Toward robust phase-locking in Melibe swim central pattern generator models

NASA Astrophysics Data System (ADS)

Jalil, Sajiya; Allen, Dane; Youker, Joseph; Shilnikov, Andrey

2013-12-01

Small groups of interneurons, abbreviated by CPG for central pattern generators, are arranged into neural networks to generate a variety of core bursting rhythms with specific phase-locked states, on distinct time scales, which govern vital motor behaviors in invertebrates such as chewing and swimming. These movements in lower level animals mimic motions of organs in higher animals due to evolutionarily conserved mechanisms. Hence, various neurological diseases can be linked to abnormal movement of body parts that are regulated by a malfunctioning CPG. In this paper, we, being inspired by recent experimental studies of neuronal activity patterns recorded from a swimming motion CPG of the sea slug Melibe leonina, examine a mathematical model of a 4-cell network that can plausibly and stably underlie the observed bursting rhythm. We develop a dynamical systems framework for explaining the existence and robustness of phase-locked states in activity patterns produced by the modeled CPGs. The proposed tools can be used for identifying core components for other CPG networks with reliable bursting outcomes and specific phase relationships between the interneurons. Our findings can be employed for identifying or implementing the conditions for normal and pathological functioning of basic CPGs of animals and artificially intelligent prosthetics that can regulate various movements.

Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

PubMed

Katz, P S

1998-11-16

Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

[The German program for disease management guidelines: evaluation by use of quality indicators].

PubMed

Kopp, Ina B; Geraedts, Max; Jäckel, Wilfried H; Altenhofen, Lutz; Thomeczek, Christian; Ollenschläger, Günter

2007-08-15

The Program for National Disease Management Guidelines (German DM-CPG Program) in Germany aims at the implementation of best-practice recommendations for prevention, acute care, rehabilitation and chronic care in the setting of disease management programs and integrated health-care systems. Like other guidelines, DM-CPG need to be assessed regarding their influence on structures, processes and outcomes of care. However, quality assessment in integrated health-care systems is challenging. On the one hand, a multitude of potential domains for measurement, actors and perspectives need to be considered. On the other hand, measures need to be identified that assess the function of the diagnostic and therapeutic chain in terms of cooperation and coordination of care. The article reviews methods and use of quality indicators in the context of the German DM-CPG Program.

[Association between obesity and DNA methylation among the 7-16 year-old twins].

PubMed

Li, C X; Gao, Y; Gao, W J; Yu, C Q; Lyu, J; Lyu, R R; Duan, J L; Sun, Y; Guo, X H; Wang, S F; Zhou, B; Wang, G; Cao, W H; Li, L M

2018-04-10

Objective: On whole-genome scale, we tried to explore the correlation between obesity-related traits and DNA methylation sites, based on discordant monozygotic twin pairs. Methods: A total of 90 pairs of 6-17 year-old twins were recruited in Chaoyang district, Yanqing district and Fangshan district in Beijing in 2016. Information on twins was gathered through a self-designed questionnaire and results: from physical examination, including height, weight and waist circumference of the subjects under study. DNA methylation detection was chosen on the Illumina Human Methylation EPIC BeadChip. R 3.3.1 language was used to read the DNA methylation signal under quality control on samples and probes. Ebayes function of empirical Bayes paired moderated t -test was used to identify the differential methylated CpG sites (DMCs). VarFit function of empirical Bayes paired moderated Levene test was used to identify the differentially variables CpG sits (DVCs) in obese and normal groups. Results According to the obesity discordance criteria, we collected 23 pairs of twins (age range 7 to 16 years), including 12 male pairs. A total of 817 471 qualified CpG loci were included in the genome-wide correlation analysis. According to the significance level of FDR set as <0.05, no positive sites would meet this standard. When DMC CpG site cg05684382, with the smallest P value (1.26E-06) as on chromosome 12, the DVC CpG site cg26188191 with the smallest P value (6.44E-06) appeared in CMIP gene on chromosome 16. Conclusions: In this study, we analyzed the genome-wide DNA methylation and its correlation with obesity traits. After multiple testing corrections, no positive sites were found to have associated with obesity. However, results from the correlation analysis demonstrated sites cg05684382 (chr: 12) and cg26188191 (chr: 16) might have played a role in the development of obesity. This study provides a methodologic reference for the studies on discordance twins related problems.

Identification and Characterization of Novel Chitin-Binding Proteins from the Larval Cuticle of Silkworm, Bombyx mori.

PubMed

Dong, Zhaoming; Zhang, Weiwei; Zhang, Yan; Zhang, Xiaolu; Zhao, Ping; Xia, Qingyou

2016-05-06

Cuticle is mainly made of chitin filaments embedded in a matrix of cuticular proteins (CPs). Cuticular chitins have minor differences, whereas CPs are widely variable with respect to their sequences and structures. To understand the molecular basis underlying the mechanical properties of cuticle, it is necessary to know which CPs interact with chitin and how they are assembled into the cuticle structure. In the present study, a chitin-binding assay was performed followed by liquid chromatography-tandem mass spectrometry to identify the extracted proteins from the larval cuticle of silkworm, Bombyx mori. There were 463 proteins identified from the silkworm larval cuticle, 200 of which were recovered in the chitin-binding fraction. A total of 103 proteins were annotated as CPs, which were classified into 11 CP families based on their conserved motifs, including CPR, CPAP, CPT, CPF and CPFL, CPCFC, chitin_bind 3, BmCPH2 homologues, BmCPH9 homologues, BmCPG1 homologues, BmCPG20 homologues, and BmCPG21 homologues. A total of five CP families were newly identified in the chitin-binding fraction, thereby providing new information and insight into the composition, structure, and function of the silkworm larval cuticle.

In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

PubMed Central

Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

2012-01-01

The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

PubMed Central

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

PubMed

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

Genome-Wide Associations between Genetic and Epigenetic Variation Influence mRNA Expression and Insulin Secretion in Human Pancreatic Islets

PubMed Central

Olsson, Anders H.; Volkov, Petr; Bacos, Karl; Dayeh, Tasnim; Hall, Elin; Nilsson, Emma A.; Ladenvall, Claes; Rönn, Tina; Ling, Charlotte

2014-01-01

Genetic and epigenetic mechanisms may interact and together affect biological processes and disease development. However, most previous studies have investigated genetic and epigenetic mechanisms independently, and studies examining their interactions throughout the human genome are lacking. To identify genetic loci that interact with the epigenome, we performed the first genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human pancreatic islets. We related 574,553 single nucleotide polymorphisms (SNPs) with genome-wide DNA methylation data of 468,787 CpG sites targeting 99% of RefSeq genes in islets from 89 donors. We identified 67,438 SNP-CpG pairs in cis, corresponding to 36,783 SNPs (6.4% of tested SNPs) and 11,735 CpG sites (2.5% of tested CpGs), and 2,562 significant SNP-CpG pairs in trans, corresponding to 1,465 SNPs (0.3% of tested SNPs) and 383 CpG sites (0.08% of tested CpGs), showing significant associations after correction for multiple testing. These include reported diabetes loci, e.g. ADCY5, KCNJ11, HLA-DQA1, INS, PDX1 and GRB10. CpGs of significant cis-mQTLs were overrepresented in the gene body and outside of CpG islands. Follow-up analyses further identified mQTLs associated with gene expression and insulin secretion in human islets. Causal inference test (CIT) identified SNP-CpG pairs where DNA methylation in human islets is the potential mediator of the genetic association with gene expression or insulin secretion. Functional analyses further demonstrated that identified candidate genes (GPX7, GSTT1 and SNX19) directly affect key biological processes such as proliferation and apoptosis in pancreatic β-cells. Finally, we found direct correlations between DNA methylation of 22,773 (4.9%) CpGs with mRNA expression of 4,876 genes, where 90% of the correlations were negative when CpGs were located in the region surrounding transcription start site. Our study demonstrates for the first time how genome-wide genetic and epigenetic variation interacts to influence gene expression, islet function and potential diabetes risk in humans. PMID:25375650

The CpG island searcher: a new WWW resource.

PubMed

Takai, Daiya; Jones, Peter A

2003-01-01

Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

Determining coding CpG islands by identifying regions significant for pattern statistics on Markov chains.

PubMed

Singer, Meromit; Engström, Alexander; Schönhuth, Alexander; Pachter, Lior

2011-09-23

Recent experimental and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may be subjected to both genomic and epigenomic constraint. It is therefore of interest to identify coding CpG islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying such islands is that coding exons exhibit sequence biases determined by codon usage and constraints that must be taken into account. We present a method for finding CCGIs that showcases a novel approach we have developed for identifying regions of interest that are significant (with respect to a Markov chain) for the counts of any pattern. Our method begins with the exact computation of tail probabilities for the number of CpGs in all regions contained in coding exons, and then applies a greedy algorithm for selecting islands from among the regions. We show that the greedy algorithm provably optimizes a biologically motivated criterion for selecting islands while controlling the false discovery rate. We applied this approach to the human genome (hg18) and annotated CpG islands in coding exons. The statistical criterion we apply to evaluating islands reduces the number of false positives in existing annotations, while our approach to defining islands reveals significant numbers of undiscovered CCGIs in coding exons. Many of these appear to be examples of functional epigenetic specialization in coding exons.

Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

PubMed Central

Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

2009-01-01

Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

Molecular characterization and transcriptional analysis of the female-enriched chondroitin proteoglycan 2 of Toxocara canis.

PubMed

Ma, G X; Zhou, R Q; Hu, L; Luo, Y L; Luo, Y F; Zhu, H H

2018-03-01

Toxocara canis is an important but neglected zoonotic parasite, and is the causative agent of human toxocariasis. Chondroitin proteoglycans are biological macromolecules, widely distributed in extracellular matrices, with a great diversity of functions in mammals. However, there is limited information regarding chondroitin proteoglycans in nematode parasites. In the present study, a female-enriched chondroitin proteoglycan 2 gene of T. canis (Tc-cpg-2) was cloned and characterized. Quantitative real-time polymerase chain reaction (qRT-PCR) was employed to measure the transcription levels of Tc-cpg-2 among tissues of male and female adult worms. A 485-amino-acid (aa) polypeptide was predicted from a continuous 1458-nuleotide open reading frame and designated as TcCPG2, which contains a 21-aa signal peptide. Conserved domain searching indicated three chitin-binding peritrophin-A (CBM_14) domains in the amino acid sequence of TcCPG2. Multiple alignment with the inferred amino acid sequences of Caenorhabditis elegans and Ascaris suum showed that CBM_14 domains were well conserved among these species. Phylogenetic analysis suggested that TcCPG2 was closely related to the sequence of chondroitin proteoglycan 2 of A. suum. Interestingly, a high level of Tc-cpg-2 was detected in female germline tissues, particularly in the oviduct, suggesting potential roles of this gene in reproduction (e.g. oogenesis and embryogenesis) of adult T. canis. The functional roles of Tc-cpg-2 in reproduction and development in this parasite and related parasitic nematodes warrant further functional studies.

The evolution of CpG density and lifespan in conserved primate and mammalian promoters

PubMed Central

McLain, Adam T.

2018-01-01

Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

PubMed Central

Qiao, Huan; May, James M.

2013-01-01

SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

Clinical practice guidelines (CPGs) reduce costs in the management of isolated splenic injuries at pediatric trauma centers.

PubMed

Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P

2013-02-01

The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.

Prenatal arsenic exposure and the epigenome: identifying sites of 5-methylcytosine alterations that predict functional changes in gene expression in newborn cord blood and subsequent birth outcomes.

PubMed

Rojas, Daniel; Rager, Julia E; Smeester, Lisa; Bailey, Kathryn A; Drobná, Zuzana; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C

2015-01-01

Prenatal exposure to inorganic arsenic (iAs) is detrimental to the health of newborns and increases the risk of disease development later in life. Here we examined a subset of newborn cord blood leukocyte samples collected from subjects enrolled in the Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico, who were exposed to a range of drinking water arsenic concentrations (0.456-236 µg/l). Changes in iAs-associated DNA 5-methylcytosine methylation were assessed across 424,935 CpG sites representing 18,761 genes and compared with corresponding mRNA expression levels and birth outcomes. In the context of arsenic exposure, a total of 2919 genes were identified with iAs-associated differences in DNA methylation. Site-specific analyses identified DNA methylation changes that were most predictive of gene expression levels where CpG methylation within CpG islands positioned within the first exon, the 5' untranslated region and 200 bp upstream of the transcription start site yielded the most significant association with gene expression levels. A set of 16 genes was identified with correlated iAs-associated changes in DNA methylation and mRNA expression and all were highly enriched for binding sites of the early growth response (EGR) and CCCTC-binding factor (CTCF) transcription factors. Furthermore, DNA methylation levels of 7 of these genes were associated with differences in birth outcomes including gestational age and head circumference.These data highlight the complex interplay between DNA methylation, functional changes in gene expression and health outcomes and underscore the need for functional analyses coupled to epigenetic assessments. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

DNA motifs associated with aberrant CpG island methylation.

PubMed

Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

2006-05-01

Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

PubMed Central

Martin, Elizabeth M.; Fry, Rebecca C.

2016-01-01

Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

Length of paternal lifespan is manifested in the DNA methylome of their nonagenarian progeny

PubMed Central

Marttila, Saara; Kananen, Laura; Jylhävä, Juulia; Nevalainen, Tapio; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko

2015-01-01

The heritability of lifespan is 20-30%, but only a few genes associated with longevity have been identified. To explain this discrepancy, the inheritance of epigenetic features, such as DNA methylation, have been proposed to contribute to the heritability of lifespan. We investigated whether parental lifespan is associated with DNA methylation profile in nonagenarians. A regression model, adjusted for differences in blood cell proportions, identified 659 CpG sites where the level of methylation was associated with paternal lifespan. However, no association was observed between maternal lifespan and DNA methylation. The 659 CpG sites associated with paternal lifespan were enriched outside of CpG islands and were located in genes associated with development and morphogenesis, as well as cell signaling. The largest difference in the level of methylation between the progeny of the shortest-lived and longest-lived fathers was identified for CpG sites mapping to CXXC5. In addition, the level of methylation in three Notch-genes (NOTCH1, NOTCH3 and NOTCH4) was also associated with paternal lifespan. There are implications for the inheritance of acquired traits via epigenetic mechanisms in mammals. Here we describe DNA methylation features that are associated with paternal lifespan, and we speculate that the identified CpG sites may represent intergenerational epigenetic inheritance. PMID:26436701

An epigenome-wide association analysis of cardiac autonomic responses among a population of welders.

PubMed

Zhang, Jinming; Liu, Zhonghua; Umukoro, Peter E; Cavallari, Jennifer M; Fang, Shona C; Weisskopf, Marc G; Lin, Xihong; Mittleman, Murray A; Christiani, David C

2017-02-01

DNA methylation is one of the potential epigenetic mechanisms associated with various adverse cardiovascular effects; however, its association with cardiac autonomic dysfunction, in particular, is unknown. In the current study, we aimed to identify epigenetic variants associated with alterations in cardiac autonomic responses. Cardiac autonomic responses were measured with two novel markers: acceleration capacity (AC) and deceleration capacity (DC). We examined DNA methylation levels at more than 472,506 CpG probes through the Illumina Infinium HumanMethylation450 BeadChip assay. We conducted separate linear mixed models to examine associations of DNA methylation levels at each CpG with AC and DC. One CpG (cg26829071) located in the GPR133 gene was negatively associated with DC values after multiple testing corrections through false discovery rate. Our study suggests the potential functional importance of methylation in cardiac autonomic responses. Findings from the current study need to be replicated in future studies in a larger population.

[Quality and compliance with Clinical Practice Guidelines of Chronic Noncommunicable Diseases in primary care].

PubMed

Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J

2017-01-01

To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.

Cadmium exposure and the epigenome

PubMed Central

Sanders, Alison P; Smeester, Lisa; Rojas, Daniel; DeBussycher, Tristan; Wu, Michael C; Wright, Fred A; Zhou, Yi-Hui; Laine, Jessica E; Rager, Julia E; Swamy, Geeta K; Ashley-Koch, Allison; Lynn Miranda, Marie; Fry, Rebecca C

2014-01-01

Cadmium (Cd) is prevalent in the environment yet understudied as a developmental toxicant. Cd partially crosses the placental barrier from mother to fetus and is linked to detrimental effects in newborns. Here we examine the relationship between levels of Cd during pregnancy and 5-methylcytosine (5mC) levels in leukocyte DNA collected from 17 mother-newborn pairs. The methylation of cytosines is an epigenetic mechanism known to impact transcriptional signaling and influence health endpoints. A methylated cytosine-guanine (CpG) island recovery assay was used to assess over 4.6 million sites spanning 16,421 CpG islands. Exposure to Cd was classified for each mother-newborn pair according to maternal blood levels and compared with levels of cotinine. Subsets of genes were identified that showed altered DNA methylation levels in their promoter regions in fetal DNA associated with levels of Cd (n = 61), cotinine (n = 366), or both (n = 30). Likewise, in maternal DNA, differentially methylated genes were identified that were associated with Cd (n = 92) or cotinine (n = 134) levels. While the gene sets were largely distinct between maternal and fetal DNA, functional similarities at the biological pathway level were identified including an enrichment of genes that encode for proteins that control transcriptional regulation and apoptosis. Furthermore, conserved DNA motifs with sequence similarity to specific transcription factor binding sites were identified within the CpG islands of the gene sets. This study provides evidence for distinct patterns of DNA methylation or “footprints” in fetal and maternal DNA associated with exposure to Cd. PMID:24169490

Combined DNA methylation and gene expression profiling in gastrointestinal stromal tumors reveals hypomethylation of SPP1 as an independent prognostic factor.

PubMed

Haller, Florian; Zhang, Jitao David; Moskalev, Evgeny A; Braun, Alexander; Otto, Claudia; Geddert, Helene; Riazalhosseini, Yasser; Ward, Aoife; Balwierz, Aleksandra; Schaefer, Inga-Marie; Cameron, Silke; Ghadimi, B Michael; Agaimy, Abbas; Fletcher, Jonathan A; Hoheisel, Jörg; Hartmann, Arndt; Werner, Martin; Wiemann, Stefan; Sahin, Ozgür

2015-03-01

Gastrointestinal stromal tumors (GISTs) have distinct gene expression patterns according to localization, genotype and aggressiveness. DNA methylation at CpG dinucleotides is an important mechanism for regulation of gene expression. We performed targeted DNA methylation analysis of 1.505 CpG loci in 807 cancer-related genes in a cohort of 76 GISTs, combined with genome-wide mRNA expression analysis in 22 GISTs, to identify signatures associated with clinicopathological parameters and prognosis. Principal component analysis revealed distinct DNA methylation patterns associated with anatomical localization, genotype, mitotic counts and clinical follow-up. Methylation of a single CpG dinucleotide in the non-CpG island promoter of SPP1 was significantly correlated with shorter disease-free survival. Hypomethylation of this CpG was an independent prognostic parameter in a multivariate analysis compared to anatomical localization, genotype, tumor size and mitotic counts in a cohort of 141 GISTs with clinical follow-up. The epigenetic regulation of SPP1 was confirmed in vitro, and the functional impact of SPP1 protein on tumorigenesis-related signaling pathways was demonstrated. In summary, SPP1 promoter methylation is a novel and independent prognostic parameter in GISTs, and might be helpful in estimating the aggressiveness of GISTs from the intermediate-risk category. © 2014 UICC.

Lack of chart reminder effectiveness on family medicine resident JNC-VI and NCEP III guideline knowledge and attitudes.

PubMed

Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P

2004-07-05

The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

PubMed

Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

2011-05-26

The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

PubMed Central

Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

2018-01-01

CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

Genome-Wide DNA Methylation Analysis and Epigenetic Variations Associated with Congenital Aortic Valve Stenosis (AVS).

PubMed

Radhakrishna, Uppala; Albayrak, Samet; Alpay-Savasan, Zeynep; Zeb, Amna; Turkoglu, Onur; Sobolewski, Paul; Bahado-Singh, Ray O

2016-01-01

Congenital heart defect (CHD) is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS), with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated). Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS.

Genome-Wide DNA Methylation Analysis and Epigenetic Variations Associated with Congenital Aortic Valve Stenosis (AVS)

PubMed Central

Radhakrishna, Uppala; Albayrak, Samet; Alpay-Savasan, Zeynep; Zeb, Amna; Turkoglu, Onur; Sobolewski, Paul; Bahado-Singh, Ray O.

2016-01-01

Congenital heart defect (CHD) is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS), with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated). Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS. PMID:27152866

TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

PubMed Central

Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

2016-01-01

Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

NASA Astrophysics Data System (ADS)

Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

1997-09-01

Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

Automating Guidelines for Clinical Decision Support: Knowledge Engineering and Implementation.

PubMed

Tso, Geoffrey J; Tu, Samson W; Oshiro, Connie; Martins, Susana; Ashcraft, Michael; Yuen, Kaeli W; Wang, Dan; Robinson, Amy; Heidenreich, Paul A; Goldstein, Mary K

2016-01-01

As utilization of clinical decision support (CDS) increases, it is important to continue the development and refinement of methods to accurately translate the intention of clinical practice guidelines (CPG) into a computable form. In this study, we validate and extend the 13 steps that Shiffman et al. 5 identified for translating CPG knowledge for use in CDS. During an implementation project of ATHENA-CDS, we encoded complex CPG recommendations for five common chronic conditions for integration into an existing clinical dashboard. Major decisions made during the implementation process were recorded and categorized according to the 13 steps. During the implementation period, we categorized 119 decisions and identified 8 new categories required to complete the project. We provide details on an updated model that outlines all of the steps used to translate CPG knowledge into a CDS integrated with existing health information technology.

Collaborations between CpG sites in DNA methylation

NASA Astrophysics Data System (ADS)

Song, You; Ren, Honglei; Lei, Jinzhi

2017-08-01

DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

Identification of the human homolog of the imprinted mouse Air non-coding RNA

PubMed Central

Yotova, Iveta Y.; Vlatkovic, Irena M.; Pauler, Florian M.; Warczok, Katarzyna E.; Ambros, Peter F.; Oshimura, Mitsuo; Theussl, Hans-Christian; Gessler, Manfred; Wagner, Erwin F.; Barlow, Denise P.

2010-01-01

Genomic imprinting is widely conserved amongst placental mammals. Imprinted expression of IGF2R, however, differs between mice and humans. In mice, Igf2r imprinted expression is seen in all fetal and adult tissues. In humans, adult tissues lack IGF2R imprinted expression, but it is found in fetal tissues and Wilms' tumors where it is polymorphic and only seen in a small proportion of tested samples. Mouse Igf2r imprinted expression is controlled by the Air (Airn) ncRNA whose promoter lies in an intronic maternally-methylated CpG island. The human IGF2R gene carries a homologous intronic maternally-methylated CpG island of unknown function. Here, we use transfection and transgenic studies to show that the human IGF2R intronic CpG island is a ncRNA promoter. We also identify the same ncRNA at the endogenous human locus in 16–40% of Wilms' tumors. Thus, the human IGF2R gene shows evolutionary conservation of key features that control imprinted expression in the mouse. PMID:18789384

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

PubMed Central

2011-01-01

Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

PubMed

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

2011-02-15

Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

PubMed Central

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

2010-01-01

Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

PubMed

Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

2017-09-11

The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

Longitudinal study of DNA methylation during the first 5 years of life.

PubMed

Urdinguio, Rocio G; Torró, María Isabel; Bayón, Gustavo F; Álvarez-Pitti, Julio; Fernández, Agustín F; Redon, Pau; Fraga, Mario F; Lurbe, Empar

2016-06-03

Early life epigenetic programming influences adult health outcomes. Moreover, DNA methylation levels have been found to change more rapidly during the first years of life. Our aim was the identification and characterization of the CpG sites that are modified with time during the first years of life. We hypothesize that these DNA methylation changes would lead to the detection of genes that might be epigenetically modulated by environmental factors during early childhood and which, if disturbed, might contribute to susceptibility to diseases later in life. The study of the DNA methylation pattern of 485577 CpG sites was performed on 30 blood samples from 15 subjects, collected both at birth and at 5 years old, using Illumina(®) Infinium 450 k array. To identify differentially methylated CpG (dmCpG) sites, the methylation status of each probe was examined using linear models and the Empirical Bayes Moderated t test implemented in the limma package of R/Bioconductor. Surogate variable analysis was used to account for batch effects. DNA methylation levels significantly changed from birth to 5 years of age in 6641 CpG sites. Of these, 36.79 % were hypermethylated and were associated with genes related mainly to developmental ontology terms, while 63.21 % were hypomethylated probes and associated with genes related to immune function. Our results suggest that DNA methylation alterations with age during the first years of life might play a significant role in development and the regulation of leukocyte-specific functions. This supports the idea that blood leukocytes experience genome remodeling related to their interaction with environmental factors, underlining the importance of environmental exposures during the first years of life and suggesting that new strategies should be take into consideration for disease prevention.

CpG Sites Associated with Cigarette Smoking: Analysis of Epigenome-Wide Data from the Sister Study

PubMed Central

Harlid, Sophia; Xu, Zongli; Panduri, Vijayalakshmi; Sandler, Dale P.

2014-01-01

Background: Smoking increases the risk of many diseases, and it is also linked to blood DNA methylation changes that may be important in disease etiology. Objectives: We sought to identify novel CpG sites associated with cigarette smoking. Methods: We used two epigenome-wide data sets from the Sister Study to identify and confirm CpG sites associated with smoking. One included 908 women with methylation measurements at 27,578 CpG sites using the HumanMethylation27 BeadChip; the other included 200 women with methylation measurements for 473,844 CpG sites using the HumanMethylation450 BeadChip. Significant CpGs from the second data set that were not included in the 27K assay were validated by pyrosequencing in a subset of 476 samples from the first data set. Results: Our study successfully confirmed smoking associations for 9 previously established CpGs and identified 2 potentially novel CpGs: cg26764244 in GNG12 (p = 9.0 × 10–10) and cg22335340 in PTPN6 (p = 2.9 × 10–05). We also found strong evidence of an association between smoking status and cg02657160 in CPOX (p = 7.3 × 10–7), which has not been previously reported. All 12 CpGs were undermethylated in current smokers and showed an increasing percentage of methylation in former and never-smokers. Conclusions: We identified 2 potentially novel smoking related CpG sites, and provided independent replication of 10 previously reported CpGs sites related to smoking, one of which is situated in the gene CPOX. The corresponding enzyme is involved in heme biosynthesis, and smoking is known to increase heme production. Our study extends the evidence base for smoking-related changes in DNA methylation. Citation: Harlid S, Xu Z, Panduri V, Sandler DP, Taylor JA. 2014. CpG sites associated with cigarette smoking: analysis of epigenome-wide data from the Sister Study. Environ Health Perspect 122:673–678; http://dx.doi.org/10.1289/ehp.1307480 PMID:24704585

Aberrant DNA methylation at genes associated with a stem cell-like phenotype in cholangiocarcinoma tumours

PubMed Central

Dai, Wei; Siddiq, Afshan; Walley, Andrew J; Limpaiboon, Temduang; Brown, Robert

2013-01-01

Genetic abnormalities of cholangiocarcinoma have been widely studied; however, epigenomic changes related to cholangiocarcinogenesis have been less well characterised. We have profiled the DNA methylomes of 28 primary cholangiocarcinoma and six matched adjacent normal tissues using Infinium’s HumanMethylation27 BeadChips with the aim of identifying gene sets aberrantly epigenetically regulated in this tumour type. Using a linear model for microarray data we identified 1610 differentially methylated autosomal CpG sites with 809 CpG sites (representing 603 genes) being hypermethylated and 801 CpG sites (representing 712 genes) being hypomethylated in cholangiocarcinoma versus adjacent normal tissues (false discovery rate ≤ 0.05). Gene ontology and gene set enrichment analyses identified gene sets significantly associated with hypermethylation at linked CpG sites in cholangiocarcinoma including homeobox genes and target genes of PRC2, EED, SUZ12 and histone H3 trimethylation at lysine 27. We confirmed frequent hypermethylation at the homeobox genes HOXA9 and HOXD9 by bisulfite pyrosequencing in a larger cohort of cholangiocarcinoma (n = 102). Our findings indicate a key role for hypermethylation of multiple CpG sites at genes associated with a stem cell-like phenotype as a common molecular aberration in cholangiocarcinoma. These data have implications for cholangiocarcinogenesis, as well as possible novel treatment options using histone methyltransferase inhibitors. PMID:24089088

Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain

PubMed Central

Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

2014-01-01

Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ∼3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ∼2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5′ CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ∼750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain. PMID:25482058

Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain.

PubMed

Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

2014-11-01

Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ~3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ~2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5' CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ~750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain.

Bisphenol A-associated epigenomic changes in prepubescent girls: a cross-sectional study in Gharbiah, Egypt

PubMed Central

2013-01-01

Background There is now compelling evidence that epigenetic modifications link adult disease susceptibility to environmental exposures during specific life stages, including pre-pubertal development. Animal studies indicate that bisphenol A (BPA), the monomer used in epoxy resins and polycarbonate plastics, may impact health through epigenetic mechanisms, and epidemiological data associate BPA levels with metabolic disorders, behavior changes, and reproductive effects. Thus, we conducted an environmental epidemiology study of BPA exposure and CpG methylation in pre-adolescent girls from Gharbiah, Egypt hypothesizing that methylation profiles exhibit exposure-dependent trends. Methods Urinary concentrations of total (free plus conjugated) species of BPA in spot samples were quantified for 60 girls aged 10 to 13. Genome-wide CpG methylation was concurrently measured in bisulfite-converted saliva DNA using the Infinium HumanMethylation27 BeadChip (N = 46). CpG sites from four candidate genes were validated via quantitative bisulfite pyrosequencing. Results CpG methylation varied widely among girls, and higher urinary BPA concentrations were generally associated with less genomic methylation. Based on pathway analyses, genes exhibiting reduced methylation with increasing urinary BPA were involved in immune function, transport activity, metabolism, and caspase activity. In particular, hypomethylation of CpG targets on chromosome X was associated with higher urinary BPA. Using the Comparative Toxicogenomics Database, we identified a number of candidate genes in our sample that previously have been associated with BPA-related expression change. Conclusions These data indicate that BPA may affect human health through specific epigenomic modification of genes in relevant pathways. Thus, epigenetic epidemiology holds promise for the identification of biomarkers from previous exposures and the development of epigenetic-based diagnostic strategies. PMID:23590724

Methylation Analysis of the BMPR2 Gene Promoter Region in Patients With Pulmonary Arterial Hypertension.

PubMed

Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

2016-06-01

Pulmonary arterial hypertension is characterizated by obstruction of the pulmonary arteries. The gene mainly related to pathology is the bone morphogenetic protein receptor type II (BMPR2). The aim of this study was to analyze the methylation pattern of the BMPR2 promoter region in patients and controls. We used Methyl Primer Express(®) v.1.0 and MatInspector softwares to analyze this region. Genomic DNA obtained from the peripheral blood of patients and controls was modified with sodium bisulphite. Methylation was analyzed using methylation-specific PCR. DNA treated with CpG methyltransferase was used as a positive control for methylation and H1299 cell culture DNA was used as positive control for gene expression. We identified a CpG island, which may have been methylated, in the BMPR2 promoter region, in addition to NIT-2 (global-acting regulatory protein), sex-determining region Y) and heat shock factor transcription factor binding sites. We found no evidence of methylation in patients and controls. No methylated CpG sites were identified in H1299 cells expressing the BMPR2 gene. The BMPR2 promoter region is the most suitable for study because of the high number of transcription factor binding sites that could alter gene function. No evidence of methylation was detected in this region in patients and controls. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

Functional characterization of dI6 interneurons in the neonatal mouse spinal cord.

PubMed

Dyck, Jason; Lanuza, Guillermo M; Gosgnach, Simon

2012-06-01

Our understanding of the neural control of locomotion has been greatly enhanced by the ability to identify and manipulate genetically defined populations of interneurons that comprise the locomotor central pattern generator (CPG). To date, the dI6 interneurons are one of the few populations that settle in the ventral region of the postnatal spinal cord that have not been investigated. In the present study, we utilized a novel transgenic mouse line to electrophysiologically characterize dI6 interneurons located close to the central canal and study their function during fictive locomotion. The majority of dI6 cells investigated were found to be rhythmically active during fictive locomotion and could be divided into two electrophysiologically distinct populations of interneurons. The first population fired rhythmic trains of action potentials that were loosely coupled to ventral root output and contained several intrinsic membrane properties of rhythm-generating neurons, raising the possibility that these cells may be involved in the generation of rhythmic activity in the locomotor CPG. The second population fired rhythmic trains of action potentials that were tightly coupled to ventral root output and lacked intrinsic oscillatory mechanisms, indicating that these neurons may be driven by a rhythm-generating network. Together these results indicate that dI6 neurons comprise an important component of the locomotor CPG that participate in multiple facets of motor behavior.

Functional characterization of dI6 interneurons in the neonatal mouse spinal cord

PubMed Central

Dyck, Jason; Lanuza, Guillermo M.

2012-01-01

Our understanding of the neural control of locomotion has been greatly enhanced by the ability to identify and manipulate genetically defined populations of interneurons that comprise the locomotor central pattern generator (CPG). To date, the dI6 interneurons are one of the few populations that settle in the ventral region of the postnatal spinal cord that have not been investigated. In the present study, we utilized a novel transgenic mouse line to electrophysiologically characterize dI6 interneurons located close to the central canal and study their function during fictive locomotion. The majority of dI6 cells investigated were found to be rhythmically active during fictive locomotion and could be divided into two electrophysiologically distinct populations of interneurons. The first population fired rhythmic trains of action potentials that were loosely coupled to ventral root output and contained several intrinsic membrane properties of rhythm-generating neurons, raising the possibility that these cells may be involved in the generation of rhythmic activity in the locomotor CPG. The second population fired rhythmic trains of action potentials that were tightly coupled to ventral root output and lacked intrinsic oscillatory mechanisms, indicating that these neurons may be driven by a rhythm-generating network. Together these results indicate that dI6 neurons comprise an important component of the locomotor CPG that participate in multiple facets of motor behavior. PMID:22442567

Adopting Health Behavior Change Theory throughout the Clinical Practice Guideline Process

ERIC Educational Resources Information Center

Ceccato, Natalie E.; Ferris, Lorraine E.; Manuel, Douglas; Grimshaw, Jeremy M.

2007-01-01

Adopting a theoretical framework throughout the clinical practice guideline (CPG) process (development, dissemination, implementation, and evaluation) can be useful in systematically identifying, addressing, and explaining behavioral influences impacting CPG uptake and effectiveness. This article argues that using a theoretical framework should…

Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion

PubMed Central

Dayeh, Tasnim; Volkov, Petr; Salö, Sofia; Hall, Elin; Nilsson, Emma; Olsson, Anders H.; Kirkpatrick, Clare L.; Wollheim, Claes B.; Eliasson, Lena; Rönn, Tina; Bacos, Karl; Ling, Charlotte

2014-01-01

Impaired insulin secretion is a hallmark of type 2 diabetes (T2D). Epigenetics may affect disease susceptibility. To describe the human methylome in pancreatic islets and determine the epigenetic basis of T2D, we analyzed DNA methylation of 479,927 CpG sites and the transcriptome in pancreatic islets from T2D and non-diabetic donors. We provide a detailed map of the global DNA methylation pattern in human islets, β- and α-cells. Genomic regions close to the transcription start site showed low degrees of methylation and regions further away from the transcription start site such as the gene body, 3′UTR and intergenic regions showed a higher degree of methylation. While CpG islands were hypomethylated, the surrounding 2 kb shores showed an intermediate degree of methylation, whereas regions further away (shelves and open sea) were hypermethylated in human islets, β- and α-cells. We identified 1,649 CpG sites and 853 genes, including TCF7L2, FTO and KCNQ1, with differential DNA methylation in T2D islets after correction for multiple testing. The majority of the differentially methylated CpG sites had an intermediate degree of methylation and were underrepresented in CpG islands (∼7%) and overrepresented in the open sea (∼60%). 102 of the differentially methylated genes, including CDKN1A, PDE7B, SEPT9 and EXOC3L2, were differentially expressed in T2D islets. Methylation of CDKN1A and PDE7B promoters in vitro suppressed their transcriptional activity. Functional analyses demonstrated that identified candidate genes affect pancreatic β- and α-cells as Exoc3l silencing reduced exocytosis and overexpression of Cdkn1a, Pde7b and Sept9 perturbed insulin and glucagon secretion in clonal β- and α-cells, respectively. Together, our data can serve as a reference methylome in human islets. We provide new target genes with altered DNA methylation and expression in human T2D islets that contribute to perturbed insulin and glucagon secretion. These results highlight the importance of epigenetics in the pathogenesis of T2D. PMID:24603685

[Comparative analysis of methylation profiles in tissues of oral leukoplakia and oral squamous cell carcinoma].

PubMed

Fu, J; Su, Y; Liu, Y; Zhang, X Y

2018-04-09

Objective: To compare the methylation profiles in tissues of oral leukoplakia (OLK) and oral squamous cell carcinoma (OSCC) with healthy tissues of oral mucosa, in order to identify the role of DNA methylation played in tumorigenesis. Methods: DNA samples extracted from tissues of 4 healthy oral mucosa, 4 OSCC and 4 OLK collected from patients of the Department of Oral Medicine, Capital Medical University School of Stomatology were examined and compared using Methylation 450 Bead Chip. The genes associated with differentially methylated CpG sites were selected for gene ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment. Results: Multiple differentially methylated CpG sites were identified by using the above mentioned assay. Hypermethylation constitutes 86.18% (23 290/27 025) of methylation changes in OLK and hypomethylation accounts for 13.82% (3 734/27 025) of methylation changes. Both hypermethylated and hypomethylated CpG sites were markedly increased in OSCC tissue compared with OLK tissue. The majority of differentially methylated CpG sites were located outside CpG islands, with approximately one-fourth in CpG shores flanking the islands, which were considered highly important for gene regulation and tumorigenesis. Pathway analysis revealed that differentially methylated CpG sites in both OLK and OSCC patients shared the same pathway enrichments, most of which were correlated with carcinogenesis and cancer progression (e.g., DNA repair, cell cycle, and apoptosis). Conclusions: In the present study, methylation-associated alterations affect almost all pathways in the cellular network in both OLK and OSCC. OLK and OSCC shared similar methylation changes whether in pathways or genes, indicating that epigenetically they might have the same molecular basis for disease progression.

To Enforce or Not to Enforce? The Use of Collaborative Interfaces to Promote Social Skills in Children with High Functioning Autism Spectrum Disorder

ERIC Educational Resources Information Center

Ben-Sasson, Ayelet; Lamash, Liron; Gal, Eynat

2013-01-01

The goal of this study was to examine whether a technological touch activated Collaborative Puzzle Game (CPG) increased positive social behaviors in children with high functioning autism spectrum disorder (HFASD). The CPG involved construction of a virtual puzzle by selecting and dragging pieces into the solution area on a touch screen table. The…

Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes.

PubMed

Mahmood, Khalid; Højland, Dorte H; Asp, Torben; Kristensen, Michael

2016-01-01

Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification.

Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

PubMed Central

Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

2011-01-01

Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

Motor Neurons Tune Premotor Activity in a Vertebrate Central Pattern Generator

PubMed Central

2017-01-01

Central patterns generators (CPGs) are neural circuits that drive rhythmic motor output without sensory feedback. Vertebrate CPGs are generally believed to operate in a top-down manner in which premotor interneurons activate motor neurons that in turn drive muscles. In contrast, the frog (Xenopus laevis) vocal CPG contains a functionally unexplored neuronal projection from the motor nucleus to the premotor nucleus, indicating a recurrent pathway that may contribute to rhythm generation. In this study, we characterized the function of this bottom-up connection. The X. laevis vocal CPG produces a 50–60 Hz “fast trill” song used by males during courtship. We recorded “fictive vocalizations” in the in vitro CPG from the laryngeal nerve while simultaneously recording premotor activity at the population and single-cell level. We show that transecting the motor-to-premotor projection eliminated the characteristic firing rate of premotor neurons. Silencing motor neurons with the intracellular sodium channel blocker QX-314 also disrupted premotor rhythms, as did blockade of nicotinic synapses in the motor nucleus (the putative location of motor neuron-to-interneuron connections). Electrically stimulating the laryngeal nerve elicited primarily IPSPs in premotor neurons that could be blocked by a nicotinic receptor antagonist. Our results indicate that an inhibitory signal, activated by motor neurons, is required for proper CPG function. To our knowledge, these findings represent the first example of a CPG in which precise premotor rhythms are tuned by motor neuron activity. SIGNIFICANCE STATEMENT Central pattern generators (CPGs) are neural circuits that produce rhythmic behaviors. In vertebrates, motor neurons are not commonly known to contribute to CPG function, with the exception of a few spinal circuits where the functional significance of motor neuron feedback is still poorly understood. The frog hindbrain vocal circuit contains a previously unexplored connection from the motor to premotor region. Our results indicate that motor neurons activate this bottom-up connection, and blocking this signal eliminates normal premotor activity. These findings may promote increased awareness of potential involvement of motor neurons in a wider range of CPGs, perhaps clarifying our understanding of network principles underlying motor behaviors in numerous organisms, including humans. PMID:28219984

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

PubMed

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

2017-10-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

PubMed Central

Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

2010-01-01

The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

PubMed

Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

2007-09-01

The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

Next-generation sequencing identifies major DNA methylation changes during progression of Ph+ chronic myeloid leukemia

PubMed Central

Heller, G; Topakian, T; Altenberger, C; Cerny-Reiterer, S; Herndlhofer, S; Ziegler, B; Datlinger, P; Byrgazov, K; Bock, C; Mannhalter, C; Hörmann, G; Sperr, W R; Lion, T; Zielinski, C C; Valent, P; Zöchbauer-Müller, S

2016-01-01

Little is known about the impact of DNA methylation on the evolution/progression of Ph+ chronic myeloid leukemia (CML). We investigated the methylome of CML patients in chronic phase (CP-CML), accelerated phase (AP-CML) and blast crisis (BC-CML) as well as in controls by reduced representation bisulfite sequencing. Although only ~600 differentially methylated CpG sites were identified in samples obtained from CP-CML patients compared with controls, ~6500 differentially methylated CpG sites were found in samples from BC-CML patients. In the majority of affected CpG sites, methylation was increased. In CP-CML patients who progressed to AP-CML/BC-CML, we identified up to 897 genes that were methylated at the time of progression but not at the time of diagnosis. Using RNA-sequencing, we observed downregulated expression of many of these genes in BC-CML compared with CP-CML samples. Several of them are well-known tumor-suppressor genes or regulators of cell proliferation, and gene re-expression was observed by the use of epigenetic active drugs. Together, our results demonstrate that CpG site methylation clearly increases during CML progression and that it may provide a useful basis for revealing new targets of therapy in advanced CML. PMID:27211271

Differential methylation of the oxytocin receptor gene in patients with anorexia nervosa: a pilot study.

PubMed

Kim, Youl-Ri; Kim, Jeong-Hyun; Kim, Mi Jeong; Treasure, Janet

2014-01-01

Recent studies in patients with anorexia nervosa suggest that oxytocin may be involved in the pathophysiology of anorexia nervosa. We examined whether there was evidence of variation in methylation status of the oxytocin receptor (OXTR) gene in patients with anorexia nervosa that might account for these findings. We analyzed the methylation status of the CpG sites in a region from the exon 1 to the MT2 regions of the OXTR gene in buccal cells from 15 patients and 36 healthy women using bisulfite sequencing. We further examined whether methylation status was associated with markers of illness severity or form. We identified six CpG sites with significant differences in average methylation levels between the patient and control groups. Among the six differentially methylated CpG sites, five showed higher than average methylation levels in patients than those in the control group (64.9-88.8% vs. 6.6-45.0%). The methylation levels of these five CpG sites were negatively associated with body mass index (BMI). BMI, eating disorders psychopathology, and anxiety were identified in a regression analysis as factors affecting the methylation levels of these CpG sites with more variation accounted for by BMI. Epigenetic misregulation of the OXTR gene may be implicated in anorexia nervosa, which may either be a mechanism linking environmental adversity to risk or may be a secondary consequence of the illness.

Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

PubMed Central

Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

2012-01-01

The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

Computational Approaches to Identify Promoters and cis-Regulatory Elements in Plant Genomes1

PubMed Central

Rombauts, Stephane; Florquin, Kobe; Lescot, Magali; Marchal, Kathleen; Rouzé, Pierre; Van de Peer, Yves

2003-01-01

The identification of promoters and their regulatory elements is one of the major challenges in bioinformatics and integrates comparative, structural, and functional genomics. Many different approaches have been developed to detect conserved motifs in a set of genes that are either coregulated or orthologous. However, although recent approaches seem promising, in general, unambiguous identification of regulatory elements is not straightforward. The delineation of promoters is even harder, due to its complex nature, and in silico promoter prediction is still in its infancy. Here, we review the different approaches that have been developed for identifying promoters and their regulatory elements. We discuss the detection of cis-acting regulatory elements using word-counting or probabilistic methods (so-called “search by signal” methods) and the delineation of promoters by considering both sequence content and structural features (“search by content” methods). As an example of search by content, we explored in greater detail the association of promoters with CpG islands. However, due to differences in sequence content, the parameters used to detect CpG islands in humans and other vertebrates cannot be used for plants. Therefore, a preliminary attempt was made to define parameters that could possibly define CpG and CpNpG islands in Arabidopsis, by exploring the compositional landscape around the transcriptional start site. To this end, a data set of more than 5,000 gene sequences was built, including the promoter region, the 5′-untranslated region, and the first introns and coding exons. Preliminary analysis shows that promoter location based on the detection of potential CpG/CpNpG islands in the Arabidopsis genome is not straightforward. Nevertheless, because the landscape of CpG/CpNpG islands differs considerably between promoters and introns on the one side and exons (whether coding or not) on the other, more sophisticated approaches can probably be developed for the successful detection of “putative” CpG and CpNpG islands in plants. PMID:12857799

Genome-Wide Assessment of Differential DNA Methylation Associated with Autoantibody Production in Systemic Lupus Erythematosus.

PubMed

Chung, Sharon A; Nititham, Joanne; Elboudwarej, Emon; Quach, Hong L; Taylor, Kimberly E; Barcellos, Lisa F; Criswell, Lindsey A

2015-01-01

Systemic lupus erythematosus (SLE) is characterized by the development of autoantibodies associated with specific clinical manifestations. Previous studies have shown an association between differential DNA methylation and SLE susceptibility, but have not investigated SLE-related autoantibodies. Our goal was to determine whether DNA methylation is associated with production of clinically relevant SLE-related autoantibodies, with an emphasis on the anti-dsDNA autoantibody. In this study, we characterized the methylation status of 467,314 CpG sites in 326 women with SLE. Using a discovery and replication study design, we identified and replicated significant associations between anti-dsDNA autoantibody production and the methylation status of 16 CpG sites (pdiscovery<1.07E-07 and preplication<0.0029) in 11 genes. Associations were further investigated using multivariable regression to adjust for estimated leukocyte cell proportions and population substructure. The adjusted mean DNA methylation difference between anti-dsDNA positive and negative cases ranged from 1.2% to 19%, and the adjusted odds ratio for anti-dsDNA autoantibody production comparing the lowest and highest methylation tertiles ranged from 6.8 to 18.2. Differential methylation for these CpG sites was also associated with anti-SSA, anti-Sm, and anti-RNP autoantibody production. Overall, associated CpG sites were hypomethylated in autoantibody positive compared to autoantibody negative cases. Differential methylation of CpG sites within the major histocompatibility region was not strongly associated with autoantibody production. Genes with differentially methylated CpG sites represent multiple biologic pathways, and have not been associated with autoantibody production in genetic association studies. In conclusion, hypomethylation of CpG sites within genes from different pathways is associated with anti-dsDNA, anti-SSA, anti-Sm, and anti-RNP production in SLE, and these associations are not explained by genetic variation. Thus, studies of epigenetic mechanisms such as DNA methylation represent a complementary method to genetic association studies to identify biologic pathways that may contribute to the clinical heterogeneity of autoimmune diseases.

Production and quality of clinical practice guidelines in Argentina (1994–2004): a cross-sectional study

PubMed Central

Esandi, María Eugenia; Ortiz, Zulma; Chapman, Evelina; Dieguez, Marcelo García; Mejía, Raúl; Bernztein, Ricardo

2008-01-01

Background In the last decades, a sustained increment of Clinical Practice Guidelines (CPG) production in the world has been accompanied by a growing concern about their quality. Many studies related to quality assessment of guidelines produced in High Income Countries were published; however, evidence on this topic is scarce in Low and Middle Income Countries (LMIC). The objectives of this research were: a) to describe guideline production in Argentina at different levels of the health system (macro, meso and micro) from 1994 to 2004; and b) to assess their quality by using the AGREE instrument. Methods A cross-sectional study was undertaken to describe guidelines production in Argentina between 1994 and 2004. CPG were identified through Internet and electronic databases (MEDLINE and LILACS). Explicit inclusion and exclusion criteria were used to select guidelines. Each CPG was independently assessed by two reviewers using the AGREE instrument. Domain scores were calculated as recommended by the AGREE Collaboration. The internal consistency of each domain was evaluated using Cronbach's alpha and inter-observer agreement by the Intraclass Correlation Coefficient (ICC). Results A total amount of 431 potential CPG were identified, but only 144 were considered CPG. At the end, 101 CPG were included for further assessment. Median standardized score for each domain were: scope = 39%; stakeholder involvement = 13%; rigour of development = 10%; clarity = 42%; applicability = 6%; editorial independence = 0%. Only 22 CPG were recommended with modifications by both appraisers. ICC and Cronbach's alpha for each domain were in all cases moderate or high (greater than 0.40), except for editorial independence. Conclusion This study has systematically employed the AGREE instrument for the critical assessment of guidelines produced in a LMIC. Guideline development and diffusion in Argentina from 1994 to 2004 shows a constant increment, although quality of reporting did not improve; moreover, in some aspects it seemed to decline. Much room for improvement of the guideline development process was found at all levels of the health system. PMID:18851739

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

PubMed Central

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

2017-01-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

PubMed

Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

2016-01-01

Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

Sexual epigenetic dimorphism in the human placenta: implications for susceptibility during the prenatal period.

PubMed

Martin, Elizabeth; Smeester, Lisa; Bommarito, Paige A; Grace, Matthew R; Boggess, Kim; Kuban, Karl; Karagas, Margaret R; Marsit, Carmen J; O'Shea, T Michael; Fry, Rebecca C

2017-03-01

Sex-based differences in response to adverse prenatal environments and infant outcomes have been observed, yet the underlying mechanisms for this are unclear. The placental epigenome may be a driver of these differences. Placental DNA methylation was assessed at more than 480,000 CpG sites from male and female infants enrolled in the extremely low gestational age newborns cohort (ELGAN) and validated in a separate US-based cohort. The impact of gestational age on placental DNA methylation was further examined using the New Hampshire Birth Cohort Study for a total of n = 467 placentas. A total of n = 2745 CpG sites, representing n = 587 genes, were identified as differentially methylated (p < 1 × 10 -7 ). The majority (n = 582 or 99%) of these were conserved among the New Hampshire Birth Cohort. The identified genes encode proteins related to immune function, growth/transcription factor signaling and transport across cell membranes. These data highlight sex-dependent epigenetic patterning in the placenta and provide insight into differences in infant outcomes and responses to the perinatal environment.

Genetic recombination is targeted towards gene promoter regions in dogs.

PubMed

Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

2013-01-01

The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

PubMed Central

Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

2013-01-01

Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles.

PubMed

Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh

2017-03-09

It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.

DNA methylation levels in candidate genes associated with chronological age in mammals are not conserved in a long-lived seabird

PubMed Central

Polanowski, Andrea M.; McMahon, Clive; Deagle, Bruce E.; Dickinson, Joanne L.; Hindell, Mark A.; Jarman, Simon N.

2017-01-01

Most seabirds do not have any outward identifiers of their chronological age, so estimation of seabird population age structure generally requires expensive, long-term banding studies. We investigated the potential to use a molecular age biomarker to estimate age in short-tailed shearwaters (Ardenna tenuirostris). We quantified DNA methylation in several A. tenuirostris genes that have shown age-related methylation changes in mammals. In birds ranging from chicks to 21 years of age, bisulphite treated blood and feather DNA was sequenced and methylation levels analysed in 67 CpG sites in 13 target gene regions. From blood samples, five of the top relationships with age were identified in KCNC3 loci (CpG66: R2 = 0.325, p = 0.019). In feather samples ELOVL2 (CpG42: R2 = 0.285, p = 0.00048) and EDARADD (CpG46: R2 = 0.168, p = 0.0067) were also weakly correlated with age. However, the majority of markers had no clear association with age (of 131 comparisons only 12 had a p-value < 0.05) and statistical analysis using a penalised lasso approach did not produce an accurate ageing model. Our data indicate that some age-related signatures identified in orthologous mammalian genes are not conserved in the long-lived short tailed shearwater. Alternative molecular approaches will be required to identify a reliable biomarker of chronological age in these seabirds. PMID:29216256

Validation of DAB2IP methylation and its relative significance in predicting outcome in renal cell carcinoma

PubMed Central

Zhao, Liang-Yun; Kapur, Payal; Wu, Kai-Jie; Wang, Bin; Yu, Yan-Hong; Liao, Bing; He, Da-Lin; Chen, Wei; Margulis, Vitaly; Hsieh, Jer-Tsong; Luo, Jun-Hang

2016-01-01

We have recently reported tumor suppressive role of DAB2IP in RCC development. In this study, We identified one CpG methylation biomarker (DAB2IP CpG1) located UTSS of DAB2IP that was associated with poor overall survival in a cohort of 318 ccRCC patients from the Cancer Genome Atlas (TCGA). We further validated the prognostic accuracy of DAB2IP CpG methylation by pyrosequencing quantitative methylation assay in 224 ccRCC patients from multiple Chinese centers (MCHC set), and 239 patients from University of Texas Southwestern Medical Center at Dallas (UTSW set) by using FFPE samples. DAB2IP CpG1 can predict the overall survival of patients in TCGA, MCHC, and UTSW sets independent of patient age, Fuhrman grade and TNM stage (all p<0.05). DAB2IP CpG1 successfully categorized patients into high-risk and low-risk groups with significant differences of clinical outcome in respective clinical subsets, regardless of age, sex, grade, stage, or race (HR: 1.63-7.83; all p<0.05). The detection of DAB2IP CpG1 methylation was minimally affected by ITH in ccRCC. DAB2IP mRNA expression was regulated by DNA methylation in vitro. DAB2IP CpG1 methylation is a practical and repeatable biomarker for ccRCC, which can provide prognostic value that complements the current staging system. PMID:27129174

Provider Adherence to Implementation of Clinical Practice Guidelines for Neurogenic Bowel in Adults With Spinal Cord Injury

PubMed Central

Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P

2005-01-01

Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086

CpG island methylation profile in non-invasive oral rinse samples is predictive of oral and pharyngeal carcinoma.

PubMed

Langevin, Scott M; Eliot, Melissa; Butler, Rondi A; Cheong, Agnes; Zhang, Xiang; McClean, Michael D; Koestler, Devin C; Kelsey, Karl T

2015-01-01

There are currently no screening tests in routine use for oral and pharyngeal cancer beyond visual inspection and palpation, which are provided on an opportunistic basis, indicating a need for development of novel methods for early detection, particularly in high-risk populations. We sought to address this need through comprehensive interrogation of CpG island methylation in oral rinse samples. We used the Infinium HumanMethylation450 BeadArray to interrogate DNA methylation in oral rinse samples collected from 154 patients with incident oral or pharyngeal carcinoma prior to treatment and 72 cancer-free control subjects. Subjects were randomly allocated to either a training or a testing set. For each subject, average methylation was calculated for each CpG island represented on the array. We applied a semi-supervised recursively partitioned mixture model to the CpG island methylation data to identify a classifier for prediction of case status in the training set. We then applied the resultant classifier to the testing set for validation and to assess the predictive accuracy. We identified a methylation classifier comprised of 22 CpG islands, which predicted oral and pharyngeal carcinoma with a high degree of accuracy (AUC = 0.92, 95 % CI 0.86, 0.98). This novel methylation panel is a strong predictor of oral and pharyngeal carcinoma case status in oral rinse samples and may have utility in early detection and post-treatment follow-up.

Changes in the activity of a CpG neuron after the reinforcement of an operantly conditioned behavior in Lymnaea.

PubMed

Spencer, Gaynor E; Kazmi, Mustapha H; Syed, Naweed I; Lukowiak, Ken

2002-10-01

We have previously shown that the aerial respiratory behavior of the mollusk Lymnaea stagnalis can be operantly conditioned, and the central pattern generating (CPG) neurons underlying this behavior have been identified. As neural correlates of operant conditioning remain poorly defined in both vertebrates and invertebrates, we have used the Lymnaea respiratory CPG to investigate neuronal changes associated with the change in behavior after conditioning. After operant conditioning of the intact animals, semi-intact preparations were dissected, so that changes in the respiratory behavior (pneumostome openings) and underlying activity of the identified CPG neuron, right pedal dorsal 1 (RPeD1), could be monitored simultaneously. RPeD1 was studied because it initiates the rhythmic activity of the CPG and receives chemo-sensory input from the pneumostome area. Pneumostome openings and RPeD1 activity were monitored both before and after a reinforcing training stimulus applied to the open pneumostome of operantly conditioned and yoked control preparations. After presentation of the reinforcing stimulus, there was a significant reduction in both breathing behavior and RPeD1 activity in operant preparations but not in yoked and naïve controls. Furthermore these changes were only significant in the subgroup of operantly conditioned animals described as good learners and not in poor learners. These data strongly suggest that changes in RPeD1 activity may underlie the behavioral changes associated with the reinforcement of operant conditioning of the respiratory behavior.

Genome-wide DNA methylation profiling identifies ALDH1A3 promoter methylation as a prognostic predictor in G-CIMP- primary glioblastoma.

PubMed

Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao

2013-01-01

To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (P<0.01). Of the 43 CpG loci that were hypermethylated in LTS G-CIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Identification of Gene Networks Associated with Acute Myeloid Leukemia by Comparative Molecular Methylation and Expression Profiling

PubMed Central

Dellett, Margaret; O’Hagan, Kathleen Ann; Colyer, Hilary Ann Alexandra; Mills, Ken I.

2010-01-01

Around 80% of acute myeloid leukemia (AML) patients achieve a complete remission, however many will relapse and ultimately die of their disease. The association between karyotype and prognosis has been studied extensively and identified patient cohorts as having favourable [e.g. t(8; 21), inv (16)/t(16; 16), t(15; 17)], intermediate [e.g. cytogenetically normal (NK-AML)] or adverse risk [e.g. complex karyotypes]. Previous studies have shown that gene expression profiling signatures can classify the sub-types of AML, although few reports have shown a similar feature by using methylation markers. The global methylation patterns in 19 diagnostic AML samples were investigated using the Methylated CpG Island Amplification Microarray (MCAM) method and CpG island microarrays containing 12,000 CpG sites. The first analysis, comparing favourable and intermediate cytogenetic risk groups, revealed significantly differentially methylated CpG sites (594 CpG islands) between the two subgroups. Mutations in the NPM1 gene occur at a high frequency (40%) within the NK-AML subgroup and are associated with a more favourable prognosis in these patients. A second analysis comparing the NPM1 mutant and wild-type research study subjects again identified distinct methylation profiles between these two subgroups. Network and pathway analysis revealed possible molecular mechanisms associated with the different risk and/or mutation sub-groups. This may result in a better classification of the risk groups, improved monitoring targets, or the identification of novel molecular therapies. PMID:24179384

Superior diastolic function with KATP channel opener diazoxide in a novel mouse Langendorff model.

PubMed

Makepeace, Carol M; Suarez-Pierre, Alejandro; Kanter, Evelyn M; Schuessler, Richard B; Nichols, Colin G; Lawton, Jennifer S

2018-07-01

Adenosine triphosphate-sensitive potassium (K ATP ) channel openers have been found to be cardioprotective in multiple animal models via an unknown mechanism. Mouse models allow genetic manipulation of K ATP channel components for the investigation of this mechanism. Mouse Langendorff models using 30 min of global ischemia are known to induce measurable myocardial infarction and injury. Prolongation of global ischemia in a mouse Langendorff model could allow the determination of the mechanisms involved in K ATP channel opener cardioprotection. Mouse hearts (C57BL/6) underwent baseline perfusion with Krebs-Henseleit buffer (30 min), assessment of function using a left ventricular balloon, delivery of test solution, and prolonged global ischemia (90 min). Hearts underwent reperfusion (30 min) and functional assessment. Coronary flow was measured using an inline probe. Test solutions included were as follows: hyperkalemic cardioplegia alone (CPG, n = 11) or with diazoxide (CPG + DZX, n = 12). Although the CPG + DZX group had greater percent recovery of developed pressure and coronary flow, this was not statistically significant. Following a mean of 74 min (CPG) and 77 min (CPG + DZX), an additional increase in end-diastolic pressure was noted (plateau), which was significantly higher in the CPG group. Similarly, the end-diastolic pressure (at reperfusion and at the end of experiment) was significantly higher in the CPG group. Prolongation of global ischemia demonstrated added benefit when DZX was added to traditional hyperkalemic CPG. This model will allow the investigation of DZX mechanism of cardioprotection following manipulation of targeted K ATP channel components. This model will also allow translation to prolonged ischemic episodes associated with cardiac surgery. Copyright © 2018 Elsevier Inc. All rights reserved.

Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

PubMed Central

Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela

2016-01-01

Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

PubMed

Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

2013-11-07

We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

Leveraging workflow control patterns in the domain of clinical practice guidelines.

PubMed

Kaiser, Katharina; Marcos, Mar

2016-02-10

Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes

PubMed Central

Asp, Torben; Kristensen, Michael

2016-01-01

Background Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. Results The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Conclusion Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification. PMID:27019205

An input-representing interneuron regulates spike timing and thereby phase switching in a motor network.

PubMed

Sasaki, Kosei; Jing, Jian; Due, Michael R; Weiss, Klaudiusz R

2008-02-20

Despite the importance of spike-timing regulation in network functioning, little is known about this regulation at the cellular level. In the Aplysia feeding network, we show that interneuron B65 regulates the timing of the spike initiation of phase-switch neurons B64 and cerebral-buccal interneuron-5/6 (CBI-5/6), and thereby determines the identity of the neuron that acts as a protraction terminator. Previous work showed that B64 begins to fire before the end of protraction phase and terminates protraction in CBI-2-elicited ingestive, but not in CBI-2-elicited egestive programs, thus indicating that the spike timing and phase-switching function of B64 depend on the type of the central pattern generator (CPG)-elicited response rather than on the input used to activate the CPG. Here, we find that CBI-5/6 is a protraction terminator in egestive programs elicited by the esophageal nerve (EN), but not by CBI-2, thus indicating that, in contrast to B64, the spike timing and protraction-terminating function of CBI-5/6 depends on the input to the CPG rather than the response type. Interestingly, B65 activity also depends on the input in that B65 is highly active in EN-elicited programs, but not in CBI-2-elicited programs independent of whether the programs are ingestive or egestive. Notably, during EN-elicited egestive programs, hyperpolarization of B65 delays the onset of CBI-5/6 firing, whereas in CBI-2-elicited ingestive programs, B65 stimulation simultaneously advances CBI-5/6 firing and delays B64 firing, thereby substituting CBI-5/6 for B64 as the protraction terminator. Thus, we identified a neural mechanism that, in an input-dependent manner, regulates spike timing and thereby the functional role of specific neurons.

DNA methylome profiling identifies novel methylated genes in African American patients with colorectal neoplasia.

PubMed

Ashktorab, Hassan; Daremipouran, M; Goel, Ajay; Varma, Sudhir; Leavitt, R; Sun, Xueguang; Brim, Hassan

2014-04-01

The identification of genes that are differentially methylated in colorectal cancer (CRC) has potential value for both diagnostic and therapeutic interventions specifically in high-risk populations such as African Americans (AAs). However, DNA methylation patterns in CRC, especially in AAs, have not been systematically explored and remain poorly understood. Here, we performed DNA methylome profiling to identify the methylation status of CpG islands within candidate genes involved in critical pathways important in the initiation and development of CRC. We used reduced representation bisulfite sequencing (RRBS) in colorectal cancer and adenoma tissues that were compared with DNA methylome from a healthy AA subject's colon tissue and peripheral blood DNA. The identified methylation markers were validated in fresh frozen CRC tissues and corresponding normal tissues from AA patients diagnosed with CRC at Howard University Hospital. We identified and validated the methylation status of 355 CpG sites located within 16 gene promoter regions associated with CpG islands. Fifty CpG sites located within CpG islands-in genes ATXN7L1 (2), BMP3 (7), EID3 (15), GAS7 (1), GPR75 (24), and TNFAIP2 (1)-were significantly hypermethylated in tumor vs. normal tissues (P<0.05). The methylation status of BMP3, EID3, GAS7, and GPR75 was confirmed in an independent, validation cohort. Ingenuity pathway analysis mapped three of these markers (GAS7, BMP3 and GPR) in the insulin and TGF-β1 network-the two key pathways in CRC. In addition to hypermethylated genes, our analysis also revealed that LINE-1 repeat elements were progressively hypomethylated in the normal-adenoma-cancer sequence. We conclude that DNA methylome profiling based on RRBS is an effective method for screening aberrantly methylated genes in CRC. While previous studies focused on the limited identification of hypermethylated genes, ours is the first study to systematically and comprehensively identify novel hypermethylated genes, as well as hypomethylated LINE-1 sequences, which may serve as potential biomarkers for CRC in African Americans. Our discovered biomarkers were intimately linked to the insulin/TGF-B1 pathway, further strengthening the association of diabetic disorders with colon oncogenic transformation.

Developmentally Programmed 3′ CpG Island Methylation Confers Tissue- and Cell-Type-Specific Transcriptional Activation

PubMed Central

Yu, Da-Hai; Ware, Carol; Waterland, Robert A.; Zhang, Jiexin; Chen, Miao-Hsueh; Gadkari, Manasi; Kunde-Ramamoorthy, Govindarajan; Nosavanh, Lagina M.

2013-01-01

During development, a small but significant number of CpG islands (CGIs) become methylated. The timing of developmentally programmed CGI methylation and associated mechanisms of transcriptional regulation during cellular differentiation, however, remain poorly characterized. Here, we used genome-wide DNA methylation microarrays to identify epigenetic changes during human embryonic stem cell (hESC) differentiation. We discovered a group of CGIs associated with developmental genes that gain methylation after hESCs differentiate. Conversely, erasure of methylation was observed at the identified CGIs during subsequent reprogramming to induced pluripotent stem cells (iPSCs), further supporting a functional role for the CGI methylation. Both global gene expression profiling and quantitative reverse transcription-PCR (RT-PCR) validation indicated opposing effects of CGI methylation in transcriptional regulation during differentiation, with promoter CGI methylation repressing and 3′ CGI methylation activating transcription. By studying diverse human tissues and mouse models, we further confirmed that developmentally programmed 3′ CGI methylation confers tissue- and cell-type-specific gene activation in vivo. Importantly, luciferase reporter assays provided evidence that 3′ CGI methylation regulates transcriptional activation via a CTCF-dependent enhancer-blocking mechanism. These findings expand the classic view of mammalian CGI methylation as a mechanism for transcriptional silencing and indicate a functional role for 3′ CGI methylation in developmental gene regulation. PMID:23459939

Survival differences of CIMP subtypes integrated with CNA information in human breast cancer.

PubMed

Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

2017-07-25

CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach.

Survival differences of CIMP subtypes integrated with CNA information in human breast cancer

PubMed Central

Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

2017-01-01

CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach. PMID:28415743

Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

PubMed Central

Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

2015-01-01

Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

PubMed

Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

2015-08-01

Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

PubMed

Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

2004-09-01

Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

PubMed

Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

2018-05-16

Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

Impact of neonatal iron deficiency on hippocampal DNA methylation and gene transcription in a porcine biomedical model of cognitive development.

PubMed

Schachtschneider, Kyle M; Liu, Yingkai; Rund, Laurie A; Madsen, Ole; Johnson, Rodney W; Groenen, Martien A M; Schook, Lawrence B

2016-11-03

Iron deficiency is a common childhood micronutrient deficiency that results in altered hippocampal function and cognitive disorders. However, little is known about the mechanisms through which neonatal iron deficiency results in long lasting alterations in hippocampal gene expression and function. DNA methylation is an epigenetic mark involved in gene regulation and altered by environmental factors. In this study, hippocampal DNA methylation and gene expression were assessed via reduced representation bisulfite sequencing and RNA-seq on samples from a previous study reporting reduced hippocampal-based learning and memory in a porcine biomedical model of neonatal iron deficiency. In total 192 differentially expressed genes (DEGs) were identified between the iron deficient and control groups. GO term and pathway enrichment analysis identified DEGs associated with hypoxia, angiogenesis, increased blood brain barrier (BBB) permeability, and altered neurodevelopment and function. Of particular interest are genes previously implicated in cognitive deficits and behavioral disorders in humans and mice, including HTR2A, HTR2C, PAK3, PRSS12, and NETO1. Altered genome-wide DNA methylation was observed across 0.5 million CpG and 2.4 million non-CpG sites. In total 853 differentially methylated (DM) CpG and 99 DM non-CpG sites were identified between groups. Samples clustered by group when comparing DM non-CpG sites, suggesting high conservation of non-CpG methylation in response to neonatal environment. In total 12 DM sites were associated with 9 DEGs, including genes involved in angiogenesis, neurodevelopment, and neuronal function. Neonatal iron deficiency leads to altered hippocampal DNA methylation and gene regulation involved in hypoxia, angiogenesis, increased BBB permeability, and altered neurodevelopment and function. Together, these results provide new insights into the mechanisms through which neonatal iron deficiency results in long lasting reductions in cognitive development in humans.

Differential DNA Methylation in Relation to Age and Health Risks of Obesity.

PubMed

Mansego, María Luisa; Milagro, Fermín I; Zulet, María Ángeles; Moreno-Aliaga, María J; Martínez, José Alfredo

2015-07-24

The aim of this study was to evaluate whether genome-wide levels of DNA methylation are associated with age and the health risks of obesity (HRO); defined according to BMI categories as "Low HRO" (overweight and class 1 obesity) versus "High HRO" (class 2 and class 3 obesity). Anthropometric measurements were assessed in a subsample of 48 volunteers from the Metabolic Syndrome Reduction in Navarra (RESMENA) study and 24 women from another independent study, Effects of Lipoic Acid and Eicosapentaenoic Acid in Human Obesity (OBEPALIP study). In the pooled population; the methylation levels of 55 CpG sites were significantly associated with age after Benjamini-Hochberg correction. In addition, DNA methylation of three CpG sites located in ELOVL2; HOXC4 and PI4KB were further negatively associated with their mRNA levels. Although no differentially methylated CpG sites were identified in relation to HRO after multiple testing correction; several nominally significant CpG sites were identified in genes related to insulin signaling; energy and lipid metabolism. Moreover, statistically significant associations between BMI or mRNA levels and two HRO-related CpG sites located in GPR133 and ITGB5 are reported. As a conclusion, these findings from two Spanish cohorts add knowledge about the important role of DNA methylation in the age-related regulation of gene expression. In addition; a relevant influence of age on DNA methylation in white blood cells was found, as well as, on a trend level, novel associations between DNA methylation and obesity.

Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.

PubMed

Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J

2016-08-01

Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

Integrative Cardiac Health Project, Windber Research Institute

DTIC Science & Technology

2014-07-01

laparoscopically placed adjustable gastric banding (LAGB) baseline (5) and one year (5), control baseline (5) and one year (5). OD260/280 ratios...coverage and detection of 3-4 million CpG sites . All samples had a bisulfite conversion rate of >98.25%; number of CpG (methylated) sites per sample...methylation) and hyper-methylated (increasing methylation) sites in the three groups were identified. For LAGB patients, a heat map based on

Genetic Recombination Is Targeted towards Gene Promoter Regions in Dogs

PubMed Central

Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J. Kim; Hayward, Jessica J.; Cohen, Paula E.; Greally, John M.; Wang, Jun; Bustamante, Carlos D.; Boyko, Adam R.

2013-01-01

The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred. PMID:24348265

Understanding and treatment of chronic abdominal pain in pediatric primary care.

PubMed

Schurman, Jennifer Verrill; Kessler, Emily D; Friesen, Craig A

2014-10-01

This study examined the practices used by primary care pediatricians to assess and treat chronic abdominal pain (CAP), as an initial step in guiding clinical practice guideline (CPG) development. A survey was mailed to a random sample of office-based pediatrician members (primary care pediatricians [PCPs]) of the American Medical Association. PCPs (n = 470) provided information about the typical presentation of CAP, assessment/treatment approaches used in their own practice, their definition of a functional gastrointestinal disorder (FGID), and their familiarity with the Rome Criteria for diagnosing FGIDs. Substantial variability among PCPs was noted across all these areas. Results suggest that perceptions and practices of pediatric CAP vary widely among PCPs; no single standard of care emerged to guide development of a CPG for this population. Future research should evaluate the efficacy of specific strategies currently in use to identify potential opportunities for improving assessment and treatment of CAP in pediatric primary care. © The Author(s) 2014.

Providers' perceptions of spinal cord injury pressure ulcer guidelines.

PubMed

Thomason, Susan S; Evitt, Celinda P; Harrow, Jeffrey J; Love, Linda; Moore, D Helen; Mullins, Maria A; Powell-Cope, Gail; Nelson, Audrey L

2007-01-01

Pressure ulcers are a serious complication for people with spinal cord injury (SCI). The Consortium for Spinal Cord Medicine (CSCM) published clinical practice guidelines (CPGs) that provided guidance for pressure ulcer prevention and treatment after SCI. The aim of this study was to assess providers' perceptions for each of the 32 CPG recommendations regarding their agreement with CPGs, degree of CPG implementation, and CPG implementation barriers and facilitators. This descriptive mixed-methods study included both qualitative (focus groups) and quantitative (survey) data collection approaches. The sample (n = 60) included 24 physicians and 36 nurses who attended the 2004 annual national conferences of the American Paraplegia Society or American Association of Spinal Cord Injury Nurses. This sample drew from two sources: a purposive sample from a list of preregistered participants and a convenience sample of conference attendee volunteers. We analyzed quantitative data using descriptive statistics and qualitative data using a coding scheme to capture barriers and facilitators. The focus groups agreed unanimously on the substance of 6 of the 32 recommendations. Nurse and physician focus groups disagreed on the degree of CGP implementation at their sites, with nurses as a group perceiving less progress in implementation of the guideline recommendations. The focus groups identified only one recommendation, complications of surgery, as being fully implemented at their sites. Categories of barriers and facilitators for implementation of CPGs that emerged from the qualitative analysis included (a) characteristics of CPGs: need for research/evidence, (b) characteristics of CPGs: complexity of design and wording, (c) organizational factors, (d) lack of knowledge, and (e) lack of resources. Although generally SCI physicians and nurses agreed with the CPG recommendations as written, they did not feel these recommendations were fully implemented in their respective clinical settings. The focus groups identified multiple barriers to the implementation of the CPGs and suggested several facilitators/solutions to improve implementation of these guidelines in SCI. Participants identified organizational factors and the lack of knowledge as the most substantial systems/issues that created barriers to CPG implementation.

Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer's disease model cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee

2011-11-04

Highlights: Black-Right-Pointing-Pointer Genome-wide DNA methylation pattern in Alzheimer's disease model cell line. Black-Right-Pointing-Pointer Integrated analysis of CpG methylation and mRNA expression profiles. Black-Right-Pointing-Pointer Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. Black-Right-Pointing-Pointer The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer's disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterationsmore » in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2 Prime -deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the -435, -295, and -271 CpG sites of CTIF, and at the -505 to -341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at -432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.« less

Epigenetic DNA Methylation Profiling with MSRE: A Quantitative NGS Approach Using a Parkinson's Disease Test Case

PubMed Central

Marsh, Adam G.; Cottrell, Matthew T.; Goldman, Morton F.

2016-01-01

Epigenetics is a rapidly developing field focused on deciphering chemical fingerprints that accumulate on human genomes over time. As the nascent idea of precision medicine expands to encompass epigenetic signatures of diagnostic and prognostic relevance, there is a need for methodologies that provide high-throughput DNA methylation profiling measurements. Here we report a novel quantification methodology for computationally reconstructing site-specific CpG methylation status from next generation sequencing (NGS) data using methyl-sensitive restriction endonucleases (MSRE). An integrated pipeline efficiently incorporates raw NGS metrics into a statistical discrimination platform to identify functional linkages between shifts in epigenetic DNA methylation and disease phenotypes in samples being analyzed. In this pilot proof-of-concept study we quantify and compare DNA methylation in blood serum of individuals with Parkinson's Disease relative to matched healthy blood profiles. Even with a small study of only six samples, a high degree of statistical discrimination was achieved based on CpG methylation profiles between groups, with 1008 statistically different CpG sites (p < 0.0025, after false discovery rate correction). A methylation load calculation was used to assess higher order impacts of methylation shifts on genes and pathways and most notably identified FGF3, FGF8, HTT, KMTA5, MIR8073, and YWHAG as differentially methylated genes with high relevance to Parkinson's Disease and neurodegeneration (based on PubMed literature citations). Of these, KMTA5 is a histone methyl-transferase gene and HTT is Huntington Disease Protein or Huntingtin, for which there are well established neurodegenerative impacts. The future need for precision diagnostics now requires more tools for exploring epigenetic processes that may be linked to cellular dysfunction and subsequent disease progression. PMID:27853465

The central pattern generator underlying swimming in Dendronotus iris: a simple half-center network oscillator with a twist.

PubMed

Sakurai, Akira; Katz, Paul S

2016-10-01

The nudibranch mollusc, Dendronotus iris, swims by rhythmically flexing its body from left to right. We identified a bilaterally represented interneuron, Si3, that provides strong excitatory drive to the previously identified Si2, forming a half-center oscillator, which functions as the central pattern generator (CPG) underlying swimming. As with Si2, Si3 inhibited its contralateral counterpart and exhibited rhythmic bursts in left-right alternation during the swim motor pattern. Si3 burst almost synchronously with the contralateral Si2 and was coactive with the efferent impulse activity in the contralateral body wall nerve. Perturbation of bursting in either Si3 or Si2 by current injection halted or phase-shifted the swim motor pattern, suggesting that they are both critical CPG members. Neither Si2 nor Si3 exhibited endogenous bursting properties when activated alone; activation of all four neurons was necessary to initiate and maintain the swim motor pattern. Si3 made a strong excitatory synapse onto the contralateral Si2 to which it is also electrically coupled. When Si3 was firing tonically but not exhibiting bursting, artificial enhancement of the Si3-to-Si2 synapse using dynamic clamp caused all four neurons to burst. In contrast, negation of the Si3-to-Si2 synapse by dynamic clamp blocked ongoing swim motor patterns. Together, these results suggest that the Dendronotus swim CPG is organized as a "twisted" half-center oscillator in which each "half" is composed of two excitatory-coupled neurons from both sides of the brain, each of which inhibits its contralateral counterpart. Consisting of only four neurons, this is perhaps the simplest known network oscillator for locomotion. Copyright © 2016 the American Physiological Society.

Genome-wide methylation analysis identifies a core set of hypermethylated genes in CIMP-H colorectal cancer.

PubMed

McInnes, Tyler; Zou, Donghui; Rao, Dasari S; Munro, Francesca M; Phillips, Vicky L; McCall, John L; Black, Michael A; Reeve, Anthony E; Guilford, Parry J

2017-03-28

Aberrant DNA methylation profiles are a characteristic of all known cancer types, epitomized by the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). Hypermethylation has been observed at CpG islands throughout the genome, but it is unclear which factors determine whether an individual island becomes methylated in cancer. DNA methylation in CRC was analysed using the Illumina HumanMethylation450K array. Differentially methylated loci were identified using Significance Analysis of Microarrays (SAM) and the Wilcoxon Signed Rank (WSR) test. Unsupervised hierarchical clustering was used to identify methylation subtypes in CRC. In this study we characterized the DNA methylation profiles of 94 CRC tissues and their matched normal counterparts. Consistent with previous studies, unsupervized hierarchical clustering of genome-wide methylation data identified three subtypes within the tumour samples, designated CIMP-H, CIMP-L and CIMP-N, that showed high, low and very low methylation levels, respectively. Differential methylation between normal and tumour samples was analysed at the individual CpG level, and at the gene level. The distribution of hypermethylation in CIMP-N tumours showed high inter-tumour variability and appeared to be highly stochastic in nature, whereas CIMP-H tumours exhibited consistent hypermethylation at a subset of genes, in addition to a highly variable background of hypermethylated genes. EYA4, TFPI2 and TLX1 were hypermethylated in more than 90% of all tumours examined. One-hundred thirty-two genes were hypermethylated in 100% of CIMP-H tumours studied and these were highly enriched for functions relating to skeletal system development (Bonferroni adjusted p value =2.88E-15), segment specification (adjusted p value =9.62E-11), embryonic development (adjusted p value =1.52E-04), mesoderm development (adjusted p value =1.14E-20), and ectoderm development (adjusted p value =7.94E-16). Our genome-wide characterization of DNA methylation in colorectal cancer has identified 132 genes hypermethylated in 100% of CIMP-H samples. Three genes, EYA4, TLX1 and TFPI2 are hypermethylated in >90% of all tumour samples, regardless of CIMP subtype.

DNA methylome and transcriptome alterations and cancer prevention by curcumin in colitis-accelerated colon cancer in mice.

PubMed

Guo, Yue; Wu, Renyi; Gaspar, John M; Sargsyan, Davit; Su, Zheng-Yuan; Zhang, Chengyue; Gao, Linbo; Cheng, David; Li, Wenji; Wang, Chao; Yin, Ran; Fang, Mingzhu; Verzi, Michael P; Hart, Ronald P; Kong, Ah-Ng

2018-05-03

Inflammation is highly associated with colon carcinogenesis. Epigenetic mechanisms could play an important role in the initiation and progression of colon cancer. Curcumin, a dietary phytochemical, shows promising effects in suppressing colitis-associated colon cancer in azoxymethane-dextran sulfate sodium (AOM-DSS) mice. However, the potential epigenetic mechanisms of curcumin in colon cancer remain unknown. In this study, the anticancer effect of curcumin in suppressing colon cancer in an 18-week AOM-DSS colon cancer mouse model was confirmed. We identified lists of differentially expressed and differentially methylated genes in pairwise comparisons and several pathways involved in the potential anticancer effect of curcumin. These pathways include LPS/IL-1-mediated inhibition of RXR function, Nrf2-mediated oxidative stress response, production of NO and ROS in macrophages and IL-6 signaling. Among these genes, Tnf stood out with decreased DNA CpG methylation of Tnf in the AOM-DSS group and reversal of the AOM-DSS induced Tnf demethylation by curcumin. These observations in Tnf methylation correlated with increased and decreased Tnf expression in RNA-seq. The functional role of DNA methylation of Tnf was further confirmed by in vitro luciferase transcriptional activity assay. In addition, the DNA methylation level in a group of inflammatory genes was decreased in the AOM+DSS group but restored by curcumin and was validated by pyrosequencing. This study shows for the first time epigenomic changes in DNA CpG methylation in the inflammatory response from colitis-associated colon cancer and the reversal of their CpG methylation changes by curcumin. Future clinical epigenetic studies with curcumin in inflammation-associated colon cancer would be warranted.

Serotonin 1B Receptor Gene (HTR1B) Methylation as a Risk Factor for Callous-Unemotional Traits in Antisocial Boys.

PubMed

Moul, Caroline; Dobson-Stone, Carol; Brennan, John; Hawes, David J; Dadds, Mark R

2015-01-01

The serotonin system is thought to play a role in the aetiology of callous-unemotional (CU) traits in children. Previous research identified a functional single nucleotide polymorphism (SNP) from the promoter region of the serotonin 1B receptor gene as being associated with CU traits in boys with antisocial behaviour problems. This research tested the hypothesis that CU traits are associated with reduced methylation of the promoter region of the serotonin 1B receptor gene due to the influence of methylation on gene expression. Participants (N = 117) were boys with antisocial behaviour problems aged 3-16 years referred to University of New South Wales Child Behaviour Research Clinics. Participants volunteered a saliva sample from which the genotype of a SNP from the promoter region of the serotonin 1B receptor gene and the methylation levels of 30 CpG sites from 3 CpG regions surrounding the location of this polymorphism were assayed. Lower levels of serotonin 1B receptor gene methylation were associated with higher levels of CU traits. This relationship, however, was found to be moderated by genotype and carried exclusively by two CpG sites for which levels of methylation were negatively associated with overall methylation levels in this region of the gene. Results provide support to the emerging literature that argues for a genetically-driven system-wide alteration in serotonin function in the aetiology of CU traits. Furthermore, the results suggest that there may be two pathways to CU traits that involve methylation of the serotonin 1B receptor gene; one that is driven by a genotypic risk and another that is associated with risk for generally increased levels of methylation. Future research that aims to replicate and further investigate these results is required.

Modulation of aerial respiratory behaviour in a pond snail.

PubMed

Lukowiak, Ken; Martens, Kara; Orr, Mike; Parvez, Kashif; Rosenegger, David; Sangha, Susan

2006-11-01

Aerial respiratory in Lymnaea is driven by a three-neuron CPG whose sufficiency and necessity has been directly demonstrated. While this CPG is 'hard-wired' it displays a tremendous amount of plasticity. That is, it is possible by employing specific training procedures to alter how it functions in a specific hypoxic environment. Thus, it is possible to study directly the causal mechanisms of long-term memory formation, forgetting, and modulation of the memory at a single cell level. Thus, it is possible to use a relatively simple three-neuron CPG to study not only important questions concerning regulation of important homeostatic mechanisms but to also use it to study how learning and non-declarative memory are mediated at a cellular level.

Formulation of vaccines containing CpG oligonucleotides and alum

PubMed Central

Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

2007-01-01

CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

DNA methylation signatures of chronic low-grade inflammation are associated with complex diseases.

PubMed

Ligthart, Symen; Marzi, Carola; Aslibekyan, Stella; Mendelson, Michael M; Conneely, Karen N; Tanaka, Toshiko; Colicino, Elena; Waite, Lindsay L; Joehanes, Roby; Guan, Weihua; Brody, Jennifer A; Elks, Cathy; Marioni, Riccardo; Jhun, Min A; Agha, Golareh; Bressler, Jan; Ward-Caviness, Cavin K; Chen, Brian H; Huan, Tianxiao; Bakulski, Kelly; Salfati, Elias L; Fiorito, Giovanni; Wahl, Simone; Schramm, Katharina; Sha, Jin; Hernandez, Dena G; Just, Allan C; Smith, Jennifer A; Sotoodehnia, Nona; Pilling, Luke C; Pankow, James S; Tsao, Phil S; Liu, Chunyu; Zhao, Wei; Guarrera, Simonetta; Michopoulos, Vasiliki J; Smith, Alicia K; Peters, Marjolein J; Melzer, David; Vokonas, Pantel; Fornage, Myriam; Prokisch, Holger; Bis, Joshua C; Chu, Audrey Y; Herder, Christian; Grallert, Harald; Yao, Chen; Shah, Sonia; McRae, Allan F; Lin, Honghuang; Horvath, Steve; Fallin, Daniele; Hofman, Albert; Wareham, Nicholas J; Wiggins, Kerri L; Feinberg, Andrew P; Starr, John M; Visscher, Peter M; Murabito, Joanne M; Kardia, Sharon L R; Absher, Devin M; Binder, Elisabeth B; Singleton, Andrew B; Bandinelli, Stefania; Peters, Annette; Waldenberger, Melanie; Matullo, Giuseppe; Schwartz, Joel D; Demerath, Ellen W; Uitterlinden, André G; van Meurs, Joyce B J; Franco, Oscar H; Chen, Yii-Der Ida; Levy, Daniel; Turner, Stephen T; Deary, Ian J; Ressler, Kerry J; Dupuis, Josée; Ferrucci, Luigi; Ong, Ken K; Assimes, Themistocles L; Boerwinkle, Eric; Koenig, Wolfgang; Arnett, Donna K; Baccarelli, Andrea A; Benjamin, Emelia J; Dehghan, Abbas

2016-12-12

Chronic low-grade inflammation reflects a subclinical immune response implicated in the pathogenesis of complex diseases. Identifying genetic loci where DNA methylation is associated with chronic low-grade inflammation may reveal novel pathways or therapeutic targets for inflammation. We performed a meta-analysis of epigenome-wide association studies (EWAS) of serum C-reactive protein (CRP), which is a sensitive marker of low-grade inflammation, in a large European population (n = 8863) and trans-ethnic replication in African Americans (n = 4111). We found differential methylation at 218 CpG sites to be associated with CRP (P < 1.15 × 10 -7 ) in the discovery panel of European ancestry and replicated (P < 2.29 × 10 -4 ) 58 CpG sites (45 unique loci) among African Americans. To further characterize the molecular and clinical relevance of the findings, we examined the association with gene expression, genetic sequence variants, and clinical outcomes. DNA methylation at nine (16%) CpG sites was associated with whole blood gene expression in cis (P < 8.47 × 10 -5 ), ten (17%) CpG sites were associated with a nearby genetic variant (P < 2.50 × 10 -3 ), and 51 (88%) were also associated with at least one related cardiometabolic entity (P < 9.58 × 10 -5 ). An additive weighted score of replicated CpG sites accounted for up to 6% inter-individual variation (R2) of age-adjusted and sex-adjusted CRP, independent of known CRP-related genetic variants. We have completed an EWAS of chronic low-grade inflammation and identified many novel genetic loci underlying inflammation that may serve as targets for the development of novel therapeutic interventions for inflammation.

Integrated analysis of epigenomic and genomic changes by DNA methylation dependent mechanisms provides potential novel biomarkers for prostate cancer.

PubMed

White-Al Habeeb, Nicole M A; Ho, Linh T; Olkhov-Mitsel, Ekaterina; Kron, Ken; Pethe, Vaijayanti; Lehman, Melanie; Jovanovic, Lidija; Fleshner, Neil; van der Kwast, Theodorus; Nelson, Colleen C; Bapat, Bharati

2014-09-15

Epigenetic silencing mediated by CpG methylation is a common feature of many cancers. Characterizing aberrant DNA methylation changes associated with tumor progression may identify potential prognostic markers for prostate cancer (PCa). We treated two PCa cell lines, 22Rv1 and DU-145 with the demethylating agent 5-Aza 2'-deoxycitidine (DAC) and global methylation status was analyzed by performing methylation-sensitive restriction enzyme based differential methylation hybridization strategy followed by genome-wide CpG methylation array profiling. In addition, we examined gene expression changes using a custom microarray. Gene Set Enrichment Analysis (GSEA) identified the most significantly dysregulated pathways. In addition, we assessed methylation status of candidate genes that showed reduced CpG methylation and increased gene expression after DAC treatment, in Gleason score (GS) 8 vs. GS6 patients using three independent cohorts of patients; the publically available The Cancer Genome Atlas (TCGA) dataset, and two separate patient cohorts. Our analysis, by integrating methylation and gene expression in PCa cell lines, combined with patient tumor data, identified novel potential biomarkers for PCa patients. These markers may help elucidate the pathogenesis of PCa and represent potential prognostic markers for PCa patients.

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

Genome-Wide Locations of Potential Epimutations Associated with Environmentally Induced Epigenetic Transgenerational Inheritance of Disease Using a Sequential Machine Learning Prediction Approach.

PubMed

Haque, M Muksitul; Holder, Lawrence B; Skinner, Michael K

2015-01-01

Environmentally induced epigenetic transgenerational inheritance of disease and phenotypic variation involves germline transmitted epimutations. The primary epimutations identified involve altered differential DNA methylation regions (DMRs). Different environmental toxicants have been shown to promote exposure (i.e., toxicant) specific signatures of germline epimutations. Analysis of genomic features associated with these epimutations identified low-density CpG regions (<3 CpG / 100bp) termed CpG deserts and a number of unique DNA sequence motifs. The rat genome was annotated for these and additional relevant features. The objective of the current study was to use a machine learning computational approach to predict all potential epimutations in the genome. A number of previously identified sperm epimutations were used as training sets. A novel machine learning approach using a sequential combination of Active Learning and Imbalance Class Learner analysis was developed. The transgenerational sperm epimutation analysis identified approximately 50K individual sites with a 1 kb mean size and 3,233 regions that had a minimum of three adjacent sites with a mean size of 3.5 kb. A select number of the most relevant genomic features were identified with the low density CpG deserts being a critical genomic feature of the features selected. A similar independent analysis with transgenerational somatic cell epimutation training sets identified a smaller number of 1,503 regions of genome-wide predicted sites and differences in genomic feature contributions. The predicted genome-wide germline (sperm) epimutations were found to be distinct from the predicted somatic cell epimutations. Validation of the genome-wide germline predicted sites used two recently identified transgenerational sperm epimutation signature sets from the pesticides dichlorodiphenyltrichloroethane (DDT) and methoxychlor (MXC) exposure lineage F3 generation. Analysis of this positive validation data set showed a 100% prediction accuracy for all the DDT-MXC sperm epimutations. Observations further elucidate the genomic features associated with transgenerational germline epimutations and identify a genome-wide set of potential epimutations that can be used to facilitate identification of epigenetic diagnostics for ancestral environmental exposures and disease susceptibility.

Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

PubMed

Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

2012-06-06

First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

NASA Astrophysics Data System (ADS)

Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

2015-08-01

In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

Epigenetic programming alterations in alligators from environmentally contaminated lakes

PubMed Central

Guillette, Louis J.; Parrott, Benjamin B.; Nilsson, Eric; Haque, M.M.; Skinner, Michael K.

2016-01-01

Previous studies examining the reproductive health of alligators in Florida lakes indicate that a variety of developmental and health impacts can be attributed to a combination of environmental quality and exposures to environmental contaminants. The majority of these environmental contaminants have been shown to disrupt normal endocrine signaling. The potential that these environmental conditions and contaminants may influence epigenetic status and correlate to the health abnormalities was investigated in the current study. The red blood cell (RBC) (erythrocyte) in the alligator is nucleated so was used as an easily purified marker cell to investigate epigenetic programming. RBCs were collected from adult male alligators captured at three sites in Florida, each characterized by varying degrees of contamination. While Lake Woodruff (WO) has remained relatively pristine, Lake Apopka (AP) and Merritt Island (MI) convey exposures to different suites of contaminants. DNA was isolated and methylated DNA immuno-precipitation (MeDIP) was used to isolate methylated DNA that was then analyzed in a competitive hybridization using a genome-wide alligator tiling array for a MeDIP-Chip analysis. Pairwise comparisons of alligators from AP and MI to WO revealed alterations in the DNA methylome. The AP vs. WO comparison identified 85 differential DNA methylation regions (DMRs) with ⩾3 adjacent oligonucleotide tiling array probes and 15,451 DMRs with a single oligo probe analysis. The MI vs. WO comparison identified 75 DMRs with the ⩾3 oligo probe and 17,411 DMRs with the single oligo probe analysis. There was negligible overlap between the DMRs identified in AP vs. WO and MI vs. WO comparisons. In both comparisons DMRs were primarily associated with CpG deserts which are regions of low CpG density (1–2 CpG/100 bp). Although the alligator genome is not fully annotated, gene associations were identified and correlated to major gene class functional categories and pathways of endocrine relevance. Observations demonstrate that environmental quality may be associated with epigenetic programming and health status in the alligator. The epigenetic alterations may provide biomarkers to assess the environmental exposures and health impacts on these populations of alligators. PMID:27080547

Global Epigenetic Changes May Underlie Ethnic Differences and Susceptibility to Prostate Cancer

DTIC Science & Technology

2013-09-01

malignancy and can often be found in non-cancerous tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA...methylcytosine (5-meC; [9, 10]). Since the recognition that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to...has also been identified for several genes. One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men

Comprehensive analysis of genome-wide DNA methylation across human polycystic ovary syndrome ovary granulosa cell.

PubMed

Xu, Jiawei; Bao, Xiao; Peng, Zhaofeng; Wang, Linlin; Du, Linqing; Niu, Wenbin; Sun, Yingpu

2016-05-10

Polycystic ovary syndrome (PCOS) affects approximately 7% of the reproductive-age women. A growing body of evidence indicated that epigenetic mechanisms contributed to the development of PCOS. The role of DNA modification in human PCOS ovary granulosa cell is still unknown in PCOS progression. Global DNA methylation and hydroxymethylation were detected between PCOS' and controls' granulosa cell. Genome-wide DNA methylation was profiled to investigate the putative function of DNA methylaiton. Selected genes expressions were analyzed between PCOS' and controls' granulosa cell. Our results showed that the granulosa cell global DNA methylation of PCOS patients was significant higher than the controls'. The global DNA hydroxymethylation showed low level and no statistical difference between PCOS and control. 6936 differentially methylated CpG sites were identified between control and PCOS-obesity. 12245 differential methylated CpG sites were detected between control and PCOS-nonobesity group. 5202 methylated CpG sites were significantly differential between PCOS-obesity and PCOS-nonobesity group. Our results showed that DNA methylation not hydroxymethylation altered genome-wide in PCOS granulosa cell. The different methylation genes were enriched in development protein, transcription factor activity, alternative splicing, sequence-specific DNA binding and embryonic morphogenesis. YWHAQ, NCF2, DHRS9 and SCNA were up-regulation in PCOS-obesity patients with no significance different between control and PCOS-nonobesity patients, which may be activated by lower DNA methylaiton. Global and genome-wide DNA methylation alteration may contribute to different genes expression and PCOS clinical pathology.

Critical Points and Traveling Wave in Locomotion: Experimental Evidence and Some Theoretical Considerations.

PubMed

Saltiel, Philippe; d'Avella, Andrea; Tresch, Matthew C; Wyler, Kuno; Bizzi, Emilio

2017-01-01

The central pattern generator (CPG) architecture for rhythm generation remains partly elusive. We compare cat and frog locomotion results, where the component unrelated to pattern formation appears as a temporal grid, and traveling wave respectively. Frog spinal cord microstimulation with N-methyl-D-Aspartate (NMDA), a CPG activator, produced a limited set of force directions, sometimes tonic, but more often alternating between directions similar to the tonic forces. The tonic forces were topographically organized, and sites evoking rhythms with different force subsets were located close to the constituent tonic force regions. Thus CPGs consist of topographically organized modules. Modularity was also identified as a limited set of muscle synergies whose combinations reconstructed the EMGs. The cat CPG was investigated using proprioceptive inputs during fictive locomotion. Critical points identified both as abrupt transitions in the effect of phasic perturbations, and burst shape transitions, had biomechanical correlates in intact locomotion. During tonic proprioceptive perturbations, discrete shifts between these critical points explained the burst durations changes, and amplitude changes occurred at one of these points. Besides confirming CPG modularity, these results suggest a fixed temporal grid of anchoring points, to shift modules onsets and offsets. Frog locomotion, reconstructed with the NMDA synergies, showed a partially overlapping synergy activation sequence. Using the early synergy output evoked by NMDA at different spinal sites, revealed a rostrocaudal topographic organization, where each synergy is preferentially evoked from a few, albeit overlapping, cord regions. Comparing the locomotor synergy sequence with this topography suggests that a rostrocaudal traveling wave would activate the synergies in the proper sequence for locomotion. This output was reproduced in a two-layer model using this topography and a traveling wave. Together our results suggest two CPG components: modules, i.e., synergies; and temporal patterning, seen as a temporal grid in the cat, and a traveling wave in the frog. Animal and limb navigation have similarities. Research relating grid cells to the theta rhythm and on segmentation during navigation may relate to our temporal grid and traveling wave results. Winfree's mathematical work, combining critical phases and a traveling wave, also appears important. We conclude suggesting tracing, and imaging experiments to investigate our CPG model.

DNA methylation in the APOE genomic region is associated with cognitive function in African Americans.

PubMed

Liu, Jiaxuan; Zhao, Wei; Ware, Erin B; Turner, Stephen T; Mosley, Thomas H; Smith, Jennifer A

2018-05-08

Genetic variations in apolipoprotein E (APOE) and proximal genes (PVRL2, TOMM40, and APOC1) are associated with cognitive function and dementia, particularly Alzheimer's disease. Epigenetic mechanisms such as DNA methylation play a central role in the regulation of gene expression. Recent studies have found evidence that DNA methylation may contribute to the pathogenesis of dementia, but its association with cognitive function in populations without dementia remains unclear. We assessed DNA methylation levels of 48 CpG sites in the APOE genomic region in peripheral blood leukocytes collected from 289 African Americans (mean age = 67 years) from the Genetic Epidemiology Network of Arteriopathy (GENOA) study. Using linear regression, we examined the relationship between methylation in the APOE genomic region and multiple cognitive measures including learning, memory, processing speed, concentration, language and global cognitive function. We identified eight CpG sites in three genes (PVRL2, TOMM40, and APOE) that showed an inverse association between methylation level and delayed recall, a measure of memory, after adjusting for age and sex (False Discovery Rate q-value < 0.1). All eight CpGs are located in either CpG islands (CGIs) or CGI shelves, and six of them are in promoter regions. Education and APOE ε4 carrier status significantly modified the effect of methylation in cg08583001 (PVRL2) and cg22024783 (TOMM40), respectively. Together, methylation of the eight CpGs explained an additional 8.7% of the variance in delayed recall, after adjustment for age, sex, education, and APOE ε4 carrier status. Methylation was not significantly associated with any other cognitive measures. Our results suggest that methylation levels at multiple CpGs in the APOE genomic region are inversely associated with delayed recall during normal cognitive aging, even after accounting for known genetic predictors for cognition. Our findings highlight the important role of epigenetic mechanisms in influencing cognitive performance, and suggest that changes in blood methylation may be an early indicator of individuals at risk for dementia as well as potential targets for intervention in asymptomatic populations.

Primary care clinical practice guidelines in South Africa: qualitative study exploring perspectives of national stakeholders.

PubMed

Kredo, Tamara; Abrams, Amber; Young, Taryn; Louw, Quinette; Volmink, Jimmy; Daniels, Karen

2017-08-29

Clinical practice guidelines (CPGs) are common tools in policy and clinical practice informing clinical decisions at the bedside, governance of health facilities, health insurer and government spending, and patient choices. South Africa's health sector is transitioning to a national health insurance system, aiming to build on other primary health care initiatives to transform the previously segregated, inequitable services. Within these plans CPGs are an integral tool for delivering standardised and cost effective care. Currently, there is no accepted standard approach to developing, adapting or implementing CPGs efficiently or effectively in South Africa. We explored the current players; drivers; and the context and processes of primary care CPG development from the perspective of stakeholders operating at national level. We used a qualitative approach. Sampling was initially purposeful, followed by snowballing and further sampling to reach representivity of primary care service providers. Individual in-depth interviews were recorded and transcribed verbatim. We used thematic content analysis to analyse the data. We conducted 37 in-depth interviews from June 2014-July 2015. We found CPG development and implementation were hampered by lack of human and funding resources for technical and methodological work; fragmentation between groups, and between national and provincial health sectors; and lack of agreed systems for CPG development and implementation. Some CPG contributors steadfastly work to improve processes aiming to enhance communication, use of evidence, and transparency to ensure credible guidance is produced. Many interviewed had shared values, and were driven to address inequity, however, resource gaps were perceived to create an enabling environment for commercial interests or personal agendas to drive the CPG development process. Our findings identified strengths and gaps in CPG development processes, and a need for national standards to guide CPG development and implementation. Based on our findings and suggestions from participants, a possible way forward would be for South Africa to have a centrally coordinated CPG unit to address these needs and aspects of fragmentation by devising processes that support collaboration, transparency and credibility across sectors and disciplines. Such an initiative will require adequate resourcing to build capacity and ensure support for the delivery of high quality CPGs for South African primary care.

The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

PubMed Central

Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

2014-01-01

One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

eMethylsorb: electrochemical quantification of DNA methylation at CpG resolution using DNA-gold affinity interactions.

PubMed

Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

2014-11-07

We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.

Exploiting Semantic Web Technologies to Develop OWL-Based Clinical Practice Guideline Execution Engines.

PubMed

Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza

2016-01-01

Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.

Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

PubMed

Peng, Liu; Wei, He; Liren, Li

2014-01-01

To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

TLR9 is critical for glioma stem cell maintenance and targeting.

PubMed

Herrmann, Andreas; Cherryholmes, Gregory; Schroeder, Anne; Phallen, Jillian; Alizadeh, Darya; Xin, Hong; Wang, Tianyi; Lee, Heehyoung; Lahtz, Christoph; Swiderski, Piotr; Armstrong, Brian; Kowolik, Claudia; Gallia, Gary L; Lim, Michael; Brown, Christine; Badie, Behnam; Forman, Stephen; Kortylewski, Marcin; Jove, Richard; Yu, Hua

2014-09-15

Understanding supports for cancer stem-like cells in malignant glioma may suggest therapeutic strategies for their elimination. Here, we show that the Toll-like receptor TLR9 is elevated in glioma stem-like cells (GSC) in which it contributes to glioma growth. TLR9 overexpression is regulated by STAT3, which is required for GSC maintenance. Stimulation of TLR9 with a CpG ligand (CpG ODN) promoted GSC growth, whereas silencing TLR9 expression abrogated GSC development. CpG-ODN treatment induced Frizzled4-dependent activation of JAK2, thereby activating STAT3. Targeted delivery of siRNA into GSC was achieved via TLR9 using CpG-siRNA conjugates. Through local or systemic treatment, administration of CpG-Stat3 siRNA to silence STAT3 in vivo reduced GSC along with glioma growth. Our findings identify TLR9 as a functional marker for GSC and a target for the delivery of efficacious therapeutics for glioma treatment. Cancer Res; 74(18); 5218-28. ©2014 AACR. ©2014 American Association for Cancer Research.

Genetic and Epigenetic Inactivation of Kruppel-like Factor 4 in Medulloblastoma1

PubMed Central

Nakahara, Yukiko; Northcott, Paul A; Li, Meihua; Kongkham, Paul N; Smith, Christian; Yan, Hai; Croul, Sidney; Ra, Young-Shin; Eberhart, Charles; Huang, Annie; Bigner, Darell; Grajkowska, Wesia; Van Meter, Timothy; Rutka, James T; Taylor, Michael D

2010-01-01

Although medulloblastoma is the most common pediatric malignant brain tumor, its molecular underpinnings are largely unknown. We have identified rare, recurrent homozygous deletions of Kruppel-like Factor 4 (KLF4) in medulloblastoma using high-resolution single nucleotide polymorphism arrays, digital karyotyping, and genomic real-time polymerase chain reaction (PCR). Furthermore, we show that there is loss of physiological KLF4 expression in more than 40% of primary medulloblastomas both at the RNA and protein levels. Medulloblastoma cell lines drastically increase the expression of KLF4 in response to the demethylating agent 5-azacytidine and demonstrate dense methylation of the promoter CpG island by bisulfite sequencing. Methylation-specific PCR targeting the KLF4 promoter demonstrates CpG methylation in approximately 16% of primary medulloblastomas. Reexpression of KLF4 in the D283 medulloblastoma cell line results in significant growth suppression both in vitro and in vivo. We conclude that KLF4 is inactivated by either genetic or epigenetic mechanisms in a large subset of medulloblastomas and that it likely functions as a tumor suppressor gene in the pathogenesis of medulloblastoma. PMID:20072650

DNA Methylation at the DAT Promoter and Risk for Psychopathology: Intergenerational Transmission between School-Age Youths and Their Parents in a Community Sample.

PubMed

Cimino, Silvia; Cerniglia, Luca; Ballarotto, Giulia; Marzilli, Eleonora; Pascale, Esterina; D'Addario, Claudio; Adriani, Walter; Tambelli, Renata

2017-01-01

The effect of gene polymorphisms and promoter methylation, associated with maladaptive developmental outcomes, vary depending on environmental factors (e.g., parental psychopathology). Most studies have focused on 0- to 5-year-old children, adolescents, or adults, whereas there is dearth of research on school-age youths and pre-adolescents. In a sample of 21 families recruited at schools, we addressed parents' psychopathological symptoms (through SCL-90-R); offspring emotional-behavioral functioning (through CBCL-6-18); dopamine transporter gene (DAT1) for epigenetic status of the 5'-untranslated region (UTR) and for genotype, i.e., variable number of tandem repeats polymorphism at the 3'-UTR. Possible associations were explored between bio-genetic and psychological characteristics within the same individual and between triplets of children, mothers, and fathers. DAT methylation of CpG at positions M1, M6, and M7 in mothers was correlated with maternal (phobic) anxiety, whereas in fathers' position M6 was related to paternal depression, anxiety, hostility, psychoticism, and higher Global Severity Index (GSI). No significant correlations were found between maternal and offspring DAT methylation. Significant correlations were found between fathers' methylation at CpG M1 and children's methylation at CpG M6. Linear regressions showed that mothers and fathers' GSI predicted children's methylation at CpG sites M2, M3, and M6, whereas fathers' GSI predicted children's methylation at CpG sites, particularly M1, M2, and M6. Moreover, offspring methylation of DAT at CpG M2 predicted somatic complaint, internalizing and attention problems; methylation of DAT at CpG M6 predicted withdraw. This study may have important clinical implication for the prevention and treatment of emotional-behavioral difficulties in children, as it adds to previous knowledge about the role of genetic and environmental factors in predicting psychopathological symptoms within non-clinical populations.

Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

PubMed Central

Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

2013-01-01

Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

Overrepresentation of missense mutations in mild hemophilia A patients from Belgium: founder effect or independent occurrence?

PubMed

Lannoy, N; Lambert, C; Vikkula, M; Hermans, C

2015-06-01

Roughly 40% of observed mutations responsible for hemophilia A (HA) are novel and present in either a single family or a limited number of unrelated families. During routine diagnostic analysis of 73 unrelated Belgian patients with mild HA, 4 out of 43 different mutations (p.Ser2030Asn, p.Arg2178Cys, p.Arg2178His, and p.Pro2311His) were detected in more than one family, representing 35% of total identified mutations. To discriminate between an independent recurrence or a founder effect, an analysis of intra- and -extragenic single nucleotide polymorphisms (SNPs) and short tandem repeats (STRs) flanking the F8 gene was conducted. SNP haplotype and microsatellite analysis revealed strong evidence that p.Ser2030Asn and p.Pro2311His mutations were probably associated with a founder effect. The two other mutations localized in an F8 cytosine-phosphate-guanine (CpG) site likely resulted from recurrent de novo events. This study suggests that missense mutations producing C-to-T or G-to-A substitutions in CpG dinucleotide can occur de novo with more repetition than other causal substitutions that do not affect the CpG site. Analysis of F8 database implied that CpG sites throughout the F8 gene are not all mutated with the same frequency. Causes are still unknown and remain to be identified. Copyright © 2015 Elsevier Ltd. All rights reserved.

A systematic review of clinical practice guidelines and best practice statements for the diagnosis and management of varicocele in children and adolescents.

PubMed

Roque, Matheus; Esteves, Sandro C

2016-01-01

A systematic review was conducted to identify and qualitatively analyze the methods as well as recommendations of Clinical Practice Guidelines (CPG) and Best Practice Statements (BPS) concerning varicocele in the pediatric and adolescent population. An electronic search was performed with the MEDLINE, EMBASE, Science Direct, and Scielo databases, as well as guidelines' Web sites until September 2015. Four guidelines were included in the qualitative synthesis. In general, the recommendations provided by the CPG/BPS were consistent despite the existence of some gaps across the studies. The guidelines issued by the American Urological Association (AUA) and American Society for Reproductive Medicine (ASRM) did not provide evidence-based levels for the recommendations given. Most of the recommendations given by the European Association of Urology (EAU) and European Society of Pediatric Urology (ESPU) were derived from nonrandomized clinical trials, retrospective studies, and expert opinion. Among all CPG/BPS, only one was specifically designed for the pediatric population. The studied guidelines did not undertake independent cost-effectiveness and risk-benefit analysis. The main objectives of these guidelines were to translate the best evidence into practice and provide a framework of standardized care while maintaining clinical autonomy and physician judgment. However, the limitations identified in the CPG/BPS for the diagnosis and management of varicocele in children and adolescents indicate ample opportunities for research and future incorporation of higher quality standards in patient care.

Hyper-Methylated Loci Persisting from Sessile Serrated Polyps to Serrated Cancers.

PubMed

Andrew, Angeline S; Baron, John A; Butterly, Lynn F; Suriawinata, Arief A; Tsongalis, Gregory J; Robinson, Christina M; Amos, Christopher I

2017-03-02

Although serrated polyps were historically considered to pose little risk, it is now understood that progression down the serrated pathway could account for as many as 15%-35% of colorectal cancers. The sessile serrated adenoma/polyp (SSA/P) is the most prevalent pre-invasive serrated lesion. Our objective was to identify the CpG loci that are persistently hyper-methylated during serrated carcinogenesis, from the early SSA/P lesion through the later cancer phases of neoplasia development. We queried the loci hyper-methylated in serrated cancers within our rightsided SSA/Ps from the New Hampshire Colonoscopy Registry, using the Illumina Infinium Human Methylation 450 k panel to comprehensively assess the DNA methylation status. We identified CpG loci and regions consistently hyper-methylated throughout the serrated carcinogenesis spectrum, in both our SSA/P specimens and in serrated cancers. Hyper-methylated CpG loci included the known the tumor suppressor gene RET (p = 5.72 x 10-10), as well as loci in differentially methylated regions for GSG1L, MIR4493, NTNG1, MCIDAS, ZNF568, and RERG. The hyper-methylated loci that we identified help characterize the biology of SSA/P development, and could be useful as therapeutic targets, or for future identification of patients who may benefit from shorter surveillance intervals.

Blood fatty acid composition of pregnant and nonpregnant Korean women: red cells may act as a reservoir of arachidonic acid and docosahexaenoic acid for utilization by the developing fetus.

PubMed

Ghebremeskel, K; Min, Y; Crawford, M A; Nam, J H; Kim, A; Koo, J N; Suzuki, H

2000-05-01

Relative fatty acid composition of plasma and red blood cell (RBC) choline phosphoglycerides (CPG), and RBC ethanolamine phosphoglycerides (EPG) of pregnant (n = 40) and nonpregnant, nonlactating (n = 40), healthy Korean women was compared. The two groups were of the same ethnic origin and comparable in age and parity. Levels of arachidonic (AA) and docosahexaenoic (DHA) acids were lower (P < 0.05) and palmitic and oleic acids higher (P < 0.0001) in plasma CPG of the pregnant women. Similarly, the RBC CPG and EPG of the pregnant women had lower AA and DHA (P < 0.05) and higher palmitic and oleic acids (P < 0.01). The reduction in DHA and total n-3 fatty acids in plasma CPG of the pregnant women was paralleled by an increase in docosatetraenoic (DTA) and docosapentaenoic (DPA) acids of the n-6 series and in DPA/DTA ratio. In the RBC phospholipids (CPG and EPG) of the pregnant women, DTA and DPA acids of the n-6 series and DPA/DTA ratio did not increase with the decrease of the n-3 metabolites (eicosapentaenoic acid, DPA, and DHA) and total n-3. Since pregnancy was the main identifiable variable between the two groups, the lower levels of AA and DHA in RBC CPG and EPG of the pregnant women suggest that the mothers were mobilizing membrane AA and DHA to meet the high fetal requirement for these nutrients. It may also suggest that RBC play a role as a potential store of AA and DHA and as a vehicle for the transport of these fatty acids from maternal circulation to the placenta to be utilized by the developing fetus.

Three SRA-Domain Methylcytosine-Binding Proteins Cooperate to Maintain Global CpG Methylation and Epigenetic Silencing in Arabidopsis

PubMed Central

Woo, Hye Ryun; Dittmer, Travis A.; Richards, Eric J.

2008-01-01

Methylcytosine-binding proteins decipher the epigenetic information encoded by DNA methylation and provide a link between DNA methylation, modification of chromatin structure, and gene silencing. VARIANT IN METHYLATION 1 (VIM1) encodes an SRA (SET- and RING-associated) domain methylcytosine-binding protein in Arabidopsis thaliana, and loss of VIM1 function causes centromere DNA hypomethylation and centromeric heterochromatin decondensation in interphase. In the Arabidopsis genome, there are five VIM genes that share very high sequence similarity and encode proteins containing a PHD domain, two RING domains, and an SRA domain. To gain further insight into the function and potential redundancy among the VIM proteins, we investigated strains combining different vim mutations and transgenic vim knock-down lines that down-regulate multiple VIM family genes. The vim1 vim3 double mutant and the transgenic vim knock-down lines showed decreased DNA methylation primarily at CpG sites in genic regions, as well as repeated sequences in heterochromatic regions. In addition, transcriptional silencing was released in these plants at most heterochromatin regions examined. Interestingly, the vim1 vim3 mutant and vim knock-down lines gained ectopic CpHpH methylation in the 5S rRNA genes against a background of CpG hypomethylation. The vim1 vim2 vim3 triple mutant displayed abnormal morphological phenotypes including late flowering, which is associated with DNA hypomethylation of the 5′ region of FWA and release of FWA gene silencing. Our findings demonstrate that VIM1, VIM2, and VIM3 have overlapping functions in maintenance of global CpG methylation and epigenetic transcriptional silencing. PMID:18704160

Cord blood DNA methylation and adiposity measures in early and mid-childhood.

PubMed

Kresovich, Jacob K; Zheng, Yinan; Cardenas, Andres; Joyce, Brian T; Rifas-Shiman, Sheryl L; Oken, Emily; Gillman, Matthew W; Hivert, Marie-France; Baccarelli, Andrea A; Hou, Lifang

2017-01-01

Excess adiposity in childhood is associated with numerous adverse health outcomes. As this condition is difficult to treat once present, identification of risk early in life can help inform and implement strategies to prevent the onset of the condition. We performed an epigenome-wide association study to prospectively investigate the relationship between cord blood DNA methylation and adiposity measurements in childhood. We measured genome-wide DNA methylation from 478 children in cord blood and measured overall and central adiposity via skinfold caliper measurements in early (range 3.1-3.3 years) and mid-childhood (age range 7.3-8.3 years) and via dual X-ray absorptiometry (DXA) in mid-childhood. Final models were adjusted for maternal age at enrollment, pre-pregnancy body mass index, education, folate intake during pregnancy, smoking during pregnancy, and gestational weight gain, and child sex, race/ethnicity, current age, and cord blood cell composition. We identified four promoter proximal CpG sites that were associated with adiposity as measured by subscapular (SS) and triceps (TR) ratio (SS:TR) in early childhood, in the genes KPRP , SCL9A10 , MYLK2 , and PRLHR . We additionally identified one gene body CpG site associated with early childhood SS + TR on PPAPDC1A ; this site was nominally associated with SS + TR in mid-childhood. Higher methylation at one promoter proximal CpG site in MMP25 was also associated with SS:TR in mid-childhood. In regional analyses, methylation at an exonal region of GFPT2 was positively associated with SS:TR in early childhood. Finally, we identified regions of two long, non-coding RNAs which were associated with SS:TR (LOC100049716) and fat-free mass index (LOC102723493) in mid-childhood. This analysis identified novel CpG loci associated with adiposity outcomes. However, our results suggest little consistency across the various adiposity outcomes tested, particularly among the more accurate DXA measurements of body composition. We recommend using caution when interpreting these associations.

A systematic review of recent clinical practice guidelines and best practice statements for the evaluation of the infertile male.

PubMed

Esteves, Sandro C; Chan, Peter

2015-09-01

We systematically identified and reviewed the methods and consistency of recommendations of recently developed clinical practice guidelines (CPG) and best practice statements (BPS) on the evaluation of the infertile male. MEDLINE and related engines as well as guidelines' Web sites were searched for CPG and BPS written in English on the general evaluation of male infertility published between January 2008 and April 2015. Four guidelines were identified, all of which reported to have been recently updated. Systematic review was not consistently used in the BPS despite being reported in the CPG. Only one of them reported having a patient representative in its development team. The CPG issued by the European Association of Urology (EAU) graded some recommendations and related that to levels (but not quality) of evidence. Overall, the BPS issued respectively by the American Urological Association and American Society for Reproductive Medicine concurred with each other, but both differed from the EAU guidelines with regard to methods of collection, extraction and interpretation of data. None of the guidelines incorporated health economics. Important specific limitations of conventional semen analysis results were ignored by all guidelines. Besides variation in the methodological quality, implementation strategies were not reported in two out of four guidelines. While the various panels of experts who contributed to the development of the CPG and BPS reviewed should be commended on their tremendous efforts aiming to establish a clinical standard in both the evaluation and management of male infertility, we recognized inconsistencies in the methodology of their synthesis and in the contents of their final recommendations. These discrepancies pose a barrier in the general implementation of these guidelines and may limit their utility in standardizing clinical practice or improving health-related outcomes. Continuous efforts are needed to generate high-quality evidence to allow further development of these important guidelines for the evaluation and management of males suffering from infertility.

The Cambridge Prognostic Groups for improved prediction of disease mortality at diagnosis in primary non-metastatic prostate cancer: a validation study.

PubMed

Gnanapragasam, V J; Bratt, O; Muir, K; Lee, L S; Huang, H H; Stattin, P; Lophatananon, A

2018-02-28

The purpose of this study is to validate a new five-tiered prognostic classification system to better discriminate cancer-specific mortality in men diagnosed with primary non-metastatic prostate cancer. We applied a recently described five-strata model, the Cambridge Prognostic Groups (CPGs 1-5), in two international cohorts and tested prognostic performance against the current standard three-strata classification of low-, intermediate- or high-risk disease. Diagnostic clinico-pathological data for men obtained from the Prostate Cancer data Base Sweden (PCBaSe) and the Singapore Health Study were used. The main outcome measure was prostate cancer mortality (PCM) stratified by age group and treatment modality. The PCBaSe cohort included 72,337 men, of whom 7162 died of prostate cancer. The CPG model successfully classified men with different risks of PCM with competing risk regression confirming significant intergroup distinction (p < 0.0001). The CPGs were significantly better at stratified prediction of PCM compared to the current three-tiered system (concordance index (C-index) 0.81 vs. 0.77, p < 0.0001). This superiority was maintained for every age group division (p < 0.0001). Also in the ethnically different Singapore cohort of 2550 men with 142 prostate cancer deaths, the CPG model outperformed the three strata categories (C-index 0.79 vs. 0.76, p < 0.0001). The model also retained superior prognostic discrimination in the treatment sub-groups: radical prostatectomy (n = 20,586), C-index 0.77 vs. 074; radiotherapy (n = 11,872), C-index 0.73 vs. 0.69; and conservative management (n = 14,950), C-index 0.74 vs. 0.73. The CPG groups that sub-divided the old intermediate-risk (CPG2 vs. CPG3) and high-risk categories (CPG4 vs. CPG5) significantly discriminated PCM outcomes after radical therapy or conservative management (p < 0.0001). This validation study of nearly 75,000 men confirms that the CPG five-tiered prognostic model has superior discrimination compared to the three-tiered model in predicting prostate cancer death across different age and treatment groups. Crucially, it identifies distinct sub-groups of men within the old intermediate-risk and high-risk criteria who have very different prognostic outcomes. We therefore propose adoption of the CPG model as a simple-to-use but more accurate prognostic stratification tool to help guide management for men with newly diagnosed prostate cancer.

Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

PubMed

Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

2015-01-01

Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

Homology and homoplasy of swimming behaviors and neural circuits in the Nudipleura (Mollusca, Gastropoda, Opisthobranchia)

PubMed Central

Newcomb, James M.; Sakurai, Akira; Lillvis, Joshua L.; Gunaratne, Charuni A.; Katz, Paul S.

2012-01-01

How neural circuit evolution relates to behavioral evolution is not well understood. Here the relationship between neural circuits and behavior is explored with respect to the swimming behaviors of the Nudipleura (Mollusca, Gastropoda, Opithobranchia). Nudipleura is a diverse monophyletic clade of sea slugs among which only a small percentage of species can swim. Swimming falls into a limited number of categories, the most prevalent of which are rhythmic left–right body flexions (LR) and rhythmic dorsal–ventral body flexions (DV). The phylogenetic distribution of these behaviors suggests a high degree of homoplasy. The central pattern generator (CPG) underlying DV swimming has been well characterized in Tritonia diomedea and in Pleurobranchaea californica. The CPG for LR swimming has been elucidated in Melibe leonina and Dendronotus iris, which are more closely related. The CPGs for the categorically distinct DV and LR swimming behaviors consist of nonoverlapping sets of homologous identified neurons, whereas the categorically similar behaviors share some homologous identified neurons, although the exact composition of neurons and synapses in the neural circuits differ. The roles played by homologous identified neurons in categorically distinct behaviors differ. However, homologous identified neurons also play different roles even in the swim CPGs of the two LR swimming species. Individual neurons can be multifunctional within a species. Some of those functions are shared across species, whereas others are not. The pattern of use and reuse of homologous neurons in various forms of swimming and other behaviors further demonstrates that the composition of neural circuits influences the evolution of behaviors. PMID:22723353

Peripheral oxygen-sensing cells directly modulate the output of an identified respiratory central pattern generating neuron.

PubMed

Bell, Harold J; Inoue, Takuya; Shum, Kelly; Luk, Collin; Syed, Naweed I

2007-06-01

Breathing is an essential homeostatic behavior regulated by central neuronal networks, often called central pattern generators (CPGs). Despite ongoing advances in our understanding of the neural control of breathing, the basic mechanisms by which peripheral input modulates the activities of the central respiratory CPG remain elusive. This lack of fundamental knowledge vis-à-vis the role of peripheral influences in the control of the respiratory CPG is due in large part to the complexity of mammalian respiratory control centres. We have therefore developed a simpler invertebrate model to study the basic cellular and synaptic mechanisms by which a peripheral chemosensory input affects the central respiratory CPG. Here we report on the identification and characterization of peripheral chemoreceptor cells (PCRCs) that relay hypoxia-sensitive chemosensory information to the known respiratory CPG neuron right pedal dorsal 1 in the mollusk Lymnaea stagnalis. Selective perfusion of these PCRCs with hypoxic saline triggered bursting activity in these neurons and when isolated in cell culture these cells also demonstrated hypoxic sensitivity that resulted in membrane depolarization and spiking activity. When cocultured with right pedal dorsal 1, the PCRCs developed synapses that exhibited a form of short-term synaptic plasticity in response to hypoxia. Finally, osphradial denervation in intact animals significantly perturbed respiratory activity compared with their sham counterparts. This study provides evidence for direct synaptic connectivity between a peripheral regulatory element and a central respiratory CPG neuron, revealing a potential locus for hypoxia-induced synaptic plasticity underlying breathing behavior.

A Knowledge-Modeling Approach to Integrate Multiple Clinical Practice Guidelines to Provide Evidence-Based Clinical Decision Support for Managing Comorbid Conditions.

PubMed

Abidi, Samina

2017-10-26

Clinical management of comorbidities is a challenge, especially in a clinical decision support setting, as it requires the safe and efficient reconciliation of multiple disease-specific clinical procedures to formulate a comorbid therapeutic plan that is both effective and safe for the patient. In this paper we pursue the integration of multiple disease-specific Clinical Practice Guidelines (CPG) in order to manage co-morbidities within a computerized Clinical Decision Support System (CDSS). We present a CPG integration framework-termed as COMET (Comorbidity Ontological Modeling & ExecuTion) that manifests a knowledge management approach to model, computerize and integrate multiple CPG to yield a comorbid CPG knowledge model that upon execution can provide evidence-based recommendations for handling comorbid patients. COMET exploits semantic web technologies to achieve (a) CPG knowledge synthesis to translate a paper-based CPG to disease-specific clinical pathways (CP) that include specialized co-morbidity management procedures based on input from domain experts; (b) CPG knowledge modeling to computerize the disease-specific CP using a Comorbidity CPG ontology; (c) CPG knowledge integration by aligning multiple ontologically-modeled CP to develop a unified comorbid CPG knowledge model; and (e) CPG knowledge execution using reasoning engines to derive CPG-mediated recommendations for managing patients with comorbidities. We present a web-accessible COMET CDSS that provides family physicians with CPG-mediated comorbidity decision support to manage Atrial Fibrillation and Chronic Heart Failure. We present our qualitative and quantitative analysis of the knowledge content and usability of COMET CDSS.

GRASP/Ada 95: Reverse Engineering Tools for Ada

NASA Technical Reports Server (NTRS)

Cross, James H., II

1996-01-01

The GRASP/Ada project (Graphical Representations of Algorithms, Structures, and Processes for Ada) has successfully created and prototyped an algorithmic level graphical representation for Ada software, the Control Structure Diagram (CSD), and a new visualization for a fine-grained complexity metric called the Complexity Profile Graph (CPG). By synchronizing the CSD and the CPG, the CSD view of control structure, nesting, and source code is directly linked to the corresponding visualization of statement level complexity in the CPG. GRASP has been integrated with GNAT, the GNU Ada 95 Translator to provide a comprehensive graphical user interface and development environment for Ada 95. The user may view, edit, print, and compile source code as a CSD with no discernible addition to storage or computational overhead. The primary impetus for creation of the CSD was to improve the comprehension efficiency of Ada software and, as a result, improve reliability and reduce costs. The emphasis has been on the automatic generation of the CSD from Ada 95 source code to support reverse engineering and maintenance. The CSD has the potential to replace traditional prettyprinted Ada source code. The current update has focused on the design and implementation of a new Motif compliant user interface, and a new CSD generator consisting of a tagger and renderer. The Complexity Profile Graph (CPG) is based on a set of functions that describes the context, content, and the scaling for complexity on a statement by statement basis. When combined graphicafly, the result is a composite profile of complexity for the program unit. Ongoing research includes the development and refinement of the associated functions, and the development of the CPG generator prototype. The current Version 5.0 prototype provides the capability for the user to generate CSDs and CPGs from Ada 95 source code in a reverse engineering as well as forward engineering mode with a level of flexibility suitable for practical application. This report provides an overview of the GRASP/Ada project with an emphasis on the current update.

Multilevel Analysis of Locomotion in Immature Preparations Suggests Innovative Strategies to Reactivate Stepping after Spinal Cord Injury.

PubMed

Brumley, Michele R; Guertin, Pierre A; Taccola, Giuliano

2017-01-01

Locomotion is one of the most complex motor behaviors. Locomotor patterns change during early life, reflecting development of numerous peripheral and hierarchically organized central structures. Among them, the spinal cord is of particular interest since it houses the central pattern generator (CPG) for locomotion. This main command center is capable of eliciting and coordinating complex series of rhythmic neural signals sent to motoneurons and to corresponding target-muscles for basic locomotor activity. For a long-time, the CPG has been considered a black box. In recent years, complementary insights from in vitro and in vivo animal models have contributed significantly to a better understanding of its constituents, properties and ways to recover locomotion after a spinal cord injury (SCI). This review discusses key findings made by comparing the results of in vitro isolated spinal cord preparations and spinal-transected in vivo models from neonatal animals. Pharmacological, electrical, and sensory stimulation approaches largely used to further understand CPG function may also soon become therapeutic tools for potent CPG reactivation and locomotor movement induction in persons with SCI or developmental neuromuscular disorder. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

PubMed

Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

2017-08-07

Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

Fragile X mental retardation 1 (FMR1) intron 1 methylation in blood predicts verbal cognitive impairment in female carriers of expanded FMR1 alleles: evidence from a pilot study.

PubMed

Godler, David E; Slater, Howard R; Bui, Quang M; Storey, Elsdon; Ono, Michele Y; Gehling, Freya; Inaba, Yoshimi; Francis, David; Hopper, John L; Kinsella, Glynda; Amor, David J; Hagerman, Randi J; Loesch, Danuta Z

2012-03-01

Cognitive status in females with mutations in the FMR1 (fragile X mental retardation 1) gene is highly variable. A biomarker would be of value for predicting which individuals were liable to develop cognitive impairment and could benefit from early intervention. A detailed analysis of CpG sites bridging exon 1 and intron 1 of FMR1, known as fragile X-related epigenetic element 2 (FREE2), suggests that a simple blood test could identify these individuals. Study participants included 74 control females (<40 CGG repeats), 62 premutation (PM) females (55-200 CGG repeats), and 18 full-mutation (FM) females assessed with Wechsler intelligence quotient (IQ) tests. We used MALDI-TOF mass spectrometry to determine the methylation status of FREE2 CpG sites that best identified low-functioning (IQ <70) FM females (>200 CGG repeats), compared the results with those for Southern blot FMR1 activation ratios, and related these assessments to the level of production of the FMR1 protein product in blood. A methylation analysis of intron 1 CpG sites 10-12 showed the highest diagnostic sensitivity (100%) and specificity (98%) of all the molecular measures tested for detecting females with a standardized verbal IQ of <70 among the study participants. In the group consisting of only FM females, methylation of these sites was significantly correlated with full-scale IQ, verbal IQ, and performance IQ. Several verbal subtest scores showed strong correlation with the methylation of these sites (P = 1.2 × 10(-5)) after adjustment for multiple measures. The data suggest that hypermethylation of the FMR1 intron 1 sites in blood is predictive of cognitive impairment in FM females, with implications for improved fragile X syndrome diagnostics in young children and screening of the newborn population.

Genome-wide site-specific differential methylation in the blood of individuals with Klinefelter Syndrome

PubMed Central

Wan, Emily S.; Qiu, Weiliang; Morrow, Jarrett; Beaty, Terri H.; Hetmanski, Jacqueline; Make, Barry J.; Lomas, David A.; Silverman, Edwin K.; DeMeo, Dawn L.

2015-01-01

Klinefelter syndrome (KS) (47 XXY) is a common sex-chromosome aneuploidy with an estimated prevalence of 1 in every 660 male births. Investigations into the associations between DNA methylation and the highly variable clinical manifestations of KS have largely focused on the supernumerary X chromosome; systematic investigations of the epigenome have been limited. We obtained genome-wide DNA methylation data from peripheral blood using the Illumina HumanMethylation450K platform in 5 KS (47 XXY), 102 male (46 XY), and 113 female (46 XX) control subjects participating in the chronic obstructive pulmonary disease (COPD) Gene Study. Empirical Bayes-mediated models were used to test for differential methylation by KS status. CpG sites with a false-discovery rate <0.05 from the first-generation HumanMethylation27K platform were further examined in an independent replication cohort of 2 KS subjects, 590 male, and 495 female controls drawn from the International COPD Genetics Network (ICGN). Differential methylation at sites throughout the genome were identified, including 86 CpG sites that were differentially methylated in KS subjects relative to both male and female controls. CpG sites annotated to the HEN1 methyltransferase homolog 1 (HENMT1), calcyclin-binding protein (CACYBP), and GTPase-activating protein (SH3 domain)-binding protein 1 (G3BP1) genes were among the “KS-specific” loci that were replicated in ICGN. We therefore conclude that site-specific differential methylation exists throughout the genome in KS. The functional impact and clinical relevance of these differentially methylated loci should be explored in future studies. PMID:25988574

Compliance with a pediatric clinical practice guideline for intravenous fluid and electrolyte administration.

PubMed

Hurdowar, Amanda; Urmson, Lynn; Bohn, Desmond; Geary, Denis; Laxer, Ronald; Stevens, Polly

2009-01-01

The occurrence of acute hyponatremia associated with cerebral edema in hospitalized children has been increasingly recognized, with over 50 cases of neurological morbidity and mortality reported in the past decade. This condition most commonly occurs in previously healthy children where maintenance intravenous (IV) fluids have been prescribed in the form of hypotonic saline (e.g., 0.2 or 0.3 NaCl). In response to similar problems at The Hospital for Sick Children (six identified through hospital morbidity and mortality reviews and safety reports prior to fall 2007), an interdisciplinary clinician group from our institution developed a clinical practice guideline (CPG) to guide fluid and electrolyte administration for pediatric patients. This article reviews the evaluation of one patient safety improvement to change the prescribing practice for IV fluids in an acute care pediatric hospital, including the removal of the ability to prescribe hypotonic IV solutions with a sodium concentration of < 75 mmol/L. The evaluation of key components of the CPG included measuring practice and process changes pre- and post-implementation. The evaluation showed that the use of restricted IV fluids was significantly reduced across the organization. Success factors of this safety initiative included the CPG development, forcing functions, reminders, team engagement and support from the hospital leadership. A key learning was that a project leader with considerable dedicated time is required during the implementation to develop change concepts, organize and liaise with stakeholders and measure changes in practice. This project highlights the importance of active implementation for policy and guideline documents.

Using an Artificial Neural Bypass to Restore Cortical Control of Rhythmic Movements in a Human with Quadriplegia

NASA Astrophysics Data System (ADS)

Sharma, Gaurav; Friedenberg, David A.; Annetta, Nicholas; Glenn, Bradley; Bockbrader, Marcie; Majstorovic, Connor; Domas, Stephanie; Mysiw, W. Jerry; Rezai, Ali; Bouton, Chad

2016-09-01

Neuroprosthetic technology has been used to restore cortical control of discrete (non-rhythmic) hand movements in a paralyzed person. However, cortical control of rhythmic movements which originate in the brain but are coordinated by Central Pattern Generator (CPG) neural networks in the spinal cord has not been demonstrated previously. Here we show a demonstration of an artificial neural bypass technology that decodes cortical activity and emulates spinal cord CPG function allowing volitional rhythmic hand movement. The technology uses a combination of signals recorded from the brain, machine-learning algorithms to decode the signals, a numerical model of CPG network, and a neuromuscular electrical stimulation system to evoke rhythmic movements. Using the neural bypass, a quadriplegic participant was able to initiate, sustain, and switch between rhythmic and discrete finger movements, using his thoughts alone. These results have implications in advancing neuroprosthetic technology to restore complex movements in people living with paralysis.

DNA methylation Landscape of body size variation in sheep.

PubMed

Cao, Jiaxue; Wei, Caihong; Liu, Dongming; Wang, Huihua; Wu, Mingming; Xie, Zhiyuan; Capellini, Terence D; Zhang, Li; Zhao, Fuping; Li, Li; Zhong, Tao; Wang, Linjie; Lu, Jian; Liu, Ruizao; Zhang, Shifang; Du, Yongfei; Zhang, Hongping; Du, Lixin

2015-10-16

Sub-populations of Chinese Mongolian sheep exhibit significant variance in body mass. In the present study, we sequenced the whole genome DNA methylation in these breeds to detect whether DNA methylation plays a role in determining the body mass of sheep by Methylated DNA immunoprecipitation - sequencing method. A high quality methylation map of Chinese Mongolian sheep was obtained in this study. We identified 399 different methylated regions located in 93 human orthologs, which were previously reported as body size related genes in human genome-wide association studies. We tested three regions in LTBP1, and DNA methylation of two CpG sites showed significant correlation with its RNA expression. Additionally, a particular set of differentially methylated windows enriched in the "development process" (GO: 0032502) was identified as potential candidates for association with body mass variation. Next, we validated small part of these windows in 5 genes; DNA methylation of SMAD1, TSC1 and AKT1 showed significant difference across breeds, and six CpG were significantly correlated with RNA expression. Interestingly, two CpG sites showed significant correlation with TSC1 protein expression. This study provides a thorough understanding of body size variation in sheep from an epigenetic perspective.

A DNA methylation fingerprint of 1628 human samples

PubMed Central

Fernandez, Agustin F.; Assenov, Yassen; Martin-Subero, Jose Ignacio; Balint, Balazs; Siebert, Reiner; Taniguchi, Hiroaki; Yamamoto, Hiroyuki; Hidalgo, Manuel; Tan, Aik-Choon; Galm, Oliver; Ferrer, Isidre; Sanchez-Cespedes, Montse; Villanueva, Alberto; Carmona, Javier; Sanchez-Mut, Jose V.; Berdasco, Maria; Moreno, Victor; Capella, Gabriel; Monk, David; Ballestar, Esteban; Ropero, Santiago; Martinez, Ramon; Sanchez-Carbayo, Marta; Prosper, Felipe; Agirre, Xabier; Fraga, Mario F.; Graña, Osvaldo; Perez-Jurado, Luis; Mora, Jaume; Puig, Susana; Prat, Jaime; Badimon, Lina; Puca, Annibale A.; Meltzer, Stephen J.; Lengauer, Thomas; Bridgewater, John; Bock, Christoph; Esteller, Manel

2012-01-01

Most of the studies characterizing DNA methylation patterns have been restricted to particular genomic loci in a limited number of human samples and pathological conditions. Herein, we present a compromise between an extremely comprehensive study of a human sample population with an intermediate level of resolution of CpGs at the genomic level. We obtained a DNA methylation fingerprint of 1628 human samples in which we interrogated 1505 CpG sites. The DNA methylation patterns revealed show this epigenetic mark to be critical in tissue-type definition and stemness, particularly around transcription start sites that are not within a CpG island. For disease, the generated DNA methylation fingerprints show that, during tumorigenesis, human cancer cells underwent a progressive gain of promoter CpG-island hypermethylation and a loss of CpG methylation in non-CpG-island promoters. Although transformed cells are those in which DNA methylation disruption is more obvious, we observed that other common human diseases, such as neurological and autoimmune disorders, had their own distinct DNA methylation profiles. Most importantly, we provide proof of principle that the DNA methylation fingerprints obtained might be useful for translational purposes by showing that we are able to identify the tumor type origin of cancers of unknown primary origin (CUPs). Thus, the DNA methylation patterns identified across the largest spectrum of samples, tissues, and diseases reported to date constitute a baseline for developing higher-resolution DNA methylation maps and provide important clues concerning the contribution of CpG methylation to tissue identity and its changes in the most prevalent human diseases. PMID:21613409

Development of an Enhanced Recovery After Surgery Guideline and Implementation Strategy Based on the Knowledge-to-action Cycle.

PubMed

McLeod, Robin S; Aarts, Mary-Anne; Chung, Frances; Eskicioglu, Cagla; Forbes, Shawn S; Conn, Lesley Gotlib; McCluskey, Stuart; McKenzie, Marg; Morningstar, Beverly; Nadler, Ashley; Okrainec, Allan; Pearsall, Emily A; Sawyer, Jason; Siddique, Naveed; Wood, Trevor

2015-12-01

Enhanced Recovery After Surgery (ERAS) protocols have been shown to increase recovery, decrease complications, and reduce length of stay. However, they are difficult to implement. To develop and implement an ERAS clinical practice guideline (CPG) at multiple hospitals. A tailored strategy based on the Knowledge-to-action (KTA) cycle was used to develop and implement an ERAS CPG at 15 academic hospitals in Canada. This included an initial audit to identify gaps and interviews to assess barriers and enablers to implementation. Implementation included development of an ERAS guideline by a multidisciplinary group, communities of practice led by multidiscipline champions (surgeons, anesthesiologists, and nurses) both provincially and locally, educational tools, and clinical pathways as well as audit and feedback. The initial audit revealed there was greater than 75% compliance in only 2 of 18 CPG recommendations. Main themes identified by stakeholders were that the CPG must be based on best evidence, there must be increased communication and collaboration among perioperative team members, and patient education is essential. ERAS and Pain Management CPGs were developed by a multidisciplinary team and have been adopted at all hospitals. Preliminary data from more than 1000 patients show that the uptake of recommended interventions varies but despite this, mean length of stay has decreased with low readmission rates and adverse events. On the basis of short-term findings, our results suggest that a tailored implementation strategy based on the KTA cycle can be used to successfully implement an ERAS program at multiple sites.

Aberrant DNA methylation of miR-219 promoter in long-term night shiftworkers.

PubMed

Shi, Fengqin; Chen, Xinyi; Fu, Alan; Hansen, Johnni; Stevens, Richard; Tjonneland, Anne; Vogel, Ulla B; Zheng, Tongzhang; Zhu, Yong

2013-07-01

The idea that shiftwork may be carcinogenic in humans has gained widespread attention since the pioneering work linking shiftwork to breast cancer over two decades ago. However, the biomolecular consequences of long-term shiftwork exposure have not been fully explored. In this study, we performed a genome-wide CpG island methylation assay of microRNA (miRNA) promoters in long-term night shiftworkers and day workers. This analysis indicated that 50 CpG loci corresponding to 31 miRNAs were differentially methylated in night shiftworkers compared to day workers, including the circadian-relevant miR-219, the expression of which has been implicated in several cancers. A genome-wide expression microarray assay was carried out in a miR-219-overexpressed MCF-7 breast cancer cell line, which identified 319 differentially expressed transcripts. The identified transcriptional targets were analyzed for network and functional interrelatedness using the Ingenuity Pathway Analysis (IPA) software. Overexpression of miR-219 in MCF-7 breast cancer cells resulted in accentuated expression of apoptosis- and proliferation-related anti-viral immunodulators of the Jak-STAT and NF-κβ pathways. These findings suggest that long-term night shiftwork exposure may lead to the methylation-dependent downregulation of miR-219, which may in turn lead to the downregulation of immunomediated antitumor activity and increased breast cancer risk. © 2013 Wiley Periodicals, Inc.

Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

2014-02-01

Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less

Local Delivery of the Toll-Like Receptor 9 Ligand CpG Downregulates Host Immune and Inflammatory Responses, Ameliorating Established Leishmania (Viannia) panamensis Chronic Infection

PubMed Central

Fernández, Olga L.; Rodriguez-Pinto, Daniel; Castilho, Tiago M.; Corral Caridad, Maria J.; Goldsmith-Pestana, Karen; Saravia, Nancy Gore; McMahon-Pratt, Diane

2017-01-01

ABSTRACT Infection by Leishmania (Viannia) panamensis, the predominant etiologic agent for cutaneous leishmaniasis in Colombia, is characterized by a chronic mixed inflammatory response. Current treatment options are plagued by toxicity, lengthy treatment regimens, and growing evidence of drug resistance. Immunotherapy, modulating the immune system to mount a protective response, may provide an alternate therapeutic approach. We investigated the ability of the Toll-like receptor 9 (TLR9) ligand CpG to modulate established disease in the L. (V.) panamensis mouse model. Treatment of established infection with a high dose (50 μg) of CpG ameliorated disease and lowered parasite burden. Interestingly, immediately after treatment there was a significant increase in transforming growth factor β (TGF-β) and concomitantly an increase in T regulatory cell (Treg) function. Although a general reduction in cell-mediated immune cytokine and chemokine (gamma interferon [IFN-γ], interleukin 10 [IL-10], IL-13, IL-6, granulocyte-macrophage colony-stimulating factor [GM-CSF], IL-4, and MIP-1α) responses of the treated mice was observed, certain chemokines (RANTES, monocyte chemoattractant protein 1[MCP-1], and IP-10) were increased. Further, in peripheral blood mononuclear cells (PBMCs) from patients with cutaneous leishmaniasis, CpG treatment similarly exhibited a dose-response effect on the production of IFN-γ, IL-17, IL-10, and IL-13, with reductions observed at higher doses. To further understand the underlying mechanisms and cell populations driving the CpG mediated response, we examined the ex vivo dose effects mediated by the TLR9+ cell populations (dendritic cells, macrophages, and B cells) found to accumulate labeled CpG in vivo. Notably, B cells altered the production of IL-17, IL-13, and IFN-γ, supporting a role for B cells functioning as antigen-presenting cells (APCs) and/or regulatory cells during infection. Interestingly, B cells have been previously demonstrated as a primary type of APC in patients infected with L. (V.) panamensis and thus may be useful targets of immunotherapy. Collectively, our results show that CpG-induced immune regulation leads to a dampening of the host immune response and healing in the mouse model, and it may provide an alternate approach to treatment of cutaneous leishmaniasis caused by L. (V.) panamensis. PMID:28052994

To enforce or not to enforce? The use of collaborative interfaces to promote social skills in children with high functioning autism spectrum disorder.

PubMed

Ben-Sasson, Ayelet; Lamash, Liron; Gal, Eynat

2013-09-01

The goal of this stud was to examine whether a technological touch activated Collaborative Puzzle Game (CPG) increased positive social behaviors in children with high functioning autism spectrum disorder (HFASD). The CPG involved construction of a virtual puzzle by selecting and dragging pieces into the solution area on a touch screen table. The target picture was presented on the top of the screen. Six dyads of children with HFASD (aged 8-11 years) engaged in the CPG in a Free Play (FP) mode in which partners could independently move puzzle pieces versus in an Enforced Collaboration (EC) mode in which partners could only move puzzle pieces together. Videos of the dames were coded for the frequencies of positive and negative social interaction, affect, play, and autistic behaviors. Parents completed the Social Responsiveness Scale (SRS). Wilcoxon Signed-ranks tests indicated that children with HFASD showed significantly higher frequencies of positive social interaction and collaborative play in the EC versus FP modes but there were no differences in negative social behaviors. Differences in social behaviors between partners during the puzzle games were not significant; however there were differences within pair in the severity of social deficits as assessed by the SRS questionnaire. The CPG in an EC mode was effective in promoting positive social interaction by requiring children to work together towards a mutual goal. However, the increased challenge in this mode, particularly for children with lower social-communication skills, suggests the need for establishing selection criteria and mediation steps for such interventions.

Central pattern generation involved in oral and respiratory control for feeding in the term infant

PubMed Central

Barlow, Steven M.

2009-01-01

Purpose of review Drinking and eating are essential skills for survival and benefit from the coordination of several pattern generating networks and their musculoskeletal effectors to achieve safe swallows. Oral-pharyngo-esophageal motility develops during infancy and early childhood, and is influenced by various factors, including neuromuscular maturation, dietary and postural habits, arousal state, ongoing illnesses, congenital anomalies, and the effects of medical or surgical interventions. Gastroesophageal reflux is frequent in neonates and infants, and its role in neonatal morbidity including dysphagia, chronic lung disease, or apparent life-threatening events is not well understood. This review highlights recent studies aimed at understanding the development of oral feeding skills, and cross-system interactions among the brainstem, spinal, and cerebral networks involved in feeding. Recent Findings Functional linkages between suck-swallow and swallow-respiration manifest transitional forms during late gestation through the first year of life which can be delayed or modified by sensory experience and/or disease processes. Relevant central pattern generator (CPG) networks and their neuromuscular targets attain functional status at different rates, which ultimately influences cross-system CPG interactions. Entrainment of trigeminal primary afferents accelerates pattern genesis for the suck CPG and transition-to-oral feed in the RDS preterm infant. Summary The genesis of within-system CPG control for rate and amplitude scaling matures differentially for suck, mastication, swallow, and respiration. Cross-system interactions among these CPGs represent targets of opportunity for new interventions which optimize experience-dependent mechanisms to promote safe swallows among newborn and pediatric patients. PMID:19417662

DNA methylation markers in combination with skeletal and dental ages to improve age estimation in children.

PubMed

Shi, Lei; Jiang, Fan; Ouyang, Fengxiu; Zhang, Jun; Wang, Zhimin; Shen, Xiaoming

2018-03-01

Age estimation is critical in forensic science, in competitive sports and games and in other age-related fields, but the current methods are suboptimal. The combination of age-associated DNA methylation markers with skeletal age (SA) and dental age (DA) may improve the accuracy and precision of age estimation, but no study has examined this topic. In the current study, we measured SA (GP, TW3-RUS, and TW3-Carpal methods) and DA (Demirjian and Willems methods) by X-ray examination in 124 Chinese children (78 boys and 46 girls) aged 6-15 years. To identify age-associated CpG sites, we analyzed methylome-wide DNA methylation profiling by using the Illumina HumanMethylation450 BeadChip system in 48 randomly selected children. Five CpG sites were identified as associated with chronologic age (CA), with an absolute value of Pearson's correlation coefficient (r)>0.5 (p<0.01) and a false discovery rate<0.01. The validation of age-associated CpG sites was performed using droplet digital PCR techniques in all 124 children. After validation, four CpG sites for boys and five CpG sites for girls were further adopted to build the age estimation model with SA and DA using multivariate linear stepwise regressions. These CpG sites were located at 4 known genes: DDO, PRPH2, DHX8, and ITGA2B and at one unknown gene with the Illumina ID number of 22398226. The accuracy of age estimation methods was compared according to the mean absolute error (MAE) and root mean square error (RMSE). The best single measure for SA was the TW3-RUS method (MAE=0.69years, RMSE=0.95years) in boys, and the GP method (MAE=0.74years, RMSE=0.94years) in girls. For DA, the Willems method was the best single measure for both boys (MAE=0.63years, RMSE=0.78years) and girls (MAE=0.54years, RMSE=0.68years). The models that incorporated SA and DA with the methylation levels of age-associated CpG sites provided the highest accuracy of age estimation in both boys (MAE=0.47years, R 2 =0.886) and girls (MAE=0.33years, R 2 =0.941). Cross validation of the results confirmed the reliability and validity of the models. In conclusion, age-associated DNA methylation markers in combination with SA and DA greatly improve the accuracy of age estimation in Chinese children. This method may be applied in forensic science, in competitive sports and games and in other age-related fields. Copyright © 2017. Published by Elsevier B.V.

Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

PubMed

Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

2015-03-01

To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

Comprehensive analysis of MGMT promoter methylation: correlation with MGMT expression and clinical response in GBM.

PubMed

Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

2011-01-07

O⁶-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089-13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301-7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting.

EG-05COMBINATION OF GENE COPY GAIN AND EPIGENETIC DEREGULATION ARE ASSOCIATED WITH THE ABERRANT EXPRESSION OF A STEM CELL RELATED HOX-SIGNATURE IN GLIOBLASTOMA

PubMed Central

Kurscheid, Sebastian; Bady, Pierre; Sciuscio, Davide; Samarzija, Ivana; Shay, Tal; Vassallo, Irene; Van Criekinge, Wim; Domany, Eytan; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika

2014-01-01

We previously reported a stem cell related HOX gene signature associated with resistance to chemo-radiotherapy (TMZ/RT- > TMZ) in glioblastoma. However, underlying mechanisms triggering overexpression remain mostly elusive. Interestingly, HOX genes are neither involved in the developing brain, nor expressed in normal brain, suggestive of an acquired gene expression signature during gliomagenesis. HOXA genes are located on CHR 7 that displays trisomy in most glioblastoma which strongly impacts gene expression on this chromosome, modulated by local regulatory elements. Furthermore we observed more pronounced DNA methylation across the HOXA locus as compared to non-tumoral brain (Human methylation 450K BeadChip Illumina; 59 glioblastoma, 5 non-tumoral brain sampes). CpG probes annotated for HOX-signature genes, contributing most to the variability, served as input into the analysis of DNA methylation and expression to identify key regulatory regions. The structural similarity of the observed correlation matrices between DNA methylation and gene expression in our cohort and an independent data-set from TCGA (106 glioblastoma) was remarkable (RV-coefficient, 0.84; p-value < 0.0001). We identified a CpG located in the promoter region of the HOXA10 locus exerting the strongest mean negative correlation between methylation and expression of the whole HOX-signature. Applying this analysis the same CpG emerged in the external set. We then determined the contribution of both, gene copy aberration (CNA) and methylation at the selected probe to explain expression of the HOX-signature using a linear model. Statistically significant results suggested an additive effect between gene dosage and methylation at the key CpG identified. Similarly, such an additive effect was also observed in the external data-set. Taken together, we hypothesize that overexpression of the stem-cell related HOX signature is triggered by gain of trisomy 7 and escape from compensatory DNA methylation at positions controlling the effect of enhanced gene dose on expression.

Comprehensive Analysis of MGMT Promoter Methylation: Correlation with MGMT Expression and Clinical Response in GBM

PubMed Central

Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

2011-01-01

O6-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089–13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301–7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting. PMID:21249131

Prediction of epigenetically regulated genes in breast cancer cell lines.

PubMed

Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria E H; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

2010-06-04

Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profiles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profiles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fixed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically significant negative correlation between methylation profiles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identified 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.

Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

PubMed

Upadhyay, Mohita; Vivekanandan, Perumal

2015-01-01

Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

PubMed Central

Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

2013-01-01

Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

CpG DNA in the prevention and treatment of infections.

PubMed

Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

2002-01-01

Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

NASA Astrophysics Data System (ADS)

Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

2018-02-01

This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

The digastric muscle is less involved in pharyngeal swallowing in rabbits.

PubMed

Tsujimura, Takanori; Yamada, Aki; Nakamura, Yuki; Fukuhara, Takako; Yamamura, Kensuke; Inoue, Makoto

2012-06-01

The swallowing reflex is centrally programmed by the lower brain stem, the so-called swallowing central pattern generator (CPG), and once the reflex is initiated, many muscles in the oral, pharyngeal, laryngeal, and esophageal regions are systematically activated. The mylohyoid (MH) muscle has been considered to be a "leading muscle" according to previous studies, but the functional role of the digastric (DIG) muscle in the swallowing reflex remains unclear. In the present study, therefore, the activities of single units of MH and DIG neurons were recorded extracellularly, and the functional involvement of these neurons in the swallowing reflex was investigated. The experiments were carried out on eight adult male Japanese white rabbits anesthetized with urethane. To identify DIG and MH neurons, the peripheral nerve (either DIG or MH) was stimulated to evoke action potentials of single motoneurons. Motoneurons were identified as such if they either (1) responded to antidromic nerve stimulation of DIG or MH in an all-or-none manner at threshold intensities and (2) followed stimulation frequencies of up to 0.5 kHz. As a result, all 11 MH neurons recorded were synchronously activated during the swallowing reflex, while there was no activity in any of the 7 DIG neurons recorded during the swallowing reflex. All neurons were anatomically localized ventromedially at the level of the caudal portion of the trigeminal motor nucleus, and there were no differences between the MH and DIG neuron sites. The present results strongly suggest that at least in the rabbit, DIG motoneurons are not tightly controlled by the swallowing CPG and, hence, the DIG muscle is less involved in the swallowing reflex.

Promoter DNA methylation regulates progranulin expression and is altered in FTLD

PubMed Central

2013-01-01

Background Frontotemporal lobar degeneration (FTLD) is a heterogeneous group of neurodegenerative diseases associated with personality changes and progressive dementia. Loss-of-function mutations in the growth factor progranulin (GRN) cause autosomal dominant FTLD, but so far the pathomechanism of sporadic FTLD is unclear. Results We analyzed whether DNA methylation in the GRN core promoter restricts GRN expression and, thus, might promote FTLD in the absence of GRN mutations. GRN expression in human lymphoblast cell lines is negatively correlated with methylation at several CpG units within the GRN promoter. Chronic treatment with the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) strongly induces GRN mRNA and protein levels. In a reporter assay, CpG methylation blocks transcriptional activity of the GRN core promoter. In brains of FTLD patients several CpG units in the GRN promoter are significantly hypermethylated compared to age-matched healthy controls, Alzheimer and Parkinson patients. These CpG motifs are critical for GRN promoter activity in reporter assays. Furthermore, DNA methyltransferase 3a (DNMT3a) is upregulated in FTLD patients and overexpression of DNMT3a reduces GRN promoter activity and expression. Conclusion These data suggest that altered DNA methylation is a novel pathomechanism for FTLD that is potentially amenable to targeted pharmacotherapy. PMID:24252647

Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture.

PubMed

Li, Cai; Lowe, Robert; Ziemke, Tom

2013-01-01

The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value.

Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture

PubMed Central

Li, Cai; Lowe, Robert; Ziemke, Tom

2013-01-01

The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value. PMID:23675345

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Characterization of the differentially methylated region of the Impact gene that exhibits Glires-specific imprinting.

PubMed

Okamura, Kohji; Wintle, Richard F; Scherer, Stephen W

2008-01-01

Imprinted genes are exclusively expressed from one of the two parental alleles in a parent-of-origin-specific manner. In mammals, nearly 100 genes are documented to be imprinted. To understand the mechanism behind this gene regulation and to identify novel imprinted genes, common features of DNA sequences have been analyzed; however, the general features required for genomic imprinting have not yet been identified, possibly due to variability in underlying molecular mechanisms from locus to locus. We performed a thorough comparative genomic analysis of a single locus, Impact, which is imprinted only in Glires (rodents and lagomorphs). The fact that Glires and primates diverged from each other as recent as 70 million years ago makes comparisons between imprinted and non-imprinted orthologues relatively reliable. In species from the Glires clade, Impact bears a differentially methylated region, whereby the maternal allele is hypermethylated. Analysis of this region demonstrated that imprinting was not associated with the presence of direct tandem repeats nor with CpG dinucleotide density. In contrast, a CpG periodicity of 8 bp was observed in this region in species of the Glires clade compared to those of carnivores, artiodactyls, and primates. We show that tandem repeats are dispensable, establishment of the differentially methylated region does not rely on G+C content and CpG density, and the CpG periodicity of 8 bp is meaningful to the imprinting. This interval has recently been reported to be optimal for de novo methylation by the Dnmt3a-Dnmt3L complex, suggesting its importance in the establishment of imprinting in Impact and other genes.

Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue

PubMed Central

Geybels, Milan S.; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A.; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L.

2016-01-01

Background Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. Methods The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. Results In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value <0.001), the majority of which were hypermethylated (n = 1,946; 95%). DNA methylation profiles accurately distinguished between PCa and benign tissue samples. Twenty-seven top-ranked hypermethylated CpGs had a mean methylation difference of at least 40% between tissue types, which included 25 CpGs in 17 genes. Furthermore, for ten genes over 50% of promoter region CpGs were hypermethylated in PCa versus benign tissue. The top-ranked differentially methylated genes included three genes that were associated with both promoter hypermethylation and reduced gene expression: SCGB3A1, HIF3A, and AOX1. Analysis of The Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. Conclusions This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. PMID:26383847

Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue.

PubMed

Geybels, Milan S; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L

2015-12-01

Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value < 0.001), the majority of which were hypermethylated (n = 1,946; 95%). DNA methylation profiles accurately distinguished between PCa and benign tissue samples. Twenty-seven top-ranked hypermethylated CpGs had a mean methylation difference of at least 40% between tissue types, which included 25 CpGs in 17 genes. Furthermore, for 10 genes over 50% of promoter region CpGs were hypermethylated in PCa versus benign tissue. The top-ranked differentially methylated genes included three genes that were associated with both promoter hypermethylation and reduced gene expression: SCGB3A1, HIF3A, and AOX1. Analysis of The Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. © 2015 Wiley Periodicals, Inc.

Identification of an episignature of human colorectal cancer associated with obesity by genome-wide DNA methylation analysis.

PubMed

Crujeiras, Ana B; Morcillo, Sonsoles; Diaz-Lagares, Angel; Sandoval, Juan; Castellano-Castillo, Daniel; Torres, Esperanza; Hervas, David; Moran, Sebastian; Esteller, Manel; Macias-Gonzalez, Manuel; Casanueva, Felipe F; Tinahones, Francisco J

2018-05-01

Obesity was established as a relevant modifiable risk factor in the onset and progression of colorectal cancer (CRC). This relationship could be mediated by an epigenetic regulation. The current work aimed to explore the effects of excess body weight on the DNA methylation profile of CRC using a genome-wide DNA methylation approach and to identify an epigenetic signature of obesity-related CRC. Fifty-six CRC-diagnosed patients (50 years) were included in the study and categorized according to their body mass index (BMI) as non-obese (BMI ≤ 25 kg/m 2 ) or overweight/obese (BMI > 25 kg/m 2 ). Data from Infinium 450k array-based methylomes of 28 CRC tumor samples were coupled with information on BMI categories. Additionally, DNA methylation results were validated in 28 CRC tumor samples. The analysis revealed statistically significant differences at 299 CpG sites, and they were mostly characterized as changes towards CpG hypermethylation occurring in the obese group. The 152 identified genes were involved in inflammatory and metabolic functional processes. Among these genes, novel genes were identified as epigenetically regulated in CRC depending on adiposity. ZNF397OS and ZNF543 represented the top scoring associated events that were further validated in an independent cohort and exhibited strong correlation with BMI and excellent and statistically significant efficiency in the discrimination of obese from non-obese CRC patients (area under the curve >0.80; p < 0.05). The present study identifies a potential epigenome mark of obesity-related CRC that could be useful for precision medicine in the management of this disease taking into account adiposity as a relevant risk factor.

Strehl ratio: a tool for optimizing optical nulls and singularities.

PubMed

Hénault, François

2015-07-01

In this paper a set of radial and azimuthal phase functions are reviewed that have a null Strehl ratio, which is equivalent to generating a central extinction in the image plane of an optical system. The study is conducted in the framework of Fraunhofer scalar diffraction, and is oriented toward practical cases where optical nulls or singularities are produced by deformable mirrors or phase plates. The identified solutions reveal unexpected links with the zeros of type-J Bessel functions of integer order. They include linear azimuthal phase ramps giving birth to an optical vortex, azimuthally modulated phase functions, and circular phase gratings (CPGs). It is found in particular that the CPG radiometric efficiency could be significantly improved by the null Strehl ratio condition. Simple design rules for rescaling and combining the different phase functions are also defined. Finally, the described analytical solutions could also serve as starting points for an automated searching software tool.

Epigenome-wide DNA methylation study of IgE concentration in relation to self-reported allergies.

PubMed

Ek, Weronica E; Ahsan, Muhammad; Rask-Andersen, Mathias; Liang, Liming; Moffatt, Miriam F; Gyllensten, Ulf; Johansson, Åsa

2017-04-01

Epigenetic mechanisms are critical for normal immune development and epigenetic alterations might therefore be possible contributors to immune diseases. To investigate if DNA methylation in whole blood is associated with total and allergen-specific IgE levels. We performed an epigenome-wide association study to investigate the association between DNA methylation and IgE level, allergen-specific IgE and self-reported immune diseases and allergies in 728 individuals. We identified and replicated 15 CpG sites associated with IgE, mapping to biologically relevant genes, including ACOT7, ILR5A, KCNH2, PRG2 and EPX. A total of 331 loci were associated with allergen-specific IgE, but none of these CpG sites were associated with self-reported allergies and immune diseases. This study shows that IgE levels are associated with DNA methylation levels at numerous CpG sites, which might provide new leads for investigating the links between IgE and allergic inflammation.

Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

PubMed Central

Harris, R. Alan; Wang, Ting; Coarfa, Cristian; Nagarajan, Raman P.; Hong, Chibo; Downey, Sara L.; Johnson, Brett E.; Fouse, Shaun D.; Delaney, Allen; Zhao, Yongjun; Olshen, Adam; Ballinger, Tracy; Zhou, Xin; Forsberg, Kevin J.; Gu, Junchen; Echipare, Lorigail; O’Geen, Henriette; Lister, Ryan; Pelizzola, Mattia; Xi, Yuanxin; Epstein, Charles B.; Bernstein, Bradley E.; Hawkins, R. David; Ren, Bing; Chung, Wen-Yu; Gu, Hongcang; Bock, Christoph; Gnirke, Andreas; Zhang, Michael Q.; Haussler, David; Ecker, Joseph; Li, Wei; Farnham, Peggy J.; Waterland, Robert A.; Meissner, Alexander; Marra, Marco A.; Hirst, Martin; Milosavljevic, Aleksandar; Costello, Joseph F.

2010-01-01

Sequencing-based DNA methylation profiling methods are comprehensive and, as accuracy and affordability improve, will increasingly supplant microarrays for genome-scale analyses. Here, four sequencing-based methodologies were applied to biological replicates of human embryonic stem cells to compare their CpG coverage genome-wide and in transposons, resolution, cost, concordance and its relationship with CpG density and genomic context. The two bisulfite methods reached concordance of 82% for CpG methylation levels and 99% for non-CpG cytosine methylation levels. Using binary methylation calls, two enrichment methods were 99% concordant, while regions assessed by all four methods were 97% concordant. To achieve comprehensive methylome coverage while reducing cost, an approach integrating two complementary methods was examined. The integrative methylome profile along with histone methylation, RNA, and SNP profiles derived from the sequence reads allowed genome-wide assessment of allele-specific epigenetic states, identifying most known imprinted regions and new loci with monoallelic epigenetic marks and monoallelic expression. PMID:20852635

Detecting cooperative sequences in the binding of RNA Polymerase-II

NASA Astrophysics Data System (ADS)

Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

2008-03-01

Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

PubMed

Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

2014-01-01

DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

Quantitative DNA Methylation Analysis Identifies a Single CpG Dinucleotide Important for ZAP-70 Expression and Predictive of Prognosis in Chronic Lymphocytic Leukemia

PubMed Central

Claus, Rainer; Lucas, David M.; Stilgenbauer, Stephan; Ruppert, Amy S.; Yu, Lianbo; Zucknick, Manuela; Mertens, Daniel; Bühler, Andreas; Oakes, Christopher C.; Larson, Richard A.; Kay, Neil E.; Jelinek, Diane F.; Kipps, Thomas J.; Rassenti, Laura Z.; Gribben, John G.; Döhner, Hartmut; Heerema, Nyla A.; Marcucci, Guido; Plass, Christoph; Byrd, John C.

2012-01-01

Purpose Increased ZAP-70 expression predicts poor prognosis in chronic lymphocytic leukemia (CLL). Current methods for accurately measuring ZAP-70 expression are problematic, preventing widespread application of these tests in clinical decision making. We therefore used comprehensive DNA methylation profiling of the ZAP-70 regulatory region to identify sites important for transcriptional control. Patients and Methods High-resolution quantitative DNA methylation analysis of the entire ZAP-70 gene regulatory regions was conducted on 247 samples from patients with CLL from four independent clinical studies. Results Through this comprehensive analysis, we identified a small area in the 5′ regulatory region of ZAP-70 that showed large variability in methylation in CLL samples but was universally methylated in normal B cells. High correlation with mRNA and protein expression, as well as activity in promoter reporter assays, revealed that within this differentially methylated region, a single CpG dinucleotide and neighboring nucleotides are particularly important in ZAP-70 transcriptional regulation. Furthermore, by using clustering approaches, we identified a prognostic role for this site in four independent data sets of patients with CLL using time to treatment, progression-free survival, and overall survival as clinical end points. Conclusion Comprehensive quantitative DNA methylation analysis of the ZAP-70 gene in CLL identified important regions responsible for transcriptional regulation. In addition, loss of methylation at a specific single CpG dinucleotide in the ZAP-70 5′ regulatory sequence is a highly predictive and reproducible biomarker of poor prognosis in this disease. This work demonstrates the feasibility of using quantitative specific ZAP-70 methylation analysis as a relevant clinically applicable prognostic test in CLL. PMID:22564988

Changes in DNA methylation over the growing season differ between North Carolina farmworkers and non-farmworkers.

PubMed

Howard, Timothy D; Hsu, Fang-Chi; Chen, Haiying; Quandt, Sara A; Talton, Jennifer W; Summers, Phillip; Arcury, Thomas A

2016-10-01

The occupational risk to farmworkers, particularly chronic exposure to pesticides, is an acknowledged environmental and work-related health problem. Epigenetics has recently been shown to contribute to a number of complex diseases and traits, including measures of cognitive function and preclinical neurodegenerative disease. We sought to determine whether changes in DNA methylation existed between farmworker and non-farmworker populations and to identify the genes most likely involved in those changes. Eighty-three farmworkers and 60 non-farmworkers were selected from PACE4, a community-based, participatory research project comparing occupational exposures between immigrant Latino farmworker and non-farmworker manual workers. Measurements of DNA methylation were performed with the Infinium HumanMethylation450 BeadChip, at the beginning and end of the 2012 growing season. Bonferroni adjustment was used to identify significant findings (p = 1.03 × 10(-7), based on 485,000 tested methylation sites), although less stringent criteria (i.e., p ≤ 1 × 10(-6)) were used to identify sites of interest. Expression quantitative trait locus (eQTL) databases were used to help identify the most likely functional genes for each associated methylation site. Methylation at 36 CpG sites, located in or near 72 genes, differed between the two groups (p ≤ 1 × 10(-6)). The difference between the two groups was generally due to an increase in methylation in the farmworkers and a slight decrease in methylation in the non-farmworkers. Enrichment was observed in several biological pathways, including those involved in the immune response, as well as growth hormone signaling, role of BRCA1 in DNA damage response, p70S6K signaling, and PI3K signaling in B lymphocytes. We identified considerable changes in DNA methylation at 36 CpG sites over the growing season that differed between farmworkers and non-farmworkers. Dominant pathways included immune-related (HLA) processes, as well as a number of diverse biological systems. Further studies are necessary to determine which exposures or behaviors are responsible for the observed changes, and whether these changes eventually lead to disease-related phenotypes in this population.

76 FR 24493 - Statement of Organization, Functions, and Delegations of Authority

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-02

... reorganization of the Laboratory Science, Policy, and Practice Program Office, Office of Surveillance... Laboratory Policy and Practice (CPGB), Laboratory Science, Policy, and Practice Program Office (CPG), and...

Structure of the MLL CXXC domain – DNA complex and its functional role in MLL-AF9 leukemia

PubMed Central

Cierpicki, Tomasz; Risner, Laurie E.; Grembecka, Jolanta; Lukasik, Stephen M.; Popovic, Relja; Omonkowska, Monika; Shultis, David S.; Zeleznik-Le, Nancy J.; Bushweller, John H.

2010-01-01

MLL (Mixed Lineage Leukemia) is the target of chromosomal translocations which cause leukemias with poor prognosis. All leukemogenic MLL fusion proteins retain the CXXC domain which binds to nonmethylated CpG DNA. We present the solution structure of the MLL CXXC domain in complex with DNA, showing for the first time how the CXXC domain distinguishes nonmethylated from methylated CpG DNA. Based on the structure, we designed point mutations which disrupt DNA binding. Introduction of these mutations into MLL-AF9 results in increased DNA methylation of specific CpG nucleotides in Hoxa9, increased H3K9 methylation, decreased expression of Hoxa9 locus transcripts, loss of immortalization potential, and inability to induce leukemia in mice. These results establish that DNA binding by the CXXC domain and protection against DNA methylation is essential for MLL fusion leukemia. They also provide support for this interaction as a potential target for therapeutic intervention. PMID:20010842

Using an Artificial Neural Bypass to Restore Cortical Control of Rhythmic Movements in a Human with Quadriplegia

PubMed Central

Sharma, Gaurav; Friedenberg, David A.; Annetta, Nicholas; Glenn, Bradley; Bockbrader, Marcie; Majstorovic, Connor; Domas, Stephanie; Mysiw, W. Jerry; Rezai, Ali; Bouton, Chad

2016-01-01

Neuroprosthetic technology has been used to restore cortical control of discrete (non-rhythmic) hand movements in a paralyzed person. However, cortical control of rhythmic movements which originate in the brain but are coordinated by Central Pattern Generator (CPG) neural networks in the spinal cord has not been demonstrated previously. Here we show a demonstration of an artificial neural bypass technology that decodes cortical activity and emulates spinal cord CPG function allowing volitional rhythmic hand movement. The technology uses a combination of signals recorded from the brain, machine-learning algorithms to decode the signals, a numerical model of CPG network, and a neuromuscular electrical stimulation system to evoke rhythmic movements. Using the neural bypass, a quadriplegic participant was able to initiate, sustain, and switch between rhythmic and discrete finger movements, using his thoughts alone. These results have implications in advancing neuroprosthetic technology to restore complex movements in people living with paralysis. PMID:27658585

Minding the Cyber-Physical Gap: Model-Based Analysis and Mitigation of Systemic Perception-Induced Failure.

PubMed

Mordecai, Yaniv; Dori, Dov

2017-07-17

The cyber-physical gap (CPG) is the difference between the 'real' state of the world and the way the system perceives it. This discrepancy often stems from the limitations of sensing and data collection technologies and capabilities, and is inevitable at some degree in any cyber-physical system (CPS). Ignoring or misrepresenting such limitations during system modeling, specification, design, and analysis can potentially result in systemic misconceptions, disrupted functionality and performance, system failure, severe damage, and potential detrimental impacts on the system and its environment. We propose CPG-Aware Modeling & Engineering (CPGAME), a conceptual model-based approach to capturing, explaining, and mitigating the CPG. CPGAME enhances the systems engineer's ability to cope with CPGs, mitigate them by design, and prevent erroneous decisions and actions. We demonstrate CPGAME by applying it for modeling and analysis of the 1979 Three Miles Island 2 nuclear accident, and show how its meltdown could be mitigated. We use ISO-19450:2015-Object Process Methodology as our conceptual modeling framework.

Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

PubMed

Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

2015-08-01

Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

PubMed

Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

2015-08-01

The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Comparative Analyses of DNA Methylation and Sequence Evolution Using Nasonia Genomes

PubMed Central

Park, Jungsun; Peng, Zuogang; Zeng, Jia; Elango, Navin; Park, Taesung; Wheeler, Dave; Werren, John H.; Yi, Soojin V.

2011-01-01

The functional and evolutionary significance of DNA methylation in insect genomes remains to be resolved. Nasonia is well situated for comparative analyses of DNA methylation and genome evolution, since the genomes of a moderately distant outgroup species as well as closely related sibling species are available. Using direct sequencing of bisulfite-converted DNA, we uncovered a substantial level of DNA methylation in 17 of 18 Nasonia vitripennis genes and a strong correlation between methylation level and CpG depletion. Notably, in the sex-determining locus transformer, the exon that is alternatively spliced between the sexes is heavily methylated in both males and females, whereas other exons are only sparsely methylated. Orthologous genes of the honeybee and Nasonia show highly similar relative levels of CpG depletion, despite ∼190 My divergence. Densely and sparsely methylated genes in these species also exhibit similar functional enrichments. We found that the degree of CpG depletion is negatively correlated with substitution rates between closely related Nasonia species for synonymous, nonsynonymous, and intron sites. This suggests that mutation rates increase with decreasing levels of germ line methylation. Thus, DNA methylation is prevalent in the Nasonia genome, may participate in regulatory processes such as sex determination and alternative splicing, and is correlated with several aspects of genome and sequence evolution. PMID:21693438

Realising the Promise of Cancer Predisposition Genes

PubMed Central

Rahman, Nazneen

2016-01-01

Genes in which germline mutations confer high or moderate increased risks of cancer are called cancer predisposition genes (CPG). Over 100 CPGs have been identified providing important scientific insights in many areas, particularly mechanisms of cancer causation. Moreover, clinical utilisation of CPGs has had substantial impact in diagnosis, optimised management and prevention of cancer. The recent transformative advances in DNA sequencing bring the promise of many more CPG discoveries and greater, broader clinical applications. However, there is also considerable potential for incorrect inferences and inappropriate clinical applications. Realising the promise of cancer predisposition genes for science and medicine will thus require careful navigation. PMID:24429628

Kidney Dysfunction in Adult Offspring Exposed In Utero to Type 1 Diabetes Is Associated with Alterations in Genome-Wide DNA Methylation

PubMed Central

Gautier, Jean-François; Porcher, Raphaël; Abi Khalil, Charbel; Bellili-Munoz, Naima; Fetita, Lila Sabrina; Travert, Florence; Choukem, Simeon-Pierre; Riveline, Jean-Pierre; Hadjadj, Samy; Larger, Etienne; Boudou, Philippe; Blondeau, Bertrand; Roussel, Ronan; Ferré, Pascal; Ravussin, Eric; Rouzet, François; Marre, Michel

2015-01-01

Background Fetal exposure to hyperglycemia impacts negatively kidney development and function. Objective Our objective was to determine whether fetal exposure to moderate hyperglycemia is associated with epigenetic alterations in DNA methylation in peripheral blood cells and whether those alterations are related to impaired kidney function in adult offspring. Design Twenty nine adult, non-diabetic offspring of mothers with type 1 diabetes (T1D) (case group) were matched with 28 offspring of T1D fathers (control group) for the study of their leukocyte genome-wide DNA methylation profile (27,578 CpG sites, Human Methylation 27 BeadChip, Illumina Infinium). In a subset of 19 cases and 18 controls, we assessed renal vascular development by measuring Glomerular Filtration Rate (GFR) and Effective Renal Plasma Flow (ERPF) at baseline and during vasodilatation produced by amino acid infusion. Results Globally, DNA was under-methylated in cases vs. controls. Among the 87 CpG sites differently methylated, 74 sites were less methylated and 13 sites more methylated in cases vs. controls. None of these CpG sites were located on a gene known to be directly involved in kidney development and/or function. However, the gene encoding DNA methyltransferase 1 (DNMT1)—a key enzyme involved in gene expression during early development–was under-methylated in cases. The average methylation of the 74 under-methylated sites differently correlated with GFR in cases and controls. Conclusion Alterations in methylation profile imprinted by the hyperglycemic milieu of T1D mothers during fetal development may impact kidney function in adult offspring. The involved pathways seem to be a nonspecific imprinting process rather than specific to kidney development or function. PMID:26258530

Kidney Dysfunction in Adult Offspring Exposed In Utero to Type 1 Diabetes Is Associated with Alterations in Genome-Wide DNA Methylation.

PubMed

Gautier, Jean-François; Porcher, Raphaël; Abi Khalil, Charbel; Bellili-Munoz, Naima; Fetita, Lila Sabrina; Travert, Florence; Choukem, Simeon-Pierre; Riveline, Jean-Pierre; Hadjadj, Samy; Larger, Etienne; Boudou, Philippe; Blondeau, Bertrand; Roussel, Ronan; Ferré, Pascal; Ravussin, Eric; Rouzet, François; Marre, Michel

2015-01-01

Fetal exposure to hyperglycemia impacts negatively kidney development and function. Our objective was to determine whether fetal exposure to moderate hyperglycemia is associated with epigenetic alterations in DNA methylation in peripheral blood cells and whether those alterations are related to impaired kidney function in adult offspring. Twenty nine adult, non-diabetic offspring of mothers with type 1 diabetes (T1D) (case group) were matched with 28 offspring of T1D fathers (control group) for the study of their leukocyte genome-wide DNA methylation profile (27,578 CpG sites, Human Methylation 27 BeadChip, Illumina Infinium). In a subset of 19 cases and 18 controls, we assessed renal vascular development by measuring Glomerular Filtration Rate (GFR) and Effective Renal Plasma Flow (ERPF) at baseline and during vasodilatation produced by amino acid infusion. Globally, DNA was under-methylated in cases vs. controls. Among the 87 CpG sites differently methylated, 74 sites were less methylated and 13 sites more methylated in cases vs. controls. None of these CpG sites were located on a gene known to be directly involved in kidney development and/or function. However, the gene encoding DNA methyltransferase 1 (DNMT1)--a key enzyme involved in gene expression during early development--was under-methylated in cases. The average methylation of the 74 under-methylated sites differently correlated with GFR in cases and controls. Alterations in methylation profile imprinted by the hyperglycemic milieu of T1D mothers during fetal development may impact kidney function in adult offspring. The involved pathways seem to be a nonspecific imprinting process rather than specific to kidney development or function.

Epigenetic Contribution of the Myosin Light Chain Kinase Gene to the Risk for Acute Respiratory Distress Syndrome

PubMed Central

Szilágyi, Keely L.; Liu, Cong; Zhang, Xu; Wang, Ting; Fortman, Jeffrey D.; Zhang, Wei; Garcia, Joe G.N.

2016-01-01

Acute respiratory distress syndrome (ARDS) is a devastating clinical syndrome with a considerable case fatality rate (~30-40%). Health disparities exist with African descent subjects (ADs) exhibiting greater mortality than European descent individuals (EDs). Myosin light chain kinase (MLCK) is encoded by MYLK whose genetic variants are implicated in ARDS pathogenesis and may influence ARDS mortality. As baseline population-specific epigenetic changes, i.e. cytosine modifications, have been observed between AD and ED individuals, epigenetic variations in MYLK may provide insights into ARDS disparities. We compared methylation levels of MYLK CpGs between ARDS patients and ICU controls overall and by ethnicity in a nested case control study of 39 ARDS cases and 75 non-ARDS intensive care unit controls. Two MYLK CpG sites (cg03892735, cg23344121) were differentially modified between ARDS subjects and controls (p<0.05; q<0.25) in a logistic regression model, where no effect modification from ethnicity or age was found. One CpG site was associated with ARDS in patients less than 58 years old, cg19611163 (intron 19,20). Two CpG sites were associated with ARDS in EDs only, gene body CpG (cg01894985, intron 2,3) and CpG (cg16212219, intron 31,32), with higher modification levels exhibited in ARDS subjects than controls. Cis-acting mQTL (modified cytosine quantitative trait loci) were identified using linear regression between local genetic variants and modification levels for two ARDS-associated CpGs (cg23344121, cg16212219). In summary, these ARDS-associated MYLK CpGs with effect modification by ethnicity and local mQTL, suggest that MYLK epigenetic variation and local genetic background may contribute to health disparities observed in ARDS. PMID:27543902

A phenolic glycoside from Flacourtia indica induces heme mediated oxidative stress in Plasmodium falciparum and attenuates malaria pathogenesis in mice.

