Sample records for identifying genes responsible

  1. Cross-species multiple environmental stress responses: An integrated approach to identify candidate genes for multiple stress tolerance in sorghum (Sorghum bicolor (L.) Moench) and related model species

    PubMed Central

    Modise, David M.; Gemeildien, Junaid; Ndimba, Bongani K.; Christoffels, Alan

    2018-01-01

    Background Crop response to the changing climate and unpredictable effects of global warming with adverse conditions such as drought stress has brought concerns about food security to the fore; crop yield loss is a major cause of concern in this regard. Identification of genes with multiple responses across environmental stresses is the genetic foundation that leads to crop adaptation to environmental perturbations. Methods In this paper, we introduce an integrated approach to assess candidate genes for multiple stress responses across-species. The approach combines ontology based semantic data integration with expression profiling, comparative genomics, phylogenomics, functional gene enrichment and gene enrichment network analysis to identify genes associated with plant stress phenotypes. Five different ontologies, viz., Gene Ontology (GO), Trait Ontology (TO), Plant Ontology (PO), Growth Ontology (GRO) and Environment Ontology (EO) were used to semantically integrate drought related information. Results Target genes linked to Quantitative Trait Loci (QTLs) controlling yield and stress tolerance in sorghum (Sorghum bicolor (L.) Moench) and closely related species were identified. Based on the enriched GO terms of the biological processes, 1116 sorghum genes with potential responses to 5 different stresses, such as drought (18%), salt (32%), cold (20%), heat (8%) and oxidative stress (25%) were identified to be over-expressed. Out of 169 sorghum drought responsive QTLs associated genes that were identified based on expression datasets, 56% were shown to have multiple stress responses. On the other hand, out of 168 additional genes that have been evaluated for orthologous pairs, 90% were conserved across species for drought tolerance. Over 50% of identified maize and rice genes were responsive to drought and salt stresses and were co-located within multifunctional QTLs. Among the total identified multi-stress responsive genes, 272 targets were shown to be co-localized within QTLs associated with different traits that are responsive to multiple stresses. Ontology mapping was used to validate the identified genes, while reconstruction of the phylogenetic tree was instrumental to infer the evolutionary relationship of the sorghum orthologs. The results also show specific genes responsible for various interrelated components of drought response mechanism such as drought tolerance, drought avoidance and drought escape. Conclusions We submit that this approach is novel and to our knowledge, has not been used previously in any other research; it enables us to perform cross-species queries for genes that are likely to be associated with multiple stress tolerance, as a means to identify novel targets for engineering stress resistance in sorghum and possibly, in other crop species. PMID:29590108

  2. Microarray analysis and scale-free gene networks identify candidate regulators in drought-stressed roots of loblolly pine (P. taeda L.)

    PubMed Central

    2011-01-01

    Background Global transcriptional analysis of loblolly pine (Pinus taeda L.) is challenging due to limited molecular tools. PtGen2, a 26,496 feature cDNA microarray, was fabricated and used to assess drought-induced gene expression in loblolly pine propagule roots. Statistical analysis of differential expression and weighted gene correlation network analysis were used to identify drought-responsive genes and further characterize the molecular basis of drought tolerance in loblolly pine. Results Microarrays were used to interrogate root cDNA populations obtained from 12 genotype × treatment combinations (four genotypes, three watering regimes). Comparison of drought-stressed roots with roots from the control treatment identified 2445 genes displaying at least a 1.5-fold expression difference (false discovery rate = 0.01). Genes commonly associated with drought response in pine and other plant species, as well as a number of abiotic and biotic stress-related genes, were up-regulated in drought-stressed roots. Only 76 genes were identified as differentially expressed in drought-recovered roots, indicating that the transcript population can return to the pre-drought state within 48 hours. Gene correlation analysis predicts a scale-free network topology and identifies eleven co-expression modules that ranged in size from 34 to 938 members. Network topological parameters identified a number of central nodes (hubs) including those with significant homology (E-values ≤ 2 × 10-30) to 9-cis-epoxycarotenoid dioxygenase, zeatin O-glucosyltransferase, and ABA-responsive protein. Identified hubs also include genes that have been associated previously with osmotic stress, phytohormones, enzymes that detoxify reactive oxygen species, and several genes of unknown function. Conclusion PtGen2 was used to evaluate transcriptome responses in loblolly pine and was leveraged to identify 2445 differentially expressed genes responding to severe drought stress in roots. Many of the genes identified are known to be up-regulated in response to osmotic stress in pine and other plant species and encode proteins involved in both signal transduction and stress tolerance. Gene expression levels returned to control values within a 48-hour recovery period in all but 76 transcripts. Correlation network analysis indicates a scale-free network topology for the pine root transcriptome and identifies central nodes that may serve as drivers of drought-responsive transcriptome dynamics in the roots of loblolly pine. PMID:21609476

  3. Characterizing the stress/defense transcriptome of Arabidopsis

    PubMed Central

    Mahalingam, Ramamurthy; Gomez-Buitrago, AnaMaria; Eckardt, Nancy; Shah, Nigam; Guevara-Garcia, Angel; Day, Philip; Raina, Ramesh; Fedoroff, Nina V

