolded aggregates (protease-resistant isoform of the prion protein [PrPres]) of the cellular prion protein (PrPC). Transmissible spongiform encephalopathy (TSE) can be induced in animals inoculated with recombinant PrP (rPrP) amyloid fibrils lacking mammalian posttranslational modifications, but this induction is inefficient in hamsters or transgenic mice overexpressing glycosylphosphatidylinositol (GPI)-anchored PrPC. Here we show that TSE can be initiated by inoculation of misfolded rPrP into mice that express wild-type (wt) levels of PrPC and that synthetic prion strain propagation and selection can be affected by GPI anchoring of the host's PrPC. To create prions de novo, we fibrillized mouse rPrP in the absence of molecular cofactors, generating fibrils with a PrPres-like protease-resistant banding profile. These fibrils induced the formation of PrPres deposits in transgenic mice coexpressing wt and GPI-anchorless PrPC (wt/GPI−) at a combined level comparable to that of PrPC expression in wt mice. Secondary passage into mice expressing wt, GPI−, or wt plus GPI− PrPC induced TSE disease with novel clinical, histopathological, and biochemical phenotypes. Contrary to laboratory-adapted mouse scrapie strains, the synthetic prion agents exhibited a preference for conversion of GPI− PrPC and, in one case, caused disease only in GPI− mice. Our data show that novel TSE agents can be generated de novo solely from purified mouse rPrP after amplification in mice coexpressing normal levels of wt and anchorless PrPC. These observations provide insight into the minimal elements required to create prions in vitro and suggest that the PrPC GPI anchor can modulate the propagation of synthetic TSE strains. PMID:22915801

  20. A brief history of prions.

    PubMed

    Zabel, Mark D; Reid, Crystal

    2015-12-01

    Proteins were described as distinct biological molecules and their significance in cellular processes was recognized as early as the 18th century. At the same time, Spanish shepherds observed a disease that compelled their Merino sheep to pathologically scrape against fences, a defining clinical sign that led to the disease being named scrapie. In the late 19th century, Robert Koch published his postulates for defining causative agents of disease. In the early 20th century, pathologists Creutzfeldt and Jakob described a neurodegenerative disease that would later be included with scrapie into a group of diseases known as transmissible spongiform encephalopathies (TSEs). Later that century, mounting evidence compelled a handful of scientists to betray the prevailing biological dogma governing pathogen replication that Watson and Crick so convincingly explained by cracking the genetic code just two decades earlier. Because TSEs seemed to defy these new rules, J.S. Griffith theorized mechanisms by which a pathogenic protein could encipher its own replication blueprint without a genetic code. Stanley Prusiner called this proteinaceous infectious pathogen a prion. Here we offer a concise account of the discovery of prions, the causative agent of TSEs, in the wider context of protein biochemistry and infectious disease. We highlight the discovery of prions in yeast and discuss the implication of prions as epigenomic carriers of biological and pathological information. We also consider expanding the prion hypothesis to include other proteins whose alternate isoforms confer new biological or pathological properties. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. A novel copper-hydrogen peroxide formulation for prion decontamination.

    PubMed

    Solassol, Jerome; Pastore, Manuela; Crozet, Carole; Perrier, Veronique; Lehmann, Sylvain

    2006-09-15

    With the appearance of variant Creutzfeldt-Jakob disease (CJD) and the detection of infectious prions in the peripheral organs of persons with sporadic CJD, the development of decontamination methods that are compatible with medical equipment has become a major issue. Here, we show that a formulation of copper metal ions in combination with hydrogen peroxide dramatically reduces the level of prion protein (PrP)(Sc) (the scrapie isoform of PrP) present in homogenates of samples from prion-infected brains, including brain samples from humans with CJD. An animal bioassay confirmed the reduction in prion infectivity, indicating that this novel Cu(2+)-H(2)O(2) formulation has great potential for prion decontamination.

  2. Stimulating the Release of Exosomes Increases the Intercellular Transfer of Prions.

    PubMed

    Guo, Belinda B; Bellingham, Shayne A; Hill, Andrew F

    2016-03-04

    Exosomes are small extracellular vesicles released by cells and play important roles in intercellular communication and pathogen transfer. Exosomes have been implicated in several neurodegenerative diseases, including prion disease and Alzheimer disease. Prion disease arises upon misfolding of the normal cellular prion protein, PrP(C), into the disease-associated isoform, PrP(Sc). The disease has a unique transmissible etiology, and exosomes represent a novel and efficient method for prion transmission. The precise mechanism by which prions are transmitted from cell to cell remains to be fully elucidated, although three hypotheses have been proposed: direct cell-cell contact, tunneling nanotubes, and exosomes. Given the reported presence of exosomes in biological fluids and in the lipid and nucleic acid contents of exosomes, these vesicles represent an ideal mechanism for encapsulating prions and potential cofactors to facilitate prion transmission. This study investigates the relationship between exosome release and intercellular prion dissemination. Stimulation of exosome release through treatment with an ionophore, monensin, revealed a corresponding increase in intercellular transfer of prion infectivity. Conversely, inhibition of exosome release using GW4869 to target the neutral sphingomyelinase pathway induced a decrease in intercellular prion transmission. Further examination of the effect of monensin on PrP conversion revealed that monensin also alters the conformational stability of PrP(C), leading to increased generation of proteinase K-resistant prion protein. The findings presented here provide support for a positive relationship between exosome release and intercellular transfer of prion infectivity, highlighting an integral role for exosomes in facilitating the unique transmissible nature of prions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Prion disease tempo determined by host-dependent substrate reduction

    PubMed Central

    Mays, Charles E.; Kim, Chae; Haldiman, Tracy; van der Merwe, Jacques; Lau, Agnes; Yang, Jing; Grams, Jennifer; Di Bari, Michele A.; Nonno, Romolo; Telling, Glenn C.; Kong, Qingzhong; Langeveld, Jan; McKenzie, Debbie; Westaway, David; Safar, Jiri G.

    2014-01-01

    The symptoms of prion infection can take years or decades to manifest following the initial exposure. Molecular markers of prion disease include accumulation of the misfolded prion protein (PrPSc), which is derived from its cellular precursor (PrPC), as well as downregulation of the PrP-like Shadoo (Sho) glycoprotein. Given the overlapping cellular environments for PrPC and Sho, we inferred that PrPC levels might also be altered as part of a host response during prion infection. Using rodent models, we found that, in addition to changes in PrPC glycosylation and proteolytic processing, net reductions in PrPC occur in a wide range of prion diseases, including sheep scrapie, human Creutzfeldt-Jakob disease, and cervid chronic wasting disease. The reduction in PrPC results in decreased prion replication, as measured by the protein misfolding cyclic amplification technique for generating PrPSc in vitro. While PrPC downregulation is not discernible in animals with unusually short incubation periods and high PrPC expression, slowly evolving prion infections exhibit downregulation of the PrPC substrate required for new PrPSc synthesis and as a receptor for pathogenic signaling. Our data reveal PrPC downregulation as a previously unappreciated element of disease pathogenesis that defines the extensive, presymptomatic period for many prion strains. PMID:24430187

  4. Quinacrine promotes replication and conformational mutation of chronic wasting disease prions.

    PubMed

    Bian, Jifeng; Kang, Hae-Eun; Telling, Glenn C

    2014-04-22

    Quinacrine's ability to reduce levels of pathogenic prion protein (PrP(Sc)) in mouse cells infected with experimentally adapted prions led to several unsuccessful clinical studies in patients with prion diseases, a 10-y investment to understand its mechanism of action, and the production of related compounds with expectations of greater efficacy. We show here, in stark contrast to this reported inhibitory effect, that quinacrine enhances deer and elk PrP(Sc) accumulation and promotes propagation of prions causing chronic wasting disease (CWD), a fatal, transmissible, neurodegenerative disorder of cervids of uncertain zoonotic potential. Surprisingly, despite increased prion titers in quinacrine-treated cells, transmission of the resulting prions produced prolonged incubation times and altered PrP(Sc) deposition patterns in the brains of diseased transgenic mice. This unexpected outcome is consistent with quinacrine affecting the intrinsic properties of the CWD prion. Accordingly, quinacrine-treated CWD prions were comprised of an altered PrP(Sc) conformation. Our findings provide convincing evidence for drug-induced conformational mutation of prions without the prerequisite of generating drug-resistant variants of the original strain. More specifically, they show that a drug capable of restraining prions in one species/strain setting, and consequently used to treat human prion diseases, improves replicative ability in another and therefore force reconsideration of current strategies to screen antiprion compounds.

  5. Quinacrine promotes replication and conformational mutation of chronic wasting disease prions

    PubMed Central

    Bian, Jifeng; Kang, Hae-Eun; Telling, Glenn C.

    2014-01-01

    Quinacrine’s ability to reduce levels of pathogenic prion protein (PrPSc) in mouse cells infected with experimentally adapted prions led to several unsuccessful clinical studies in patients with prion diseases, a 10-y investment to understand its mechanism of action, and the production of related compounds with expectations of greater efficacy. We show here, in stark contrast to this reported inhibitory effect, that quinacrine enhances deer and elk PrPSc accumulation and promotes propagation of prions causing chronic wasting disease (CWD), a fatal, transmissible, neurodegenerative disorder of cervids of uncertain zoonotic potential. Surprisingly, despite increased prion titers in quinacrine-treated cells, transmission of the resulting prions produced prolonged incubation times and altered PrPSc deposition patterns in the brains of diseased transgenic mice. This unexpected outcome is consistent with quinacrine affecting the intrinsic properties of the CWD prion. Accordingly, quinacrine-treated CWD prions were comprised of an altered PrPSc conformation. Our findings provide convincing evidence for drug-induced conformational mutation of prions without the prerequisite of generating drug-resistant variants of the original strain. More specifically, they show that a drug capable of restraining prions in one species/strain setting, and consequently used to treat human prion diseases, improves replicative ability in another and therefore force reconsideration of current strategies to screen antiprion compounds. PMID:24711410

  6. Correlation analysis for the incubation period of prion disease.

    PubMed

    Bae, Se-Eun; Jung, Sunghoon; Kim, Ha-Yeon; Son, Hyeon S

    2012-07-01

    Previous studies have shown that genetic quantitative trait loci (QTL), strain barriers, inoculation dose and inoculation method modulate the incubation period of prion diseases. We examined the relationship between a diverse set of physical, genetic and immunological characteristics and the incubation period of prion disease using correlation analyses. We found that incubation period was highly correlated with brain weight. In addition, mean corpuscular volume and cell size were strongly correlated with incubation period, indicating that the physical magnitude of prion-infected organs or individual cells may be important in determining the incubation period. Given the same prion inoculation dose, animals with a lower brain weight, mean corpuscular volume or cell size may experience more virulent disease, as the effective concentration of abnormal prion, which might regulate the attachment rate of prions to aggregates, is increased with smaller capacity of brains and cells. This is partly consistent with previous theoretical modeling. The strong correlations between incubation period and physical properties of the brain and cells in this study suggest that the mechanism underlying prion disease pathology may be physical, indicating that the incubation process is governed by simple chemical stoichiometry.

  7. Decontamination of prions in a plasma product manufacturing environment.

    PubMed

    Bellon, Anne; Comoy, Emmanuel; Simoneau, Steve; Mornac, Sandrine; Dehen, Capucine; Perrin, Audrey; Arzel, Aude; Arrabal, Samuel; Baron, Henry; Laude, Hubert; You, Bruno; Deslys, Jean-Philippe; Flan, Benoit

    2014-04-01

    The high resistance of prions to inactivating treatments requires the proper management of decontaminating procedures of equipment in contact with materials of human or animal origin destined for medical purposes. Sodium hydroxide (NaOH) is widely used today for this purpose as it inactivates a wide variety of pathogens including prions. Several NaOH treatments were tested on prions bound to either stainless steel or chromatographic resins in industrial conditions with multiple prion strains. Data show a strong correlation between inactivation results obtained by immunochemical detection of the prion protein and those obtained with infectivity assays and establish effective inactivation treatments for prions bound to stainless steel or chromatographic resins (ion exchange and affinity), including treatments with lower NaOH concentrations. Furthermore, no obvious strain-specific behavior difference was observed between experimental models. The results generated by these investigations show that industrial NaOH decontamination regimens (in combination with the NaCl elution in the case of the chromatography process) attain substantial prion inactivation and/or removal between batches, thus providing added assurance to the biologic safety of the final plasma-derived medicinal products. © 2013 American Association of Blood Banks.

  8. Correlation analysis for the incubation period of prion disease

    PubMed Central

    Bae, Se-Eun; Jung, Sunghoon; Kim, Ha-Yeon; Son, Hyeon S.

    2012-01-01

    Previous studies have shown that genetic quantitative trait loci (QTL), strain barriers, inoculation dose and inoculation method modulate the incubation period of prion diseases. We examined the relationship between a diverse set of physical, genetic and immunological characteristics and the incubation period of prion disease using correlation analyses. We found that incubation period was highly correlated with brain weight. In addition, mean corpuscular volume and cell size were strongly correlated with incubation period, indicating that the physical magnitude of prion-infected organs or individual cells may be important in determining the incubation period. Given the same prion inoculation dose, animals with a lower brain weight, mean corpuscular volume or cell size may experience more virulent disease, as the effective concentration of abnormal prion, which might regulate the attachment rate of prions to aggregates, is increased with smaller capacity of brains and cells. This is partly consistent with previous theoretical modeling. The strong correlations between incubation period and physical properties of the brain and cells in this study suggest that the mechanism underlying prion disease pathology may be physical, indicating that the incubation process is governed by simple chemical stoichiometry. PMID:22561168

  9. Polymorphism analysis of the prion gene in BSE-affected and unaffected cattle.

    PubMed

    Neibergs, H L; Ryan, A M; Womack, J E; Spooner, R L; Williams, J L

    1994-10-01

    Polymerase chain reaction (PCR) primers designed to amplify the octapeptide repeat region of the bovine prion gene were used to test the association of genotypes with bovine spongiform encephalitis (BSE) in 56 BSE-affected and 177 unaffected animals. Three alleles (A,B,C) were detected as single-strand conformation polymorphisms (SSCPs) and two alleles (1,2--representing six or five copies of the octapeptide repeat respectively) were detected as amplified double-strand fragment length polymorphisms (AMFLPs). Observed genotypes of SSCPs and AMFLPs were analysed by chi-square. The SSCP genotypes of nuclear family members of animals with BSE and BSE-affected animals were different (P < 0.001, P < 0.01) from unrelated animals of the same breed without BSE. No genotypic differences were found between the BSE-affected animals and their relatives (P > 0.469). No AMFLP genotypic differences were detected between BSE-affected animals, their relatives, unrelated animals of the same breed or animals of different breeds (P > 0.05). These data suggest that BSE-affected animals and their relatives are more likely to have the AA SSCP genotype than unrelated animals of the same breed or animals of different breeds.

  10. Novel epitopes identified by Anti-PrP monoclonal antibodies produced following immunization of Prnp0/0 Balb/cJ mice with purified scrapie prions

    USDA-ARS?s Scientific Manuscript database

    Prions, or infectious proteins, cause a class of uniformly fatal neurodegenerative diseases. Prions are composed solely of an aberrantly folded isoform(PrPSc)of a normal cellular protein (PrPC). Shared sequence identity of PrPSc with PrPC has limited the detection sensitivity of immunochemical assay...

  11. Allelic variants of hereditary prions: The bimodularity principle.

    PubMed

    Tikhodeyev, Oleg N; Tarasov, Oleg V; Bondarev, Stanislav A

    2017-01-02

    Modern biology requires modern genetic concepts equally valid for all discovered mechanisms of inheritance, either "canonical" (mediated by DNA sequences) or epigenetic. Applying basic genetic terms such as "gene" and "allele" to protein hereditary factors is one of the necessary steps toward these concepts. The basic idea that different variants of the same prion protein can be considered as alleles has been previously proposed by Chernoff and Tuite. In this paper, the notion of prion allele is further developed. We propose the idea that any prion allele is a bimodular hereditary system that depends on a certain DNA sequence (DNA determinant) and a certain epigenetic mark (epigenetic determinant). Alteration of any of these 2 determinants may lead to establishment of a new prion allele. The bimodularity principle is valid not only for hereditary prions; it seems to be universal for any epigenetic hereditary factor.

  12. Allelic variants of hereditary prions: The bimodularity principle

    PubMed Central

    Tikhodeyev, Oleg N.; Tarasov, Oleg V.; Bondarev, Stanislav A.

    2017-01-01

    ABSTRACT Modern biology requires modern genetic concepts equally valid for all discovered mechanisms of inheritance, either “canonical” (mediated by DNA sequences) or epigenetic. Applying basic genetic terms such as “gene” and “allele” to protein hereditary factors is one of the necessary steps toward these concepts. The basic idea that different variants of the same prion protein can be considered as alleles has been previously proposed by Chernoff and Tuite. In this paper, the notion of prion allele is further developed. We propose the idea that any prion allele is a bimodular hereditary system that depends on a certain DNA sequence (DNA determinant) and a certain epigenetic mark (epigenetic determinant). Alteration of any of these 2 determinants may lead to establishment of a new prion allele. The bimodularity principle is valid not only for hereditary prions; it seems to be universal for any epigenetic hereditary factor. PMID:28281926

  13. Prion disease susceptibility is affected by β-structure folding propensity and local side-chain interactions in PrP

    PubMed Central

    Khan, M. Qasim; Sweeting, Braden; Mulligan, Vikram Khipple; Arslan, Pharhad Eli; Cashman, Neil R.; Pai, Emil F.; Chakrabartty, Avijit

    2010-01-01

    Prion diseases occur when the normally α-helical prion protein (PrP) converts to a pathological β-structured state with prion infectivity (PrPSc). Exposure to PrPSc from other mammals can catalyze this conversion. Evidence from experimental and accidental transmission of prions suggests that mammals vary in their prion disease susceptibility: Hamsters and mice show relatively high susceptibility, whereas rabbits, horses, and dogs show low susceptibility. Using a novel approach to quantify conformational states of PrP by circular dichroism (CD), we find that prion susceptibility tracks with the intrinsic propensity of mammalian PrP to convert from the native, α-helical state to a cytotoxic β-structured state, which exists in a monomer–octamer equilibrium. It has been controversial whether β-structured monomers exist at acidic pH; sedimentation equilibrium and dual-wavelength CD evidence is presented for an equilibrium between a β-structured monomer and octamer in some acidic pH conditions. Our X-ray crystallographic structure of rabbit PrP has identified a key helix-capping motif implicated in the low prion disease susceptibility of rabbits. Removal of this capping motif increases the β-structure folding propensity of rabbit PrP to match that of PrP from mouse, a species more susceptible to prion disease. PMID:21041683

  14. Prion disease susceptibility is affected by beta-structure folding propensity and local side-chain interactions in PrP.

    PubMed

    Khan, M Qasim; Sweeting, Braden; Mulligan, Vikram Khipple; Arslan, Pharhad Eli; Cashman, Neil R; Pai, Emil F; Chakrabartty, Avijit

    2010-11-16

    Prion diseases occur when the normally α-helical prion protein (PrP) converts to a pathological β-structured state with prion infectivity (PrP(Sc)). Exposure to PrP(Sc) from other mammals can catalyze this conversion. Evidence from experimental and accidental transmission of prions suggests that mammals vary in their prion disease susceptibility: Hamsters and mice show relatively high susceptibility, whereas rabbits, horses, and dogs show low susceptibility. Using a novel approach to quantify conformational states of PrP by circular dichroism (CD), we find that prion susceptibility tracks with the intrinsic propensity of mammalian PrP to convert from the native, α-helical state to a cytotoxic β-structured state, which exists in a monomer-octamer equilibrium. It has been controversial whether β-structured monomers exist at acidic pH; sedimentation equilibrium and dual-wavelength CD evidence is presented for an equilibrium between a β-structured monomer and octamer in some acidic pH conditions. Our X-ray crystallographic structure of rabbit PrP has identified a key helix-capping motif implicated in the low prion disease susceptibility of rabbits. Removal of this capping motif increases the β-structure folding propensity of rabbit PrP to match that of PrP from mouse, a species more susceptible to prion disease.

  15. Destabilization and recovery of a yeast prion after mild heat shock

    PubMed Central

    Newnam, Gary P.; Birchmore, Jennifer L.; Chernoff, Yury O.

    2011-01-01

    Yeast prion [PSI+] is a self-perpetuating amyloid of the translational termination factor Sup35. Although [PSI+] propagation is modulated by heat shock proteins (Hsps), high temperature was previously reported to have little or no effect on [PSI+]. Our results show that short-term exposure of exponentially growing yeast culture to mild heat shock, followed by immediate resumption of growth, leads to [PSI+] destabilization, sometimes persisting for several cell divisions after heat shock. Prion loss occurring in the first division after heat shock is preferentially detected in a daughter cell, indicating the impairment of prion segregation that results in asymmetric prion distribution between a mother cell and a bud. Longer heat shock or prolonged incubation in the absence of nutrients after heat shock lead to [PSI+] recovery. Both prion destabilization and recovery during heat shock depend on protein synthesis. Maximal prion destabilization coincides with maximal imbalance between Hsp104 and other Hsps such as Hsp70-Ssa. Deletions of individual SSA genes increase prion destabilization and/or counteract recovery. Dynamics of prion aggregation during destabilization and recovery is consistent with the notion that efficient prion fragmentation and segregation require a proper balance between Hsp104 and other (e. g. Hsp70-Ssa) chaperones. In contrast to heat shock, [PSI+] destabilization by osmotic stressors does not always depend on cell proliferation and/or protein synthesis, indicating that different stresses may impact the prion via different mechanisms. Our data demonstrate that heat stress causes asymmetric prion distribution in a cell division, and confirm that effects of Hsps on prions are physiologically relevant. PMID:21392508

  16. Emergence of two prion subtypes in ovine PrP transgenic mice infected with human MM2-cortical Creutzfeldt-Jakob disease prions.

    PubMed

    Chapuis, Jérôme; Moudjou, Mohammed; Reine, Fabienne; Herzog, Laetitia; Jaumain, Emilie; Chapuis, Céline; Quadrio, Isabelle; Boulliat, Jacques; Perret-Liaudet, Armand; Dron, Michel; Laude, Hubert; Rezaei, Human; Béringue, Vincent

    2016-02-05

    Mammalian prions are proteinaceous pathogens responsible for a broad range of fatal neurodegenerative diseases in humans and animals. These diseases can occur spontaneously, such as Creutzfeldt-Jakob disease (CJD) in humans, or be acquired or inherited. Prions are primarily formed of macromolecular assemblies of the disease-associated prion protein PrP(Sc), a misfolded isoform of the host-encoded prion protein PrP(C). Within defined host-species, prions can exist as conformational variants or strains. Based on both the M/V polymorphism at codon 129 of PrP and the electrophoretic signature of PrP(Sc) in the brain, sporadic CJD is classified in different subtypes, which may encode different strains. A transmission barrier, the mechanism of which remains unknown, limits prion cross-species propagation. To adapt to the new host, prions have the capacity to 'mutate' conformationally, leading to the emergence of a variant with new biological properties. Here, we transmitted experimentally one rare subtype of human CJD, designated cortical MM2 (129 MM with type 2 PrP(Sc)), to transgenic mice overexpressing either human or the VRQ allele of ovine PrP(C). In marked contrast with the reported absence of transmission to knock-in mice expressing physiological levels of human PrP, this subtype transmitted faithfully to mice overexpressing human PrP, and exhibited unique strain features. Onto the ovine PrP sequence, the cortical MM2 subtype abruptly evolved on second passage, thereby allowing emergence of a pair of strain variants with distinct PrP(Sc) biochemical characteristics and differing tropism for the central and lymphoid tissues. These two strain components exhibited remarkably distinct replicative properties in cell-free amplification assay, allowing the 'physical' cloning of the minor, lymphotropic component, and subsequent isolation in ovine PrP mice and RK13 cells. Here, we provide in-depth assessment of the transmissibility and evolution of one rare subtype of

  17. Aβ seeds and prions: How close the fit?

    PubMed

    Rasmussen, Jay; Jucker, Mathias; Walker, Lary C

    2017-07-04

    The prion paradigm is increasingly invoked to explain the molecular pathogenesis of neurodegenerative diseases involving the misfolding and aggregation of proteins other than the prion protein (PrP). Extensive evidence from in vitro and in vivo studies indicates that misfolded and aggregated Aβ peptide, which is the probable molecular trigger for Alzheimer's disease, manifests all of the key characteristics of canonical mammalian prions. These features include a β-sheet rich architecture, tendency to polymerize into amyloid, templated corruption of like protein molecules, ability to form structurally and functionally variant strains, systematic spread by neuronal transport, and resistance to inactivation by heat and formaldehyde. In addition to Aβ, a growing body of research supports the view that the prion-like molecular transformation of specific proteins drives the onset and course of a remarkable variety of clinicopathologically diverse diseases. As such, the expanded prion paradigm could conceptually unify fundamental and translational investigations of these disorders.

  18. Destabilization and recovery of a yeast prion after mild heat shock.

    PubMed

    Newnam, Gary P; Birchmore, Jennifer L; Chernoff, Yury O

    2011-05-06

    Yeast prion [PSI(+)] is a self-perpetuating amyloid of the translational termination factor Sup35. Although [PSI(+)] propagation is modulated by heat shock proteins (Hsps), high temperature was previously reported to have little or no effect on [PSI(+)]. Our results show that short-term exposure of exponentially growing yeast culture to mild heat shock, followed by immediate resumption of growth, leads to [PSI(+)] destabilization, sometimes persisting for several cell divisions after heat shock. Prion loss occurring in the first division after heat shock is preferentially detected in a daughter cell, indicating the impairment of prion segregation that results in asymmetric prion distribution between a mother cell and a bud. Longer heat shock or prolonged incubation in the absence of nutrients after heat shock led to [PSI(+)] recovery. Both prion destabilization and recovery during heat shock depend on protein synthesis. Maximal prion destabilization coincides with maximal imbalance between Hsp104 and other Hsps such as Hsp70-Ssa. Deletions of individual SSA genes increase prion destabilization and/or counteract recovery. The dynamics of prion aggregation during destabilization and recovery are consistent with the notion that efficient prion fragmentation and segregation require a proper balance between Hsp104 and other (e.g., Hsp70-Ssa) chaperones. In contrast to heat shock, [PSI(+)] destabilization by osmotic stressors does not always depend on cell proliferation and/or protein synthesis, indicating that different stresses may impact the prion via different mechanisms. Our data demonstrate that heat stress causes asymmetric prion distribution in a cell division and confirm that the effects of Hsps on prions are physiologically relevant. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. The neutral sphingomyelinase pathway regulates packaging of the prion protein into exosomes.

    PubMed

    Guo, Belinda B; Bellingham, Shayne A; Hill, Andrew F

    2015-02-06

    Prion diseases are a group of transmissible, fatal neurodegenerative disorders associated with the misfolding of the host-encoded prion protein, PrP(C), into a disease-associated form, PrP(Sc). The transmissible prion agent is principally formed of PrP(Sc) itself and is associated with extracellular vesicles known as exosomes. Exosomes are released from cells both in vitro and in vivo, and have been proposed as a mechanism by which prions spread intercellularly. The biogenesis of exosomes occurs within the endosomal system, through formation of intraluminal vesicles (ILVs), which are subsequently released from cells as exosomes. ILV formation is known to be regulated by the endosomal sorting complexes required for transport (ESCRT) machinery, although an alternative neutral sphingomyelinase (nSMase) pathway has been suggested to also regulate this process. Here, we investigate a role for the nSMase pathway in exosome biogenesis and packaging of PrP into these vesicles. Inhibition of the nSMase pathway using GW4869 revealed a role for the nSMase pathway in both exosome formation and PrP packaging. In agreement, targeted knockdown of nSMase1 and nSMase2 in mouse neurons using lentivirus-mediated RNAi also decreases exosome release, demonstrating the nSMase pathway regulates the biogenesis and release of exosomes. We also demonstrate that PrP(C) packaging is dependent on nSMase2, whereas the packaging of disease-associated PrP(Sc) into exosomes occurs independently of nSMase2. These findings provide further insight into prion transmission and identify a pathway which directly assists exosome-mediated transmission of prions. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Cleaning, disinfection and sterilization of surface prion contamination.

    PubMed

    McDonnell, G; Dehen, C; Perrin, A; Thomas, V; Igel-Egalon, A; Burke, P A; Deslys, J P; Comoy, E

    2013-12-01

    Prion contamination is a risk during device reprocessing, being difficult to remove and inactivate. Little is known of the combined effects of cleaning, disinfection and sterilization during a typical reprocessing cycle in clinical practice. To investigate the combination of cleaning, disinfection and/or sterilization on reducing the risk of surface prion contamination. In vivo test methods were used to study the impact of cleaning alone and cleaning combined with thermal disinfection and high- or low-temperature sterilization processes. A standardized test method, based on contamination of stainless steel wires with high titres of scrapie-infected brain homogenates, was used to determine infectivity reduction. Traditional chemical methods of surface decontamination against prions were confirmed to be effective, but extended steam sterilization was more variable. Steam sterilization alone reduced the risk of prion contamination under normal or extended exposure conditions, but did show significant variation. Thermal disinfection had no impact in these studies. Cleaning with certain defined formulations in combination with steam sterilization can be an effective prion decontamination process, in particular with alkaline formulations. Low-temperature, gaseous hydrogen peroxide sterilization was also confirmed to reduce infectivity in the presence and absence of cleaning. Prion decontamination is affected by the full reprocessing cycle used on contaminated surfaces. The correct use of defined cleaning, disinfection and sterilization methods as tested in this report in the scrapie infectivity assay can provide a standard precaution against prion contamination. Copyright © 2013 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  1. The Physics of Amyloid Aggregation and Templating in Prions

    NASA Astrophysics Data System (ADS)

    Cox, Daniel

    2012-02-01

    The problem of self-assembled amyloid aggregation of proteins in structures with beta-strands perpendicular to a one dimensional grown axis is interesting at a fundamental level (is this the most generic end state of proteins?), from a biological level (if the self-assembly can be regulated it is of use in contexts like spider silk and bacterial colony formation), for human public health (aggregation unregulated induces diseases like mad cow and Alzheimer's), and for possible materials applications (e.g., in tissue scaffolding). In this presentation, I will review the work of my group in examining the possibility that the left-handed beta helix (LHBH) structure can be the building block of the aggregates of mammalian prion and yeast prion proteins. I will also discuss our efforts to assess the possibility of a novel pH driven structural switch between LHBH and alpha-helical forms in the ordered half of the mammalian prion protein, and now the possibly pH stabilized LHBH structure can template aggregate growth of the disordered half of the protein, identified in numerous experimental studies as most relevant to disease.

  2. Pathways of Prion Spread during Early Chronic Wasting Disease in Deer.

    PubMed

    Hoover, Clare E; Davenport, Kristen A; Henderson, Davin M; Denkers, Nathaniel D; Mathiason, Candace K; Soto, Claudio; Zabel, Mark D; Hoover, Edward A

    2017-05-15

    Among prion infections, two scenarios of prion spread are generally observed: (i) early lymphoid tissue replication or (ii) direct neuroinvasion without substantial antecedent lymphoid amplification. In nature, cervids are infected with chronic wasting disease (CWD) prions by oral and nasal mucosal exposure, and studies of early CWD pathogenesis have implicated pharyngeal lymphoid tissue as the earliest sites of prion accumulation. However, knowledge of chronological events in prion spread during early infection remains incomplete. To investigate this knowledge gap in early CWD pathogenesis, we exposed white-tailed deer to CWD prions by mucosal routes and performed serial necropsies to assess PrP CWD tissue distribution by real-time quaking-induced conversion (RT-QuIC) and tyramide signal amplification immunohistochemistry (TSA-IHC). Although PrP CWD was not detected by either method in the initial days (1 and 3) postexposure, we observed PrP CWD seeding activity and follicular immunoreactivity in oropharyngeal lymphoid tissues at 1 and 2 months postexposure (MPE). At 3 MPE, PrP CWD replication had expanded to all systemic lymphoid tissues. By 4 MPE, the PrP CWD burden in all lymphoid tissues had increased and approached levels observed in terminal disease, yet there was no evidence of nervous system invasion. These results indicate the first site of CWD prion entry is in the oropharynx, and the initial phase of prion amplification occurs in the oropharyngeal lymphoid tissues followed by rapid dissemination to systemic lymphoid tissues. This lymphoid replication phase appears to precede neuroinvasion. IMPORTANCE Chronic wasting disease (CWD) is a universally fatal transmissible spongiform encephalopathy affecting cervids, and natural infection occurs through oral and nasal mucosal exposure to infectious prions. Terminal disease is characterized by PrP CWD accumulation in the brain and lymphoid tissues of affected animals. However, the initial sites of prion

  3. Pathways of Prion Spread during Early Chronic Wasting Disease in Deer

    PubMed Central

    Hoover, Clare E.; Davenport, Kristen A.; Henderson, Davin M.; Denkers, Nathaniel D.; Mathiason, Candace K.; Soto, Claudio; Zabel, Mark D.

    2017-01-01

    ABSTRACT Among prion infections, two scenarios of prion spread are generally observed: (i) early lymphoid tissue replication or (ii) direct neuroinvasion without substantial antecedent lymphoid amplification. In nature, cervids are infected with chronic wasting disease (CWD) prions by oral and nasal mucosal exposure, and studies of early CWD pathogenesis have implicated pharyngeal lymphoid tissue as the earliest sites of prion accumulation. However, knowledge of chronological events in prion spread during early infection remains incomplete. To investigate this knowledge gap in early CWD pathogenesis, we exposed white-tailed deer to CWD prions by mucosal routes and performed serial necropsies to assess PrPCWD tissue distribution by real-time quaking-induced conversion (RT-QuIC) and tyramide signal amplification immunohistochemistry (TSA-IHC). Although PrPCWD was not detected by either method in the initial days (1 and 3) postexposure, we observed PrPCWD seeding activity and follicular immunoreactivity in oropharyngeal lymphoid tissues at 1 and 2 months postexposure (MPE). At 3 MPE, PrPCWD replication had expanded to all systemic lymphoid tissues. By 4 MPE, the PrPCWD burden in all lymphoid tissues had increased and approached levels observed in terminal disease, yet there was no evidence of nervous system invasion. These results indicate the first site of CWD prion entry is in the oropharynx, and the initial phase of prion amplification occurs in the oropharyngeal lymphoid tissues followed by rapid dissemination to systemic lymphoid tissues. This lymphoid replication phase appears to precede neuroinvasion. IMPORTANCE Chronic wasting disease (CWD) is a universally fatal transmissible spongiform encephalopathy affecting cervids, and natural infection occurs through oral and nasal mucosal exposure to infectious prions. Terminal disease is characterized by PrPCWD accumulation in the brain and lymphoid tissues of affected animals. However, the initial sites of prion

  4. Comparative analysis of the prion protein gene sequences in African lion.

    PubMed

    Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming

    2006-10-01

    The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.