PubMed

Singh, Shiv Vardan; Manhas, Ashan; Singh, Suriya P; Mishra, Sonali; Tiwari, Nimisha; Kumar, Parmanand; Shanker, Karuna; Srivastava, Kumkum; Sashidhara, Koneni V; Pal, Anirban

2017-07-01

Flacourtia indica is especially popular among the various communities of many African countries where it is being used traditionally for the treatment of malaria. In our previous report, we have identified some phenolic glycosides from the aerial parts of F. indica as promising antiplasmodial agents under in vitro conditions. Antimalarial bioprospection of F. indica derived phenolic glycoside in Swiss mice (in vivo) with special emphasis on its mode of action. Chloroquine sensitive strain of Plasmodium falciparum was routinely cultured and used for the in vitro studies. The in vivo antimalarial potential of phenolic glycoside was evaluated against P. berghei in Swiss mice through an array of parameters viz., hematological, biochemical, chemo-suppression and mean survival time. 2-(6-benzoyl-β-d-glucopyranosyloxy)-7-(1α, 2α, 6α-trihydroxy-3-oxocyclohex-4-enoyl)-5-hydroxybenzyl alcohol (CPG), a phenolic glycoside isolated from the aerial parts of F. indica was found to exhibit promising antiplasmodial activity by arresting the P. falciparum growth at the trophozoite stage. Spectroscopic investigations reveal that CPG possesses a strong binding affinity with free heme moieties. In addition, these interactions lead to the inhibition of heme polymerization in malaria parasite, augmenting oxidative stress, and delaying the rapid growth of parasite. Under in-vivo condition, CPG exhibited significant antimalarial activity against P. berghei at 50 and 75mg/kg body weight through chemo-suppression of parasitemia and ameliorating the parasite induced inflammatory and oxidative (hepatic) imbalance in the experimental mice. CPG was found to be a potential antimalarial constituent of F. indica with an explored mechanism of action, which also offers the editing choices for developing CPG based antimalarial chemotypes. Copyright © 2017 Elsevier GmbH. All rights reserved.

Genome-wide methylation analysis identifies differentially methylated CpG loci associated with severe obesity in childhood.

PubMed

Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A

2015-01-01

Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value < 0.05). The top pathways enriched among the DMCpGs included developmental processes, immune system regulation, regulation of cell signaling, and small GTPase-mediated signal transduction. The associations between the methylation of selected DMCpGs with childhood obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P < 0.01), while obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.

Methylomics of gene expression in human monocytes

PubMed Central

Liu, Yongmei; Ding, Jingzhong; Reynolds, Lindsay M.; Lohman, Kurt; Register, Thomas C.; De La Fuente, Alberto; Howard, Timothy D.; Hawkins, Greg A.; Cui, Wei; Morris, Jessica; Smith, Shelly G.; Barr, R. Graham; Kaufman, Joel D.; Burke, Gregory L.; Post, Wendy; Shea, Steven; Mccall, Charles E.; Siscovick, David; Jacobs, David R.; Tracy, Russell P.; Herrington, David M.; Hoeschele, Ina

2013-01-01

DNA methylation is one of several epigenetic mechanisms that contribute to the regulation of gene expression; however, the extent to which methylation of CpG dinucleotides correlates with gene expression at the genome-wide level is still largely unknown. Using purified primary monocytes from subjects in a large community-based cohort (n = 1264), we characterized methylation (>485 000 CpG sites) and mRNA expression (>48K transcripts) and carried out genome-wide association analyses of 8370 expression phenotypes. We identified 11 203 potential cis-acting CpG loci whose degree of methylation was associated with gene expression (eMS) at a false discovery rate threshold of 0.001. Most of the associations were consistent in effect size and direction of effect across sex and three ethnicities. Contrary to expectation, these eMS were not predominately enriched in promoter regions, or CpG islands, but rather in the 3′ UTR, gene bodies, CpG shores or ‘offshore’ sites, and both positive and negative correlations between methylation and expression were observed across all locations. eMS were enriched for regions predicted to be regulatory by ENCODE (Encyclopedia of DNA Elements) data in multiple cell types, particularly enhancers. One of the strongest association signals detected (P < 2.2 × 10−308) was a methylation probe (cg17005068) in the promoter/enhancer region of the glutathione S-transferase theta 1 gene (GSTT1, encoding the detoxification enzyme) with GSTT1 mRNA expression. Our study provides a detailed description of the epigenetic architecture in human monocytes and its relationship to gene expression. These data may help prioritize interrogation of biologically relevant methylation loci and provide new insights into the epigenetic basis of human health and diseases. PMID:23900078

Phase 1 testing of detoxified LPS/group B meningococcal outer membrane protein vaccine with and without synthetic CPG 7909 adjuvant for the prevention and treatment of sepsis.

PubMed

Cross, Alan S; Greenberg, Nancy; Billington, Melissa; Zhang, Lei; DeFilippi, Christopher; May, Ryan C; Bajwa, Kanwaldeep K

2015-11-27

Gram-negative bacteria (GNB) are a leading cause of nosocomial infection and sepsis. Increasing multi-antibiotic resistance has left clinicians with fewer therapeutic options. Antibodies to GNB lipopolysaccharide (LPS, or endotoxin) have reduced morbidity and mortality as a result of infection and are not subject to the resistance mechanisms deployed by bacteria against antibiotics. In this phase 1 study, we administered a vaccine that elicits antibodies against a highly conserved portion of LPS with and without a CpG oligodeoxynucleotide (ODN) TLR9 agonist as adjuvant. A vaccine composed of the detoxified LPS (dLPS) from E. coli O111:B4 (J5 mutant) non-covalently complexed to group B meningococcal outer membrane protein (OMP). Twenty healthy adult subjects received three doses at 0, 29 and 59 days of antigen (10 μg dLPS) with or without CPG 7909 (250 or 500 μg). Subjects were evaluated for local and systemic adverse effects and laboratory findings. Anti-J5 LPS IgG and IgM antibody levels were measured by electrochemiluminesence. Due to premature study termination, not all subjects received all three doses. All vaccine formulations were well-tolerated with no local or systemic events of greater than moderate severity. The vaccine alone group achieved a ≥ 4-fold "responder" response in IgG and IgM antibody in only one of 6 subjects. In contrast, the vaccine plus CPG 7909 groups appeared to have earlier and more sustained (to 180 days) responses, greater mean-fold increases, and a higher proportion of "responders" achieving ≥ 4-fold increases over baseline. Although the study was halted before all enrolled subjects received all three doses, the J5dLPS/OMP vaccine, with or without CpG adjuvant, was safe and well-tolerated. The inclusion of CpG increased the number of subjects with a ≥ 4-fold antibody response, evident even after the second of three planned doses. A vaccine comprising J5dLPS/OMP antigen with CpG adjuvant merits further investigation. ClinicalTrials.gov Identifier: NCT01164514. Copyright © 2015 Elsevier Ltd. All rights reserved.

Adherence to Clinical Practice Guidelines during Dementia Work-Up in a Real-World Setting: A Study from the Registry of Dementias of Girona.

PubMed

Turró-Garriga, Oriol; Calvó-Perxas, Laia; Vilalta-Franch, Joan; Hernández-Ferrándiz, Marta; Flaqué, Margarita; Linares, Marta; Cullell, Marta; Gich, Jordi; Casas, Isabel; Perkal, Héctor; Garre-Olmo, Josep

2017-01-01

There are several position statements and clinical practice guidelines (CPG) for diagnosing dementia. Our aims were to evaluate the adherence to CPG among specialists in the 7 memory clinics included in the Registry of Dementias of Girona (ReDeGi), and to compare the results between 2007-2011 and 2012-2015. We also determined the time and number of visits required to achieve a diagnosis, the supplementary tests ordered, and the drugs prescribed according to dementia subtypes. Medical charts of a stratified random sample of 475 ReDeGi cases were reviewed. Basic dementia work-up was evaluated using as a reference evidence-based CPG. An Index of Adherence (AI) was calculated using the following items in the medical chart: cognitive symptomatology; functional disability evaluation; physical examination; neurological examination; psychiatric examination; brief cognitive examination; activities of daily living performance examination; blood test; structural neuroimaging (CT-scan or MRI). The mean AI to CPG among specialists was of 8.2 points, and it improved from 7.9 points in 2007-2011 to 8.5 points in 2012-2015 (Cohen's d = 0.46). A lower adherence was detected in the most severe cases. A dementia diagnosis required 3.5 visits, regardless of the subtype of dementia, although milder cases required more time, more visits, and more supplementary tests than severe cases. The adherence to CPG in the catchment area of the ReDeGi is high, and an epidemiological surveillance system such as the ReDeGi may help in improving it. Dementia guidelines should establish procedures adapted to clinical practice, with simplified recommendations for most severe cases.

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

PubMed Central

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

2016-01-01

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

PubMed

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

Immortalization of T-cells is accompanied by gradual changes in CpG methylation resulting in a profile resembling a subset of T-cell leukemias.

PubMed

Degerman, Sofie; Landfors, Mattias; Siwicki, Jan Konrad; Revie, John; Borssén, Magnus; Evelönn, Emma; Forestier, Erik; Chrzanowska, Krystyna H; Rydén, Patrik; Keith, W Nicol; Roos, Göran

2014-07-01

We have previously described gene expression changes during spontaneous immortalization of T-cells, thereby identifying cellular processes important for cell growth crisis escape and unlimited proliferation. Here, we analyze the same model to investigate the role of genome-wide methylation in the immortalization process at different time points pre-crisis and post-crisis using high-resolution arrays. We show that over time in culture there is an overall accumulation of methylation alterations, with preferential increased methylation close to transcription start sites (TSSs), islands, and shore regions. Methylation and gene expression alterations did not correlate for the majority of genes, but for the fraction that correlated, gain of methylation close to TSS was associated with decreased gene expression. Interestingly, the pattern of CpG site methylation observed in immortal T-cell cultures was similar to clinical T-cell acute lymphoblastic leukemia (T-ALL) samples classified as CpG island methylator phenotype positive. These sites were highly overrepresented by polycomb target genes and involved in developmental, cell adhesion, and cell signaling processes. The presence of non-random methylation events in in vitro immortalized T-cell cultures and diagnostic T-ALL samples indicates altered methylation of CpG sites with a possible role in malignant hematopoiesis. Copyright © 2014 Neoplasia Press, Inc. Published by Elsevier Inc. All rights reserved.

Combining Human Epigenetics and Sleep Studies in Caenorhabditis elegans: A Cross-Species Approach for Finding Conserved Genes Regulating Sleep.

PubMed

Huang, Huiyan; Zhu, Yong; Eliot, Melissa N; Knopik, Valerie S; McGeary, John E; Carskadon, Mary A; Hart, Anne C

2017-06-01

We aimed to test a combined approach to identify conserved genes regulating sleep and to explore the association between DNA methylation and sleep length. We identified candidate genes associated with shorter versus longer sleep duration in college students based on DNA methylation using Illumina Infinium HumanMethylation450 BeadChip arrays. Orthologous genes in Caenorhabditis elegans were identified, and we examined whether their loss of function affected C. elegans sleep. For genes whose perturbation affected C. elegans sleep, we subsequently undertook a small pilot study to re-examine DNA methylation in an independent set of human participants with shorter versus longer sleep durations. Eighty-seven out of 485,577 CpG sites had significant differential methylation in young adults with shorter versus longer sleep duration, corresponding to 52 candidate genes. We identified 34 C. elegans orthologs, including NPY/flp-18 and flp-21, which are known to affect sleep. Loss of five additional genes alters developmentally timed C. elegans sleep (B4GALT6/bre-4, DOCK180/ced-5, GNB2L1/rack-1, PTPRN2/ida-1, ZFYVE28/lst-2). For one of these genes, ZFYVE28 (also known as hLst2), the pilot replication study again found decreased DNA methylation associated with shorter sleep duration at the same two CpG sites in the first intron of ZFYVE28. Using an approach that combines human epigenetics and C. elegans sleep studies, we identified five genes that play previously unidentified roles in C. elegans sleep. We suggest sleep duration in humans may be associated with differential DNA methylation at specific sites and that the conserved genes identified here likely play roles in C. elegans sleep and in other species. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

PubMed Central

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

2013-01-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

DOE PAGES

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

2015-09-21

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

PubMed

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

2013-12-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

Functional characterization of the human phosphodiesterase 7A1 promoter.

PubMed Central

Torras-Llort, Mònica; Azorín, Fernando

2003-01-01

In this paper, the human phosphodiesterase 7A1 (h PDE7A1 ) promoter region was identified and functionally characterized. Transient transfection experiments indicated that a 2.9 kb fragment of the h PDE7A1 5'-flanking region, to position -2907, has strong promoter activity in Jurkat T-cells. Deletion analysis showed that the proximal region, up to position -988, contains major cis -regulatory elements of the h PDE7A1 promoter. This minimal promoter region contains a regulatory CpG island which is essential for promoter activity. The CpG island contains three potential cAMP-response-element-binding protein (CREB)-binding sites that, as judged by in vivo dimethyl sulphate (DMS) footprinting, are occupied in Jurkat T-cells. Moreover, over-expression of CREB results in increased promoter activity, but, on the other hand, promoter activity decreases when a dominant-negative form of CREB (KCREB) is over-expressed. In vivo DMS footprinting strongly indicates that other transcription factors, such Ets-2, nuclear factor of activated T-cells 1 (NFAT-1) and nuclear factor kappaB (NF-kappaB), might also contribute to the regulation of h PDE7A1 promoter. Finally, h PDE7A1 promoter was found to be induced by treatment with PMA, but not by treatment with dibutyryl cAMP or forskolin. These results provide insights into the factors and mechanisms that regulate expression of the h PDE7A gene. PMID:12737631

CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

PubMed

Hanagata, Nobutaka

2017-01-01

Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

DNA containing CpG motifs induces angiogenesis

NASA Astrophysics Data System (ADS)

Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

2002-06-01

New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

DNA-inorganic hybrid nanovaccine for cancer immunotherapy

NASA Astrophysics Data System (ADS)

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-01

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker

PubMed Central

Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

2015-01-01

Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445

[Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].

PubMed

Delessert, D; Pomini, V; Grasset, F; Baumann, P

2008-01-01

Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".

Effectiveness of implementation strategies in improving physician adherence to guideline recommendations in heart failure: a systematic review protocol.

PubMed

Van Spall, Harriette G C; Shanbhag, Deepti; Gabizon, Itzhak; Ibrahim, Quazi; Graham, Ian D; Harlos, Karen; Haynes, R Brian; Connolly, Stuart J

2016-03-31

The uptake of Clinical Practice Guideline (CPG) recommendations that improve outcomes in heart failure (HF) remains suboptimal. We will conduct a systematic review to identify implementation strategies that improve physician adherence to class I recommendations, those with clear evidence that benefits outweigh the risks. We will use American, Canadian and European HF guidelines as our reference. We will conduct a literature search in the databases of MEDLINE, EMBASE, HEALTHSTAR, CINAHL, Cochrane Library, Campbell Collaboration, Joanna Briggs Institute Evidence Based Practice, Centre for Reviews and Dissemination and Evidence Based Practice Centres. We will include prospective studies evaluating implementation interventions aimed at improving uptake of class I CPG recommendations in HF. We will extract data in duplicate. We will classify interventions according to their level of application (ie, provider, organisation, systems level) and common underlying characteristics (eg, education, decision-support, financial incentives) using the Cochrane Effective Practice and Organisation of Care Taxonomy. We will assess the impact of the intervention on adherence to the CPGs. Outcomes will include proportion of eligible patients who were: prescribed a CPG-recommended pharmacological treatment; referred for device consideration; provided self-care education at discharge; and provided left ventricular function assessment. We will include clinical outcomes such as hospitalisations, readmissions and mortality, if data is available. We will identify the common elements of successful and failing interventions, and examine the context in which they were applied, using the Process Redesign contextual framework. We will synthesise the results narratively and, if appropriate, will pool results for meta-analysis. In this review, we will assess the impact of implementation strategies and contextual factors on physician adherence to HF CPGs. We will explore why some interventions may succeed in one setting and fail in another. We will disseminate our findings through briefing reports, publications and presentations. CRD42015017155. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Non-specific filtering of beta-distributed data.

PubMed

Wang, Xinhui; Laird, Peter W; Hinoue, Toshinori; Groshen, Susan; Siegmund, Kimberly D

2014-06-19

Non-specific feature selection is a dimension reduction procedure performed prior to cluster analysis of high dimensional molecular data. Not all measured features are expected to show biological variation, so only the most varying are selected for analysis. In DNA methylation studies, DNA methylation is measured as a proportion, bounded between 0 and 1, with variance a function of the mean. Filtering on standard deviation biases the selection of probes to those with mean values near 0.5. We explore the effect this has on clustering, and develop alternate filter methods that utilize a variance stabilizing transformation for Beta distributed data and do not share this bias. We compared results for 11 different non-specific filters on eight Infinium HumanMethylation data sets, selected to span a variety of biological conditions. We found that for data sets having a small fraction of samples showing abnormal methylation of a subset of normally unmethylated CpGs, a characteristic of the CpG island methylator phenotype in cancer, a novel filter statistic that utilized a variance-stabilizing transformation for Beta distributed data outperformed the common filter of using standard deviation of the DNA methylation proportion, or its log-transformed M-value, in its ability to detect the cancer subtype in a cluster analysis. However, the standard deviation filter always performed among the best for distinguishing subgroups of normal tissue. The novel filter and standard deviation filter tended to favour features in different genome contexts; for the same data set, the novel filter always selected more features from CpG island promoters and the standard deviation filter always selected more features from non-CpG island intergenic regions. Interestingly, despite selecting largely non-overlapping sets of features, the two filters did find sample subsets that overlapped for some real data sets. We found two different filter statistics that tended to prioritize features with different characteristics, each performed well for identifying clusters of cancer and non-cancer tissue, and identifying a cancer CpG island hypermethylation phenotype. Since cluster analysis is for discovery, we would suggest trying both filters on any new data sets, evaluating the overlap of features selected and clusters discovered.

HumanMethylation450K Array–Identified Biomarkers Predict Tumour Recurrence/Progression at Initial Diagnosis of High-risk Non-muscle Invasive Bladder Cancer

PubMed Central

Kitchen, Mark O; Bryan, Richard T; Emes, Richard D; Luscombe, Christopher J; Cheng, KK; Zeegers, Maurice P; James, Nicholas D; Gommersall, Lyndon M; Fryer, Anthony A

2018-01-01

Background: High-risk non-muscle invasive bladder cancer (HR-NMIBC) is a clinically unpredictable disease. Despite clinical risk estimation tools, many patients are undertreated with intra-vesical therapies alone, whereas others may be over-treated with early radical surgery. Molecular biomarkers, particularly DNA methylation, have been reported as predictive of tumour/patient outcomes in numerous solid organ and haematologic malignancies; however, there are few reports in HR-NMIBC and none using genome-wide array assessment. We therefore sought to identify novel DNA methylation markers of HR-NMIBC clinical outcomes that might predict tumour behaviour at initial diagnosis and help guide patient management. Patients and methods: A total of 21 primary initial diagnosis HR-NMIBC tumours were analysed by Illumina HumanMethylation450 BeadChip arrays and subsequently bisulphite Pyrosequencing. In all, 7 had not recurred at 1 year after resection and 14 had recurred and/or progressed despite intra-vesical BCG. A further independent cohort of 32 HR-NMIBC tumours (17 no recurrence and 15 recurrence and/or progression despite BCG) were also assessed by bisulphite Pyrosequencing. Results: Array analyses identified 206 CpG loci that segregated non-recurrent HR-NMIBC tumours from clinically more aggressive recurrence/progression tumours. Hypermethylation of CpG cg11850659 and hypomethylation of CpG cg01149192 in combination predicted HR-NMIBC recurrence and/or progression within 1 year of diagnosis with 83% sensitivity, 79% specificity, and 83% positive and 79% negative predictive values. Conclusions: This is the first genome-wide DNA methylation analysis of a unique HR-NMIBC tumour cohort encompassing known 1-year clinical outcomes. Our analyses identified potential novel epigenetic markers that could help guide individual patient management in this clinically unpredictable disease. PMID:29343995

Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

PubMed

Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

2016-01-01

Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

Comprehensive analysis of CpG islands in human chromosomes 21 and 22

NASA Astrophysics Data System (ADS)

Takai, Daiya; Jones, Peter A.

2002-03-01

CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

PubMed

Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

2017-06-01

Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

PubMed

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-28

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

A Hybrid Approach for CpG Island Detection in the Human Genome.

PubMed

Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

2016-01-01

CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

PubMed Central

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

Improved Prediction of Non-methylated Islands in Vertebrates Highlights Different Characteristic Sequence Patterns

PubMed Central

Vingron, Martin

2016-01-01

Non-methylated islands (NMIs) of DNA are genomic regions that are important for gene regulation and development. A recent study of genome-wide non-methylation data in vertebrates by Long et al. (eLife 2013;2:e00348) has shown that many experimentally identified non-methylated regions do not overlap with classically defined CpG islands which are computationally predicted using simple DNA sequence features. This is especially true in cold-blooded vertebrates such as Danio rerio (zebrafish). In order to investigate how predictive DNA sequence is of a region’s methylation status, we applied a supervised learning approach using a spectrum kernel support vector machine, to see if a more complex model and supervised learning can be used to improve non-methylated island prediction and to understand the sequence properties of these regions. We demonstrate that DNA sequence is highly predictive of methylation status, and that in contrast to existing CpG island prediction methods our method is able to provide more useful predictions of NMIs genome-wide in all vertebrate organisms that were studied. Our results also show that in cold-blooded vertebrates (Anolis carolinensis, Xenopus tropicalis and Danio rerio) where genome-wide classical CpG island predictions consist primarily of false positives, longer primarily AT-rich DNA sequence features are able to identify these regions much more accurately. PMID:27984582

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

The survival decrease in gastric cancer is associated with the methylation of B-cell CLL/lymphoma 6 member B promoter.

PubMed

Deng, Jingyu; Liang, Han; Dong, Qiuping; Hou, Yachao; Xie, Xingming; Yu, Jun; Fan, Daiming; Hao, Xishan

2014-07-01

The methylation of B-cell CLL/lymphoma 6 member B (BCL6B) DNA promoter was detected in several malignancies. Here, we quantitatively detect the methylated status of CpG sites of BCL6B DNA promoter of 459 patients with gastric cancer (GC) by using bisulfite gene sequencing. We show that patients with three or more methylated CpG sites in the BCL6B promoter were significantly associated with poor survival. Furthermore, by using the Akaike information criterion value calculation, we show that the methylated count of BCL6B promoter was identified to be the optimal prognostic predictor of GC patients.

Systematic CpT (ApG) depletion and CpG excess are unique genomic signatures of large DNA viruses infecting invertebrates.

PubMed

Upadhyay, Mohita; Sharma, Neha; Vivekanandan, Perumal

2014-01-01

Differences in the relative abundance of dinucleotides, if any may provide important clues on host-driven evolution of viruses. We studied dinucleotide frequencies of large DNA viruses infecting vertebrates (n = 105; viruses infecting mammals = 99; viruses infecting aves = 6; viruses infecting reptiles = 1) and invertebrates (n = 88; viruses infecting insects = 84; viruses infecting crustaceans = 4). We have identified systematic depletion of CpT(ApG) dinucleotides and over-representation of CpG dinucleotides as the unique genomic signature of large DNA viruses infecting invertebrates. Detailed investigation of this unique genomic signature suggests the existence of invertebrate host-induced pressures specifically targeting CpT(ApG) and CpG dinucleotides. The depletion of CpT dinucleotides among large DNA viruses infecting invertebrates is at least in part, explained by non-canonical DNA methylation by the infected host. Our findings highlight the role of invertebrate host-related factors in shaping virus evolution and they also provide the necessary framework for future studies on evolution, epigenetics and molecular biology of viruses infecting this group of hosts.

Pattern generating and reflex-like processes controlling aiming movements in the presence of inertia, damping and gravity. A theoretical note.

PubMed

Kalveram, K T

1991-01-01

A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.

Nucleosome dynamics and maintenance of epigenetic states of CpG islands

NASA Astrophysics Data System (ADS)

Sneppen, Kim; Dodd, Ian B.

2016-06-01

Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

Conserved nonsense-prone CpG sites in apoptosis-regulatory genes: conditional stop signs on the road to cell death.

PubMed

Zhao, Yongzhong; Epstein, Richard J

2013-01-01

Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.

The left end of rat L1 (L1Rn, long interspersed repeated) DNA which is a CpG island can function as a promoter.

PubMed Central

Nur, I; Pascale, E; Furano, A V

1988-01-01

Here we report that the 600 bp promoter-like region at the left end of a newly isolated and characterized rat L1 DNA element can activate the prokaryotic chloramphenicol acyltransferase gene in a rat cell line. Activation only occurs when the promoter region is oriented to the transferase gene as it is to the L1 protein encoding sequences and is 75% inhibited by methylation of just 5 of the 22 CpGs present in the promoter. The G + C rich promoter contains enough CpGs to qualify it as a CpG island, but in contrast to other CpG islands, genomic L1 promoters are fully methylated in both somatic cell and sperm DNA as judged by restriction enzyme analysis. Partial demethylation of the genomic promoters by treatment with 5-azacytidine failed to produce discrete L1 transcripts. The relationship of methylation to the evolutionary history and fate of the rat L1 promoter is discussed. Images PMID:2459662

Minding the Cyber-Physical Gap: Model-Based Analysis and Mitigation of Systemic Perception-Induced Failure

PubMed Central

2017-01-01

The cyber-physical gap (CPG) is the difference between the ‘real’ state of the world and the way the system perceives it. This discrepancy often stems from the limitations of sensing and data collection technologies and capabilities, and is inevitable at some degree in any cyber-physical system (CPS). Ignoring or misrepresenting such limitations during system modeling, specification, design, and analysis can potentially result in systemic misconceptions, disrupted functionality and performance, system failure, severe damage, and potential detrimental impacts on the system and its environment. We propose CPG-Aware Modeling & Engineering (CPGAME), a conceptual model-based approach to capturing, explaining, and mitigating the CPG. CPGAME enhances the systems engineer’s ability to cope with CPGs, mitigate them by design, and prevent erroneous decisions and actions. We demonstrate CPGAME by applying it for modeling and analysis of the 1979 Three Miles Island 2 nuclear accident, and show how its meltdown could be mitigated. We use ISO-19450:2015—Object Process Methodology as our conceptual modeling framework. PMID:28714910

Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker.

PubMed

Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

2015-12-01

Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

An automated graphics tool for comparative genomics: the Coulson plot generator

PubMed Central

2013-01-01

Background Comparative analysis is an essential component to biology. When applied to genomics for example, analysis may require comparisons between the predicted presence and absence of genes in a group of genomes under consideration. Frequently, genes can be grouped into small categories based on functional criteria, for example membership of a multimeric complex, participation in a metabolic or signaling pathway or shared sequence features and/or paralogy. These patterns of retention and loss are highly informative for the prediction of function, and hence possible biological context, and can provide great insights into the evolutionary history of cellular functions. However, representation of such information in a standard spreadsheet is a poor visual means from which to extract patterns within a dataset. Results We devised the Coulson Plot, a new graphical representation that exploits a matrix of pie charts to display comparative genomics data. Each pie is used to describe a complex or process from a separate taxon, and is divided into sectors corresponding to the number of proteins (subunits) in a complex/process. The predicted presence or absence of proteins in each complex are delineated by occupancy of a given sector; this format is visually highly accessible and makes pattern recognition rapid and reliable. A key to the identity of each subunit, plus hierarchical naming of taxa and coloring are included. A java-based application, the Coulson plot generator (CPG) automates graphic production, with a tab or comma-delineated text file as input and generating an editable portable document format or svg file. Conclusions CPG software may be used to rapidly convert spreadsheet data to a graphical matrix pie chart format. The representation essentially retains all of the information from the spreadsheet but presents a graphically rich format making comparisons and identification of patterns significantly clearer. While the Coulson plot format is highly useful in comparative genomics, its original purpose, the software can be used to visualize any dataset where entity occupancy is compared between different classes. Availability CPG software is available at sourceforge http://sourceforge.net/projects/coulson and http://dl.dropbox.com/u/6701906/Web/Sites/Labsite/CPG.html PMID:23621955

A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

PubMed Central

Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

2006-01-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

PubMed

Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

2006-03-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

The impact of methylation quantitative trait loci (mQTLs) on active smoking-related DNA methylation changes.

PubMed

Gao, Xu; Thomsen, Hauke; Zhang, Yan; Breitling, Lutz Philipp; Brenner, Hermann

2017-01-01

Methylation quantitative trait loci (mQTLs) are the genetic variants that may affect the DNA methylation patterns of CpG sites. However, their roles in influencing the disturbances of smoking-related epigenetic changes have not been well established. This study was conducted to address whether mQTLs exist in the vicinity of smoking-related CpG sites (± 50 kb) and to examine their associations with smoking exposure and all-cause mortality in older adults. We obtained DNA methylation profiles in whole blood samples by Illumina Infinium Human Methylation 450 BeadChip array of two independent subsamples of the ESTHER study (discovery set, n  = 581; validation set, n  = 368) and their corresponding genotyping data using the Illumina Infinium OncoArray BeadChip. After correction for multiple testing (FDR), we successfully identified that 70 out of 151 previously reported smoking-related CpG sites were significantly associated with 192 SNPs within the 50 kb search window of each locus. The 192 mQTLs significantly influenced the active smoking-related DNA methylation changes, with percentage changes ranging from 0.01 to 18.96%, especially for the weakly/moderately smoking-related CpG sites. However, these identified mQTLs were not directly associated with active smoking exposure or all-cause mortality. Our findings clearly demonstrated that if not dealt with properly, the mQTLs might impair the power of epigenetic-based models of smoking exposure to a certain extent. In addition, such genetic variants could be the key factor to distinguish between the heritable and smoking-induced impact on epigenome disparities. These mQTLs are of special importance when DNA methylation markers measured by Illumina Infinium assay are used for any comparative population studies related to smoking-related cancers and chronic diseases.

Epigenetics meets metabolomics: an epigenome-wide association study with blood serum metabolic traits

PubMed Central

Petersen, Ann-Kristin; Zeilinger, Sonja; Kastenmüller, Gabi; Römisch-Margl, Werner; Brugger, Markus; Peters, Annette; Meisinger, Christine; Strauch, Konstantin; Hengstenberg, Christian; Pagel, Philipp; Huber, Fritz; Mohney, Robert P.; Grallert, Harald; Illig, Thomas; Adamski, Jerzy; Waldenberger, Melanie; Gieger, Christian; Suhre, Karsten

2014-01-01

Previously, we reported strong influences of genetic variants on metabolic phenotypes, some of them with clinical relevance. Here, we hypothesize that DNA methylation may have an important and potentially independent effect on human metabolism. To test this hypothesis, we conducted what is to the best of our knowledge the first epigenome-wide association study (EWAS) between DNA methylation and metabolic traits (metabotypes) in human blood. We assess 649 blood metabolic traits from 1814 participants of the Kooperative Gesundheitsforschung in der Region Augsburg (KORA) population study for association with methylation of 457 004 CpG sites, determined on the Infinium HumanMethylation450 BeadChip platform. Using the EWAS approach, we identified two types of methylome–metabotype associations. One type is driven by an underlying genetic effect; the other type is independent of genetic variation and potentially driven by common environmental and life-style-dependent factors. We report eight CpG loci at genome-wide significance that have a genetic variant as confounder (P = 3.9 × 10−20 to 2.0 × 10−108, r2 = 0.036 to 0.221). Seven loci display CpG site-specific associations to metabotypes, but do not exhibit any underlying genetic signals (P = 9.2 × 10−14 to 2.7 × 10−27, r2 = 0.008 to 0.107). We further identify several groups of CpG loci that associate with a same metabotype, such as 4-vinylphenol sulfate and 4-androsten-3-beta,17-beta-diol disulfate. In these cases, the association between CpG-methylation and metabotype is likely the result of a common external environmental factor, including smoking. Our study shows that analysis of EWAS with large numbers of metabolic traits in large population cohorts are, in principle, feasible. Taken together, our data suggest that DNA methylation plays an important role in regulating human metabolism. PMID:24014485

Whole Genome DNA Methylation Analysis of Obstructive Sleep Apnea: IL1R2, NPR2, AR, SP140 Methylation and Clinical Phenotype.

PubMed

Chen, Yung-Che; Chen, Ting-Wen; Su, Mao-Chang; Chen, Chung-Jen; Chen, Kuang-Den; Liou, Chia-Wei; Tang, Petrus; Wang, Ting-Ya; Chang, Jen-Chieh; Wang, Chin-Chou; Lin, Hsin-Ching; Chin, Chien-Hung; Huang, Kuo-Tung; Lin, Meng-Chih; Hsiao, Chang-Chun

2016-04-01

We hypothesized that DNA methylation patterns may contribute to disease severity or the development of hypertension and excessive daytime sleepiness (EDS) in patients with obstructive sleep apnea (OSA). Illumina's (San Diego, CA, USA) DNA methylation 27-K assay was used to identify differentially methylated loci (DML). DNA methylation levels were validated by pyrosequencing. A discovery cohort of 15 patients with OSA and 6 healthy subjects, and a validation cohort of 72 patients with sleep disordered breathing (SDB). Microarray analysis identified 636 DMLs in patients with OSA versus healthy subjects, and 327 DMLs in patients with OSA and hypertension versus those without hypertension. In the validation cohort, no significant difference in DNA methylation levels of six selected genes was found between the primary snoring subjects and OSA patients (primary outcome). However, a secondary outcome analysis showed that interleukin-1 receptor 2 (IL1R2) promoter methylation (-114 cytosine followed by guanine dinucleotide sequence [CpG] site) was decreased and IL1R2 protein levels were increased in the patients with SDB with an oxygen desaturation index > 30. Androgen receptor (AR) promoter methylation (-531 CpG site) and AR protein levels were both increased in the patients with SDB with an oxygen desaturation index > 30. Natriuretic peptide receptor 2 (NPR2) promoter methylation (-608/-618 CpG sites) were decreased, whereas levels of both NPR2 and serum C type natriuretic peptide protein were increased in the SDB patients with EDS. Speckled protein 140 (SP140) promoter methylation (-194 CpG site) was increased, and SP140 protein levels were decreased in the patients with SDB and EDS. IL1R2 hypomethylation and AR hypermethylation may constitute an important determinant of disease severity, whereas NPR2 hypomethylation and SP140 hypermethylation may provide a biomarker for vulnerability to EDS in OSA. A commentary on this article appears in this issue on page 723. © 2016 Associated Professional Sleep Societies, LLC.

Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma

PubMed Central

Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li

2017-01-01

Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900

Exposure to Low Levels of Lead in Utero and Umbilical Cord Blood DNA Methylation in Project Viva: An Epigenome-Wide Association Study

PubMed Central

Hivert, Marie-France; Cardenas, Andres; Zhong, Jia; Rifas-Shiman, Sheryl L.; Agha, Golareh; Colicino, Elena; Just, Allan C.; Amarasiriwardena, Chitra; Lin, Xihong; Litonjua, Augusto A.; DeMeo, Dawn L.; Gillman, Matthew W.; Wright, Robert O.; Oken, Emily

2017-01-01

Background: Early-life exposure to lead is associated with deficits in neurodevelopment and with hematopoietic system toxicity. DNA methylation may be one of the underlying mechanisms for the adverse effects of prenatal lead on the offspring, but epigenome-wide methylation data for low levels of prenatal lead exposure are lacking. Objectives: We investigated the association between prenatal maternal lead exposure and epigenome-wide DNA methylation in umbilical cord blood nucleated cells in Project Viva, a prospective U.S.-based prebirth cohort with relatively low levels of lead exposure. Methods: Among 268 mother–infant pairs, we measured lead concentrations in red blood cells (RBC) from prenatal maternal blood samples, and using HumanMethylation450 Bead Chips, we measured genome-wide methylation levels at 482,397 CpG loci in umbilical cord blood and retained 394,460 loci after quality control. After adjustment for batch effects, cell types, and covariates, we used robust linear regression models to examine associations of prenatal lead exposure with DNA methylation in cord blood at epigenome-wide significance level [false discovery rate (FDR)<0.05]. Results: The mean [standard deviation (SD)] maternal RBC lead level was 1.22 (0.63) μg/dL. CpG cg10773601 showed an epigenome-wide significant negative association with prenatal lead exposure (−1.4% per doubling increase in lead exposure; p=2.3×10−7) and was annotated to C-Type Lectin Domain Family 11, Member A (CLEC11A), which functions as a growth factor for primitive hematopoietic progenitor cells. In sex-specific analyses, we identified more CpGs with FDR<0.05 among female infants (n=38) than among male infants (n=2). One CpG (cg24637308), which showed a strong negative association with prenatal lead exposure among female infants (−4.3% per doubling increase in lead exposure; p=1.1×10−06), was annotated to Dynein Heavy Chain Domain 1 gene (DNHD1) which is highly expressed in human brain. Interestingly, there were strong correlations between blood and brain methylation for CpG (cg24637308) based on another independent set of samples with a high proportion of female participants. Conclusion: Prenatal low-level lead exposure was associated with newborn DNA methylation, particularly in female infants. https://doi.org/10.1289/EHP1246 PMID:28858830

Exposure to Low Levels of Lead in Utero and Umbilical Cord Blood DNA Methylation in Project Viva: An Epigenome-Wide Association Study.

PubMed

Wu, Shaowei; Hivert, Marie-France; Cardenas, Andres; Zhong, Jia; Rifas-Shiman, Sheryl L; Agha, Golareh; Colicino, Elena; Just, Allan C; Amarasiriwardena, Chitra; Lin, Xihong; Litonjua, Augusto A; DeMeo, Dawn L; Gillman, Matthew W; Wright, Robert O; Oken, Emily; Baccarelli, Andrea A

2017-08-25

Early-life exposure to lead is associated with deficits in neurodevelopment and with hematopoietic system toxicity. DNA methylation may be one of the underlying mechanisms for the adverse effects of prenatal lead on the offspring, but epigenome-wide methylation data for low levels of prenatal lead exposure are lacking. We investigated the association between prenatal maternal lead exposure and epigenome-wide DNA methylation in umbilical cord blood nucleated cells in Project Viva, a prospective U.S.-based prebirth cohort with relatively low levels of lead exposure. Among 268 mother-infant pairs, we measured lead concentrations in red blood cells (RBC) from prenatal maternal blood samples, and using HumanMethylation450 Bead Chips, we measured genome-wide methylation levels at 482,397 CpG loci in umbilical cord blood and retained 394,460 loci after quality control. After adjustment for batch effects, cell types, and covariates, we used robust linear regression models to examine associations of prenatal lead exposure with DNA methylation in cord blood at epigenome-wide significance level [false discovery rate (FDR)<0.05]. The mean [standard deviation (SD)] maternal RBC lead level was 1.22 (0.63) μg/dL. CpG cg10773601 showed an epigenome-wide significant negative association with prenatal lead exposure (-1.4% per doubling increase in lead exposure; p=2.3×10-7) and was annotated to C-Type Lectin Domain Family 11, Member A ( CLEC11A ), which functions as a growth factor for primitive hematopoietic progenitor cells. In sex-specific analyses, we identified more CpGs with FDR<0.05 among female infants (n=38) than among male infants (n=2). One CpG (cg24637308), which showed a strong negative association with prenatal lead exposure among female infants (-4.3% per doubling increase in lead exposure; p=1.1×10-06), was annotated to Dynein Heavy Chain Domain 1 gene ( DNHD1 ) which is highly expressed in human brain. Interestingly, there were strong correlations between blood and brain methylation for CpG (cg24637308) based on another independent set of samples with a high proportion of female participants. Prenatal low-level lead exposure was associated with newborn DNA methylation, particularly in female infants. https://doi.org/10.1289/EHP1246.

Links between DNA methylation and nucleosome occupancy in the human genome.

PubMed

Collings, Clayton K; Anderson, John N

2017-01-01

DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

Prediction of epigenetically regulated genes in breast cancer cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen

Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines,more » which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identifed 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.« less

Clinical practice guideline for Sjögren's syndrome 2017.

PubMed

Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto

2018-05-01

The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.

Substantial reduction in hospital stay of children and adolescents with diabetic ketoacidosis after implementation of Clinical Practice Guidelines in a university hospital in Saudi Arabia.

PubMed

Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar

2017-02-01

We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.

Effects of low-dose aspirin on maternal blood pressure and vascular function in an experimental model of gestational hypertension.

PubMed

Osikoya, Oluwatobiloba; Jaini, Paresh A; Nguyen, An; Valdes, Melissa; Goulopoulou, Styliani

2017-06-01

Daily intake of low-dose aspirin after 12weeks of gestation is currently recommended as a preventative intervention in pregnancies in high risk of developing preeclampsia. This recommendation is based on epidemiological evidence, whereas experimental studies investigating the exact mechanisms of aspirin action during pregnancy are lacking. We previously showed that treating pregnant rats with a synthetic mimetic of unmethylated CpG DNA (bacterial DNA) caused preeclampsia-like characteristics such as maternal hypertension and increased cyclooxygenase (COX) expression and activity. In this study, we tested the hypothesis that daily maternal treatment with low-dose aspirin would prevent the development of maternal hypertension, reduce COX activity and thromboxane A 2 (TxA 2 ) production, and improve maternal vascular function in pregnant rats exposed to CpG ODN during gestation. Pregnant rats were treated with ODN2395 (synthetic CpG DNA) or saline (vehicle) on gestational days (GD) 14, 16, 18. Daily low-dose aspirin treatment (1.5mg/kgBW) started on GD10 and continued throughout gestation. Pregnant rats treated with ODN2395 had greater systolic blood pressure compared to controls (120±4mmHg vs. 100±5mmHg, p=0.03) and aspirin did not prevent this increase (p=0.86). Aspirin prevented ODN2395-induced increases of TxB 2 (TxA 2 metabolite) in serum and mesenteric arteries. ODN2395 increased expression of COX-1 and COX-2 in mesenteric and uterine arteries and aspirin abolished these effects. Aspirin reduced contractile responses to phenylephrine and U46619 (TxA 2 mimetic) in mesenteric arteries from control rats but not from ODN2395-treated rats. In conclusion, treatment with low-dose aspirin reduced systemic and vascular COX expression and activity but did not prevent the development of maternal hypertension induced by exposure to unmethylated CpG DNA (bacterial DNA). Copyright © 2017 Elsevier Ltd. All rights reserved.

[Web Visit Patterns for the Clinical Practice Guidelines for Management of Depressive Disorder and Alcohol Abuse-Dependence].

PubMed

Suárez-Obando, Fernando; Restrepo, Carlos Gómez

Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

PubMed

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

2012-11-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

PubMed Central

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

2013-01-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

PubMed

Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

2011-10-01

Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

PubMed

Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

2008-12-20

The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

Pretreatment dietary intake is associated with tumor suppressor DNA methylation in head and neck squamous cell carcinomas

PubMed Central

Colacino, Justin A.; Arthur, Anna E.; Dolinoy, Dana C.; Sartor, Maureen A.; Duffy, Sonia A.; Chepeha, Douglas B.; Bradford, Carol R.; Walline, Heather M.; McHugh, Jonathan B.; D'Silva, Nisha; Carey, Thomas E.; Wolf, Gregory T.; Taylor, Jeremy M.G.; Peterson, Karen E.; Rozek, Laura S.

2012-01-01

Diet is associated with cancer prognosis, including head and neck cancer (HNC), and has been hypothesized to influence epigenetic state by determining the availability of functional groups involved in the modification of DNA and histone proteins. The goal of this study was to describe the association between pretreatment diet and HNC tumor DNA methylation. Information on usual pretreatment food and nutrient intake was estimated via food frequency questionnaire (FFQ) on 49 HNC cases. Tumor DNA methylation patterns were assessed using the Illumina Goldengate Methylation Cancer Panel. First, a methylation score, the sum of individual hypermethylated tumor suppressor associated CpG sites, was calculated and associated with dietary intake of micronutrients involved in one-carbon metabolism and antioxidant activity, and food groups abundant in these nutrients. Second, gene specific analyses using linear modeling with empirical Bayesian variance estimation were conducted to identify if methylation at individual CpG sites was associated with diet. All models were controlled for age, sex, smoking, alcohol and HPV status. Individuals reporting in the highest quartile of folate, vitamin B12 and vitamin A intake, compared with those in the lowest quartile, showed significantly less tumor suppressor gene methylation, as did patients reporting the highest cruciferous vegetable intake. Gene specific analyses identified differential associations between DNA methylation and vitamin B12 and vitamin A intake when stratifying by HPV status. These preliminary results suggest that intake of folate, vitamin A and vitamin B12 may be associated with the tumor DNA methylation profile in HNC and enhance tumor suppression. PMID:22722388

Epigenetic contribution of the myosin light chain kinase gene to the risk for acute respiratory distress syndrome.

PubMed

Szilágyi, Keely L; Liu, Cong; Zhang, Xu; Wang, Ting; Fortman, Jeffrey D; Zhang, Wei; Garcia, Joe G N

2017-02-01

Acute respiratory distress syndrome (ARDS) is a devastating clinical syndrome with a considerable case fatality rate (∼30%-40%). Health disparities exist with African descent (AD) subjects exhibiting greater mortality than European descent (ED) individuals. Myosin light chain kinase is encoded by MYLK, whose genetic variants are implicated in ARDS pathogenesis and may influence ARDS mortality. As baseline population-specific epigenetic changes, that is, cytosine modifications, have been observed between AD and ED individuals, epigenetic variations in MYLK may provide insights into ARDS disparities. We compared methylation levels of MYLK cytosine-guanine dinucleotides (CpGs) between ARDS patients and intensive care unit (ICU) controls overall and by ethnicity in a nested case-control study of 39 ARDS cases and 75 non-ARDS ICU controls. Two MYLK CpG sites (cg03892735 and cg23344121) were differentially modified between ARDS subjects and controls (P < 0.05; q < 0.25) in a logistic regression model, where no effect modification by ethnicity or age was found. One CpG site was associated with ARDS in patients aged <58 years, cg19611163 (intron 19, 20). Two CpG sites were associated with ARDS in EDs only, gene body CpG (cg01894985, intron 2, 3) and CpG (cg16212219, intron 31, 32), with higher modification levels exhibited in ARDS subjects than controls. Cis-acting modified cytosine quantitative trait loci (mQTL) were identified using linear regression between local genetic variants and modification levels for 2 ARDS-associated CpGs (cg23344121 and cg16212219). In summary, these ARDS-associated MYLK CpGs with effect modification by ethnicity and local mQTL suggest that MYLK epigenetic variation and local genetic background may contribute to health disparities observed in ARDS. Copyright © 2016 Elsevier Inc. All rights reserved.

MLH1 Region Polymorphisms Show a Significant Association with CpG Island Shore Methylation in a Large Cohort of Healthy Individuals

PubMed Central

Savio, Andrea J.; Lemire, Mathieu; Mrkonjic, Miralem; Gallinger, Steven; Zanke, Brent W.; Hudson, Thomas J.; Bapat, Bharati

2012-01-01

Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation. We previously demonstrated that SNPs (rs1800734, rs749072, and rs13098279) in the MLH1 gene region are associated with MLH1 promoter island methylation, loss of MLH1 protein expression, and microsatellite instability (MSI) in colorectal cancer (CRC) patients. Recent studies have identified less CpG-dense “shore” regions flanking many CpG islands. These shores often exhibit distinct methylation profiles between different tissues and matched normal versus tumor cells of patients. To date, most epigenetic studies have focused on somatic methylation events occurring within solid tumors; less is known of the contributions of peripheral blood cell (PBC) methylation to processes such as aging and tumorigenesis. To address whether MLH1 methylation in PBCs is correlated with tumorigenesis we utilized the Illumina 450 K microarrays to measure methylation in PBC DNA of 846 healthy controls and 252 CRC patients from Ontario, Canada. Analysis of a region of chromosome 3p21 spanning the MLH1 locus in healthy controls revealed that a CpG island shore 1 kb upstream of the MLH1 gene exhibits different methylation profiles when stratified by SNP genotypes (rs1800734, rs749072, and rs13098279). Individuals with wild-type genotypes incur significantly higher PBC shore methylation than heterozygous or homozygous variant carriers (p<1.1×10−6; ANOVA). This trend is also seen in CRC cases (p<0.096; ANOVA). Shore methylation also decreases significantly with increasing age in cases and controls. This is the first study of its kind to integrate PBC methylation at a CpG island shore with SNP genotype status in CRC cases and controls. These results indicate that CpG island shore methylation in PBCs may be influenced by genotype as well as the normal aging process. PMID:23240038

Characterization and machine learning prediction of allele-specific DNA methylation.

PubMed

He, Jianlin; Sun, Ming-an; Wang, Zhong; Wang, Qianfei; Li, Qing; Xie, Hehuang

2015-12-01

A large collection of Single Nucleotide Polymorphisms (SNPs) has been identified in the human genome. Currently, the epigenetic influences of SNPs on their neighboring CpG sites remain elusive. A growing body of evidence suggests that locus-specific information, including genomic features and local epigenetic state, may play important roles in the epigenetic readout of SNPs. In this study, we made use of mouse methylomes with known SNPs to develop statistical models for the prediction of SNP associated allele-specific DNA methylation (ASM). ASM has been classified into parent-of-origin dependent ASM (P-ASM) and sequence-dependent ASM (S-ASM), which comprises scattered-S-ASM (sS-ASM) and clustered-S-ASM (cS-ASM). We found that P-ASM and cS-ASM CpG sites are both enriched in CpG rich regions, promoters and exons, while sS-ASM CpG sites are enriched in simple repeat and regions with high frequent SNP occurrence. Using Lasso-grouped Logistic Regression (LGLR), we selected 21 out of 282 genomic and methylation related features that are powerful in distinguishing cS-ASM CpG sites and trained the classifiers with machine learning techniques. Based on 5-fold cross-validation, the logistic regression classifier was found to be the best for cS-ASM prediction with an ACC of 0.77, an AUC of 0.84 and an MCC of 0.54. Lastly, we applied the logistic regression classifier on human brain methylome and predicted 608 genes associated with cS-ASM. Gene ontology term enrichment analysis indicated that these cS-ASM associated genes are significantly enriched in the category coding for transcripts with alternative splicing forms. In summary, this study provided an analytical procedure for cS-ASM prediction and shed new light on the understanding of different types of ASM events. Published by Elsevier Inc.

Maternal BMI as a predictor of methylation of obesity-related genes in saliva samples from preschool-age Hispanic children at-risk for obesity.

PubMed

Oelsner, Kathryn Tully; Guo, Yan; To, Sophie Bao-Chieu; Non, Amy L; Barkin, Shari L

2017-01-09

The study of epigenetic processes and mechanisms present a dynamic approach to assess complex individual variation in obesity susceptibility. However, few studies have examined epigenetic patterns in preschool-age children at-risk for obesity despite the relevance of this developmental stage to trajectories of weight gain. We hypothesized that salivary DNA methylation patterns of key obesogenic genes in Hispanic children would 1) correlate with maternal BMI and 2) allow for identification of pathways associated with children at-risk for obesity. Genome-wide DNA methylation was conducted on 92 saliva samples collected from Hispanic preschool children using the Infinium Illumina HumanMethylation 450 K BeadChip (Illumina, San Diego, CA, USA), which interrogates >484,000 CpG sites associated with ~24,000 genes. The analysis was limited to 936 genes that have been associated with obesity in a prior GWAS Study. Child DNA methylation at 17 CpG sites was found to be significantly associated with maternal BMI, with increased methylation at 12 CpG sites and decreased methylation at 5 CpG sites. Pathway analysis revealed methylation at these sites related to homocysteine and methionine degradation as well as cysteine biosynthesis and circadian rhythm. Furthermore, eight of the 17 CpG sites reside in genes (FSTL1, SORCS2, NRF1, DLC1, PPARGC1B, CHN2, NXPH1) that have prior known associations with obesity, diabetes, and the insulin pathway. Our study confirms that saliva is a practical human tissue to obtain in community settings and in pediatric populations. These salivary findings indicate potential epigenetic differences in Hispanic preschool children at risk for pediatric obesity. Identifying early biomarkers and understanding pathways that are epigenetically regulated during this critical stage of child development may present an opportunity for prevention or early intervention for addressing childhood obesity. The clinical trial protocol is available at ClinicalTrials.gov ( NCT01316653 ). Registered 3 March 2011.

Comparative mapping of GABA-immunoreactive neurons in the central nervous systems of nudibranch molluscs.

PubMed

Gunaratne, Charuni A; Sakurai, Akira; Katz, Paul S

2014-03-01

The relative simplicity of certain invertebrate nervous systems, such as those of gastropod molluscs, allows behaviors to be dissected at the level of small neural circuits composed of individually identifiable neurons. Elucidating the neurotransmitter phenotype of neurons in neural circuits is important for understanding how those neural circuits function. In this study, we examined the distribution of γ-aminobutyric-acid;-immunoreactive (GABA-ir) neurons in four species of sea slugs (Mollusca, Gastropoda, Opisthobranchia, Nudibranchia): Tritonia diomedea, Melibe leonina, Dendronotus iris, and Hermissenda crassicornis. We found consistent patterns of GABA immunoreactivity in the pedal and cerebral-pleural ganglia across species. In particular, there were bilateral clusters in the lateral and medial regions of the dorsal surface of the cerebral ganglia as well as a cluster on the ventral surface of the pedal ganglia. There were also individual GABA-ir neurons that were recognizable across species. The invariant presence of these individual neurons and clusters suggests that they are homologous, although there were interspecies differences in the numbers of neurons in the clusters. The GABAergic system was largely restricted to the central nervous system, with the majority of axons confined to ganglionic connectives and commissures, suggesting a central, integrative role for GABA. GABA was a candidate inhibitory neurotransmitter for neurons in central pattern generator (CPG) circuits underlying swimming behaviors in these species, however none of the known swim CPG neurons were GABA-ir. Although the functions of these GABA-ir neurons are not known, it is clear that their presence has been strongly conserved across nudibranchs. Copyright © 2013 Wiley Periodicals, Inc.

Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

PubMed

Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

2018-05-01

We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.

Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

PubMed

Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

2016-06-01

Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

Hypermethylation of MST1 in IgG4-related autoimmune pancreatitis and rheumatoid arthritis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fukuhara, Takataro; Tomiyama, Takashi; Yasuda, Kaneki

The serine/threonine kinase Mst1 plays important roles in the control of immune cell trafficking, proliferation, and differentiation. Previously, we reported that Mst1 was required for thymocyte selection and regulatory T-cell functions, thereby the prevention of autoimmunity in mice. In humans, MST1 null mutations cause T-cell immunodeficiency and hypergammaglobulinemia with autoantibody production. RASSF5C(RAPL) is an activator of MST1 and it is frequently methylated in some tumors. Herein, we investigated methylation of the promoter regions of MST1 and RASSF5C(RAPL) in leukocytes from patients with IgG4-related autoimmune pancreatitis (AIP) and rheumatoid arthritis (RA). Increased number of CpG methylation in the 5′ region ofmore » MST1 was detected in AIP patients with extrapancreatic lesions, whereas AIP patients without extrapancreatic lesions were similar to controls. In RA patients, we detected a slight increased CpG methylation in MST1, although the overall number of methylation sites was lower than that of AIP patients with extrapancreatic lesions. There were no significant changes of the methylation levels of the CpG islands in the 5′ region of RASSF5C(RAPL) in leukocytes from AIP and RA patients. Consistently, we found a significantly down-regulated expression of MST1 in regulatory T cells of AIP patients. Our results suggest that the decreased expression of MST1 in regulatory T cells due to hypermethylation of the promoter contributes to the pathogenesis of IgG4-related AIP. - Highlights: • Mst1 controls immune cells trafficking, cell proliferation and differentiation. • Autoimmune pancreatitis (AIP) is an idiopathic pancreatitis affecting multiple organs. • Decreased MST1 expression and increased CpG methylation of promoter of MST1 in AIP. • Slight increased CpG methylation of MST1 in rheumatoid arthritis patients. • MST1 contributes pathogenesis of IgG4-related AIP.« less

Non-linear patterns in age-related DNA methylation may reflect CD4+ T cell differentiation

PubMed Central

Johnson, Nicholas D.; Wiener, Howard W.; Smith, Alicia K.; Nishitani, Shota; Absher, Devin M.; Arnett, Donna K.; Aslibekyan, Stella; Conneely, Karen N.

2017-01-01

ABSTRACT DNA methylation (DNAm) is an important epigenetic process involved in the regulation of gene expression. While many studies have identified thousands of loci associated with age, few have differentiated between linear and non-linear DNAm trends with age. Non-linear trends could indicate early- or late-life gene regulatory processes. Using data from the Illumina 450K array on 336 human peripheral blood samples, we identified 21 CpG sites that associated with age (P<1.03E-7) and exhibited changing rates of DNAm change with age (P<1.94E-6). For 2 of these CpG sites (cg07955995 and cg22285878), DNAm increased with age at an increasing rate, indicating that differential DNAm was greatest among elderly individuals. We observed significant replication for both CpG sites (P<5.0E-8) in a second set of peripheral blood samples. In 8 of 9 additional data sets comprising samples of monocytes, T cell subtypes, and brain tissue, we observed a pattern directionally consistent with DNAm increasing with age at an increasing rate, which was nominally significant in the 3 largest data sets (4.3E-15

In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

PubMed

Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

2018-03-01

Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen-, mitogen-, and alloantigen-induced lymphoproliferation in vitro when measured by [3H]-thymidine. The synthetic methylated DNA CpG ODN but not an unmethylated CpG ODN sequence was shown to promote FoxP3 expression in human CD4+ T cells in the presence of TGF beta and IL-2. The induction of FoxP3+ suppressor cells is dose dependent and offers a potential clinical therapeutic application in allergic and autoimmune and inflammatory diseases. The use of this methylated CpG ODN offers a broad clinical application as a novel therapeutic method for Treg induction and, because of its low cost and small size, should facilitate delivery via nasal, respiratory, gastrointestinal routes, and/or by injection, routes of administration important for vaccine delivery to target sites responsible for respiratory, gastrointestinal, and systemic forms of allergic and autoimmune disease.

CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs.

PubMed

Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing; Zeng, Ruihong; Wei, Lin

2017-05-15

Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8 + lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and effective killed RSV vaccine. Using adjuvants to regulate innate and adaptive immune responses could be an effective method to prevent ERD. We evaluated the impact of TLR and Notch signaling on ERD by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling, during FI-RSV immunization. The data showed that treatment of TLR or Notch signaling alone did not suppress FI-RSV-enhanced airway inflammation, while CpG plus L685,458 markedly inhibited ERD. The mechanism appears to involve suppressing Th17 memory responses and promoting tissue-resident memory cells. Moreover, these results suggest that regulation of lung immune memory with adjuvant compounds containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD. Copyright © 2017 American Society for Microbiology.

CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs

PubMed Central

Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing

2017-01-01

ABSTRACT Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8+ lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and effective killed RSV vaccine. Using adjuvants to regulate innate and adaptive immune responses could be an effective method to prevent ERD. We evaluated the impact of TLR and Notch signaling on ERD by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling, during FI-RSV immunization. The data showed that treatment of TLR or Notch signaling alone did not suppress FI-RSV-enhanced airway inflammation, while CpG plus L685,458 markedly inhibited ERD. The mechanism appears to involve suppressing Th17 memory responses and promoting tissue-resident memory cells. Moreover, these results suggest that regulation of lung immune memory with adjuvant compounds containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD. PMID:28275186

Social Behavior of Pet Dogs Is Associated with Peripheral OXTR Methylation.

PubMed

Cimarelli, Giulia; Virányi, Zsófia; Turcsán, Borbála; Rónai, Zsolt; Sasvári-Székely, Mária; Bánlaki, Zsófia

2017-01-01

Oxytocin is a key modulator of emotional processing and social cognitive function. In line with this, polymorphisms of genes involved in oxytocin signaling, like the oxytocin receptor ( OXTR ) gene, are known to influence social behavior in various species. However, to date, no study has investigated environmental factors possibly influencing the epigenetic variation of the OXTR gene and its behavioral effects in dogs. Pet dogs form individualized and strong relationships with their owners who are central figures in the social environment of their dogs and therefore might influence the methylation levels of their OXTR gene. Here we set out to investigate whether DNA methylation within the OXTR promoter region of pet dogs is linked to their owner's interaction style and to the social behavior of the dogs. To be able to do so, we collected buccal epithelial cells and, in Study 1, we used pyrosequencing techniques to look for differentially methylated CpG sites in the canine OXTR promoter region on a heterogeneous sample of dogs and wolves of different ages and keeping conditions. Four identified sites (at positions -727, -751, -1371, and -1383 from transcription start site) showing more than 10% methylation variation were then, in Study 2, measured in triplicate in 217 pet Border Collies previously tested for reactions to an adverse social situation (i.e., approach by a threatening human) and with available data on their owners' interaction styles. We found that CpG methylation was significantly associated with the behavior of the dogs, in particular with the likelihood that dogs would hide behind their owner or remain passive when approached by a threatening human. On the other hand, CpG methylation was not related to the owners' behavior but to dog sex (at position -1371). Our findings underpin the complex relationship between epigenetics and behavior and highlight the importance of including epigenetic methods in the analysis of dog behavioral development. Further research is needed to investigate which environmental factors influence the epigenetic variation of the OXTR gene.

Tumor suppressor function of PGP9.5 is associated with epigenetic regulation in prostate cancer--novel predictor of biochemical recurrence after radical surgery.