    2003-01-01

    Background To understand the gene networks that underlie plant stress and defense responses, it is necessary to identify and characterize the genes that respond both initially and as the physiological response to the stress or pathogen develops. We used PCR-based suppression subtractive hybridization to identify Arabidopsis genes that are differentially expressed in response to ozone, bacterial and oomycete pathogens and the signaling molecules salicylic acid (SA) and jasmonic acid. Results We identified a total of 1,058 differentially expressed genes from eight stress cDNA libraries. Digital northern analysis revealed that 55% of the stress-inducible genes are rarely transcribed in unstressed plants and 17% of them were not previously represented in Arabidopsis expressed sequence tag databases. More than two-thirds of the genes in the stress cDNA collection have not been identified in previous studies as stress/defense response genes. Several stress-responsive cis-elements showed a statistically significant over-representation in the promoters of the genes in the stress cDNA collection. These include W- and G-boxes, the SA-inducible element, the abscisic acid response element and the TGA motif. Conclusions The stress cDNA collection comprises a broad repertoire of stress-responsive genes encoding proteins that are involved in both the initial and subsequent stages of the physiological response to abiotic stress and pathogens. This set of stress-, pathogen- and hormone-modulated genes is an important resource for understanding the genetic interactions underlying stress signaling and responses and may contribute to the characterization of the stress transcriptome through the construction of standardized specialized arrays. PMID:12620105

  4. Co-acting gene networks predict TRAIL responsiveness of tumour cells with high accuracy.

    PubMed

    O'Reilly, Paul; Ortutay, Csaba; Gernon, Grainne; O'Connell, Enda; Seoighe, Cathal; Boyce, Susan; Serrano, Luis; Szegezdi, Eva

    2014-12-19

    Identification of differentially expressed genes from transcriptomic studies is one of the most common mechanisms to identify tumor biomarkers. This approach however is not well suited to identify interaction between genes whose protein products potentially influence each other, which limits its power to identify molecular wiring of tumour cells dictating response to a drug. Due to the fact that signal transduction pathways are not linear and highly interlinked, the biological response they drive may be better described by the relative amount of their components and their functional relationships than by their individual, absolute expression. Gene expression microarray data for 109 tumor cell lines with known sensitivity to the death ligand cytokine tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) was used to identify genes with potential functional relationships determining responsiveness to TRAIL-induced apoptosis. The machine learning technique Random Forest in the statistical environment "R" with backward elimination was used to identify the key predictors of TRAIL sensitivity and differentially expressed genes were identified using the software GeneSpring. Gene co-regulation and statistical interaction was assessed with q-order partial correlation analysis and non-rejection rate. Biological (functional) interactions amongst the co-acting genes were studied with Ingenuity network analysis. Prediction accuracy was assessed by calculating the area under the receiver operator curve using an independent dataset. We show that the gene panel identified could predict TRAIL-sensitivity with a very high degree of sensitivity and specificity (AUC=0·84). The genes in the panel are co-regulated and at least 40% of them functionally interact in signal transduction pathways that regulate cell death and cell survival, cellular differentiation and morphogenesis. Importantly, only 12% of the TRAIL-predictor genes were differentially expressed highlighting the importance of functional interactions in predicting the biological response. The advantage of co-acting gene clusters is that this analysis does not depend on differential expression and is able to incorporate direct- and indirect gene interactions as well as tissue- and cell-specific characteristics. This approach (1) identified a descriptor of TRAIL sensitivity which performs significantly better as a predictor of TRAIL sensitivity than any previously reported gene signatures, (2) identified potential novel regulators of TRAIL-responsiveness and (3) provided a systematic view highlighting fundamental differences between the molecular wiring of sensitive and resistant cell types.

  5. Identifying ultrasensitive HGF dose-response functions in a 3D mammalian system for synthetic morphogenesis.

    PubMed

    Senthivel, Vivek Raj; Sturrock, Marc; Piedrafita, Gabriel; Isalan, Mark

    2016-12-16

    Nonlinear responses to signals are widespread natural phenomena that affect various cellular processes. Nonlinearity can be a desirable characteristic for engineering living organisms because it can lead to more switch-like responses, similar to those underlying the wiring in electronics. Steeper functions are described as ultrasensitive, and can be applied in synthetic biology by using various techniques including receptor decoys, multiple co-operative binding sites, and sequential positive feedbacks. Here, we explore the inherent non-linearity of a biological signaling system to identify functions that can potentially be exploited using cell genome engineering. For this, we performed genome-wide transcription profiling to identify genes with ultrasensitive response functions to Hepatocyte Growth Factor (HGF). We identified 3,527 genes that react to increasing concentrations of HGF, in Madin-Darby canine kidney (MDCK) cells, grown as cysts in 3D collagen cell culture. By fitting a generic Hill function to the dose-responses of these genes we obtained a measure of the ultrasensitivity of HGF-responsive genes, identifying a subset with higher apparent Hill coefficients (e.g. MMP1, TIMP1, SNORD75, SNORD86 and ERRFI1). The regulatory regions of these genes are potential candidates for future engineering of synthetic mammalian gene circuits requiring nonlinear responses to HGF signalling.