  5. The ribosome-associated complex antagonizes prion formation in yeast.

    PubMed

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  6. Transition-metal prion protein attachment: Competition with copper

    NASA Astrophysics Data System (ADS)

    Hodak, Miroslav; Bernholc, Jerry

    2012-02-01

    Prion protein, PrP, is a protein capable of binding copper ions in multiple modes depending on their concentration. Misfolded PrP is implicated in a group of neurodegenerative diseases, which include ``mad cow disease'' and its human form, variant Creutzfeld-Jacob disease. An increasing amount of evidence suggests that attachment of non-copper metal ions to PrP triggers transformations to abnormal forms similar to those observed in prion diseases. In this work, we use hybrid Kohn-Sham/orbital-free density functional theory simulations to investigate copper replacement by other transition metals that bind to PrP, including zinc, iron and manganese. We consider all known copper binding modes in the N-terminal domain of PrP. Our calculations identify modes most susceptible to copper replacement and reveal metals that can successfully compete with copper for attachment to PrP.

  7. Region-specific protein misfolding cyclic amplification reproduces brain tropism of prion strains.

    PubMed

    Privat, Nicolas; Levavasseur, Etienne; Yildirim, Serfildan; Hannaoui, Samia; Brandel, Jean-Philippe; Laplanche, Jean-Louis; Béringue, Vincent; Seilhean, Danielle; Haïk, Stéphane

    2017-10-06

    Human prion diseases such as Creutzfeldt-Jakob disease are transmissible brain proteinopathies, characterized by the accumulation of a misfolded isoform of the host cellular prion protein (PrP) in the brain. According to the prion model, prions are defined as proteinaceous infectious particles composed solely of this abnormal isoform of PrP (PrP Sc ). Even in the absence of genetic material, various prion strains can be propagated in experimental models. They can be distinguished by the pattern of disease they produce and especially by the localization of PrP Sc deposits within the brain and the spongiform lesions they induce. The mechanisms involved in this strain-specific targeting of distinct brain regions still are a fundamental, unresolved question in prion research. To address this question, we exploited a prion conversion in vitro assay, protein misfolding cyclic amplification (PMCA), by using experimental scrapie and human prion strains as seeds and specific brain regions from mice and humans as substrates. We show here that region-specific PMCA in part reproduces the specific brain targeting observed in experimental, acquired, and sporadic Creutzfeldt-Jakob diseases. Furthermore, we provide evidence that, in addition to cellular prion protein, other region- and species-specific molecular factors influence the strain-dependent prion conversion process. This important step toward understanding prion strain propagation in the human brain may impact research on the molecular factors involved in protein misfolding and the development of ultrasensitive methods for diagnosing prion disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Role of prion protein aggregation in neurotoxicity.

    PubMed

    Corsaro, Alessandro; Thellung, Stefano; Villa, Valentina; Nizzari, Mario; Florio, Tullio

    2012-01-01

    In several neurodegenerative diseases, such as Parkinson, Alzheimer's, Huntington, and prion diseases, the deposition of aggregated misfolded proteins is believed to be responsible for the neurotoxicity that characterizes these diseases. Prion protein (PrP), the protein responsible of prion diseases, has been deeply studied for the peculiar feature of its misfolded oligomers that are able to propagate within affected brains, inducing the conversion of the natively folded PrP into the pathological conformation. In this review, we summarize the available experimental evidence concerning the relationship between aggregation status of misfolded PrP and neuronal death in the course of prion diseases. In particular, we describe the main findings resulting from the use of different synthetic (mainly PrP106-126) and recombinant PrP-derived peptides, as far as mechanisms of aggregation and amyloid formation, and how these different spatial conformations can affect neuronal death. In particular, most data support the involvement of non-fibrillar oligomers rather than actual amyloid fibers as the determinant of neuronal death.

  9. The prion-like domain of FUS is multiphosphorylated following DNA damage without altering nuclear localization.

    PubMed

    Rhoads, Shannon N; Monahan, Zachary T; Yee, Debra S; Leung, Andrew Y; Newcombe, Cameron G; O'Meally, Robert N; Cole, Robert N; Shewmaker, Frank P

    2018-06-13

    FUS is an abundant, predominantly nuclear protein involved in RNA processing. Under various conditions, FUS functionally associates with RNA and other macromolecules to form distinct, reversible phase-separated liquid structures. Persistence of the phase-separated state and increased cytoplasmic localization are both hypothesized to predispose FUS to irreversible aggregation, which is a pathological hallmark of subtypes of amyotrophic lateral sclerosis and frontotemporal dementia. We previously showed that phosphorylation of FUS's prion-like domain suppressed phase separation and toxic aggregation, proportionally to the number of added phosphates. However, phosphorylation of FUS's prion-like domain was previously reported to promote its cytoplasmic localization, potentially favoring pathological behavior. Here, we used mass spectrometry and human cell models to further identify phosphorylation sites within FUS's prion-like domain, specifically following DNA-damaging stress. In total, 28 putative sites have been identified, about half of which are DNA-dependent protein kinase (DNA-PK) consensus sites. Custom antibodies were developed to confirm the phosphorylation of two of these sites (Ser26 and Ser30). Both sites were usually phosphorylated in a sub-population of cellular FUS following a variety of DNA-damaging stresses, but not necessarily equally or simultaneously. Importantly, we found DNA-PK-dependent multi-phosphorylation of FUS's prion-like domain does not cause cytoplasmic localization.

  10. Infectious Prion Protein Alters Manganese Transport and Neurotoxicity in a Cell Culture Model of Prion Disease

    PubMed Central

    Martin, Dustin P.; Anantharam, Vellareddy; Jin, Huajun; Witte, Travis; Houk, Robert; Kanthasamy, Arthi; Kanthasamy, Anumantha G.

    2011-01-01

    Protein misfolding and aggregation are considered key features of many neurodegenerative diseases, but biochemical mechanisms underlying protein misfolding and the propagation of protein aggregates are not well understood. Prion disease is a classical neurodegenerative disorder resulting from the misfolding of endogenously expressed normal cellular prion protein (PrPC). Although the exact function of PrPC has not been fully elucidated, studies have suggested that it can function as a metal binding protein. Interestingly, increased brain manganese (Mn) levels have been reported in various prion diseases indicating divalent metals also may play a role in the disease process. Recently, we reported that PrPC protects against Mn-induced cytotoxicity in a neural cell culture model. To further understand the role of Mn in prion diseases, we examined Mn neurotoxicity in an infectious cell culture model of prion disease. Our results show CAD5 scrapie-infected cells were more resistant to Mn neurotoxicity as compared to uninfected cells (EC50 = 428.8 μM for CAD5 infected cells vs. 211.6 μM for uninfected cells). Additionally, treatment with 300 μM Mn in persistently infected CAD5 cells showed a reduction in mitochondrial impairment, caspase-3 activation, and DNA fragmentation when compared to uninfected cells. Scrapie-infected cells also showed significantly reduced Mn uptake as measured by inductively coupled plasma-mass spectrometry (ICP-MS), and altered expression of metal transporting proteins DMT1 and transferrin. Together, our data indicate that conversion of PrP to the pathogenic isoform enhances its ability to regulate Mn homeostasis, and suggest that understanding the interaction of metals with disease-specific proteins may provide further insight to protein aggregation in neurodegenerative diseases. PMID:21871919

  11. Semi-purification procedures of prions from a prion-infected brain using sucrose has no influence on the nonenzymatic glycation of the disease-associated prion isoform.

    PubMed

    Choi, Yeong-Gon; Kim, Jae-Il; Choi, Eun-Kyoung; Carp, Richard I; Kim, Yong-Sun

    2016-01-01

    Previous studies have shown that the Nε-carboxymethyl group is linked to not only one or more N-terminal Lys residues but also to one or more Lys residues of the protease-resistant core region of the pathogenic prion isoform (PrPSc) in prion-infected brains. Using an anti-advanced glycation end product (AGE) antibody, we detected nonenzymatically glycated PrPSc (AGE-PrPSc) in prion-infected brains following concentration by a series of ultracentrifugation steps with a sucrose cushion. In the present study, the levels of in vitro nonenzymatic glycation of PrPSc using sucrose were investigated to determine whether sucrose cushion can artificially and nonenzymatically induce in vitro glycation during ultracentrifugation. The first insoluble pellet fraction following the first ultracentrifugation (PU1st) collected from 263K scrapie-infected brains was incubated with sucrose, glucose or colloidal silica coated with polyvinylpyrrolidone (percoll). None of the compounds in vitro resulted in AGE-PrPSc. Nonetheless, glucose and percoll produced AGEs in vitro from other proteins within PU1st of the infected brains. This reaction could lead to the AGE-modified polymer(s) of nonenzymatic glycation-prone protein(s). This study showed that PrPSc is not nonenzymatically glycated in vitro with sucrose, glucose or percoll and that AGE-modified PrPSc can be isolated and enriched from prion-infected brains.

  12. Effect of Domestication on the Spread of the [PIN+] Prion in Saccharomyces cerevisiae

    PubMed Central

    Kelly, Amy C.; Busby, Ben; Wickner, Reed B.

    2014-01-01

    Prions (infectious proteins) cause fatal neurodegenerative diseases in mammals. In the yeast Saccharomyces cerevisiae, many toxic and lethal variants of the [PSI+] and [URE3] prions have been identified in laboratory strains, although some commonly studied variants do not seem to impair cell growth. Phylogenetic analysis has revealed four major clades of S. cerevisiae that share histories of two prion proteins and largely correspond to different ecological niches of yeast. The [PIN+] prion was most prevalent in commercialized niches, infrequent among wine/vineyard strains, and not observed in ancestral isolates. As previously reported, the [PSI+] and [URE3] prions are not found in any of these strains. Patterns of heterozygosity revealed genetic mosaicism and indicated extensive outcrossing among divergent strains in commercialized environments. In contrast, ancestral isolates were all homozygous and wine/vineyard strains were closely related to each other and largely homozygous. Cellular growth patterns were highly variable within and among clades, although ancestral isolates were the most efficient sporulators and domesticated strains showed greater tendencies for flocculation. [PIN+]-infected strains had a significantly higher likelihood of polyploidy, showed a higher propensity for flocculation compared to uninfected strains, and had higher sporulation efficiencies compared to domesticated, uninfected strains. Extensive phenotypic variability among strains from different environments suggests that S. cerevisiae is a niche generalist and that most wild strains are able to switch from asexual to sexual and from unicellular to multicellular growth in response to environmental conditions. Our data suggest that outbreeding and multicellular growth patterns adapted for domesticated environments are ecological risk factors for the [PIN+] prion in wild yeast. PMID:24812307

  13. Insights into mechanisms of transmission and pathogenesis from transgenic mouse models of prion diseases

    PubMed Central

    Moreno, Julie A.; Telling, Glenn C.

    2018-01-01

    Prions represent a new paradigm of protein-mediated information transfer. In the case of mammals, prions are the cause of fatal, transmissible neurodegenerative diseases, sometimes referred to as transmissible spongiform encephalopathies (TSE’s), which frequently occur as epidemics. An increasing body of evidence indicates that the canonical mechanism of conformational corruption of cellular prion protein (PrPC) by the pathogenic isoform (PrPSc) that is the basis of prion formation in TSE’s, is common to a spectrum of proteins associated with various additional human neurodegenerative disorders, including the more common Alzheimer’s and Parkinson’s diseases. The peerless infectious properties of TSE prions, and the unparalleled tools for their study, therefore enable elucidation of mechanisms of template-mediated conformational propagation that are generally applicable to these related disease states. Many unresolved issues remain including the exact molecular nature of the prion, the detailed cellular and molecular mechanisms of prion propagation, and the means by which prion diseases can be both genetic and infectious. In addition, we know little about the mechanism by which neurons degenerate during prion diseases. Tied to this, the physiological role of the normal form of the prion protein remains unclear and it is uncertain whether or not loss of this function contributes to prion pathogenesis. The factors governing the transmission of prions between species remain unclear, in particular the means by which prion strains and PrP primary structure interact to affect inter-species prion transmission. Despite all these unknowns, advances in our understanding of prions have occurred because of their transmissibility to experimental animals and the development of transgenic (Tg) mouse models has done much to further our understanding about various aspects of prion biology. In this review we will focus on advances in our understanding of prion biology that

  14. [PSI+] Prion transmission barriers protect Saccharomyces cerevisiae from infection: intraspecies 'species barriers'.

    PubMed

    Bateman, David A; Wickner, Reed B

    2012-02-01

    [PSI+] is a prion of Sup35p, an essential translation termination and mRNA turnover factor. The existence of lethal [PSI+] variants, the absence of [PSI+] in wild strains, the mRNA turnover function of the Sup35p prion domain, and the stress reaction to prion infection suggest that [PSI+] is a disease. Nonetheless, others have proposed that [PSI+] and other yeast prions benefit their hosts. We find that wild Saccharomyces cerevisiae strains are polymorphic for the sequence of the prion domain and particularly in the adjacent M domain. Here we establish that these variations within the species produce barriers to prion transmission. The barriers are partially asymmetric in some cases, and evidence for variant specificity in barriers is presented. We propose that, as the PrP 129M/V polymorphism protects people from Creutzfeldt-Jakob disease, the Sup35p polymorphisms were selected to protect yeast cells from prion infection. In one prion incompatibility group, the barrier is due to N109S in the Sup35 prion domain and several changes in the middle (M) domain, with either the single N109S mutation or the group of M changes (without the N109S) producing a barrier. In another, the barrier is due to a large deletion in the repeat domain. All are outside the region previously believed to determine transmission compatibility. [SWI+], a prion of the chromatin remodeling factor Swi1p, was also proposed to benefit its host. We find that none of 70 wild strains carry this prion, suggesting that it is not beneficial.

  15. Optimization of Aryl Amides that Extend Survival in Prion-Infected Mice

    PubMed Central

    Giles, Kurt; Berry, David B.; Condello, Carlo; Dugger, Brittany N.; Li, Zhe; Oehler, Abby; Bhardwaj, Sumita; Elepano, Manuel; Guan, Shenheng; Silber, B. Michael; Olson, Steven H.

    2016-01-01

    Developing therapeutics for neurodegenerative diseases (NDs) prevalent in the aging population remains a daunting challenge. With the growing understanding that many NDs progress by conformational self-templating of specific proteins, the prototypical prion diseases offer a platform for ND drug discovery. We evaluated high-throughput screening hits with the aryl amide scaffold and explored the structure–activity relationships around three series differing in their N-aryl core: benzoxazole, benzothiazole, and cyano. Potent anti-prion compounds were advanced to pharmacokinetic studies, and the resulting brain-penetrant leads from each series, together with a related N-aryl piperazine lead, were escalated to long-term dosing and efficacy studies. Compounds from each of the four series doubled the survival of mice infected with a mouse-passaged prion strain. Treatment with aryl amides altered prion strain properties, as evidenced by the distinct patterns of neuropathological deposition of prion protein and associated astrocytic gliosis in the brain; however, none of the aryl amide compounds resulted in drug-resistant prion strains, in contrast to previous studies on compounds with the 2-aminothiazole (2-AMT) scaffold. As seen with 2-AMTs and other effective anti-prion compounds reported to date, the novel aryl amides reported here were ineffective in prolonging the survival of transgenic mice infected with human prions. Most encouraging is our discovery that aryl amides show that the development of drug resistance is not an inevitable consequence of efficacious anti-prion therapeutics. PMID:27317802

  16. Homogenous photocatalytic decontamination of prion infected stainless steel and titanium surfaces.

    PubMed

    Berberidou, Chrysanthi; Xanthopoulos, Konstantinos; Paspaltsis, Ioannis; Lourbopoulos, Athanasios; Polyzoidou, Eleni; Sklaviadis, Theodoros; Poulios, Ioannis

    2013-01-01

    Prions are notorious for their extraordinary resistance to traditional methods of decontamination, rendering their transmission a public health risk. Iatrogenic Creutzfeldt-Jakob disease (iCJD) via contaminated surgical instruments and medical devices has been verified both experimentally and clinically. Standard methods for prion inactivation by sodium hydroxide or sodium hypochlorite have failed, in some cases, to fully remove prion infectivity, while they are often impractical for routine applications. Prion accumulation in peripheral tissues and indications of human-to-human bloodborne prion transmission, highlight the need for novel, efficient, yet user-friendly methods of prion inactivation. Here we show both in vitro and in vivo that homogenous photocatalytic oxidation, mediated by the photo-Fenton reagent, has the potential to inactivate the pathological prion isoform adsorbed on metal substrates. Photocatalytic oxidation with 224 μg mL(-1) Fe (3+), 500 μg mL(-1) h(-1) H 2O 2, UV-A for 480 min lead to 100% survival in golden Syrian hamsters after intracranial implantation of stainless steel wires infected with the 263K prion strain. Interestingly, photocatalytic treatment of 263K infected titanium wires, under the same experimental conditions, prolonged the survival interval significantly, but failed to eliminate infectivity, a result that we correlate with the increased adsorption of PrP(Sc) on titanium, in comparison to stainless steel. Our findings strongly indicate that our, user--and environmentally--friendly protocol can be safely applied to the decontamination of prion infected stainless steel surfaces.

  17. Prions Adhere to Soil Minerals and Remain Infectious

    PubMed Central

    Johnson, Christopher J; Phillips, Kristen E; Schramm, Peter T; McKenzie, Debbie; Aiken, Judd M; Pedersen, Joel A

    2006-01-01

    An unidentified environmental reservoir of infectivity contributes to the natural transmission of prion diseases (transmissible spongiform encephalopathies [TSEs]) in sheep, deer, and elk. Prion infectivity may enter soil environments via shedding from diseased animals and decomposition of infected carcasses. Burial of TSE-infected cattle, sheep, and deer as a means of disposal has resulted in unintentional introduction of prions into subsurface environments. We examined the potential for soil to serve as a TSE reservoir by studying the interaction of the disease-associated prion protein (PrPSc) with common soil minerals. In this study, we demonstrated substantial PrPSc adsorption to two clay minerals, quartz, and four whole soil samples. We quantified the PrPSc-binding capacities of each mineral. Furthermore, we observed that PrPSc desorbed from montmorillonite clay was cleaved at an N-terminal site and the interaction between PrPSc and Mte was strong, making desorption of the protein difficult. Despite cleavage and avid binding, PrPSc bound to Mte remained infectious. Results from our study suggest that PrPSc released into soil environments may be preserved in a bioavailable form, perpetuating prion disease epizootics and exposing other species to the infectious agent. PMID:16617377

  18. Human Tonsil-Derived Follicular Dendritic-Like Cells are Refractory to Human Prion Infection in Vitro and Traffic Disease-Associated Prion Protein to Lysosomes

    PubMed Central

    Krejciova, Zuzana; De Sousa, Paul; Manson, Jean; Ironside, James W.; Head, Mark W.

    2014-01-01

    The molecular mechanisms involved in human cellular susceptibility to prion infection remain poorly defined. This is due, in part, to the absence of any well characterized and relevant cultured human cells susceptible to infection with human prions, such as those involved in Creutzfeldt-Jakob disease. In variant Creutzfeldt-Jakob disease, prion replication is thought to occur first in the lymphoreticular system and then spread into the brain. We have, therefore, examined the susceptibility of a human tonsil-derived follicular dendritic cell-like cell line (HK) to prion infection. HK cells were found to display a readily detectable, time-dependent increase in cell-associated abnormal prion protein (PrPTSE) when exposed to medium spiked with Creutzfeldt-Jakob disease brain homogenate, resulting in a coarse granular perinuclear PrPTSE staining pattern. Despite their high level of cellular prion protein expression, HK cells failed to support infection, as judged by longer term maintenance of PrPTSE accumulation. Colocalization studies revealed that exposure of HK cells to brain homogenate resulted in increased numbers of detectable lysosomes and that these structures immunostained intensely for PrPTSE after exposure to Creutzfeldt-Jakob disease brain homogenate. Our data suggest that human follicular dendritic-like cells and perhaps other human cell types are able to avoid prion infection by efficient lysosomal degradation of PrPTSE. PMID:24183781

  19. Human stem cell–derived astrocytes replicate human prions in a PRNP genotype–dependent manner

    PubMed Central

    Krejciova, Zuzana; Alibhai, James; Zhao, Chen; Rzechorzek, Nina M.; Ullian, Erik M.; Manson, Jean

    2017-01-01

    Prions are infectious agents that cause neurodegenerative diseases such as Creutzfeldt–Jakob disease (CJD). The absence of a human cell culture model that replicates human prions has hampered prion disease research for decades. In this paper, we show that astrocytes derived from human induced pluripotent stem cells (iPSCs) support the replication of prions from brain samples of CJD patients. For experimental exposure of astrocytes to variant CJD (vCJD), the kinetics of prion replication occur in a prion protein codon 129 genotype–dependent manner, reflecting the genotype-dependent susceptibility to clinical vCJD found in patients. Furthermore, iPSC-derived astrocytes can replicate prions associated with the major sporadic CJD strains found in human patients. Lastly, we demonstrate the subpassage of prions from infected to naive astrocyte cultures, indicating the generation of prion infectivity in vitro. Our study addresses a long-standing gap in the repertoire of human prion disease research, providing a new in vitro system for accelerated mechanistic studies and drug discovery. PMID:29141869

  20. Cholesterol Balance in Prion Diseases and Alzheimer’s Disease

    PubMed Central

    Hannaoui, Samia; Shim, Su Yeon; Cheng, Yo Ching; Corda, Erica; Gilch, Sabine

    2014-01-01

    Prion diseases are transmissible and fatal neurodegenerative disorders of humans and animals. They are characterized by the accumulation of PrPSc, an aberrantly folded isoform of the cellular prion protein PrPC, in the brains of affected individuals. PrPC is a cell surface glycoprotein attached to the outer leaflet of the plasma membrane by a glycosyl-phosphatidyl-inositol (GPI) anchor. Specifically, it is associated with lipid rafts, membrane microdomains enriched in cholesterol and sphinoglipids. It has been established that inhibition of endogenous cholesterol synthesis disturbs lipid raft association of PrPC and prevents PrPSc accumulation in neuronal cells. Additionally, prion conversion is reduced upon interference with cellular cholesterol uptake, endosomal export, or complexation at the plasma membrane. Altogether, these results demonstrate on the one hand the importance of cholesterol for prion propagation. On the other hand, growing evidence suggests that prion infection modulates neuronal cholesterol metabolism. Similar results were reported in Alzheimer’s disease (AD): whereas amyloid β peptide formation is influenced by cellular cholesterol, levels of cholesterol in the brains of affected individuals increase during the clinical course of the disease. In this review, we summarize commonalities of alterations in cholesterol homeostasis and discuss consequences for neuronal function and therapy of prion diseases and AD. PMID:25419621

  1. Primary transmission of chronic wasting disease versus scrapie prions from small ruminants to transgenic mice expressing ovine or cervid prion protein.

    PubMed

    Madsen-Bouterse, Sally A; Schneider, David A; Zhuang, Dongyue; Dassanayake, Rohana P; Balachandran, Aru; Mitchell, Gordon B; O'Rourke, Katherine I

    2016-09-01

    Development of mice expressing either ovine (Tg338) or cervid (TgElk) prion protein (PrP) have aided in characterization of scrapie and chronic wasting disease (CWD), respectively. Experimental inoculation of sheep with CWD prions has demonstrated the potential for interspecies transmission but, infection with CWD versus classical scrapie prions may be difficult to differentiate using validated diagnostic platforms. In this study, mouse bioassay in Tg338 and TgElk was utilized to evaluate transmission of CWD versus scrapie prions from small ruminants. Mice (≥5 per homogenate) were inoculated with brain homogenates from clinically affected sheep or goats with naturally acquired classical scrapie, white-tailed deer with naturally acquired CWD (WTD-CWD) or sheep with experimentally acquired CWD derived from elk (sheep-passaged-CWD). Survival time (time to clinical disease) and attack rates (brain accumulation of protease resistant PrP, PrPres) were determined. Inoculation with classical scrapie prions resulted in clinical disease and 100 % attack rates in Tg338, but no clinical disease at endpoint (>300 days post-inoculation, p.i.) and low attack rates (6.8 %) in TgElk. Inoculation with WTD-CWD prions yielded no clinical disease or brain PrPres accumulation in Tg338 at endpoint (>500 days p.i.), but rapid onset of clinical disease (~121 days p.i.) and 100 % attack rate in TgElk. Sheep-passaged-CWD resulted in transmission to both mouse lines with 100 % attack rates at endpoint in Tg338 and an attack rate of ~73 % in TgElk with some culled due to clinical disease. These primary transmission observations demonstrate the potential of bioassay in Tg338 and TgElk to help differentiate possible infection with CWD versus classical scrapie prions in sheep and goats.

  2. Patterns of [PSI+] aggregation allow insights into cellular organization of yeast prion aggregates

    PubMed Central

    Tyedmers, Jens

    2012-01-01

    The yeast prion phenomenon is very widespread and mounting evidence suggests that it has an impact on cellular regulatory mechanisms related to phenotypic responses to changing environments. Studying the aggregation patterns of prion amyloids during different stages of the prion life cycle is a first key step to understand major principles of how and where cells generate, organize and turn-over prion aggregates. The induction of the [PSI+] state involves the actin cytoskeleton and quality control compartments such as the Insoluble Protein Deposit (IPOD). An initially unstable transitional induction state can be visualized by overexpression of the prion determinant and displays characteristic large ring- and ribbon-shaped aggregates consisting of poorly fragmented bundles of very long prion fibrils. In the mature prion state, the aggregation pattern is characterized by highly fragmented, shorter prion fibrils that form aggregates, which can be visualized through tagging with fluorescent proteins. The number of aggregates formed varies, ranging from a single large aggregate at the IPOD to multiple smaller ones, depending on several parameters discussed. Aggregate units below the resolution of light microscopy that are detectable by fluorescence correlation spectroscopy are in equilibrium with larger aggregates in this stage and can mediate faithful inheritance of the prion state. Loss of the prion state is often characterized by reduced fragmentation of prion fibrils and fewer, larger aggregates. PMID:22449721

  3. Dominant-Negative Inhibition of Prion Formation Diminished by Deletion Mutagenesis of the Prion Protein

    PubMed Central

    Zulianello, Laurence; Kaneko, Kiyotoshi; Scott, Michael; Erpel, Susanne; Han, Dong; Cohen, Fred E.; Prusiner, Stanley B.

    2000-01-01

    Polymorphic basic residues near the C terminus of the prion protein (PrP) in humans and sheep appear to protect against prion disease. In heterozygotes, inhibition of prion formation appears to be dominant negative and has been simulated in cultured cells persistently infected with scrapie prions. The results of nuclear magnetic resonance and mutagenesis studies indicate that specific substitutions at the C-terminal residues 167, 171, 214, and 218 of PrPC act as dominant-negative, inhibitors of PrPSc formation (K. Kaneko et al., Proc. Natl. Acad. Sci. USA 94:10069–10074, 1997). Trafficking of substituted PrPC to caveaola-like domains or rafts by the glycolipid anchor was required for the dominant-negative phenotype; interestingly, amino acid replacements at multiple sites were less effective than single-residue substitutions. To elucidate which domains of PrPC are responsible for dominant-negative inhibition of PrPSc formation, we analyzed whether N-terminally truncated PrP(Q218K) molecules exhibited dominant-negative effects in the conversion of full-length PrPC to PrPSc. We found that the C-terminal domain of PrP is not sufficient to impede the conversion of the full-length PrPC molecule and that N-terminally truncated molecules (with residues 23 to 88 and 23 to 120 deleted) have reduced dominant-negative activity. Whether the N-terminal region of PrP acts by stabilizing the C-terminal domain of the molecule or by modulating the binding of PrPC to an auxiliary molecule that participates in PrPSc formation remains to be established. PMID:10756050

  4. Heterologous Gln/Asn-Rich Proteins Impede the Propagation of Yeast Prions by Altering Chaperone Availability

    PubMed Central

    Yang, Zi; Hong, Joo Y.; Derkatch, Irina L.; Liebman, Susan W.

    2013-01-01

    Prions are self-propagating conformations of proteins that can cause heritable phenotypic traits. Most yeast prions contain glutamine (Q)/asparagine (N)-rich domains that facilitate the accumulation of the protein into amyloid-like aggregates. Efficient transmission of these infectious aggregates to daughter cells requires that chaperones, including Hsp104 and Sis1, continually sever the aggregates into smaller “seeds.” We previously identified 11 proteins with Q/N-rich domains that, when overproduced, facilitate the de novo aggregation of the Sup35 protein into the [PSI +] prion state. Here, we show that overexpression of many of the same 11 Q/N-rich proteins can also destabilize pre-existing [PSI +] or [URE3] prions. We explore in detail the events leading to the loss (curing) of [PSI+] by the overexpression of one of these proteins, the Q/N-rich domain of Pin4, which causes Sup35 aggregates to increase in size and decrease in transmissibility to daughter cells. We show that the Pin4 Q/N-rich domain sequesters Hsp104 and Sis1 chaperones away from the diffuse cytoplasmic pool. Thus, a mechanism by which heterologous Q/N-rich proteins impair prion propagation appears to be the loss of cytoplasmic Hsp104 and Sis1 available to sever [PSI +]. PMID:23358669

  5. Role of Prion Protein Aggregation in Neurotoxicity

    PubMed Central

    Corsaro, Alessandro; Thellung, Stefano; Villa, Valentina; Nizzari, Mario; Florio, Tullio

    2012-01-01

    In several neurodegenerative diseases, such as Parkinson, Alzheimer’s, Huntington, and prion diseases, the deposition of aggregated misfolded proteins is believed to be responsible for the neurotoxicity that characterizes these diseases. Prion protein (PrP), the protein responsible of prion diseases, has been deeply studied for the peculiar feature of its misfolded oligomers that are able to propagate within affected brains, inducing the conversion of the natively folded PrP into the pathological conformation. In this review, we summarize the available experimental evidence concerning the relationship between aggregation status of misfolded PrP and neuronal death in the course of prion diseases. In particular, we describe the main findings resulting from the use of different synthetic (mainly PrP106-126) and recombinant PrP-derived peptides, as far as mechanisms of aggregation and amyloid formation, and how these different spatial conformations can affect neuronal death. In particular, most data support the involvement of non-fibrillar oligomers rather than actual amyloid fibers as the determinant of neuronal death. PMID:22942726

  6. Genetic Diversity in the Prion Protein Gene (PRNP) of Domestic Cattle and Water Buffaloes in Vietnam, Indonesia and Thailand

    PubMed Central

    UCHIDA, Leo; HERIYANTO, Agus; THONGCHAI, Chalermchaikit; HANH, Tran Thi; HORIUCHI, Motohiro; ISHIHARA, Kanako; TAMURA, Yutaka; MURAMATSU, Yasukazu

    2014-01-01

    ABSTRACT There has been an accumulation of information on frequencies of insertion/deletion (indel) polymorphisms within the bovine prion protein gene (PRNP) and on the number of octapeptide repeats and single nucleotide polymorphisms (SNPs) in the coding region of bovine PRNP related to bovine spongiform encephalopathy (BSE) susceptibility. We investigated the frequencies of 23-bp indel polymorphism in the promoter region (23indel) and 12-bp indel polymorphism in intron 1 region (12indel), octapeptide repeat polymorphisms and SNPs in the bovine PRNP of cattle and water buffaloes in Vietnam, Indonesia and Thailand. The frequency of the deletion allele in the 23indel site was significantly low in cattle of Indonesia and Thailand and water buffaloes. The deletion allele frequency in the 12indel site was significantly low in all of the cattle and buffaloes categorized in each subgroup. In both indel sites, the deletion allele has been reported to be associated with susceptibility to classical BSE. In some Indonesian local cattle breeds, the frequency of the allele with 5 octapeptide repeats was significantly high despite the fact that the allele with 6 octapeptide repeats has been reported to be most frequent in many breeds of cattle. Four SNPs observed in Indonesian local cattle have not been reported for domestic cattle. This study provided information on PRNP of livestock in these Southeast Asian countries. PMID:24705506

  7. Prion Strain Characterization of a Novel Subtype of Creutzfeldt-Jakob Disease.

    PubMed

    Galeno, Roberta; Di Bari, Michele Angelo; Nonno, Romolo; Cardone, Franco; Sbriccoli, Marco; Graziano, Silvia; Ingrosso, Loredana; Fiorini, Michele; Valanzano, Angelina; Pasini, Giulia; Poleggi, Anna; Vinci, Ramona; Ladogana, Anna; Puopolo, Maria; Monaco, Salvatore; Agrimi, Umberto; Zanusso, Gianluigi; Pocchiari, Maurizio

    2017-06-01

    In 2007, we reported a patient with an atypical form of Creutzfeldt-Jakob disease (CJD) heterozygous for methionine-valine (MV) at codon 129 who showed a novel pathological prion protein (PrP TSE ) conformation with an atypical glycoform (AG) profile and intraneuronal PrP deposition. In the present study, we further characterize the conformational properties of this pathological prion protein (PrP TSE MV AG ), showing that PrP TSE MV AG is composed of multiple conformers with biochemical properties distinct from those of PrP TSE type 1 and type 2 of MV sporadic CJD (sCJD). Experimental transmission of CJD-MV AG to bank voles and gene-targeted transgenic mice carrying the human prion protein gene (TgHu mice) showed unique transmission rates, survival times, neuropathological changes, PrP TSE deposition patterns, and PrP TSE glycotypes that are distinct from those of sCJD-MV1 and sCJD-MV2. These biochemical and experimental data suggest the presence of a novel prion strain in CJD-MV AG IMPORTANCE Sporadic Creutzfeldt-Jakob disease is caused by the misfolding of the cellular prion protein, which assumes two different major conformations (type 1 and type 2) and, together with the methionine/valine polymorphic codon 129 of the prion protein gene, contribute to the occurrence of distinct clinical-pathological phenotypes. Inoculation in laboratory rodents of brain tissues from the six possible combinations of pathological prion protein types with codon 129 genotypes results in the identification of 3 or 4 strains of prions. We report on the identification of a novel strain of Creutzfeldt-Jakob disease isolated from a patient who carried an abnormally glycosylated pathological prion protein. This novel strain has unique biochemical characteristics, does not transmit to humanized transgenic mice, and shows exclusive transmission properties in bank voles. The identification of a novel human prion strain improves our understanding of the pathogenesis of the disease and of

  8. Implications of prion adaptation and evolution paradigm for human neurodegenerative diseases.

    PubMed

    Kabir, M Enamul; Safar, Jiri G

    2014-01-01

    There is a growing body of evidence indicating that number of human neurodegenerative diseases, including Alzheimer disease, Parkinson disease, fronto-temporal dementias, and amyotrophic lateral sclerosis, propagate in the brain via prion-like intercellular induction of protein misfolding. Prions cause lethal neurodegenerative diseases in humans, the most prevalent being sporadic Creutzfeldt-Jakob disease (sCJD); they self-replicate and spread by converting the cellular form of prion protein (PrP(C)) to a misfolded pathogenic conformer (PrP(Sc)). The extensive phenotypic heterogeneity of human prion diseases is determined by polymorphisms in the prion protein gene, and by prion strain-specific conformation of PrP(Sc). Remarkably, even though informative nucleic acid is absent, prions may undergo rapid adaptation and evolution in cloned cells and upon crossing the species barrier. In the course of our investigation of this process, we isolated distinct populations of PrP(Sc) particles that frequently co-exist in sCJD. The human prion particles replicate independently and undergo competitive selection of those with lower initial conformational stability. Exposed to mutant substrate, the winning PrP(Sc) conformers are subject to further evolution by natural selection of the subpopulation with the highest replication rate due to the lowest stability. Thus, the evolution and adaptation of human prions is enabled by a dynamic collection of distinct populations of particles, whose evolution is governed by the selection of progressively less stable, faster replicating PrP(Sc) conformers. This fundamental biological mechanism may explain the drug resistance that some prions gained after exposure to compounds targeting PrP(Sc). Whether the phenotypic heterogeneity of other neurodegenerative diseases caused by protein misfolding is determined by the spectrum of misfolded conformers (strains) remains to be established. However, the prospect that these conformers may evolve and

  9. Computational Calculation Of The Ionization Energies Of The Human Prion Protein By The Coarse-grain Method

    NASA Astrophysics Data System (ADS)

    Lyu, Justin; Andrianarijaona, V. M.