PubMed

Mitsui, Yozo; Shiina, Hiroaki; Hiraki, Miho; Arichi, Naoko; Hiraoka, Takeo; Sumura, Masahiro; Honda, Satoshi; Yasumoto, Hiroaki; Igawa, Mikio

2012-03-01

The expression level of protein G product 9.5 (PGP9.5) is downregulated because of promoter CpG hypermethylation in several tumors. We speculated that impaired regulation of PGP9.5 through epigenetic pathways is associated with the pathogenesis of prostate cancer. CpG methylation of the PGP9.5 gene was analyzed in cultured prostate cancer cell lines, 226 localized prostate cancer samples from radical prostatectomy cases, and 80 benign prostate hyperplasia (BPH) tissues. Following 5-aza-2'-deoxycytidune treatment, increased PGP9.5 mRNA transcript expression was found in the LNCaP and PC3 cell lines. With bisulfite DNA sequencing, partial methylation of the PGP9.5 promoter was shown in LNCaP whereas complete methylation was found in PC3 cells. After transfection of PGP9.5 siRNA, cell viability was significantly accelerated in LNCaP but not in PC3 cells as compared with control siRNA transfection. Promoter methylation of PGP9.5 was extremely low in only one of 80 BPH tissues, whereas it was found in 37 of 226 prostate cancer tissues. Expression of the mRNA transcript of PGP9.5 was significantly lower in methylation (+) than methylation (-) prostate cancer tissues. Multivariate analysis of biochemical recurrence (BCR) after an radical prostatectomy revealed pT category and PGP9.5 methylation as prognostically relevant. Further stratification with the pT category in addition to methylation status identified a stepwise reduction of BCR-free probability. This is the first clinical and comprehensive study of inactivation of the PGP9.5 gene via epigenetic pathways in primary prostate cancer. CpG methylation of PGP9.5 in primary prostate cancer might become useful as a molecular marker for early clinical prediction of BCR after radical prostatectomy. ©2012 AACR.

75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-22

...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

PubMed Central

Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

2005-01-01

Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

PubMed

Najar, Hossain M; Dutz, Jan P

2008-09-01

Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

PubMed

Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

2009-04-06

The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

Royal Australian and New Zealand College of Psychiatrists clinical practice guidelines for the treatment of eating disorders.

PubMed

Hay, Phillipa; Chinn, David; Forbes, David; Madden, Sloane; Newton, Richard; Sugenor, Lois; Touyz, Stephen; Ward, Warren

2014-11-01

This clinical practice guideline for treatment of DSM-5 feeding and eating disorders was conducted as part of the Royal Australian and New Zealand College of Psychiatrists (RANZCP) Clinical Practice Guidelines (CPG) Project 2013-2014. The CPG was developed in accordance with best practice according to the National Health and Medical Research Council of Australia. Literature of evidence for treatments of anorexia nervosa (AN), bulimia nervosa (BN), binge eating disorder (BED), other specified and unspecified eating disorders and avoidant restrictive food intake disorder (ARFID) was sourced from the previous RANZCP CPG reviews (dated to 2009) and updated with a systematic review (dated 2008-2013). A multidisciplinary working group wrote the draft CPG, which then underwent expert, community and stakeholder consultation, during which process additional evidence was identified. In AN the CPG recommends treatment as an outpatient or day patient in most instances (i.e. in the least restrictive environment), with hospital admission for those at risk of medical and/or psychological compromise. A multi-axial and collaborative approach is recommended, including consideration of nutritional, medical and psychological aspects, the use of family based therapies in younger people and specialist therapist-led manualised based psychological therapies in all age groups and that include longer-term follow-up. A harm minimisation approach is recommended in chronic AN. In BN and BED the CPG recommends an individual psychological therapy for which the best evidence is for therapist-led cognitive behavioural therapy (CBT). There is also a role for CBT adapted for internet delivery, or CBT in a non-specialist guided self-help form. Medications that may be helpful either as an adjunctive or alternative treatment option include an antidepressant, topiramate, or orlistat (the last for people with comorbid obesity). No specific treatment is recommended for ARFID as there are no trials to guide practice. Specific evidence based psychological and pharmacological treatments are recommended for most eating disorders but more trials are needed for specific therapies in AN, and research is urgently needed for all aspects of ARFID assessment and management. Associate Professor Susan Byrne, Dr Angelica Claudino, Dr Anthea Fursland, Associate Professor Jennifer Gaudiani, Dr Susan Hart, Ms Gabriella Heruc, Associate Professor Michael Kohn, Dr Rick Kausman, Dr Sarah Maguire, Ms Peta Marks, Professor Janet Treasure and Mr Andrew Wallis. © The Royal Australian and New Zealand College of Psychiatrists 2014.

Systematic CpT (ApG) Depletion and CpG Excess Are Unique Genomic Signatures of Large DNA Viruses Infecting Invertebrates

PubMed Central

Upadhyay, Mohita; Sharma, Neha; Vivekanandan, Perumal

2014-01-01

Differences in the relative abundance of dinucleotides, if any may provide important clues on host-driven evolution of viruses. We studied dinucleotide frequencies of large DNA viruses infecting vertebrates (n = 105; viruses infecting mammals = 99; viruses infecting aves = 6; viruses infecting reptiles = 1) and invertebrates (n = 88; viruses infecting insects = 84; viruses infecting crustaceans = 4). We have identified systematic depletion of CpT(ApG) dinucleotides and over-representation of CpG dinucleotides as the unique genomic signature of large DNA viruses infecting invertebrates. Detailed investigation of this unique genomic signature suggests the existence of invertebrate host-induced pressures specifically targeting CpT(ApG) and CpG dinucleotides. The depletion of CpT dinucleotides among large DNA viruses infecting invertebrates is at least in part, explained by non-canonical DNA methylation by the infected host. Our findings highlight the role of invertebrate host-related factors in shaping virus evolution and they also provide the necessary framework for future studies on evolution, epigenetics and molecular biology of viruses infecting this group of hosts. PMID:25369195

Dual Roles for CXCL4 Chemokines and CXCR3 in Angiogenesis and Invasion of Pancreatic Cancer.

PubMed

Quemener, Cathy; Baud, Jessica; Boyé, Kevin; Dubrac, Alexandre; Billottet, Clotilde; Soulet, Fabienne; Darlot, Florence; Dumartin, Laurent; Sire, Marie; Grepin, Renaud; Daubon, Thomas; Rayne, Fabienne; Wodrich, Harald; Couvelard, Anne; Pineau, Raphael; Schilling, Martin; Castronovo, Vincent; Sue, Shih-Che; Clarke, Kim; Lomri, Abderrahim; Khatib, Abdel-Majid; Hagedorn, Martin; Prats, Hervé; Bikfalvi, Andreas

2016-11-15

The CXCL4 paralog CXCL4L1 is a less studied chemokine that has been suggested to exert an antiangiogenic function. However, CXCL4L1 is also expressed in patient tumors, tumor cell lines, and murine xenografts, prompting a more detailed analysis of its role in cancer pathogenesis. We used genetic and antibody-based approaches to attenuate CXCL4L1 in models of pancreatic ductal adenocarcinoma (PDAC). Mechanisms of expression were assessed in cell coculture experiments, murine, and avian xenotransplants, including through an evaluation of CpG methylation and mutation of critical CpG residues. CXCL4L1 gene expression was increased greatly in primary and metastatic PDAC. We found that myofibroblasts triggered cues in the tumor microenvironment, which led to induction of CXCL4L1 in tumor cells. CXCL4L1 expression was also controlled by epigenetic modifications at critical CpG islands, which were mapped. CXCL4L1 inhibited angiogenesis but also affected tumor development more directly, depending on the tumor cell type. In vivo administration of an mAb against CXCL4L1 demonstrated a blockade in the growth of tumors positive for CXCR3, a critical receptor for CXCL4 ligands. Our findings define a protumorigenic role in PDAC development for endogenous CXCL4L1, which is independent of its antiangiogenic function. Cancer Res; 76(22); 6507-19. ©2016 AACR. ©2016 American Association for Cancer Research.

DNA methylation of the filaggrin gene adds to the risk of eczema associated with loss-of-function variants

PubMed Central

Ziyab, A. H.; Karmaus, W.; Holloway, J. W.; Zhang, H.; Ewart, S.; Arshad, S. H.

2012-01-01

Background Loss-of-function variants within the filaggrin gene (FLG) are associated with a dysfunctional skin barrier that contributes to the development of eczema. Epigenetic modifications, such as DNA methylation, are genetic regulatory mechanisms that modulate gene expression without changing the DAN sequence. Objectives To investigate whether genetic variants and adjacent differential DNA methylation within the FLG gene synergistically act on the development of eczema. Methods A subsample (n = 245, only females aged 18 years) of the Isle of Wight birth cohort participants (n = 1,456) had available information for FLG variants R501X, 2282del4, and S3247X and DNA methylation levels for 10 CpG sites within the FLG gene. Log-binomial regression was used to estimate the risk ratios (RRs) of eczema associated with FLG variants at different methylation levels. Results The period prevalence of eczema was 15.2% at age 18 years and 9.0% of participants were carriers (heterozygous) of FLG variants. Of the 10 CpG sites spanning the genomic region of FLG, methylation levels of CpG site ‘cg07548383’ showed a significant interaction with FLG sequence variants on the risk for eczema. At 86% methylation level, filaggrin haploinsufficient individuals had 5.48-fold increased risk of eczema when compared to those with wild type FLG genotype (p-value = 0.0008). Conclusions Our novel results indicated that the association between FLG loss-of-function variants and eczema is modulated by DNA methylation. Simultaneously assessing the joint effect of genetic and epigenetic factors within the FLG gene further highlights the importance of this genomic region for eczema manifestation. PMID:23003573

Synthetic orocutaneous stimulation entrains preterm infants with feeding difficulties to suck

PubMed Central

Barlow, SM; Finan, DS; Lee, J; Chu, S

2013-01-01

Background Prematurity can disrupt the development of a specialized neural circuit known as suck central pattern generator (sCPG), which often leads to poor feeding skills. The extent to which suck can be entrained using a synthetically patterned orocutaneous input to promote its development in preterm infants who lack a functional suck is unknown. Objective To evaluate the effects of a new motorized ‘pulsating’ pacifier capable of entraining the sCPG in tube-fed premature infants who lack a functional suck and exhibit feeding disorders. Methods Prospective cohort study of 31 preterm infants assigned to either the oral patterned entrainment intervention (study) or non-treated (controls) group, matched by gestational age, birth weight, oxygen supplementation history, and oral feed status. Study infants received a daily regimen of orocutaneous pulse trains through a pneumatically-controlled silicone pacifier concurrent with gavage feeds. Results The patterned orocutaneous stimulus was highly effective in accelerating the development of NNS in preterm infants. A repeated-measure multivariate analysis of covariance revealed significant increases in minute-rates for total oral compressions, NNS bursts, and NNS cycles, suck cycles per burst, and the ratiometric measure of NNS cycles as a percentage of total ororhythmic output. Moreover, study infants also manifest significantly greater success at achieving oral feeds, surpassing their control counterparts by a factor of 3.1× (72.8% daily oral feed versus 23.3% daily oral feed, respectively). Conclusion Functional expression of the sCPG among preterm infants who lack an organized suck can be induced through the delivery of synthetically patterned orocutaneous pulse trains. The rapid emergence of NNS in treated infants is accompanied by a significant increase in the proportion of nutrient taken orally. PMID:18548084

Speech pathologists' experiences with stroke clinical practice guidelines and the barriers and facilitators influencing their use: a national descriptive study.

PubMed

Hadely, Kathleen A; Power, Emma; O'Halloran, Robyn

2014-03-06

Communication and swallowing disorders are a common consequence of stroke. Clinical practice guidelines (CPGs) have been created to assist health professionals to put research evidence into clinical practice and can improve stroke care outcomes. However, CPGs are often not successfully implemented in clinical practice and research is needed to explore the factors that influence speech pathologists' implementation of stroke CPGs. This study aimed to describe speech pathologists' experiences and current use of guidelines, and to identify what factors influence speech pathologists' implementation of stroke CPGs. Speech pathologists working in stroke rehabilitation who had used a stroke CPG were invited to complete a 39-item online survey. Content analysis and descriptive and inferential statistics were used to analyse the data. 320 participants from all states and territories of Australia were surveyed. Almost all speech pathologists had used a stroke CPG and had found the guideline "somewhat useful" or "very useful". Factors that speech pathologists perceived influenced CPG implementation included the: (a) guideline itself, (b) work environment, (c) aspects related to the speech pathologist themselves, (d) patient characteristics, and (e) types of implementation strategies provided. There are many different factors that can influence speech pathologists' implementation of CPGs. The factors that influenced the implementation of CPGs can be understood in terms of knowledge creation and implementation frameworks. Speech pathologists should continue to adapt the stroke CPG to their local work environment and evaluate their use. To enhance guideline implementation, they may benefit from a combination of educational meetings and resources, outreach visits, support from senior colleagues, and audit and feedback strategies.

Neural basis of singing in crickets: central pattern generation in abdominal ganglia

NASA Astrophysics Data System (ADS)

Schöneich, Stefan; Hedwig, Berthold

2011-12-01

The neural mechanisms underlying cricket singing behavior have been the focus of several studies, but the central pattern generator (CPG) for singing has not been localized conclusively. To test if the abdominal ganglia contribute to the singing motor pattern and to analyze if parts of the singing CPG are located in these ganglia, we systematically truncated the abdominal nerve cord of fictively singing crickets while recording the singing motor pattern from a front-wing nerve. Severing the connectives anywhere between terminal ganglion and abdominal ganglion A3 did not preclude singing, although the motor pattern became more variable and failure-prone as more ganglia were disconnected. Singing terminated immediately and permanently after transecting the connectives between the metathoracic ganglion complex and the first unfused abdominal ganglion A3. The contribution of abdominal ganglia for singing pattern generation was confirmed by intracellular interneuron recordings and current injections. During fictive singing, an ascending interneuron with its soma and dendrite in A3 depolarized rhythmically. It spiked 10 ms before the wing-opener activity and hyperpolarized in phase with the wing-closer activity. Depolarizing current injection elicited rhythmic membrane potential oscillations and spike bursts that elicited additional syllables and reliably reset the ongoing chirp rhythm. Our results disclose that the abdominal ganglion A3 is directly involved in generating the singing motor pattern, whereas the more posterior ganglia seem to provide only stabilizing feedback to the CPG circuit. Localizing the singing CPG in the anterior abdominal neuromeres now allows analyzing its circuitry at the level of identified interneurons in subsequent studies.

AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY PROTOCOL FOR STANDARDIZED PRODUCTION OF CLINICAL PRACTICE GUIDELINES, ALGORITHMS, AND CHECKLISTS - 2017 UPDATE.

PubMed

Mechanick, Jeffrey I; Pessah-Pollack, Rachel; Camacho, Pauline; Correa, Ricardo; Figaro, M Kathleen; Garber, Jeffrey R; Jasim, Sina; Pantalone, Kevin M; Trence, Dace; Upala, Sikarin

2017-08-01

Clinical practice guideline (CPG), clinical practice algorithm (CPA), and clinical checklist (CC, collectively CPGAC) development is a high priority of the American Association of Clinical Endocrinologists (AACE) and American College of Endocrinology (ACE). This 2017 update in CPG development consists of (1) a paradigm change wherein first, environmental scans identify important clinical issues and needs, second, CPA construction focuses on these clinical issues and needs, and third, CPG provide CPA node/edge-specific scientific substantiation and appended CC; (2) inclusion of new technical semantic and numerical descriptors for evidence types, subjective factors, and qualifiers; and (3) incorporation of patient-centered care components such as economics and transcultural adaptations, as well as implementation, validation, and evaluation strategies. This third point highlights the dominating factors of personal finances, governmental influences, and third-party payer dictates on CPGAC implementation, which ultimately impact CPGAC development. The AACE/ACE guidelines for the CPGAC program is a successful and ongoing iterative exercise to optimize endocrine care in a changing and challenging healthcare environment. AACE = American Association of Clinical Endocrinologists ACC = American College of Cardiology ACE = American College of Endocrinology ASeRT = ACE Scientific Referencing Team BEL = best evidence level CC = clinical checklist CPA = clinical practice algorithm CPG = clinical practice guideline CPGAC = clinical practice guideline, algorithm, and checklist EBM = evidence-based medicine EHR = electronic health record EL = evidence level G4GAC = Guidelines for Guidelines, Algorithms, and Checklists GAC = guidelines, algorithms, and checklists HCP = healthcare professional(s) POEMS = patient-oriented evidence that matters PRCT = prospective randomized controlled trial.

Phenotype-specific CpG island methylation events in a murine model of prostate cancer.

PubMed

Camoriano, Marta; Kinney, Shannon R Morey; Moser, Michael T; Foster, Barbara A; Mohler, James L; Trump, Donald L; Karpf, Adam R; Smiraglia, Dominic J

2008-06-01

Aberrant DNA methylation plays a significant role in nearly all human cancers and may contribute to disease progression to advanced phenotypes. Study of advanced prostate cancer phenotypes in the human disease is hampered by limited availability of tissues. We therefore took advantage of the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model to study whether three different phenotypes of TRAMP tumors (PRIM, late-stage primary tumors; AIP, androgen-independent primary tumors; and MET, metastases) displayed specific patterns of CpG island hypermethylation using Restriction Landmark Genomic Scanning. Each tumor phenotype displayed numerous hypermethylation events, with the most homogeneous methylation pattern in AIP and the most heterogeneous pattern in MET. Several loci displayed a phenotype-specific methylation pattern; the most striking pattern being loci methylated at high frequency in PRIM and AIP but rarely in MET. Examination of the mRNA expression of three genes, BC058385, Goosecoid, and Neurexin 2, which exhibited nonpromoter methylation, revealed increased expression associated with downstream methylation. Only methylated samples showed mRNA expression, in which tumor phenotype was a key factor determining the level of expression. The CpG island in the human orthologue of BC058385 was methylated in human AIP but not in primary androgen-stimulated prostate cancer or benign prostate. The clinical data show a proof-of-principle that the TRAMP model can be used to identify targets of aberrant CpG island methylation relevant to human disease. In conclusion, phenotype-specific hypermethylation events were associated with the overexpression of different genes and may provide new markers of prostate tumorigenesis.

In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

PubMed

Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

2018-01-01

Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

DOE Office of Scientific and Technical Information (OSTI.GOV)

Diver, R.B.; Moss, T.A.; Goldberg, V.

Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

Energetic study of cardioplegic hearts under ischaemia/reperfusion and [Ca(2+)] changes in cardiomyocytes of guinea-pig: mitochondrial role.

PubMed

Ragone, M I; Torres, N S; Consolini, A E

2013-02-01

To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

Functional Genomic Analysis of Variation on Beef Tenderness Induced by Acute Stress in Angus Cattle

PubMed Central

Zhao, Chunping; Tian, Fei; Yu, Ying; Luo, Juan; Mitra, Apratim; Zhan, Fei; Hou, Yali; Liu, George; Zan, Linsen; Updike, M. Scott; Song, Jiuzhou

2012-01-01

Beef is one of the leading sources of protein, B vitamins, iron, and zinc in human food. Beef palatability is based on three general criteria: tenderness, juiciness, and flavor, of which tenderness is thought to be the most important factor. In this study, we found that beef tenderness, measured by the Warner-Bratzler shear force (WBSF), was dramatically increased by acute stress. Microarray analysis and qPCR identified a variety of genes that were differentially expressed. Pathway analysis showed that these genes were involved in immune response and regulation of metabolism process as activators or repressors. Further analysis identified that these changes may be related with CpG methylation of several genes. Therefore, the results from this study provide an enhanced understanding of the mechanisms that genetic and epigenetic regulations control meat quality and beef tenderness. PMID:22566754

Sherlock Holmes and the Curious Case of the Human Locomotor Central Pattern Generator.

PubMed

Klarner, Taryn; Zehr, E Paul

2018-03-14

Evidence first described in reduced animal models over 100 years ago led to deductions about the control of locomotion through spinal locomotor central pattern generating (CPG) networks. These discoveries in nature were contemporaneous with another form of deductive reasoning found in popular culture-that of Arthur Conan Doyle's detective "Sherlock Holmes". Since the invasive methods used in reduced non-human animal preparations are not amenable to study in humans, we are left instead with deducing from other measures and observations. Using the deductive reasoning approach of Sherlock Holmes as a metaphor for framing research into human CPGs, we speculate and weigh the evidence that should be observable in humans based on knowledge from other species. This review summarizes indirect inference to assess "observable evidence" of pattern generating activity which leads to the logical deduction of CPG contributions to arm and leg activity during locomotion in humans. The question of where a CPG may be housed in the human nervous system remains incompletely resolved at this time. Ongoing understanding, elaboration and application of functioning locomotor CPGs in humans is important for gait rehabilitation strategies in those with neurological injuries.

The type of adjuvant strongly influences the T-cell response during nanoparticle-based immunization

PubMed Central

Knuschke, Torben; Epple, Matthias; Westendorf, Astrid M

2014-01-01

Potent vaccines require the ability to effectively induce immune responses. Especially for the control of infectious diseases with intracellular pathogens, like viruses or bacteria, potent T-cell responses are indispensable. Several delivery systems such as nanoparticles have been considered to boost the immunogenicity of pathogen derived peptides or subunits for the induction of potent T-cell responses. Since they can be further functionalized with immunostimulants, like Toll-like receptor (TLR) agonists, they improve the response by enhanced activation of the innate immune system. Currently, TLR agonists like unmethylated CpG oligonucleotides and the synthetic dsRNA derivate polyriboinosinic acid-polyribocytidylic acid (poly[I:C]) are widely used as vaccine adjuvants. CpG and poly(I:C) trigger different TLRs and therefore show differential signal transduction. Recently, we established biodegradable calcium phosphate (CaP) nanoparticles as potent T cell inducing vaccination vehicles. In this commentary we discuss the role of CpG and poly(I:C) for the effective induction of virus-specific T cells during immunization with CaP nanoparticles. The presented results underline the importance of the right formulation of vaccines for specific immunization purpose. PMID:23982325

75 FR 60761 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-01

... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-01

... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

Promoter methylation assay of SASH1 gene in breast cancer.

PubMed

Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

2013-01-01

To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

NASA Technical Reports Server (NTRS)

Nillen, Jeannie L.; Smith, Scott M.

2003-01-01

A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

Reinforcement learning for a biped robot based on a CPG-actor-critic method.

PubMed

Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

2007-08-01

Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

NASA Astrophysics Data System (ADS)

Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

2003-04-01

A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

The Spanish Neurological Society official clinical practice guidelines in epilepsy.

PubMed

Mercadé Cerdá, J M; Toledo Argani, M; Mauri Llerda, J A; López Gonzalez, F J; Salas Puig, X; Sancho Rieger, J

2016-03-01

Previous Official Clinical Practice Guidelines (CPGs) in Epilepsy were based on expert opinions and developed by the Epilepsy Study Group of the Spanish Neurological Society (GE-SEN). The current CPG in epilepsy is based on the scientific method, which extracts recommendations from published scientific evidence. A reduction in the variability in clinical practice through standardization of medical practice has become its main function. This CPG is focused on comprehensive care for individuals affected by epilepsy as a primary and predominant symptom, regardless of the age of onset and medical policy. 1. Creation of GE-SEN neurologists working group, in collaboration with Neuropediatricians, Neurophysiologists and Neuroradiologists. 2. Identification of clinical areas to be covered: diagnosis, prognosis and treatment. 3. Search and selection of the relevant scientific evidence. 4. Formulation of recommendations based on the classification of the available scientific evidence. It contains 161 recommendations of which 57% are consensus between authors and publishers, due to an important lack of awareness in many fields of this pathology. This Epilepsy CPG formulates recommendations based on explicit scientific evidence as a result of a formal and rigorous methodology, according to the current knowledge in the pre-selected areas. This paper includes the CPG chapter dedicated to emergency situations in seizures and epilepsy, which may present as a first seizure, an unfavorable outcome in a patient with known epilepsy, or status epilepticus as the most severe manifestation. Copyright © 2013 Sociedad Española de Neurología. Published by Elsevier España, S.L.U. All rights reserved.

DNA methylation profiling identifies global methylation differences and markers of adrenocortical tumors.

PubMed

Rechache, Nesrin S; Wang, Yonghong; Stevenson, Holly S; Killian, J Keith; Edelman, Daniel C; Merino, Maria; Zhang, Lisa; Nilubol, Naris; Stratakis, Constantine A; Meltzer, Paul S; Kebebew, Electron

2012-06-01

It is not known whether there are any DNA methylation alterations in adrenocortical tumors. The objective of the study was to determine the methylation profile of normal adrenal cortex and benign and malignant adrenocortical tumors. Genome-wide methylation status of CpG regions were determined in normal (n = 19), benign (n = 48), primary malignant (n = 8), and metastatic malignant (n = 12) adrenocortical tissue samples. An integrated analysis of genome-wide methylation and mRNA expression in benign vs. malignant adrenocortical tissue samples was also performed. Methylation profiling revealed the following: 1) that methylation patterns were distinctly different and could distinguish normal, benign, primary malignant, and metastatic tissue samples; 2) that malignant samples have global hypomethylation; and 3) that the methylation of CpG regions are different in benign adrenocortical tumors by functional status. Normal compared with benign samples had the least amount of methylation differences, whereas normal compared with primary and metastatic adrenocortical carcinoma samples had the greatest variability in methylation (adjusted P ≤ 0.01). Of 215 down-regulated genes (≥2-fold, adjusted P ≤ 0.05) in malignant primary adrenocortical tumor samples, 52 of these genes were also hypermethylated. Malignant adrenocortical tumors are globally hypomethylated as compared with normal and benign tumors. Methylation profile differences may accurately distinguish between primary benign and malignant adrenocortical tumors. Several differentially methylated sites are associated with genes known to be dysregulated in malignant adrenocortical tumors.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

PubMed

Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-08-16

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

PubMed Central

Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-01-01

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.

PubMed

McKenna, Malachi J; Murray, Barbara F

2013-06-01

The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.

A silicon central pattern generator controls locomotion in vivo.

PubMed

Vogelstein, R J; Tenore, F; Guevremont, L; Etienne-Cummings, R; Mushahwar, V K

2008-09-01

We present a neuromorphic silicon chip that emulates the activity of the biological spinal central pattern generator (CPG) and creates locomotor patterns to support walking. The chip implements ten integrate-and-fire silicon neurons and 190 programmable digital-to-analog converters that act as synapses. This architecture allows for each neuron to make synaptic connections to any of the other neurons as well as to any of eight external input signals and one tonic bias input. The chip's functionality is confirmed by a series of experiments in which it controls the motor output of a paralyzed animal in real-time and enables it to walk along a three-meter platform. The walking is controlled under closed-loop conditions with the aide of sensory feedback that is recorded from the animal's legs and fed into the silicon CPG. Although we and others have previously described biomimetic silicon locomotor control systems for robots, this is the first demonstration of a neuromorphic device that can replace some functions of the central nervous system in vivo.

Overlap in drug-disease associations between clinical practice guidelines and drug structured product label indications.

PubMed

Leung, Tiffany I; Dumontier, Michel

2016-06-08

Clinical practice guidelines (CPGs) recommend pharmacologic treatments for clinical conditions, and drug structured product labels (SPLs) summarize approved treatment indications. Both resources are intended to promote evidence-based medical practices and guide clinicians' prescribing decisions. However, it is unclear how well CPG recommendations about pharmacologic therapies match SPL indications for recommended drugs. In this study, we perform text mining of CPG summaries to examine drug-disease associations in CPG recommendations and in SPL treatment indications for 15 common chronic conditions. We constructed an initial text corpus of guideline summaries from the National Guideline Clearinghouse (NGC) from a set of manually selected ICD-9 codes for each of the 15 conditions. We obtained 377 relevant guideline summaries and their Major Recommendations section, which excludes guidelines for pediatric patients, pregnant or breastfeeding women, or for medical diagnoses not meeting inclusion criteria. A vocabulary of drug terms was derived from five medical taxonomies. We used named entity recognition, in combination with dictionary-based and ontology-based methods, to identify drug term occurrences in the text corpus and construct drug-disease associations. The ATC (Anatomical Therapeutic Chemical Classification) was utilized to perform drug name and drug class matching to construct the drug-disease associations from CPGs. We then obtained drug-disease associations from SPLs using conditions mentioned in their Indications section in SIDER. The primary outcomes were the frequency of drug-disease associations in CPGs and SPLs, and the frequency of overlap between the two sets of drug-disease associations, with and without using taxonomic information from ATC. Without taxonomic information, we identified 1444 drug-disease associations across CPGs and SPLs for 15 common chronic conditions. Of these, 195 drug-disease associations overlapped between CPGs and SPLs, 917 associations occurred in CPGs only and 332 associations occurred in SPLs only. With taxonomic information, 859 unique drug-disease associations were identified, of which 152 of these drug-disease associations overlapped between CPGs and SPLs, 541 associations occurred in CPGs only, and 166 associations occurred in SPLs only. Our results suggest that CPG-recommended pharmacologic therapies and SPL indications do not overlap frequently when identifying drug-disease associations using named entity recognition, although incorporating taxonomic relationships between drug names and drug classes into the approach improves the overlap. This has important implications in practice because conflicting or inconsistent evidence may complicate clinical decision making and implementation or measurement of best practices.

CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

PubMed Central

Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

2011-01-01

The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

PubMed

Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

2018-02-01

Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.

SU94. Allele-Specific and Trauma-Related Epigenetic Changes in the FKBP5 Gene: Differences Between Psychotic Patients and Healthy Controls

PubMed Central

Mihaljevic, Marina; Franic, Dusica; Soldatovic, Ivan; Andric, Sanja; Mirjanic, Tijana; Novakovic, Ivana; Adzic, Miroslav; Maric, Nadja

2017-01-01

Abstract Background: Hypothalamic-pituitary-adrenal (HPA) axis dysregulation is a proposed etiological mechanism of psychosis. Recent studies highlighted impact of the FKBP5 gene and its functional variant rs1360780, which risk (T) allele affects the activity of HPA axis following stress exposure, on psychotic patients exposed to early trauma (1). Additionally, risk allele and trauma dependent FKBP5 demethylation in intron 7 was observed in traumatized individuals (2). Thus, the purpose of this pilot study was to investigate influence of the risk allele and trauma on FKBP5 DNA methylation levels at intron 7 in psychotic patients and to compare it with healthy individuals. Methods: The sample consisted of 24 psychosis spectrum patients and 24 controls matched by age and gender. All participants were genotyped for rs1360780 and divided into 2 groups depending on the presence of the risk allele (risk and nonrisk group). DNA methylation levels at 3 CpG sites (CpG1, CpG2, and CpG3) in intron 7 were analyzed by Sanger sequencing. Early-life adversities were measured by Childhood Trauma Questionnaire. Pearson correlation and t test were performed as appropriate. Results: Analyses revealed decreased FKBP5 methylation at targeted CpG sites and averaged methylation level (AML) at intron 7 in patients compared to controls (P = .026, P = .017, P = .027, and P = .003, respectively). Decreased AML and methylation at CpG3 were observed comparing risk and nonrisk patients’ groups (P = .018 and P = .016, respectively). Additionally, decreased methylation was found in risk patients’ group compared to risk controls’ group. No differences were found comparing nonrisk groups. Furthermore, strong negative associations between trauma and methylation at CpG3 and AML were observed only in risk controls’ group (r = −0.707, P = .007; r = −0.741, P = .004, respectively). Conclusion: Our preliminary results revealed allele-specific epigenetic changes of the FKBP5 gene in psychotic patients, which is in line with previous reports in traumatized individuals. Trauma-related demethylation in risk controls’ group supports the hypothesis that psychotic and stress-related conditions could share common neurobiological underlying mechanism, such as HPA axis dysregulation, particularly in individuals with genetic predisposition for altered stress response. References 1.Daskalakis NP, Binder EB. Schizophrenia in the spectrum of gene-stress interactions: the FKBP5 example. Schizophr Bull. 2015;41:323–329. 2.Klengel T, Mehta D, Anacker C et al. Allele-specific FKBP5 DNA demethylation mediates gene-childhood trauma interactions. Nat Neurosci. 2013;16:33–41.

Methylation of HPA axis related genes in men with hypersexual disorder.

PubMed

Jokinen, Jussi; Boström, Adrian E; Chatzittofis, Andreas; Ciuculete, Diana M; Öberg, Katarina Görts; Flanagan, John N; Arver, Stefan; Schiöth, Helgi B

2017-06-01

Hypersexual Disorder (HD) defined as non-paraphilic sexual desire disorder with components of compulsivity, impulsivity and behavioral addiction, and proposed as a diagnosis in the DSM 5, shares some overlapping features with substance use disorder including common neurotransmitter systems and dysregulated hypothalamic-pituitary-adrenal (HPA) axis function. In this study, comprising 67 HD male patients and 39 male healthy volunteers, we aimed to identify HPA-axis coupled CpG-sites, in which modifications of the epigenetic profile are associated with hypersexuality. The genome-wide methylation pattern was measured in whole blood using the Illumina Infinium Methylation EPIC BeadChip, measuring the methylation state of over 850K CpG sites. Prior to analysis, the global DNA methylation pattern was pre-processed according to standard protocols and adjusted for white blood cell type heterogeneity. We included CpG sites located within 2000bp of the transcriptional start site of the following HPA-axis coupled genes: Corticotropin releasing hormone (CRH), corticotropin releasing hormone binding protein (CRHBP), corticotropin releasing hormone receptor 1 (CRHR1), corticotropin releasing hormone receptor 2 (CRHR2), FKBP5 and the glucocorticoid receptor (NR3C1). We performed multiple linear regression models of methylation M-values to a categorical variable of hypersexuality, adjusting for depression, dexamethasone non-suppression status, Childhood Trauma Questionnaire total score and plasma levels of TNF-alpha and IL-6. Of 76 tested individual CpG sites, four were nominally significant (p<0.05), associated with the genes CRH, CRHR2 and NR3C1. Cg23409074-located 48bp upstream of the transcription start site of the CRH gene - was significantly hypomethylated in hypersexual patients after corrections for multiple testing using the FDR-method. Methylation levels of cg23409074 were positively correlated with gene expression of the CRH gene in an independent cohort of 11 healthy male subjects. The methylation levels at the identified CRH site, cg23409074, were significantly correlated between blood and four different brain regions. CRH is an important integrator of neuroendocrine stress responses in the brain, with a key role in the addiction processes. Our results show epigenetic changes in the CRH gene related to hypersexual disorder in men. Copyright © 2017 Elsevier Ltd. All rights reserved.

Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene.

PubMed

Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya

2017-10-20

We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.

Extended Plasticity of Visual Cortex in Dark-Reared Animals May Result from Prolonged Expression of cpg15-Like Genes

PubMed Central

Lee, Wei-Chung Allen; Nedivi, Elly

2011-01-01

cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509

Evidence-based clinical practice guideline for adult Still's disease.

PubMed

Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki

2018-05-09

Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.

The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

PubMed

Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

2017-02-14

The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

PubMed

Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

2015-07-08

The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

A terahertz EO detector with large dynamical range, high modulation depth and signal-noise ratio

NASA Astrophysics Data System (ADS)

Pan, Xinjian; Cai, Yi; Zeng, Xuanke; Zheng, Shuiqin; Li, Jingzhen; Xu, Shixiang

2017-05-01

The paper presents a novel design for terahertz (THz) free-space time domain electro-optic (EO) detection where the static birefringent phases of the two balanced arms are set close to zero but opposite to each other. Our theoretical and numerical analyses show this design has much stronger ability to cancel the optical background noise than both THz ellipsometer and traditional crossed polarizer geometry (CPG). Its optical modulation depth is about twice as high as that of traditional CPG, but about ten times as high as that of THz ellipsometer. As for the dynamical range, our improved design is comparable to the THz ellipsometer but obviously larger than the traditional CPG. Some experiments for comparing our improved CPG with traditional CPG agree well with the corresponding theoretical predictions. Our experiments also show that the splitting ratio of the used non-polarization beam splitter is critical for the performance of our design.

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

PubMed Central

2010-01-01

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

PubMed

Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

2010-02-05

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

Broad DNA methylation changes of spermatogenesis, inflammation and immune response-related genes in a subgroup of sperm samples for assisted reproduction.

PubMed

Schütte, B; El Hajj, N; Kuhtz, J; Nanda, I; Gromoll, J; Hahn, T; Dittrich, M; Schorsch, M; Müller, T; Haaf, T

2013-11-01

Aberrant sperm DNA methylation patterns, mainly in imprinted genes, have been associated with male subfertility and oligospermia. Here, we performed a genome-wide methylation analysis in sperm samples representing a wide range of semen parameters. Sperm DNA samples of 38 males attending a fertility centre were analysed with Illumina HumanMethylation27 BeadChips, which quantify methylation of >27 000 CpG sites in cis-regulatory regions of almost 15 000 genes. In an unsupervised analysis of methylation of all analysed sites, the patient samples clustered into a major and a minor group. The major group clustered with samples from normozoospermic healthy volunteers and, thus, may more closely resemble the normal situation. When correlating the clusters with semen and clinical parameters, the sperm counts were significantly different between groups with the minor group exhibiting sperm counts in the low normal range. A linear model identified almost 3000 CpGs with significant methylation differences between groups. Functional analysis revealed a broad gain of methylation in spermatogenesis-related genes and a loss of methylation in inflammation- and immune response-related genes. Quantitative bisulfite pyrosequencing validated differential methylation in three of five significant candidate genes on the array. Collectively, we identified a subgroup of sperm samples for assisted reproduction with sperm counts in the low normal range and broad methylation changes (affecting approximately 10% of analysed CpG sites) in specific pathways, most importantly spermatogenesis-related genes. We propose that epigenetic analysis can supplement traditional semen parameters and has the potential to provide new insights into the aetiology of male subfertility. © 2013 American Society of Andrology and European Academy of Andrology.

Identification and comparison of aberrant key regulatory networks in breast, colon, liver, lung, and stomach cancers through methylome database analysis.

PubMed

Kim, Byungtak; Kang, Seongeun; Jeong, Gookjoo; Park, Sung-Bin; Kim, Sun Jung

2014-01-01

Aberrant methylation of specific CpG sites at the promoter is widely responsible for genesis and development of various cancer types. Even though the microarray-based methylome analyzing techniques have contributed to the elucidation of the methylation change at the genome-wide level, the identification of key methylation markers or top regulatory networks appearing common in highly incident cancers through comparison analysis is still limited. In this study, we in silico performed the genome-wide methylation analysis on each 10 sets of normal and cancer pairs of five tissues: breast, colon, liver, lung, and stomach. The methylation array covers 27,578 CpG sites, corresponding to 14,495 genes, and significantly hypermethylated or hypomethylated genes in the cancer were collected (FDR adjusted p-value <0.05; methylation difference >0.3). Analysis of the dataset confirmed the methylation of previously known methylation markers and further identified novel methylation markers, such as GPX2, CLDN15, and KL. Cluster analysis using the methylome dataset resulted in a diagram with a bipartite mode distinguishing cancer cells from normal cells regardless of tissue types. The analysis further revealed that breast cancer was closest with lung cancer, whereas it was farthest from colon cancer. Pathway analysis identified that either the "cancer" related network or the "cancer" related bio-function appeared as the highest confidence in all the five cancers, whereas each cancer type represents its tissue-specific gene sets. Our results contribute toward understanding the essential abnormal epigenetic pathways involved in carcinogenesis. Further, the novel methylation markers could be applied to establish markers for cancer prognosis.

Extensive sequence-influenced DNA methylation polymorphism in the human genome

PubMed Central

2010-01-01

Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

DNA activates human immune cells through a CpG sequence-dependent manner

PubMed Central

Bauer, M; Heeg, K; Wagner, H; Lipford, G B

1999-01-01

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

[Evaluation of the quality of clinical practice guidelines published in the Annales de Biologie Clinique with the help of the EFLM checklist].

PubMed

Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph

2014-01-01

Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.

Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

PubMed

Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

2013-10-01

Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

Towards autonomous locomotion: CPG-based control of smooth 3D slithering gait transition of a snake-like robot.

PubMed

Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois

2017-04-04

Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.

CpG island methylator phenotype in colorectal cancer

PubMed Central

Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

1999-01-01

Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

PubMed

Kava, Hieronimus W; Murray, Vincent

2016-10-01

This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540

Analysis of the association between CIMP and BRAF in colorectal cancer by DNA methylation profiling.

PubMed

Hinoue, Toshinori; Weisenberger, Daniel J; Pan, Fei; Campan, Mihaela; Kim, Myungjin; Young, Joanne; Whitehall, Vicki L; Leggett, Barbara A; Laird, Peter W

2009-12-21

A CpG island methylator phenotype (CIMP) is displayed by a distinct subset of colorectal cancers with a high frequency of DNA hypermethylation in a specific group of CpG islands. Recent studies have shown that an activating mutation of BRAF (BRAF(V600E)) is tightly associated with CIMP, raising the question of whether BRAF(V600E) plays a causal role in the development of CIMP or whether CIMP provides a favorable environment for the acquisition of BRAF(V600E). We employed Illumina GoldenGate DNA methylation technology, which interrogates 1,505 CpG sites in 807 different genes, to further study this association. We first examined whether expression of BRAF(V600E) causes DNA hypermethylation by stably expressing BRAF(V600E) in the CIMP-negative, BRAF wild-type COLO 320DM colorectal cancer cell line. We determined 100 CIMP-associated CpG sites and examined changes in DNA methylation in eight stably transfected clones over multiple passages. We found that BRAF(V600E) is not sufficient to induce CIMP in our system. Secondly, considering the alternative possibility, we identified genes whose DNA hypermethylation was closely linked to BRAF(V600E) and CIMP in 235 primary colorectal tumors. Interestingly, genes that showed the most significant link include those that mediate various signaling pathways implicated in colorectal tumorigenesis, such as BMP3 and BMP6 (BMP signaling), EPHA3, KIT, and FLT1 (receptor tyrosine kinases) and SMO (Hedgehog signaling). Furthermore, we identified CIMP-dependent DNA hypermethylation of IGFBP7, which has been shown to mediate BRAF(V600E)-induced cellular senescence and apoptosis. Promoter DNA hypermethylation of IGFBP7 was associated with silencing of the gene. CIMP-specific inactivation of BRAF(V600E)-induced senescence and apoptosis pathways by IGFBP7 DNA hypermethylation might create a favorable context for the acquisition of BRAF(V600E) in CIMP+ colorectal cancer. Our data will be useful for future investigations toward understanding CIMP in colorectal cancer and gaining insights into the role of aberrant DNA hypermethylation in colorectal tumorigenesis.

Induction of Type I Interferons by Therapeutic Nanoparticle-Based Vaccination Is Indispensable to Reinforce Cytotoxic CD8+ T Cell Responses During Chronic Retroviral Infection

PubMed Central

Knuschke, Torben; Rotan, Olga; Bayer, Wibke; Kollenda, Sebastian; Dickow, Julia; Sutter, Kathrin; Hansen, Wiebke; Dittmer, Ulf; Lang, Karl S.; Epple, Matthias; Buer, Jan; Westendorf, Astrid M.

2018-01-01

T cell dysfunction and immunosuppression are characteristic for chronic viral infections and contribute to viral persistence. Overcoming these burdens is the goal of new therapeutic strategies to cure chronic infectious diseases. We recently described that therapeutic vaccination of chronic retrovirus infected mice with a calcium phosphate (CaP) nanoparticle (NP)-based vaccine carrier, functionalized with CpG and viral peptides is able to efficiently reactivate the CD8+ T cell response and improve the eradication of virus infected cells. However, the mechanisms underlying this effect were largely unclear. While type I interferons (IFNs I) are considered to drive T cell exhaustion by persistent immune activation during chronic viral infection, we here describe an indispensable role of IFN I induced by therapeutic vaccination to efficiently reinforce cytotoxic CD8+ T cells (CTL) and improve control of chronic retroviral infection. The induction of IFN I is CpG dependent and leads to significant IFN signaling indicated by upregulation of IFN stimulated genes. By vaccinating chronically retrovirus-infected mice lacking the IFN I receptor (IFNAR−/−) or by blocking IFN I signaling in vivo during therapeutic vaccination, we demonstrate that IFN I signaling is necessary to drive full reactivation of CTLs. Surprisingly, we also identified an impaired suppressive capability of regulatory T cells in the presence of IFNα, which implicates an important role for vaccine-induced IFNα in the regulation of the T cell response during chronic retroviral infection. Our data suggest that inducing IFN I signaling in conjunction with the presentation of viral antigens can reactivate immune functions and reduce viral loads in chronic infections. Therefore, we propose CaP NPs as potential therapeutic tool to treat chronic infections. PMID:29740425

Inhibitory and modulatory inputs to the vocal central pattern generator of a teleost fish

PubMed Central

Rosner, Elisabeth; Rohmann, Kevin N.; Bass, Andrew H.

2018-01-01

Abstract Vocalization is a behavioral feature that is shared among multiple vertebrate lineages, including fish. The temporal patterning of vocal communication signals is set, in part, by central pattern generators (CPGs). Toadfishes are well‐established models for CPG coding of vocalization at the hindbrain level. The vocal CPG comprises three topographically separate nuclei: pre‐pacemaker, pacemaker, motor. While the connectivity between these nuclei is well understood, their neurochemical profile remains largely unexplored. The highly vocal Gulf toadfish, Opsanus beta, has been the subject of previous behavioral, neuroanatomical and neurophysiological studies. Combining transneuronal neurobiotin‐labeling with immunohistochemistry, we map the distribution of inhibitory neurotransmitters and neuromodulators along with gap junctions in the vocal CPG of this species. Dense GABAergic and glycinergic label is found throughout the CPG, with labeled somata immediately adjacent to or within CPG nuclei, including a distinct subset of pacemaker neurons co‐labeled with neurobiotin and glycine. Neurobiotin‐labeled motor and pacemaker neurons are densely co‐labeled with the gap junction protein connexin 35/36, supporting the hypothesis that transneuronal neurobiotin‐labeling occurs, at least in part, via gap junction coupling. Serotonergic and catecholaminergic label is also robust within the entire vocal CPG, with additional cholinergic label in pacemaker and prepacemaker nuclei. Likely sources of these putative modulatory inputs are neurons within or immediately adjacent to vocal CPG neurons. Together with prior neurophysiological investigations, the results reveal potential mechanisms for generating multiple classes of social context‐dependent vocalizations with widely divergent temporal and spectral properties. PMID:29424431

CpG Distribution and Methylation Pattern in Porcine Parvovirus

PubMed Central

Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

2013-01-01

Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

Novel epigenetic determinants of type 2 diabetes in Mexican-American families.

PubMed

Kulkarni, Hemant; Kos, Mark Z; Neary, Jennifer; Dyer, Thomas D; Kent, Jack W; Göring, Harald H H; Cole, Shelley A; Comuzzie, Anthony G; Almasy, Laura; Mahaney, Michael C; Curran, Joanne E; Blangero, John; Carless, Melanie A

2015-09-15

Although DNA methylation is now recognized as an important mediator of complex diseases, the extent to which the genetic basis of such diseases is accounted for by DNA methylation is unknown. In the setting of large, extended families representing a minority, high-risk population of the USA, we aimed to characterize the role of epigenome-wide DNA methylation in type 2 diabetes (T2D). Using Illumina HumanMethylation450 BeadChip arrays, we tested for association of DNA methylation at 446 356 sites with age, sex and phenotypic traits related to T2D in 850 pedigreed Mexican-American individuals. Robust statistical analyses showed that (i) 15% of the methylome is significantly heritable, with a median heritability of 0.14; (ii) DNA methylation at 14% of CpG sites is associated with nearby sequence variants; (iii) 22% and 3% of the autosomal CpG sites are associated with age and sex, respectively; (iv) 53 CpG sites were significantly associated with liability to T2D, fasting blood glucose and insulin resistance; (v) DNA methylation levels at five CpG sites, mapping to three well-characterized genes (TXNIP, ABCG1 and SAMD12) independently explained 7.8% of the heritability of T2D (vi) methylation at these five sites was unlikely to be influenced by neighboring DNA sequence variation. Our study has identified novel epigenetic indicators of T2D risk in Mexican Americans who have increased risk for this disease. These results provide new insights into potential treatment targets of T2D. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection.

PubMed

Tabeta, Koichi; Georgel, Philippe; Janssen, Edith; Du, Xin; Hoebe, Kasper; Crozat, Karine; Mudd, Suzanne; Shamel, Louis; Sovath, Sosathya; Goode, Jason; Alexopoulou, Lena; Flavell, Richard A; Beutler, Bruce

2004-03-09

Several subsets of dendritic cells have been shown to produce type I IFN in response to viral infections, thereby assisting the natural killer cell-dependent response that eliminates the pathogen. Type I IFN production can be induced both by unmethylated CpG-oligodeoxynucleotide and by double-stranded RNA. Here, we describe a codominant CpG-ODN unresponsive phenotype that results from an N-ethyl-N-nitrosourea-induced missense mutation in the Tlr9 gene (Tlr9(CpG1)). Mice homozygous for the Tlr9(CpG1) allele are highly susceptible to mouse cytomegalovirus infection and show impaired infection-induced secretion of IFN-alpha/beta and natural killer cell activation. We also demonstrate that both the Toll-like receptor (TLR) 9 --> MyD88 and TLR3 --> Trif signaling pathways are activated in vivo on viral inoculation, and that each pathway contributes to innate defense against systemic viral infection. Whereas both pathways lead to type I IFN production, neither pathway offers full protection against mouse cytomegalovirus infection in the absence of the other. The Tlr9(CpG1) mutation alters a leucine-rich repeat motif and lies within a receptor domain that is conserved within the evolutionary cluster encompassing TLRs 7, 8, and 9. In other TLRs, including three mouse-specific TLRs described in this paper, the affected region is not represented. The phenotypic effect of the Tlr9(CpG1) allele thus points to a critical role for TLR9 in viral sensing and identifies a vulnerable amino acid within the ectodomain of three TLR proteins, essential for a ligand response.

Nicotine Induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

PubMed Central

Wang, Tingting; Chen, Man; Liu, Lian; Cheng, Huaiyan; Yan, You-E; Feng, Ying-Hong; Wang, Hui

2011-01-01

Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a single site CpG methylation at nt −377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. PMID:21971485

Speech pathologists’ experiences with stroke clinical practice guidelines and the barriers and facilitators influencing their use: a national descriptive study

PubMed Central

2014-01-01

Background Communication and swallowing disorders are a common consequence of stroke. Clinical practice guidelines (CPGs) have been created to assist health professionals to put research evidence into clinical practice and can improve stroke care outcomes. However, CPGs are often not successfully implemented in clinical practice and research is needed to explore the factors that influence speech pathologists’ implementation of stroke CPGs. This study aimed to describe speech pathologists’ experiences and current use of guidelines, and to identify what factors influence speech pathologists’ implementation of stroke CPGs. Methods Speech pathologists working in stroke rehabilitation who had used a stroke CPG were invited to complete a 39-item online survey. Content analysis and descriptive and inferential statistics were used to analyse the data. Results 320 participants from all states and territories of Australia were surveyed. Almost all speech pathologists had used a stroke CPG and had found the guideline “somewhat useful” or “very useful”. Factors that speech pathologists perceived influenced CPG implementation included the: (a) guideline itself, (b) work environment, (c) aspects related to the speech pathologist themselves, (d) patient characteristics, and (e) types of implementation strategies provided. Conclusions There are many different factors that can influence speech pathologists’ implementation of CPGs. The factors that influenced the implementation of CPGs can be understood in terms of knowledge creation and implementation frameworks. Speech pathologists should continue to adapt the stroke CPG to their local work environment and evaluate their use. To enhance guideline implementation, they may benefit from a combination of educational meetings and resources, outreach visits, support from senior colleagues, and audit and feedback strategies. PMID:24602148

Computational Models and Emergent Properties of Respiratory Neural Networks

PubMed Central

Lindsey, Bruce G.; Rybak, Ilya A.; Smith, Jeffrey C.

2012-01-01

Computational models of the neural control system for breathing in mammals provide a theoretical and computational framework bringing together experimental data obtained from different animal preparations under various experimental conditions. Many of these models were developed in parallel and iteratively with experimental studies and provided predictions guiding new experiments. This data-driven modeling approach has advanced our understanding of respiratory network architecture and neural mechanisms underlying generation of the respiratory rhythm and pattern, including their functional reorganization under different physiological conditions. Models reviewed here vary in neurobiological details and computational complexity and span multiple spatiotemporal scales of respiratory control mechanisms. Recent models describe interacting populations of respiratory neurons spatially distributed within the Bötzinger and pre-Bötzinger complexes and rostral ventrolateral medulla that contain core circuits of the respiratory central pattern generator (CPG). Network interactions within these circuits along with intrinsic rhythmogenic properties of neurons form a hierarchy of multiple rhythm generation mechanisms. The functional expression of these mechanisms is controlled by input drives from other brainstem components, including the retrotrapezoid nucleus and pons, which regulate the dynamic behavior of the core circuitry. The emerging view is that the brainstem respiratory network has rhythmogenic capabilities at multiple levels of circuit organization. This allows flexible, state-dependent expression of different neural pattern-generation mechanisms under various physiological conditions, enabling a wide repertoire of respiratory behaviors. Some models consider control of the respiratory CPG by pulmonary feedback and network reconfiguration during defensive behaviors such as cough. Future directions in modeling of the respiratory CPG are considered. PMID:23687564

Association between DNA Methylation in Whole Blood and Measures of Glucose Metabolism: KORA F4 Study

PubMed Central

Wahl, Simone; Kunze, Sonja; Molnos, Sophie; Volkova, Nadezda; Schramm, Katharina; Carstensen-Kirberg, Maren; Waldenberger, Melanie; Gieger, Christian; Peters, Annette; Illig, Thomas; Prokisch, Holger; Roden, Michael; Grallert, Harald

2016-01-01

Epigenetic regulation has been postulated to affect glucose metabolism, insulin sensitivity and the risk of type 2 diabetes. Therefore, we performed an epigenome-wide association study for measures of glucose metabolism in whole blood samples of the population-based Cooperative Health Research in the Region of Augsburg F4 study using the Illumina HumanMethylation 450 BeadChip. We identified a total of 31 CpG sites where methylation level was associated with measures of glucose metabolism after adjustment for age, sex, smoking, and estimated white blood cell proportions and correction for multiple testing using the Benjamini-Hochberg (B-H) method (four for fasting glucose, seven for fasting insulin, 25 for homeostasis model assessment-insulin resistance [HOMA-IR]; B-H-adjusted p-values between 9.2x10-5 and 0.047). In addition, DNA methylation at cg06500161 (annotated to ABCG1) was associated with all the aforementioned phenotypes and 2-hour glucose (B-H-adjusted p-values between 9.2x10-5 and 3.0x10-3). Methylation status of additional three CpG sites showed an association with fasting insulin only after additional adjustment for body mass index (BMI) (B-H-adjusted p-values = 0.047). Overall, effect strengths were reduced by around 30% after additional adjustment for BMI, suggesting that this variable has an influence on the investigated phenotypes. Furthermore, we found significant associations between methylation status of 21 of the aforementioned CpG sites and 2-hour insulin in a subset of samples with seven significant associations persisting after additional adjustment for BMI. In a subset of 533 participants, methylation of the CpG site cg06500161 (ABCG1) was inversely associated with ABCG1 gene expression (B-H-adjusted p-value = 1.5x10-9). Additionally, we observed an enrichment of the top 1,000 CpG sites for diabetes-related canonical pathways using Ingenuity Pathway Analysis. In conclusion, our study indicates that DNA methylation and diabetes-related traits are associated and that these associations are partially BMI-dependent. Furthermore, the interaction of ABCG1 with glucose metabolism is modulated by epigenetic processes. PMID:27019061

Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

PubMed

Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

2017-06-27

Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

PubMed

Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

2014-11-28

NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Accounting for cell lineage and sex effects in the identification of cell-specific DNA methylation using a Bayesian model selection algorithm.

PubMed

White, Nicole; Benton, Miles; Kennedy, Daniel; Fox, Andrew; Griffiths, Lyn; Lea, Rodney; Mengersen, Kerrie

2017-01-01

Cell- and sex-specific differences in DNA methylation are major sources of epigenetic variation in whole blood. Heterogeneity attributable to cell type has motivated the identification of cell-specific methylation at the CpG level, however statistical methods for this purpose have been limited to pairwise comparisons between cell types or between the cell type of interest and whole blood. We developed a Bayesian model selection algorithm for the identification of cell-specific methylation profiles that incorporates knowledge of shared cell lineage and allows for the identification of differential methylation profiles in one or more cell types simultaneously. Under the proposed methodology, sex-specific differences in methylation by cell type are also assessed. Using publicly available, cell-sorted methylation data, we show that 51.3% of female CpG markers and 61.4% of male CpG markers identified were associated with differential methylation in more than one cell type. The impact of cell lineage on differential methylation was also highlighted. An evaluation of sex-specific differences revealed differences in CD56+NK methylation, within both single and multi- cell dependent methylation patterns. Our findings demonstrate the need to account for cell lineage in studies of differential methylation and associated sex effects.

Expression and methylation of BDNF in the human brain in schizophrenia.

PubMed

Cheah, Sern-Yih; McLeay, Robert; Wockner, Leesa F; Lawford, Bruce R; Young, Ross McD; Morris, Charles P; Voisey, Joanne

2017-08-01

To examine the combined effect of the BDNF Val66Met (rs6265) polymorphism and BDNF DNA methylation on transcriptional regulation of the BDNF gene. DNA methylation profiles were generated for CpG sites proximal to Val66Met, within BDNF promoter I and exon V for prefrontal cortex samples from 25 schizophrenia and 25 control subjects. Val66Met genotypes and BDNF mRNA expression data were generated by transcriptome sequencing. Expression, methylation and genotype data were correlated and examined for association with schizophrenia. There was 43% more of the BDNF V-VIII-IX transcript in schizophrenia samples. BDNF mRNA expression and DNA methylation of seven CpG sites were not associated with schizophrenia after accounting for age and PMI effects. BDNF mRNA expression and DNA methylation were not altered by Val66Met after accounting for age and PMI effects. DNA methylation of one CpG site had a marginally significant positive correlation with mRNA expression in schizophrenia subjects. Schizophrenia risk was not associated with differential BDNF mRNA expression and DNA methylation. A larger age-matched cohort with comprehensive clinical history is required to accurately identify the effects of genotype, mRNA expression and DNA methylation on schizophrenia risk.

Potential interaction between the GARS-AIRS-GART Gene and CP2/LBP-1c/LSF transcription factor in Down syndrome-related Alzheimer disease.

PubMed

Banerjee, Disha; Nandagopal, Krishnadas

2007-12-01

(1) GARS-AIRS-GART is an important candidate gene in studies of Down syndrome (DS)-related Alzheimer's disease (AD), due to its chromosomal localization (21q22.1) in the Down syndrome critical region, involvement in de novo purine biosynthesis, and over-expression in DS brain. The aim of this study was to identify factor(s) likely to enhance transcription of GARS-AIRS-GART in DS-related AD. (2) Based on a bio-informatics approach, the PromoterInspector, Promoter Scan II, and EBI toolbox CpG plot software programs were used to identify GARS-AIRS-GART sequences important for gene transcription. Transcription factor binding motifs within these regions were mapped with the help of the MatInspector and TFSEARCH programs. Factors implicated in neurodevelopment or neurodegeneration were the focus of attention, and mining of human (T1Dbase) and murine (GNF) expression databases revealed information on the regional distribution of these factors and their relative abundance vis-a-vis GARS-AIRS-GART. (3) The Leader-binding protein 1-c (LBP-1c/CP2/LSF) emerged as a promising candidate from these studies, as MatInspector and TFSEARCH analyses revealed a total of four CP2 binding sites with potential for functional interaction(s) within the promoter and CpG islands of GARS-AIRS-GART. Furthermore, two of these sites harbor sequences for methylation-sensitive restriction enzymes, which suggest that methylation status may, in part, regulate CP2-mediated transcription of GARS-AIRS-GART. A search of T1Dbase and GNF expression databases reveals co-expression of CP2 and GARS-AIRS-GART in brain regions relevant to DS-related AD. (4) The virtual screen identified CP2/LBP-1c/LSF as a factor that likely mediates enhanced transcription of GARS-AIRS-GART in DS-related AD.

Regulation of ventral surface chemoreceptors by the central respiratory pattern generator.

PubMed

Guyenet, Patrice G; Mulkey, Daniel K; Stornetta, Ruth L; Bayliss, Douglas A

2005-09-28

The rat retrotrapezoid nucleus (RTN) contains neurons described as central chemoreceptors in the adult and respiratory rhythm-generating pacemakers in neonates [parafacial respiratory group (pfRG)]. Here we test the hypothesis that both RTN and pfRG neurons are intrinsically chemosensitive and tonically firing neurons whose respiratory rhythmicity is caused by a synaptic feedback from the central respiratory pattern generator (CPG). In halothane-anesthetized adults, RTN neurons were silent below 4.5% end-expiratory (e-exp) CO2. Their activity increased linearly (3.2 Hz/1% CO2) up to 6.5% (CPG threshold) and then more slowly to peak approximately 10 Hz at 10% CO2. Respiratory modulation of RTN neurons was absent below CPG threshold, gradually stronger beyond, and, like pfRG neurons, typically (42%) characterized by twin periods of reduced activity near phrenic inspiration. After CPG inactivation with kynurenate (KYN), RTN neurons discharged linearly as a function of e-exp CO2 (slope, +1.7 Hz/1% CO2) and arterial pH (threshold, 7.48; slope, 39 Hz/pH unit). In coronal brain slices (postnatal days 7-12), RTN chemosensitive neurons were silent at pH 7.55. Their activity increased linearly with acidification up to pH 7.2 (17 Hz/pH unit at 35 degrees C) and was always tonic. In conclusion, consistent with their postulated central chemoreceptor role, RTN/pfRG neurons encode pH linearly and discharge tonically when disconnected from the rest of the respiratory centers in vivo (KYN treatment) and in vitro. In vivo, RTN neurons receive respiratory synchronous inhibitory inputs that may serve as feedback and impart these neurons with their characteristic respiratory modulation.