    2016-05-01

    The causes of the misfolding of prion protein -i.e. the transformation of PrPC to PrPSc - have not been clearly elucidated. Many studies have focused on identifying possible chemical conditions, such as pH, temperature and chemical denaturation, that may trigger the pathological transformation of prion proteins (Weiwei Tao, Gwonchan Yoon, Penghui Cao, `` β-sheet-like formation during the mechanical unfolding of prion protein'', The Journal of Chemical Physics, 2015, 143, 125101). Here, we attempt to calculate the ionization energies of the prion protein, which will be able to shed light onto the possible causes of the misfolding. We plan on using the coarse-grain method which allows for a more feasible calculation time by means of approximation. We believe that by being able to approximate the ionization potential, particularly that of the regions known to form stable β-strands of the PrPSc form, the possible sources of denaturation, be it chemical or mechanical, may be narrowed down.

  10. Molecular modeling of the conformational dynamics of the cellular prion protein

    NASA Astrophysics Data System (ADS)

    Nguyen, Charles; Colling, Ian; Bartz, Jason; Soto, Patricia

    2014-03-01

    Prions are infectious agents responsible for transmissible spongiform encephalopathies (TSEs), a type of fatal neurodegenerative disease in mammals. Prions propagate biological information by conversion of the non-pathological version of the prion protein to the infectious conformation, PrPSc. A wealth of knowledge has shed light on the nature and mechanism of prion protein conversion. In spite of the significance of this problem, we are far from fully understanding the conformational dynamics of the cellular isoform. To remedy this situation we employ multiple biomolecular modeling techniques such as docking and molecular dynamics simulations to map the free energy landscape and determine what specific regions of the prion protein are most conductive to binding. The overall goal is to characterize the conformational dynamics of the cell form of the prion protein, PrPc, to gain insight into inhibition pathways against misfolding. NE EPSCoR FIRST Award to Patricia Soto.

  11. Diagnostic and prognostic value of human prion detection in cerebrospinal fluid.

    PubMed

    Foutz, Aaron; Appleby, Brian S; Hamlin, Clive; Liu, Xiaoqin; Yang, Sheng; Cohen, Yvonne; Chen, Wei; Blevins, Janis; Fausett, Cameron; Wang, Han; Gambetti, Pierluigi; Zhang, Shulin; Hughson, Andrew; Tatsuoka, Curtis; Schonberger, Lawrence B; Cohen, Mark L; Caughey, Byron; Safar, Jiri G

    2017-01-01

    Several prion amplification systems have been proposed for detection of prions in cerebrospinal fluid (CSF), most recently, the measurements of prion seeding activity with second-generation real-time quaking-induced conversion (RT-QuIC). The objective of this study was to investigate the diagnostic performance of the RT-QuIC prion test in the broad phenotypic spectrum of prion diseases. We performed CSF RT-QuIC testing in 2,141 patients who had rapidly progressive neurological disorders, determined diagnostic sensitivity and specificity in 272 cases that were autopsied, and evaluated the impact of mutations and polymorphisms in the PRNP gene, and type 1 or type 2 human prions on diagnostic performance. The 98.5% diagnostic specificity and 92% sensitivity of CSF RT-QuIC in a blinded retrospective analysis matched the 100% specificity and 95% sensitivity of a blind prospective study. The CSF RT-QuIC differentiated 94% of cases of sporadic Creutzfeldt-Jakob disease (sCJD) MM1 from the sCJD MM2 phenotype, and 80% of sCJD VV2 from sCJD VV1. The mixed prion type 1-2 and cases heterozygous for codon 129 generated intermediate CSF RT-QuIC patterns, whereas genetic prion diseases revealed distinct profiles for each PRNP gene mutation. The diagnostic performance of the improved CSF RT-QuIC is superior to surrogate marker tests for prion diseases such as 14-3-3 and tau proteins, and together with PRNP gene sequencing the test allows the major prion subtypes to be differentiated in vivo. This differentiation facilitates prediction of the clinicopathological phenotype and duration of the disease-two important considerations for envisioned therapeutic interventions. ANN NEUROL 2017;81:79-92. © 2016 American Neurological Association.

  12. Diagnostic and Prognostic Value of Human Prion Detection in Cerebrospinal Fluid

    PubMed Central

    Foutz, Aaron; Appleby, Brian S.; Hamlin, Clive; Liu, Xiaoqin; Yang, Sheng; Cohen, Yvonne; Chen, Wei; Blevins, Janis; Fausett, Cameron; Wang, Han; Gambetti, Pierluigi; Zhang, Shulin; Hughson, Andrew; Tatsuoka, Curtis; Schonberger, Lawrence B.; Cohen, Mark L.; Caughey, Byron; Safar, Jiri G.

    2016-01-01

    Objective Several prion amplification systems have been proposed for detection of prions in cerebrospinal fluid (CSF), most recently, the measurements of prion seeding activity with second-generation real-time quaking-induced conversion (RT-QuIC). The objective of this study was to investigate the diagnostic performance of the RT-QuIC prion test in the broad phenotypic spectrum of prion diseases. Methods We performed CSF RT-QuIC testing in 2,141 patients who had rapidly progressive neurological disorders, determined diagnostic sensitivity and specificity in 272 cases which were autopsied, and evaluated the impact of mutations and polymorphisms in the PRNP gene, and Type 1 or Type 2 of human prions on diagnostic performance. Results The 98.5% diagnostic specificity and 92% sensitivity of CSF RT-QuIC in a blinded retrospective analysis matched the 100% specificity and 95% sensitivity of a blind prospective study. The CSF RT-QuIC differentiated 94% of cases of sporadic Creutzfeldt-Jakob disease (sCJD) MM1 from the sCJD MM2 phenotype, and 80% of sCJD VV2 from sCJD VV1. The mixed prion type 1–2 and cases heterozygous for codon 129 generated intermediate CSF RT-QuIC patterns, while genetic prion diseases revealed distinct profiles for each PRNP gene mutation. Interpretation The diagnostic performance of the improved CSF RT-QuIC is superior to surrogate marker tests for prion diseases such as 14-3-3 and Tau proteins and together with PRNP gene sequencing, the test allows the major prion subtypes to be differentiated in vivo. This differentiation facilitates prediction of the clinicopathological phenotype and duration of the disease—two important considerations for envisioned therapeutic interventions. PMID:27893164

  13. Modelling charge interactions in the prion protein: predictions for pathogenesis.

    PubMed

    Warwicker, J

    1999-04-30

    Calculations are presented for the pH-dependence of stability and membrane charge complementarity of prion protein fragments. The theoretical results are compared with reported characterisations of prion protein folding in vitro. Discussion of models for conformational change and pathogenesis in vivo leads to the prediction of amino acids that could mediate sensitivity to the endosomal pH and to a design strategy for recombinant prion proteins with an increased susceptibility to prion proteinSc-like properties in vitro. In this model, the protective effect of certain basic polymorphisms can be interpreted in terms of oligomerisation on a negatively-charged surface.

  14. Optimization of Aryl Amides that Extend Survival in Prion-Infected Mice.

    PubMed

    Giles, Kurt; Berry, David B; Condello, Carlo; Dugger, Brittany N; Li, Zhe; Oehler, Abby; Bhardwaj, Sumita; Elepano, Manuel; Guan, Shenheng; Silber, B Michael; Olson, Steven H; Prusiner, Stanley B

    2016-09-01

    Developing therapeutics for neurodegenerative diseases (NDs) prevalent in the aging population remains a daunting challenge. With the growing understanding that many NDs progress by conformational self-templating of specific proteins, the prototypical prion diseases offer a platform for ND drug discovery. We evaluated high-throughput screening hits with the aryl amide scaffold and explored the structure-activity relationships around three series differing in their N-aryl core: benzoxazole, benzothiazole, and cyano. Potent anti-prion compounds were advanced to pharmacokinetic studies, and the resulting brain-penetrant leads from each series, together with a related N-aryl piperazine lead, were escalated to long-term dosing and efficacy studies. Compounds from each of the four series doubled the survival of mice infected with a mouse-passaged prion strain. Treatment with aryl amides altered prion strain properties, as evidenced by the distinct patterns of neuropathological deposition of prion protein and associated astrocytic gliosis in the brain; however, none of the aryl amide compounds resulted in drug-resistant prion strains, in contrast to previous studies on compounds with the 2-aminothiazole (2-AMT) scaffold. As seen with 2-AMTs and other effective anti-prion compounds reported to date, the novel aryl amides reported here were ineffective in prolonging the survival of transgenic mice infected with human prions. Most encouraging is our discovery that aryl amides show that the development of drug resistance is not an inevitable consequence of efficacious anti-prion therapeutics. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  15. Molecular Model of Prion Transmission to Humans

    PubMed Central

    Wight, Darren; Barron, Rona; Jeffrey, Martin; Manson, Jean; Prowse, Christopher; Ironside, James W.; Head, Mark W.

    2009-01-01

    To assess interspecies barriers to transmission of transmissible spongiform encephalopathies, we investigated the ability of disease-associated prion proteins (PrPd) to initiate conversion of the human normal cellular form of prion protein of the 3 major PRNP polymorphic variants in vitro. Protein misfolding cyclic amplification showed that conformation of PrPd partly determines host susceptibility. PMID:19961689

  16. Frameshifted prion proteins as pathological agents: quantitative considerations.

    PubMed

    Wills, Peter R

    2013-05-21

    A quantitatively consistent explanation for the titres of infectivity found in a variety of prion-containing preparations is provided on the basis that the ætiological agents of transmissible spongiform encephalopathy comprise a very small population fraction of prion protein (PrP) variants, which contain frameshifted elements in their N-terminal octapeptide-repeat regions. A mechanism for the replication of frameshifted prions is described and calculations are performed to obtain estimates of the concentration of these PrP variants in normal and infected brain, as well as their enrichment in products of protein misfolding cyclic amplification. These calculations resolve the lack of proper quantitative correlation between measures of infectivity and the presence of conformationally-altered, protease-resistant variants of PrP. Experiments, which could confirm or eventually exclude the role of frameshifted variants in the ætiology of prion disease, are suggested. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Using small molecule reagents to help distinguish among prion structural models

    USDA-ARS?s Scientific Manuscript database

    The only demonstrated difference between infectious prions (PrPSc) and the isosequential normal cellular prion protein (PrPC) is conformation. The structure of PrPC has been determined by a variety of instrumental techniques. The structure of prions remains uncertain. Recent instrumental analysis h...

  18. Persistence of pathogenic prion protein during simulated wastewater treatment processes

    USGS Publications Warehouse

    Hinckley, G.T.; Johnson, C.J.; Jacobson, K.H.; Bartholomay, C.; Mcmahon, K.D.; McKenzie, D.; Aiken, Judd M.; Pedersen, J.A.

    2008-01-01

    Transmissible spongiform encephalopathies (TSEs, prion diseases) are a class of fatal neurodegenerative diseases affecting a variety of mammalian species including humans. A misfolded form of the prion protein (PrP TSE) is the major, if not sole, component of the infectious agent. Prions are highly resistant to degradation and to many disinfection procedures suggesting that, if prions enter wastewater treatment systems through sewers and/or septic systems (e.g., from slaughterhouses, necropsy laboratories, rural meat processors, private game dressing) or through leachate from landfills that have received TSE-contaminated material, prions could survive conventional wastewater treatment Here, we report the results of experiments examining the partitioning and persistence of PrPTSE during simulated wastewater treatment processes including activated and mesophilic anaerobic sludge digestion. Incubation with activated sludge did not result in significant PrPTSE degradation. PrPTSE and prion infectivity partitioned strongly to activated sludge solids and are expected to enter biosolids treatment processes. A large fraction of PrPTSE survived simulated mesophilic anaerobic sludge digestion. The small reduction in recoverable PrPTSE after 20-d anaerobic sludge digestion appeared attributable to a combination of declining extractability with time and microbial degradation. Our results suggest that if prions were to enter municipal wastewater treatment systems, most would partition to activated sludge solids, survive mesophilic anaerobic digestion, and be present in treated biosolids. ?? 2008 American Chemical Society.

  19. Alteration of the endocannabinoid system in mouse brain during prion disease.

    PubMed

    Petrosino, S; Ménard, B; Zsürger, N; Di Marzo, V; Chabry, J

    2011-03-17

    Prion diseases are neurodegenerative disorders characterized by deposition of the pathological prion protein (PrPsc) within the brain of affected humans and animals. Microglial cell activation is a common feature of prion diseases; alterations of various neurotransmitter systems and neurotransmission have been also reported. Owing to its ability to modulate both neuroimmune responses and neurotransmission, it was of interest to study the brain endocannabinoid system in a prion-infected mouse model. The production of the endocannabinoid, 2-arachidonoyglycerol (2-AG), was enhanced 10 weeks post-infection, without alteration of the other endocannabinoid, anandamide. The CB2 receptor expression was up-regulated in brains of prion-infected mice as early as 10 weeks and up to 32 weeks post-infection whereas the mRNAs of other cannabinoid receptors (CBRs) remain unchanged. The observed alterations of the endocannabinoid system were specific for prion infection since no significant changes were observed in the brain of prion-resistant mice, that is, mice devoid of the Prnp gene. Our study highlights important alterations of the endocannabinoid system during early stages of the disease long before the clinical signs of the disease. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

  20. Human stem cell-derived astrocytes replicate human prions in a PRNP genotype-dependent manner.

    PubMed

    Krejciova, Zuzana; Alibhai, James; Zhao, Chen; Krencik, Robert; Rzechorzek, Nina M; Ullian, Erik M; Manson, Jean; Ironside, James W; Head, Mark W; Chandran, Siddharthan

    2017-12-04

    Prions are infectious agents that cause neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD). The absence of a human cell culture model that replicates human prions has hampered prion disease research for decades. In this paper, we show that astrocytes derived from human induced pluripotent stem cells (iPSCs) support the replication of prions from brain samples of CJD patients. For experimental exposure of astrocytes to variant CJD (vCJD), the kinetics of prion replication occur in a prion protein codon 129 genotype-dependent manner, reflecting the genotype-dependent susceptibility to clinical vCJD found in patients. Furthermore, iPSC-derived astrocytes can replicate prions associated with the major sporadic CJD strains found in human patients. Lastly, we demonstrate the subpassage of prions from infected to naive astrocyte cultures, indicating the generation of prion infectivity in vitro. Our study addresses a long-standing gap in the repertoire of human prion disease research, providing a new in vitro system for accelerated mechanistic studies and drug discovery. © 2017 Krejciova et al.

  1. Biochemical typing of pathological prion protein in aging cattle with BSE

    PubMed Central

    Tester, Seraina; Juillerat, Valerie; Doherr, Marcus G; Haase, Bianca; Polak, Miroslaw; Ehrensperger, Felix; Leeb, Tosso; Zurbriggen, Andreas; Seuberlich, Torsten

    2009-01-01

    Background The broad enforcement of active surveillance for bovine spongiform encephalopathy (BSE) in 2000 led to the discovery of previously unnoticed, atypical BSE phenotypes in aged cattle that differed from classical BSE (C-type) in biochemical properties of the pathological prion protein. Depending on the molecular mass and the degree of glycosylation of its proteinase K resistant core fragment (PrPres), mainly determined in samples derived from the medulla oblongata, these atypical cases are currently classified into low (L)-type or high (H)-type BSE. In the present study we address the question to what extent such atypical BSE cases are part of the BSE epidemic in Switzerland. Results To this end we analyzed the biochemical PrPres type by Western blot in a total of 33 BSE cases in cattle with a minimum age of eight years, targeting up to ten different brain regions. Our work confirmed H-type BSE in a zebu but classified all other cases as C-type BSE; indicating a very low incidence of H- and L-type BSE in Switzerland. It was documented for the first time that the biochemical PrPres type was consistent across different brain regions of aging animals with C-type and H-type BSE, i.e. independent of the neuroanatomical structure investigated. Conclusion Taken together this study provides further characteristics of the BSE epidemic in Switzerland and generates new baseline data for the definition of C- and H-type BSE phenotypes, thereby underpinning the notion that they indeed represent distinct prion disease entities. PMID:19470160

  2. The chemistry of prions: small molecules, protein conformers and mass spectrometry

    USDA-ARS?s Scientific Manuscript database

    Background/Introduction. Prions propagate by converting a normal cellular isoform (PrPC) into the prion isoform (PrPSc) in a template-driven process. The lysines in PrPC are highly conserved and strongly influence prion propagation, based on studies using natural polymorphisms of PrPC and transg...

  3. Crystallographic Studies of Prion Protein (PrP) Segments Suggest How Structural Changes Encoded by Polymorphism at Residue 129 Modulate Susceptibility to Human Prion Disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Apostol, Marcin I.; Sawaya, Michael R.; Cascio, Duilio

    2010-09-23

    A single nucleotide polymorphism (SNP) in codon 129 of the human prion gene, leading to a change from methionine to valine at residue 129 of prion protein (PrP), has been shown to be a determinant in the susceptibility to prion disease. However, the molecular basis of this effect remains unexplained. In the current study, we determined crystal structures of prion segments having either Met or Val at residue 129. These 6-residue segments of PrP centered on residue 129 are 'steric zippers,' pairs of interacting {beta}-sheets. Both structures of these 'homozygous steric zippers' reveal direct intermolecular interactions between Met or Valmore » in one sheet and the identical residue in the mating sheet. These two structures, plus a structure-based model of the heterozygous Met-Val steric zipper, suggest an explanation for the previously observed effects of this locus on prion disease susceptibility and progression.« less

  4. Gene knockout of tau expression does not contribute to the pathogenesis of prion disease.

    PubMed

    Lawson, Victoria A; Klemm, Helen M; Welton, Jeremy M; Masters, Colin L; Crouch, Peter; Cappai, Roberto; Ciccotosto, Giuseppe D

    2011-11-01

    Prion diseases or transmissible spongiform encephalopathies are a group of fatal and transmissible disorders affecting the central nervous system of humans and animals. The principal agent of prion disease transmission and pathogenesis is proposed to be an abnormal protease-resistant isoform of the normal cellular prion protein. The microtubule-associated protein tau is elevated in patients with Creutzfeldt-Jakob disease. To determine whether tau expression contributes to prion disease pathogenesis, tau knockout and control wild-type mice were infected with the M1000 strain of mouse-adapted human prions. Immunohistochemical analysis for total tau expression in prion-infected wild-type mice indicated tau aggregation in the cytoplasm of a subpopulation of neurons in regions associated with spongiform change. Western immunoblot analysis of brain homogenates revealed a decrease in total tau immunoreactivity and epitope-specific changes in tau phosphorylation. No significant difference in incubation period or other disease features were observed between tau knockout and wild-type mice with clinical prion disease. These results demonstrate that, in this model of prion disease, tau does not contribute to the pathogenesis of prion disease and that changes in the tau protein profile observed in mice with clinical prion disease occurs as a consequence of the prion-induced pathogenesis.

  5. Orally administered indomethacin acutely reduces cellular prion protein in the small intestine and modestly increases survival of mice exposed to infectious prions.

    PubMed

    Martin, Gary R; Sharkey, Keith A; Jirik, Frank R

    2015-05-01

    The oral uptake of infectious prions represents a common way to acquire a prion disease; thus, host factors, such as gut inflammation and intestinal "leakiness", have the potential to influence infectivity. For example, the ingestion of nonsteroidal anti-inflammatory drugs (NSAIDs) is known to induce intestinal inflammation and increase intestinal permeability. Previously, we reported that normal cellular prion protein (PrP(C)) expression was increased in experimental colitis, and since the level of PrP(C) expressed is a determinant of prion disease propagation, we hypothesized that NSAID administration prior to the oral inoculation of mice with infectious prions would increase intestinal PrP(C) expression and accelerate the onset of neurological disease. In the long-term experiments, one group of mice was gavaged with indomethacin, followed by a second gavage with brain homogenate containing mouse-adapted scrapie (ME7). Control mice received ME7 brain homogenate alone. Brain and splenic tissues were harvested at several time points for immunoblotting, including at the onset of clinical signs of disease. In a second series of experiments, mice were gavaged with indomethacin to assess the acute effects of this treatment on intestinal PrP(C) expression. Acutely, NSAID treatment reduced intestinal PrP(C) expression, and chronically, there was a modest delay in the onset of neurological disease. In contrast to our hypothesis, brief exposure to an NSAID decreased intestinal PrP(C) expression and led to a modest survival advantage following oral ingestion of infectious prions.

  6. Removal of transmissible spongiform encephalopathy prion from large volumes of cell culture media supplemented with fetal bovine serum by using hollow fiber anion-exchange membrane chromatography.

    PubMed

    Chou, Ming Li; Bailey, Andy; Avory, Tiffany; Tanimoto, Junji; Burnouf, Thierry

    2015-01-01

    Cases of variant Creutzfeldt-Jakob disease in people who had consumed contaminated meat products from cattle with bovine spongiform encephalopathy emphasize the need for measures aimed at preventing the transmission of the pathogenic prion protein (PrPSc) from materials derived from cattle. Highly stringent scrutiny is required for fetal bovine serum (FBS), a growth-medium supplement used in the production of parenteral vaccines and therapeutic recombinant proteins and in the ex vivo expansion of stem cells for transplantation. One such approach is the implementation of manufacturing steps dedicated to removing PrPSc from materials containing FBS. We evaluated the use of the QyuSpeed D (QSD) adsorbent hollow-fiber anion-exchange chromatographic column (Asahi Kasei Medical, Tokyo, Japan) for the removal of PrPSc from cell culture media supplemented with FBS. We first established that QSD filtration had no adverse effect on the chemical composition of various types of culture media supplemented with 10% FBS or the growth and viability characteristics of human embryonic kidney (HEK293) cells, baby hamster kidney (BHK-21) cells, African green monkey kidney (Vero) cells, and Chinese hamster ovary (CHO-k1) cells propagated in the various culture-medium filtrates. We used a 0.6-mL QSD column for removing PrPSc from up to 1000 mL of Dulbecco's modified Eagle's medium containing 10% FBS previously spiked with the 263K strain of hamster-adapted scrapie. The Western blot analysis, validated alongside an infectivity assay, revealed that the level of PrPSc in the initial 200mL flow-through was reduced by 2.5 to > 3 log10, compared with that of the starting material. These results indicate that QSD filtration removes PrPSc from cell culture media containing 10% FBS, and demonstrate the ease with which QSD filtration can be implemented in at industrial-scale to improve the safety of vaccines, therapeutic recombinant proteins, and ex vivo expanded stem cells produced using growth

  7. Removal of Transmissible Spongiform Encephalopathy Prion from Large Volumes of Cell Culture Media Supplemented with Fetal Bovine Serum by Using Hollow Fiber Anion-Exchange Membrane Chromatography

    PubMed Central

    Chou, Ming Li; Bailey, Andy; Avory, Tiffany; Tanimoto, Junji; Burnouf, Thierry

    2015-01-01

    Cases of variant Creutzfeldt-Jakob disease in people who had consumed contaminated meat products from cattle with bovine spongiform encephalopathy emphasize the need for measures aimed at preventing the transmission of the pathogenic prion protein (PrPSc) from materials derived from cattle. Highly stringent scrutiny is required for fetal bovine serum (FBS), a growth-medium supplement used in the production of parenteral vaccines and therapeutic recombinant proteins and in the ex vivo expansion of stem cells for transplantation. One such approach is the implementation of manufacturing steps dedicated to removing PrPSc from materials containing FBS. We evaluated the use of the QyuSpeed D (QSD) adsorbent hollow-fiber anion-exchange chromatographic column (Asahi Kasei Medical, Tokyo, Japan) for the removal of PrPSc from cell culture media supplemented with FBS. We first established that QSD filtration had no adverse effect on the chemical composition of various types of culture media supplemented with 10% FBS or the growth and viability characteristics of human embryonic kidney (HEK293) cells, baby hamster kidney (BHK-21) cells, African green monkey kidney (Vero) cells, and Chinese hamster ovary (CHO-k1) cells propagated in the various culture-medium filtrates. We used a 0.6-mL QSD column for removing PrPSc from up to 1000 mL of Dulbecco’s modified Eagle’s medium containing 10% FBS previously spiked with the 263K strain of hamster-adapted scrapie. The Western blot analysis, validated alongside an infectivity assay, revealed that the level of PrPSc in the initial 200mL flow-through was reduced by 2.5 to > 3 log10, compared with that of the starting material. These results indicate that QSD filtration removes PrPSc from cell culture media containing 10% FBS, and demonstrate the ease with which QSD filtration can be implemented in at industrial-scale to improve the safety of vaccines, therapeutic recombinant proteins, and ex vivo expanded stem cells produced using

  8. Lack of prion transmission by sexual or parental routes in experimentally infected hamsters.

    PubMed

    Morales, Rodrigo; Pritzkow, Sandra; Hu, Ping Ping; Duran-Aniotz, Claudia; Soto, Claudio

    2013-01-01

    Prion diseases are a group of neurodegenerative disorders affecting humans as well as captive and wild animals. The mechanisms and routes governing the natural spread of prions are not completely understood and several hypotheses have been proposed. In this study, we analyzed the effect of gender in prion incubation period, as well as the possibility of prion transmission by sexual and parental contact using 263K infected hamsters as a model. Our results show that males have significantly longer incubation periods compared with females when exposed to the same quantity of infectious material. Importantly, no evidence of sexual or parental prion transmission was found, even 500 d after sexual contact or birth, respectively. Western blotting and PMCA were unable to detect sub-clinical levels of PrP(Sc) in experimental subjects, suggesting a complete absence of prion transmission by these routes. Our results show that sexual and parental transmission of prions does not occur in this model. It remains to be studied whether this conclusion is valid also for other prion strains and species.

  9. Mouse-hamster chimeric prion protein (PrP) devoid of N-terminal residues 23-88 restores susceptibility to 22L prions, but not to RML prions in PrP-knockout mice.

    PubMed

    Uchiyama, Keiji; Miyata, Hironori; Yano, Masashi; Yamaguchi, Yoshitaka; Imamura, Morikazu; Muramatsu, Naomi; Das, Nandita Rani; Chida, Junji; Hara, Hideyuki; Sakaguchi, Suehiro

    2014-01-01

    Prion infection induces conformational conversion of the normal prion protein PrPC, into the pathogenic isoform PrPSc, in prion diseases. It has been shown that PrP-knockout (Prnp0/0) mice transgenically reconstituted with a mouse-hamster chimeric PrP lacking N-terminal residues 23-88, or Tg(MHM2Δ23-88)/Prnp 0/0 mice, neither developed the disease nor accumulated MHM2ScΔ23-88 in their brains after inoculation with RML prions. In contrast, RML-inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice developed the disease with abundant accumulation of MHM2ScΔ23-88 in their brains. These results indicate that MHM2Δ23-88 itself might either lose or greatly reduce the converting capacity to MHM2ScΔ23-88, and that the co-expressing wild-type PrPC can stimulate the conversion of MHM2Δ23-88 to MHM2ScΔ23-88 in trans. In the present study, we confirmed that Tg(MHM2Δ23-88)/Prnp 0/0 mice remained resistant to RML prions for up to 730 days after inoculation. However, we found that Tg(MHM2Δ23-88)/Prnp 0/0 mice were susceptible to 22L prions, developing the disease with prolonged incubation times and accumulating MHM2ScΔ23-88 in their brains. We also found accelerated conversion of MHM2Δ23-88 into MHM2ScΔ23-88 in the brains of RML- and 22L-inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice. However, wild-type PrPSc accumulated less in the brains of these inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice, compared with RML- and 22L-inoculated Prnp 0/+ mice. These results show that MHM2Δ23-88 itself can convert into MHM2ScΔ23-88 without the help of the trans-acting PrPC, and that, irrespective of prion strains inoculated, the co-expressing wild-type PrPC stimulates the conversion of MHM2Δ23-88 into MHM2ScΔ23-88, but to the contrary, the co-expressing MHM2Δ23-88 disturbs the conversion of wild-type PrPC into PrPSc.

  10. Mouse-Hamster Chimeric Prion Protein (PrP) Devoid of N-Terminal Residues 23-88 Restores Susceptibility to 22L Prions, but Not to RML Prions in PrP-Knockout Mice

    PubMed Central

    Yano, Masashi; Yamaguchi, Yoshitaka; Imamura, Morikazu; Muramatsu, Naomi; Das, Nandita Rani; Chida, Junji; Hara, Hideyuki; Sakaguchi, Suehiro

    2014-01-01

    Prion infection induces conformational conversion of the normal prion protein PrPC, into the pathogenic isoform PrPSc, in prion diseases. It has been shown that PrP-knockout (Prnp0/0) mice transgenically reconstituted with a mouse-hamster chimeric PrP lacking N-terminal residues 23-88, or Tg(MHM2Δ23-88)/Prnp0/0 mice, neither developed the disease nor accumulated MHM2ScΔ23-88 in their brains after inoculation with RML prions. In contrast, RML-inoculated Tg(MHM2Δ23-88)/Prnp0/+ mice developed the disease with abundant accumulation of MHM2ScΔ23-88 in their brains. These results indicate that MHM2Δ23-88 itself might either lose or greatly reduce the converting capacity to MHM2ScΔ23-88, and that the co-expressing wild-type PrPC can stimulate the conversion of MHM2Δ23-88 to MHM2ScΔ23-88 in trans. In the present study, we confirmed that Tg(MHM2Δ23-88)/Prnp0/0 mice remained resistant to RML prions for up to 730 days after inoculation. However, we found that Tg(MHM2Δ23-88)/Prnp0/0 mice were susceptible to 22L prions, developing the disease with prolonged incubation times and accumulating MHM2ScΔ23-88 in their brains. We also found accelerated conversion of MHM2Δ23-88 into MHM2ScΔ23-88 in the brains of RML- and 22L-inoculated Tg(MHM2Δ23-88)/Prnp0/+ mice. However, wild-type PrPSc accumulated less in the brains of these inoculated Tg(MHM2Δ23-88)/Prnp0/+ mice, compared with RML- and 22L-inoculated Prnp0/+ mice. These results show that MHM2Δ23-88 itself can convert into MHM2ScΔ23-88 without the help of the trans-acting PrPC, and that, irrespective of prion strains inoculated, the co-expressing wild-type PrPC stimulates the conversion of MHM2Δ23-88 into MHM2ScΔ23-88, but to the contrary, the co-expressing MHM2Δ23-88 disturbs the conversion of wild-type PrPC into PrPSc. PMID:25330286

  11. Recombinant Prion Protein Refolded with Lipid and RNA Has the Biochemical Hallmarks of a Prion but Lacks In Vivo Infectivity

    PubMed Central

    Timmes, Andrew G.; Moore, Roger A.; Fischer, Elizabeth R.; Priola, Suzette A.

    2013-01-01

    During prion infection, the normal, protease-sensitive conformation of prion protein (PrPC) is converted via seeded polymerization to an abnormal, infectious conformation with greatly increased protease-resistance (PrPSc). In vitro, protein misfolding cyclic amplification (PMCA) uses PrPSc in prion-infected brain homogenates as an initiating seed to convert PrPC and trigger the self-propagation of PrPSc over many cycles of amplification. While PMCA reactions produce high levels of protease-resistant PrP, the infectious titer is often lower than that of brain-derived PrPSc. More recently, PMCA techniques using bacterially derived recombinant PrP (rPrP) in the presence of lipid and RNA but in the absence of any starting PrPSc seed have been used to generate infectious prions that cause disease in wild-type mice with relatively short incubation times. These data suggest that lipid and/or RNA act as cofactors to facilitate the de novo formation of high levels of prion infectivity. Using rPrP purified by two different techniques, we generated a self-propagating protease-resistant rPrP molecule that, regardless of the amount of RNA and lipid used, had a molecular mass, protease resistance and insolubility similar to that of PrPSc. However, we were unable to detect prion infectivity in any of our reactions using either cell-culture or animal bioassays. These results demonstrate that the ability to self-propagate into a protease-resistant insoluble conformer is not unique to infectious PrP molecules. They suggest that the presence of RNA and lipid cofactors may facilitate the spontaneous refolding of PrP into an infectious form while also allowing the de novo formation of self-propagating, but non-infectious, rPrP-res. PMID:23936256

  12. Mineral licks as environmental reservoirs of chronic wasting disease prions

    PubMed Central

    Plummer, Ian H.; Johnson, Chad J.; Chesney, Alexandra R.; Pedersen, Joel A.

    2018-01-01

    Chronic wasting disease (CWD) is a fatal neurodegenerative disease of deer, elk, moose, and reindeer (cervids) caused by misfolded prion proteins. The disease has been reported across North America and recently discovered in northern Europe. Transmission of CWD in wild cervid populations can occur through environmental routes, but limited ability to detect prions in environmental samples has prevented the identification of potential transmission “hot spots”. We establish widespread CWD prion contamination of mineral licks used by free-ranging cervids in an enzootic area in Wisconsin, USA. We show mineral licks can serve as reservoirs of CWD prions and thus facilitate disease transmission. Furthermore, mineral licks attract livestock and other wildlife that also obtain mineral nutrients via soil and water consumption. Exposure to CWD prions at mineral licks provides potential for cross-species transmission to wildlife, domestic animals, and humans. Managing deer use of mineral licks warrants further consideration to help control outbreaks of CWD. PMID:29719000

  13. Prion-Associated Toxicity is Rescued by Elimination of Cotranslational Chaperones

    PubMed Central

    Keefer, Kathryn M.; True, Heather L.

    2016-01-01

    The nascent polypeptide-associated complex (NAC) is a highly conserved but poorly characterized triad of proteins that bind near the ribosome exit tunnel. The NAC is the first cotranslational factor to bind to polypeptides and assist with their proper folding. Surprisingly, we found that deletion of NAC subunits in Saccharomyces cerevisiae rescues toxicity associated with the strong [PSI+] prion. This counterintuitive finding can be explained by changes in chaperone balance and distribution whereby the folding of the prion protein is improved and the prion is rendered nontoxic. In particular, the ribosome-associated Hsp70 Ssb is redistributed away from Sup35 prion aggregates to the nascent chains, leading to an array of aggregation phenotypes that can mimic both overexpression and deletion of Ssb. This toxicity rescue demonstrates that chaperone modification can block key steps of the prion life cycle and has exciting implications for potential treatment of many human protein conformational disorders. PMID:27828954

  14. High hydrophobic amino acid exposure is responsible of the neurotoxic effects induced by E200K or D202N disease-related mutations of the human prion protein.

    PubMed

    Corsaro, Alessandro; Thellung, Stefano; Bucciarelli, Tonino; Scotti, Luca; Chiovitti, Katia; Villa, Valentina; D'Arrigo, Cristina; Aceto, Antonio; Florio, Tullio

    2011-03-01

    Mutations in prion protein are thought to be causative of inherited prion diseases favoring the spontaneous conversion of the normal prion protein into the scrapie-like pathological prion protein. We previously reported that, by controlled thermal denaturation, human prion protein fragment 90-231 acquires neurotoxic properties when transformed in a β-rich conformation, resembling the scrapie-like conformation. In this study we generated prion protein fragment 90-231 bearing mutations identified in familial prion diseases (D202N and E200K), to analyze their role in the induction of a neurotoxic conformation. Prion protein fragment 90-231(wild type) and the D202N mutant were not toxic in native conformation but induced cell death only after thermal denaturation. Conversely, prion protein fragment 90-231(E200K) was highly toxic in its native structure, suggesting that E200K mutation per se favors the acquisition of a peptide neurotoxic conformation. To identify the structural determinants of prion protein fragment 90-231 toxicity, we show that while the wild type peptide is structured in α-helix, hPrP90-231 E200K is spontaneously refolded in a β-structured conformer characterized by increased proteinase K resistance and propensity to generate fibrils. However, the most significant difference induced by E200K mutation in prion protein fragment 90-231 structure in native conformation we observed, was an increase in the exposure of hydrophobic amino-acids on protein surface that was detected in wild type and D202N proteins only after thermal denaturation. In conclusion, we propose that increased hydrophobicity is one of the main determinants of toxicity induced by different mutations in prion protein-derived peptides. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. The Ecology of Prions

    PubMed Central

    Ortega, Aimee

    2017-01-01

    SUMMARY Chronic wasting disease (CWD) affects cervids and is the only known prion disease readily transmitted among free-ranging wild animal populations in nature. The increasing spread and prevalence of CWD among cervid populations threaten the survival of deer and elk herds in North America, and potentially beyond. This review focuses on prion ecology, specifically that of CWD, and the current understanding of the role that the environment may play in disease propagation. We recount the discovery of CWD, discuss the role of the environment in indirect CWD transmission, and consider potentially relevant environmental reservoirs and vectors. We conclude by discussing how understanding the environmental persistence of CWD lends insight into transmission dynamics and potential management and mitigation strategies. PMID:28566466

  16. Reduced Abundance and Subverted Functions of Proteins in Prion-Like Diseases: Gained Functions Fascinate but Lost Functions Affect Aetiology.

    PubMed

    Allison, W Ted; DuVal, Michèle G; Nguyen-Phuoc, Kim; Leighton, Patricia L A

    2017-10-24

    Prions have served as pathfinders that reveal many aspects of proteostasis in neurons. The recent realization that several prominent neurodegenerative diseases spread via a prion-like mechanism illuminates new possibilities for diagnostics and therapeutics. Thus, key proteins in Alzheimer Disease and Amyotrophic lateral sclerosis (ALS), including amyloid-β precursor protein, Tau and superoxide dismutase 1 (SOD1), spread to adjacent cells in their misfolded aggregated forms and exhibit template-directed misfolding to induce further misfolding, disruptions to proteostasis and toxicity. Here we invert this comparison to ask what these prion-like diseases can teach us about the broad prion disease class, especially regarding the loss of these key proteins' function(s) as they misfold and aggregate. We also consider whether functional amyloids might reveal a role for subverted protein function in neurodegenerative disease. Our synthesis identifies SOD1 as an exemplar of protein functions being lost during prion-like protein misfolding, because SOD1 is inherently unstable and loses function in its misfolded disease-associated form. This has under-appreciated parallels amongst the canonical prion diseases, wherein the normally folded prion protein, PrP C , is reduced in abundance in fatal familial insomnia patients and during the preclinical phase in animal models, apparently via proteostatic mechanisms. Thus while template-directed misfolding and infectious properties represent gain-of-function that fascinates proteostasis researchers and defines (is required for) the prion(-like) diseases, loss and subversion of the functions attributed to hallmark proteins in neurodegenerative disease needs to be integrated into design towards effective therapeutics. We propose experiments to uniquely test these ideas.

  17. Fate of prions in soil: trapped conformation of full-length ovine prion protein induced by adsorption on clays.

    PubMed

    Revault, M; Quiquampoix, H; Baron, M H; Noinville, S

    2005-08-05

    Studying the mechanism of retention of ovine prion protein in soils will tackle the environmental aspect of potential dissemination of scrapie infectious agent. We consider the surface-induced conformational changes that the recombinant ovine prion protein (ovPrP) may undergo under different pH conditions when interacting with soil minerals of highly adsorptive capacities such as montmorillonite. The conformational states of the full-length ovine prion protein adsorbed on the electronegative clay surface are compared to its solvated state in deuterated buffer in the pD range 3.5-9, using FTIR spectroscopy. The in vitro pH-induced conversion of the alpha-helical monomer of ovPrP into oligomers of beta-like structure prone to self-aggregation does not occur when the protein is adsorbed on the clay surface. The conformation of the trapped ovPrP molecules on montmorillonite is pH-independent and looks like that of the ovPrP solvated state at pD higher than 7, suggesting the major role of Arg and Lys residues in the electrostatic origin of adsorption. The uneven distribution of positively and negatively charged residues of the ovPrP protein would promote a favored orientation of the protein towards the clay, so that not only the basic residues embedded in the N-terminal flexible part but also external basic residues in the globular part of the protein might participate to the attractive interaction. From these results, it appears unlikely that the interaction of normal prions (PrP(C)) with soil clay surfaces could induce a change of conformation leading to the pathogenic form of prions (PrP(Sc)).

  18. Identification of Two Prion Protein Regions That Modify Scrapie Incubation Time

    PubMed Central

    Supattapone, Surachai; Muramoto, Tamaki; Legname, Giuseppe; Mehlhorn, Ingrid; Cohen, Fred E.; DeArmond, Stephen J.; Prusiner, Stanley B.; Scott, Michael R.

    2001-01-01

    A series of prion transmission experiments was performed in transgenic (Tg) mice expressing either wild-type, chimeric, or truncated prion protein (PrP) molecules. Following inoculation with Rocky Mountain Laboratory (RML) murine prions, scrapie incubation times for Tg(MoPrP)4053, Tg(MHM2)294/Prnp0/0, and Tg(MoPrP,Δ23–88)9949/Prnp0/0 mice were ∼50, 120, and 160 days, respectively. Similar scrapie incubation times were obtained after inoculation of these lines of Tg mice with either MHM2(MHM2(RML)) or MoPrP(Δ23–88)(RML) prions, excluding the possibility that sequence-dependent transmission barriers could account for the observed differences. Tg(MHM2)294/Prnp0/0 mice displayed prolonged scrapie incubation times with four different strains of murine prions. These data provide evidence that the N terminus of MoPrP and the chimeric region of MHM2 PrP (residues 108 through 111) both influence the inherent efficiency of prion propagation. PMID:11152514

  19. Strain conformation controls the specificity of cross-species prion transmission in the yeast model.

    PubMed

    Grizel, Anastasia V; Rubel, Aleksandr A; Chernoff, Yury O

    2016-07-03

    Transmissible self-assembled fibrous cross-β polymer infectious proteins (prions) cause neurodegenerative diseases in mammals and control non-Mendelian heritable traits in yeast. Cross-species prion transmission is frequently impaired, due to sequence differences in prion-forming proteins. Recent studies of prion species barrier on the model of closely related yeast species show that colocalization of divergent proteins is not sufficient for the cross-species prion transmission, and that an identity of specific amino acid sequences and a type of prion conformational variant (strain) play a major role in the control of transmission specificity. In contrast, chemical compounds primarily influence transmission specificity via favoring certain strain conformations, while the species origin of the host cell has only a relatively minor input. Strain alterations may occur during cross-species prion conversion in some combinations. The model is discussed which suggests that different recipient proteins can acquire different spectra of prion strain conformations, which could be either compatible or incompatible with a particular donor strain.

  20. Correlation of cellular factors and differential scrapie prion permissiveness in ovine microglia

    USDA-ARS?s Scientific Manuscript database

    Prion diseases are fatal neurodegenerative disorders by which the native cellular prion protein (PrP-C) is misfolded into an accumulating, disease-associated isoform (PrP-D). To improve the understanding of prion pathogenesis and develop effective treatments, it is essential to elucidate factors con...

  1. Hsp40 function in yeast prion propagation: Amyloid diversity necessitates chaperone functional complexity.

    PubMed

    Sporn, Zachary A; Hines, Justin K

    2015-01-01

    Yeast prions are heritable protein-based elements, most of which are formed of amyloid aggregates that rely on the action of molecular chaperones for transmission to progeny. Prions can form distinct amyloid structures, known as 'strains' in mammalian systems, that dictate both pathological progression and cross-species infection barriers. In yeast these same amyloid structural polymorphisms, called 'variants', dictate the intensity of prion-associated phenotypes and stability in mitosis. We recently reported that [PSI(+)] prion variants differ in the fundamental domain requirements for one chaperone, the Hsp40/J-protein Sis1, which are mutually exclusive between 2 different yeast prions, demonstrating a functional plurality for Sis1. Here we extend that analysis to incorporate additional data that collectively support the hypothesis that Sis1 has multiple functional roles that can be accomplished by distinct sets of domains. These functions are differentially required by distinct prions and prion variants. We also present new data regarding Hsp104-mediated prion elimination and show that some Sis1 functions, but not all, are conserved in the human homolog Hdj1/DNAJB1. Importantly, of the 10 amyloid-based prions indentified to date in Saccharomyces cerevisiae, the chaperone requirements of only 4 are known, leaving a great diversity of amyloid structures, and likely modes of amyloid-chaperone interaction, largely unexplored.

  2. Enzymatic Formulation Capable of Degrading Scrapie Prion under Mild Digestion Conditions

    PubMed Central

    Okoroma, Emeka A.; Purchase, Diane; Garelick, Hemda; Morris, Roger; Neale, Michael H.; Windl, Otto; Abiola, Oduola O.

    2013-01-01

    The prion agent is notoriously resistant to common proteases and conventional sterilisation procedures. The current methods known to destroy prion infectivity such as incineration, alkaline and thermal hydrolysis are harsh, destructive, environmentally polluting and potentially hazardous, thus limit their applications for decontamination of delicate medical and laboratory devices, remediation of prion contaminated environment and for processing animal by-products including specified risk materials and carcases. Therefore, an environmentally friendly, non-destructive enzymatic degradation approach is highly desirable. A feather-degrading Bacillus licheniformis N22 keratinase has been isolated which degraded scrapie prion to undetectable level of PrPSc signals as determined by Western Blot analysis. Prion infectivity was verified by ex vivo cell-based assay. An enzymatic formulation combining N22 keratinase and biosurfactant derived from Pseudomonas aeruginosa degraded PrPSc at 65°C in 10 min to undetectable level -. A time-course degradation analysis carried out at 50°C over 2 h revealed the progressive attenuation of PrPSc intensity. Test of residual infectivity by standard cell culture assay confirmed that the enzymatic formulation reduced PrPSc infectivity to undetectable levels as compared to cells challenged with untreated standard scrapie sheep prion (SSBP/1) (p-value = 0.008 at 95% confidence interval). This novel enzymatic formulation has significant potential application for prion decontamination in various environmentally friendly systems under mild treatment conditions. PMID:23874511

  3. Rapid and Highly Sensitive Detection of Variant Creutzfeldt - Jakob Disease Abnormal Prion Protein on Steel Surfaces by Protein Misfolding Cyclic Amplification: Application to Prion Decontamination Studies

    PubMed Central

    Belondrade, Maxime; Nicot, Simon; Béringue, Vincent; Coste, Joliette; Lehmann, Sylvain; Bougard, Daisy

    2016-01-01

    The prevalence of variant Creutzfeldt-Jakob disease (vCJD) in the population remains uncertain, although it has been estimated that 1 in 2000 people in the United Kingdom are positive for abnormal prion protein (PrPTSE) by a recent survey of archived appendix tissues. The prominent lymphotropism of vCJD prions raises the possibility that some surgical procedures may be at risk of iatrogenic vCJD transmission in healthcare facilities. It is therefore vital that decontamination procedures applied to medical devices before their reprocessing are thoroughly validated. A current limitation is the lack of a rapid model permissive to human prions. Here, we developed a prion detection assay based on protein misfolding cyclic amplification (PMCA) technology combined with stainless-steel wire surfaces as carriers of prions (Surf-PMCA). This assay allowed the specific detection of minute quantities (10−8 brain dilution) of either human vCJD or ovine scrapie PrPTSE adsorbed onto a single steel wire, within a two week timeframe. Using Surf-PMCA we evaluated the performance of several reference and commercially available prion-specific decontamination procedures. Surprisingly, we found the efficiency of several marketed reagents to remove human vCJD PrPTSE was lower than expected. Overall, our results demonstrate that Surf-PMCA can be used as a rapid and ultrasensitive assay for the detection of human vCJD PrPTSE adsorbed onto a metallic surface, therefore facilitating the development and validation of decontamination procedures against human prions. PMID:26800081

  4. Mechanism of Unfolding of Human Prion Protein.

    PubMed

    Singh, Reman K; Chamachi, Neharika G; Chakrabarty, Suman; Mukherjee, Arnab

    2017-01-26

    Misfolding and aggregation of prion proteins are associated with several neurodegenerative diseases. Therefore, understanding the mechanism of the misfolding process is of enormous interest in the scientific community. It has been speculated and widely discussed that the native cellular prion protein (PrP C ) form needs to undergo substantial unfolding to a more stable PrP C* state, which may further oligomerize into the toxic scrapie (PrP Sc ) form. Here, we have studied the mechanism of the unfolding of the human prion protein (huPrP) using a set of extensive well-tempered metadynamics simulations. Through multiple microsecond-long metadynamics simulations, we find several possible unfolding pathways. We show that each pathway leads to an unfolded state of lower free energy than the native state. Thus, our study may point to the signature of a PrP C* form that corresponds to a global minimum on the conformational free-energy landscape. Moreover, we find that these global minima states do not involve an increased β-sheet content, as was assumed to be a signature of PrP Sc formation in previous simulation studies. We have further analyzed the origin of metastability of the PrP C form through free-energy surfaces of the chopped helical segments to show that the helices, particularly H2 and H3 of the prion protein, have the tendency to form either a random coil or a β-structure. Therefore, the secondary structural elements of the prion protein are only weakly stabilized by tertiary contacts and solvation forces so that relatively weak perturbations induced by temperature, pressure, pH, and so forth can lead to substantial unfolding with characteristics of intrinsically disordered proteins.

  5. Estimating Prion Adsorption Capacity of Soil by BioAssay of Subtracted Infectivity from Complex Solutions (BASICS)

    PubMed Central

    Wyckoff, A. Christy; Lockwood, Krista L.; Meyerett-Reid, Crystal; Michel, Brady A.; Bender, Heather; VerCauteren, Kurt C.; Zabel, Mark D.

    2013-01-01

    Prions, the infectious agent of scrapie, chronic wasting disease and other transmissible spongiform encephalopathies, are misfolded proteins that are highly stable and resistant to degradation. Prions are known to associate with clay and other soil components, enhancing their persistence and surprisingly, transmissibility. Currently, few detection and quantification methods exist for prions in soil, hindering an understanding of prion persistence and infectivity in the environment. Variability in apparent infectious titers of prions when bound to soil has complicated attempts to quantify the binding capacity of soil for prion infectivity. Here, we quantify the prion adsorption capacity of whole, sandy loam soil (SLS) typically found in CWD endemic areas in Colorado; and purified montmorillonite clay (Mte), previously shown to bind prions, by BioAssay of Subtracted Infectivity in Complex Solutions (BASICS). We incubated prion positive 10% brain homogenate from terminally sick mice infected with the Rocky Mountain Lab strain of mouse-adapted prions (RML) with 10% SLS or Mte. After 24 hours samples were centrifuged five minutes at 200×g and soil-free supernatant was intracerebrally inoculated into prion susceptible indicator mice. We used the number of days post inoculation to clinical disease to calculate the infectious titer remaining in the supernatant, which we subtracted from the starting titer to determine the infectious prion binding capacity of SLS and Mte. BASICS indicated SLS bound and removed ≥ 95% of infectivity. Mte bound and removed lethal doses (99.98%) of prions from inocula, effectively preventing disease in the mice. Our data reveal significant prion-binding capacity of soil and the utility of BASICS to estimate prion loads and investigate persistence and decomposition in the environment. Additionally, since Mte successfully rescued the mice from prion disease, Mte might be used for remediation and decontamination protocols. PMID:23484043

  6. Estimating prion adsorption capacity of soil by BioAssay of Subtracted Infectivity from Complex Solutions (BASICS).

    PubMed

    Wyckoff, A Christy; Lockwood, Krista L; Meyerett-Reid, Crystal; Michel, Brady A; Bender, Heather; VerCauteren, Kurt C; Zabel, Mark D

    2013-01-01

    Prions, the infectious agent of scrapie, chronic wasting disease and other transmissible spongiform encephalopathies, are misfolded proteins that are highly stable and resistant to degradation. Prions are known to associate with clay and other soil components, enhancing their persistence and surprisingly, transmissibility. Currently, few detection and quantification methods exist for prions in soil, hindering an understanding of prion persistence and infectivity in the environment. Variability in apparent infectious titers of prions when bound to soil has complicated attempts to quantify the binding capacity of soil for prion infectivity. Here, we quantify the prion adsorption capacity of whole, sandy loam soil (SLS) typically found in CWD endemic areas in Colorado; and purified montmorillonite clay (Mte), previously shown to bind prions, by BioAssay of Subtracted Infectivity in Complex Solutions (BASICS). We incubated prion positive 10% brain homogenate from terminally sick mice infected with the Rocky Mountain Lab strain of mouse-adapted prions (RML) with 10% SLS or Mte. After 24 hours samples were centrifuged five minutes at 200 × g and soil-free supernatant was intracerebrally inoculated into prion susceptible indicator mice. We used the number of days post inoculation to clinical disease to calculate the infectious titer remaining in the supernatant, which we subtracted from the starting titer to determine the infectious prion binding capacity of SLS and Mte. BASICS indicated SLS bound and removed ≥ 95% of infectivity. Mte bound and removed lethal doses (99.98%) of prions from inocula, effectively preventing disease in the mice. Our data reveal significant prion-binding capacity of soil and the utility of BASICS to estimate prion loads and investigate persistence and decomposition in the environment. Additionally, since Mte successfully rescued the mice from prion disease, Mte might be used for remediation and decontamination protocols.

  7. Biaryl Amides and Hydrazones as Therapeutics for Prion Disease in Transgenic Mice

    PubMed Central

    Lu, Duo; Giles, Kurt; Li, Zhe; Rao, Satish; Dolghih, Elena; Gever, Joel R.; Geva, Michal; Elepano, Manuel L.; Oehler, Abby; Bryant, Clifford; Renslo, Adam R.; Jacobson, Matthew P.; DeArmond, Stephen J.; Silber, B. Michael

    2013-01-01

    The only small-molecule compound demonstrated to substantially extend survival in prion-infected mice is a biaryl hydrazone termed “Compd B” (4-pyridinecarboxaldehyde,2-[4-(5-oxazolyl)phenyl]hydrazone). However, the hydrazone moiety of Compd B results in toxic metabolites, making it a poor candidate for further drug development. We developed a pharmacophore model based on diverse antiprion compounds identified by high-throughput screening; based on this model, we generated biaryl amide analogs of Compd B. Medicinal chemistry optimization led to multiple compounds with increased potency, increased brain concentrations, and greater metabolic stability, indicating that they could be promising candidates for antiprion therapy. Replacing the pyridyl ring of Compd B with a phenyl group containing an electron-donating substituent increased potency, while adding an aryl group to the oxazole moiety increased metabolic stability. To test the efficacy of Compd B, we applied bioluminescence imaging (BLI), which was previously shown to detect prion disease onset in live mice earlier than clinical signs. In our studies, Compd B showed good efficacy in two lines of transgenic mice infected with the mouse-adapted Rocky Mountain Laboratory (RML) strain of prions, but not in transgenic mice infected with human prions. The BLI system successfully predicted the efficacies in all cases long before extension in survival could be observed. Our studies suggest that this BLI system has good potential to be applied in future antiprion drug efficacy studies. PMID:23965382

  8. Enzymatic Digestion of Chronic Wasting Disease Prions Bound to Soil

    PubMed Central

    SAUNDERS, SAMUEL E.; BARTZ, JASON C.; VERCAUTEREN, KURT C.; BARTELT-HUNT, SHANNON L.

    2010-01-01

    Chronic wasting disease (CWD) and sheep scrapie can be transmitted via indirect environmental routes, and it is known that soil can serve as a reservoir of prion infectivity. Given the strong interaction between the prion protein (PrP) and soil, we hypothesized that binding to soil enhances prion resistance to enzymatic digestion, thereby facilitating prion longevity in the environment and providing protection from host degradation. We characterized the performance of a commercially available subtilisin enzyme, the Prionzyme, to degrade soil-bound and unbound CWD and HY TME PrP as a function of pH, temperature, and treatment time. The subtilisin enzyme effectively degraded PrP adsorbed to a wide range of soils and soil minerals below the limits of detection. Signal loss occurred rapidly at high pH (12.5) and within 7 d under conditions representative of the natural environment (pH 7.4, 22°C). We observed no apparent difference in enzyme effectiveness between bound and unbound CWD PrP. Our results show that although adsorbed prions do retain relative resistance to enzymatic digestion compared with other brain homogenate proteins, they can be effectively degraded when bound to soil. Our results also suggest a topical application of a subtilisin enzyme solution may be an effective decontamination method to limit disease transmission via environmental ‘hot spots’ of prion infectivity. PMID:20450190

  9. Prions, prionoid complexes and amyloids: the bad, the good and something in between.

    PubMed

    Hafner Bratkovič, Iva

    2017-04-19

    Prions are infectious agents causing transmissible spongiform encephalopathies in humans and animals. These protein-based particles template conformational changes in a host-encoded prion protein to an insoluble self-like conformation. Prions are also present in yeast, where they support protein-based epigenetic inheritance. There is emerging evidence that prion-like (prionoid) particles can support a variety of pathological and beneficial functions. The recent data on the prionoid spread of other pathological amyloids are discussed in light of differences between prions and prion-like aggregates. On the other hand, prion-like action has also been found to support important functions such as memory, and amyloids were shown to have a variety of physiological roles from storage to scaffolding in simple organisms and in humans. Higher-order protein complexes play important roles in signalling. Many death-fold domains can polymerise upon nucleation to enhance sensitivity and induce a robust response. Although these polymers are structurally different from amyloids, some of them are characterised by prionoid activities, such as intercellular spread. The initial activation of these complexes is vital for organismal health, whereas prolonged activation leading to unresolved inflammation underlies autoinflammatory and other diseases. Prionoid complexes play important roles far beyond prion diseases and neurodegeneration.

  10. Efficient PRNP deletion in bovine genome using gene-editing technologies in bovine cells

    PubMed Central

    Choi, WooJae; Kim, Eunji; Yum, Soo-Young; Lee, ChoongIl; Lee, JiHyun; Moon, JoonHo; Ramachandra, Sisitha; Malaweera, Buddika Oshadi; Cho, JongKi; Kim, Jin-Soo; Kim, SeokJoong; Jang, Goo

    2015-01-01

    abstract Even though prion (encoded by the PRNP gene) diseases like bovine spongiform encephalopathy (BSE) are fatal neurodegenerative diseases in cattle, their study via gene deletion has been limited due to the absence of cell lines or mutant models. In this study, we aim to develop an immortalized fibroblast cell line in which genome-engineering technology can be readily applied to create gene-modified clones for studies. To this end, this study is designed to 1) investigate the induction of primary fibroblasts to immortalization by introducing Bmi-1 and hTert genes; 2) investigate the disruption of the PRNP in those cells; and 3) evaluate the gene expression and embryonic development using knockout (KO) cell lines. Primary cells from a male neonate were immortalized with Bmi-1and hTert. Immortalized cells were cultured for more than 180 days without any changes in their doubling time and morphology. Furthermore, to knockout the PRNP gene, plasmids that encode transcription activator-like effector nuclease (TALEN) pairs were transfected into the cells, and transfected single cells were propagated. Mutated clonal cell lines were confirmed by T7 endonuclease I assay and sequencing. Four knockout cell lines were used for somatic cell nuclear transfer (SCNT), and the resulting embryos were developed to the blastocyst stage. The genes (CSNK2A1, FAM64A, MPG and PRND) were affected after PRNP disruption in immortalized cells. In conclusion, we established immortalized cattle fibroblasts using Bmi-1 and hTert genes, and used TALENs to knockout the PRNP gene in these immortalized cells. The efficient PRNP KO is expected to be a useful technology to develop our understanding of in vitro prion protein functions in cattle. PMID:26217959

  11. Pathogenic prions deviate PrPC signaling in neuronal cells and impair A-beta clearance

    PubMed Central

    Pradines, E; Hernandez-Rapp, J; Villa-Diaz, A; Dakowski, C; Ardila-Osorio, H; Haik, S; Schneider, B; Launay, J-M; Kellermann, O; Torres, J-M; Mouillet-Richard, S

    2013-01-01

    The subversion of the normal function exerted by the cellular prion protein (PrPC) in neurons by pathogenic prions is assumed to have a central role in the pathogenesis of transmissible spongiform encephalopathies. Using two murine models of prion infection, the 1C11 neuronal cell line and neurospheres, we document that prion infection is associated with the constitutive activation of signaling targets normally coupled with PrPC, including the Fyn kinase, the mitogen-associated protein kinases ERK1/2 and the CREB transcription factor. PrPC-dependent signaling overactivation in infected cells is associated with the recruitment of p38 and JNK stress-associated kinases. Downstream from CREB, prion-infected cells exhibit reduced activity of the matrix metalloprotease (MMP)-9. As MMP-9 catalyzes the degradation of the amyloid A-beta peptide, the decrease in MMP-9 activity in prion-infected cells causes a significant impairment of the clearance of A-beta, leading to its accumulation. By exploiting two 1C11-infected clones accumulating high or moderate levels of prions, we show that the prion-induced changes are correlated with the level of infectivity. Of note, a dose-dependent increase in A-beta levels was also found in the cerebrospinal fluid of mice inoculated with these infected clones. By demonstrating that pathogenic prions trigger increases in A-beta levels through the deviation of PrPC signaling, our data argue that A-beta may exacerbate prion-induced toxicity. PMID:23303130

  12. The intricate mechanisms of neurodegeneration in prion diseases

    PubMed Central

    Soto, Claudio; Satani, Nikunj

    2010-01-01

    Prion diseases are a group of infectious neurodegenerative diseases with an entirely novel mechanism of transmission, involving a protein-only infectious agent that propagates the disease by transmitting protein conformational changes. The disease results from extensive and progressive brain degeneration. The molecular mechanisms involved in neurodegeneration are not entirely known but involve multiple processes operating simultaneously and synergistically in the brain, including spongiform degeneration, synaptic alterations, brain inflammation, neuronal death and the accumulation of protein aggregates. Here, we review the pathways implicated in prion-induced brain damage and put the pieces together into a possible model of neurodegeneration in prion disorders. A more comprehensive understanding of the molecular basis of brain degeneration is essential to develop a much needed therapy for these devastating diseases. PMID:20889378

  13. Prion propagation in cells expressing PrP glycosylation mutants.

    PubMed

    Salamat, Muhammad K; Dron, Michel; Chapuis, Jérôme; Langevin, Christelle; Laude, Hubert

    2011-04-01

    Infection by prions involves conversion of a host-encoded cell surface protein (PrP(C)) to a disease-related isoform (PrP(Sc)). PrP(C) carries two glycosylation sites variably occupied by complex N-glycans, which have been suggested by previous studies to influence the susceptibility to these diseases and to determine characteristics of prion strains. We used the Rov cell system, which is susceptible to sheep prions, to generate a series of PrP(C) glycosylation mutants with mutations at one or both attachment sites. We examined their subcellular trafficking and ability to convert into PrP(Sc) and to sustain stable prion propagation in the absence of wild-type PrP. The susceptibility to infection of mutants monoglycosylated at either site differed dramatically depending on the amino acid substitution. Aglycosylated double mutants showed overaccumulation in the Golgi compartment and failed to be infected. Introduction of an ectopic glycosylation site near the N terminus fully restored cell surface expression of PrP but not convertibility into PrP(Sc), while PrP(C) with three glycosylation sites conferred cell permissiveness to infection similarly to the wild type. In contrast, predominantly aglycosylated molecules with nonmutated N-glycosylation sequons, produced in cells expressing glycosylphosphatidylinositol-anchorless PrP(C), were able to form infectious PrP(Sc). Together our findings suggest that glycosylation is important for efficient trafficking of anchored PrP to the cell surface and sustained prion propagation. However, properly trafficked glycosylation mutants were not necessarily prone to conversion, thus making it difficult in such studies to discern whether the amino acid changes or glycan chain removal most influences the permissiveness to prion infection.

  14. The Effect of Fragmented Pathogenic α-Synuclein Seeds on Prion-like Propagation*

    PubMed Central

    Tarutani, Airi; Suzuki, Genjiro; Shimozawa, Aki; Nonaka, Takashi; Akiyama, Haruhiko; Hisanaga, Shin-ichi; Hasegawa, Masato

    2016-01-01

    Aggregates of abnormal proteins are widely observed in neuronal and glial cells of patients with various neurodegenerative diseases, and it has been proposed that prion-like behavior of these proteins can account for not only the onset but also the progression of these diseases. However, it is not yet clear which abnormal protein structures function most efficiently as seeds for prion-like propagation. In this study, we aimed to identify the most pathogenic species of α-synuclein (α-syn), the main component of the Lewy bodies and Lewy neurites that are observed in α-synucleinopathies. We prepared various forms of α-syn protein and examined their seeding properties in vitro in cells and in mouse experimental models. We also characterized these α-syn species by means of electron microscopy and thioflavin fluorescence assays and found that fragmented β sheet-rich fibrous structures of α-syn with a length of 50 nm or less are the most efficient promoters of accumulation of phosphorylated α-syn, which is the hallmark of α-synucleinopathies. These results indicate that fragmented amyloid-like aggregates of short α-syn fibrils are the key pathogenic seeds that trigger prion-like conversion. PMID:27382062

  15. Protective V127 prion variant prevents prion disease by interrupting the formation of dimer and fibril from molecular dynamics simulations.

    PubMed

    Zhou, Shuangyan; Shi, Danfeng; Liu, Xuewei; Liu, Huanxiang; Yao, Xiaojun

    2016-02-24

    Recent studies uncovered a novel protective prion protein variant: V127 variant, which was reported intrinsically resistant to prion conversion and propagation. However, the structural basis of its protective effect is still unknown. To uncover the origin of the protective role of V127 variant, molecular dynamics simulations were performed to explore the influence of G127V mutation on two key processes of prion propagation: dimerization and fibril formation. The simulation results indicate V127 variant is unfavorable to form dimer by reducing the main-chain H-bond interactions. The simulations of formed fibrils consisting of β1 strand prove V127 variant will make the formed fibril become unstable and disorder. The weaker interaction energies between layers and reduced H-bonds number for V127 variant reveal this mutation is unfavorable to the formation of stable fibril. Consequently, we find V127 variant is not only unfavorable to the formation of dimer but also unfavorable to the formation of stable core and fibril, which can explain the mechanism on the protective role of V127 variant from the molecular level. Our findings can deepen the understanding of prion disease and may guide the design of peptide mimetics or small molecule to mimic the protective effect of V127 variant.