Smoking-Associated Site-Specific Differential Methylation in Buccal Mucosa in the COPDGene Study

PubMed Central

Qiu, Weiliang; Carey, Vincent J.; Morrow, Jarrett; Bacherman, Helene; Foreman, Marilyn G.; Hokanson, John E.; Bowler, Russell P.; Crapo, James D.; DeMeo, Dawn L.

2015-01-01

DNA methylation is a complex, tissue-specific phenomenon that can reflect both endogenous factors and exogenous exposures. Buccal brushings represent an easily accessible source of DNA, which may be an appropriate surrogate tissue in the study of environmental exposures and chronic respiratory diseases. Buccal brushings were obtained from a subset of current and former smokers from the COPDGene study. Genome-wide DNA methylation data were obtained in the discovery cohort (n = 82) using the Illumina HumanMethylation450K array. Empirical Bayes methods were used to test for differential methylation by current smoking status at 468,219 autosomal CpG sites using linear models adjusted for age, sex, and race. Pyrosequencing was performed in a nonoverlapping replication cohort (n = 130). Current smokers were significantly younger than former smokers in both the discovery and replication cohorts. Seven CpG sites were associated with current smoking at a false discovery rate less than 0.05 in the discovery cohort. Six of the seven significant sites were pyrosequenced in the replication cohort; five CpG sites, including sites annotated to CYP1B1 and PARVA, were replicated. Correlations between cumulative smoke exposure and time since smoking cessation were observed in a subset of the significantly associated CpG sites. A significant correlation between reduced lung function and increased radiographic emphysema with methylation at cg02162897 (CYP1B1) was observed among female subjects. Site-specific methylation of DNA isolated from buccal mucosa is associated with exposure to cigarette smoke, and may provide insights into the mechanisms underlying differential susceptibility toward the development of smoking-related chronic respiratory diseases. PMID:25517428

Cryotherapy with concurrent CpG oligonucleotide treatment controls local tumor recurrence and modulates HER2/neu immunity.

PubMed

Veenstra, Jesse J; Gibson, Heather M; Littrup, Peter J; Reyes, Joyce D; Cher, Michael L; Takashima, Akira; Wei, Wei-Zen

2014-10-01

Percutaneous cryoablation is a minimally invasive procedure for tumor destruction, which can potentially initiate or amplify antitumor immunity through the release of tumor-associated antigens. However, clinically efficacious immunity is lacking and regional recurrences are a limiting factor relative to surgical excision. To understand the mechanism of immune activation by cryoablation, comprehensive analyses of innate immunity and HER2/neu humoral and cellular immunity following cryoablation with or without peritumoral CpG injection were conducted using two HER2/neu(+) tumor systems in wild-type (WT), neu-tolerant, and SCID mice. Cryoablation of neu(+) TUBO tumor in BALB/c mice resulted in systemic immune priming, but not in neu-tolerant BALB NeuT mice. Cryoablation of human HER2(+) D2F2/E2 tumor enabled the functionality of tumor-induced immunity, but secondary tumors were refractory to antitumor immunity if rechallenge occurred during the resolution phase of the cryoablated tumor. A step-wise increase in local recurrence was observed in WT, neu-tolerant, and SCID mice, indicating a role of adaptive immunity in controlling residual tumor foci. Importantly, local recurrences were eliminated or greatly reduced in WT, neu tolerant, and SCID mice when CpG was incorporated in the cryoablation regimen, showing significant local control by innate immunity. For long-term protection, however, adaptive immunity was required because most SCID mice eventually succumbed to local tumor recurrence even with combined cryoablation and CpG treatment. This improved understanding of the mechanisms by which cryoablation affects innate and adaptive immunity will help guide appropriate combination of therapeutic interventions to improve treatment outcomes. ©2014 American Association for Cancer Research.

A modeling approach on why simple central pattern generators are built of irregular neurons.

PubMed

Reyes, Marcelo Bussotti; Carelli, Pedro Valadão; Sartorelli, José Carlos; Pinto, Reynaldo Daniel

2015-01-01

The crustacean pyloric Central Pattern Generator (CPG) is a nervous circuit that endogenously provides periodic motor patterns. Even after about 40 years of intensive studies, the rhythm genesis is still not rigorously understood in this CPG, mainly because it is made of neurons with irregular intrinsic activity. Using mathematical models we addressed the question of using a network of irregularly behaving elements to generate periodic oscillations, and we show some advantages of using non-periodic neurons with intrinsic behavior in the transition from bursting to tonic spiking (as found in biological pyloric CPGs) as building components. We studied two- and three-neuron model CPGs built either with Hindmarsh-Rose or with conductance-based Hodgkin-Huxley-like model neurons. By changing a model's parameter we could span the neuron's intrinsic dynamical behavior from slow periodic bursting to fast tonic spiking, passing through a transition where irregular bursting was observed. Two-neuron CPG, half center oscillator (HCO), was obtained for each intrinsic behavior of the neurons by coupling them with mutual symmetric synaptic inhibition. Most of these HCOs presented regular antiphasic bursting activity and the changes of the bursting frequencies was studied as a function of the inhibitory synaptic strength. Among all HCOs, those made of intrinsic irregular neurons presented a wider burst frequency range while keeping a reliable regular oscillatory (bursting) behavior. HCOs of periodic neurons tended to be either hard to change their behavior with synaptic strength variations (slow periodic burster neurons) or unable to perform a physiologically meaningful rhythm (fast tonic spiking neurons). Moreover, 3-neuron CPGs with connectivity and output similar to those of the pyloric CPG presented the same results.

A High-Throughput Process for the Solid-Phase Purification of Synthetic DNA Sequences

PubMed Central

Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L.

2017-01-01

An efficient process for the purification of synthetic phosphorothioate and native DNA sequences is presented. The process is based on the use of an aminopropylated silica gel support functionalized with aminooxyalkyl functions to enable capture of DNA sequences through an oximation reaction with the keto function of a linker conjugated to the 5′-terminus of DNA sequences. Deoxyribonucleoside phosphoramidites carrying this linker, as a 5′-hydroxyl protecting group, have been synthesized for incorporation into DNA sequences during the last coupling step of a standard solid-phase synthesis protocol executed on a controlled pore glass (CPG) support. Solid-phase capture of the nucleobase- and phosphate-deprotected DNA sequences released from the CPG support is demonstrated to proceed near quantitatively. Shorter than full-length DNA sequences are first washed away from the capture support; the solid-phase purified DNA sequences are then released from this support upon reaction with tetra-n-butylammonium fluoride in dry dimethylsulfoxide (DMSO) and precipitated in tetrahydrofuran (THF). The purity of solid-phase-purified DNA sequences exceeds 98%. The simulated high-throughput and scalability features of the solid-phase purification process are demonstrated without sacrificing purity of the DNA sequences. PMID:28628204

Gestational exposure to diethylstilbestrol alters cardiac structure/function, protein expression and DNA methylation in adult male mice progeny

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haddad, Rami, E-mail: rami.haddad@mail.mcgill.ca; Division of Experimental Medicine, Department of Medicine, McGill University, 850 Sherbrooke Street, Montréal, Québec, Canada H3A 1A2; Kasneci, Amanda, E-mail: amanda.kasneci@mail.mcgill.ca

2013-01-01

Pregnant women, and thus their fetuses, are exposed to many endocrine disruptor compounds (EDCs). Fetal cardiomyocytes express sex hormone receptors making them potentially susceptible to re-programming by estrogenizing EDCs. Diethylstilbestrol (DES) is a proto-typical, non-steroidal estrogen. We hypothesized that changes in adult cardiac structure/function after gestational exposure to the test compound DES would be a proof in principle for the possibility of estrogenizing environmental EDCs to also alter the fetal heart. Vehicle (peanut oil) or DES (0.1, 1.0 and 10.0 μg/kg/da.) was orally delivered to pregnant C57bl/6n dams on gestation days 11.5–14.5. At 3 months, male progeny were left sedentarymore » or were swim trained for 4 weeks. Echocardiography of isoflurane anesthetized mice revealed similar cardiac structure/function in all sedentary mice, but evidence of systolic dysfunction and increased diastolic relaxation after swim training at higher DES doses. The calcium homeostasis proteins, SERCA2a, phospholamban, phospho-serine 16 phospholamban and calsequestrin 2, are important for cardiac contraction and relaxation. Immunoblot analyses of ventricle homogenates showed increased expression of SERCA2a and calsequestrin 2 in DES mice and greater molecular remodeling of these proteins and phospho-serine 16 phospholamban in swim trained DES mice. DES increased cardiac DNA methyltransferase 3a expression and DNA methylation in the CpG island within the calsequestrin 2 promoter in heart. Thus, gestational DES epigenetically altered ventricular DNA, altered cardiac function and expression, and reduced the ability of adult progeny to cardiac remodel when physically challenged. We conclude that gestational exposure to estrogenizing EDCs may impact cardiac structure/function in adult males. -- Highlights: ► Gestational DES changes cardiac SERCA2a and CASQ2 expression. ► Echocardiography identified systolic dysfunction and increased diastolic relaxation. ► DES increased DNMT3a expression and increased CpG DNA methylation. ► DES impacts fetal heart reducing cardiac reserve on challenge in adulthood. ► Fetal heart can be re-programmed by a non-steroidal estrogen.« less

Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

PubMed Central

Scheiermann, Julia; Klinman, Dennis M.

2014-01-01

Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

Transcultural Endocrinology: Adapting Type-2 Diabetes Guidelines on a Global Scale.

PubMed

Nieto-Martínez, Ramfis; González-Rivas, Juan P; Florez, Hermes; Mechanick, Jeffrey I

2016-12-01

Type-2 diabetes (T2D) needs to be prevented and treated effectively to reduce its burden and consequences. White papers, such as evidence-based clinical practice guidelines (CPG) and their more portable versions, clinical practice algorithms and clinical checklists, may improve clinical decision-making and diabetes outcomes. However, CPG are underused and poorly validated. Protocols that translate and implement these CPG are needed. This review presents the global dimension of T2D, details the importance of white papers in the transculturalization process, compares relevant international CPG, analyzes cultural variables, and summarizes translation strategies that can improve care. Specific protocols and algorithmic tools are provided. Copyright © 2016 Elsevier Inc. All rights reserved.

Transcutaneous immunization with tetanus toxoid and mutants of Escherichia coli heat-labile enterotoxin as adjuvants elicits strong protective antibody responses.

PubMed

Tierney, Rob; Beignon, Anne-Sophie; Rappuoli, Rino; Muller, Sylviane; Sesardic, Dorothea; Partidos, Charalambos D

2003-09-01

In this study, the adjuvanticity of 2 nontoxic derivatives (LTK63 and LTR72) of heat-labile enterotoxin of Escherichia coli (LT) was evaluated and was compared with that of a cytosine phosphodiester-guanine (CpG) motif, after transcutaneous immunization with tetanus toxoid (TT). TT plus LTR72 elicited the strongest antibody responses, compared with those elicited by the other vaccines (TT, TT plus LTK63, TT plus CpG, and TT plus LTK63 plus CpG); it neutralized the toxin and conferred full protection after passive transfer in mice. Preexisting immunity to LT mutants did not adversely affect their adjuvant potency. Both LTK63 and LTR72 promoted the induction of IgG1 antibodies. In contrast, mice receiving either CpG motif alone or CpG motif plus LTK63 produced strong IgG2a anti-TT antibody responses. Overall, these findings demonstrate that mutants of enterotoxins with reduced toxicity are effective adjuvants for transcutaneous immunization.

On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion

PubMed Central

Amrollah, Elmira; Henaff, Patrick

2010-01-01

This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904

[The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

PubMed

Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

2005-10-01

Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

New insights into sucking, swallowing and breathing central generators: A complexity analysis of rhythmic motor behaviors.

PubMed

Samson, Nathalie; Praud, Jean-Paul; Quenet, Brigitte; Similowski, Thomas; Straus, Christian

2017-01-18

Sucking, swallowing and breathing are dynamic motor behaviors. Breathing displays features of chaos-like dynamics, in particular nonlinearity and complexity, which take their source in the automatic command of breathing. In contrast, buccal/gill ventilation in amphibians is one of the rare motor behaviors that do not display nonlinear complexity. This study aimed at assessing whether sucking and swallowing would also follow nonlinear complex dynamics in the newborn lamb. Breathing movements were recorded before, during and after bottle-feeding. Sucking pressure and the integrated EMG of the thyroartenoid muscle, as an index of swallowing, were recorded during bottle-feeding. Nonlinear complexity of the whole signals was assessed through the calculation of the noise limit value (NL). Breathing and swallowing always exhibited chaos-like dynamics. The NL of breathing did not change significantly before, during or after bottle-feeding. On the other hand, sucking inconsistently and significantly less frequently than breathing exhibited a chaos-like dynamics. Therefore, the central pattern generator (CPG) that drives sucking may be functionally different from the breathing CPG. Furthermore, the analogy between buccal/gill ventilation and sucking suggests that the latter may take its phylogenetic origin in the gill ventilation CPG of the common ancestor of extant amphibians and mammals. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

PubMed

Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

2017-04-01

Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

Identification of secretaglobin Scgb2a1 as a target for developmental reprogramming by BPA in the rat prostate.

PubMed

Wong, Rebecca Lee Yean; Wang, Quan; Treviño, Lindsey S; Bosland, Maarten C; Chen, Jing; Medvedovic, Mario; Prins, Gail S; Kannan, Kurunthachalam; Ho, Shuk-Mei; Walker, Cheryl Lyn

2015-01-01

Secretoglobins are a superfamily of secreted proteins thought to participate in inflammation, tissue repair, and tumorigenesis. Secretoglobin family 2A member 1 (Scgb2a1) is a component of prostatein, a major androgen-binding protein secreted by the rat prostate. Using a rat model for developmental reprogramming of susceptibility to prostate carcinogenesis, we identified, by RNA-seq, that Scgb2a1 is significantly upregulated (>100-fold) in the prostate of adult rats neonatally exposed to bisphenol A (BPA), with increased gene expression confirmed by quantitative RT-PCR and chromatin immunoprecipitation for histone H3 lysine 9 acetylation. Bisulfite analysis of both CpG islands located within 10 kb of the Scgb2a1 promoter identified significant hypomethylation of the CpG island upstream of the transcription start site of this gene in the reprogrammed prostate. These data suggest that expression of Scgb2a1 in the adult prostate could be epigenetically reprogrammed by BPA exposure during prostate development, with potential implications for cancer risk and response to chemotherapeutics associated with prostatein binding.

Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA.

PubMed

Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu

2016-12-01

For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

PubMed Central

Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

2014-01-01

Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

Spreadsheet-based program for alignment of overlapping DNA sequences.

PubMed

Anbazhagan, R; Gabrielson, E

1999-06-01

Molecular biology laboratories frequently face the challenge of aligning small overlapping DNA sequences derived from a long DNA segment. Here, we present a short program that can be used to adapt Excel spreadsheets as a tool for aligning DNA sequences, regardless of their orientation. The program runs on any Windows or Macintosh operating system computer with Excel 97 or Excel 98. The program is available for use as an Excel file, which can be downloaded from the BioTechniques Web site. Upon execution, the program opens a specially designed customized workbook and is capable of identifying overlapping regions between two sequence fragments and displaying the sequence alignment. It also performs a number of specialized functions such as recognition of restriction enzyme cutting sites and CpG island mapping without costly specialized software.

Marked enhancement of the immune response to BioThrax® (Anthrax Vaccine Adsorbed) by the TLR9 agonist CPG 7909 in healthy volunteers.

PubMed

Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J

2011-08-26

Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.

Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

PubMed

Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

2006-01-16

Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine profile shifts.

Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

PubMed

Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

2014-10-20

The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

PubMed Central

Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

2012-01-01

CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

DTIC Science & Technology

2006-03-01

may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

[Similarity of cycloprolylglycine to piracetam in antihypoxic and neuroprotective effects].

PubMed

Kolisnikova, K N; Gudasheva, T A; Nazarova, G A; Antipov, T A; Voronina, T A; Seredenin, S B

2012-01-01

The antihypoxic activity of the endogenous cyclic dipeptide cycloprolylglycine (CPG) has been studied on a model of normobaric hypoxia with hypercapnia and its neuroprotective activity has been studied on a model of human neuroblastoma SH-SY5Y cell damage by 6-hydroxydopamine. It is established that CPG exhibits the antihypoxic activity at doses of 0.5 and 1.0 mg/kg (i.p.) on outbred and BALB/c mice, but not on C57B1/6 mice. The neuroprotective activity of CPG was detected in 10(-5) - 10(-8) M concentration range only when the treatment was carried out 24h before toxin introduction. The obtained data confirm the hypothesis that piracetam is a mimetic of the endogenous CPG neuropeptide.

CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

PubMed

Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

2010-11-23

Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

PlantPAN 2.0: an update of plant promoter analysis navigator for reconstructing transcriptional regulatory networks in plants.

PubMed

Chow, Chi-Nga; Zheng, Han-Qin; Wu, Nai-Yun; Chien, Chia-Hung; Huang, Hsien-Da; Lee, Tzong-Yi; Chiang-Hsieh, Yi-Fan; Hou, Ping-Fu; Yang, Tien-Yi; Chang, Wen-Chi

2016-01-04

Transcription factors (TFs) are sequence-specific DNA-binding proteins acting as critical regulators of gene expression. The Plant Promoter Analysis Navigator (PlantPAN; http://PlantPAN2.itps.ncku.edu.tw) provides an informative resource for detecting transcription factor binding sites (TFBSs), corresponding TFs, and other important regulatory elements (CpG islands and tandem repeats) in a promoter or a set of plant promoters. Additionally, TFBSs, CpG islands, and tandem repeats in the conserve regions between similar gene promoters are also identified. The current PlantPAN release (version 2.0) contains 16 960 TFs and 1143 TF binding site matrices among 76 plant species. In addition to updating of the annotation information, adding experimentally verified TF matrices, and making improvements in the visualization of transcriptional regulatory networks, several new features and functions are incorporated. These features include: (i) comprehensive curation of TF information (response conditions, target genes, and sequence logos of binding motifs, etc.), (ii) co-expression profiles of TFs and their target genes under various conditions, (iii) protein-protein interactions among TFs and their co-factors, (iv) TF-target networks, and (v) downstream promoter elements. Furthermore, a dynamic transcriptional regulatory network under various conditions is provided in PlantPAN 2.0. The PlantPAN 2.0 is a systematic platform for plant promoter analysis and reconstructing transcriptional regulatory networks. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genome-wide mapping and analysis of active promoters in mouse embryonic stem cells and adult organs

PubMed Central

Barrera, Leah O.; Li, Zirong; Smith, Andrew D.; Arden, Karen C.; Cavenee, Webster K.; Zhang, Michael Q.; Green, Roland D.; Ren, Bing

2008-01-01

By integrating genome-wide maps of RNA polymerase II (Polr2a) binding with gene expression data and H3ac and H3K4me3 profiles, we characterized promoters with enriched activity in mouse embryonic stem cells (mES) as well as adult brain, heart, kidney, and liver. We identified ∼24,000 promoters across these samples, including 16,976 annotated mRNA 5′ ends and 5153 additional sites validating cap-analysis of gene expression (CAGE) 5′ end data. We showed that promoters with CpG islands are typically non-tissue specific, with the majority associated with Polr2a and the active chromatin modifications in nearly all the tissues examined. By contrast, the promoters without CpG islands are generally associated with Polr2a and the active chromatin marks in a tissue-dependent way. We defined 4396 tissue-specific promoters by adapting a quantitative index of tissue-specificity based on Polr2a occupancy. While there is a general correspondence between Polr2a occupancy and active chromatin modifications at the tissue-specific promoters, a subset of them appear to be persistently marked by active chromatin modifications in the absence of detectable Polr2a binding, highlighting the complexity of the functional relationship between chromatin modification and gene expression. Our results provide a resource for exploring promoter Polr2a binding and epigenetic states across pluripotent and differentiated cell types in mammals. PMID:18042645

Human gingival fibroblasts express functional chemokine receptor CXCR6.

PubMed

Hosokawa, Y; Hosokawa, I; Ozaki, K; Nakae, H; Matsuo, T

2009-06-01

We have reported that CXCL16, a recently discovered transmembrane chemokine, is expressed in human gingival fibroblasts (HGF). However, it is not known whether HGF express CXCR6, the receptor for CXCL16, or CXCL16 affects HGF biology. We have shown that HGF expressed CXCR6 by reverse transcription-polymerase chain reaction and flow cytometric analysis. Moreover, we elucidated that tumour necrosis factor (TNF)-alpha and cytosine-guanine dinucleotide (CpG) DNA (Toll-like receptor-9 ligand) treatment enhanced CXCR6 expression by HGF. Interleukin (IL)-4, IL-13 and CpG DNA up-regulated CXCR6 expression by TNF-alpha-stimulated HGF. On the other hand, IL-1beta and interferon-gamma inhibited CXCR6 expression on TNF-alpha-treated HGF. CXCL16 treatment induced HGF proliferation and phosphorylation of extracellular regulated kinase (ERK) and protein kinase B (AKT) in HGF. In conclusion, HGF expressed CXCR6 functionally, because CXCL16 induced HGF proliferation and ERK and AKT phosphorylation in HGF. These results indicate that CXCL16 may play an important role in the pathogenesis and remodelling in periodontally diseased tissues.

Methylation profiling in individuals with Russell-Silver syndrome.

PubMed

Peñaherrera, Maria S; Weindler, Susanne; Van Allen, Margot I; Yong, Siu-Li; Metzger, Daniel L; McGillivray, Barbara; Boerkoel, Cornelius; Langlois, Sylvie; Robinson, Wendy P

2010-02-01

Russell-Silver syndrome (RSS) is a heterogeneous disorder associated with pre- and post-natal growth restriction and relative macrocephaly. Involvement of imprinted genes on both chromosome 7 and 11p15.5 has been reported. To further characterize the role of epimutations in RSS we evaluated the methylation status at both 11p15.5 imprinting control regions (ICRs): ICR1 associated with H19/IGF2 expression and ICR2 (KvDMR1) associated with CDKN1C expression in a series of 35 patients with RSS. We also evaluated methylation at the promoter regions of other imprinted genes involved in growth such as PLAGL1 (6q24), GCE (7q21), and PEG10 (7q21) in this series of 35 patients with RSS. Thirteen of the 35 patient samples, but none of 22 controls, showed methylation levels at ICR1 that were more than 2 SD below the mean for controls. Three RSS patients were highly methylated at the SCGE promoter, all of which were diagnosed with upd(7)mat. To identify further potential global methylation changes in RSS patients, a subset of 22 patients were evaluated at 1505 CpG sites by the Illumina GoldenGate methylation array. Among the few CpG sites displaying a significant difference between RSS patients and controls, was a CpG associated with the H19 promoter. No other sites associated with known imprinted genes were identified as abnormally methylated in RSS patients by this approach. While the association of hypomethylation of the H19/IGF2 ICR1 is clear, the continuous distribution of methylation values among the patients and controls complicates the establishment of clear cut-offs for clinical diagnosis. Copyright 2010 Wiley-Liss, Inc.

Alignment of practice guidelines with targeted-therapy drug funding policies in Ontario.

PubMed

Ramjeesingh, R; Meyer, R M; Brouwers, M; Chen, B E; Booth, C M

2013-02-01

We evaluated clinical practice guideline (cpg) recommendations from Cancer Care Ontario's Program in Evidence-Based Care (pebc) for molecularly targeted systemic treatments (tts) and subsequent funding decisions from the Ontario Ministry of Health and Long-Term Care. We identified pebc cpgs on tt published before June 1, 2010, and extracted information regarding the key evidence cited in support of cpg recommendations and the effect size associated with each tt. Those variables were compared with mohltc funding decisions as of June 2011. From 23 guidelines related to 17 tts, we identified 43 recommendations, among which 38 (88%) endorsed tt use. Among all the recommendations, 38 (88%) were based on published key evidence, with 82% (31 of 38) being supported by meta-analyses or phase iii trials. For the 38 recommendations endorsing tts, funding was approved in 28 (74%; odds ratio related to cpg recommendation: 29.9; p = 0.003). We were unable to demonstrate that recommendations associated with statistically significant improvements in overall survival [os: 14 of 16 (88%) vs. 8 of 14 (57%); p = 0.10] or disease- (dfs) or progression-free survival [pfs: 16 of 21 (76%) vs. 3 of 5 (60%); p = 0.59] were more likely to be funded than those with no significant difference. Moreover, we did not observe significant associations between funding approvals and absolute improvements of 3 months or more in os [6 of 6 (100%) vs. 3 of 6 (50%), p = 0.18] or pfs [6 of 8 (75%) vs. 10 of 12 (83%), p = 1.00]. For use of tts, most recommendations in pebc cpgs are based on meta-analyses or phase iii data, and funding decisions were strongly associated with those recommendations. Our data suggest a trend toward increased rates of funding for therapies with statistically significant improvements in os.

Relatively high rates of G:C → A:T transitions at CpG sites were observed in certain epithelial tissues including pancreas and submaxillary gland of adult big blue® mice.

PubMed

Prtenjaca, Anita; Tarnowski, Heather E; Marr, Alison M; Heney, Melanie A; Creamer, Laura; Sathiamoorthy, Sarmitha; Hill, Kathleen A

2014-01-01

With few exceptions, spontaneous mutation frequency and pattern are similar across tissue types and relatively constant in young to middle adulthood in wild type mice. Underrepresented in surveys of spontaneous mutations across murine tissues is the diversity of epithelial tissues. For the first time, spontaneous mutations were detected in pancreas and submaxillary gland and compared with kidney, lung, and male germ cells from five adult male Big Blue® mice. Mutation load was assessed quantitatively through measurement of mutant and mutation frequency and qualitatively through identification of mutations and characterization of recurrent mutations, multiple mutations, mutation pattern, and mutation spectrum. A total of 9.6 million plaque forming units were screened, 226 mutants were collected, and 196 independent mutations were identified. Four novel mutations were discovered. Spontaneous mutation frequency was low in pancreas and high in the submaxillary gland. The submaxillary gland had multiple recurrent mutations in each of the mice and one mutant had two independent mutations. Mutation patterns for epithelial tissues differed from that observed in male germ cells with a striking bias for G:C to A:T transitions at CpG sites. A comprehensive review of lacI spontaneous mutation patterns in young adult mice and rats identified additional examples of this mutational bias. An overarching observation about spontaneous mutation frequency in adult tissues of the mouse remains one of stability. A repeated observation in certain epithelial tissues is a higher rate of G:C to A:T transitions at CpG sites and the underlying mechanisms for this bias are not known. Copyright © 2013 Wiley Periodicals, Inc.

Epigenome-wide association study of metabolic syndrome in African-American adults.

PubMed

Akinyemiju, Tomi; Do, Anh N; Patki, Amit; Aslibekyan, Stella; Zhi, Degui; Hidalgo, Bertha; Tiwari, Hemant K; Absher, Devin; Geng, Xin; Arnett, Donna K; Irvin, Marguerite R

2018-01-01

The high prevalence of obesity among US adults has resulted in significant increases in associated metabolic disorders such as diabetes, dyslipidemia, and high blood pressure. Together, these disorders constitute metabolic syndrome, a clinically defined condition highly prevalent among African-Americans. Identifying epigenetic alterations associated with metabolic syndrome may provide additional information regarding etiology beyond current evidence from genome-wide association studies. Data on metabolic syndrome and DNA methylation was assessed on 614 African-Americans from the Hypertension Genetic Epidemiology Network (HyperGEN) study. Metabolic syndrome was defined using the joint harmonized criteria, and DNA methylation was assessed using the Illumina HumanMethylation450K Bead Chip assay on DNA extracted from buffy coat. Linear mixed effects regression models were used to examine the association between CpG methylation at > 450,000 CpG sites and metabolic syndrome adjusted for study covariates. Replication using DNA from a separate sample of 69 African-Americans, as well as meta-analysis combining both cohorts, was conducted. Two differentially methylated CpG sites in the IGF2BP1 gene on chromosome 17 (cg06638433; p value = 3.10 × 10 - 7 ) and the ABCG1 gene on chromosome 21 (cg06500161; p value = 2.60 × 10 - 8 ) were identified. Results for the ABCG1 gene remained statistically significant in the replication dataset and meta-analysis. Metabolic syndrome was consistently associated with increased methylation in the ABCG1 gene in the discovery and replication datasets, a gene that encodes a protein in the ATP-binding cassette transporter family and is involved in intra- and extra-cellular signaling and lipid transport.

DNA methylation array analysis identifies breast cancer associated RPTOR, MGRN1 and RAPSN hypomethylation in peripheral blood DNA.

PubMed

Tang, Qiuqiong; Holland-Letz, Tim; Slynko, Alla; Cuk, Katarina; Marme, Frederik; Schott, Sarah; Heil, Jörg; Qu, Bin; Golatta, Michael; Bewerunge-Hudler, Melanie; Sutter, Christian; Surowy, Harald; Wappenschmidt, Barbara; Schmutzler, Rita; Hoth, Markus; Bugert, Peter; Bartram, Claus R; Sohn, Christof; Schneeweiss, Andreas; Yang, Rongxi; Burwinkel, Barbara

2016-09-27

DNA methylation changes in peripheral blood DNA have been shown to be associated with solid tumors. We sought to identify methylation alterations in whole blood DNA that are associated with breast cancer (BC). Epigenome-wide DNA methylation profiling on blood DNA from BC cases and healthy controls was performed by applying Infinium HumanMethylation450K BeadChips. Promising CpG sites were selected and validated in three independent larger sample cohorts via MassARRAY EpiTyper assays. CpG sites located in three genes (cg06418238 in RPTOR, cg00736299 in MGRN1 and cg27466532 in RAPSN), which showed significant hypomethylation in BC patients compared to healthy controls in the discovery cohort (p < 1.00 x 10-6) were selected and successfully validated in three independent cohorts (validation I, n =211; validation II, n=378; validation III, n=520). The observed methylation differences are likely not cell-type specific, as the differences were only seen in whole blood, but not in specific sub cell-types of leucocytes. Moreover, we observed in quartile analysis that women in the lower methylation quartiles of these three loci had higher ORs than women in the higher quartiles. The combined AUC of three loci was 0.79 (95%CI 0.73-0.85) in validation cohort I, and was 0.60 (95%CI 0.54-0.66) and 0.62 (95%CI 0.57-0.67) in validation cohort II and III, respectively. Our study suggests that hypomethylation of CpG sites in RPTOR, MGRN1 and RAPSN in blood is associated with BC and might serve as blood-based marker supplements for BC if these could be verified in prospective studies.

Combined study of genetic and epigenetic biomarker risperidone treatment efficacy in Chinese Han schizophrenia patients

PubMed Central

Shi, Y; Li, M; Song, C; Xu, Q; Huo, R; Shen, L; Xing, Q; Cui, D; Li, W; Zhao, J; He, L; Qin, S

2017-01-01

Nowadays, risperidone is an atypical antipsychotic drug that has been increasingly used for treatment and maintenance therapy in schizophrenia. However, partially affected by genetic or environmental factors, there is significant difference in treatment outcomes among patients. In this study, we aimed to interpret the difference between good and poor responders treated with risperidone in both genetic and epigenetic levels in 288 mainland Chinese patients. We recruited a Henan cohort including 98 patients as initial discovery group and then confirmed our results in Shanghai cohort. In genetic studies, we found 10 candidate single-nucleotide polymorphisms (SNPs) and 2 rare variants in Henan cohort by next-generation sequencing of 100 risperidone-response-related genes. After replication in Shanghai cohort by massarray platform, ultimately, rs6706232 and rs4818 were significantly associated with risperidone response in the two cohort meta-analysis (P=0.024 and 0.04, respectively). Besides, we also selected another reported 17 candidate SNPs associated with risperidone drug response to replicate in our mainland Chinese samples, while, we found no significant SNPs after Bonferroni correction. In epigenetic studies, we investigated the methylation status in promoters or gene-coding region of risperidone drug response-related genes including CYP3A4, CYP2D6, ABCB1, HTR2A, DRD2. Totally we found seven significant CpG sites in the meta-analysis with Bonferroni-corrected PCYP3A4_CpG_-36=0.0014, PCYP3A4_CpG_-258=0.0013, PCYP3A4_CpG_-296=0.0014, PCYP3A4_CpG_-367:-372:-374=0.028, PCYP2D6_CpG_193=0.012, PCYP2D6_CpG_242:244:250=0.00076 and PCYP2D6_CpG_284=0.034, respectively. As genetic and epigenetic factors may interactively affect drug response, we finally carried out a multivariant interaction analysis with multifactor dimensionality reduction and discovered a significant four-locus model (CYP3A4_CpG_-82:-86 +rs6280+rs1800497+rs6265, P=0.038) affecting drug response. These findings could partially explain different risperidone response outcome in Chinese population in a systematic level. PMID:28696411

Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

PubMed

Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

2015-06-01

Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

Potential for diagnosis versus therapy monitoring of attention deficit hyperactivity disorder: a new epigenetic biomarker interacting with both genotype and auto-immunity.

PubMed

Adriani, Walter; Romano, Emilia; Pucci, Mariangela; Pascale, Esterina; Cerniglia, Luca; Cimino, Silvia; Tambelli, Renata; Curatolo, Paolo; Granstrem, Oleg; Maccarrone, Mauro; Laviola, Giovanni; D'Addario, Claudio

2018-02-01

In view of the need for easily accessible biomarkers, we evaluated in ADHD children the epigenetic status of the 5'-untranslated region (UTR) in the SLC6A3 gene, coding for human dopamine transporter (DAT). We analysed buccal swabs and sera from 30 children who met DSM-IV-TR criteria for ADHD, assigned to treatment according to severity. Methylation levels at six-selected CpG sites (among which, a CGGCGGCGG and a CGCG motif), alone or in combination with serum titers in auto-antibodies against dopamine transporter (DAT aAbs), were analysed for correlation with CGAS scores (by clinicians) and Conners' scales (by parents), collected at recruitment and after 6 weeks. In addition, we characterized the DAT genotype, i.e., the variable number tandem repeat (VNTR) polymorphisms at the 3'-UTR of the gene. DAT methylation levels were greatly reduced in ADHD patients compared to control, healthy children. Within patients carrying at least one DAT 9 allele (DAT 9/x), methylation at positions CpG2 and/or CpG6 correlated with recovery, as evident from delta-CGAS scores as well as delta Conners' scales ('inattentive' and 'hyperactive' subscales). Moreover, hypermethylation at CpG1 position denoted severity, specifically for those patients carrying a DAT 10/10 genotype. Intriguingly, high serum DAT-aAbs titers appeared to corroborate indications from high CpG1 versus high CpG2/CpG6 levels, likewise denoting severity versus recovery in DAT 10/10 versus 9/x patients, respectively. These profiles suggest that DAT 5'UTR epigenetics plus serum aAbs can serve as suitable biomarkers, to confirm ADHD diagnosis and/or to predict the efficacy of treatment.

Perception, attitude, and satisfaction of paediatric physicians and nurses towards clinical practice guidelines at a university teaching hospital.

PubMed

Amer, Yasser Sami; Al Nemri, Abdulrahman; Osman, Mohamed Elfaki; Saeed, Elshazaly; Assiri, Asaad Mohamed; Mohamed, Sarar

2018-04-03

To explore perception, attitude, and satisfaction of paediatric clinicians, trainees, and nurses at King Khalid University Hospital towards clinical practice guidelines (CPGs) including the locally adapted diabetic ketoacidosis CPG (DKA-CPG). A cross-sectional survey was distributed to 260 doctors and nurses working in the paediatrics department. The response rate was 95.4%. The respondents had a positive perception and attitude towards general CPGs and specifically for the DKA-CPG; 98.7% thought CPGs were useful sources of advice, improved safety, and decreased risk, and reduced variation in practice. A total of 99.2% thought CPGs were good clinical tools, 98.3% satisfied with, had confidence in well-developed CPGs, and would recommend them to their colleagues to use, and 94.6% agreed they were cost-effective. The preferred format for CPGs was paper (46.6%) and electronic (42.9%). The DKA-CPG helped in managing patients and respondents were all satisfied and had confidence with it (100%). The rationale and objectives of the DKA-CPG were clear for 99.25%; 98.5% thought the layout was clear and well organized and user-friendly (96.2%). Compared with nurses, physicians had a higher perception towards CPGs in general (P < .05) and the DKA-CPG (P < .05). The paediatric doctors, and nurses have a great perception and satisfaction and positive attitude towards CPGs in general, towards the paediatric diabetic ketoacidosis CPG in particular, which in turn had a positive impact on the acceptability and implementation of the CPGs. These findings could help in sustaining a safe and high-quality health care environment through implementation of evidence-based CPGs. © 2018 John Wiley & Sons, Ltd.

CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

PubMed

Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

2008-03-01

The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release

PubMed Central

Wang, Jun; Zhou, Hong; Zheng, Jiang; Cheng, Juan; Liu, Wei; Ding, Guofu; Wang, Liangxi; Luo, Ping; Lu, Yongling; Cao, Hongwei; Yu, Shuangjiang; Li, Bin; Zhang, Lezhi

2006-01-01

In the present study artemisinin (ART) was found to have potent anti-inflammatory effects in animal models of sepsis induced by CpG-containing oligodeoxy-nucleotides (CpG ODN), lipopolysaccharide (LPS), heat-killed Escherichia coli 35218 or live E. coli. Furthermore, we found that ART protected mice from a lethal challenge by CpG ODN, LPS, or heat-killed E. coli in a dose-dependent manner and that the protection was related to a reduction in serum tumor necrosis factor alpha (TNF-α). More significantly, the administration of ART together with ampicillin or unasyn (a complex of ampicillin and sulbactam) decreased mortality from 100 to 66.7% or 33.3%, respectively, in mice subjected to a lethal live E. coli challenge. Together with the observation that ART alone does not inhibit bacterial growth, this result suggests that ART protection is achieved as a result of its anti-inflammatory activity rather than an antimicrobial effect. In RAW264.7 cells, pretreatment with ART potently inhibited TNF-α and interleukin-6 release induced by CpG ODN, LPS, or heat-killed E. coli in a dose- and time-dependent manner. Experiments utilizing affinity sensor technology revealed no direct binding of ART with CpG ODN or LPS. Flow cytometry further showed that ART did not alter binding of CpG ODN to cell surfaces or the internalization of CpG ODN. In addition, upregulated levels of TLR9 and TLR4 mRNA were not attenuated by ART treatment. ART treatment did, however, block the NF-κB activation induced by CpG ODN, LPS, or heat-killed E. coli. These findings provide compelling evidence that ART may be an important potential drug for sepsis treatment. PMID:16801421

Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

PubMed

Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

2014-01-23

Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

Social Behavior of Pet Dogs Is Associated with Peripheral OXTR Methylation

PubMed Central

Cimarelli, Giulia; Virányi, Zsófia; Turcsán, Borbála; Rónai, Zsolt; Sasvári-Székely, Mária; Bánlaki, Zsófia

2017-01-01

Oxytocin is a key modulator of emotional processing and social cognitive function. In line with this, polymorphisms of genes involved in oxytocin signaling, like the oxytocin receptor (OXTR) gene, are known to influence social behavior in various species. However, to date, no study has investigated environmental factors possibly influencing the epigenetic variation of the OXTR gene and its behavioral effects in dogs. Pet dogs form individualized and strong relationships with their owners who are central figures in the social environment of their dogs and therefore might influence the methylation levels of their OXTR gene. Here we set out to investigate whether DNA methylation within the OXTR promoter region of pet dogs is linked to their owner’s interaction style and to the social behavior of the dogs. To be able to do so, we collected buccal epithelial cells and, in Study 1, we used pyrosequencing techniques to look for differentially methylated CpG sites in the canine OXTR promoter region on a heterogeneous sample of dogs and wolves of different ages and keeping conditions. Four identified sites (at positions -727, -751, -1371, and -1383 from transcription start site) showing more than 10% methylation variation were then, in Study 2, measured in triplicate in 217 pet Border Collies previously tested for reactions to an adverse social situation (i.e., approach by a threatening human) and with available data on their owners’ interaction styles. We found that CpG methylation was significantly associated with the behavior of the dogs, in particular with the likelihood that dogs would hide behind their owner or remain passive when approached by a threatening human. On the other hand, CpG methylation was not related to the owners’ behavior but to dog sex (at position -1371). Our findings underpin the complex relationship between epigenetics and behavior and highlight the importance of including epigenetic methods in the analysis of dog behavioral development. Further research is needed to investigate which environmental factors influence the epigenetic variation of the OXTR gene. PMID:28443051

Gene-Specific Differential DNA Methylation and Chronic Arsenic Exposure in an Epigenome-Wide Association Study of Adults in Bangladesh

PubMed Central

Argos, Maria; Chen, Lin; Jasmine, Farzana; Tong, Lin; Pierce, Brandon L.; Roy, Shantanu; Paul-Brutus, Rachelle; Gamble, Mary V.; Harper, Kristin N.; Parvez, Faruque; Rahman, Mahfuzar; Rakibuz-Zaman, Muhammad; Slavkovich, Vesna; Baron, John A.; Graziano, Joseph H.; Kibriya, Muhammad G.

2014-01-01

Background: Inorganic arsenic is one of the most common naturally occurring contaminants found in the environment. Arsenic is associated with a number of health outcomes, with epigenetic modification suggested as a potential mechanism of toxicity. Objective: Among a sample of 400 adult participants, we evaluated the association between arsenic exposure, as measured by blood and urinary total arsenic concentrations, and epigenome-wide white blood cell DNA methylation. Methods: We used linear regression models to examine the associations between arsenic exposure and methylation at each CpG site, adjusted for sex, age, and batch. Differentially methylated loci were subsequently examined in relation to corresponding gene expression for functional evidence of gene regulation. Results: In adjusted analyses, we observed four differentially methylated CpG sites with urinary total arsenic concentration and three differentially methylated CpG sites with blood arsenic concentration, based on the Bonferroni-corrected significance threshold of p < 1 × 10–7. Methylation of PLA2G2C (probe cg04605617) was the most significantly associated locus in relation to both urinary (p = 3.40 × 10–11) and blood arsenic concentrations (p = 1.48 × 10–11). Three additional novel methylation loci—SQSTM1 (cg01225779), SLC4A4 (cg06121226), and IGH (cg13651690)—were also significantly associated with arsenic exposure. Further, there was evidence of methylation-related gene regulation based on gene expression for a subset of differentially methylated loci. Conclusions: We observed significant associations between arsenic exposure and gene-specific differential white blood cell DNA methylation, suggesting that epigenetic modifications may be an important pathway underlying arsenic toxicity. The specific differentially methylated loci identified may inform potential pathways for future interventions. Citation: Argos M, Chen L, Jasmine F, Tong L, Pierce BL, Roy S, Paul-Brutus R, Gamble MV, Harper KN, Parvez F, Rahman M, Rakibuz-Zaman M, Slavkovich V, Baron JA, Graziano JH, Kibriya MG, Ahsan H. 2015. Gene-specific differential DNA methylation and chronic arsenic exposure in an epigenome-wide association study of adults in Bangladesh. Environ Health Perspect 123:64–71; http://dx.doi.org/10.1289/ehp.1307884 PMID:25325195

Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

PubMed

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

PubMed Central

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

PubMed

Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

2018-05-02

Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN–based vaginal microbicide

PubMed Central

Shen, Hong; Iwasaki, Akiko

2006-01-01

Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177

The contribution of a central pattern generator in a reflex-based neuromuscular model

PubMed Central

Dzeladini, Florin; van den Kieboom, Jesse; Ijspeert, Auke

2014-01-01

Although the concept of central pattern generators (CPGs) controlling locomotion in vertebrates is widely accepted, the presence of specialized CPGs in human locomotion is still a matter of debate. An interesting numerical model developed in the 90s’ demonstrated the important role CPGs could play in human locomotion, both in terms of stability against perturbations, and in terms of speed control. Recently, a reflex-based neuro-musculo-skeletal model has been proposed, showing a level of stability to perturbations similar to the previous model, without any CPG components. Although exhibiting striking similarities with human gaits, the lack of CPG makes the control of speed/step length in the model difficult. In this paper, we hypothesize that a CPG component will offer a meaningful way of controlling the locomotion speed. After introducing the CPG component in the reflex model, and taking advantage of the resulting properties, a simple model for gait modulation is presented. The results highlight the advantages of a CPG as feedforward component in terms of gait modulation. PMID:25018712

Genomic Distribution and Inter-Sample Variation of Non-CpG Methylation across Human Cell Types

PubMed Central

Liao, Jing; Zhang, Yingying; Gu, Hongcang; Bock, Christoph; Boyle, Patrick; Epstein, Charles B.; Bernstein, Bradley E.; Lengauer, Thomas; Gnirke, Andreas; Meissner, Alexander

2011-01-01

DNA methylation plays an important role in development and disease. The primary sites of DNA methylation in vertebrates are cytosines in the CpG dinucleotide context, which account for roughly three quarters of the total DNA methylation content in human and mouse cells. While the genomic distribution, inter-individual stability, and functional role of CpG methylation are reasonably well understood, little is known about DNA methylation targeting CpA, CpT, and CpC (non-CpG) dinucleotides. Here we report a comprehensive analysis of non-CpG methylation in 76 genome-scale DNA methylation maps across pluripotent and differentiated human cell types. We confirm non-CpG methylation to be predominantly present in pluripotent cell types and observe a decrease upon differentiation and near complete absence in various somatic cell types. Although no function has been assigned to it in pluripotency, our data highlight that non-CpG methylation patterns reappear upon iPS cell reprogramming. Intriguingly, the patterns are highly variable and show little conservation between different pluripotent cell lines. We find a strong correlation of non-CpG methylation and DNMT3 expression levels while showing statistical independence of non-CpG methylation from pluripotency associated gene expression. In line with these findings, we show that knockdown of DNMTA and DNMT3B in hESCs results in a global reduction of non-CpG methylation. Finally, non-CpG methylation appears to be spatially correlated with CpG methylation. In summary these results contribute further to our understanding of cytosine methylation patterns in human cells using a large representative sample set. PMID:22174693

Episodic swimming in the larval zebrafish is generated by a spatially distributed spinal network with modular functional organization

PubMed Central

Wiggin, Timothy D.; Anderson, Tatiana M.; Eian, John; Peck, Jack H.

2012-01-01

Despite the diverse methods vertebrates use for locomotion, there is evidence that components of the locomotor central pattern generator (CPG) are conserved across species. When zebrafish begin swimming early in development, they perform short episodes of activity separated by periods of inactivity. Within these episodes, the trunk flexes with side-to-side alternation and the traveling body wave progresses rostrocaudally. To characterize the distribution of the swimming CPG along the rostrocaudal axis, we performed transections of the larval zebrafish spinal cord and induced fictive swimming using N-methyl-d-aspartate (NMDA). In both intact and spinalized larvae, bursting is found throughout the rostrocaudal extent of the spinal cord, and the properties of fictive swimming observed were dependent on the concentration of NMDA. We isolated series of contiguous spinal segments by performing multiple spinal transections on the same larvae. Although series from all regions of the spinal cord have the capacity to produce bursts, the capacity to produce organized episodes of fictive swimming has a rostral bias: in the rostral spinal cord, only 12 contiguous body segments are necessary, whereas 23 contiguous body segments are necessary in the caudal spinal cord. Shorter series of segments were often active but produced either continuous rhythmic bursting or sporadic, nonrhythmic bursting. Both episodic and continuous bursting alternated between the left and right sides of the body and showed rostrocaudal progression, demonstrating the functional dissociation of the circuits responsible for episodic structure and fine burst timing. These findings parallel results in mammalian locomotion, and we propose a hierarchical model of the larval zebrafish swimming CPG. PMID:22572943

Genomic and oncogenic preference of HBV integration in hepatocellular carcinoma

PubMed Central

Zhao, Ling-Hao; Liu, Xiao; Yan, He-Xin; Li, Wei-Yang; Zeng, Xi; Yang, Yuan; Zhao, Jie; Liu, Shi-Ping; Zhuang, Xue-Han; Lin, Chuan; Qin, Chen-Jie; Zhao, Yi; Pan, Ze-Ya; Huang, Gang; Liu, Hui; Zhang, Jin; Wang, Ruo-Yu; Yang, Yun; Wen, Wen; Lv, Gui-Shuai; Zhang, Hui-Lu; Wu, Han; Huang, Shuai; Wang, Ming-Da; Tang, Liang; Cao, Hong-Zhi; Wang, Ling; Lee, Tin-Lap; Jiang, Hui; Tan, Ye-Xiong; Yuan, Sheng-Xian; Hou, Guo-Jun; Tao, Qi-Fei; Xu, Qin-Guo; Zhang, Xiu-Qing; Wu, Meng-Chao; Xu, Xun; Wang, Jun; Yang, Huan-Ming; Zhou, Wei-Ping; Wang, Hong-Yang

2016-01-01

Hepatitis B virus (HBV) can integrate into the human genome, contributing to genomic instability and hepatocarcinogenesis. Here by conducting high-throughput viral integration detection and RNA sequencing, we identify 4,225 HBV integration events in tumour and adjacent non-tumour samples from 426 patients with HCC. We show that HBV is prone to integrate into rare fragile sites and functional genomic regions including CpG islands. We observe a distinct pattern in the preferential sites of HBV integration between tumour and non-tumour tissues. HBV insertional sites are significantly enriched in the proximity of telomeres in tumours. Recurrent HBV target genes are identified with few that overlap. The overall HBV integration frequency is much higher in tumour genomes of males than in females, with a significant enrichment of integration into chromosome 17. Furthermore, a cirrhosis-dependent HBV integration pattern is observed, affecting distinct targeted genes. Our data suggest that HBV integration has a high potential to drive oncogenic transformation. PMID:27703150

Even-Skipped(+) Interneurons Are Core Components of a Sensorimotor Circuit that Maintains Left-Right Symmetric Muscle Contraction Amplitude.

PubMed

Heckscher, Ellie S; Zarin, Aref Arzan; Faumont, Serge; Clark, Matthew Q; Manning, Laurina; Fushiki, Akira; Schneider-Mizell, Casey M; Fetter, Richard D; Truman, James W; Zwart, Maarten F; Landgraf, Matthias; Cardona, Albert; Lockery, Shawn R; Doe, Chris Q

2015-10-21

Bilaterally symmetric motor patterns--those in which left-right pairs of muscles contract synchronously and with equal amplitude (such as breathing, smiling, whisking, and locomotion)--are widespread throughout the animal kingdom. Yet, surprisingly little is known about the underlying neural circuits. We performed a thermogenetic screen to identify neurons required for bilaterally symmetric locomotion in Drosophila larvae and identified the evolutionarily conserved Even-skipped(+) interneurons (Eve/Evx). Activation or ablation of Eve(+) interneurons disrupted bilaterally symmetric muscle contraction amplitude, without affecting the timing of motor output. Eve(+) interneurons are not rhythmically active and thus function independently of the locomotor CPG. GCaMP6 calcium imaging of Eve(+) interneurons in freely moving larvae showed left-right asymmetric activation that correlated with larval behavior. TEM reconstruction of Eve(+) interneuron inputs and outputs showed that the Eve(+) interneurons are at the core of a sensorimotor circuit capable of detecting and modifying body wall muscle contraction. Copyright © 2015 Elsevier Inc. All rights reserved.

Even-skipped+ interneurons are core components of a sensorimotor circuit that maintains left-right symmetric muscle contraction amplitude

PubMed Central

Heckscher, Ellie S.; Zarin, Aref Arzan; Faumont, Serge; Clark, Matthew Q.; Manning, Laurina; Fushiki, Akira; Schneider-Mizel, Casey M.; Fetter, Richard D.; Truman, James W.; Zwart, Maarten F.; Landgraf, Matthias; Cardona, Albert; Lockery, Shawn R.; Doe, Chris Q.

2015-01-01

Summary Bilaterally symmetric motor patterns—those in which left-right pairs of muscles contract synchronously and with equal amplitude (such as breathing, smiling, whisking, locomotion)—are widespread throughout the animal kingdom. Yet surprisingly little is known about the underlying neural circuits. We performed a thermogenetic screen to identify neurons required for bilaterally symmetric locomotion in Drosophila larvae, and identified the evolutionarily-conserved Even-skipped+ interneurons (Eve/Evx). Activation or ablation of Eve+ interneurons disrupted bilaterally symmetric muscle contraction amplitude, without affecting the timing of motor output. Eve+ interneurons are not rhythmically active, and thus function independently of the locomotor CPG. GCaMP6 calcium imaging of Eve+ interneurons in freely-moving larvae showed left-right asymmetric activation that correlated with larval behavior. TEM reconstruction of Eve+ interneuron inputs and outputs showed that the Eve+ interneurons are at the core of a sensorimotor circuit capable of detecting and modifying body wall muscle contraction. PMID:26439528

PHD Finger Recognition of Unmodified Histone H3R2 Links UHRF1 to Regulation of Euchromatic Gene Expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

E Rajakumara; Z Wang; H Ma

2011-12-31

Histone methylation occurs on both lysine and arginine residues, and its dynamic regulation plays a critical role in chromatin biology. Here we identify the UHRF1 PHD finger (PHD{sub UHRF1}), an important regulator of DNA CpG methylation, as a histone H3 unmodified arginine 2 (H3R2) recognition modality. This conclusion is based on binding studies and cocrystal structures of PHD{sub UHRF1} bound to histone H3 peptides, where the guanidinium group of unmodified R2 forms an extensive intermolecular hydrogen bond network, with methylation of H3R2, but not H3K4 or H3K9, disrupting complex formation. We have identified direct target genes of UHRF1 from microarraymore » and ChIP studies. Importantly, we show that UHRF1's ability to repress its direct target gene expression is dependent on PHD{sub UHRF1} binding to unmodified H3R2, thereby demonstrating the functional importance of this recognition event and supporting the potential for crosstalk between histone arginine methylation and UHRF1 function.« less

PHD Finger Recognition of Unmodified Histone H3R2 Links UHRF1 to Regulation of Euchromatic Gene Expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rajakumara, Eerappa; Wang, Zhentian; Ma, Honghui

2011-08-29

Histone methylation occurs on both lysine and arginine residues, and its dynamic regulation plays a critical role in chromatin biology. Here we identify the UHRF1 PHD finger (PHD{sub UHRF1}), an important regulator of DNA CpG methylation, as a histone H3 unmodified arginine 2 (H3R2) recognition modality. This conclusion is based on binding studies and cocrystal structures of PHD{sub UHRF1} bound to histone H3 peptides, where the guanidinium group of unmodified R2 forms an extensive intermolecular hydrogen bond network, with methylation of H3R2, but not H3K4 or H3K9, disrupting complex formation. We have identified direct target genes of UHRF1 from microarraymore » and ChIP studies. Importantly, we show that UHRF1's ability to repress its direct target gene expression is dependent on PHD{sub UHRF1} binding to unmodified H3R2, thereby demonstrating the functional importance of this recognition event and supporting the potential for crosstalk between histone arginine methylation and UHRF1 function.« less

Long noncoding RNA AB074169 inhibits cell proliferation via modulation of KHSRP-mediated p21 expression in papillary thyroid carcinoma.

PubMed

Gou, Qiheng; Gao, Linbo; Nie, Xinwen; Pu, Wenchen; Zhu, Jingqiang; Wang, Yichao; Liu, Xuesha; Tan, Shuangyan; Zhou, Jian-Kang; Gong, Yanqiu; He, Juan; Wu, Ke; Xie, Yuxin; Zhao, Wanjun; Dai, Lunzhi; Liu, Lunxu; Xiang, Rong; Wei, Yu-Quan; Zhang, Lin; Peng, Yong

2018-05-07

Long noncoding RNAs (lncRNAs) are emerging as a novel class of regulators in gene expression associated with tumorigenesis. However, the role of lncRNAs in papillary thyroid carcinoma (PTC) is poorly understood. Here we conducted global lncRNA profiling and identified lncRNA AB074169 (lncAB) as significantly downregulated in PTC. Decreased expression of lncAB in PTC was caused by CpG hypermethylation within its gene promoter. Functional studies showed that lncAB overexpression led to cell cycle arrest and tumor growth inhibition in vitro and in vivo, whereas lncAB knockdown promoted cell proliferation. Mechanistic analyses revealed that lncAB bound KH-type splicing regulatory protein (KHSRP) and also decreased expression of KHSRP, thus increasing CDKN1a (p21) expression and decreasing CDK2 expression to repress cell proliferation. Taken together, these findings demonstrate that lncAB functions as a tumor suppressor during PTC tumorigenesis. Copyright ©2018, American Association for Cancer Research.

Enhancement of anti-tumor effect of particulate vaccine delivery system by 'bacteriomimetic' CpG functionalization of poly-lactic-co-glycolic acid nanoparticles.

PubMed

Kokate, Rutika A; Thamake, Sanjay I; Chaudhary, Pankaj; Mott, Brittney; Raut, Sangram; Vishwanatha, Jamboor K; Jones, Harlan P

2015-01-01

Low immunogenicity remains a major obstacle in realizing the full potential of cancer vaccines. In this study, we evaluated CpG-coated tumor antigen (Tag)-encapsulating 'bacteriomimetic' nanoparticles (CpG-nanoparticle [NP]-Tag NPs) as an approach to enhance anti-tumor immunity. CpG-NP-Tag NPs were synthesized, characterized for their physicochemical properties and tested in vivo. We found CpG predosing followed by intraperitoneal (IP) immunization with CpG-NP-Tag NPs significantly attenuated tumor growth in female BALB/c mice compared with respective controls. Histopathological and Immunofluorescence data revealed CpG-NP-Tag tumors had lower proliferation, higher apoptotic activity, greater CD4(+) and CD8(+) T cell infiltration as well as higher IFN-γ levels as compared with control groups. Our findings suggest CpG-NP-Tag NPs can enhance anti-tumor effect of nanoparticulate tumor vaccination system.

[Vesicular and nonvesicular glutamate release in the nucleus accumbens during a forced switch in behavioral strategy].

PubMed

Saul'skaia, N B; Mikhaĭlova, M O

2004-01-01

By means of in vivo microdialysis combined with HPLC analysis, we have shown that glutamate extracellular level in the rat n. accumbens increases during a forced switch in behavioral strategy. When infused in the n. accumbens, a Na+ channel blocker tetrodotoxin (TTX, 1 microM) completely prevents this increase whereas a potent cystine/glutamate exchanger blocker (S)-4-carboxyphenylglycine ((S)-4-CPG, 5 microM) has no effect. In contrast, TT (1 microM), infused in the n. accumbens, fails to significantly alter basal level of extracellular glutamate in this region whereas (S)-4-CPG (5 microM) produced a significant decrease. Our data suggest that basal and factional glutamate releases in the n. accumbens are differently regulated. The source of basal glutamate release is a non-vesicular release via cystine/glutamate exchanger. Functional glutamate release observed during a forced switch in behavioral strategy derives from vesicular synaptic pool.

An XML-based system for the flexible classification and retrieval of clinical practice guidelines.

PubMed Central

Ganslandt, T.; Mueller, M. L.; Krieglstein, C. F.; Senninger, N.; Prokosch, H. U.

2002-01-01

Beneficial effects of clinical practice guidelines (CPGs) have not yet reached expectations due to limited routine adoption. Electronic distribution and reminder systems have the potential to overcome implementation barriers. Existing electronic CPG repositories like the National Guideline Clearinghouse (NGC) provide individual access but lack standardized computer-readable interfaces necessary for automated guideline retrieval. The aim of this paper was to facilitate automated context-based selection and presentation of CPGs. Using attributes from the NGC classification scheme, an XML-based metadata repository was successfully implemented, providing document storage, classification and retrieval functionality. Semi-automated extraction of attributes was implemented for the import of XML guideline documents using XPath. A hospital information system interface was exemplarily implemented for diagnosis-based guideline invocation. Limitations of the implemented system are discussed and possible future work is outlined. Integration of standardized computer-readable search interfaces into existing CPG repositories is proposed. PMID:12463831

Conformational characteristics of dimeric subunits of RNA from energy minimization studies. Mixed sugar-puckered ApG, ApU, CpG, and CpU.

PubMed

Thiyagarajan, P; Ponnuswamy, P K

1981-09-01

Following the procedure described in the preceding article, the low energy conformations located for the four dimeric subunits of RNA, ApG, ApU, CpG, and CpU are presented. The A-RNA type and Watson-Crick type helical conformations and a number of different kinds of loop promoting ones were identified as low energy in all the units. The 3E-3E and 3E-2E pucker sequences are found to be more or less equally preferred; the 2E-2E sequence is occasionally preferred, while the 2E-3E is highly prohibited in all the units. A conformation similar to the one observed in the drug-dinucleoside monophosphate complex crystals becomes a low energy case only for the CpG unit. The low energy conformations obtained for the four model units were used to assess the stability of the conformational states of the dinucleotide segments in the four crystal models of the tRNAPhe molecule. Information on the occurrence of the less preferred sugar-pucker sequences in the various loop regions in the tRNAPhe molecule has been obtained. A detailed comparison of the conformational characteristics of DNA and RNA subunits at the dimeric level is presented on the basis of the results.

Conformational characteristics of dimeric subunits of RNA from energy minimization studies. Mixed sugar-puckered ApG, ApU, CpG, and CpU.

PubMed Central

Thiyagarajan, P; Ponnuswamy, P K

1981-01-01

Following the procedure described in the preceding article, the low energy conformations located for the four dimeric subunits of RNA, ApG, ApU, CpG, and CpU are presented. The A-RNA type and Watson-Crick type helical conformations and a number of different kinds of loop promoting ones were identified as low energy in all the units. The 3E-3E and 3E-2E pucker sequences are found to be more or less equally preferred; the 2E-2E sequence is occasionally preferred, while the 2E-3E is highly prohibited in all the units. A conformation similar to the one observed in the drug-dinucleoside monophosphate complex crystals becomes a low energy case only for the CpG unit. The low energy conformations obtained for the four model units were used to assess the stability of the conformational states of the dinucleotide segments in the four crystal models of the tRNAPhe molecule. Information on the occurrence of the less preferred sugar-pucker sequences in the various loop regions in the tRNAPhe molecule has been obtained. A detailed comparison of the conformational characteristics of DNA and RNA subunits at the dimeric level is presented on the basis of the results. PMID:6168312

MMASS: an optimized array-based method for assessing CpG island methylation.

PubMed

Ibrahim, Ashraf E K; Thorne, Natalie P; Baird, Katie; Barbosa-Morais, Nuno L; Tavaré, Simon; Collins, V Peter; Wyllie, Andrew H; Arends, Mark J; Brenton, James D

2006-01-01

We describe an optimized microarray method for identifying genome-wide CpG island methylation called microarray-based methylation assessment of single samples (MMASS) which directly compares methylated to unmethylated sequences within a single sample. To improve previous methods we used bioinformatic analysis to predict an optimized combination of methylation-sensitive enzymes that had the highest utility for CpG-island probes and different methods to produce unmethylated representations of test DNA for more sensitive detection of differential methylation by hybridization. Subtraction or methylation-dependent digestion with McrBC was used with optimized (MMASS-v2) or previously described (MMASS-v1, MMASS-sub) methylation-sensitive enzyme combinations and compared with a published McrBC method. Comparison was performed using DNA from the cell line HCT116. We show that the distribution of methylation microarray data is inherently skewed and requires exogenous spiked controls for normalization and that analysis of digestion of methylated and unmethylated control sequences together with linear fit models of replicate data showed superior statistical power for the MMASS-v2 method. Comparison with previous methylation data for HCT116 and validation of CpG islands from PXMP4, SFRP2, DCC, RARB and TSEN2 confirmed the accuracy of MMASS-v2 results. The MMASS-v2 method offers improved sensitivity and statistical power for high-throughput microarray identification of differential methylation.

Association between DNA methylation in cord blood and maternal smoking: The Hokkaido Study on Environment and Children's Health.

PubMed

Miyake, Kunio; Kawaguchi, Akio; Miura, Ryu; Kobayashi, Sachiko; Tran, Nguyen Quoc Vuong; Kobayashi, Sumitaka; Miyashita, Chihiro; Araki, Atsuko; Kubota, Takeo; Yamagata, Zentaro; Kishi, Reiko

2018-04-04

Maternal smoking is reported to cause adverse effects on the health of the unborn child, the underlying mechanism for which is thought to involve alterations in DNA methylation. We examined the effects of maternal smoking on DNA methylation in cord blood, in 247 mother-infant pairs in the Sapporo cohort of the Hokkaido Study, using the Infinium HumanMethylation 450K BeadChip. We first identified differentially methylated CpG sites with a false discovery rate (FDR) of <0.05 and the magnitude of DNA methylation changes (|β| >0.02) from the pairwise comparisons of never-smokers (Ne-S), sustained-smokers (Su-S), and stopped-smokers (St-S). Subsequently, secondary comparisons between St-S and Su-S revealed nine common sites that mapped to ACSM3, AHRR, CYP1A1, GFI1, SHANK2, TRIM36, and the intergenic region between ANKRD9 and RCOR1 in Ne-S vs. Su-S, and one common CpG site mapping to EVC2 in Ne-S vs. St-S. Further, we verified these CpG sites and examined neighbouring sites using bisulfite next-generation sequencing, except for AHRR cg21161138. These changes in DNA methylation implicate the effect of smoking cessation. Our findings add to the current knowledge of the association between DNA methylation and maternal smoking and suggest future studies for clarifying this relationship in disease development.

Conflict of Interest Policies for Organizations Producing a Large Number of Clinical Practice Guidelines

PubMed Central

Norris, Susan L.; Holmer, Haley K.; Burda, Brittany U.; Ogden, Lauren A.; Fu, Rongwei

2012-01-01

Background Conflict of interest (COI) of clinical practice guideline (CPG) sponsors and authors is an important potential source of bias in CPG development. The objectives of this study were to describe the COI policies for organizations currently producing a significant number of CPGs, and to determine if these policies meet 2011 Institute of Medicine (IOM) standards. Methodology/Principal Findings We identified organizations with five or more guidelines listed in the National Guideline Clearinghouse between January 1, 2009 and November 5, 2010. We obtained the COI policy for each organization from publicly accessible sources, most often the organization's website, and compared those polices to IOM standards related to COI. 37 organizations fulfilled our inclusion criteria, of which 17 (46%) had a COI policy directly related to CPGs. These COI policies varied widely with respect to types of COI addressed, from whom disclosures were collected, monetary thresholds for disclosure, approaches to management, and updating requirements. Not one organization's policy adhered to all seven of the IOM standards that were examined, and nine organizations did not meet a single one of the standards. Conclusions/Significance COI policies among organizations producing a large number of CPGs currently do not measure up to IOM standards related to COI disclosure and management. CPG developers need to make significant improvements in these policies and their implementation in order to optimize the quality and credibility of their guidelines. PMID:22629391

Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer

DTIC Science & Technology

2012-09-01

tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another

DNA methylation levels at chromosome 8q24 in peripheral blood are associated with 8q24 cancer susceptibility loci.

PubMed

Barry, Kathryn Hughes; Moore, Lee E; Sampson, Joshua; Yan, Liying; Meyer, Ann; Oler, Andrew J; Chung, Charles C; Wang, Zhaoming; Yeager, Meredith; Amundadottir, Laufey; Berndt, Sonja I

2014-12-01

Chromosome 8q24 has emerged as an important region for genetic susceptibility to various cancers, but little is known about the contribution of DNA methylation at 8q24. To evaluate variability in DNA methylation levels at 8q24 and the relationship with cancer susceptibility single nucleotide polymorphisms (SNPs) in this region, we quantified DNA methylation levels in peripheral blood at 145 CpG sites nearby 8q24 cancer susceptibility SNPs or MYC using pyrosequencing among 80 Caucasian men in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. For the 60 CpG sites meeting quality control, which also demonstrated temporal stability over a 5-year period, we calculated pairwise Spearman correlations for DNA methylation levels at each CpG site with 42 8q24 cancer susceptibility SNPs. To account for multiple testing, we adjusted P values into q values reflecting the false discovery rate (FDR). In contrast to the MYC CpG sites, most sites nearby the SNPs demonstrated good reproducibility, high methylation levels, and moderate-high between-individual variation. We observed 10 statistically significant (FDR < 0.05) CpG site-SNP correlations. These included correlations between an intergenic CpG site at Chr8:128393157 and the prostate cancer SNP rs16902094 (ρ = -0.54; P = 9.7 × 10(-7); q = 0.002), a PRNCR1 CpG site at Chr8:128167809 and the prostate cancer SNP rs1456315 (ρ = 0.52; P = 1.4 × 10(-6); q = 0.002), and two POU5F1B CpG sites and several prostate/colorectal cancer SNPs (for Chr8:128498051 and rs6983267, ρ = 0.46; P = 2.0 × 10(-5); q = 0.01). This is the first report of correlations between blood DNA methylation levels and cancer susceptibility SNPs at 8q24, suggesting that DNA methylation at this important susceptibility locus may contribute to cancer risk. ©2014 American Association for Cancer Research.

Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

PubMed Central

Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

2012-01-01

Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

Hydrocarbon pyrolysis reactor experimentation and modeling for the production of solar absorbing carbon nanoparticles

NASA Astrophysics Data System (ADS)

Frederickson, Lee Thomas

Much of combustion research focuses on reducing soot particulates in emissions. However, current research at San Diego State University (SDSU) Combustion and Solar Energy Laboratory (CSEL) is underway to develop a high temperature solar receiver which will utilize carbon nanoparticles as a solar absorption medium. To produce carbon nanoparticles for the small particle heat exchange receiver (SPHER), a lab-scale carbon particle generator (CPG) has been built and tested. The CPG is a heated ceramic tube reactor with a set point wall temperature of 1100-1300°C operating at 5-6 bar pressure. Natural gas and nitrogen are fed to the CPG where natural gas undergoes pyrolysis resulting in carbon particles. The gas-particle mixture is met downstream with dilution air and sent to the lab scale solar receiver. To predict soot yield and general trends in CPG performance, a model has been setup in Reaction Design CHEMKIN-PRO software. One of the primary goals of this research is to accurately measure particle properties. Mean particle diameter, size distribution, and index of refraction are calculated using Scanning Electron Microscopy (SEM) and a Diesel Particulate Scatterometer (DPS). Filter samples taken during experimentation are analyzed to obtain a particle size distribution with SEM images processed in ImageJ software. These results are compared with the DPS, which calculates the particle size distribution and the index of refraction from light scattering using Mie theory. For testing with the lab scale receiver, a particle diameter range of 200-500 nm is desired. Test conditions are varied to understand effects of operating parameters on particle size and the ability to obtain the size range. Analysis of particle loading is the other important metric for this research. Particle loading is measured downstream of the CPG outlet and dilution air mixing point. The air-particle mixture flows through an extinction tube where opacity of the mixture is measured with a 532 nm laser and detector. Beer's law is then used to calculate particle loading. The CPG needs to produce a certain particle loading for a corresponding receiver test. By obtaining the particle loading in the system, the reaction conversion to solid carbon in the CPG can be calculated to measure the efficiency of the CPG. To predict trends in reaction conversion and particle size from experimentation, the CHEMKIN-PRO computer model for the CPG is run for various flow rates and wall temperature profiles. These predictions were a reason for testing at higher wall set point temperatures. Based on these research goals, it was shown that the CPG consistently produces a mean particle diameter of 200-400 nm at the conditions tested, fitting perfectly inside the desired range. This led to successful lab scale SPHER testing which produced a 10-point efficiency increase and 150°C temperature difference with particles present. Also, at 3 g/s dilution air flow rate, an efficiency of 80% at an outlet temperature above 800°C was obtained. Promise was shown at higher CPG experimental temperatures to produce higher reaction conversion, both experimentally and in the model. However, based on wall temperature data taken during experimentation, it is apparent that the CPG needs to have multiple heating zones with separate temperature controllers in order to have an isothermal zone rather than a parabolic temperature profile. As for the computer model, it predicted much higher reaction conversion at higher temperature. The mass fraction of fuel in the inlet stream was shown to not affect conversion while increasing residence time led to increasing conversion. Particle size distribution in the model was far off and showed a bimodal distribution for one of the statistical methods. Using the results from experimentation and modeling, a preliminary CPG design is presented that will operate in a 5MWth receiver system.

Targeting Stat3 in the myeloid compartment drastically improves the in vivo antitumor functions of adoptively transferred T cells

PubMed Central

Herrmann, Andreas; Kortylewski, Marcin; Kujawski, Maciej; Zhang, Chunyan; Reckamp, Karen; Armstrong, Brian; Wang, Lin; Kowolik, Claudia; Deng, Jiehui; Robert, Figlin; Yu, Hua

2010-01-01

Improving effector T cell functions is highly desirable for preventive or therapeutic interventions of diverse diseases. Stat3 in the myeloid compartment constrains Th-1 type immunity, dampening natural and induced antitumor immune responses. We have recently developed an in vivo siRNA delivery platform by conjugating a TLR9 agonist with siRNA that efficiently targets myeloid and B cells. Here we show that either ablating the Stat3 alleles in the myeloid compartment and B cells combined with CpG triggering or administrating the CpG-Stat3siRNA conjugates drastically augments effector functions of adoptively transferred CD8+ T cells. Specifically, we demonstrate that both approaches are capable of increasing dendritic cell and CD8+ T cell engagement in tumor draining lymph nodes. Furthermore, both approaches can significantly activate the transferred CD8+ T cells in vivo, upregulating effector molecules such as perforin, granzyme B and IFN-γ. Intravital multiphoton microscopy reveals that Stat3 silencing combined with CpG triggering greatly increases killing activity and tumor infiltration of transferred T cells. These results suggest the use of CpG-Stat3siRNA, and possibly other Stat3 inhibitors, as a potent adjuvant to improve T cell therapies. PMID:20841481

Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum

PubMed Central

Song, Xiaowen; Huang, Fei; Liu, Juanjuan; Li, Chengjun; Gao, Shanshan; Wu, Wei; Zhai, Mengfan; Yu, Xiaojuan; Xiong, Wenfeng; Xie, Jia

2017-01-01

Abstract Cytosine DNA methylation is a vital epigenetic regulator of eukaryotic development. Whether this epigenetic modification occurs in Tribolium castaneum has been controversial, its distribution pattern and functions have not been established. Here, using bisulphite sequencing (BS-Seq), we confirmed the existence of DNA methylation and described the methylation profiles of the four life stages of T. castaneum. In the T. castaneum genome, both symmetrical CpG and non-CpG methylcytosines were observed. Symmetrical CpG methylation, which was catalysed by DNMT1 and occupied a small part in T. castaneum methylome, was primarily enriched in gene bodies and was positively correlated with gene expression levels. Asymmetrical non-CpG methylation, which was predominant in the methylome, was strongly concentrated in intergenic regions and introns but absent from exons. Gene body methylation was negatively correlated with gene expression levels. The distribution pattern and functions of this type of methylation were similar only to the methylome of Drosophila melanogaster, which further supports the existence of a novel methyltransferase in the two species responsible for this type of methylation. This first life-cycle methylome of T. castaneum reveals a novel and unique methylation pattern, which will contribute to the further understanding of the variety and functions of DNA methylation in eukaryotes. PMID:28449092

10 kW SOFC Power System Commercialization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dan Norrick; Brad Palmer; Charles Vesely

2006-02-01

Cummins Power Generation (CPG) as the prime contractor and SOFCo-EFS Holdings LLC (SOFCo), as their subcontractor, teamed under the Solid-state Energy Conversion Alliance (SECA) program to develop 3-10kW solid oxide fuel cell systems for use in recreational vehicles, commercial work trucks and stand-by telecommunications applications. The program goal is demonstration of power systems that meet commercial performance requirements and can be produced in volume at a cost of $400/kW. This report summarizes the team's activities during the seventh six-month period (July-December 2005) of the four-year Phase I effort. While there has been significant progress in the development of the SOFCmore » subsystems that can support meeting the program Phase 1 goals, the SOFCo ceramic stack technology has progressed significantly slower than plan and CPG consider it unlikely that the systemic problems encountered will be overcome in the near term. SOFCo has struggled with a series of problems associated with inconsistent manufacturing, inadequate cell performance, and the achievement of consistent, durable, low resistance inter-cell connections with reduced or no precious materials. A myriad of factors have contributed to these problems, but the fact remains that progress has not kept pace with the SECA program. A contributing factor in SOFCo's technical difficulties is attributed to their significantly below plan industry cost share spending over the last four years. This has resulted in a much smaller SOFC stack development program, has contributed to SOFCo not being able to aggressively resolve core issues, and clouds their ability to continue into a commercialization phase. In view of this situation, CPG has conducted an independent assessment of the state-of-the-art in planar SOFC's stacks and have concluded that alternative technology exists offering the specific performance, durability, and low cost needed to meet the SECA objectives. We have further concluded that there is insufficient evidence to reliably predict that SOFCo will be able to achieve the SECA performance and cost goals on a schedule consistent with SECA or CPG commercialization goals. CPG believes SOFCo have made a good faith effort consistent with the available resources, but have repeatedly fallen short of achieving the programs scheduled targets. CPG has therefore initiated a process of application for extension of Phase 1 of our SECA program with the intent of transitioning to an alternative stack supplier with more mature SOFC technology, and demonstrating a system meeting the SECA Phase 1 goals by the end of calendar 2006. We have identified an alternative supplier and will be reporting the progress on transition and program planning in monthly technical reports, reviews, and in the next semiannual report.« less

Extending antigen release from particulate vaccines results in enhanced antitumor immune response.

PubMed

Kapadia, Chintan H; Tian, Shaomin; Perry, Jillian L; Sailer, David; Christopher Luft, J; DeSimone, Joseph M

2018-01-10

Tumor-specific CD8 + cytotoxic T lymphocytes (CTLs) play a critical role in an anti-tumor immune response. However, vaccination intended to elicit a potent CD8 + T cell responses employing tumor-associated peptide antigens, are typically ineffective due to poor immunogenicity. Previously, we engineered a polyethylene glycol (PEG) hydrogel-based subunit vaccine for the delivery of an antigenic peptide and CpG (adjuvant) to elicit potent CTLs. In this study, we further examined the effect of antigen release kinetics on their induced immune responses. A CD8 + T cell epitope peptide from OVA (CSIINFEKL) and CpG were co-conjugated to nanoparticles utilizing either a disulfide or a thioether linkage. Subsequent studies comparing peptide release rates as a function of linker, determined that the thioether linkage provided sustained release of peptide over 72h. Ability to control the release of peptide resulted in both higher and prolonged antigen presentation when compared to disulfide-linked peptide. Both NP vaccine formulations resulted in activation and maturation of bone marrow derived dendritic cells (BMDCs) and induced potent CD8 + T cell responses when compared to soluble antigen and soluble CpG. Immunization with either disulfide or thioether linked vaccine constructs effectively inhibited EG7-OVA tumor growth in mice, however only treatment with the thioether linked vaccine construct resulted in enhanced survival. Copyright © 2017. Published by Elsevier B.V.

Aging as an Epigenetic Phenomenon

PubMed Central

Ashapkin, Vasily V.; Kutueva, Lyudmila I.; Vanyushin, Boris F.

2017-01-01

Introduction: Hypermethylation of genes associated with promoter CpG islands, and hypomethylation of CpG poor genes, repeat sequences, transposable elements and intergenic genome sections occur during aging in mammals. Methylation levels of certain CpG sites display strict correlation to age and could be used as “epigenetic clock” to predict biological age. Multi-substrate deacetylases SIRT1 and SIRT6 affect aging via locus-specific modulations of chromatin structure and activity of multiple regulatory proteins involved in aging. Random errors in DNA methylation and other epigenetic marks during aging increase the transcriptional noise, and thus lead to enhanced phenotypic variation between cells of the same tissue. Such variation could cause progressive organ dysfunction observed in aged individuals. Multiple experimental data show that induction of NF-κB regulated gene sets occurs in various tissues of aged mammals. Upregulation of multiple miRNAs occurs at mid age leading to downregulation of enzymes and regulatory proteins involved in basic cellular functions, such as DNA repair, oxidative phosphorylation, intermediate metabolism, and others. Conclusion: Strong evidence shows that all epigenetic systems contribute to the lifespan control in various organisms. Similar to other cell systems, epigenome is prone to gradual degradation due to the genome damage, stressful agents, and other aging factors. But unlike mutations and other kinds of the genome damage, age-related epigenetic changes could be fully or partially reversed to a “young” state. PMID:29081695

Year 2000 (Y2K) computer compliance guide; guidance for FDA personnel. Food and Drug Administration. Notice.

PubMed

1999-05-14

The Food and Drug Administration (FDA) is announcing the availability of a new compliance policy guide (CPG) entitled "Year 2000 (Y2K) Computer Compliance" (section 160-800). This guidance document represents the agency's current thinking on the manufacturing and distribution of domestic and imported products regulated by FDA using computer systems that may not perform properly before, or during, the transition to the year 2000 (Y2K). The text of the CPG is included in this notice. This compliance guidance document is an update to the Compliance Policy Guides Manual (August 1996 edition). It is a new CPG, and it will be included in the next printing of the Compliance Policy Guides Manual. This CPG is intended for FDA personnel, and it is available electronically to the public.

CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.

PubMed

Liu, Chengju; Chen, Qijun; Wang, Danwei

2011-06-01

This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.

CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

PubMed

Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

2016-02-08

Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

PubMed Central

Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

2017-01-01

In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979

The role of system Xc- in methamphetamine-induced dopaminergic neurotoxicity in mice.

PubMed

Dang, Duy-Khanh; Shin, Eun-Joo; Tran, Hai-Quyen; Kim, Dae-Joong; Jeong, Ji Hoon; Jang, Choon-Gon; Nah, Seung-Yeol; Sato, Hideyo; Nabeshima, Toshitaka; Yoneda, Yukio; Kim, Hyoung-Chun

2017-09-01

The cystine/glutamate antiporter (system Xc - , Sxc) transports cystine into cell in exchange for glutamate. Since xCT is a specific subunit of Sxc, we employed xCT knockout mice and investigated whether this antiporter affected methamphetamine (MA)-induced dopaminergic neurotoxicity. MA treatment significantly increased striatal oxidative burdens in wild type mice. xCT inhibitor [i.e., S-4-carboxy-phenylglycine (CPG), sulfasalazine] or an xCT knockout significantly protected against these oxidative burdens. MA-induced increases in Iba-1 expression and Iba-1-labeled microglial immunoreactivity (Iba-1-IR) were significantly attenuated by CPG or sulfasalazine administration or xCT knockout. CPG or sulfasalazine significantly attenuated MA-induced TUNEL-positive cell populations in the striatum of Taconic ICR mice. The decrease in excitatory amino acid transporter-2 (or glutamate transporter-1) expression and increase in glutamate release were attenuated by CPG, sulfasalazine or xCT knockout. In addition, CPG, sulfasalazine or xCT knockout significantly protected against dopaminergic loss (i.e., decreases in tyrosine hydroxylase expression and immunoreactivity, and an increase in dopamine turnover rate) induced by MA. However, CPG, sulfasalazine or xCT knockout did not significantly affect the impaired glutathione system [i.e., decrease in reduced glutathione (GSH) and increase in oxidized glutathione (GSSG)] induced by MA. Our results suggest that Sxc mediates MA-induced neurotoxicity via facilitating oxidative stress, microgliosis, proapoptosis, and glutamate-related toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mitochondrial role in ischemia-reperfusion of rat hearts exposed to high-K+ cardioplegia and clonazepam: energetic and contractile consequences.

PubMed

Consolini, A E; Ragone, M I; Conforti, P; Volonté, M G

2007-05-01

The role of the mitochondrial Na/Ca-exchanger (mNCX) in hearts exposed to ischemia-reperfusion (I/R) and pretreated with cardioplegia (CPG) was studied from a mechano-calorimetric approach. No-flow ischemia (ISCH) and reperfusion (REP) were developed in isolated rat hearts pretreated with 10 micromol/L clonazepam (CLZP), an inhibitor of the mNCX, and (or) a high K+ - low Ca2+ solution (CPG). Left ventricular end diastolic pressure (LVEDP), pressure development during beats (P), and the steady heat release (Ht) were continuously measured and muscle contents of ATP and PCr were analyzed at the end of REP. During REP, Ht increased more than P, reducing muscle economy (P/Ht) and the ATP content. CPG induced an increase in P recovery during REP (to 90% +/- 10% of preISCH) with respect to nonpretreated hearts (control, C, to 64% +/- 10%, p < 0.05). In contrast, CLZP reduced P recovery of CPG-hearts (50% +/- 6.4%, p < 0.05) and increased LVEDP in C hearts. To evaluate effects on sarcoplasmic reticulum (SR) function, ischemic hearts were reperfused with 10 mmol/L caffeine -36 mmol/L Na (C - caff - low Na). It increased LVEDP, which afterwards slowly relaxed, whereas Ht increased (by about 6.5 mW/g). CLZP sped up the relaxation with higher DeltaHt, C - caff - low Na produced higher contracture and lower Ht in perfused than in ischemic hearts. Values of DeltaHt were compared with reported fluxes of Ca2+-transporters, suggesting that mitochondria may be in part responsible for the DeltaHt during C - caff - low Na REP. Results suggest that ISCH-REP reduced the SR store for the recovery of contractility, but induced Ca2+ movement from the mitochondria to the SR stores. Also, mitochondria and SR are able to remove cytosolic Ca2+ during overloads (as under caffeine), through the mNCX and the uniporter. CPG increases Ca2+ cycling from mitochondria to the SR, which contributes to the higher recovery of P. In contrast, CLZP produces a deleterious effect on ISCH-REP associated with higher heat release and reduced resynthesis of high energy phosphates, which suggests the induction of mitochondrial Ca cycling and uncoupling.

CNVs affecting cancer predisposing genes (CPGs) detected as incidental findings in routine germline diagnostic chromosomal microarray (CMA) testing.

PubMed

Innes, Josie; Reali, Lisa; Clayton-Smith, Jill; Hall, Georgina; Lim, Derek Hk; Burghel, George J; French, Kim; Khan, Unzela; Walker, Daniel; Lalloo, Fiona; Evans, D Gareth R; McMullan, Dominic; Maher, Eamonn R; Woodward, Emma R

2018-02-01

Identification of CNVs through chromosomal microarray (CMA) testing is the first-line investigation in individuals with learning difficulties/congenital abnormalities. Although recognised that CMA testing may identify CNVs encompassing a cancer predisposition gene (CPG), limited information is available on the frequency and nature of such results. We investigated CNV gains and losses affecting 39 CPGs in 3366 pilot index case individuals undergoing CMA testing, and then studied an extended cohort (n=10 454) for CNV losses at 105 CPGs and CNV gains at 9 proto-oncogenes implicated in inherited cancer susceptibility. In the pilot cohort, 31/3366 (0.92%) individuals had a CNV involving one or more of 16/39 CPGs. 30/31 CNVs involved a tumour suppressor gene (TSG), and 1/30 a proto-oncogene (gain of MET ). BMPR1A , TSC2 and TMEM127 were affected in multiple cases. In the second stage analysis, 49/10 454 (0.47%) individuals in the extended cohort had 50 CNVs involving 24/105 CPGs. 43/50 CNVs involved a TSG and 7/50 a proto-oncogene (4 gains, 3 deletions). The most frequently involved genes, FLCN (n=10) and SDHA (n=7), map to the Smith-Magenis and cri-du-chat regions, respectively. Incidental identification of a CNV involving a CPG is not rare and poses challenges for future cancer risk estimation. Prospective data collection from CPG-CNV cohorts ascertained incidentally and through syndromic presentations is required to determine the risks posed by specific CNVs. In particular, ascertainment and investigation of adults with CPG-CNVs and adults with learning disability and cancer, could provide important information to guide clinical management and surveillance. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Neuronal activity in the isolated mouse spinal cord during spontaneous deletions in fictive locomotion: insights into locomotor central pattern generator organization

PubMed Central

Zhong, Guisheng; Shevtsova, Natalia A; Rybak, Ilya A; Harris-Warrick, Ronald M

2012-01-01

We explored the organization of the spinal central pattern generator (CPG) for locomotion by analysing the activity of spinal interneurons and motoneurons during spontaneous deletions occurring during fictive locomotion in the isolated neonatal mouse spinal cord, following earlier work on locomotor deletions in the cat. In the isolated mouse spinal cord, most spontaneous deletions were non-resetting, with rhythmic activity resuming after an integer number of cycles. Flexor and extensor deletions showed marked asymmetry: flexor deletions were accompanied by sustained ipsilateral extensor activity, whereas rhythmic flexor bursting was not perturbed during extensor deletions. Rhythmic activity on one side of the cord was not perturbed during non-resetting spontaneous deletions on the other side, and these deletions could occur with no input from the other side of the cord. These results suggest that the locomotor CPG has a two-level organization with rhythm-generating (RG) and pattern-forming (PF) networks, in which only the flexor RG network is intrinsically rhythmic. To further explore the neuronal organization of the CPG, we monitored activity of motoneurons and selected identified interneurons during spontaneous non-resetting deletions. Motoneurons lost rhythmic synaptic drive during ipsilateral deletions. Flexor-related commissural interneurons continued to fire rhythmically during non-resetting ipsilateral flexor deletions. Deletion analysis revealed two classes of rhythmic V2a interneurons. Type I V2a interneurons retained rhythmic synaptic drive and firing during ipsilateral motor deletions, while type II V2a interneurons lost rhythmic synaptic input and fell silent during deletions. This suggests that the type I neurons are components of the RG, whereas the type II neurons are components of the PF network. We propose a computational model of the spinal locomotor CPG that reproduces our experimental results. The results may provide novel insights into the organization of spinal locomotor networks. PMID:22869012

Construction and characterization of normalized cDNA libraries by 454 pyrosequencing and estimation of DNA methylation levels in three distantly related termite species.

PubMed

Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

2013-01-01

In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti, Reticulitermes speratus and Nasutitermes takasagoensis. We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H. sjostedti library, while all except dnmt3 were found in R. speratus and N. takasagoensis. The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation.

Construction and Characterization of Normalized cDNA Libraries by 454 Pyrosequencing and Estimation of DNA Methylation Levels in Three Distantly Related Termite Species

PubMed Central

Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

2013-01-01

In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti , Reticulitermessperatus and Nasutitermestakasagoensis . We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H . sjostedti library, while all except dnmt3 were found in R . speratus and N . takasagoensis . The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation. PMID:24098800

DNA methylation profiles of ovarian epithelial carcinoma tumors and cell lines.

PubMed

Houshdaran, Sahar; Hawley, Sarah; Palmer, Chana; Campan, Mihaela; Olsen, Mari N; Ventura, Aviva P; Knudsen, Beatrice S; Drescher, Charles W; Urban, Nicole D; Brown, Patrick O; Laird, Peter W

2010-02-22

Epithelial ovarian carcinoma is a significant cause of cancer mortality in women worldwide and in the United States. Epithelial ovarian cancer comprises several histological subtypes, each with distinct clinical and molecular characteristics. The natural history of this heterogeneous disease, including the cell types of origin, is poorly understood. This study applied recently developed methods for high-throughput DNA methylation profiling to characterize ovarian cancer cell lines and tumors, including representatives of three major histologies. We obtained DNA methylation profiles of 1,505 CpG sites (808 genes) in 27 primary epithelial ovarian tumors and 15 ovarian cancer cell lines. We found that the DNA methylation profiles of ovarian cancer cell lines were markedly different from those of primary ovarian tumors. Aggregate DNA methylation levels of the assayed CpG sites tended to be higher in ovarian cancer cell lines relative to ovarian tumors. Within the primary tumors, those of the same histological type were more alike in their methylation profiles than those of different subtypes. Supervised analyses identified 90 CpG sites (68 genes) that exhibited 'subtype-specific' DNA methylation patterns (FDR<1%) among the tumors. In ovarian cancer cell lines, we estimated that for at least 27% of analyzed autosomal CpG sites, increases in methylation were accompanied by decreases in transcription of the associated gene. The significant difference in DNA methylation profiles between ovarian cancer cell lines and tumors underscores the need to be cautious in using cell lines as tumor models for molecular studies of ovarian cancer and other cancers. Similarly, the distinct methylation profiles of the different histological types of ovarian tumors reinforces the need to treat the different histologies of ovarian cancer as different diseases, both clinically and in biomarker studies. These data provide a useful resource for future studies, including those of potential tumor progenitor cells, which may help illuminate the etiology and natural history of these cancers.

Developing prehospital clinical practice guidelines for resource limited settings: why re-invent the wheel?

PubMed

McCaul, Michael; de Waal, Ben; Hodkinson, Peter; Pigoga, Jennifer L; Young, Taryn; Wallis, Lee A

2018-02-05

Methods on developing new (de novo) clinical practice guidelines (CPGs) have received substantial attention. However, the volume of literature is not matched by research into alternative methods of CPG development using existing CPG documents-a specific issue for guideline development groups in low- and middle-income countries. We report on how we developed a context specific prehospital CPG using an alternative guideline development method. Difficulties experienced and lessons learnt in applying existing global guidelines' recommendations to a national context are highlighted. The project produced the first emergency care CPG for prehospital providers in Africa. It included > 270 CPGs and produced over 1000 recommendations for prehospital emergency care. We encountered various difficulties, including (1) applicability issues: few pre-hospital CPGs applicable to Africa, (2) evidence synthesis: heterogeneous levels of evidence classifications and (3) guideline quality. Learning points included (1) focusing on key CPGs and evidence mapping, (2) searching other resources for CPGs, (3) broad representation on CPG advisory boards and (4) transparency and knowledge translation. Re-inventing the wheel to produce CPGs is not always feasible. We hope this paper will encourage further projects to use existing CPGs in developing guidance to improve patient care in resource-limited settings.

Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

PubMed

Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

2012-05-01

Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

Simulation design of high reverse blocking high-K/low-K compound passivation AlGaN/GaN Schottky barrier diode with gated edge termination

NASA Astrophysics Data System (ADS)

Bai, Zhiyuan; Du, Jiangfeng; Xin, Qi; Li, Ruonan; Yu, Qi

2017-11-01

In this paper, a novel high-K/low-K compound passivation AlGaN/GaN Schottky Barrier Diode (CPG-SBD) is proposed to improve the off-state characteristics of AlGaN/GaN schottky barrier diode with gated edge termination (GET-SBD) by adding low-K blocks in to the high-K passivation layer. The reverse leakage current of CPG-SBD can be reduced to 1.6 nA/mm by reducing the thickness of high-K dielectric under GET region to 5 nm, while the forward voltage and on-state resistance keep 1 V and 3.8 Ω mm, respectively. Breakdown voltage of CPG-SBDs can be improved by inducing discontinuity of the electric field at the high-K/low-K interface. The breakdown voltage of the optimized CPG-SBD with 4 blocks of low-K can reach 1084 V with anode to cathode distance of 5 μm yielding a high FOM of 5.9 GW/cm2. From the C-V simulation results, CPG-SBDs induce no parasitic capacitance by comparison of the GET-SBDs.

Hypermethylation of brain natriuretic peptide gene is associated with the risk of rheumatic heart disease

PubMed Central

Li, Ni; Zheng, Dawei; Sun, Lebo; Shi, Huoshun; Zhu, Xiuying; Xu, Guodong; Wang, Qinning; Zhu, Caimin

2016-01-01

To investigate the contribution of brain natriuretic peptide (BNP) promoter DNA methylation to the risk of rheumatic heart disease (RHD) and the influence of warfarin anticoagulant therapy on BNP methylation levels for RHD patients after surgery. BNP methylation levels were determined by bisulfite pyrosequencing from plasma samples of RHD patients compared with healthy controls. Several factors influencing the RHD patients were included like age, smoking and cholesterol levels. A fragment of five CG sites (CpG1–5) in the promoter region of BNP gene was measured. BNP gene hypermethylation was found in CpG4 and CpG5 in RHD patients compared with non-RHD controls. A significant difference was also observed between RHD patients with long-term administration of warfarin and RHD patients who had recently undergone an operation. Moreover, single CpG4 and CpG5 analysis revealed a significant increase in methylation levels in men. BNP gene body hypermethylation is associated with the risk of RHD, and also influenced by the warfarin anticoagulant therapy of RHD patients after surgery, which could represent novel and promising targets for therapeutic development. PMID:27920275

Compositional searching of CpG islands in the human genome

NASA Astrophysics Data System (ADS)

Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

2005-06-01

We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

Trichloroethylene-induced alterations in DNA methylation were enriched in polycomb protein binding sites in effector/memory CD4+ T cells

PubMed Central

Gilbert, Kathleen M.; Blossom, Sarah J.; Reisfeld, Brad; Erickson, Stephen W.; Vyas, Kanan; Maher, Mary; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A.; Bhattacharyya, Sudeepa

2017-01-01

Abstract Exposure to industrial solvent and water pollutant trichloroethylene (TCE) can promote autoimmunity, and expand effector/memory (CD62L) CD4+ T cells. In order to better understand etiology reduced representation bisulfite sequencing was used to study how a 40-week exposure to TCE in drinking water altered methylation of ∼337 770 CpG sites across the entire genome of effector/memory CD4+ T cells from MRL+/+ mice. Regardless of TCE exposure, 62% of CpG sites in autosomal chromosomes were hypomethylated (0–15% methylation), and 25% were hypermethylated (85–100% methylation). In contrast, only 6% of the CpGs on the X chromosome were hypomethylated, and 51% had mid-range methylation levels. In terms of TCE impact, TCE altered (≥ 10%) the methylation of 233 CpG sites in effector/memory CD4+ T cells. Approximately 31.7% of these differentially methylated sites occurred in regions known to bind one or more Polycomb group (PcG) proteins, namely Ezh2, Suz12, Mtf2 or Jarid2. In comparison, only 23.3% of CpG sites not differentially methylated by TCE were found in PcG protein binding regions. Transcriptomics revealed that TCE altered the expression of ∼560 genes in the same effector/memory CD4+ T cells. At least 80% of the immune genes altered by TCE had binding sites for PcG proteins flanking their transcription start site, or were regulated by other transcription factors that were in turn ordered by PcG proteins at their own transcription start site. Thus, PcG proteins, and the differential methylation of their binding sites, may represent a new mechanism by which TCE could alter the function of effector/memory CD4+ T cells. PMID:29129997

Asymmetric Operation of the Locomotor Central Pattern Generator in the Neonatal Mouse Spinal Cord

PubMed Central

Endo, Toshiaki; Kiehn, Ole

2008-01-01

The rhythmic voltage oscillations in motor neurons (MNs) during locomotor movements reflect the operation of the pre-MN central pattern generator (CPG) network. Recordings from MNs can thus be used as a method to deduct the organization of CPGs. Here, we use continuous conductance measurements and decomposition methods to quantitatively assess the weighting and phase tuning of synaptic inputs to different flexor and extensor MNs during locomotor-like activity in the isolated neonatal mice lumbar spinal cord preparation. Whole cell recordings were obtained from 22 flexor and 18 extensor MNs in rostral and caudal lumbar segments. In all flexor and the large majority of extensor MNs the extracted excitatory and inhibitory synaptic conductances alternate but with a predominance of inhibitory conductances, most pronounced in extensors. These conductance changes are consistent with a “push–pull” operation of locomotor CPG. The extracted excitatory and inhibitory synaptic conductances varied between 2 and 56% of the mean total conductance. Analysis of the phase tuning of the extracted synaptic conductances in flexor and extensor MNs in the rostral lumbar cord showed that the flexor-phase–related synaptic conductance changes have sharper locomotor-phase tuning than the extensor-phase–related conductances, suggesting a modular organization of premotor CPG networks consisting of reciprocally coupled, but differently composed, flexor and extensor CPG networks. There was a clear difference between phase tuning in rostral and caudal MNs, suggesting a distinct operation of CPG networks in different lumbar segments. The highly asymmetric features were preserved throughout all ranges of locomotor frequencies investigated and with different combinations of locomotor-inducing drugs. The asymmetric nature of CPG operation and phase tuning of the conductance profiles provide important clues to the organization of the rodent locomotor CPG and are compatible with a multilayered and distributed structure of the network. PMID:18829847

Nullomers and High Order Nullomers in Genomic Sequences

PubMed Central

Vergni, Davide; Santoni, Daniele

2016-01-01

A nullomer is an oligomer that does not occur as a subsequence in a given DNA sequence, i.e. it is an absent word of that sequence. The importance of nullomers in several applications, from drug discovery to forensic practice, is now debated in the literature. Here, we investigated the nature of nullomers, whether their absence in genomes has just a statistical explanation or it is a peculiar feature of genomic sequences. We introduced an extension of the notion of nullomer, namely high order nullomers, which are nullomers whose mutated sequences are still nullomers. We studied different aspects of them: comparison with nullomers of random sequences, CpG distribution and mean helical rise. In agreement with previous results we found that the number of nullomers in the human genome is much larger than expected by chance. Nevertheless antithetical results were found when considering a random DNA sequence preserving dinucleotide frequencies. The analysis of CpG frequencies in nullomers and high order nullomers revealed, as expected, a high CpG content but it also highlighted a strong dependence of CpG frequencies on the dinucleotide position, suggesting that nullomers have their own peculiar structure and are not simply sequences whose CpG frequency is biased. Furthermore, phylogenetic trees were built on eleven species based on both the similarities between the dinucleotide frequencies and the number of nullomers two species share, showing that nullomers are fairly conserved among close species. Finally the study of mean helical rise of nullomers sequences revealed significantly high mean rise values, reinforcing the hypothesis that those sequences have some peculiar structural features. The obtained results show that nullomers are the consequence of the peculiar structure of DNA (also including biased CpG frequency and CpGs islands), so that the hypermutability model, also taking into account CpG islands, seems to be not sufficient to explain nullomer phenomenon. Finally, high order nullomers could emphasize those features that already make simple nullomers useful in several applications. PMID:27906971

Design and pilot evaluation of a system to develop computer-based site-specific practice guidelines from decision models.

PubMed

Sanders, G D; Nease, R F; Owens, D K

2000-01-01

Local tailoring of clinical practice guidelines (CPGs) requires experts in medicine and evidence synthesis unavailable in many practice settings. The authors' computer-based system enables developers and users to create, disseminate, and tailor CPGs, using normative decision models (DMs). ALCHEMIST, a web-based system, analyzes a DM, creates a CPG in the form of an annotated algorithm, and displays for the guideline user the optimal strategy. ALCHEMIST'S interface enables remote users to tailor the guideline by changing underlying input variables and observing the new annotated algorithm that is developed automatically. In a pilot evaluation of the system, a DM was used to evaluate strategies for staging non-small-cell lung cancer. Subjects (n = 15) compared the automatically created CPG with published guidelines for this staging and critiqued both using a previously developed instrument to rate the CPGs' usability, accountability, and accuracy on a scale of 0 (worst) to 2 (best), with higher scores reflecting higher quality. The mean overall score for the ALCHEMIST CPG was 1.502, compared with the published-CPG score of 0.987 (p = 0.002). The ALCHEMIST CPG scores for usability, accountability, and accuracy were 1.683, 1.393, and 1.430, respectively; the published CPG scores were 1.192, 0.941, and 0.830 (each comparison p < 0.05). On a scale of 1 (worst) to 5 (best), users' mean ratings of ALCHEMIST'S ease of use, usefulness of content, and presentation format were 4.76, 3.98, and 4.64, respectively. The results demonstrate the feasibility of a web-based system that automatically analyzes a DM and creates a CPG as an annotated algorithm, enabling remote users to develop site-specific CPGs. In the pilot evaluation, the ALCHEMIST guidelines met established criteria for quality and compared favorably with national CPGs. The high usability and usefulness ratings suggest that such systems can be a good tool for guideline development.

Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

PubMed Central

Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

2014-01-01

While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

Neonatal testosterone suppresses a neuroendocrine pulse generator required for reproduction

NASA Astrophysics Data System (ADS)

Israel, Jean-Marc; Cabelguen, Jean-Marie; Le Masson, Gwendal; Oliet, Stéphane H.; Ciofi, Philippe

2014-02-01

The pituitary gland releases hormones in a pulsatile fashion guaranteeing signalling efficiency. The determinants of pulsatility are poorly circumscribed. Here we show in magnocellular hypothalamo-neurohypophyseal oxytocin (OT) neurons that the bursting activity underlying the neurohormonal pulses necessary for parturition and the milk-ejection reflex is entirely driven by a female-specific central pattern generator (CPG). Surprisingly, this CPG is active in both male and female neonates, but is inactivated in males after the first week of life. CPG activity can be restored in males by orchidectomy or silenced in females by exogenous testosterone. This steroid effect is aromatase and caspase dependent, and is mediated via oestrogen receptor-α. This indicates the apoptosis of the CPG network during hypothalamic sexual differentiation, explaining why OT neurons do not burst in adult males. This supports the view that stereotypic neuroendocrine pulsatility is governed by CPGs, some of which are subjected to gender-specific perinatal programming.

Output variability across animals and levels in a motor system

PubMed Central

Norris, Brian J; Günay, Cengiz; Kueh, Daniel

2018-01-01

Rhythmic behaviors vary across individuals. We investigated the sources of this output variability across a motor system, from the central pattern generator (CPG) to the motor plant. In the bilaterally symmetric leech heartbeat system, the CPG orchestrates two coordinations in the bilateral hearts with different intersegmental phase relations (Δϕ) and periodic side-to-side switches. Population variability is large. We show that the system is precise within a coordination, that differences in repetitions of a coordination contribute little to population output variability, but that differences between bilaterally homologous cells may contribute to some of this variability. Nevertheless, much output variability is likely associated with genetic and life history differences among individuals. Variability of Δϕ were coordination-specific: similar at all levels in one, but significantly lower for the motor pattern than the CPG pattern in the other. Mechanisms that transform CPG output to motor neurons may limit output variability in the motor pattern. PMID:29345614

Patterns of DNA Methylation Across the Leptin Core Promoter in Four Diverse Asian and North American Populations.

PubMed

Mosher, M J; Melton, P E; Stapleton, P; Schanfield, M S; Crawford, M H

2016-04-01

DNA methylation is the most widely studied of epigenetic mechanisms, with environmental effects recorded through patterned attachments of methyl groups along the DNA that are capable of modifying gene expression without altering the DNA sequencing. The degree to which these patterns of DNA methylation are heritable, the expected range of normality across populations, and the phenotypic relevance of pattern variation remain unclear. Genes regulating metabolic pathways appear to be vulnerable to ongoing nutritional programming over the life course, as dietary nutrients are significant environmental determinants of DNA methylation, supplying both the methyl groups and energy to generate the methylation process. Here we examine methylation patterns along a region of the metabolic gene leptin (LEP). LEP's putative functions include regulation of energy homeostasis, with its signals affecting energy intake and expenditure, adipogenesis and energy storage, lipid and glucose metabolism, bone metabolism, and reproductive endocrine function. A pattern of differential methylation across CpG sites of the LEP core promoter has been previously identified; however, any consistency of pattern or its phenotypic significance is not fully elucidated among populations. Using DNA extracted from unfractionated white blood cells of peripheral blood samples, our pilot study, divided into two parts, examined the significance of variation in DNA methylation patterns along the leptin core promoter in four populations (phase 1) and used biomarkers reflecting leptin's functional process in two of those populations, western Buryat of Siberia and the Mennonite of central Kansas, to investigate the relevance of the ethnic variation identified in the DNA methylation (phase 2). LEP's core promoter region contains both the binding site for C/EBPα (CCAAT/enhancer binding protein alpha), which tempers the final step in adipocyte maturity and capacity to synthesize leptin, and the TATA motif controlling leptin synthesis. Previous studies report that increased methylation in this region is correlated to decreased gene expression, suggesting tissue-specific methylation variation at this region ( Melzner et al. 2002 ). We hypothesized that evidence of nutritional epigenetic programming would be identified through variation in patterns of DNA methylation and that functional relevance of that variation among populations would be identified through biomarkers that reflect leptin's metabolic signals: serum leptin levels, lipoproteins of the lipid transport system, and anthropometric measures. In phase 1, our combined analyses of 313 individuals documented a distinct and consistent overall pattern of differential DNA methylation across seven CpG sites of LEP core promoter in all ethnicities and both sexes. This pattern replicates those identified in previous studies, suggesting a conserved core promoter region across populations. Phase 2 analyses of two of the four populations (n = 239), correlating methylation at the C/EBPα transcription binding site (TBS) with metabolic and anthropometric biomarkers reflecting LEP roles, showed that stature, which reflects bone growth and remodeling, was significantly and inversely correlated with the percentage of DNA methylation at this site in both sexes. We suggest that variation in DNA methylation along the LEP core promoter plays a substantial role in energy signals affecting both adipogenesis and bone metabolism.

KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands

PubMed Central

Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J

2012-01-01

CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043

Cellular basis for singing motor pattern generation in the field cricket (Gryllus bimaculatus DeGeer)

PubMed Central

Schöneich, Stefan; Hedwig, Berthold

2012-01-01

The singing behavior of male crickets allows analyzing a central pattern generator (CPG) that was shaped by sexual selection for reliable production of species-specific communication signals. After localizing the essential ganglia for singing in Gryllus bimaculatus, we now studied the calling song CPG at the cellular level. Fictive singing was initiated by pharmacological brain stimulation. The motor pattern underlying syllables and chirps was recorded as alternating spike bursts of wing-opener and wing-closer motoneurons in a truncated wing nerve; it precisely reflected the natural calling song. During fictive singing, we intracellularly recorded and stained interneurons in thoracic and abdominal ganglia and tested their impact on the song pattern by intracellular current injections. We identified three interneurons of the metathoracic and first unfused abdominal ganglion that rhythmically de- and hyperpolarized in phase with the syllable pattern and spiked strictly before the wing-opener motoneurons. Depolarizing current injection in two of these opener interneurons caused additional rhythmic singing activity, which reliably reset the ongoing chirp rhythm. The closely intermeshing arborizations of the singing interneurons revealed the dorsal midline neuropiles of the metathoracic and three most anterior abdominal neuromeres as the anatomical location of singing pattern generation. In the same neuropiles, we also recorded several closer interneurons that rhythmically hyper- and depolarized in the syllable rhythm and spiked strictly before the wing-closer motoneurons. Some of them received pronounced inhibition at the beginning of each chirp. Hyperpolarizing current injection in the dendrite revealed postinhibitory rebound depolarization as one functional mechanism of central pattern generation in singing crickets. PMID:23170234

The Healthy Weight Commitment Foundation Pledge

PubMed Central

Ng, Shu Wen; Slining, Meghan M.; Popkin, Barry M.

2014-01-01

Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation’s leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (−10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007–2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcals/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcals/capita/day, but there was little change in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 87 kcals/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. PMID:25240967

CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

PubMed

Jung, Myung-Hwa; Jung, Sung-Ju

2017-10-01

Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

DNA methylation screening of primary prostate tumors identifies SRD5A2 and CYP11A1 as candidate markers for assessing risk of biochemical recurrence.

PubMed

Horning, Aaron M; Awe, Julius A; Wang, Chiou-Miin; Liu, Joseph; Lai, Zhao; Wang, Vickie Yao; Jadhav, Rohit R; Louie, Anna D; Lin, Chun-Lin; Kroczak, Tad; Chen, Yidong; Jin, Victor X; Abboud-Werner, Sherry L; Leach, Robin J; Hernandez, Javior; Thompson, Ian M; Saranchuk, Jeff; Drachenberg, Darrel; Chen, Chun-Liang; Mai, Sabine; Huang, Tim Hui-Ming

2015-11-01

Altered DNA methylation in CpG islands of gene promoters has been implicated in prostate cancer (PCa) progression and can be used to predict disease outcome. In this study, we determine whether methylation changes of androgen biosynthesis pathway (ABP)-related genes in patients' plasma cell-free DNA (cfDNA) can serve as prognostic markers for biochemical recurrence (BCR). Methyl-binding domain capture sequencing (MBDCap-seq) was used to identify differentially methylated regions (DMRs) in primary tumors of patients who subsequently developed BCR or not, respectively. Methylation pyrosequencing of candidate loci was validated in cfDNA samples of 86 PCa patients taken at and/or post-radical prostatectomy (RP) using univariate and multivariate prediction analyses. Putative DMRs in 13 of 30 ABP-related genes were found between tumors of BCR (n = 12) versus no evidence of disease (NED) (n = 15). In silico analysis of The Cancer Genome Atlas data confirmed increased DNA methylation of two loci-SRD5A2 and CYP11A1, which also correlated with their decreased expression, in tumors with subsequent BCR development. Their aberrant cfDNA methylation was also associated with detectable levels of PSA taken after patients' post-RP. Multivariate analysis of the change in cfDNA methylation at all of CpG sites measured along with patient's treatment history predicted if a patient will develop BCR with 77.5% overall accuracy. Overall, increased DNA methylation of SRD5A2 and CYP11A1 related to androgen biosynthesis functions may play a role in BCR after patients' RP. The correlation between aberrant cfDNA methylation and detectable PSA in post-RP further suggests their utility as predictive markers for PCa recurrence. . © 2015 Wiley Periodicals, Inc.

Regulation of DNA methylation on EEF1D and RPL8 expression in cattle.

PubMed

Liu, Xuan; Yang, Jie; Zhang, Qin; Jiang, Li

2017-10-01

Dynamic changes to the epigenome play a critical role in a variety of biology processes and complex traits. Many important candidate genes have been identified through our previous genome wide association study (GWAS) on milk production traits in dairy cattle. However, the underlying mechanism of candidate genes have not yet been clearly understood. In this study, we analyzed the methylation variation of the candidate genes, EEF1D and RPL8, which were identified to be strongly associated with milk production traits in dairy cattle in our previous studies, and its effect on protein and mRNA expression. We compared DNA methylation profiles and gene expression levels of EEF1D and RPL8 in five different tissues (heart, liver, mammary gland, ovary and muscle) of three cows. Both genes showed the highest expression level in mammary gland. For RPL8, there was no difference in the DNA methylation pattern in the five tissues, suggesting no effect of DNA methylation on gene expression. For EEF1D, the DNA methylation levels of its first CpG island differed in the five tissues and were negatively correlated with the gene expression levels. To further investigate the function of DNA methylation on the expression of EEF1D, we collected blood samples of three cows at early stage of lactation and in dry period and analyzed its expression and the methylation status of the first CpG island in blood. As a result, the mRNA expression of EEF1D in the dry period was higher than that at the early stage of lactation, while the DNA methylation level in the dry period was lower than that at the early stage of lactation. Our result suggests that the DNA methylation of EEF1D plays an important role in the spatial and temporal regulation of its expression and possibly have an effect on the milk production traits.

Spatiotemporal clustering of the epigenome reveals rules of dynamic gene regulation

PubMed Central

Yu, Pengfei; Xiao, Shu; Xin, Xiaoyun; Song, Chun-Xiao; Huang, Wei; McDee, Darina; Tanaka, Tetsuya; Wang, Ting; He, Chuan; Zhong, Sheng

2013-01-01

Spatial organization of different epigenomic marks was used to infer functions of the epigenome. It remains unclear what can be learned from the temporal changes of the epigenome. Here, we developed a probabilistic model to cluster genomic sequences based on the similarity of temporal changes of multiple epigenomic marks during a cellular differentiation process. We differentiated mouse embryonic stem (ES) cells into mesendoderm cells. At three time points during this differentiation process, we used high-throughput sequencing to measure seven histone modifications and variants—H3K4me1/2/3, H3K27ac, H3K27me3, H3K36me3, and H2A.Z; two DNA modifications—5-mC and 5-hmC; and transcribed mRNAs and noncoding RNAs (ncRNAs). Genomic sequences were clustered based on the spatiotemporal epigenomic information. These clusters not only clearly distinguished gene bodies, promoters, and enhancers, but also were predictive of bidirectional promoters, miRNA promoters, and piRNAs. This suggests specific epigenomic patterns exist on piRNA genes much earlier than germ cell development. Temporal changes of H3K4me2, unmethylated CpG, and H2A.Z were predictive of 5-hmC changes, suggesting unmethylated CpG and H3K4me2 as potential upstream signals guiding TETs to specific sequences. Several rules on combinatorial epigenomic changes and their effects on mRNA expression and ncRNA expression were derived, including a simple rule governing the relationship between 5-hmC and gene expression levels. A Sox17 enhancer containing a FOXA2 binding site and a Foxa2 enhancer containing a SOX17 binding site were identified, suggesting a positive feedback loop between the two mesendoderm transcription factors. These data illustrate the power of using epigenome dynamics to investigate regulatory functions. PMID:23033340

Profile analysis and prediction of tissue-specific CpG island methylation classes

PubMed Central

2009-01-01

Background The computational prediction of DNA methylation has become an important topic in the recent years due to its role in the epigenetic control of normal and cancer-related processes. While previous prediction approaches focused merely on differences between methylated and unmethylated DNA sequences, recent experimental results have shown the presence of much more complex patterns of methylation across tissues and time in the human genome. These patterns are only partially described by a binary model of DNA methylation. In this work we propose a novel approach, based on profile analysis of tissue-specific methylation that uncovers significant differences in the sequences of CpG islands (CGIs) that predispose them to a tissue- specific methylation pattern. Results We defined CGI methylation profiles that separate not only between constitutively methylated and unmethylated CGIs, but also identify CGIs showing a differential degree of methylation across tissues and cell-types or a lack of methylation exclusively in sperm. These profiles are clearly distinguished by a number of CGI attributes including their evolutionary conservation, their significance, as well as the evolutionary evidence of prior methylation. Additionally, we assess profile functionality with respect to the different compartments of protein coding genes and their possible use in the prediction of DNA methylation. Conclusion Our approach provides new insights into the biological features that determine if a CGI has a functional role in the epigenetic control of gene expression and the features associated with CGI methylation susceptibility. Moreover, we show that the ability to predict CGI methylation is based primarily on the quality of the biological information used and the relationships uncovered between different sources of knowledge. The strategy presented here is able to predict, besides the constitutively methylated and unmethylated classes, two more tissue specific methylation classes conserving the accuracy provided by leading binary methylation classification methods. PMID:19383127

CD24(hi)CD27(+) B cells from patients with allergic asthma have impaired regulatory activity in response to lipopolysaccharide.

PubMed

van der Vlugt, L E P M; Mlejnek, E; Ozir-Fazalalikhan, A; Janssen Bonas, M; Dijksman, T R; Labuda, L A; Schot, R; Guigas, B; Möller, G M; Hiemstra, P S; Yazdanbakhsh, M; Smits, H H

2014-04-01

Regulatory B cells have been identified that strongly reduce allergic and auto-immune inflammation in experimental models by producing IL-10. Recently, several human regulatory B-cell subsets with an impaired function in auto-immunity have been described, but there is no information on regulatory B cells in allergic asthma. In this study, the frequency and function of IL-10 producing B-cell subsets in allergic asthma were investigated. Isolated peripheral blood B cells from 13 patients with allergic asthma and matched healthy controls were analyzed for the expression of different regulatory B-cell markers. Next, the B cells were activated by lipopolysaccharide (LPS), CpG or through the B-cell receptor, followed by co-culture with endogenous memory CD4(+) T cells and house dust mite allergen DerP1. Lower number of IL-10 producing B cells were found in patients in response to LPS, however, this was not the case when B cells were activated through the B-cell receptor or by CpG. Further dissection showed that only the CD24(hi)CD27(+) B-cell subset was reduced in number and IL-10 production to LPS. In response to DerP1, CD4(+) T cells from patients co-cultured with LPS-primed total B cells produced less IL-10 compared to similar cultures from controls. These results are in line with the finding that sorted CD24(hi)CD27(+) B cells are responsible for the induction of IL-10(+) CD4(+) T cells. Taken together, these data indicate that CD24(hi)CD27(+) B cells from allergic asthma patients produce less IL-10 in response to LPS leading to a weaker IL-10 induction in T cells in response to DerP1, which may play a role in allergic asthma. © 2013 John Wiley & Sons Ltd.

The 3p14.2 tumour suppressor ADAMTS9 is inactivated by promoter CpG methylation and inhibits tumour cell growth in breast cancer.

PubMed

Shao, Bianfei; Feng, Yixiao; Zhang, Hongbin; Yu, Fang; Li, Qianqian; Tan, Cui; Xu, Hongying; Ying, Jianming; Li, Lili; Yang, Dejuan; Peng, Weiyan; Tang, Jun; Li, Shuman; Ren, Guosheng; Tao, Qian; Xiang, Tingxiu

2018-02-01

Chromosome region 3p12-14 is an important tumour suppressor gene (TSG) locus for multiple cancers. ADAMTS9, a member of the metalloprotease large family, has been identified as a candidate 3p14.2 TSG inactivated by aberrant promoter CpG methylation in several carcinomas, but little known about its expression and function in breast cancer. In this report, ADAMTS9 expression and methylation was analysed in breast cancer cell lines and tissue samples. ADAMTS9 RNA was significantly down-regulated in breast cancer cell lines (6/8). After treating the cells with demethylation agent Aza and TSA, ADAMTS9 expression was dramatically increased. Bisulphite genomic sequencing and methylation-specific PCR detected promoter methylation, which was associated with decreased ADAMTS9 expression. Hypermethylation was also detected in 130/219 (59.4%) of primary tumours but only in 4.5% (2/44) of paired surgical margin tissues. Ectopic expression of ADAMTS9 in tumor cells induced significant growth suppression, cell cycle arrest at the G0/G1 phase, enhanced apoptosis and reduced cell migration and invasion. Conditioned culture medium from ADAMTS9-transfected BT549 cells markedly disrupted tube formation ability of human umbilical vein endothelial cell (HUVEC) in Matrigel. Furthermore, ADAMTS9 inhibited AKT signaling and its downstream targets (MDM2, p53, p21, p27, E-cadherin, VIM, SNAIL, VEGFA, NFκB-p65 and MMP2). In addition, we demonstrated, for the first time, that ADAMTS9 inhibits AKT signaling, through suppressing its upstream activators EGFR and TGFβ1/TβR(I/II) in breast cancer cells. Our results suggest that ADAMTS9 is a TSG epigenetically inactivated in breast cancer, which functions through blocking EGFR- and TGFβ1/TβR(I/II)-activated AKT signaling. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

PBOV1 Is a Human De Novo Gene with Tumor-Specific Expression That Is Associated with a Positive Clinical Outcome of Cancer

PubMed Central

Samusik, Nikolay; Krukovskaya, Larisa; Meln, Irina; Shilov, Evgeny; Kozlov, Andrey P.