  16. A direct assessment of human prion adhered to steel wire using real-time quaking-induced conversion

    PubMed Central

    Mori, Tsuyoshi; Atarashi, Ryuichiro; Furukawa, Kana; Takatsuki, Hanae; Satoh, Katsuya; Sano, Kazunori; Nakagaki, Takehiro; Ishibashi, Daisuke; Ichimiya, Kazuko; Hamada, Masahisa; Nakayama, Takehisa; Nishida, Noriyuki

    2016-01-01

    Accidental transmission of prions during neurosurgery has been reported as a consequence of re-using contaminated surgical instruments. Several decontamination methods have been studied using the 263K-hamster prion; however, no studies have directly evaluated human prions. A newly developed in vitro amplification system, designated real-time quaking-induced conversion (RT-QuIC), has allowed the activity of abnormal prion proteins to be assessed within a few days. RT-QuIC using human recombinant prion protein (PrP) showed high sensitivity for prions as the detection limit of our assay was estimated as 0.12 fg of active prions. We applied this method to detect human prion activity on stainless steel wire. When we put wires contaminated with human Creutzfeldt–Jakob disease brain tissue directly into the test tube, typical PrP-amyloid formation was observed within 48 hours, and we could detect the activity of prions at 50% seeding dose on the wire from 102.8 to 105.8 SD50. Using this method, we also confirmed that the seeding activities on the wire were removed following treatment with NaOH. As seeding activity closely correlated with the infectivity of prions using the bioassay, this wire-QuIC assay will be useful for the direct evaluation of decontamination methods for human prions. PMID:27112110

  17. Proteomic analysis of bovine nucleolus.

    PubMed

    Patel, Amrutlal K; Olson, Doug; Tikoo, Suresh K

    2010-09-01

    Nucleolus is the most prominent subnuclear structure, which performs a wide variety of functions in the eukaryotic cellular processes. In order to understand the structural and functional role of the nucleoli in bovine cells, we analyzed the proteomic composition of the bovine nucleoli. The nucleoli were isolated from Madin Darby bovine kidney cells and subjected to proteomic analysis by LC-MS/MS after fractionation by SDS-PAGE and strong cation exchange chromatography. Analysis of the data using the Mascot database search and the GPM database search identified 311 proteins in the bovine nucleoli, which contained 22 proteins previously not identified in the proteomic analysis of human nucleoli. Analysis of the identified proteins using the GoMiner software suggested that the bovine nucleoli contained proteins involved in ribosomal biogenesis, cell cycle control, transcriptional, translational and post-translational regulation, transport, and structural organization. Copyright © 2010 Beijing Genomics Institute. Published by Elsevier Ltd. All rights reserved.

  18. Translational errors as an early event in prion conversion.

    PubMed

    Hatin, I; Bidou, L; Cullin, C; Rousset, J P

    2001-01-01

    A prion is an infectious, altered form of a cellular protein which can self-propagate and affect normal phenotype. Prion conversion has been observed for mammalian and yeast proteins but molecular mechanisms that trigger this process remain unclear. Up to now, only post-translational models have been explored. In this work, we tested the hypothesis that co-translational events may be implicated in the conformation changes of the Ure2p protein of Saccharomyces cerevisiae. This protein can adopt a prion conformation leading to an [URE3] phenotype which can be easily assessed and quantified. We analyzed the effect of two antibiotics, known to affect translation, on [URE3] conversion frequency. For cells treated with G418 we observed a parallel increase of translational errors rate and frequency of [URE3] conversion. By contrast, cycloheximide which was not found to affect translational fidelity, has no influence on the induction of [URE3] phenotype. These results raise the possibility that the mechanism of prion conversion might not only involve alternative structures of strictly identical molecules but also aberrant proteins resulting from translational errors.

  19. Absence of Evidence for a Causal Link between Bovine Spongiform Encephalopathy Strain Variant L-BSE and Known Forms of Sporadic Creutzfeldt-Jakob Disease in Human PrP Transgenic Mice.

    PubMed

    Jaumain, Emilie; Quadrio, Isabelle; Herzog, Laetitia; Reine, Fabienne; Rezaei, Human; Andréoletti, Olivier; Laude, Hubert; Perret-Liaudet, Armand; Haïk, Stéphane; Béringue, Vincent

    2016-12-01

    Prions are proteinaceous pathogens responsible for subacute spongiform encephalopathies in animals and humans. The prions responsible for bovine spongiform encephalopathy (BSE) are zoonotic agents, causing variant Creutzfeldt-Jakob disease (CJD) in humans. The transfer of prions between species is limited by a species barrier, which is thought to reflect structural incompatibilities between the host cellular prion protein (PrP C ) and the infecting pathological PrP assemblies (PrP Sc ) constituting the prion. A BSE strain variant, designated L-BSE and responsible for atypical, supposedly spontaneous forms of prion diseases in aged cattle, demonstrates zoonotic potential, as evidenced by its capacity to propagate more easily than classical BSE in transgenic mice expressing human PrP C and in nonhuman primates. In humanized mice, L-BSE propagates without any apparent species barrier and shares similar biochemical PrP Sc signatures with the CJD subtype designated MM2-cortical, thus opening the possibility that certain CJD cases classified as sporadic may actually originate from L-type BSE cross-transmission. To address this issue, we compared the biological properties of L-BSE and those of a panel of CJD subtypes representative of the human prion strain diversity using standard strain-typing criteria in human PrP transgenic mice. We found no evidence that L-BSE causes a known form of sporadic CJD. Since the quasi-extinction of classical BSE, atypical BSE forms are the sole BSE variants circulating in cattle worldwide. They are observed in rare cases of old cattle, making them difficult to detect. Extrapolation of our results suggests that L-BSE may propagate in humans as an unrecognized form of CJD, and we urge both the continued utilization of precautionary measures to eliminate these agents from the human food chain and active surveillance for CJD phenotypes in the general population. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  20. Infectivity-associated PrPSc and disease duration-associated PrPSc of mouse BSE prions

    PubMed Central

    Miyazawa, Kohtaro; Okada, Hiroyuki; Masujin, Kentaro; Iwamaru, Yoshifumi; Yokoyama, Takashi

    2015-01-01

    ABSTRACT Disease-related prion protein (PrPSc), which is a structural isoform of the host-encoded cellular prion protein, is thought to be a causative agent of transmissible spongiform encephalopathies. However, the specific role of PrPSc in prion pathogenesis and its relationship to infectivity remain controversial. A time-course study of prion-affected mice was conducted, which showed that the prion infectivity was not simply proportional to the amount of PrPSc in the brain. Centrifugation (20,000 ×g) of the brain homogenate showed that most of the PrPSc was precipitated into the pellet, and the supernatant contained only a slight amount of PrPSc. Interestingly, mice inoculated with the obtained supernatant showed incubation periods that were approximately 15 d longer than those of mice inoculated with the crude homogenate even though both inocula contained almost the same infectivity. Our results suggest that a small population of fine PrPSc may be responsible for prion infectivity and that large, aggregated PrPSc may contribute to determining prion disease duration. PMID:26555211

  1. Modulation of prion polymerization and toxicity by rationally designed peptidomimetics.

    PubMed

    Srivastava, Ankit; Sharma, Sakshi; Sadanandan, Sandhya; Gupta, Sakshi; Singh, Jasdeep; Gupta, Sarika; Haridas, V; Kundu, Bishwajit

    2017-01-01

    Misfolding and aggregation of cellular prion protein is associated with a large array of neurological disorders commonly called the transmissible spongiform encephalopathies. Designing inhibitors against prions has remained a daunting task owing to limited information about mechanism(s) of their pathogenic self-assembly. Here, we explore the anti-prion properties of a combinatorial library of bispidine-based peptidomimetics (BPMs) that conjugate amino acids with hydrophobic and aromatic side chains. Keeping the bispidine unit unaltered, a series of structurally diverse BPMs were synthesized and tested for their prion-modulating properties. Administration of Leu- and Trp-BPMs delayed and completely inhibited the amyloidogenic conversion of human prion protein (HuPrP), respectively. We found that each BPM induced the HuPrP to form unique oligomeric nanostructures differing in their biophysical properties, cellular toxicities and response to conformation-specific antibodies. While Leu-BPMs were found to stabilize the oligomers, Trp-BPMs effected transient oligomerization, resulting in the formation of non-toxic, non-fibrillar aggregates. Yet another aromatic residue, Phe, however, accelerated the aggregation process in HuPrP. Molecular insights obtained through MD (molecular dynamics) simulations suggested that each BPM differently engages a conserved Tyr 169 residue at the α2-β2 loop of HuPrP and affects the stability of α2 and α3 helices. Our results demonstrate that this new class of molecules having chemical scaffolds conjugating hydrophobic/aromatic residues could effectively modulate prion aggregation and toxicity. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  2. Infectious Prions in the Saliva and Blood of Deer with Chronic Wasting Disease

    NASA Astrophysics Data System (ADS)

    Mathiason, Candace K.; Powers, Jenny G.; Dahmes, Sallie J.; Osborn, David A.; Miller, Karl V.; Warren, Robert J.; Mason, Gary L.; Hays, Sheila A.; Hayes-Klug, Jeanette; Seelig, Davis M.; Wild, Margaret A.; Wolfe, Lisa L.; Spraker, Terry R.; Miller, Michael W.; Sigurdson, Christina J.; Telling, Glenn C.; Hoover, Edward A.

    2006-10-01

    A critical concern in the transmission of prion diseases, including chronic wasting disease (CWD) of cervids, is the potential presence of prions in body fluids. To address this issue directly, we exposed cohorts of CWD-naïve deer to saliva, blood, or urine and feces from CWD-positive deer. We found infectious prions capable of transmitting CWD in saliva (by the oral route) and in blood (by transfusion). The results help to explain the facile transmission of CWD among cervids and prompt caution concerning contact with body fluids in prion infections.

  3. Prion peripheralization is a host-driven trait of prion infection, independent of strain

    USDA-ARS?s Scientific Manuscript database

    Chronic wasting disease (CWD), like scrapie of sheep, is a horizontally transmissible spongiform encephalopathy. Proposed natural routes of transmission for both agents include saliva, urine, and feces, and are likely related to an accumulation of misfolded prion proteins in peripheral excretory tis...

  4. Sulforaphane-induced autophagy flux prevents prion protein-mediated neurotoxicity through AMPK pathway.

    PubMed

    Lee, J-H; Jeong, J-K; Park, S-Y

    2014-10-10

    Prion diseases are neurodegenerative and infectious disorders that involve accumulation of misfolded scrapie prion protein, and which are characterized by spongiform degeneration. Autophagy, a major homeostatic process responsible for the degradation of cytoplasmic components, has garnered attention as the potential target for neurodegenerative diseases such as prion disease. We focused on protective effects of sulforaphane found in cruciferous vegetables on prion-mediated neurotoxicity and the mechanism of sulforaphane related to autophagy. In human neuroblastoma cells, sulforaphane protected prion protein (PrP) (106-126)-mediated neurotoxicity and increased autophagy flux marker microtubule-associated protein 1 light chain 3-II protein levels, following a decrease of p62 protein level. Pharmacological and genetical inhibition of autophagy by 3MA, wortmannin and knockdown of autophagy-related 5 (ATG5) led to block the effect of sulforaphane against PrP (106-126)-induced neurotoxicity. Furthermore we demonstrated that both sulforaphane-induced autophagy and protective effect of sulforaphane against PrP (106-126)-induced neurotoxicity are dependent on the AMP-activated protein kinase (AMPK) signaling. The present results indicated that sulforaphane of cruciferous vegetables enhanced autophagy flux led to the protection effects against prion-mediated neurotoxicity, which was regulated by AMPK signaling pathways in human neuron cells. Our data also suggest that sulforaphane has a potential value as a therapeutic tool in neurodegenerative disease including prion diseases. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  5. Prying into the Prion Hypothesis for Parkinson's Disease.

    PubMed

    Brundin, Patrik; Melki, Ronald

    2017-10-11

    In Parkinson's disease, intracellular α-synuclein inclusions form in neurons. We suggest that prion-like behavior of α-synuclein is a key component in Parkinson's disease pathogenesis. Although multiple molecular changes are involved in the triggering of the disease process, we propose that neuron-to-neuron transfer is a crucial event that is essential for Lewy pathology to spread from one brain region to another. In this review, we describe key findings in human postmortem brains, cultured cells, and animal models of disease that support the idea that α-synuclein can act as a prion. We consider potential triggers of the α-synuclein misfolding and why the aggregates escape cellular degradation under disease conditions. We also discuss whether different strains of α-synuclein fibrils can underlie differences in cellular and regional distribution of aggregates in different synucleinopathies. Our conclusion is that α-synuclein probably acts as a prion in human diseases, and a deeper understanding of this step in the pathogenesis of Parkinson's disease can facilitate the development of disease-modifying therapies in the future. Dual Perspectives Companion Paper: Parkinson's Disease Is Not Simply a Prion Disorder, by D. James Surmeier, José A. Obeso, and Glenda M. Halliday. Copyright © 2017 the authors 0270-6474/17/379808-11$15.00/0.

  6. Kinetics of Ozone Inactivation of Infectious Prion Protein

    PubMed Central

    Ding, Ning; Price, Luke M.; Braithwaite, Shannon L.; Balachandran, Aru; Mitchell, Gordon; Belosevic, Miodrag

    2013-01-01

    The kinetics of ozone inactivation of infectious prion protein (PrPSc, scrapie 263K) was investigated in ozone-demand-free phosphate-buffered saline (PBS). Diluted infectious brain homogenates (IBH) (0.01%) were exposed to a predetermined ozone dose (10.8 ± 2.0 mg/liter) at three pHs (pH 4.4, 6.0, and 8.0) and two temperatures (4°C and 20°C). The inactivation of PrPSc was quantified by determining the in vitro destruction of PrPSc templating properties using the protein misfolding cyclic amplification (PMCA) assay and bioassay, which were shown to correlate well. The inactivation kinetics were characterized by both Chick-Watson (CW) and efficiency factor Hom (EFH) models. It was found that the EFH model fit the experimental data more appropriately. The efficacy of ozone inactivation of PrPSc was both pH and temperature dependent. Based on the EFH model, CT (disinfectant concentration multiplied by contact time) values were determined for 2-log10, 3-log10, and 4-log10 inactivation at the conditions under which they were achieved. Our results indicated that ozone is effective for prion inactivation in ozone-demand-free water and may be applied for the inactivation of infectious prion in prion-contaminated water and wastewater. PMID:23416994

  7. Yeast prion architecture explains how proteins can be genes

    NASA Astrophysics Data System (ADS)

    Wickner, Reed

    2013-03-01

    Prions (infectious proteins) transmit information without an accompanying DNA or RNA. Most yeast prions are self-propagating amyloids that inactivate a normally functional protein. A single protein can become any of several prion variants, with different manifestations due to different amyloid structures. We showed that the yeast prion amyloids of Ure2p, Sup35p and Rnq1p are folded in-register parallel beta sheets using solid state NMR dipolar recoupling experiments, mass-per-filament-length measurements, and filament diameter measurements. The extent of beta sheet structure, measured by chemical shifts in solid-state NMR and acquired protease-resistance on amyloid formation, combined with the measured filament diameters, imply that the beta sheets must be folded along the long axis of the filament. We speculate that prion variants of a single protein sequence differ in the location of these folds. Favorable interactions between identical side chains must hold these structures in-register. The same interactions must guide an unstructured monomer joining the end of a filament to assume the same conformation as molecules already in the filament, with the turns at the same locations. In this way, a protein can template its own conformation, in analogy to the ability of a DNA molecule to template its sequence by specific base-pairing. Bldg. 8, Room 225, NIH, 8 Center Drive MSC 0830, Bethesda, MD 20892-0830, wickner@helix.nih.gov, 301-496-3452

  8. Protein conformation determines the sensibility to high pressure treatment of infectious scrapie prions.

    PubMed

    Heindl, Philipp; García, Avelina Fernández; Butz, Peter; Pfaff, Eberhard; Tauscher, Bernhard

    2006-03-01

    Application of high pressure can be used for gentle pasteurizing of food, minimizing undesirable alterations such as vitamin losses and changes in taste and color. In addition, pressure has become a useful tool for investigating structural changes in proteins. Treatments of proteins with high pressure can reveal conformations that are not obtainable by other physical variables like temperature, since pressure favors structural transitions accompanied with smaller volumes. Here, we discuss both the potential use of high pressure to inactivate infectious TSE material and the application of this thermodynamic parameter for the investigation of prion folding. This review summarizes our findings on the effects of pressure on the structure of native infectious scrapie prions in hamster brain homogenates and on the structure of infectious prion rods isolated from diseased hamsters brains. Native prions were found to be pressure sensitive, whereas isolated prions revealed an extreme pressure-resistant structure. The discussion will be focused on the different pressure behavior of these prion isoforms, which points out differences in the protein structure that have not been taken into consideration before.

  9. Divergent prion strain evolution driven by PrPC expression level in transgenic mice

    PubMed Central

    Le Dur, Annick; Laï, Thanh Lan; Stinnakre, Marie-George; Laisné, Aude; Chenais, Nathalie; Rakotobe, Sabine; Passet, Bruno; Reine, Fabienne; Soulier, Solange; Herzog, Laetitia; Tilly, Gaëlle; Rézaei, Human; Béringue, Vincent; Vilotte, Jean-Luc; Laude, Hubert

    2017-01-01

    Prions induce a fatal neurodegenerative disease in infected host brain based on the refolding and aggregation of the host-encoded prion protein PrPC into PrPSc. Structurally distinct PrPSc conformers can give rise to multiple prion strains. Constrained interactions between PrPC and different PrPSc strains can in turn lead to certain PrPSc (sub)populations being selected for cross-species transmission, or even produce mutation-like events. By contrast, prion strains are generally conserved when transmitted within the same species, or to transgenic mice expressing homologous PrPC. Here, we compare the strain properties of a representative sheep scrapie isolate transmitted to a panel of transgenic mouse lines expressing varying levels of homologous PrPC. While breeding true in mice expressing PrPC at near physiological levels, scrapie prions evolve consistently towards different strain components in mice beyond a certain threshold of PrPC overexpression. Our results support the view that PrPC gene dosage can influence prion evolution on homotypic transmission. PMID:28112164

  10. Search for the genome of bovine herpesvirus types 1, 4 and 5 in bovine semen

    PubMed Central

    Morán, P.E.; Favier, P.A.; Lomónaco, M.; Catena, M.C.; Chiapparrone, M.L.; Odeón, A.C.; Verna, A.E.; Pérez, S.E.

    2013-01-01

    Bovine herpesvirus type 1 (BoHV-1) causes respiratory and reproductive disorders in cattle. Recently, bovine herpesvirus type 5 (BoHV-5) and bovine herpesvirus type 4 (BoHV-4) have been identified to be associated with genital disease. In this study, the presence of the genome of BoHV-1, BoHV-4 and BoHV-5 in bovine semen of Argentinean and international origin was analyzed by PCR assays. The most important finding of this study is the detection of the genome of BoHV-1 and BoHV-4 in semen of bulls maintained at artificial insemination centers. It is particularly relevant that BoHV-1 DNA was also identified in one sample of international origin suggesting the need for extensive quality control measures on international transport of bovine semen. PMID:26623325

  11. Proteomics analyses for the global proteins in the brain tissues of different human prion diseases.

    PubMed

    Shi, Qi; Chen, Li-Na; Zhang, Bao-Yun; Xiao, Kang; Zhou, Wei; Chen, Cao; Zhang, Xiao-Mei; Tian, Chan; Gao, Chen; Wang, Jing; Han, Jun; Dong, Xiao-Ping

    2015-04-01

    Proteomics changes of brain tissues have been described in different neurodegenerative diseases including Alzheimer's disease and Parkinson's disease. However, the brain proteomics of human prion disease remains less understood. In the study, the proteomics patterns of cortex and cerebellum of brain tissues of sporadic Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD were analyzed with isobaric tags for relative and absolute quantitation combined with multidimensional liquid chromatography and MS analysis, with the brains from three normal individuals as controls. Global protein profiling, significant pathway, and functional categories were analyzed. In total, 2287 proteins were identified with quantitative information both in cortex and cerebellum regions. Cerebellum tissues appeared to contain more up- and down-regulated proteins (727 proteins) than cortex regions (312 proteins) of Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD. Viral myocarditis, Parkinson's disease, Alzheimer's disease, lysosome, oxidative phosphorylation, protein export, and drug metabolism-cytochrome P450 were the most commonly affected pathways of the three kinds of diseases. Almost coincident biological functions were identified in the brain tissues of the three diseases. In all, data here demonstrate that the brain tissues of Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD have obvious proteomics changes at their terminal stages, which show the similarities not only among human prion diseases but also with other neurodegeneration diseases. This is the first study to provide a reference proteome map for human prion diseases and will be helpful for future studies focused on potential biomarkers for the diagnosis and therapy of human prion diseases. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Risk factors associated with bovine trichomoniasis in beef cattle identified by a questionnaire.

    PubMed

    Jin, Yinzhu; Schumaker, Brant; Logan, Jim; Yao, Chaoqun

    2014-06-01

    Bovine trichomoniasis is a venereal disease that causes substantial economic losses to the cattle industry worldwide. It has been endemic in the USA since its discovery in the 1930s. The reasons for this long-lasting endemism are poorly understood. The main objective of this study was to identify herd-level risk factors for trichomoniasis in Wyoming beef cattle. A questionnaire was sent to all Wyoming beef cattle producers. The overall response proportion was 23.4 %. Questionnaires were returned from producers throughout the state in different geographical regions and with various herd sizes. In total, 863 questionnaires were analysed for correlation between the disease endemism and 25 variables. Tritrichomonas foetus infections were found to be significantly (P<0.05) associated with neighbouring a positive herd(s), grazing on public allotments and commingling with other herds. In addition, a delay in fixing broken fences approached statistical significance (P = 0.078). This study provides producers with valuable information and useful suggestions on how to effectively control and reduce the risks of bovine trichomoniasis. © 2014 The Authors.

  13. CWDPRNP: A tool for cervid prion sequence analysis in program R

    USGS Publications Warehouse

    Miller, William L.; Walter, W. David

    2017-01-01

    Chronic wasting disease is a fatal, neurological disease caused by an infectious prion protein, which affects economically and ecologically important members of the family Cervidae. Single nucleotide polymorphisms within the prion protein gene have been linked to differential susceptibility to the disease in many species. Wildlife managers are seeking to determine the frequencies of disease-associated alleles and genotypes and delineate spatial genetic patterns. The CWDPRNP package, implemented in program R, provides a unified framework for analyzing prion protein gene variability and spatial structure.

  14. A transfectant RK13 cell line permissive to classical caprine scrapie prion propagation.

    PubMed

    Dassanayake, Rohana P; Zhuang, Dongyue; Truscott, Thomas C; Madsen-Bouterse, Sally A; O'Rourke, Katherine I; Schneider, David A

    2016-03-03

    To assess scrapie infectivity associated with caprine-origin tissues, bioassay can be performed using kids, lambs or transgenic mice expressing caprine or ovine prion (PRNP) alleles, but the incubation periods are fairly long. Although several classical ovine scrapie prion permissive cell lines with the ability to detect brain-derived scrapie prion have been available, no classical caprine scrapie permissive cell line is currently available. Therefore, the aims of this study were to generate a rabbit kidney epithelial cell line (RK13) stably expressing caprine wild-type PRNP (cpRK13) and then to assess permissiveness of cpRK13 cells to classical caprine scrapie prion propagation. The cpRK13 and plasmid control RK13 (pcRK13) cells were incubated with brain-derived classical caprine scrapie inocula prepared from goats or ovinized transgenic mice (Tg338, express ovine VRQ allele) infected with caprine scrapie. Significant PrP(Sc) accumulation, which is indicative of scrapie prion propagation, was detected by TSE ELISA and immunohistochemistry in cpRK13 cells inoculated with classical caprine scrapie inocula. Western blot analysis revealed the typical proteinase K-resistant 3 PrP(res) isoforms in the caprine scrapie prion inoculated cpRK13 cell lysate. Importantly, PrP(Sc) accumulation was not detected in similarly inoculated pcRK13 cells, whether by TSE ELISA, immunohistochemistry, or western blot. These findings suggest that caprine scrapie prions can be propagated in cpRK13 cells, thus this cell line may be a useful tool for the assessment of classical caprine prions in the brain tissues of goats.

  15. Alteration of the chronic wasting disease species barrier by in vitro prion amplification

    USGS Publications Warehouse

    Kurt, Timothy D.; Seelig, Davis M.; Schneider, Jay R.; Johnson, Christopher J.; Telling, Glenn C.; Heisey, Dennis M.; Hoover, Edward A.

    2011-01-01

    Chronic wasting disease (CWD) is a transmissible spongiform encephalopathy (TSE) of cervids now detected in 19 states of the United States, three Canadian provinces, and South Korea. Whether noncervid species can be infected by CWD and thereby serve as reservoirs for the infection is not known. To investigate this issue, we previously used serial protein misfolding cyclic amplification (sPMCA) to demonstrate that CWD prions can amplify in brain homogenates from several species sympatric with cervids, including prairie voles (Microtus ochrogaster) and field mice (Peromyscus spp.). Here, we show that prairie voles are susceptible to mule deer CWD prions in vivo and that sPMCA amplification of CWD prions in vole brain enhances the infectivity of CWD for this species. Prairie voles inoculated with sPMCA products developed clinical signs of TSE disease approximately 300 days prior to, and more consistently than, those inoculated with CWD prions from deer brain. Moreover, the deposition patterns and biochemical properties of protease-resistant form of PrP (PrPRES) in the brains of affected voles differed from those in cervidized transgenic (CerPrP) mice infected with CWD. In addition, voles inoculated orally with sPMCA products developed clinical signs of TSE and were positive for PrPRES deposition, whereas those inoculated orally with deer-origin CWD prions did not. These results demonstrate that transspecies sPMCA of CWD prions can enhance the infectivity and adapt the host range of CWD prions and thereby may be useful to assess determinants of prion species barriers.

  16. Effect of Q211 and K222 PRNP Polymorphic Variants in the Susceptibility of Goats to Oral Infection With Goat Bovine Spongiform Encephalopathy.

    PubMed

    Aguilar-Calvo, Patricia; Fast, Christine; Tauscher, Kerstin; Espinosa, Juan-Carlos; Groschup, Martin H; Nadeem, Muhammad; Goldmann, Wilfred; Langeveld, Jan; Bossers, Alex; Andreoletti, Olivier; Torres, Juan-María

    2015-08-15

    The prion protein-encoding gene (PRNP) is one of the major determinants for scrapie occurrence in sheep and goats. However, its effect on bovine spongiform encephalopathy (BSE) transmission to goats is not clear. Goats harboring wild-type, R/Q211 or Q/K222 PRNP genotypes were orally inoculated with a goat-BSE isolate to assess their relative susceptibility to BSE infection. Goats were killed at different time points during the incubation period and after the onset of clinical signs, and their brains as well as several peripheral tissues were analyzed for the accumulation of pathological prion protein (PrP(Sc)) and prion infectivity by mouse bioassay. R/Q211 goats displayed delayed clinical signs compared with wild-type goats. Deposits of PrP(Sc) were detected only in brain, whereas infectivity was present in peripheral tissues too. In contrast, none of the Q/K222 goats showed any evidence of clinical prion disease. No PrP(Sc) accumulation was observed in their brains or peripheral tissues, but very low infectivity was detected in some tissues very long after inoculation (44-45 months). These results demonstrate that transmission of goat BSE is genotype dependent, and they highlight the pivotal protective effect of the K222 PRNP variant in the oral susceptibility of goats to BSE. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Structural variants of yeast prions show conformer-specific requirements for chaperone activity

    PubMed Central

    Stein, Kevin C.; True, Heather L.

    2016-01-01

    Summary Molecular chaperones monitor protein homeostasis and defend against the misfolding and aggregation of proteins that is associated with protein conformational disorders. In these diseases, a variety of different aggregate structures can form. These are called prion strains, or variants, in prion diseases, and cause variation in disease pathogenesis. Here, we use variants of the yeast prions [RNQ+] and [PSI+] to explore the interactions of chaperones with distinct aggregate structures. We found that prion variants show striking variation in their relationship with Hsp40s. Specifically, the yeast Hsp40 Sis1, and its human ortholog Hdj1, had differential capacities to process prion variants, suggesting that Hsp40 selectivity has likely changed through evolution. We further show that such selectivity involves different domains of Sis1, with some prion conformers having a greater dependence on particular Hsp40 domains. Moreover, [PSI+] variants were more sensitive to certain alterations in Hsp70 activity as compared to [RNQ+] variants. Collectively, our data indicate that distinct chaperone machinery is required, or has differential capacity, to process different aggregate structures. Elucidating the intricacies of chaperone-client interactions, and how these are altered by particular client structures, will be crucial to understanding how this system can go awry in disease and contribute to pathological variation. PMID:25060529

  18. Prion Propagation in Cells Expressing PrP Glycosylation Mutants ▿

    PubMed Central

    Salamat, Muhammad K.; Dron, Michel; Chapuis, Jérôme; Langevin, Christelle; Laude, Hubert

    2011-01-01

    Infection by prions involves conversion of a host-encoded cell surface protein (PrPC) to a disease-related isoform (PrPSc). PrPC carries two glycosylation sites variably occupied by complex N-glycans, which have been suggested by previous studies to influence the susceptibility to these diseases and to determine characteristics of prion strains. We used the Rov cell system, which is susceptible to sheep prions, to generate a series of PrPC glycosylation mutants with mutations at one or both attachment sites. We examined their subcellular trafficking and ability to convert into PrPSc and to sustain stable prion propagation in the absence of wild-type PrP. The susceptibility to infection of mutants monoglycosylated at either site differed dramatically depending on the amino acid substitution. Aglycosylated double mutants showed overaccumulation in the Golgi compartment and failed to be infected. Introduction of an ectopic glycosylation site near the N terminus fully restored cell surface expression of PrP but not convertibility into PrPSc, while PrPC with three glycosylation sites conferred cell permissiveness to infection similarly to the wild type. In contrast, predominantly aglycosylated molecules with nonmutated N-glycosylation sequons, produced in cells expressing glycosylphosphatidylinositol-anchorless PrPC, were able to form infectious PrPSc. Together our findings suggest that glycosylation is important for efficient trafficking of anchored PrP to the cell surface and sustained prion propagation. However, properly trafficked glycosylation mutants were not necessarily prone to conversion, thus making it difficult in such studies to discern whether the amino acid changes or glycan chain removal most influences the permissiveness to prion infection. PMID:21248032

  19. Ozone inactivation of infectious prions in rendering plant and municipal wastewaters.

    PubMed

    Ding, Ning; Neumann, Norman F; Price, Luke M; Braithwaite, Shannon L; Balachandran, Aru; Belosevic, Miodrag; Gamal El-Din, Mohamed

    2014-02-01

    Disposal of tissues and organs associated with prion accumulation and infectivity in infected animals (designated as Specified Risk Materials [SRM]) is strictly regulated by the Canadian Food Inspection Agency (CFIA); however, the contamination of wastewater from slaughterhouses that handle SRM still poses public concern. In this study, we examined for the first time the partitioning of infectious prions in rendering plant wastewater and found that a large proportion of infectious prions were partitioned into the scum layer formed at the top after gravity separation, while quite a few infectious prions still remained in the wastewater. Subsequently, we assessed the ozone inactivation of infectious prions in the raw, natural gravity-separated and dissolved air flotation (DAF)-treated (i.e., primary-treated) rendering plant wastewater, and in a municipal final effluent (i.e., secondary-treated municipal wastewater). At applied ozone doses of 43.4-44.6 mg/L, ozone was instantaneously depleted in the raw rendering plant wastewater, while a greater than 4-log10 inactivation was achieved at a 5 min exposure in the DAF-treated rendering plant wastewater. Prion inactivation in the municipal final effluent was conducted with two levels of applied ozone doses of 13.4 and 22.5mg/L, and a greater than 4-log10 inactivation was achieved at a 5 min exposure with the higher ozone dose. Efficiency factor Hom (EFH) models were used to model (i.e., fit) the experimental data. The CT (disinfectant concentration multiplied by contact time) values were determined for 2- and 3-log10 inactivation in the municipal final effluent treated with an ozone dose of 13.4 mg/L. Our results indicate that ozone could serve as a final barrier for prion inactivation in primary- and/or secondary-treated wastewaters. © 2013.

  20. Early increase and late decrease of purkinje cell dendritic spine density in prion-infected organotypic mouse cerebellar cultures.

    PubMed

    Campeau, Jody L; Wu, Gengshu; Bell, John R; Rasmussen, Jay; Sim, Valerie L

    2013-01-01

    Prion diseases are infectious neurodegenerative diseases associated with the accumulation of protease-resistant prion protein, neuronal loss, spongiform change and astrogliosis. In the mouse model, the loss of dendritic spines is one of the earliest pathological changes observed in vivo, occurring 4-5 weeks after the first detection of protease-resistant prion protein in the brain. While there are cell culture models of prion infection, most do not recapitulate the neuropathology seen in vivo. Only the recently developed prion organotypic slice culture assay has been reported to undergo neuronal loss and the development of some aspects of prion pathology, namely small vacuolar degeneration and tubulovesicular bodies. Given the rapid replication of prions in this system, with protease-resistant prion protein detectable by 21 days, we investigated whether the dendritic spine loss and altered dendritic morphology seen in prion disease might also develop within the lifetime of this culture system. Indeed, six weeks after first detection of protease-resistant prion protein in tga20 mouse cerebellar slice cultures infected with RML prion strain, we found a statistically significant loss of Purkinje cell dendritic spines and altered dendritic morphology in infected cultures, analogous to that seen in vivo. In addition, we found a transient but statistically significant increase in Purkinje cell dendritic spine density during infection, at the time when protease-resistant prion protein was first detectable in culture. Our findings support the use of this slice culture system as one which recapitulates prion disease pathology and one which may facilitate study of the earliest stages of prion disease pathogenesis.

  1. Exploring the cause of initially reactive bovine brains on rapid tests for BSE

    PubMed Central

    Dudas, Sandor; James, Jace; Anderson, Renee; Czub, Stefanie

    2015-01-01

    ABSTRACT Bovine spongiform encephalopathy (BSE) is an invariably fatal prion disease of cattle. The identification of the zoonotic potential of BSE prompted safety officials to initiate surveillance testing for this disease. In Canada, BSE surveillance is primarily focused on high risk cattle including animals which are dead, down and unable to rise, diseased or distressed. This targeted surveillance results in the submission of brain samples with a wide range of tissue autolysis and associated contaminants. These contaminants have the potential to interfere with important steps of surveillance tests resulting in initially positive test results requiring additional testing to confirm the disease status of the animal. The current tests used for BSE screening in Canada utilize the relative protease resistance of the prion protein gained when it misfolds from PrPC to PrPSc as part of the disease process. Proteinase K completely digests PrPC in normal brains, but leaves most of the PrPSc in BSE positive brains intact which is detected using anti-prion antibodies. These tests are highly reliable but occasionally give rise to initially reactive/false positive results. Test results for these reactive samples were close to the positive/negative cut-off on a sub set of test platforms. This is in contrast to all of the previous Canadian positive samples whose numeric values on these same test platforms were 10 to 100 fold greater than the test positive/negative cut-off. Here we explore the potential reason why a sample is repeatedly positive on a sub-set of rapid surveillance tests, but negative on other test platforms. In order to better understand and identify what might cause these initial reactions, we have conducted a variety of rapid and confirmatory assays as well as bacterial isolation and identification on BSE positive, negative and initially reactive samples. We observed high levels of viable bacterial contamination in initially reactive samples suggesting that the

  2. Similar folds with different stabilization mechanisms: the cases of prion and doppel proteins

    PubMed Central

    Colacino, Stefano; Tiana, Guido; Colombo, Giorgio

    2006-01-01

    Background Protein misfolding is the main cause of a group of fatal neurodegenerative diseases in humans and animals. In particular, in Prion-related diseases the normal cellular form of the Prion Protein PrP (PrPC) is converted into the infectious PrPSc through a conformational process during which it acquires a high β-sheet content. Doppel is a protein that shares a similar native fold, but lacks the scrapie isoform. Understanding the molecular determinants of these different behaviours is important both for biomedical and biophysical research. Results In this paper, the dynamical and energetic properties of the two proteins in solution is comparatively analyzed by means of long time scale explicit solvent, all-atom molecular dynamics in different temperature conditions. The trajectories are analyzed by means of a recently introduced energy decomposition approach (Tiana et al, Prot. Sci. 2004) aimed at identifying the key residues for the stabilization and folding of the protein. Our analysis shows that Prion and Doppel have two different cores stabilizing the native state and that the relative contribution of the nucleus to the global stability of the protein for Doppel is sensitively higher than for PrP. Moreover, under misfolding conditions the Doppel core is conserved, while the energy stabilization network of PrP is disrupted. Conclusion These observations suggest that different sequences can share similar native topology with different stabilizing interactions and that the sequences of the Prion and Doppel proteins may have diverged under different evolutionary constraints resulting in different folding and stabilization mechanisms. PMID:16857062

  3. Oral Prion Disease Pathogenesis Is Impeded in the Specific Absence of CXCR5-Expressing Dendritic Cells

    PubMed Central

    Bradford, Barry M.; Reizis, Boris

    2017-01-01

    ABSTRACT After oral exposure, the early replication of certain prion strains upon stromal cell-derived follicular dendritic cells (FDC) in the Peyer's patches in the small intestine is essential for the efficient spread of disease to the brain. However, little is known of how prions are initially conveyed from the gut lumen to establish infection on FDC. Our previous data suggest that mononuclear phagocytes such as CD11c+ conventional dendritic cells play an important role in the initial propagation of prions from the gut lumen into Peyer's patches. However, whether these cells conveyed orally acquired prions toward FDC within Peyer's patches was not known. The chemokine CXCL13 is expressed by FDC and follicular stromal cells and modulates the homing of CXCR5-expressing cells toward the FDC-containing B cell follicles. Here, novel compound transgenic mice were created in which a CXCR5 deficiency was specifically restricted to CD11c+ cells. These mice were used to determine whether CXCR5-expressing conventional dendritic cells propagate prions toward FDC after oral exposure. Our data show that in the specific absence of CXCR5-expressing conventional dendritic cells the early accumulation of prions upon FDC in Peyer's patches and the spleen was impaired, and disease susceptibility significantly reduced. These data suggest that CXCR5-expressing conventional dendritic cells play an important role in the efficient propagation of orally administered prions toward FDC within Peyer's patches in order to establish host infection. IMPORTANCE Many natural prion diseases are acquired by oral consumption of contaminated food or pasture. Once the prions reach the brain they cause extensive neurodegeneration, which ultimately leads to death. In order for the prions to efficiently spread from the gut to the brain, they first replicate upon follicular dendritic cells within intestinal Peyer's patches. How the prions are first delivered to follicular dendritic cells to establish

  4. Theoretical Modeling of Molecular Mechanisms, Time Scales and Strains in Prion Diseases

    DTIC Science & Technology

    2008-01-01

    transmembrane form of the prion protein is localized in the Golgi apparatus of neurons. J. Biol. Chem. 280: 15855-15864. 5 Baskakov, I.V., G. Legname, M.A...research on the prion problem, particularly on a promising new model for the in vitro mammalian prion fibril which involves a new suggestion for a C... new model for in vitro grown fibrils, new domain swapped oligomer models, and models of the influence of proline mutations on the kinetics of

  5. Polythiophenes Inhibit Prion Propagation by Stabilizing Prion Protein (PrP) Aggregates*

    PubMed Central

    Margalith, Ilan; Suter, Carlo; Ballmer, Boris; Schwarz, Petra; Tiberi, Cinzia; Sonati, Tiziana; Falsig, Jeppe; Nyström, Sofie; Hammarström, Per; Åslund, Andreas; Nilsson, K. Peter R.; Yam, Alice; Whitters, Eric; Hornemann, Simone; Aguzzi, Adriano

    2012-01-01

    Luminescent conjugated polymers (LCPs) interact with ordered protein aggregates and sensitively detect amyloids of many different proteins, suggesting that they may possess antiprion properties. Here, we show that a variety of anionic, cationic, and zwitterionic LCPs reduced the infectivity of prion-containing brain homogenates and of prion-infected cerebellar organotypic cultured slices and decreased the amount of scrapie isoform of PrPC (PrPSc) oligomers that could be captured in an avidity assay. Paradoxically, treatment enhanced the resistance of PrPSc to proteolysis, triggered the compaction, and enhanced the resistance to proteolysis of recombinant mouse PrP(23–231) fibers. These results suggest that LCPs act as antiprion agents by transitioning PrP aggregates into structures with reduced frangibility. Moreover, ELISA on cerebellar organotypic cultured slices and in vitro conversion assays with mouse PrP(23–231) indicated that poly(thiophene-3-acetic acid) may additionally interfere with the generation of PrPSc by stabilizing the conformation of PrPC or of a transition intermediate. Therefore, LCPs represent a novel class of antiprion agents whose mode of action appears to rely on hyperstabilization, rather than destabilization, of PrPSc deposits. PMID:22493452

  6. Shaking Alone Induces De Novo Conversion of Recombinant Prion Proteins to β-Sheet Rich Oligomers and Fibrils

    PubMed Central

    Ladner-Keay, Carol L.; Griffith, Bethany J.; Wishart, David S.

    2014-01-01

    The formation of β-sheet rich prion oligomers and fibrils from native prion protein (PrP) is thought to be a key step in the development of prion diseases. Many methods are available to convert recombinant prion protein into β-sheet rich fibrils using various chemical denaturants (urea, SDS, GdnHCl), high temperature, phospholipids, or mildly acidic conditions (pH 4). Many of these methods also require shaking or another form of agitation to complete the conversion process. We have identified that shaking alone causes the conversion of recombinant PrP to β-sheet rich oligomers and fibrils at near physiological pH (pH 5.5 to pH 6.2) and temperature. This conversion does not require any denaturant, detergent, or any other chemical cofactor. Interestingly, this conversion does not occur when the water-air interface is eliminated in the shaken sample. We have analyzed shaking-induced conversion using circular dichroism, resolution enhanced native acidic gel electrophoresis (RENAGE), electron microscopy, Fourier transform infrared spectroscopy, thioflavin T fluorescence and proteinase K resistance. Our results show that shaking causes the formation of β-sheet rich oligomers with a population distribution ranging from octamers to dodecamers and that further shaking causes a transition to β-sheet fibrils. In addition, we show that shaking-induced conversion occurs for a wide range of full-length and truncated constructs of mouse, hamster and cervid prion proteins. We propose that this method of conversion provides a robust, reproducible and easily accessible model for scrapie-like amyloid formation, allowing the generation of milligram quantities of physiologically stable β-sheet rich oligomers and fibrils. These results may also have interesting implications regarding our understanding of prion conversion and propagation both within the brain and via techniques such as protein misfolding cyclic amplification (PMCA) and quaking induced conversion (QuIC). PMID

  7. A prolonged chronological lifespan is an unexpected benefit of the [PSI+] prion in yeast.

    PubMed

    Wang, Kai; Melki, Ronald; Kabani, Mehdi

    2017-01-01

    Self-replicating 'proteinaceous infectious particles' or prions are responsible for complex heritable traits in the yeast Saccharomyces cerevisiae. Our current understanding of the biology of yeast prions stems from studies mostly done in the context of actively dividing cells in optimal laboratory growth conditions. Evidence suggest that fungal prions exist in the wild where most cells are in a non-dividing quiescent state, because of imperfect growth conditions, scarcity of nutrients and competition. We know little about the faithful transmission of yeast prions in such conditions and their physiological consequences throughout the lifespan of yeast cells. We addressed this issue for the [PSI+] prion that results from the self-assembly of the translation release factor Sup35p into insoluble fibrillar aggregates. [PSI+] leads to increased nonsense suppression and confers phenotypic plasticity in response to environmental fluctuations. Here, we report that while [PSI+] had little to no effect on growth per se, it dramatically improved the survival of yeast cells in stationary phase. Remarkably, prolonged chronological lifespan persisted even after [PSI+] was cured from the cells, suggesting that prions may facilitate the acquisition of complex new traits. Such an important selective advantage may contribute to the evolutionary conservation of the prion-forming ability of Sup35p orthologues in distantly related yeast species.

  8. Concentration-dependent Cu(II) binding to prion protein

    NASA Astrophysics Data System (ADS)

    Hodak, Miroslav; Lu, Wenchang; Bernholc, Jerry

    2008-03-01

    The prion protein plays a causative role in several neurodegenerative diseases, including mad cow disease in cattle and Creutzfeldt-Jakob disease in humans. The normal function of the prion protein is unknown, but it has been linked to its ability to bind copper ions. Experimental evidence suggests that copper can be bound in three distinct modes depending on its concentration, but only one of those binding modes has been fully characterized experimentally. Using a newly developed hybrid DFT/DFT method [1], which combines Kohn-Sham DFT with orbital-free DFT, we have examined all the binding modes and obtained their detailed binding geometries and copper ion binding energies. Our results also provide explanation for experiments, which have found that when the copper concentration increases the copper binding mode changes, surprisingly, from a stronger to a weaker one. Overall, our results indicate that prion protein can function as a copper buffer. 1. Hodak, Lu, Bernholc, JCP, in press.

  9. A novel and rapid method for obtaining high titre intact prion strains from mammalian brain.

    PubMed

    Wenborn, Adam; Terry, Cassandra; Gros, Nathalie; Joiner, Susan; D'Castro, Laura; Panico, Silvia; Sells, Jessica; Cronier, Sabrina; Linehan, Jacqueline M; Brandner, Sebastian; Saibil, Helen R; Collinge, John; Wadsworth, Jonathan D F

    2015-05-07

    Mammalian prions exist as multiple strains which produce characteristic and highly reproducible phenotypes in defined hosts. How this strain diversity is encoded by a protein-only agent remains one of the most interesting and challenging questions in biology with wide relevance to understanding other diseases involving the aggregation or polymerisation of misfolded host proteins. Progress in understanding mammalian prion strains has however been severely limited by the complexity and variability of the methods used for their isolation from infected tissue and no high resolution structures have yet been reported. Using high-throughput cell-based prion bioassay to re-examine prion purification from first principles we now report the isolation of prion strains to exceptional levels of purity from small quantities of infected brain and demonstrate faithful retention of biological and biochemical strain properties. The method's effectiveness and simplicity should facilitate its wide application and expedite structural studies of prions.

  10. The first report of prion-related protein gene (PRNT) polymorphisms in goat.

    PubMed

    Kim, Yong-Chan; Jeong, Byung-Hoon

    2017-06-01

    Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.

  11. Tau prions from Alzheimer’s disease and chronic traumatic encephalopathy patients propagate in cultured cells

    PubMed Central

    Woerman, Amanda L.; Aoyagi, Atsushi; Patel, Smita; Kazmi, Sabeen A.; Lobach, Iryna; Grinberg, Lea T.; McKee, Ann C.; Seeley, William W.; Olson, Steven H.; Prusiner, Stanley B.

    2016-01-01

    Tau prions are thought to aggregate in the central nervous system, resulting in neurodegeneration. Among the tauopathies, Alzheimer’s disease (AD) is the most common, whereas argyrophilic grain disease (AGD), corticobasal degeneration (CBD), chronic traumatic encephalopathy (CTE), Pick’s disease (PiD), and progressive supranuclear palsy (PSP) are less prevalent. Brain extracts from deceased individuals with PiD, a neurodegenerative disorder characterized by three-repeat (3R) tau prions, were used to infect HEK293T cells expressing 3R tau fused to yellow fluorescent protein (YFP). Extracts from AGD, CBD, and PSP patient samples, which contain four-repeat (4R) tau prions, were transmitted to HEK293 cells expressing 4R tau fused to YFP. These studies demonstrated that prion propagation in HEK cells requires isoform pairing between the infecting prion and the recipient substrate. Interestingly, tau aggregates in AD and CTE, containing both 3R and 4R isoforms, were unable to robustly infect either 3R- or 4R-expressing cells. However, AD and CTE prions were able to replicate in HEK293T cells expressing both 3R and 4R tau. Unexpectedly, increasing the level of 4R isoform expression alone supported the propagation of both AD and CTE prions. These results allowed us to determine the levels of tau prions in AD and CTE brain extracts. PMID:27911827

  12. Extensive Diversity of Prion Strains Is Defined by Differential Chaperone Interactions and Distinct Amyloidogenic Regions

    PubMed Central

    Stein, Kevin C.; True, Heather L.

    2014-01-01

    Amyloidogenic proteins associated with a variety of unrelated diseases are typically capable of forming several distinct self-templating conformers. In prion diseases, these different structures, called prion strains (or variants), confer dramatic variation in disease pathology and transmission. Aggregate stability has been found to be a key determinant of the diverse pathological consequences of different prion strains. Yet, it remains largely unclear what other factors might account for the widespread phenotypic variation seen with aggregation-prone proteins. Here, we examined a set of yeast prion variants of the [RNQ+] prion that differ in their ability to induce the formation of another yeast prion called [PSI+]. Remarkably, we found that the [RNQ+] variants require different, non-contiguous regions of the Rnq1 protein for both prion propagation and [PSI+] induction. This included regions outside of the canonical prion-forming domain of Rnq1. Remarkably, such differences did not result in variation in aggregate stability. Our analysis also revealed a striking difference in the ability of these [RNQ+] variants to interact with the chaperone Sis1. Thus, our work shows that the differential influence of various amyloidogenic regions and interactions with host cofactors are critical determinants of the phenotypic consequences of distinct aggregate structures. This helps reveal the complex interdependent factors that influence how a particular amyloid structure may dictate disease pathology and progression. PMID:24811344

  13. A common bacterial metabolite elicits prion-based bypass of glucose repression

    PubMed Central

    Garcia, David M; Dietrich, David; Clardy, Jon; Jarosz, Daniel F

    2016-01-01

    Robust preference for fermentative glucose metabolism has motivated domestication of the budding yeast Saccharomyces cerevisiae. This program can be circumvented by a protein-based genetic element, the [GAR+] prion, permitting simultaneous metabolism of glucose and other carbon sources. Diverse bacteria can elicit yeast cells to acquire [GAR+], although the molecular details of this interaction remain unknown. Here we identify the common bacterial metabolite lactic acid as a strong [GAR+] inducer. Transient exposure to lactic acid caused yeast cells to heritably circumvent glucose repression. This trait had the defining genetic properties of [GAR+], and did not require utilization of lactic acid as a carbon source. Lactic acid also induced [GAR+]-like epigenetic states in fungi that diverged from S. cerevisiae ~200 million years ago, and in which glucose repression evolved independently. To our knowledge, this is the first study to uncover a bacterial metabolite with the capacity to potently induce a prion. DOI: http://dx.doi.org/10.7554/eLife.17978.001 PMID:27906649

  14. Prion protein degradation by lichens of the genus Cladonia

    USGS Publications Warehouse

    Bennett, James P.; Rodriguez, Cynthia M.; Johnson, Christopher J.

    2012-01-01

    It has recently been discovered that lichens contain a serine protease capable of degrading the pathogenic prion protein, the etiological agent of prion diseases such as sheep scrapie and cervid chronic wasting disease. Limited methods are available to degrade or inactivate prion disease agents, especially in the environment, and lichens or their serine protease could prove important for management of these diseases. Scant information is available regarding the presence or absence of the protease responsible for degrading prion protein (PrP) in lichen species and, in this study, we tested the hypothesis that PrP degradation activity in lichens is phylogenetically-based by testing 44 species of Cladonia lichens, a genus for which a significant portion of the phylogeny is well established. We categorized PrP degradation activity among the 44 species (high, moderate, low or none) and found that activity in Cladonia species did not correspond with phylogenetic position of the species. Degradation of PrP did correspond, however, with three classical taxonomic characters within the genus: species with brown apothecia, no usnic acid, and the presence of a cortex. Of the 44 species studied, 18 (41%) had either high or moderate PrP degradation activity, suggesting the protease may be frequent in this genus of lichens.

  15. A novel and rapid method for obtaining high titre intact prion strains from mammalian brain

    PubMed Central

    Wenborn, Adam; Terry, Cassandra; Gros, Nathalie; Joiner, Susan; D’Castro, Laura; Panico, Silvia; Sells, Jessica; Cronier, Sabrina; Linehan, Jacqueline M.; Brandner, Sebastian; Saibil, Helen R.; Collinge, John; Wadsworth, Jonathan D. F.

    2015-01-01

    Mammalian prions exist as multiple strains which produce characteristic and highly reproducible phenotypes in defined hosts. How this strain diversity is encoded by a protein-only agent remains one of the most interesting and challenging questions in biology with wide relevance to understanding other diseases involving the aggregation or polymerisation of misfolded host proteins. Progress in understanding mammalian prion strains has however been severely limited by the complexity and variability of the methods used for their isolation from infected tissue and no high resolution structures have yet been reported. Using high-throughput cell-based prion bioassay to re-examine prion purification from first principles we now report the isolation of prion strains to exceptional levels of purity from small quantities of infected brain and demonstrate faithful retention of biological and biochemical strain properties. The method’s effectiveness and simplicity should facilitate its wide application and expedite structural studies of prions. PMID:25950908

  16. Methods and Protocols for Developing Prion Vaccines.

    PubMed

    Marciniuk, Kristen; Taschuk, Ryan; Napper, Scott

    2016-01-01

    Prion diseases denote a distinct form of infectivity that is based in the misfolding of a self-protein (PrP(C)) into a pathological, infectious conformation (PrP(Sc)). Efforts to develop vaccines for prion diseases have been complicated by the potential dangers that are associated with induction of immune responses against a self-protein. As a consequence, there is considerable appeal for vaccines that specifically target the misfolded prion conformation. Such conformation-specific immunotherapy is made possible through the identification of vaccine targets (epitopes) that are exclusively presented as a consequence of misfolding. An immune response directed against these targets, termed disease-specific epitopes (DSEs), has the potential to spare the function of the native form of the protein while clearing, or neutralizing, the infectious isomer. Although identification of DSEs represents a critical first step in the induction of conformation-specific immune responses, substantial efforts are required to translate these targets into functional vaccines. Due to the poor immunogenicity that is inherent to self-proteins, and that is often associated with short peptides, substantial efforts are required to overcome tolerance-to-self and maximize the resultant immune response following DSE-based immunization. This often includes optimization of target sequences in terms of immunogenicity and development of effective formulation and delivery strategies for the associated peptides. Further, these vaccines must satisfy additional criteria from perspectives of specificity (PrP(C) vs. PrP(Sc)) and safety (antibody-induced template-driven misfolding of PrP(C)). The emphasis of this report is on the steps required to translate DSEs into prion vaccines and subsequent evaluation of the resulting immune responses.

  17. Metagenomic characterization of the virome associated with bovine respiratory disease in feedlot cattle identified novel viruses and suggests an etiologic role for influenza D virus.

    PubMed

    Mitra, Namita; Cernicchiaro, Natalia; Torres, Siddartha; Li, Feng; Hause, Ben M

    2016-08-01

    Bovine respiratory disease (BRD) is the most costly disease affecting the cattle industry. The pathogenesis of BRD is complex and includes contributions from microbial pathogens as well as host, environmental and animal management factors. In this study, we utilized viral metagenomic sequencing to explore the virome of nasal swab samples obtained from feedlot cattle with acute BRD and asymptomatic pen-mates at six and four feedlots in Mexico and the USA, respectively, in April-October 2015. Twenty-one viruses were detected, with bovine rhinitis A (52.7 %) and B (23.7 %) virus, and bovine coronavirus (24.7 %) being the most commonly identified. The emerging influenza D virus (IDV) tended to be significantly associated (P=0.134; odds ratio=2.94) with disease, whereas viruses commonly associated with BRD such as bovine viral diarrhea virus, bovine herpesvirus 1, bovine respiratory syncytial virus and bovine parainfluenza 3 virus were detected less frequently. The detection of IDV was further confirmed using a real-time PCR assay. Nasal swabs from symptomatic animals had significantly more IDV RNA than those collected from healthy animals (P=0.04). In addition to known viruses, new genotypes of bovine rhinitis B virus and enterovirus E were identified and a newly proposed species of bocaparvovirus, Ungulate bocaparvovirus 6, was characterized. Ungulate tetraparvovirus 1 was also detected for the first time in North America to our knowledge. These results illustrate the complexity of the virome associated with BRD and highlight the need for further research into the contribution of other viruses to BRD pathogenesis.

  18. 77 FR 29914 - Bovine Spongiform Encephalopathy; Importation of Bovines and Bovine Products

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-21

    ... Spongiform Encephalopathy; Importation of Bovines and Bovine Products AGENCY: Animal and Plant Health... derived from bovines with regard to bovine spongiform encephalopathy. This action will allow interested... importation of live bovines and products derived from bovines with regard to bovine spongiform encephalopathy...

  19. On the kinetics of infection by pathogenic prion protein molecules

    NASA Astrophysics Data System (ADS)

    Durup, Jean

    1997-03-01

    Literature data on the transmission of spongiform encephalopathies between mammal species point to the importance of methionine residuies in species barriers. This in turn favours the assumption of an oligomerization of identical metastable pathogenic prion protein molecules as the rate-determining step in those diseases. Published experimental data on the analogous case of yeast prion proteins closely agree with the proposed scheme.

  20. Infectivity-associated PrP(Sc) and disease duration-associated PrP(Sc) of mouse BSE prions.

    PubMed

    Miyazawa, Kohtaro; Okada, Hiroyuki; Masujin, Kentaro; Iwamaru, Yoshifumi; Yokoyama, Takashi

    2015-01-01

    Disease-related prion protein (PrP(Sc)), which is a structural isoform of the host-encoded cellular prion protein, is thought to be a causative agent of transmissible spongiform encephalopathies. However, the specific role of PrP(Sc) in prion pathogenesis and its relationship to infectivity remain controversial. A time-course study of prion-affected mice was conducted, which showed that the prion infectivity was not simply proportional to the amount of PrP(Sc) in the brain. Centrifugation (20,000 ×g) of the brain homogenate showed that most of the PrP(Sc) was precipitated into the pellet, and the supernatant contained only a slight amount of PrP(Sc). Interestingly, mice inoculated with the obtained supernatant showed incubation periods that were approximately 15 d longer than those of mice inoculated with the crude homogenate even though both inocula contained almost the same infectivity. Our results suggest that a small population of fine PrP(Sc) may be responsible for prion infectivity and that large, aggregated PrP(Sc) may contribute to determining prion disease duration.

  1. Bovine spongiform encephalopathy: the effect of oral exposure dose on attack rate and incubation period in cattle - an update.

    PubMed

    Konold, Timm; Arnold, Mark E; Austin, Anthony R; Cawthraw, Saira; Hawkins, Steve A C; Stack, Michael J; Simmons, Marion M; Sayers, A Robin; Dawson, Michael; Wilesmith, John W; Wells, Gerald A H

    2012-12-05

    To provide information on dose-response and aid in modelling the exposure dynamics of the BSE epidemic in the United Kingdom groups of cattle were exposed orally to a range of different doses of brainstem homogenate of known infectious titre from clinical cases of classical bovine spongiform encephalopathy (BSE). Interim data from this study was published in 2007. This communication documents additional BSE cases, which occurred subsequently, examines possible influence of the bovine prion protein gene on disease incidence and revises estimates of effective oral exposure. Following interim published results, two further cattle, one dosed with 100 mg and culled at 127 months post exposure and the other dosed with 10 mg and culled at 110 months post exposure, developed BSE. Both had a similar pathological phenotype to previous cases. Based on attack rate and incubation period distribution according to dose, the dose estimate at which 50% of confirmed cases would be clinically affected was revised to 0.15 g of the brain homogenate used in the experiment, with a 95% confidence interval of 0.03-0.79 g. Neither the full open reading frame nor the promoter region of the prion protein gene of dosed cattle appeared to influence susceptibility to BSE, but this may be due to the sample size. Oral exposure of cattle to a large range of doses of a BSE brainstem homogenate produced disease in all dose groups. The pathological presentation resembled natural disease. The attack rate and incubation period were dependent on the dose.

  2. Prion subcellular fractionation reveals infectivity spectrum, with a high titre-low PrPres level disparity

    PubMed Central

    2012-01-01

    Background Prion disease transmission and pathogenesis are linked to misfolded, typically protease resistant (PrPres) conformers of the normal cellular prion protein (PrPC), with the former posited to be the principal constituent of the infectious 'prion'. Unexplained discrepancies observed between detectable PrPres and infectivity levels exemplify the complexity in deciphering the exact biophysical nature of prions and those host cell factors, if any, which contribute to transmission efficiency. In order to improve our understanding of these important issues, this study utilized a bioassay validated cell culture model of prion infection to investigate discordance between PrPres levels and infectivity titres at a subcellular resolution. Findings Subcellular fractions enriched in lipid rafts or endoplasmic reticulum/mitochondrial marker proteins were equally highly efficient at prion transmission, despite lipid raft fractions containing up to eight times the levels of detectable PrPres. Brain homogenate infectivity was not differentially enhanced by subcellular fraction-specific co-factors, and proteinase K pre-treatment of selected fractions modestly, but equally reduced infectivity. Only lipid raft associated infectivity was enhanced by sonication. Conclusions This study authenticates a subcellular disparity in PrPres and infectivity levels, and eliminates simultaneous divergence of prion strains as the explanation for this phenomenon. On balance, the results align best with the concept that transmission efficiency is influenced more by intrinsic characteristics of the infectious prion, rather than cellular microenvironment conditions or absolute PrPres levels. PMID:22534096

  3. Pathogenic prion protein is degraded by a manganese oxide mineral found in soils

    USGS Publications Warehouse

    Russo, F.; Johnson, C.J.; McKenzie, D.; Aiken, Judd M.; Pedersen, J.A.

    2009-01-01

    Prions, the aetiological agents of transmissible spongiform encephalopathies, exhibit extreme resistance to degradation. Soil can retain prion infectivity in the environment for years. Reactive soil components may, however, contribute to the inactivation of prions in soil. Members of the birnessite family of manganese oxides (MnO2) rank among the strongest natural oxidants in soils. Here, we report the abiotic degradation of pathogenic prion protein (PrPTSE) by a synthetic analogue of naturally occurring birnessite minerals. Aqueous MnO2 suspensions degraded the PrPTSE as evidenced by decreased immunoreactivity and diminished ability to seed protein misfolding cyclic amplification reactions. Birnessite-mediated PrPTSE degradation increased as a solution's pH decreased, consistent with the pH-dependence of the redox potential of MnO2. Exposure to 5.6 mg MnO2 ml-1 (PrPTSE:MnO2=1 : 110) decreased PrPTSE levels by ???4 orders of magnitude. Manganese oxides may contribute to prion degradation in soil environments rich in these minerals. ?? 2009 SGM.

  4. Humic substances interfere with detection of pathogenic prion protein

    USGS Publications Warehouse

    Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.

    2014-01-01

    Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.

  5. Amino acid sequence of the Amur tiger prion protein.

    PubMed

    Wu, Changde; Pang, Wanyong; Zhao, Deming

    2006-10-01

    Prion diseases are fatal neurodegenerative disorders in human and animal associated with conformational conversion of a cellular prion protein (PrP(C)) into the pathologic isoform (PrP(Sc)). Various data indicate that the polymorphisms within the open reading frame (ORF) of PrP are associated with the susceptibility and control the species barrier in prion diseases. In the present study, partial Prnp from 25 Amur tigers (tPrnp) were cloned and screened for polymorphisms. Four single nucleotide polymorphisms (T423C, A501G, C511A, A610G) were found; the C511A and A610G nucleotide substitutions resulted in the amino acid changes Lysine171Glutamine and Alanine204Threoine, respectively. The tPrnp amino acid sequence is similar to house cat (Felis catus ) and sheep, but differs significantly from other two cat Prnp sequences that were previously deposited in GenBank.

  6. The mechanisms of humic substances self-assembly with biological molecules: The case study of the prion protein

    PubMed Central

    Nepravishta, Ridvan; Mandaliti, Walter; Melino, Sonia; Margon, Alja; Scaini, Denis; Mazzei, Pierluigi; Piccolo, Alessandro; Legname, Giuseppe; Paci, Maurizio; Leita, Liviana

    2017-01-01

    Humic substances (HS) are the largest constituent of soil organic matter and are considered as a key component of the terrestrial ecosystem. HS may facilitate the transport of organic and inorganic molecules, as well as the sorption interactions with environmentally relevant proteins such as prions. Prions enter the environment through shedding from live hosts, facilitating a sustained incidence of animal prion diseases such as Chronic Wasting Disease and scrapie in cervid and ovine populations, respectively. Changes in prion structure upon environmental exposure may be significant as they can affect prion infectivity and disease pathology. Despite its relevance, the mechanisms of prion interaction with HS are still not completely understood. The goal of this work is to advance a structural-level picture of the encapsulation of recombinant, non-infectious, prion protein (PrP) into different natural HS. We observed that PrP precipitation upon addition of HS is mainly driven by a mechanism of “salting-out” whereby PrP molecules are rapidly removed from the solution and aggregate in insoluble adducts with humic molecules. Importantly, this process does not alter the protein folding since insoluble PrP retains its α-helical content when in complex with HS. The observed ability of HS to promote PrP insolubilization without altering its secondary structure may have potential relevance in the context of “prion ecology”. These results suggest that soil organic matter interacts with prions possibly without altering the protein structures. This may facilitate prions preservation from biotic and abiotic degradation leading to their accumulation in the environment. PMID:29161325

  7. Evolutionary Descent of Prion Genes from the ZIP Family of Metal Ion Transporters

    PubMed Central

    Schmitt-Ulms, Gerold; Ehsani, Sepehr; Watts, Joel C.; Westaway, David; Wille, Holger

    2009-01-01

    In the more than twenty years since its discovery, both the phylogenetic origin and cellular function of the prion protein (PrP) have remained enigmatic. Insights into a possible function of PrP may be obtained through the characterization of its molecular neighborhood in cells. Quantitative interactome data demonstrated the spatial proximity of two metal ion transporters of the ZIP family, ZIP6 and ZIP10, to mammalian prion proteins in vivo. A subsequent bioinformatic analysis revealed the unexpected presence of a PrP-like amino acid sequence within the N-terminal, extracellular domain of a distinct sub-branch of the ZIP protein family that includes ZIP5, ZIP6 and ZIP10. Additional structural threading and orthologous sequence alignment analyses argued that the prion gene family is phylogenetically derived from a ZIP-like ancestral molecule. The level of sequence homology and the presence of prion protein genes in most chordate species place the split from the ZIP-like ancestor gene at the base of the chordate lineage. This relationship explains structural and functional features found within mammalian prion proteins as elements of an ancient involvement in the transmembrane transport of divalent cations. The phylogenetic and spatial connection to ZIP proteins is expected to open new avenues of research to elucidate the biology of the prion protein in health and disease. PMID:19784368

  8. Signal Transduction by a Fungal NOD-Like Receptor Based on Propagation of a Prion Amyloid Fold

    PubMed Central

    Daskalov, Asen; Habenstein, Birgit; Martinez, Denis; Debets, Alfons J. M.; Sabaté, Raimon; Loquet, Antoine; Saupe, Sven J.

    2015-01-01

    In the fungus Podospora anserina, the [Het-s] prion induces programmed cell death by activating the HET-S pore-forming protein. The HET-s β-solenoid prion fold serves as a template for converting the HET-S prion-forming domain into the same fold. This conversion, in turn, activates the HET-S pore-forming domain. The gene immediately adjacent to het-S encodes NWD2, a Nod-like receptor (NLR) with an N-terminal motif similar to the elementary repeat unit of the β-solenoid fold. NLRs are immune receptors controlling cell death and host defense processes in animals, plants and fungi. We have proposed that, analogously to [Het-s], NWD2 can activate the HET-S pore-forming protein by converting its prion-forming region into the β-solenoid fold. Here, we analyze the ability of NWD2 to induce formation of the β-solenoid prion fold. We show that artificial NWD2 variants induce formation of the [Het-s] prion, specifically in presence of their cognate ligands. The N-terminal motif is responsible for this prion induction, and mutations predicted to affect the β-solenoid fold abolish templating activity. In vitro, the N-terminal motif assembles into infectious prion amyloids that display a structure resembling the β-solenoid fold. In vivo, the assembled form of the NWD2 N-terminal region activates the HET-S pore-forming protein. This study documenting the role of the β-solenoid fold in fungal NLR function further highlights the general importance of amyloid and prion-like signaling in immunity-related cell fate pathways. PMID:25671553

  9. Prions, amyloids, and RNA: Pieces of a puzzle.

    PubMed

    Nizhnikov, Anton A; Antonets, Kirill S; Bondarev, Stanislav A; Inge-Vechtomov, Sergey G; Derkatch, Irina L

    2016-05-03

    Amyloids are protein aggregates consisting of fibrils rich in β-sheets. Growth of amyloid fibrils occurs by the addition of protein molecules to the tip of an aggregate with a concurrent change of a conformation. Thus, amyloids are self-propagating protein conformations. In certain cases these conformations are transmissible / infectious; they are known as prions. Initially, amyloids were discovered as pathological extracellular deposits occurring in different tissues and organs. To date, amyloids and prions have been associated with over 30 incurable diseases in humans and animals. However, a number of recent studies demonstrate that amyloids are also functionally involved in a variety of biological processes, from biofilm formation by bacteria, to long-term memory in animals. Interestingly, amyloid-forming proteins are highly overrepresented among cellular factors engaged in all stages of mRNA life cycle: from transcription and translation, to storage and degradation. Here we review rapidly accumulating data on functional and pathogenic amyloids associated with mRNA processing, and discuss possible significance of prion and amyloid networks in the modulation of key cellular functions.