2013-01-01

PBOV1 is a known human protein-coding gene with an uncharacterized function. We have previously found that PBOV1 lacks orthologs in non-primate genomes and is expressed in a wide range of tumor types. Here we report that PBOV1 protein-coding sequence is human-specific and has originated de novo in the primate evolution through a series of frame-shift and stop codon mutations. We profiled PBOV1 expression in multiple cancer and normal tissue samples and found that it was expressed in 19 out of 34 tumors of various origins but completely lacked expression in any of the normal adult or fetal human tissues. We found that, unlike the cancer/testis antigens that are typically controlled by CpG island-containing promoters, PBOV1 was expressed from a GC-poor TATA-containing promoter which was not influenced by CpG demethylation and was inactive in testis. Our analysis of public microarray data suggests that PBOV1 activation in tumors could be dependent on the Hedgehog signaling pathway. Despite the recent de novo origin and the lack of identifiable functional signatures, a missense SNP in the PBOV1 coding sequence has been previously associated with an increased risk of breast cancer. Using publicly available microarray datasets, we found that high levels of PBOV1 expression in breast cancer and glioma samples were significantly associated with a positive outcome of the cancer disease. We also found that PBOV1 was highly expressed in primary but not in recurrent high-grade gliomas, suggesting the presence of a negative selection against PBOV1-expressing cancer cells. Our findings could contribute to the understanding of the mechanisms behind de novo gene origin and the possible role of tumors in this process. PMID:23418531

MECP2 variation in Rett syndrome-An overview of current coverage of genetic and phenotype data within existing databases.

PubMed

Townend, Gillian S; Ehrhart, Friederike; van Kranen, Henk J; Wilkinson, Mark; Jacobsen, Annika; Roos, Marco; Willighagen, Egon L; van Enckevort, David; Evelo, Chris T; Curfs, Leopold M G

2018-04-27

Rett syndrome (RTT) is a monogenic rare disorder that causes severe neurological problems. In most cases, it results from a loss-of-function mutation in the gene encoding methyl-CPG-binding protein 2 (MECP2). Currently, about 900 unique MECP2 variations (benign and pathogenic) have been identified and it is suspected that the different mutations contribute to different levels of disease severity. For researchers and clinicians, it is important that genotype-phenotype information is available to identify disease-causing mutations for diagnosis, to aid in clinical management of the disorder, and to provide counseling for parents. In this study, 13 genotype-phenotype databases were surveyed for their general functionality and availability of RTT-specific MECP2 variation data. For each database, we investigated findability and interoperability alongside practical user functionality, and type and amount of genetic and phenotype data. The main conclusions are that, as well as being challenging to find these databases and specific MECP2 variants held within, interoperability is as yet poorly developed and requires effort to search across databases. Nevertheless, we found several thousand online database entries for MECP2 variations and their associated phenotypes, diagnosis, or predicted variant effects, which is a good starting point for researchers and clinicians who want to provide, annotate, and use the data. © 2018 The Authors. Human Mutation published by Wiley Periodicals, Inc.

Uracil Accumulation and Mutagenesis Dominated by Cytosine Deamination in CpG Dinucleotides in Mice Lacking UNG and SMUG1

DOE PAGES

Alsøe, Lene; Sarno, Antonio; Carracedo, Sergio; ...

2017-08-03

Both a DNA lesion and an intermediate for antibody maturation, uracil is primarily processed by base excision repair (BER), either initiated by uracil-DNA glycosylase (UNG) or by single-strand selective monofunctional uracil DNA glycosylase (SMUG1). The relative in vivo contributions of each glycosylase remain elusive. To assess the impact of SMUG1 deficiency, we measured uracil and 5-hydroxymethyluracil, another SMUG1 substrate, in Smug1 -/ - mice. Here, we found that 5-hydroxymethyluracil accumulated in Smug1 -/ - tissues and correlated with 5-hydroxymethylcytosine levels. The highest increase was found in brain, which contained about 26-fold higher genomic 5-hydroxymethyluracil levels than the wild type. Smug1more » -/ - mice did not accumulate uracil in their genome and Ung -/ - mice showed slightly elevated uracil levels. Contrastingly, Ung -/ -Smug1 -/ - mice showed a synergistic increase in uracil levels with up to 25-fold higher uracil levels than wild type. Whole genome sequencing of UNG/SMUG1-deficient tumours revealed that combined UNG and SMUG1 deficiency leads to the accumulation of mutations, primarily C to T transitions within CpG sequences. This unexpected sequence bias suggests that CpG dinucleotides are intrinsically more mutation prone. In conclusion, we showed that SMUG1 efficiently prevent genomic uracil accumulation, even in the presence of UNG, and identified mutational signatures associated with combined UNG and SMUG1 deficiency.« less

Uracil Accumulation and Mutagenesis Dominated by Cytosine Deamination in CpG Dinucleotides in Mice Lacking UNG and SMUG1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alsøe, Lene; Sarno, Antonio; Carracedo, Sergio

Both a DNA lesion and an intermediate for antibody maturation, uracil is primarily processed by base excision repair (BER), either initiated by uracil-DNA glycosylase (UNG) or by single-strand selective monofunctional uracil DNA glycosylase (SMUG1). The relative in vivo contributions of each glycosylase remain elusive. To assess the impact of SMUG1 deficiency, we measured uracil and 5-hydroxymethyluracil, another SMUG1 substrate, in Smug1 -/ - mice. Here, we found that 5-hydroxymethyluracil accumulated in Smug1 -/ - tissues and correlated with 5-hydroxymethylcytosine levels. The highest increase was found in brain, which contained about 26-fold higher genomic 5-hydroxymethyluracil levels than the wild type. Smug1more » -/ - mice did not accumulate uracil in their genome and Ung -/ - mice showed slightly elevated uracil levels. Contrastingly, Ung -/ -Smug1 -/ - mice showed a synergistic increase in uracil levels with up to 25-fold higher uracil levels than wild type. Whole genome sequencing of UNG/SMUG1-deficient tumours revealed that combined UNG and SMUG1 deficiency leads to the accumulation of mutations, primarily C to T transitions within CpG sequences. This unexpected sequence bias suggests that CpG dinucleotides are intrinsically more mutation prone. In conclusion, we showed that SMUG1 efficiently prevent genomic uracil accumulation, even in the presence of UNG, and identified mutational signatures associated with combined UNG and SMUG1 deficiency.« less

Genome-wide methylation patterns provide insight into differences in breast tumor biology between American women of African and European ancestry

PubMed Central

Ambrosone, Christine B.; Young, Allyson C.; Sucheston, Lara E.; Wang, Dan; Li, Yan; Liu, Song; Tang, Li; Hu, Quang; Freudenheim, Jo L.; Shields, Peter G.; Morrison, Carl D.; Demissie, Kitaw; Higgins, Michael J.

2014-01-01

American women of African ancestry (AA) are more likely than European-Americans (EA) to be diagnosed with aggressive, estrogen receptor (ER) negative breast tumors; mechanisms underlying these disparities are poorly understood. We conducted a genome wide (450K loci) methylation analysis to determine if there were differences in DNA methylation patterns between tumors from AA and EA women and if these differences were similar for both ER positive and ER negative breast cancer. Methylation levels at CpG loci within CpG islands (CGI)s and CGI-shores were significantly higher in tumors (n=138) than in reduction mammoplasty samples (n=124). In hierarchical cluster analysis, there was separation between tumor and normal samples, and in tumors, there was delineation by ER status, but not by ancestry. However, differential methylation analysis identified 157 CpG loci with a mean β value difference of at least 0.17 between races, with almost twice as many differences in ER-negative tumors compared to ER-positive cancers. This first genome-wide methylation study to address disparities indicates that there are likely differing etiologic pathways for the development of ER negative breast cancer between AA and EA women. Further investigation of the genes most differentially methylated by race in ER negative tumors can guide new approaches for cancer prevention and targeted therapies, and elucidate the biologic basis of breast cancer disparities. PMID:24368439

76 FR 28308 - Compliance Policy Guide: Surgeons' Gloves and Patient Examination Gloves; Defects-Criteria for...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-17

... quality levels (AQLs) for leaks and visual defects observed during FDA testing of medical gloves. The CPG... practices regulation (21 CFR 10.115). The CPG represents FDA's current thinking on the criteria for direct...

A method for developing standardised interactive education for complex clinical guidelines

PubMed Central

2012-01-01

Background Although systematic use of the Perinatal Society of Australia and New Zealand internationally endorsed Clinical Practice Guideline for Perinatal Mortality (PSANZ-CPG) improves health outcomes, implementation is inadequate. Its complexity is a feature known to be associated with non-compliance. Interactive education is effective as a guideline implementation strategy, but lacks an agreed definition. SCORPIO is an educational framework containing interactive and didactic teaching, but has not previously been used to implement guidelines. Our aim was to transform the PSANZ-CPG into an education workshop to develop quality standardised interactive education acceptable to participants for learning skills in collaborative interprofessional care. Methods The workshop was developed using the construct of an educational framework (SCORPIO), the PSANZ-CPG, a transformation process and tutor training. After a pilot workshop with key target and stakeholder groups, modifications were made to this and subsequent workshops based on multisource written observations from interprofessional participants, tutors and an independent educator. This participatory action research process was used to monitor acceptability and educational standards. Standardised interactive education was defined as the attainment of content and teaching standards. Quantitative analysis of positive expressed as a percentage of total feedback was used to derive a total quality score. Results Eight workshops were held with 181 participants and 15 different tutors. Five versions resulted from the action research methodology. Thematic analysis of multisource observations identified eight recurring education themes or quality domains used for standardisation. The two content domains were curriculum and alignment with the guideline and the six teaching domains; overload, timing, didacticism, relevance, reproducibility and participant engagement. Engagement was the most challenging theme to resolve. Tutors identified all themes for revision whilst participants identified a number of teaching but no content themes. From version 1 to 5, a significant increasing trend in total quality score was obtained; participants: 55%, p=0.0001; educator: 42%, p=0.0004; tutor peers: 57%, p=0.0001. Conclusions Complex clinical guidelines can be developed into a workshop acceptable to interprofessional participants. Eight quality domains provide a framework to standardise interactive teaching for complex clinical guidelines. Tutor peer review is important for content validity. This methodology may be useful for other guideline implementation. PMID:23131137

An epigenome-wide study of body mass index and DNA methylation in blood using participants from the Sister Study cohort.

PubMed

Wilson, L E; Harlid, S; Xu, Z; Sandler, D P; Taylor, J A

2017-01-01

The relationship between obesity and chronic disease risk is well-established; the underlying biological mechanisms driving this risk increase may include obesity-related epigenetic modifications. To explore this hypothesis, we conducted a genome-wide analysis of DNA methylation and body mass index (BMI) using data from a subset of women in the Sister Study. The Sister Study is a cohort of 50 884 US women who had a sister with breast cancer but were free of breast cancer themselves at enrollment. Study participants completed examinations which included measurements of height and weight, and provided blood samples. Blood DNA methylation data generated with the Illumina Infinium HumanMethylation27 BeadChip array covering 27,589 CpG sites was available for 871 women from a prior study of breast cancer and DNA methylation. To identify differentially methylated CpG sites associated with BMI, we analyzed this methylation data using robust linear regression with adjustment for age and case status. For those CpGs passing the false discovery rate significance level, we examined the association in a replication set comprised of a non-overlapping group of 187 women from the Sister Study who had DNA methylation data generated using the Infinium HumanMethylation450 BeadChip array. Analysis of this expanded 450 K array identified additional BMI-associated sites which were investigated with targeted pyrosequencing. Four CpG sites reached genome-wide significance (false discovery rate (FDR) q<0.05) in the discovery set and associations for all four were significant at strict Bonferroni correction in the replication set. An additional 23 sites passed FDR in the replication set and five were replicated by pyrosequencing in the discovery set. Several of the genes identified including ANGPT4, RORC, SOCS3, FSD2, XYLT1, ABCG1, STK39, ASB2 and CRHR2 have been linked to obesity and obesity-related chronic diseases. Our findings support the hypothesis that obesity-related epigenetic differences are detectable in blood and may be related to risk of chronic disease.

A method for developing standardised interactive education for complex clinical guidelines.

PubMed

Vaughan, Janet I; Jeffery, Heather E; Raynes-Greenow, Camille; Gordon, Adrienne; Hirst, Jane; Hill, David A; Arbuckle, Susan

2012-11-06

Although systematic use of the Perinatal Society of Australia and New Zealand internationally endorsed Clinical Practice Guideline for Perinatal Mortality (PSANZ-CPG) improves health outcomes, implementation is inadequate. Its complexity is a feature known to be associated with non-compliance. Interactive education is effective as a guideline implementation strategy, but lacks an agreed definition. SCORPIO is an educational framework containing interactive and didactic teaching, but has not previously been used to implement guidelines. Our aim was to transform the PSANZ-CPG into an education workshop to develop quality standardised interactive education acceptable to participants for learning skills in collaborative interprofessional care. The workshop was developed using the construct of an educational framework (SCORPIO), the PSANZ-CPG, a transformation process and tutor training. After a pilot workshop with key target and stakeholder groups, modifications were made to this and subsequent workshops based on multisource written observations from interprofessional participants, tutors and an independent educator. This participatory action research process was used to monitor acceptability and educational standards. Standardised interactive education was defined as the attainment of content and teaching standards. Quantitative analysis of positive expressed as a percentage of total feedback was used to derive a total quality score. Eight workshops were held with 181 participants and 15 different tutors. Five versions resulted from the action research methodology. Thematic analysis of multisource observations identified eight recurring education themes or quality domains used for standardisation. The two content domains were curriculum and alignment with the guideline and the six teaching domains; overload, timing, didacticism, relevance, reproducibility and participant engagement. Engagement was the most challenging theme to resolve. Tutors identified all themes for revision whilst participants identified a number of teaching but no content themes. From version 1 to 5, a significant increasing trend in total quality score was obtained; participants: 55%, p=0.0001; educator: 42%, p=0.0004; tutor peers: 57%, p=0.0001. Complex clinical guidelines can be developed into a workshop acceptable to interprofessional participants. Eight quality domains provide a framework to standardise interactive teaching for complex clinical guidelines. Tutor peer review is important for content validity. This methodology may be useful for other guideline implementation.

A Genome-Wide mQTL Analysis in Human Adipose Tissue Identifies Genetic Variants Associated with DNA Methylation, Gene Expression and Metabolic Traits

PubMed Central

Volkov, Petr; Olsson, Anders H.; Gillberg, Linn; Jørgensen, Sine W.; Brøns, Charlotte; Eriksson, Karl-Fredrik; Groop, Leif; Jansson, Per-Anders; Nilsson, Emma; Rönn, Tina; Vaag, Allan; Ling, Charlotte

2016-01-01

Little is known about the extent to which interactions between genetics and epigenetics may affect the risk of complex metabolic diseases and/or their intermediary phenotypes. We performed a genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human adipose tissue of 119 men, where 592,794 single nucleotide polymorphisms (SNPs) were related to DNA methylation of 477,891 CpG sites, covering 99% of RefSeq genes. SNPs in significant mQTLs were further related to gene expression in adipose tissue and obesity related traits. We found 101,911 SNP-CpG pairs (mQTLs) in cis and 5,342 SNP-CpG pairs in trans showing significant associations between genotype and DNA methylation in adipose tissue after correction for multiple testing, where cis is defined as distance less than 500 kb between a SNP and CpG site. These mQTLs include reported obesity, lipid and type 2 diabetes loci, e.g. ADCY3/POMC, APOA5, CETP, FADS2, GCKR, SORT1 and LEPR. Significant mQTLs were overrepresented in intergenic regions meanwhile underrepresented in promoter regions and CpG islands. We further identified 635 SNPs in significant cis-mQTLs associated with expression of 86 genes in adipose tissue including CHRNA5, G6PC2, GPX7, RPL27A, THNSL2 and ZFP57. SNPs in significant mQTLs were also associated with body mass index (BMI), lipid traits and glucose and insulin levels in our study cohort and public available consortia data. Importantly, the Causal Inference Test (CIT) demonstrates how genetic variants mediate their effects on metabolic traits (e.g. BMI, cholesterol, high-density lipoprotein (HDL), hemoglobin A1c (HbA1c) and homeostatic model assessment of insulin resistance (HOMA-IR)) via altered DNA methylation in human adipose tissue. This study identifies genome-wide interactions between genetic and epigenetic variation in both cis and trans positions influencing gene expression in adipose tissue and in vivo (dys)metabolic traits associated with the development of obesity and diabetes. PMID:27322064

Adjuvant-Loaded Spiky Gold Nanoparticles for Activation of Innate Immune Cells.

PubMed

Nam, Jutaek; Son, Sejin; Moon, James J

2017-10-01

Gold nanoparticles are versatile carriers for delivery of biomacromolecules. Here, we have developed spiky gold nanoparticles (SGNPs) that can efficiently deliver immunostimulatory agents. Our goal was to develop a platform technology for co-delivery of multiple adjuvant molecules for synergistic stimulation and maturation of innate immune cells. SGNPs were synthesized by a seed-mediated, surfactant-free synthesis method and incorporated with polyinosinic-polycytidylic acid (pIC) and DNA oligonucleotide containing unmethylated CpG motif (CpG) by an electrostatic layer-by-layer approach. Adjuvant-loaded SGNP nano-complexes were examined for their biophysical and biochemical properties and studied for immune activation using bone marrow-derived dendritic cells (BMDCs). We have synthesized SGNPs with branched nano-spikes layered with pIC and/or CpG. Adjuvant-loaded SGNP nano-complexes promoted cellular uptake of the adjuvants. Importantly, we achieved spatio-temporal control over co-delivery of pIC and CpG via SGNPs, which produced synergistic enhancement in cytokine release (IL-6, TNF-α) and upregulation of co-stimulatory markers (CD40, CD80, CD86) in BMDCs, compared with pIC, CpG, or their admixtures. SGNPs serve as a versatile delivery platform that allows flexible and on-demand cargo fabrication for strong activation of innate immune cells.

A multifaceted knowledge translation strategy can increase compliance with guideline recommendations for mechanical bowel preparation.

PubMed

Eskicioglu, Cagla; Pearsall, Emily; Victor, J Charles; Aarts, Mary-Anne; Okrainec, Allan; McLeod, Robin S

2015-01-01

The successful transfer of evidence into clinical practice is a slow and haphazard process. We report the outcome of a 5-year knowledge translation (KT) strategy to increase adherence with a clinical practice guideline (CPG) for mechanical bowel preparation (MBP) for elective colorectal surgery patients. A locally tailored CPG recommending MBP practices was developed. Data on MBP practices were collected at six University of Toronto hospitals before CPG implementation as well as after two separate KT strategies. KT strategy #1 included development of the CPG, education by opinion leaders, reminder cards, and presentations of data. KT strategy #2 included selection of hospital champions, development of communities of practice, education, reminder cards, electronic updates, pre-printed standardized orders, and audit and feedback. A total of 744 patients (400 males, 344 females, mean age 57.0) were included. Compliance increased from 58.6 to 70.4% after KT strategy #1 and to 81.1% after KT strategy #2 (p < 0.001). Using a tailored KT strategy, increased compliance was observed with CPG recommendations over time suggesting that a longitudinal KT strategy is required to increase and sustain compliance with recommendations. Furthermore, different strategies may be required at different times (i.e., educational sessions initially and reminders and standardized orders to maintain adherence).

Synthetic Poly(L-Glutamic Acid)-conjugated CpG Exhibits Antitumor Efficacy With Increased Retention in Tumor and Draining Lymph Nodes After Intratumoral Injection in a Mouse Model of Melanoma.

PubMed

Ma, Qing; Zhou, Dapeng; DeLyria, Elizabeth S; Wen, Xiaoxia; Lu, Wei; Thapa, Prakash; Liu, Chengwen; Li, Dan; Bassett, Roland L; Overwijk, Willem W; Hwu, Patrick; Li, Chun

2017-01-01

There is an urgent need for new clinically applicable drug-delivery methods to enhance accumulation of immune-activating drugs in tumors. We synthesized a poly(L-glutamic acid)-CpG ODN2216 conjugate (PG-CpG) and injected it intratumorally into C57BL/6 mice bearing subcutaneous B16-ovalbumin melanoma. PG-CpG elicited the same potent antitumoral activity as CpG with respect to reducing tumor growth and triggering antigen-specific CD8 T-cell responses in this well-established solid tumor model. Moreover, PG-CpG was retained significantly longer in both tumor and draining lymph nodes than was free CpG after intratumoral injection. Specifically, 48 hours after injection, 26.5%±16.9% of the injected PG-CpG dose versus 4.72%±2.61% of free CpG remained at the tumor, and 1.53%±1.22% of the injected PG-CpG versus 0.37%±0.33% of free CpG was retained in the draining inguinal lymph nodes. These findings indicate that PG is an effective synthetic polymeric carrier for delivery of immunostimulatory agents to tumors and lymph nodes.

Across-Platform Imputation of DNA Methylation Levels Incorporating Nonlocal Information Using Penalized Functional Regression.

PubMed

Zhang, Guosheng; Huang, Kuan-Chieh; Xu, Zheng; Tzeng, Jung-Ying; Conneely, Karen N; Guan, Weihua; Kang, Jian; Li, Yun

2016-05-01

DNA methylation is a key epigenetic mark involved in both normal development and disease progression. Recent advances in high-throughput technologies have enabled genome-wide profiling of DNA methylation. However, DNA methylation profiling often employs different designs and platforms with varying resolution, which hinders joint analysis of methylation data from multiple platforms. In this study, we propose a penalized functional regression model to impute missing methylation data. By incorporating functional predictors, our model utilizes information from nonlocal probes to improve imputation quality. Here, we compared the performance of our functional model to linear regression and the best single probe surrogate in real data and via simulations. Specifically, we applied different imputation approaches to an acute myeloid leukemia dataset consisting of 194 samples and our method showed higher imputation accuracy, manifested, for example, by a 94% relative increase in information content and up to 86% more CpG sites passing post-imputation filtering. Our simulated association study further demonstrated that our method substantially improves the statistical power to identify trait-associated methylation loci. These findings indicate that the penalized functional regression model is a convenient and valuable imputation tool for methylation data, and it can boost statistical power in downstream epigenome-wide association study (EWAS). © 2016 WILEY PERIODICALS, INC.

Epigenetic inactivation of CHFR in human tumors

PubMed Central

Toyota, Minoru; Sasaki, Yasushi; Satoh, Ayumi; Ogi, Kazuhiro; Kikuchi, Takefumi; Suzuki, Hiromu; Mita, Hiroaki; Tanaka, Nobuyuki; Itoh, Fumio; Issa, Jean-Pierre J.; Jair, Kam-Wing; Schuebel, Kornel E.; Imai, Kohzoh; Tokino, Takashi

2003-01-01

Cell-cycle checkpoints controlling the orderly progression through mitosis are frequently disrupted in human cancers. One such checkpoint, entry into metaphase, is regulated by the CHFR gene encoding a protein possessing forkhead-associated and RING finger domains as well as ubiquitin–ligase activity. Although defects in this checkpoint have been described, the molecular basis and prevalence of CHFR inactivation in human tumors are still not fully understood. To address this question, we analyzed the pattern of CHFR expression in a number of human cancer cell lines and primary tumors. We found CpG methylation-dependent silencing of CHFR expression in 45% of cancer cell lines, 40% of primary colorectal cancers, 53% of colorectal adenomas, and 30% of primary head and neck cancers. Expression of CHFR was precisely correlated with both CpG methylation and deacetylation of histones H3 and H4 in the CpG-rich regulatory region. Moreover, CpG methylation and thus silencing of CHFR depended on the activities of two DNA methyltransferases, DNMT1 and DNMT3b, as their genetic inactivation restored CHFR expression. Finally, cells with CHFR methylation had an intrinsically high mitotic index when treated with microtubule inhibitor. This means that cells in which CHFR was epigenetically inactivated constitute loss-of-function alleles for mitotic checkpoint control. Taken together, these findings shed light on a pathway by which mitotic checkpoint is bypassed in cancer cells and suggest that inactivation of checkpoint genes is much more widespread than previously suspected. PMID:12810945

Purification and DNA-binding properties of the cro-type regulatory repressor protein cng encoded by the Lactobacillus plantarum phage phi g1e.

PubMed

Kakikawa, M; Ohkubo, S; Sakate, T; Sayama, M; Taketo, A; Kodaira, K

2000-05-16

The putative repressor protein Cng (10kDa on an SDS gel) for the lytic pathway of Lactobacillus plantarum phage φg1e was purified using the Escherichia coli Pt7 system, and its DNA-binding ability for the seven operator-like sequences, the GATAC-boxes (Gb1 to Gb7), was investigated in vitro. In gel-shift assays, Cng selectively bound to the DNA fragments containing the GATAC-box(es). In addition, DNase I footprinting analysis with supercoiled DNA demonstrated that Cng can specifically cover about a 25bp region centered around each of the GATAC-boxes, although two boxes, Gb4 and Gb6, were only partially protected. Moreover, protein crosslinking experiments using glutaraldehyde suggested that Cng most likely functions as a dimer. On the other hand, the binding ability of Cpg for the GATAC-boxes in supercoiled DNA was also examined under the same conditions as in Cng; unlike Cng, Cpg covered Gb4 and Gb6 completely sufficiently as well as the other five boxes. Thus, the present and previous [Kakikawa et al., Gene 215 (1998) 371-379; 242 (2000) 155-166] results indicate a possibility that the two proteins Cng and Cpg selectively bind to the GATAC-boxes that act as operators, and can decide between the lytic or lysogenic pathways through repression of the promoter activity of P(R) as well as P(L).

PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.

2008-11-28

The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but notmore » with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed.« less

Sex differences in DNA methylation and expression in zebrafish brain: a test of an extended 'male sex drive' hypothesis.

PubMed

Chatterjee, Aniruddha; Lagisz, Malgorzata; Rodger, Euan J; Zhen, Li; Stockwell, Peter A; Duncan, Elizabeth J; Horsfield, Julia A; Jeyakani, Justin; Mathavan, Sinnakaruppan; Ozaki, Yuichi; Nakagawa, Shinichi

2016-09-30

The sex drive hypothesis predicts that stronger selection on male traits has resulted in masculinization of the genome. Here we test whether such masculinizing effects can be detected at the level of the transcriptome and methylome in the adult zebrafish brain. Although methylation is globally similar, we identified 914 specific differentially methylated CpGs (DMCs) between males and females (435 were hypermethylated and 479 were hypomethylated in males compared to females). These DMCs were prevalent in gene body, intergenic regions and CpG island shores. We also discovered 15 distinct CpG clusters with striking sex-specific DNA methylation differences. In contrast, at transcriptome level, more female-biased genes than male-biased genes were expressed, giving little support for the male sex drive hypothesis. Our study provides genome-wide methylome and transcriptome assessment and sheds light on sex-specific epigenetic patterns and in zebrafish for the first time. Copyright © 2016 Elsevier B.V. All rights reserved.

Diesel Fueled SOFC for Class 7/Class 8 On-Highway Truck Auxiliary Power

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vesely, Charles John-Paul; Fuchs, Benjamin S.; Booten, Chuck W.

2010-03-31

The following report documents the progress of the Cummins Power Generation (CPG) Diesel Fueled SOFC for Class 7/Class 8 On-Highway Truck Auxiliary Power (SOFC APU) development and final testing under the U.S. Department of Energy (DOE) Energy Efficiency and Renewable Energy (EERE) contract DE-FC36-04GO14318. This report overviews and summarizes CPG and partner development leading to successful demonstration of the SOFC APU objectives and significant progress towards SOFC commercialization. Significant SOFC APU Milestones: Demonstrated: Operation meeting SOFC APU requirements on commercial Ultra Low Sulfur Diesel (ULSD) fuel. SOFC systems operating on dry CPOX reformate. Successful start-up and shut-down of SOFC APUmore » system without inert gas purge. Developed: Low cost balance of plant concepts and compatible systems designs. Identified low cost, high volume components for balance of plant systems. Demonstrated efficient SOFC output power conditioning. Demonstrated SOFC control strategies and tuning methods.« less

Identification of methylation haplotype blocks aids in deconvolution of heterogeneous tissue samples and tumor tissue-of-origin mapping from plasma DNA.

PubMed

Guo, Shicheng; Diep, Dinh; Plongthongkum, Nongluk; Fung, Ho-Lim; Zhang, Kang; Zhang, Kun

2017-04-01

Adjacent CpG sites in mammalian genomes can be co-methylated owing to the processivity of methyltransferases or demethylases, yet discordant methylation patterns have also been observed, which are related to stochastic or uncoordinated molecular processes. We focused on a systematic search and investigation of regions in the full human genome that show highly coordinated methylation. We defined 147,888 blocks of tightly coupled CpG sites, called methylation haplotype blocks, after analysis of 61 whole-genome bisulfite sequencing data sets and validation with 101 reduced-representation bisulfite sequencing data sets and 637 methylation array data sets. Using a metric called methylation haplotype load, we performed tissue-specific methylation analysis at the block level. Subsets of informative blocks were further identified for deconvolution of heterogeneous samples. Finally, using methylation haplotypes we demonstrated quantitative estimation of tumor load and tissue-of-origin mapping in the circulating cell-free DNA of 59 patients with lung or colorectal cancer.

Short-term memory of motor network performance via activity-dependent potentiation of Na+/K+ pump function.

PubMed

Zhang, Hong-Yan; Sillar, Keith T

2012-03-20

Brain networks memorize previous performance to adjust their output in light of past experience. These activity-dependent modifications generally result from changes in synaptic strengths or ionic conductances, and ion pumps have only rarely been demonstrated to play a dynamic role. Locomotor behavior is produced by central pattern generator (CPG) networks and modified by sensory and descending signals to allow for changes in movement frequency, intensity, and duration, but whether or how the CPG networks recall recent activity is largely unknown. In Xenopus frog tadpoles, swim bout duration correlates linearly with interswim interval, suggesting that the locomotor network retains a short-term memory of previous output. We discovered an ultraslow, minute-long afterhyperpolarization (usAHP) in network neurons following locomotor episodes. The usAHP is mediated by an activity- and sodium spike-dependent enhancement of electrogenic Na(+)/K(+) pump function. By integrating spike frequency over time and linking the membrane potential of spinal neurons to network performance, the usAHP plays a dynamic role in short-term motor memory. Because Na(+)/K(+) pumps are ubiquitously expressed in neurons of all animals and because sodium spikes inevitably accompany network activity, the usAHP may represent a phylogenetically conserved but largely overlooked mechanism for short-term memory of neural network function. Copyright © 2012 Elsevier Ltd. All rights reserved.

Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum.

PubMed

Song, Xiaowen; Huang, Fei; Liu, Juanjuan; Li, Chengjun; Gao, Shanshan; Wu, Wei; Zhai, Mengfan; Yu, Xiaojuan; Xiong, Wenfeng; Xie, Jia; Li, Bin

2017-10-01

Cytosine DNA methylation is a vital epigenetic regulator of eukaryotic development. Whether this epigenetic modification occurs in Tribolium castaneum has been controversial, its distribution pattern and functions have not been established. Here, using bisulphite sequencing (BS-Seq), we confirmed the existence of DNA methylation and described the methylation profiles of the four life stages of T. castaneum. In the T. castaneum genome, both symmetrical CpG and non-CpG methylcytosines were observed. Symmetrical CpG methylation, which was catalysed by DNMT1 and occupied a small part in T. castaneum methylome, was primarily enriched in gene bodies and was positively correlated with gene expression levels. Asymmetrical non-CpG methylation, which was predominant in the methylome, was strongly concentrated in intergenic regions and introns but absent from exons. Gene body methylation was negatively correlated with gene expression levels. The distribution pattern and functions of this type of methylation were similar only to the methylome of Drosophila melanogaster, which further supports the existence of a novel methyltransferase in the two species responsible for this type of methylation. This first life-cycle methylome of T. castaneum reveals a novel and unique methylation pattern, which will contribute to the further understanding of the variety and functions of DNA methylation in eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Aberrant signature methylome by DNMT1 hot spot mutation in hereditary sensory and autonomic neuropathy 1E.

PubMed

Sun, Zhifu; Wu, Yanhong; Ordog, Tamas; Baheti, Saurabh; Nie, Jinfu; Duan, Xiaohui; Hojo, Kaori; Kocher, Jean-Pierre; Dyck, Peter J; Klein, Christopher J

2014-08-01

DNA methyltransferase 1 (DNMT1) is essential for DNA methylation, gene regulation and chromatin stability. We previously discovered DNMT1 mutations cause hereditary sensory and autonomic neuropathy type 1 with dementia and hearing loss (HSAN1E; OMIM 614116). HSAN1E is the first adult-onset neurodegenerative disorder caused by a defect in a methyltransferase gene. HSAN1E patients appear clinically normal until young adulthood, then begin developing the characteristic symptoms involving central and peripheral nervous systems. Some HSAN1E patients also develop narcolepsy and it has recently been suggested that HSAN1E is allelic to autosomal dominant cerebellar ataxia, deafness, with narcolepsy (ADCA-DN; OMIM 604121), which is also caused by mutations in DNMT1. A hotspot mutation Y495C within the targeting sequence domain of DNMT1 has been identified among HSAN1E patients. The mutant DNMT1 protein shows premature degradation and reduced DNA methyltransferase activity. Herein, we investigate genome-wide DNA methylation at single-base resolution through whole-genome bisulfite sequencing of germline DNA in 3 pairs of HSAN1E patients and their gender- and age-matched siblings. Over 1 billion 75-bp single-end reads were generated for each sample. In the 3 affected siblings, overall methylation loss was consistently found in all chromosomes with X and 18 being most affected. Paired sample analysis identified 564,218 differentially methylated CpG sites (DMCs; P<0.05), of which 300 134 were intergenic and 264 084 genic CpGs. Hypomethylation was predominant in both genic and intergenic regions, including promoters, exons, most CpG islands, L1, L2, Alu, and satellite repeats and simple repeat sequences. In some CpG islands, hypermethylated CpGs outnumbered hypomethylated CpGs. In 201 imprinted genes, there were more DMCs than in non-imprinted genes and most were hypomethylated. Differentially methylated region (DMR) analysis identified 5649 hypomethylated and 1872 hypermethylated regions. Importantly, pathway analysis revealed 1693 genes associated with the identified DMRs were highly associated in diverse neurological disorders and NAD+/NADH metabolism pathways is implicated in the pathogenesis. Our results provide novel insights into the epigenetic mechanism of neurodegeneration arising from a hotspot DNMT1 mutation and reveal pathways potentially important in a broad category of neurological and psychological disorders.

Aberrant signature methylome by DNMT1 hot spot mutation in hereditary sensory and autonomic neuropathy 1E

PubMed Central

Sun, Zhifu; Wu, Yanhong; Ordog, Tamas; Baheti, Saurabh; Nie, Jinfu; Duan, Xiaohui; Hojo, Kaori; Kocher, Jean-Pierre; Dyck, Peter J; Klein, Christopher J

2014-01-01

DNA methyltransferase 1 (DNMT1) is essential for DNA methylation, gene regulation and chromatin stability. We previously discovered DNMT1 mutations cause hereditary sensory and autonomic neuropathy type 1 with dementia and hearing loss (HSAN1E; OMIM 614116). HSAN1E is the first adult-onset neurodegenerative disorder caused by a defect in a methyltransferase gene. HSAN1E patients appear clinically normal until young adulthood, then begin developing the characteristic symptoms involving central and peripheral nervous systems. Some HSAN1E patients also develop narcolepsy and it has recently been suggested that HSAN1E is allelic to autosomal dominant cerebellar ataxia, deafness, with narcolepsy (ADCA-DN; OMIM 604121), which is also caused by mutations in DNMT1. A hotspot mutation Y495C within the targeting sequence domain of DNMT1 has been identified among HSAN1E patients. The mutant DNMT1 protein shows premature degradation and reduced DNA methyltransferase activity. Herein, we investigate genome-wide DNA methylation at single-base resolution through whole-genome bisulfite sequencing of germline DNA in 3 pairs of HSAN1E patients and their gender- and age-matched siblings. Over 1 billion 75-bp single-end reads were generated for each sample. In the 3 affected siblings, overall methylation loss was consistently found in all chromosomes with X and 18 being most affected. Paired sample analysis identified 564,218 differentially methylated CpG sites (DMCs; P < 0.05), of which 300 134 were intergenic and 264 084 genic CpGs. Hypomethylation was predominant in both genic and intergenic regions, including promoters, exons, most CpG islands, L1, L2, Alu, and satellite repeats and simple repeat sequences. In some CpG islands, hypermethylated CpGs outnumbered hypomethylated CpGs. In 201 imprinted genes, there were more DMCs than in non-imprinted genes and most were hypomethylated. Differentially methylated region (DMR) analysis identified 5649 hypomethylated and 1872 hypermethylated regions. Importantly, pathway analysis revealed 1693 genes associated with the identified DMRs were highly associated in diverse neurological disorders and NAD+/NADH metabolism pathways is implicated in the pathogenesis. Our results provide novel insights into the epigenetic mechanism of neurodegeneration arising from a hotspot DNMT1 mutation and reveal pathways potentially important in a broad category of neurological and psychological disorders. PMID:25033457

Forging a potent vaccine adjuvant: CpG ODN/cationic peptide nanorings.

PubMed

Gungor, Bilgi; Yagci, Fuat Cem; Gursel, Ihsan; Gursel, Mayda

Type I interferon inducers may potentially be engineered to function as antiviral and anticancer agents, or alternatively, vaccine adjuvants, all of which may have clinical applications. We recently described a simple strategy to convert a Toll-like receptor 9 (TLR9) agonist devoid of interferon α (IFNα) stimulating activity into a robust Type I interferon inducer with potent vaccine adjuvant activity.

Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.

PubMed

Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui

2011-02-28

To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.

Repetition priming of motor activity mediated by a central pattern generator: the importance of extrinsic vs. intrinsic program initiators

PubMed Central

Siniscalchi, Michael J.; Jing, Jian; Weiss, Klaudiusz R.

2016-01-01

Repetition priming is characterized by increased performance as a behavior is repeated. Although this phenomenon is ubiquitous, mediating mechanisms are poorly understood. We address this issue in a model system, the feeding network of Aplysia. This network generates both ingestive and egestive motor programs. Previous data suggest a chemical coding model: ingestive and egestive inputs to the feeding central pattern generator (CPG) release different modulators, which act via different second messengers to prime motor activity in different ways. The ingestive input to the CPG (neuron CBI-2) releases the peptides feeding circuit activating peptide and cerebral peptide 2, which produce an ingestive pattern of activity. The egestive input to the CPG (the esophageal nerve) releases the peptide small cardioactive peptide. This model is based on research that focused on a single aspect of motor control (radula opening). Here we ask whether repetition priming is observed if activity is triggered with a neuron within the core CPG itself and demonstrate that it is not. Moreover, previous studies demonstrated that effects of modulatory neurotransmitters that induce repetition priming persist. This suggests that it should be possible to “prime” motor programs triggered from within the CPG by first stimulating extrinsic modulatory inputs. We demonstrate that programs triggered after ingestive input activation are ingestive and programs triggered after egestive input activation are egestive. We ask where this priming occurs and demonstrate modifications within the CPG itself. This arrangement is likely to have important consequences for “task” switching, i.e., the cessation of one type of motor activity and the initiation of another. PMID:27466134

Comprehensive DNA methylation analysis of human neuroblastoma cells treated with blonanserin.

PubMed

Murata, Yui; Nishioka, Masaki; Bundo, Miki; Sunaga, Fumiko; Kasai, Kiyoto; Iwamoto, Kazuya

2014-03-20

Blonanserin is a second-generation antipsychotic drug for schizophrenia. The pharmacological actions of blonanserin are shown to be the antagonism of dopamine receptor 2 and serotonin receptors. However, its molecular mechanisms in brain cells have not been fully characterized. Accumulating evidence suggests that antipsychotic drugs and mood stabilizers show epigenetic effects on a wide range of genes in animal and cellular models. We performed genome-wide DNA methylation analysis targeting 479,814 CpG sites of cultured human neuroblastoma cells administered with blonanserin. We found that 3,057 CpG sites showed statistically significant changes in DNA methylation at two different doses of blonanserin (1.36 nM and 13.6 nM). These included hypermethylated CpG sites that were enriched in genes related to axonogenesis and cell morphogenesis involved in neuron differentiation. We also showed that the global effect on DNA methylome depends on the concentration of the drug. With a high dose of blonanserin, the overall methylation levels across all CpG sites significantly increased. These increases in DNA methylation were prominent in the CpG sites distant from promoter regions. We further examined DNA methylation changes in specific genes implicated for the actions of antipsychotic drugs, such as the dopamine receptor 2 (DRD2) gene and the serotonin receptor 2A (HTR2A) gene. We observed that CpG sites that were located within DRD2 and HTR2A genes were significantly hypermethylated by blonanserin. The DNA methylation changes induced by the treatment with blonanserin will be useful for understanding its pharmacological actions at the cellular level. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Syncope Best Practices: A Syncope Clinical Practice Guideline to Improve Quality.

PubMed

Phelps, Heather M; Sachdeva, Ritu; Mahle, William T; McCracken, Courtney E; Kelleman, Michael; McConnell, Michael; Fischbach, Peter S; Cardis, Brian M; Campbell, Robert M; Oster, Matthew E

2016-05-01

To determine whether implementation of a standardized clinical practice guideline (CPG) for the evaluation of syncope would decrease practice variability and resource utilization. A retrospective review of medical records of patients presenting to our practice for outpatient evaluation of syncope before and after implementation of the CPG. The guideline included elements of history, physical exam, electrocardiogram, and "red flags" for further testing. Outpatient pediatric cardiology offices of a large pediatric cardiology practice. All new patients between 3 and 21 years old, who presented to cardiology clinic with a chief complaint of syncope. The CPG for the evaluation of pediatric syncope was presented to the providers. Resource utilization was determined by the tests ordered by individual physicians before and after initiation of the CPG. Patient final diagnoses were recorded and the medical records were subsequently reviewed to determine if any patients, who presented again to the system, were ultimately diagnosed with cardiac disease. Of the 1496 patients with an initial visit for syncope, there was no significant difference in the diagnosis of cardiac disease before or after initiation of the CPG: (0.6% vs. 0.4%, P = .55). Electrocardiography provides the highest yield in the evaluation of pediatric syncope. Despite high compliance (86.9%), there were no overall changes in costs ($346.31 vs. $348.53, P = .85) or in resource utilization. There was, however, a decrease in the variability of ordering of echocardiograms among physicians, particularly among those at the extremes of utilization. Although the CPG did not decrease already low costs, it did decrease the wide variability in echo utilization. Evaluation beyond detailed history, physical exam, and electrocardiography provides no additional benefit in the evaluations of pediatric patients presenting with syncope. © 2015 Wiley Periodicals, Inc.

Polycomb-like proteins link the PRC2 complex to CpG islands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Haojie; Liefke, Robert; Jiang, Junyi

The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

PubMed

Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

2002-04-01

Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

The Healthy Weight Commitment Foundation pledge: calories sold from U.S. consumer packaged goods, 2007-2012.

PubMed

Ng, Shu Wen; Slining, Meghan M; Popkin, Barry M

2014-10-01

Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation's leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (-10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007-2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcal/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcal/capita/day, and there were similar declines in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 99 kcal/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. Copyright © 2014 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

Risk Factors Associated with Invasive Fungal Infections in Combat Trauma

PubMed Central

Rodriguez, Carlos J.; Weintrob, Amy C.; Shah, Jinesh; Malone, Debra; Dunne, James R.; Weisbrod, Allison B.; Lloyd, Bradley A.; Warkentien, Tyler E.; Murray, Clinton K.; Wilkins, Kenneth; Shaikh, Faraz; Carson, M. Leigh; Aggarwal, Deepak

2014-01-01

Abstract Background: In recent years, invasive fungal infections (IFI) have complicated the clinical course of patients with combat-related injuries. Commonalities in injury patterns and characteristics among patients with IFI led to the development of a Joint Trauma System (JTS) clinical practice guideline (CPG) for IFI management. We performed a case-control study to confirm and further delineate risk factors associated with IFI development in combat casualties with the objective of generating data to refine the CPG and promote timelier initiation of treatment. Methods: Data were collected retrospectively for United States (U.S.) military personnel injured during deployment in Afghanistan from June 2009 through August 2011. Cases were identified as IFI based upon wound cultures with fungal growth and/or fungal elements seen on histology, in addition to the presence of recurrent wound necrosis. Controls were matched using date of injury (±3 mo) and injury severity score (±10). Risk factor parameters analyzed included injury circumstances, blood transfusion requirements, amputations after first operative intervention, and associated injuries. Data are expressed as multivariate odds ratios (OR; 95% confidence interval [CI]). Results: Seventy-six IFI cases were identified from 1,133 U.S. military personnel wounded in Afghanistan and matched to 150 controls. Parameters associated significantly with the development of IFI multivariate analysis were blast injuries (OR: 5.7; CI: 1.1–29.6), dismounted at time of injury (OR: 8.5; CI: 1.2–59.8); above the knee amputations (OR: 4.1; CI: 1.3-12.7), and large-volume packed red blood cell (PRBC; >20 U) transfusions within first 24 h (OR: 7.0; CI: 2.5-19.7). Conclusions: Our analysis indicates that dismounted blast injuries, resulting in above the knee amputations, and requirement of large volume PRBC transfusions are independent predictors of IFI development. These data confirm all the preliminary risk factors, except for genitalia/perineal injuries, utilized by JTS in their IFI CPG. Model validation is necessary for further risk factor specification. PMID:24821267

Mapping South African allied health primary care clinical guideline activity: establishing a stakeholder reference sample.

PubMed

Dizon, Janine Margarita; Grimmer, Karen; Machingaidze, Shingai; McLaren, Pam; Louw, Quinette

2016-10-10

Little is known about allied health (AH) clinical practice guideline (CPG) activity in South Africa, and particularly in relation to primary health care (PHC). This paper reports on a scoping study undertaken to establish a reference framework, from which a comprehensive maximum variation sample could be selected. This was required to underpin robust sampling for a qualitative study aimed at understanding South African primary care AH therapy CPG activities. This paper builds on findings from the South African Guidelines Evaluation (Project SAGE) Flagship grant. South African government websites were searched for structures of departments and portfolios, and available CPGs. Professional AH association websites were searched for CPGs, purposively-identified key informants were interviewed, and CPGs previously identified for priority South African primary care conditions were critiqued for AH therapy involvement. Key informants described potentially complex relationships between players who may be engaged in South African AH CPGs, in both public and private sectors. There were disability/rehabilitation portfolios at national and provincial governments, but no uniformity in provincial government organisation of, or support for, PHC AH services. There were no AH primary care therapy CPGs on government websites, although there was 'clinical guidance' in various forms on professional association websites. Only two CPGs of priority South African PHC conditions included mention of any AH therapy (physiotherapy for adult asthma and chronic obstructive pulmonary disease). A comprehensive and wide-reaching stakeholder reference framework would be required in order to capture the heterogeneity of AH primary care CPG activity in South Africa. This should involve the voices of national and purposively-selected provincial governments, academic institutions, consultants, public sector managers and clinicians, private practitioners, professional associations, and private sector insurers. Provincial governments should be selected to reflect heterogeneity in local economics, population demographics and availability of university AH training programs. This investigation should aim to determine the areas of PHC in which AH are engaged.

Computationally expanding infinium HumanMethylation450 BeadChip array data to reveal distinct DNA methylation patterns of rheumatoid arthritis

PubMed Central

Li, Chengzhe; Ai, Rizi; Wang, Mengchi; Firestein, Gary S.; Wang, Wei

2016-01-01

Motivation: DNA methylation signatures in rheumatoid arthritis (RA) have been identified in fibroblast-like synoviocytes (FLS) with Illumina HumanMethylation450 array. Since <2% of CpG sites are covered by the Illumina 450K array and whole genome bisulfite sequencing is still too expensive for many samples, computationally predicting DNA methylation levels based on 450K data would be valuable to discover more RA-related genes. Results: We developed a computational model that is trained on 14 tissues with both whole genome bisulfite sequencing and 450K array data. This model integrates information derived from the similarity of local methylation pattern between tissues, the methylation information of flanking CpG sites and the methylation tendency of flanking DNA sequences. The predicted and measured methylation values were highly correlated with a Pearson correlation coefficient of 0.9 in leave-one-tissue-out cross-validations. Importantly, the majority (76%) of the top 10% differentially methylated loci among the 14 tissues was correctly detected using the predicted methylation values. Applying this model to 450K data of RA, osteoarthritis and normal FLS, we successfully expanded the coverage of CpG sites 18.5-fold and accounts for about 30% of all the CpGs in the human genome. By integrative omics study, we identified genes and pathways tightly related to RA pathogenesis, among which 12 genes were supported by triple evidences, including 6 genes already known to perform specific roles in RA and 6 genes as new potential therapeutic targets. Availability and implementation: The source code, required data for prediction, and demo data for test are freely available at: http://wanglab.ucsd.edu/star/LR450K/. Contact: wei-wang@ucsd.edu or gfirestein@ucsd.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26883487

Developing Leadership in Managers to Facilitate the Implementation of National Guideline Recommendations: A Process Evaluation of Feasibility and Usefulness

PubMed Central

Tistad, Malin; Palmcrantz, Susanne; Wallin, Lars; Ehrenberg, Anna; Olsson, Christina B.; Tomson, Göran; Holmqvist, Lotta Widén; Gifford, Wendy; Eldh, Ann Catrine

2016-01-01

Background: Previous research supports the claim that managers are vital players in the implementation of clinical practice guidelines (CPGs), yet little is known about interventions aiming to develop managers’ leadership in facilitating implementation. In this pilot study, process evaluation was employed to study the feasibility and usefulness of a leadership intervention by exploring the intervention’s potential to support managers in the implementation of national guideline recommendations for stroke care in outpatient rehabilitation. Methods: Eleven senior and frontline managers from five outpatient stroke rehabilitation centers participated in a four-month leadership intervention that included workshops, seminars, and teleconferences. The focus was on developing knowledge and skills to enhance the implementation of CPG recommendations, with a particular focus on leadership behaviors. Each dyad of managers was assigned to develop a leadership plan with specific goals and leadership behaviors for implementing three rehabilitation recommendations. Feasibility and usefulness were explored through observations and interviews with the managers and staff members prior to the intervention, and then one month and one year after the intervention. Results: Managers considered the intervention beneficial, particularly the participation of both senior and frontline managers and the focus on leadership knowledge and skills for implementing CPG recommendations. All the managers developed a leadership plan, but only two units identified goals specific to implementing the three stroke rehabilitation recommendations. Of these, only one identified leadership behaviors that support implementation. Conclusion: Managers found that the intervention was delivered in a feasible way and appreciated the focus on leadership to facilitate implementation. However, the intervention appeared to have limited impact on managers’ behaviors or clinical practice at the units. Future interventions directed towards managers should have a stronger focus on developing leadership skills and behaviors to tailor implementation plans and support implementation of CPG recommendations. PMID:27694661

Developing Leadership in Managers to Facilitate the Implementation of National Guideline Recommendations: A Process Evaluation of Feasibility and Usefulness.

PubMed

Tistad, Malin; Palmcrantz, Susanne; Wallin, Lars; Ehrenberg, Anna; Olsson, Christina B; Tomson, Göran; Holmqvist, Lotta Widén; Gifford, Wendy; Eldh, Ann Catrine

2016-04-11

Previous research supports the claim that managers are vital players in the implementation of clinical practice guidelines (CPGs), yet little is known about interventions aiming to develop managers' leadership in facilitating implementation. In this pilot study, process evaluation was employed to study the feasibility and usefulness of a leadership intervention by exploring the intervention's potential to support managers in the implementation of national guideline recommendations for stroke care in outpatient rehabilitation. Eleven senior and frontline managers from five outpatient stroke rehabilitation centers participated in a four-month leadership intervention that included workshops, seminars, and teleconferences. The focus was on developing knowledge and skills to enhance the implementation of CPG recommendations, with a particular focus on leadership behaviors. Each dyad of managers was assigned to develop a leadership plan with specific goals and leadership behaviors for implementing three rehabilitation recommendations. Feasibility and usefulness were explored through observations and interviews with the managers and staff members prior to the intervention, and then one month and one year after the intervention. Managers considered the intervention beneficial, particularly the participation of both senior and frontline managers and the focus on leadership knowledge and skills for implementing CPG recommendations. All the managers developed a leadership plan, but only two units identified goals specific to implementing the three stroke rehabilitation recommendations. Of these, only one identified leadership behaviors that support implementation. Managers found that the intervention was delivered in a feasible way and appreciated the focus on leadership to facilitate implementation. However, the intervention appeared to have limited impact on managers' behaviors or clinical practice at the units. Future interventions directed towards managers should have a stronger focus on developing leadership skills and behaviors to tailor implementation plans and support implementation of CPG recommendations. © 2016 by Kerman University of Medical Sciences

MGMT methylation analysis of glioblastoma on the Infinium methylation BeadChip identifies two distinct CpG regions associated with gene silencing and outcome, yielding a prediction model for comparisons across datasets, tumor grades, and CIMP-status.

PubMed

Bady, Pierre; Sciuscio, Davide; Diserens, Annie-Claire; Bloch, Jocelyne; van den Bent, Martin J; Marosi, Christine; Dietrich, Pierre-Yves; Weller, Michael; Mariani, Luigi; Heppner, Frank L; Mcdonald, David R; Lacombe, Denis; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika E

2012-10-01

The methylation status of the O(6)-methylguanine-DNA methyltransferase (MGMT) gene is an important predictive biomarker for benefit from alkylating agent therapy in glioblastoma. Recent studies in anaplastic glioma suggest a prognostic value for MGMT methylation. Investigation of pathogenetic and epigenetic features of this intriguingly distinct behavior requires accurate MGMT classification to assess high throughput molecular databases. Promoter methylation-mediated gene silencing is strongly dependent on the location of the methylated CpGs, complicating classification. Using the HumanMethylation450 (HM-450K) BeadChip interrogating 176 CpGs annotated for the MGMT gene, with 14 located in the promoter, two distinct regions in the CpG island of the promoter were identified with high importance for gene silencing and outcome prediction. A logistic regression model (MGMT-STP27) comprising probes cg12434587 [corrected] and cg12981137 provided good classification properties and prognostic value (kappa = 0.85; log-rank p < 0.001) using a training-set of 63 glioblastomas from homogenously treated patients, for whom MGMT methylation was previously shown to be predictive for outcome based on classification by methylation-specific PCR. MGMT-STP27 was successfully validated in an independent cohort of chemo-radiotherapy-treated glioblastoma patients (n = 50; kappa = 0.88; outcome, log-rank p < 0.001). Lower prevalence of MGMT methylation among CpG island methylator phenotype (CIMP) positive tumors was found in glioblastomas from The Cancer Genome Atlas than in low grade and anaplastic glioma cohorts, while in CIMP-negative gliomas MGMT was classified as methylated in approximately 50 % regardless of tumor grade. The proposed MGMT-STP27 prediction model allows mining of datasets derived on the HM-450K or HM-27K BeadChip to explore effects of distinct epigenetic context of MGMT methylation suspected to modulate treatment resistance in different tumor types.

TRAF3 Epigenetic Regulation Is Associated With Vascular Recurrence in Patients With Ischemic Stroke.

PubMed

Gallego-Fabrega, Cristina; Carrera, Caty; Reny, Jean-Luc; Fontana, Pierre; Slowik, Agnieszka; Pera, Joanna; Pezzini, Alessandro; Serrano-Heras, Gemma; Segura, Tomás; Martí-Fàbregas, Joan; Muiño, Elena; Cullell, Natalia; Montaner, Joan; Krupinski, Jerzy; Fernandez-Cadenas, Israel

2016-05-01

Clopidogrel is one of the most used antiplatelet drugs in patients with cardiovascular disease. However, 16% to 50% of patients have a high on-clopidogrel platelet reactivity and an increased risk of ischemic events. The pathogenesis of high on-treatment platelet reactivity in patients with stroke is only partially explained by genetic variations. This study aims to find differentially methylated sites across the genome associated with vascular recurrence in ischemic stroke patients treated with clopidogrel. From a cohort of 1900 patients with ischemic stroke, we selected 42 patients treated with clopidogrel, including 21 with a recurrent vascular event and 21 without vascular recurrence during the first year of follow-up. Over 480 000 DNA methylation sites were analyzed across the genome. Differentially methylated CpG sites were identified by nonparametric testing using R. Replication analysis was performed in a new cohort of 191 subjects and results were correlated with platelet reactivity in a subset of 90 subjects using light transmission aggregometry. A total of 73 differentially methylated CpG sites (P<1×10(-05)) were identified; 3 of them were selected for further replication: cg03548645 (P=1.42×10(-05), TRAF3), cg09533145 (P=7.81×10(-06), ADAMTS2), and cg15107336 (P=1.89×10(-05), XRCC1). The cg03548645 CpG remained significant in the replication study (P=0.034), a deep analysis of this region revealed another methylation site associated with vascular recurrence, P=0.037. Lower cg03548645 (TRAF3) DNA methylation levels were correlated with an increased platelet aggregation (ρ=-0.29, P=0.0075). This study suggests for the first time that epigenetics may significantly contribute to the variability of clopidogrel response and recurrence of ischemic events in patients with stroke. © 2016 American Heart Association, Inc.

High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions.

PubMed

Krebs, Arnaud R; Dessus-Babus, Sophie; Burger, Lukas; Schübeler, Dirk

2014-09-26

The majority of mammalian promoters are CpG islands; regions of high CG density that require protection from DNA methylation to be functional. Importantly, how sequence architecture mediates this unmethylated state remains unclear. To address this question in a comprehensive manner, we developed a method to interrogate methylation states of hundreds of sequence variants inserted at the same genomic site in mouse embryonic stem cells. Using this assay, we were able to quantify the contribution of various sequence motifs towards the resulting DNA methylation state. Modeling of this comprehensive dataset revealed that CG density alone is a minor determinant of their unmethylated state. Instead, these data argue for a principal role for transcription factor binding sites, a prediction confirmed by testing synthetic mutant libraries. Taken together, these findings establish the hierarchy between the two cis-encoded mechanisms that define the DNA methylation state and thus the transcriptional competence of CpG islands.

On Modeling and Analysis of MIMO Wireless Mesh Networks with Triangular Overlay Topology

DOE PAGES

Cao, Zhanmao; Wu, Chase Q.; Zhang, Yuanping; ...

2015-01-01

Multiple input multiple output (MIMO) wireless mesh networks (WMNs) aim to provide the last-mile broadband wireless access to the Internet. Along with the algorithmic development for WMNs, some fundamental mathematical problems also emerge in various aspects such as routing, scheduling, and channel assignment, all of which require an effective mathematical model and rigorous analysis of network properties. In this paper, we propose to employ Cartesian product of graphs (CPG) as a multichannel modeling approach and explore a set of unique properties of triangular WMNs. In each layer of CPG with a single channel, we design a node coordinate scheme thatmore » retains the symmetric property of triangular meshes and develop a function for the assignment of node identity numbers based on their coordinates. We also derive a necessary-sufficient condition for interference-free links and combinatorial formulas to determine the number of the shortest paths for channel realization in triangular WMNs.« less

Whole-genome fingerprint of the DNA methylome during human B cell differentiation.

PubMed

Kulis, Marta; Merkel, Angelika; Heath, Simon; Queirós, Ana C; Schuyler, Ronald P; Castellano, Giancarlo; Beekman, Renée; Raineri, Emanuele; Esteve, Anna; Clot, Guillem; Verdaguer-Dot, Néria; Duran-Ferrer, Martí; Russiñol, Nuria; Vilarrasa-Blasi, Roser; Ecker, Simone; Pancaldi, Vera; Rico, Daniel; Agueda, Lidia; Blanc, Julie; Richardson, David; Clarke, Laura; Datta, Avik; Pascual, Marien; Agirre, Xabier; Prosper, Felipe; Alignani, Diego; Paiva, Bruno; Caron, Gersende; Fest, Thierry; Muench, Marcus O; Fomin, Marina E; Lee, Seung-Tae; Wiemels, Joseph L; Valencia, Alfonso; Gut, Marta; Flicek, Paul; Stunnenberg, Hendrik G; Siebert, Reiner; Küppers, Ralf; Gut, Ivo G; Campo, Elías; Martín-Subero, José I

2015-07-01

We analyzed the DNA methylome of ten subpopulations spanning the entire B cell differentiation program by whole-genome bisulfite sequencing and high-density microarrays. We observed that non-CpG methylation disappeared upon B cell commitment, whereas CpG methylation changed extensively during B cell maturation, showing an accumulative pattern and affecting around 30% of all measured CpG sites. Early differentiation stages mainly displayed enhancer demethylation, which was associated with upregulation of key B cell transcription factors and affected multiple genes involved in B cell biology. Late differentiation stages, in contrast, showed extensive demethylation of heterochromatin and methylation gain at Polycomb-repressed areas, and genes with apparent functional impact in B cells were not affected. This signature, which has previously been linked to aging and cancer, was particularly widespread in mature cells with an extended lifespan. Comparing B cell neoplasms with their normal counterparts, we determined that they frequently acquire methylation changes in regions already undergoing dynamic methylation during normal B cell differentiation.

78 FR 42526 - Salmonella

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-16

... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-D-0254] Salmonella Contamination of Dry Dog Food; Withdrawal of Compliance Policy Guide AGENCY: Food and Drug... entitled ``Sec. 690.700 Salmonella Contamination of Dry Dog Food (CPG 690.700)'' on October 1, 1980. CPG...