  10. Minimalist Prion-Inspired Polar Self-Assembling Peptides.

    PubMed

    Díaz-Caballero, Marta; Navarro, Susanna; Fuentes, Isabel; Teixidor, Francesc; Ventura, Salvador

    2018-06-04

    Nature provides copious examples of self-assembling supramolecular nanofibers. Among them, amyloid structures have found amazing applications as advanced materials in fields such as biomedicine and nanotechnology. Prions are a singular subset of proteins able to switch between a soluble conformation and an amyloid state. The ability to transit between these two conformations is encoded in the so-called prion domains (PrDs), which are long and disordered regions of low complexity, enriched in polar and uncharged amino acids such as Gln, Asn, Tyr, Ser, and Gly. The polar nature of PrDs results in slow amyloid formation, which allows kinetic control of fiber assembly. This approach has been exploited for fabrication of multifunctional materials because in contrast to most amyloids, PrDs lack hydrophobic stretches that can nucleate their aggregation, their assembly depends on the establishment of a large number of weak interactions along the complete domain. The length and low complexity of PrDs make their chemical synthesis for applied purposed hardly affordable. Here, we designed four minimalist polar binary patterned peptides inspired in PrDs, which include the [Q/N/G/S]-Y-[Q/N/G/S] motif frequently observed in these domains: NYNYNYN, QYQYQYQ, SYSYSYS, and GYGYGYG. Despite their small size, they all recapitulate the properties of full-length PrDs, self-assembling into nontoxic amyloids under physiological conditions. Thus, they constitute small building blocks for the construction of tailored prion-inspired nanostructures. We exploited Tyr residues in these peptides to generate highly stable dityrosine cross-linked assemblies for the immobilization of metal nanoparticles in the fibrils surface and to develop an electrocatalytic amyloid scaffold. Moreover, we show that the shorter and more polar NYNNYN, QYQQYQ, and SYSSYS hexapeptides also self-assemble into amyloid-like structures, consistent with the presence of these tandem motifs in human prion-like proteins.

  11. Mitigation of Prion Infectivity and Conversion Capacity by a Simulated Natural Process—Repeated Cycles of Drying and Wetting

    PubMed Central

    Yuan, Qi; Eckland, Thomas; Telling, Glenn; Bartz, Jason; Bartelt-Hunt, Shannon

    2015-01-01

    Prions enter the environment from infected hosts, bind to a wide range of soil and soil minerals, and remain highly infectious. Environmental sources of prions almost certainly contribute to the transmission of chronic wasting disease in cervids and scrapie in sheep and goats. While much is known about the introduction of prions into the environment and their interaction with soil, relatively little is known about prion degradation and inactivation by natural environmental processes. In this study, we examined the effect of repeated cycles of drying and wetting on prion fitness and determined that 10 cycles of repeated drying and wetting could reduce PrPSc abundance, PMCA amplification efficiency and extend the incubation period of disease. Importantly, prions bound to soil were more susceptible to inactivation by repeated cycles of drying and wetting compared to unbound prions, a result which may be due to conformational changes in soil-bound PrPSc or consolidation of the bonding between PrPSc and soil. This novel finding demonstrates that naturally-occurring environmental process can degrade prions. PMID:25665187

  12. A single amino acid (Asp159) from the dog prion protein suppresses the toxicity of the mouse prion protein in Drosophila

    PubMed Central

    Sanchez-Garcia, J; Jensen, K; Zhang, Y; Rincon-Limas, DE; Fernandez-Funez, P

    2016-01-01

    Misfolding of the prion protein (PrP) is the key step in the transmission of spongiform pathologies in humans and several animals. Although PrP is highly conserved in mammals, a few changes in the sequence of endogenous PrP are proposed to confer protection to dogs, which were highly exposed to prion during the mad-cow epidemics. D159 is a unique amino acid found in PrP from dogs and other canines that was shown to alter surface charge, but its functional relevance has never been tested in vivo. Here, we show in transgenic Drosophila that introducing the N159D substitution on mouse PrP decreases its turnover. Additionally, mouse PrP-N159D demonstrates no toxicity and accumulates no pathogenic conformations, suggesting that a single D159 substitution is sufficient to prevent PrP conformational change and pathogenesis. Understanding the mechanisms mediating the protective activity of D159 is likely to lessen the burden of prion diseases in humans and domestic animals. PMID:27477054

  13. Whole genome association study identifies regions of the bovine genome and biological pathways involved in carcass trait performance in Holstein-Friesian cattle.

    PubMed

    Doran, Anthony G; Berry, Donagh P; Creevey, Christopher J

    2014-10-01

    Four traits related to carcass performance have been identified as economically important in beef production: carcass weight, carcass fat, carcass conformation of progeny and cull cow carcass weight. Although Holstein-Friesian cattle are primarily utilized for milk production, they are also an important source of meat for beef production and export. Because of this, there is great interest in understanding the underlying genomic structure influencing these traits. Several genome-wide association studies have identified regions of the bovine genome associated with growth or carcass traits, however, little is known about the mechanisms or underlying biological pathways involved. This study aims to detect regions of the bovine genome associated with carcass performance traits (employing a panel of 54,001 SNPs) using measures of genetic merit (as predicted transmitting abilities) for 5,705 Irish Holstein-Friesian animals. Candidate genes and biological pathways were then identified for each trait under investigation. Following adjustment for false discovery (q-value < 0.05), 479 quantitative trait loci (QTL) were associated with at least one of the four carcass traits using a single SNP regression approach. Using a Bayesian approach, 46 QTL were associated (posterior probability > 0.5) with at least one of the four traits. In total, 557 unique bovine genes, which mapped to 426 human orthologs, were within 500kbs of QTL found associated with a trait using the Bayesian approach. Using this information, 24 significantly over-represented pathways were identified across all traits. The most significantly over-represented biological pathway was the peroxisome proliferator-activated receptor (PPAR) signaling pathway. A large number of genomic regions putatively associated with bovine carcass traits were detected using two different statistical approaches. Notably, several significant associations were detected in close proximity to genes with a known role in animal growth

  14. Hsp104 Overexpression Cures Saccharomyces cerevisiae [PSI+] by Causing Dissolution of the Prion Seeds

    PubMed Central

    Park, Yang-Nim; Zhao, Xiaohong; Yim, Yang-In; Todor, Horia; Ellerbrock, Robyn; Reidy, Michael; Eisenberg, Evan; Masison, Daniel C.

    2014-01-01

    The [PSI+] yeast prion is formed when Sup35 misfolds into amyloid aggregates. [PSI+], like other yeast prions, is dependent on the molecular chaperone Hsp104, which severs the prion seeds so that they pass on as the yeast cells divide. Surprisingly, however, overexpression of Hsp104 also cures [PSI+]. Several models have been proposed to explain this effect: inhibition of severing, asymmetric segregation of the seeds between mother and daughter cells, and dissolution of the prion seeds. First, we found that neither the kinetics of curing nor the heterogeneity in the distribution of the green fluorescent protein (GFP)-labeled Sup35 foci in partially cured yeast cells is compatible with Hsp104 overexpression curing [PSI+] by inhibiting severing. Second, we ruled out the asymmetric segregation model by showing that the extent of curing was essentially the same in mother and daughter cells and that the fluorescent foci did not distribute asymmetrically, but rather, there was marked loss of foci in both mother and daughter cells. These results suggest that Hsp104 overexpression cures [PSI+] by dissolution of the prion seeds in a two-step process. First, trimming of the prion seeds by Hsp104 reduces their size, and second, their amyloid core is eliminated, most likely by proteolysis. PMID:24632242

  15. Hsp104 overexpression cures Saccharomyces cerevisiae [PSI+] by causing dissolution of the prion seeds.

    PubMed

    Park, Yang-Nim; Zhao, Xiaohong; Yim, Yang-In; Todor, Horia; Ellerbrock, Robyn; Reidy, Michael; Eisenberg, Evan; Masison, Daniel C; Greene, Lois E

    2014-05-01

    The [PSI(+)] yeast prion is formed when Sup35 misfolds into amyloid aggregates. [PSI(+)], like other yeast prions, is dependent on the molecular chaperone Hsp104, which severs the prion seeds so that they pass on as the yeast cells divide. Surprisingly, however, overexpression of Hsp104 also cures [PSI(+)]. Several models have been proposed to explain this effect: inhibition of severing, asymmetric segregation of the seeds between mother and daughter cells, and dissolution of the prion seeds. First, we found that neither the kinetics of curing nor the heterogeneity in the distribution of the green fluorescent protein (GFP)-labeled Sup35 foci in partially cured yeast cells is compatible with Hsp104 overexpression curing [PSI(+)] by inhibiting severing. Second, we ruled out the asymmetric segregation model by showing that the extent of curing was essentially the same in mother and daughter cells and that the fluorescent foci did not distribute asymmetrically, but rather, there was marked loss of foci in both mother and daughter cells. These results suggest that Hsp104 overexpression cures [PSI(+)] by dissolution of the prion seeds in a two-step process. First, trimming of the prion seeds by Hsp104 reduces their size, and second, their amyloid core is eliminated, most likely by proteolysis.

  16. Distinct prion-like strains of amyloid beta implicated in phenotypic diversity of Alzheimer's disease.

    PubMed

    Cohen, Mark; Appleby, Brian; Safar, Jiri G

    2016-01-01

    Vast evidence on human prions demonstrates that variable disease phenotypes, rates of propagation, and targeting of distinct brain structures are determined by unique conformers (strains) of pathogenic prion protein (PrP(Sc)). Recent progress in the development of advanced biophysical tools that inventory structural characteristics of amyloid beta (Aβ) in the brain cortex of phenotypically diverse Alzheimer's disease (AD) patients, revealed unique spectrum of oligomeric particles in the cortex of rapidly progressive cases, implicating these structures in variable rates of propagation in the brain, and in distict disease manifestation. Since only ∼30% of phenotypic diversity of AD can be explained by polymorphisms in risk genes, these and transgenic bioassay data argue that structurally distinct Aβ particles play a major role in the diverse pathogenesis of AD, and may behave as distinct prion-like strains encoding diverse phenotypes. From these observations and our growing understanding of prions, there is a critical need for new strain-specific diagnostic strategies for misfolded proteins causing these elusive disorders. Since targeted drug therapy can induce mutation and evolution of prions into new strains, effective treatments of AD will require drugs that enhance clearance of pathogenic conformers, reduce the precursor protein, or inhibit the conversion of precursors into prion-like states.

  17. Ovine leukocyte profiles do not associate with variation in the prion gene, but are breed-dependent

    USDA-ARS?s Scientific Manuscript database

    Prion genotype in sheep confer resistance to scrapie. In cattle, lymphocyte profile has been found to be associated with prion genotype. Therefore, the aim of this study was to determine if variations in the sheep prion gene were associated with leukocyte populations as measured by complete blood ce...

  18. Determining the relative susceptibility of four prion protein genotypes to atypical scrapie

    USDA-ARS?s Scientific Manuscript database

    Atypical scrapie is a sheep prion (PrPSc) disease whose epidemiology is consistent with a sporadic origin and is associated with specific polymorphisms of the normal cellular prion protein (PrPC). We describe a mass spectrometry-based method of detecting and quantifying the polymorphisms of sheep P...

  19. Inactivation of Template-Directed Misfolding of Infectious Prion Protein by Ozone

    PubMed Central

    Ding, Ning; Price, Luke M.; Braithwaite, Shannon L.; Balachandran, Aru; Belosevic, Miodrag

    2012-01-01

    Misfolded prions (PrPSc) are well known for their resistance to conventional decontamination processes. The potential risk of contamination of the water environment, as a result of disposal of specified risk materials (SRM), has raised public concerns. Ozone is commonly utilized in the water industry for inactivation of microbial contaminants and was tested in this study for its ability to inactivate prions (263K hamster scrapie = PrPSc). Treatment variables included initial ozone dose (7.6 to 25.7 mg/liter), contact time (5 s and 5 min), temperature (4°C and 20°C), and pH (pH 4.4, 6.0, and 8.0). Exposure of dilute suspensions of the infected 263K hamster brain homogenates (IBH) (0.01%) to ozone resulted in the in vitro destruction of the templating properties of PrPSc, as measured by the protein misfolding cyclic amplification (PMCA) assay. The highest levels of prion inactivation (≥4 log10) were observed with ozone doses of 13.0 mg/liter, at pH 4.4 and 20°C, resulting in a CT (the product of residual ozone concentration and contact time) value as low as 0.59 mg · liter−1 min. A comparison of ozone CT requirements among various pathogens suggests that prions are more susceptible to ozone degradation than some model bacteria and protozoa and that ozone treatment may be an effective solution for inactivating prions in water and wastewater. PMID:22138993

  20. STITCHER: Dynamic assembly of likely amyloid and prion β-structures from secondary structure predictions

    PubMed Central

    Bryan, Allen W; O’Donnell, Charles W; Menke, Matthew; Cowen, Lenore J; Lindquist, Susan; Berger, Bonnie

    2012-01-01

    The supersecondary structure of amyloids and prions, proteins of intense clinical and biological interest, are difficult to determine by standard experimental or computational means. In addition, significant conformational heterogeneity is known or suspected to exist in many amyloid fibrils. Previous work has demonstrated that probability-based prediction of discrete β-strand pairs can offer insight into these structures. Here, we devise a system of energetic rules that can be used to dynamically assemble these discrete β-strand pairs into complete amyloid β-structures. The STITCHER algorithm progressively ‘stitches’ strand-pairs into full β-sheets based on a novel free-energy model, incorporating experimentally observed amino-acid side-chain stacking contributions, entropic estimates, and steric restrictions for amyloidal parallel β-sheet construction. A dynamic program computes the top 50 structures and returns both the highest scoring structure and a consensus structure taken by polling this list for common discrete elements. Putative structural heterogeneity can be inferred from sequence regions that compose poorly. Predictions show agreement with experimental models of Alzheimer’s amyloid beta peptide and the Podospora anserina Het-s prion. Predictions of the HET-s homolog HET-S also reflect experimental observations of poor amyloid formation. We put forward predicted structures for the yeast prion Sup35, suggesting N-terminal structural stability enabled by tyrosine ladders, and C-terminal heterogeneity. Predictions for the Rnq1 prion and alpha-synuclein are also given, identifying a similar mix of homogenous and heterogeneous secondary structure elements. STITCHER provides novel insight into the energetic basis of amyloid structure, provides accurate structure predictions, and can help guide future experimental studies. Proteins 2012. © 2011 Wiley Periodicals, Inc. PMID:22095906

  1. STITCHER: Dynamic assembly of likely amyloid and prion β-structures from secondary structure predictions.

    PubMed

    Bryan, Allen W; O'Donnell, Charles W; Menke, Matthew; Cowen, Lenore J; Lindquist, Susan; Berger, Bonnie

    2012-02-01

    The supersecondary structure of amyloids and prions, proteins of intense clinical and biological interest, are difficult to determine by standard experimental or computational means. In addition, significant conformational heterogeneity is known or suspected to exist in many amyloid fibrils. Previous work has demonstrated that probability-based prediction of discrete β-strand pairs can offer insight into these structures. Here, we devise a system of energetic rules that can be used to dynamically assemble these discrete β-strand pairs into complete amyloid β-structures. The STITCHER algorithm progressively 'stitches' strand-pairs into full β-sheets based on a novel free-energy model, incorporating experimentally observed amino-acid side-chain stacking contributions, entropic estimates, and steric restrictions for amyloidal parallel β-sheet construction. A dynamic program computes the top 50 structures and returns both the highest scoring structure and a consensus structure taken by polling this list for common discrete elements. Putative structural heterogeneity can be inferred from sequence regions that compose poorly. Predictions show agreement with experimental models of Alzheimer's amyloid beta peptide and the Podospora anserina Het-s prion. Predictions of the HET-s homolog HET-S also reflect experimental observations of poor amyloid formation. We put forward predicted structures for the yeast prion Sup35, suggesting N-terminal structural stability enabled by tyrosine ladders, and C-terminal heterogeneity. Predictions for the Rnq1 prion and alpha-synuclein are also given, identifying a similar mix of homogenous and heterogeneous secondary structure elements. STITCHER provides novel insight into the energetic basis of amyloid structure, provides accurate structure predictions, and can help guide future experimental studies. Copyright © 2011 Wiley Periodicals, Inc.

  2. Celecoxib Inhibits Prion Protein 90-231-Mediated Pro-inflammatory Responses in Microglial Cells.

    PubMed

    Villa, Valentina; Thellung, Stefano; Corsaro, Alessandro; Novelli, Federica; Tasso, Bruno; Colucci-D'Amato, Luca; Gatta, Elena; Tonelli, Michele; Florio, Tullio

    2016-01-01

    Activation of microglia is a central event in the atypical inflammatory response occurring during prion encephalopathies. We report that the prion protein fragment encompassing amino acids 90-231 (PrP90-231), a model of the neurotoxic activity of the pathogenic prion protein (PrP(Sc)), causes activation of both primary microglia cultures and N9 microglial cells in vitro. This effect was characterized by cell proliferation arrest and induction of a secretory phenotype, releasing prostaglandin E2 (PGE2) and nitric oxide (NO). Conditioned medium from PrP90-231-treated microglia induced in vitro cytotoxicity of A1 mesencephalic neurons, supporting the notion that soluble mediators released by activated microglia contributes to the neurodegeneration during prion diseases. The neuroinflammatory role of COX activity, and its potential targeting for anti-prion therapies, was tested measuring the effects of ketoprofen and celecoxib (preferential inhibitors of COX1 and COX2, respectively) on PrP90-231-induced microglial activation. Celecoxib, but not ketoprofen significantly reverted the growth arrest as well as NO and PGE2 secretion induced by PrP90-231, indicating that PrP90-231 pro-inflammatory response in microglia is mainly dependent on COX2 activation. Taken together, these data outline the importance of microglia in the neurotoxicity occurring during prion diseases and highlight the potentiality of COX2-selective inhibitors to revert microglia as adjunctive pharmacological approach to contrast the neuroinflammation-dependent neurotoxicity.

  3. The Good, the Bad, and the Ugly of Dendritic Cells during Prion Disease

    PubMed Central

    Mabbott, Neil Andrew; Bradford, Barry Matthew

    2015-01-01

    Prions are a unique group of proteinaceous pathogens which cause neurodegenerative disease and can be transmitted by a variety of exposure routes. After peripheral exposure, the accumulation and replication of prions within secondary lymphoid organs are obligatory for their efficient spread from the periphery to the brain where they ultimately cause neurodegeneration and death. Mononuclear phagocytes (MNP) are a heterogeneous population of dendritic cells (DC) and macrophages. These cells are abundant throughout the body and display a diverse range of roles based on their anatomical locations. For example, some MNP are strategically situated to provide a first line of defence against pathogens by phagocytosing and destroying them. Conventional DC are potent antigen presenting cells and migrate via the lymphatics to the draining lymphoid tissue where they present the antigens to lymphocytes. The diverse roles of MNP are also reflected in various ways in which they interact with prions and in doing so impact on disease pathogenesis. Indeed, some studies suggest that prions exploit conventional DC to infect the host. Here we review our current understanding of the influence of MNP in the pathogenesis of the acquired prion diseases with particular emphasis on the role of conventional DC. PMID:26697507

  4. Genetic variation of the prion protein gene (PRNP) in alpaca (Vicugna pacos)

    USDA-ARS?s Scientific Manuscript database

    Transmissible spongiform encephalopathies (TSE) are caused by accumulation of a misfolded form of the prion protein (PrP). The normal cellular isoform of PrP is produced by the prion gene (PRNP) and is highly expressed in the central nervous system. Currently, there is an absence of information rega...

  5. Variably Protease-Sensitive Prionopathy: A New Sporadic Disease of the Prion Protein

    PubMed Central

    Zou, Wen-Quan; Puoti, Gianfranco; Xiao, Xiangzhu; Yuan, Jue; Qing, Liuting; Cali, Ignazio; Shimoji, Miyuki; Langeveld, Jan P. M.; Castellani, Rudy; Notari, Silvio; Crain, Barbara; Schmidt, Robert E.; Geschwind, Michael; DeArmond, Stephen J.; Cairns, Nigel J.; Dickson, Dennis; Honig, Lawrence; Torres, Juan Maria; Mastrianni, James; Capellari, Sabina; Giaccone, Giorgio; Belay, Ermias D.; Schonberger, Lawrence B.; Cohen, Mark; Perry, George; Kong, Qingzhong; Parchi, Piero; Tagliavini, Fabrizio; Gambetti, Pierluigi

    2011-01-01

    Objective The objective of the study is to report 2 new genotypic forms of protease-sensitive prionopathy (PSPr), a novel prion disease described in 2008, in 11 subjects all homozygous for valine at codon 129 of the prion protein (PrP) gene (129VV). The 2 new PSPr forms affect individuals who are either homozygous for methionine (129MM) or heterozygous for methionine/valine (129MV). Methods Fifteen affected subjects with 129MM, 129MV, and 129VV underwent comparative evaluation at the National Prion Disease Pathology Surveillance Center for clinical, histopathologic, immunohistochemical, genotypical, and PrP characteristics. Results Disease duration (between 22 and 45 months) was significantly different in the 129VV and 129MV subjects. Most other phenotypic features along with the PrP electrophoretic profile were similar but distinguishable in the 3 129 genotypes. A major difference laid in the sensitivity to protease digestion of the disease-associated PrP, which was high in 129VV but much lower, or altogether lacking, in 129MV and 129MM. This difference prompted the substitution of the original designation with “variably protease-sensitive prionopathy” (VPSPr). None of the subjects had mutations in the PrP gene coding region. Interpretation Because all 3 129 genotypes are involved, and are associated with distinguishable phenotypes, VPSPr becomes the second sporadic prion protein disease with this feature after Creutzfeldt-Jakob disease, originally reported in 1920. However, the characteristics of the abnormal prion protein suggest that VPSPr is different from typical prion diseases, and perhaps more akin to subtypes of Gerstmann-Sträussler-Scheinker disease. PMID:20695009

  6. Variant Creutzfeldt-Jakob Disease (vCJD)

    MedlinePlus

    ... Compartir Variant Creutzfeldt-Jakob disease (vCJD) is a prion disease that was first described in 1996 in ... that the agent responsible for the outbreak of prion disease in cows, bovine spongiform encephalopathy (BSE or ' ...

  7. [Psychiatric manifestations by prions. A narrative review].

    PubMed

    Carrillo Robles, Daniel; García Maldonado, Gerardo

    2016-01-01

    Prion diseases are a group of rare and rapidly progressive neurodegenerative conditions that may cause neuropsychiatric symptoms. This group of diseases has been described since the 18(th) century, but they were recognized decades later, when it became clear that the humans were affected by infected animals. There was controversy when the problem was attributed to a single protein with infective capacity. The common pathological process is characterized by the conversion of the normal cellular prion protein into an abnormal form. In humans, the illness has been classified as idiopathic, inherited and acquired through exposure to exogenous material containing abnormal prions. The most prominent neurological manifestation of prion diseases is the emergence of a rapidly progressive dementia, mioclonus associated with cerebellar ataxia and also extra pyramidal symptoms. Psychiatric symptoms occur in early stages of the illness and can contribute to timely diagnosis of this syndrome. Psychiatric symptoms have traditionally been grouped in three categories: affective symptoms, impaired motor function and psychotic symptoms. Such events usually occur during the prodromal period prior to the neurological manifestations and consists in the presence of social isolation, onset of delusions, irritability/aggression, visual hallucinations, anxiety and depression, and less frequent first-rank symptoms among others. Definite diagnosis requires post mortem examination. The possibility that a large number of cases may occur in the next years or that many cases have not been considered with this diagnosis is a fact. In our opinion, psychiatrists should be aware of symptoms of this disease. The main objective of this research consisted of assessing the correlation between this disturbance and neuro-psychiatric symptoms and particularly if this psychiatric manifestations integrate a clinical picture suggestive for the diagnosis of these diseases, but firstly reviewed taxonomic

  8. An Enzymatic Treatment of Soil-Bound Prions Effectively Inhibits Replication ▿

    PubMed Central

    Saunders, Samuel E.; Bartz, Jason C.; Vercauteren, Kurt C.; Bartelt-Hunt, Shannon L.

    2011-01-01

    Chronic wasting disease (CWD) and scrapie can be transmitted through indirect environmental routes, possibly via soil, and a practical decontamination strategy for prion-contaminated soil is currently unavailable. In the laboratory, an enzymatic treatment under environmentally relevant conditions (22°C, pH 7.4) can degrade soil-bound PrPSc below the limits of Western blot detection. We developed and used a quantitative serial protein misfolding cyclic amplification (PMCA) protocol to characterize the amplification efficiency of treated soil samples relative to controls of known infectious titer. Our results suggest large (104- to >106-fold) decreases in soil-bound prion infectivity following enzyme treatment, demonstrating that a mild enzymatic treatment could effectively reduce the risk of prion disease transmission via soil or other environmental surfaces. PMID:21571886

  9. Replica Exchange Molecular Dynamics Study of Dimerization in Prion Protein: Multiple Modes of Interaction and Stabilization.

    PubMed

    Chamachi, Neharika G; Chakrabarty, Suman

    2016-08-04

    The pathological forms of prions are known to be a result of misfolding, oligomerization, and aggregation of the cellular prion. While the mechanism of misfolding and aggregation in prions has been widely studied using both experimental and computational tools, the structural and energetic characterization of the dimer form have not garnered as much attention. On one hand dimerization can be the first step toward a nucleation-like pathway to aggregation, whereas on the other hand it may also increase the conformational stability preventing self-aggregation. In this work, we have used extensive all-atom replica exchange molecular dynamics simulations of both monomer and dimer forms of a mouse prion protein to understand the structural, dynamic, and thermodynamic stability of dimeric prion as compared to the monomeric form. We show that prion proteins can dimerize spontaneously being stabilized by hydrophobic interactions as well as intermolecular hydrogen bonding and salt bridge formation. We have computed the conformational free energy landscapes for both monomer and dimer forms to compare the thermodynamic stability and misfolding pathways. We observe large conformational heterogeneity among the various modes of interactions between the monomers and the strong intermolecular interactions may lead to as high as 20% β-content. The hydrophobic regions in helix-2, surrounding coil regions, terminal regions along with the natively present β-sheet region appear to actively participate in prion-prion intermolecular interactions. Dimerization seems to considerably suppress the inherent dynamic instability observed in monomeric prions, particularly because the regions of structural frustration constitute the dimer interface. Further, we demonstrate an interesting reversible coupling between the Q160-G131 interaction (which leads to inhibition of β-sheet extension) and the G131-V161 H-bond formation.

  10. Experimental and Theoretical Insights into the Inhibition Mechanism of Prion Fibrillation by Resveratrol and its Derivatives.

    PubMed

    Li, Lanlan; Zhu, Yongchang; Zhou, Shuangyan; An, Xiaoli; Zhang, Yan; Bai, Qifeng; He, Yong-Xing; Liu, Huanxiang; Yao, Xiaojun

    2017-12-20

    Resveratrol and its derivatives have been shown to display beneficial effects to neurodegenerative diseases. However, the molecular mechanism of resveratrol and its derivatives on prion conformational conversion is poorly understood. In this work, the interaction mechanism between prion and resveratrol as well as its derivatives was investigated using steady-state fluorescence quenching, Thioflavin T binding assay, Western blotting, and molecular dynamics simulation. Protein fluorescence quenching method and Thioflavin T assay revealed that resveratrol and its derivatives could interact with prion and interrupt prion fibril formation. Molecular dynamics simulation results indicated that resveratrol can stabilize the PrP 127-147 peptide mainly through π-π stacking interactions between resveratrol and Tyr128. The hydrogen bonds interactions between resveratrol and the PrP 127-147 peptide could further reduce the flexibility and the propensity to aggregate. The results of this study not only can provide useful information about the interaction mechanism between resveratrol and prion, but also can provide useful clues for further design of new inhibitors inhibiting prion aggregation.

  11. Disparate modes of evolution shaped modern prion (PRNP) and prion-related doppel (PRND) variation in domestic cattle

    USDA-ARS?s Scientific Manuscript database

    Previous investigations aimed at determining whether the mammalian prion protein actually facilitates tangible molecular aspects of either a discrete or pleiotropic functional niche have been debated, especially given the apparent absence of overt behavioral or physiological phenotypes associated wi...

  12. Travel history, hunting, and venison consumption related to prion disease exposure, 2006-2007 FoodNet Population Survey.

    PubMed

    Abrams, Joseph Y; Maddox, Ryan A; Harvey, Alexis R; Schonberger, Lawrence B; Belay, Ermias D

    2011-06-01

    The transmission of bovine spongiform encephalopathy (BSE) to human beings and the spread of chronic wasting disease (CWD) among cervids have prompted concerns about zoonotic transmission of prion diseases. Travel to the United Kingdom and other European countries, hunting for deer or elk, and venison consumption could result in the exposure of US residents to the agents that cause BSE and CWD. The Foodborne Diseases Active Surveillance Network 2006-2007 population survey was used to assess the prevalence of these behaviors among residents of 10 catchment areas across the United States. Of 17,372 survey respondents, 19.4% reported travel to the United Kingdom since 1980, and 29.5% reported travel to any of the nine European countries considered to be BSE-endemic since 1980. The proportion of respondents who had ever hunted deer or elk was 18.5%, and 1.2% had hunted deer or elk in a CWD-endemic area. More than two thirds (67.4%) reported having ever eaten deer or elk meat. Respondents who traveled spent more time in the United Kingdom (median 14 days) than in any other BSE-endemic country. Of the 11,635 respondents who had consumed venison, 59.8% ate venison at most one to two times during their year of highest consumption, and 88.6% had obtained all of their meat from the wild. The survey results were useful in determining the prevalence and frequency of behaviors that could be important factors for foodborne prion transmission. Copyright © 2011 American Dietetic Association. Published by Elsevier Inc. All rights reserved.

  13. Close Vicinity of PrP Expressing Cells (FDC) with Noradrenergic Fibers in Healthy Sheep Spleen

    PubMed Central

    Lezmi, S.; Hunsmann, G.; Baron, T.

    2001-01-01

    In naturally and experimentally occurring scrapie in sheep, prions invade the immune system and replicate in lymphoid organs. Here we analysed immunohistochemically, in seven spleens of 6-month-old healthy sheep, the nature of the cells expressing prion protein (PrP) potentially supporting prion replication, as well as their relationship with autonomic innervation. PrP was identified using either RB1 rabbit antiserum or 4F2 monoclonal antibody directed against AA 108–123 portion of the bovine and AA 79–92 of human prion protein respectively. Using double labelling analysis, we demonstrated that PrPc is expressed by follicular dendritic cells using a specific monoclonal antibody (CNA42). We also showed the close vicinity of these PrP expressing cells with noradrenergic fibers, using a polyclonal tyrosine hydroxylase antibody. Our results may help the study of the cellular requirements for the possible neuroinvasion from the spleen. PMID:11785673

  14. The Mechanism of Toxicity in HET-S/HET-s Prion Incompatibility

    PubMed Central

    Seuring, Carolin; Greenwald, Jason; Wasmer, Christian; Wepf, Roger; Saupe, Sven J.; Meier, Beat H.; Riek, Roland

    2012-01-01

    The HET-s protein from the filamentous fungus Podospora anserina is a prion involved in a cell death reaction termed heterokaryon incompatibility. This reaction is observed at the point of contact between two genetically distinct strains when one harbors a HET-s prion (in the form of amyloid aggregates) and the other expresses a soluble HET-S protein (96% identical to HET-s). How the HET-s prion interaction with HET-S brings about cell death remains unknown; however, it was recently shown that this interaction leads to a relocalization of HET-S from the cytoplasm to the cell periphery and that this change is associated with cell death. Here, we present detailed insights into this mechanism in which a non-toxic HET-s prion converts a soluble HET-S protein into an integral membrane protein that destabilizes membranes. We observed liposomal membrane defects of approximately 10 up to 60 nm in size in transmission electron microscopy images of freeze-fractured proteoliposomes that were formed in mixtures of HET-S and HET-s amyloids. In liposome leakage assays, HET-S has an innate ability to associate with and disrupt lipid membranes and that this activity is greatly enhanced when HET-S is exposed to HET-s amyloids. Solid-state nuclear magnetic resonance (NMR) analyses revealed that HET-s induces the prion-forming domain of HET-S to adopt the β-solenoid fold (previously observed in HET-s) and this change disrupts the globular HeLo domain. These data indicate that upon interaction with a HET-s prion, the HET-S HeLo domain partially unfolds, thereby exposing a previously buried ∼34-residue N-terminal transmembrane segment. The liberation of this segment targets HET-S to the membrane where it further oligomerizes, leading to a loss of membrane integrity. HET-S thus appears to display features that are reminiscent of pore-forming toxins. PMID:23300377

  15. Detecting and discriminating among pathogenic protein conformers(prions), using mass spectrometry-based and antibody-based approaches(Abstract)

    USDA-ARS?s Scientific Manuscript database

    A set of fatal neurological diseases that includes scrapie and chronic wasting disease (CWD) are caused by a pathological protein referred to as a prion (PrPSc). A prion propagates an infection by converting a normal cellular protein (PrPC) into a prion. Unlike viral, bacterial, or fungal pathogens,...

  16. Prions on the run: How extracellular vesicles serve as delivery vehicles for self-templating protein aggregates.

    PubMed

    Liu, Shu; Hossinger, André; Göbbels, Sarah; Vorberg, Ina M

    2017-03-04

    Extracellular vesicles (EVs) are actively secreted, membrane-bound communication vehicles that exchange biomolecules between cells. EVs also serve as dissemination vehicles for pathogens, including prions, proteinaceous infectious agents that cause transmissible spongiform encephalopathies (TSEs) in mammals. Increasing evidence accumulates that diverse protein aggregates associated with common neurodegenerative diseases are packaged into EVs as well. Vesicle-mediated intercellular transmission of protein aggregates can induce aggregation of homotypic proteins in acceptor cells and might thereby contribute to disease progression. Our knowledge of how protein aggregates are sorted into EVs and how these vesicles adhere to and fuse with target cells is limited. Here we review how TSE prions exploit EVs for intercellular transmission and compare this to the transmission behavior of self-templating cytosolic protein aggregates derived from the yeast prion domain Sup 35 NM. Artificial NM prions are non-toxic to mammalian cell cultures and do not cause loss-of-function phenotypes. Importantly, NM particles are also secreted in association with exosomes that horizontally transmit the prion phenotype to naive bystander cells, a process that can be monitored with high accuracy by automated high throughput confocal microscopy. The high abundance of mammalian proteins with amino acid stretches compositionally similar to yeast prion domains makes the NM cell model an attractive model to study self-templating and dissemination properties of proteins with prion-like domains in the mammalian context.

  17. Screening of intact yeasts and cell extracts to reduce Scrapie prions during biotransformation of food waste.

    PubMed

    Huyben, David; Boqvist, Sofia; Passoth, Volkmar; Renström, Lena; Allard Bengtsson, Ulrika; Andréoletti, Olivier; Kiessling, Anders; Lundh, Torbjörn; Vågsholm, Ivar

    2018-02-08

    Yeasts can be used to convert organic food wastes to protein-rich animal feed in order to recapture nutrients. However, the reuse of animal-derived waste poses a risk for the transmission of infectious prions that can cause neurodegeneration and fatality in humans and animals. The aim of this study was to investigate the ability of yeasts to reduce prion activity during the biotransformation of waste substrates-thereby becoming a biosafety hurdle in such a circular food system. During pre-screening, 30 yeast isolates were spiked with Classical Scrapie prions and incubated for 72 h in casein substrate, as a waste substitute. Based on reduced Scrapie seeding activity, waste biotransformation and protease activities, intact cells and cell extracts of 10 yeasts were further tested. Prion analysis showed that five yeast species reduced Scrapie seeding activity by approximately 1 log10 or 90%. Cryptococcus laurentii showed the most potential to reduce prion activity since both intact and extracted cells reduced Scrapie by 1 log10 and achieved the highest protease activity. These results show that select forms of yeast can act as a prion hurdle during the biotransformation of waste. However, the limited ability of yeasts to reduce prion activity warrants caution as a sole barrier to transmission as higher log reductions are needed before using waste-cultured yeast in circular food systems.

  18. The Oral Secretion of Infectious Scrapie Prions Occurs in Preclinical Sheep with a Range of PRNP Genotypes

    PubMed Central

    Gough, Kevin C.; Baker, Claire A.; Rees, Helen C.; Terry, Linda A.; Spiropoulos, John; Thorne, Leigh

    2012-01-01

    Preclinical sheep with the highly scrapie-susceptible VRQ/VRQ PRNP genotype secrete prions from the oral cavity. In order to further understand the significance of orally available prions, buccal swabs were taken from sheep with a range of PRNP genotypes and analyzed by serial protein misfolding cyclic amplification (sPMCA). Prions were detected in buccal swabs from scrapie-exposed sheep of genotypes linked to high (VRQ/VRQ and ARQ/VRQ) and low (ARR/VRQ and AHQ/VRQ) lymphoreticular system involvement in scrapie pathogenesis. For both groups, the level of prion detection was significantly higher than that for scrapie-resistant ARR/ARR sheep which were kept in the same farm environment and acted as sentinel controls for prions derived from the environment which might contaminate the oral cavity. In addition, sheep with no exposure to the scrapie agent did not contain any measurable prions within the oral cavity. Furthermore, prions were detected in sheep over a wide age range representing various stages of preclinical disease. These data demonstrate that orally available scrapie prions may be a common feature in sheep incubating scrapie, regardless of the PRNP genotype and any associated high-level accumulation of PrPSc within lymphoreticular tissues. PrPSc was present in buccal swabs from a large proportion of sheep with PRNP genotypes associated with relatively low disease penetrance, indicating that subclinical scrapie infection is likely to be a common occurrence. The significance of positive sPMCA reactions was confirmed by the transmission of infectivity in buccal swab extracts to Tg338 mice, illustrating the likely importance of orally available prions in the horizontal transmission of scrapie. PMID:22013047

  19. The role of the unusual threonine string in the conversion of prion protein.

    PubMed

    Abskharon, Romany; Wang, Fei; Vander Stel, Kayla J; Sinniah, Kumar; Ma, Jiyan

    2016-12-16

    The conversion of normal prion protein (PrP) into pathogenic PrP conformers is central to prion disease, but the mechanism remains unclear. The α-helix 2 of PrP contains a string of four threonines, which is unusual due to the high propensity of threonine to form β-sheets. This structural feature was proposed as the basis for initiating PrP conversion, but experimental results have been conflicting. We studied the role of the threonine string on PrP conversion by analyzing mouse Prnp a and Prnp b polymorphism that contains a polymorphic residue at the beginning of the threonine string, and PrP mutants in which threonine 191 was replaced by valine, alanine, or proline. The PMCA (protein misfolding cyclic amplification) assay was able to recapitulate the in vivo transmission barrier between PrP a and PrP b . Relative to PMCA, the amyloid fibril growth assay is less restrictive, but it did reflect certain properties of in vivo prion transmission. Our results suggest a plausible theory explaining the apparently contradictory results in the role of the threonine string in PrP conversion and provide novel insights into the complicated relationship among PrP stability, seeded conformational change, and prion structure, which is critical for understanding the molecular basis of prion infectivity.

  20. Prion infectivity in the spleen of a PRNP heterozygous individual with subclinical variant Creutzfeldt–Jakob disease

    PubMed Central

    Bishop, Matthew T.; Diack, Abigail B.; Ritchie, Diane L.; Ironside, James W.; Will, Robert G.

    2013-01-01

    Blood transfusion has been identified as a source of human-to-human transmission of variant Creutzfeldt–Jakob disease. Three cases of variant Creutzfeldt–Jakob disease have been identified following red cell transfusions from donors who subsequently developed variant Creutzfeldt–Jakob disease and an asymptomatic red cell transfusion recipient, who did not die of variant Creutzfeldt–Jakob disease, has been identified with prion protein deposition in the spleen and a lymph node, but not the brain. This individual was heterozygous (MV) at codon 129 of the prion protein gene (PRNP), whereas all previous definite and probable cases of variant Creutzfeldt–Jakob disease have been methionine homozygotes (MM). A critical question for public health is whether the prion protein deposition reported in peripheral tissues from this MV individual correlates with infectivity. Additionally it is important to establish whether the PRNP codon 129 genotype has influenced the transmission characteristics of the infectious agent. Brain and spleen from the MV blood recipient were inoculated into murine strains that have consistently demonstrated transmission of the variant Creutzfeldt–Jakob disease agent. Mice were assessed for clinical and pathological signs of disease and transmission data were compared with other transmission studies in variant Creutzfeldt–Jakob disease, including those on the spleen and brain of the donor to the index case. Transmission of variant Creutzfeldt–Jakob disease was observed from the MV blood recipient spleen, but not from the brain, whereas there was transmission from both spleen and brain tissues from the red blood cell donor. Longer incubation times were observed for the blood donor spleen inoculum compared with the blood donor brain inoculum, suggesting lower titres of infectivity in the spleen. The distribution of vacuolar pathology and abnormal prion protein in infected mice were similar following inoculation with both donor and

  1. PrPC Governs Susceptibility to Prion Strains in Bank Vole, While Other Host Factors Modulate Strain Features

    PubMed Central

    Espinosa, J. C.; Nonno, R.; Di Bari, M.; Aguilar-Calvo, P.; Pirisinu, L.; Fernández-Borges, N.; Vanni, I.; Vaccari, G.; Marín-Moreno, A.; Frassanito, P.; Lorenzo, P.; Agrimi, U.

    2016-01-01

    ABSTRACT Bank vole is a rodent species that shows differential susceptibility to the experimental transmission of different prion strains. In this work, the transmission features of a panel of diverse prions with distinct origins were assayed both in bank vole expressing methionine at codon 109 (Bv109M) and in transgenic mice expressing physiological levels of bank vole PrPC (the BvPrP-Tg407 mouse line). This work is the first systematic comparison of the transmission features of a collection of prion isolates, representing a panel of diverse prion strains, in a transgenic-mouse model and in its natural counterpart. The results showed very similar transmission properties in both the natural species and the transgenic-mouse model, demonstrating the key role of the PrP amino acid sequence in prion transmission susceptibility. However, differences in the PrPSc types propagated by Bv109M and BvPrP-Tg407 suggest that host factors other than PrPC modulate prion strain features. IMPORTANCE The differential susceptibility of bank voles to prion strains can be modeled in transgenic mice, suggesting that this selective susceptibility is controlled by the vole PrP sequence alone rather than by other species-specific factors. Differences in the phenotypes observed after prion transmissions in bank voles and in the transgenic mice suggest that host factors other than the PrPC sequence may affect the selection of the substrain replicating in the animal model. PMID:27654300

  2. 76 FR 71294 - Prions; Proposed Amendment To Clarify Product Performance Data for Products With Prion-Related...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-17

    ... control pest microorganisms that pose a threat to human health and whose presence cannot readily be... control pest microorganisms that pose a threat to human health and whose presence cannot readily be... of prions (that poses a threat to human health), an applicant or registrant would be required by...

  3. Molecular dynamics simulations of Hsp40 J-domain mutants identifies disruption of the critical HPD-motif as the key factor for impaired curing in vivo of the yeast prion [URE3].

    PubMed

    Xue, You-Lin; Wang, Hao; Riedy, Michael; Roberts, Brittany-Lee; Sun, Yuna; Song, Yong-Bo; Jones, Gary W; Masison, Daniel C; Song, Youtao

    2018-05-01

    Genetic screens using Saccharomyces cerevisiae have identified an array of Hsp40 (Ydj1p) J-domain mutants that are impaired in the ability to cure the yeast [URE3] prion through disrupting functional interactions with Hsp70. However, biochemical analysis of some of these Hsp40 J-domain mutants has so far failed to provide major insight into the specific functional changes in Hsp40-Hsp70 interactions. To explore the detailed structural and dynamic properties of the Hsp40 J-domain, 20 ns molecular dynamic simulations of 4 mutants (D9A, D36A, A30T, and F45S) and wild-type J-domain were performed, followed by Hsp70 docking simulations. Results demonstrated that although the Hsp70 interaction mechanism of the mutants may vary, the major structural change was targeted to the critical HPD motif of the J-domain. Our computational analysis fits well with previous yeast genetics studies regarding highlighting the importance of J-domain function in prion propagation. During the molecular dynamics simulations several important residues were identified and predicted to play an essential role in J-domain structure. Among these residues, Y26 and F45 were confirmed, using both in silico and in vivo methods, as being critical for Ydj1p function.

  4. The Gut-Associated Lymphoid Tissues in the Small Intestine, Not the Large Intestine, Play a Major Role in Oral Prion Disease Pathogenesis

    PubMed Central

    Donaldson, David S.; Else, Kathryn J.

    2015-01-01

    ABSTRACT Prion diseases are infectious neurodegenerative disorders characterized by accumulations of abnormally folded cellular prion protein in affected tissues. Many natural prion diseases are acquired orally, and following exposure, the early replication of some prion isolates upon follicular dendritic cells (FDC) within gut-associated lymphoid tissues (GALT) is important for the efficient spread of disease to the brain (neuroinvasion). Prion detection within large intestinal GALT biopsy specimens has been used to estimate human and animal disease prevalence. However, the relative contributions of the small and large intestinal GALT to oral prion pathogenesis were unknown. To address this issue, we created mice that specifically lacked FDC-containing GALT only in the small intestine. Our data show that oral prion disease susceptibility was dramatically reduced in mice lacking small intestinal GALT. Although these mice had FDC-containing GALT throughout their large intestines, these tissues were not early sites of prion accumulation or neuroinvasion. We also determined whether pathology specifically within the large intestine might influence prion pathogenesis. Congruent infection with the nematode parasite Trichuris muris in the large intestine around the time of oral prion exposure did not affect disease pathogenesis. Together, these data demonstrate that the small intestinal GALT are the major early sites of prion accumulation and neuroinvasion after oral exposure. This has important implications for our understanding of the factors that influence the risk of infection and the preclinical diagnosis of disease. IMPORTANCE Many natural prion diseases are acquired orally. After exposure, the accumulation of some prion diseases in the gut-associated lymphoid tissues (GALT) is important for efficient spread of disease to the brain. However, the relative contributions of GALT in the small and large intestines to oral prion pathogenesis were unknown. We show that the

  5. Glycoform-independent prion conversion by highly efficient, cell-based, protein misfolding cyclic amplification

    PubMed Central

    Moudjou, Mohammed; Chapuis, Jérôme; Mekrouti, Mériem; Reine, Fabienne; Herzog, Laetitia; Sibille, Pierre; Laude, Hubert; Vilette, Didier; Andréoletti, Olivier; Rezaei, Human; Dron, Michel; Béringue, Vincent

    2016-01-01

    Prions are formed of misfolded assemblies (PrPSc) of the variably N-glycosylated cellular prion protein (PrPC). In infected species, prions replicate by seeding the conversion and polymerization of host PrPC. Distinct prion strains can be recognized, exhibiting defined PrPSc biochemical properties such as the glycotype and specific biological traits. While strain information is encoded within the conformation of PrPSc assemblies, the storage of the structural information and the molecular requirements for self-perpetuation remain uncertain. Here, we investigated the specific role of PrPC glycosylation status. First, we developed an efficient protein misfolding cyclic amplification method using cells expressing the PrPC species of interest as substrate. Applying the technique to PrPC glycosylation mutants expressing cells revealed that neither PrPC nor PrPSc glycoform stoichiometry was instrumental to PrPSc formation and strainness perpetuation. Our study supports the view that strain properties, including PrPSc glycotype are enciphered within PrPSc structural backbone, not in the attached glycans. PMID:27384922

  6. Normal Cellular Prion Protein Protects against Manganese-induced Oxidative Stress and Apoptotic Cell Death

    PubMed Central

    Choi, Christopher J.; Anantharam, Vellareddy; Saetveit, Nathan J.; Houk, Robert. S.; Kanthasamy, Arthi; Kanthasamy, Anumantha G.

    2012-01-01

    The normal prion protein is abundantly expressed in the CNS, but its biological function remains unclear. The prion protein has octapeptide repeat regions that bind to several divalent metals, suggesting that the prion proteins may alter the toxic effect of environmental neurotoxic metals. In the present study, we systematically examined whether prion protein modifies the neurotoxicity of manganese (Mn) by comparing the effect of Mn on mouse neural cells expressing prion protein (PrPC -cells) and prion-knockout (PrPKO -cells). Exposure to Mn (10 μM-1 mM) for 24 hr produced a dose-dependent cytotoxic response in both PrPC -cells and PrPKO -cells. Interestingly, PrPC -cells (EC50 117.6μM) were more resistant to Mn-induced cytotoxicity, as compared to PrPKO -cells (EC50 59.9μM), suggesting a protective role for PrPC against Mn neurotoxicity. Analysis of intracellular Mn levels showed less Mn accumulation in PrPC -cells as compared to PrPKO -cells. Furthermore, Mn-induced mitochondrial depolarization and ROS generation were significantly attenuated in PrPC -cells as compared to PrPKO -cells. Measurement of antioxidant status revealed similar basal levels of glutathione (GSH) in PrPC -cells and PrPKO -cells; however, Mn treatment caused greater depletion of GSH in PrPKO -cells. Mn-induced mitochondrial depolarization and ROS production were followed by time- and dose-dependent activation of the apoptotic cell death cascade involving caspase-9 and -3. Notably, DNA fragmentation induced by both Mn treatment and oxidative stress-inducer hydrogen peroxide (100μM) was significantly suppressed in PrPC -cells as compared to PrPKO -cells. Together, these results demonstrate that prion protein interferes with divalent metal Mn uptake and protects against Mn-induced oxidative stress and apoptotic cell death. PMID:17483122

  7. Mutants of the Paf1 Complex Alter Phenotypic Expression of the Yeast Prion [PSI+

    PubMed Central

    Strawn, Lisa A.; Lin, Changyi A.; Tank, Elizabeth M.H.; Osman, Morwan M.; Simpson, Sarah A.

    2009-01-01

    The yeast [PSI+] prion is an epigenetic modifier of translation termination fidelity that causes nonsense suppression. The prion [PSI+] forms when the translation termination factor Sup35p adopts a self-propagating conformation. The presence of the [PSI+] prion modulates survivability in a variety of growth conditions. Nonsense suppression is essential for many [PSI+]-mediated phenotypes, but many do not appear to be due to read-through of a single stop codon, but instead are multigenic traits. We hypothesized that other global mechanisms act in concert with [PSI+] to influence [PSI+]-mediated phenotypes. We have identified one such global regulator, the Paf1 complex (Paf1C). Paf1C is conserved in eukaryotes and has been implicated in several aspects of transcriptional and posttranscriptional regulation. Mutations in Ctr9p and other Paf1C components reduced [PSI+]-mediated nonsense suppression. The CTR9 deletion also alters nonsense suppression afforded by other genetic mutations but not always to the same extent as the effects on [PSI+]-mediated read-through. Our data suggest that the Paf1 complex influences mRNA translatability but not solely through changes in transcript stability or abundance. Finally, we demonstrate that the CTR9 deletion alters several [PSI+]-dependent phenotypes. This provides one example of how [PSI+] and genetic modifiers can interact to uncover and regulate phenotypic variability. PMID:19225160

  8. Ssb1 chaperone is a [PSI+] prion-curing factor.

    PubMed

    Chacinska, A; Szczesniak, B; Kochneva-Pervukhova, N V; Kushnirov, V V; Ter-Avanesyan, M D; Boguta, M

    2001-04-01

    Yeast SUP7' or SUP11 nonsense suppressors have no phenotypic expression in strains deficient in the isopentenylation of A37 in tRNA. Here we show that such strains spontaneously produce cells with a nonsense suppressor phenotype which is related to the cytoplasmically inherited determinant and manifests all the key features of the [PSI+] prion. A screen of a multicopy yeast genomic library for genes that inactivate the [PSI+]-related suppressor phenotype resulted in the isolation of the SSB1 gene. Moreover, we demonstrate that multicopy plasmid encoding the Ssb1 chaperone cures cells of the [PSI+] prion.

  9. Using mass spectrometry and small molecule reagents to detect distinctive structural features of different prion conformations (strains)

    USDA-ARS?s Scientific Manuscript database

    A prion (PrPSc) is a conformer of a normal cellular prion protein (PrPC). Although they are isosequential, PrPSc is an infectious protein able to convert PrPC into the prion conformation and thereby propagate an infection. PrPC is monomeric while PrPSc is a multimer. PrPSc can adopt more than one co...

  10. Prion propagation and toxicity occur in vitro with two-phase kinetics specific to strain and neuronal type.

    PubMed

    Hannaoui, Samia; Maatouk, Layal; Privat, Nicolas; Levavasseur, Etienne; Faucheux, Baptiste A; Haïk, Stéphane

    2013-03-01

    Prion diseases, or transmissible spongiform encephalopathies (TSEs), are fatal neurodegenerative disorders that occur in humans and animals. The neuropathological hallmarks of TSEs are spongiosis, glial proliferation, and neuronal loss. The only known specific molecular marker of TSEs is the abnormal isoform (PrP(Sc)) of the host-encoded prion protein (PrP(C)), which accumulates in the brain of infected subjects and forms infectious prion particles. Although this transmissible agent lacks a specific nucleic acid component, several prion strains have been isolated. Prion strains are characterized by differences in disease outcome, PrP(Sc) distribution patterns, and brain lesion profiles at the terminal stage of the disease. The molecular factors and cellular mechanisms involved in strain-specific neuronal tropism and toxicity remain largely unknown. Currently, no cellular model exists to facilitate in vitro studies of these processes. A few cultured cell lines that maintain persistent scrapie infections have been developed, but only two of them have shown the cytotoxic effects associated with prion propagation. In this study, we have developed primary neuronal cultures to assess in vitro neuronal tropism and toxicity of different prion strains (scrapie strains 139A, ME7, and 22L). We have tested primary neuronal cultures enriched in cerebellar granular, striatal, or cortical neurons. Our results showed that (i) a strain-specific neuronal tropism operated in vitro; (ii) the cytotoxic effect varied among strains and neuronal cell types; (iii) prion propagation and toxicity occurred in two kinetic phases, a replicative phase followed by a toxic phase; and (iv) neurotoxicity peaked when abnormal PrP accumulation reached a plateau.

  11. Prion Propagation and Toxicity Occur In Vitro with Two-Phase Kinetics Specific to Strain and Neuronal Type

    PubMed Central

    Hannaoui, Samia; Maatouk, Layal; Privat, Nicolas; Levavasseur, Etienne; Faucheux, Baptiste A.

    2013-01-01

    Prion diseases, or transmissible spongiform encephalopathies (TSEs), are fatal neurodegenerative disorders that occur in humans and animals. The neuropathological hallmarks of TSEs are spongiosis, glial proliferation, and neuronal loss. The only known specific molecular marker of TSEs is the abnormal isoform (PrPSc) of the host-encoded prion protein (PrPC), which accumulates in the brain of infected subjects and forms infectious prion particles. Although this transmissible agent lacks a specific nucleic acid component, several prion strains have been isolated. Prion strains are characterized by differences in disease outcome, PrPSc distribution patterns, and brain lesion profiles at the terminal stage of the disease. The molecular factors and cellular mechanisms involved in strain-specific neuronal tropism and toxicity remain largely unknown. Currently, no cellular model exists to facilitate in vitro studies of these processes. A few cultured cell lines that maintain persistent scrapie infections have been developed, but only two of them have shown the cytotoxic effects associated with prion propagation. In this study, we have developed primary neuronal cultures to assess in vitro neuronal tropism and toxicity of different prion strains (scrapie strains 139A, ME7, and 22L). We have tested primary neuronal cultures enriched in cerebellar granular, striatal, or cortical neurons. Our results showed that (i) a strain-specific neuronal tropism operated in vitro; (ii) the cytotoxic effect varied among strains and neuronal cell types; (iii) prion propagation and toxicity occurred in two kinetic phases, a replicative phase followed by a toxic phase; and (iv) neurotoxicity peaked when abnormal PrP accumulation reached a plateau. PMID:23255799

  12. PrPC Governs Susceptibility to Prion Strains in Bank Vole, While Other Host Factors Modulate Strain Features.

    PubMed

    Espinosa, J C; Nonno, R; Di Bari, M; Aguilar-Calvo, P; Pirisinu, L; Fernández-Borges, N; Vanni, I; Vaccari, G; Marín-Moreno, A; Frassanito, P; Lorenzo, P; Agrimi, U; Torres, J M

    2016-12-01

    Bank vole is a rodent species that shows differential susceptibility to the experimental transmission of different prion strains. In this work, the transmission features of a panel of diverse prions with distinct origins were assayed both in bank vole expressing methionine at codon 109 (Bv109M) and in transgenic mice expressing physiological levels of bank vole PrP C (the BvPrP-Tg407 mouse line). This work is the first systematic comparison of the transmission features of a collection of prion isolates, representing a panel of diverse prion strains, in a transgenic-mouse model and in its natural counterpart. The results showed very similar transmission properties in both the natural species and the transgenic-mouse model, demonstrating the key role of the PrP amino acid sequence in prion transmission susceptibility. However, differences in the PrP Sc types propagated by Bv109M and BvPrP-Tg407 suggest that host factors other than PrP C modulate prion strain features. The differential susceptibility of bank voles to prion strains can be modeled in transgenic mice, suggesting that this selective susceptibility is controlled by the vole PrP sequence alone rather than by other species-specific factors. Differences in the phenotypes observed after prion transmissions in bank voles and in the transgenic mice suggest that host factors other than the PrP C sequence may affect the selection of the substrain replicating in the animal model. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. Regulation of MicroRNAs-Mediated Autophagic Flux: A New Regulatory Avenue for Neurodegenerative Diseases With Focus on Prion Diseases

    PubMed Central

    Shah, Syed Zahid Ali; Zhao, Deming; Hussain, Tariq; Sabir, Naveed; Yang, Lifeng

    2018-01-01

    Prion diseases are fatal neurological disorders affecting various mammalian species including humans. Lack of proper diagnostic tools and non-availability of therapeutic remedies are hindering the control strategies for prion diseases. MicroRNAs (miRNAs) are abundant endogenous short non-coding essential RNA molecules that negatively regulate the target genes after transcription. Several biological processes depend on miRNAs, and altered profiles of these miRNAs are potential biomarkers for various neurodegenerative diseases, including prion diseases. Autophagic flux degrades the misfolded prion proteins to reduce chronic endoplasmic reticulum stress and enhance cell survival. Recent evidence suggests that specific miRNAs target and regulate the autophagic mechanism, which is critical for alleviating cellular stress. miRNAs-mediated regulation of these specific proteins involved in the autophagy represents a new target with highly significant therapeutic prospects. Here, we will briefly describe the biology of miRNAs, the use of miRNAs as potential biomarkers with their credibility, the regulatory mechanism of miRNAs in major neurodegenerative diseases such as Alzheimer’s, Parkinson’s, and prion diseases, degradation pathways for aggregated prion proteins, the role of autophagy in prion diseases. Finally, we will discuss the miRNAs-modulated autophagic flux in neurodegenerative diseases and employ them as potential therapeutic intervention strategy in prion diseases. PMID:29867448

  14. Serial transmission in rodents of neurodegeneration from transgenic mice expressing mutant prion protein.

    PubMed Central

    Hsiao, K K; Groth, D; Scott, M; Yang, S L; Serban, H; Rapp, D; Foster, D; Torchia, M; Dearmond, S J; Prusiner, S B

    1994-01-01

    Two lines of transgenic (Tg) mice expressing high (H) levels of the mutant P101L prion protein (PrP) developed a neurologic illness and central nervous system pathology indistinguishable from experimental murine scrapie; these mice were designated Tg(MoPrP-P101L)H. Brain homogenates from Tg(MoPrP-P101L)H mice were inoculated intracerebrally into CD-1 Swiss mice, Syrian hamsters, and Tg196 mice, Tg mice expressing the MoPrP-P101L transgene at low levels. None of the CD-1 mice developed central nervous system dysfunction, whereas approximately 10% of hamsters and approximately 40% of the Tg196 mice manifested neurologic signs between 117 and 639 days after inoculation. Serial transmission of neurodegeneration in Tg196 mice and Syrian hamsters was initiated with brain extracts, producing incubation times of approximately 400 and approximately 75 days, respectively. Although the Tg(MoPrP-P101L)H mice appear to accumulate only low levels of infections prions in their brains, the serial transmission of disease to inoculated recipients argues that prion formation occurs de novo in the brains of these uninoculated animals. These Tg mouse studies, taken together with similar findings in humans dying of inherited prion diseases, provide additional evidence that prions lack a foreign nucleic acid. Images PMID:7916462

  15. Quantitative Risk Assessment of Bovine Spongiform Encephalopathy

    NASA Astrophysics Data System (ADS)

    Tsutsui, Toshiyuki; Kasuga, Fumiko

    Bovine spongiform encephalopathy (BSE) is a progressive neurological disease of cattle affecting the central nervous system and was first diagnosed in the United Kingdom (UK) in 1986 (Wells et al., 1987). This disease is one of the transmissible spongiform encephalopathy (TSE) which includes Creutzfeldt-Jakob disease (CJD) in humans and scrapie in sheep. The causative agent of TSE is considered to be an abnormal form of prion protein. However, the details of its pathogenic mechanism have not been fully identified. Scrapie, which causes neurological symptoms in sheep and goats, has existed in the UK for 200 years (Hoinville, 1996) and spread across the rest of the world in the 1900s (Detwiler & Baylis, 2003). There has been no report so far that scrapie can be transmitted to humans. Initially, BSE was also considered as a disease affecting only animals. However, a variant type of Creutzfeldt-Jakob disease (vCJD) was first reported in the UK, and exposure to a BSE agent was suspected (Collinge, Sidle, Meads, Ironside, & Hill, 1996). vCJD is clinically and pathologically different from the sporadic type of CJD, and age at clinical onset of vCJD is younger than sporadic type (Will et al., 1996). Since the UK government announced the possible association between BSE and vCJD in 1996, BSE has become a huge public health concern all over the world. Of particular concern about vCJD, the fatal disease in younger age, distorted consumer confidence in beef safety, and as a result reduced beef consumption has been seen in many BSE-affected countries.

  16. Enhanced detection of infectious prions by direct ELISA from the brains of asymptomatic animals using DRM2-118 monoclonal antibody and Gdn-HCl.

    PubMed

    Hnasko, Robert; Lin, Alice; McGarvey, Jeffery; Stanker, Larry

    2018-05-01

    In this report we describe the use of a novel anti-prion monoclonal antibody (DRM2-118) for the direct detection of infectious prions by ELISA. Epitope mapping using overlapping hamster (SHa) prion peptides indicates DRM2-118 binding occurs between residues 93-100 and at the 3 10 -helix (residues 163-170) between alpha helix-A and -B. This antibody shows broad species binding to endogenous prions from brain homogenates and corresponding recombinant prion proteins. To evaluate the performance of this MAb for the detection of prion proteins we performed an animal time course and evaluated prion detection from both crude brain homogenates and lipid raft fractions (DRM) by direct ELISA. Prion detection was significantly enhanced by the addition of the chaotropic guanidine-HCl (Gdn-HCl) during protein immobilization with detection of PK-resistant prion from asymptomatic animal brains at (45-DPI) and from lipid rafts at (24-DPI). Our data demonstrates enhanced prion detection from brain lipid rafts of asymptomatic animals by a simple direct ELISA using the DRM2-118 MAb combined with Gdn-HCl. Published by Elsevier B.V.

  17. Plasminogen stimulates propagation of protease-resistant prion protein in vitro.

    PubMed

    Mays, Charles E; Ryou, Chongsuk

    2010-12-01

    To clarify the role of plasminogen as a cofactor for prion propagation, we conducted functional assays using a cell-free prion protein (PrP) conversion assay termed protein misfolding cyclic amplification (PMCA) and prion-infected cell lines. Here, we report that plasminogen stimulates propagation of the protease-resistant scrapie PrP (PrP(Sc)). Compared to control PMCA conducted without plasminogen, addition of plasminogen in PMCA using wild-type brain material significantly increased PrP conversion, with an EC(50) = ∼56 nM. PrP conversion in PMCA was substantially less efficient with plasminogen-deficient brain material than with wild-type material. The activity stimulating PrP conversion was specific for plasminogen and conserved in its kringle domains. Such activity was abrogated by modification of plasminogen structure and interference of PrP-plasminogen interaction. Kinetic analysis of PrP(Sc) generation demonstrated that the presence of plasminogen in PMCA enhanced the PrP(Sc) production rate to ∼0.97 U/μl/h and reduced turnover time to ∼1 h compared to those (∼0.4 U/μl/h and ∼2.5 h) obtained without supplementation. Furthermore, as observed in PMCA, plasminogen and kringles promoted PrP(Sc) propagation in ScN2a and Elk 21(+) cells. Our results demonstrate that plasminogen functions in stimulating conversion processes and represents the first cellular protein cofactor that enhances the hypothetical mechanism of prion propagation.

  18. Virus Infections on Prion Diseased Mice Exacerbate Inflammatory Microglial Response

    PubMed Central

    Lins, Nara; Mourão, Luiz; Trévia, Nonata; Passos, Aline; Farias, José Augusto; Assunção, Jarila; Bento-Torres, João; Consentino Kronka Sosthenes, Marcia; Diniz, José Antonio Picanço; Vasconcelos, Pedro Fernando da Costa

    2016-01-01

    We investigated possible interaction between an arbovirus infection and the ME7 induced mice prion disease. C57BL/6, females, 6-week-old, were submitted to a bilateral intrahippocampal injection of ME7 prion strain (ME7) or normal brain homogenate (NBH). After injections, animals were organized into two groups: NBH (n = 26) and ME7 (n = 29). At 15th week after injections (wpi), animals were challenged intranasally with a suspension of Piry arbovirus 0.001% or with NBH. Behavioral changes in ME7 animals appeared in burrowing activity at 14 wpi. Hyperactivity on open field test, errors on rod bridge, and time reduction in inverted screen were detected at 15th, 19th, and 20th wpi respectively. Burrowing was more sensitive to earlier hippocampus dysfunction. However, Piry-infection did not significantly affect the already ongoing burrowing decline in the ME7-treated mice. After behavioral tests, brains were processed for IBA1, protease-resistant form of PrP, and Piry virus antigens. Although virus infection in isolation did not change the number of microglia in CA1, virus infection in prion diseased mice (at 17th wpi) induced changes in number and morphology of microglia in a laminar-dependent way. We suggest that virus infection exacerbates microglial inflammatory response to a greater degree in prion-infected mice, and this is not necessarily correlated with hippocampal-dependent behavioral deficits. PMID:28003864

  19. The Endoplasmic Reticulum Chaperone GRP78/BiP Modulates Prion Propagation in vitro and in vivo.

    PubMed

    Park, Kyung-Won; Eun Kim, Gyoung; Morales, Rodrigo; Moda, Fabio; Moreno-Gonzalez, Ines; Concha-Marambio, Luis; Lee, Amy S; Hetz, Claudio; Soto, Claudio

    2017-03-23

    Prion diseases are fatal neurodegenerative disorders affecting several mammalian species, characterized by the accumulation of the misfolded form of the prion protein, which is followed by the induction of endoplasmic reticulum (ER) stress and the activation of the unfolded protein response (UPR). GRP78, also called BiP, is a master regulator of the UPR, reducing ER stress levels and apoptosis due to an enhancement of the cellular folding capacity. Here, we studied the role of GRP78 in prion diseases using several in vivo and in vitro approaches. Our results show that a reduction in the expression of this molecular chaperone accelerates prion pathogenesis in vivo. In addition, we observed that prion replication in cell culture was inversely related to the levels of expression of GRP78 and that both proteins interact in the cellular context. Finally, incubation of PrP Sc with recombinant GRP78 led to the dose-dependent reduction of protease-resistant PrP Sc in vitro. Our results uncover a novel role of GRP78 in reducing prion pathogenesis, suggesting that modulating its levels/activity may offer a novel opportunity for designing therapeutic approaches for these diseases. These findings may also have implications for other diseases involving the accumulation of misfolded proteins.

  20. Computational methods for yeast prion curing curves.

    PubMed

    Ridout, Martin S

    2008-10-01

    If the chemical guanidine hydrochloride is added to a dividing culture of yeast cells in which some of the protein Sup35p is in its prion form, the proportion of cells that carry replicating units of the prion, termed propagons, decreases gradually over time. Stochastic models to describe this process of 'curing' have been developed in earlier work. The present paper investigates the use of numerical methods of Laplace transform inversion to calculate curing curves and contrasts this with an alternative, more direct, approach that involves numerical integration. Transform inversion is found to provide a much more efficient computational approach that allows different models to be investigated with minimal programming effort. The method is used to investigate the robustness of the curing curve to changes in the assumed distribution of cell generation times. Matlab code is available for carrying out the calculations.