  6. NAC transcription factor genes: genome-wide identification, phylogenetic, motif and cis-regulatory element analysis in pigeonpea (Cajanus cajan (L.) Millsp.).

    PubMed

    Satheesh, Viswanathan; Jagannadham, P Tej Kumar; Chidambaranathan, Parameswaran; Jain, P K; Srinivasan, R

    2014-12-01

    The NAC (NAM, ATAF and CUC) proteins are plant-specific transcription factors implicated in development and stress responses. In the present study 88 pigeonpea NAC genes were identified from the recently published draft genome of pigeonpea by using homology based and de novo prediction programmes. These sequences were further subjected to phylogenetic, motif and promoter analyses. In motif analysis, highly conserved motifs were identified in the NAC domain and also in the C-terminal region of the NAC proteins. A phylogenetic reconstruction using pigeonpea, Arabidopsis and soybean NAC genes revealed 33 putative stress-responsive pigeonpea NAC genes. Several stress-responsive cis-elements were identified through in silico analysis of the promoters of these putative stress-responsive genes. This analysis is the first report of NAC gene family in pigeonpea and will be useful for the identification and selection of candidate genes associated with stress tolerance.

  7. Dynamic transcriptional signatures and network responses for clinical symptoms in influenza-infected human subjects using systems biology approaches.

    PubMed

    Linel, Patrice; Wu, Shuang; Deng, Nan; Wu, Hulin

    2014-10-01

    Recent studies demonstrate that human blood transcriptional signatures may be used to support diagnosis and clinical decisions for acute respiratory viral infections such as influenza. In this article, we propose to use a newly developed systems biology approach for time course gene expression data to identify significant dynamically response genes and dynamic gene network responses to viral infection. We illustrate the methodological pipeline by reanalyzing the time course gene expression data from a study with healthy human subjects challenged by live influenza virus. We observed clear differences in the number of significant dynamic response genes (DRGs) between the symptomatic and asymptomatic subjects and also identified DRG signatures for symptomatic subjects with influenza infection. The 505 common DRGs shared by the symptomatic subjects have high consistency with the signature genes for predicting viral infection identified in previous works. The temporal response patterns and network response features were carefully analyzed and investigated.

  8. Transcriptome Analysis Reveals Genes Commonly Induced by Botrytis cinerea Infection, Cold, Drought and Oxidative Stresses in Arabidopsis

    PubMed Central

    Al-Ameri, Salma; Al-Mahmoud, Bassam; Awwad, Falah; Al-Rawashdeh, Ahmed; Iratni, Rabah; AbuQamar, Synan

    2014-01-01

    Signaling pathways controlling biotic and abiotic stress responses may interact synergistically or antagonistically. To identify the similarities and differences among responses to diverse stresses, we analyzed previously published microarray data on the transcriptomic responses of Arabidopsis to infection with Botrytis cinerea (a biotic stress), and to cold, drought, and oxidative stresses (abiotic stresses). Our analyses showed that at early stages after B. cinerea inoculation, 1498 genes were up-regulated (B. cinerea up-regulated genes; BUGs) and 1138 genes were down-regulated (B. cinerea down-regulated genes; BDGs). We showed a unique program of gene expression was activated in response each biotic and abiotic stress, but that some genes were similarly induced or repressed by all of the tested stresses. Of the identified BUGs, 25%, 6% and 12% were also induced by cold, drought and oxidative stress, respectively; whereas 33%, 7% and 5.5% of the BDGs were also down-regulated by the same abiotic stresses. Coexpression and protein-protein interaction network analyses revealed a dynamic range in the expression levels of genes encoding regulatory proteins. Analysis of gene expression in response to electrophilic oxylipins suggested that these compounds are involved in mediating responses to B. cinerea infection and abiotic stress through TGA transcription factors. Our results suggest an overlap among genes involved in the responses to biotic and abiotic stresses in Arabidopsis. Changes in the transcript levels of genes encoding components of the cyclopentenone signaling pathway in response to biotic and abiotic stresses suggest that the oxylipin signal transduction pathway plays a role in plant defense. Identifying genes that are commonly expressed in response to environmental stresses, and further analyzing the functions of their encoded products, will increase our understanding of the plant stress response. This information could identify targets for genetic modification to improve plant resistance to multiple stresses. PMID:25422934

  9. Comparison of genomics and functional imaging from canine sarcomas treated with thermoradiotherapy predicts therapeutic response and identifies combination therapeutics

    PubMed Central

    Chi, Jen-Tsan; Thrall, Donald E.; Jiang, Chen; Snyder, Stacey; Fels, Diane; Landon, Chelsea; McCall, Linda; Lan, Lan; Hauck, Marlene; MacFall, James R.; Viglianti, Benjamin L.; Dewhirst, Mark W.

    2011-01-01

    Purpose While hyperthermia is an effective adjuvant treatment to radiotherapy, we don’t completely understand the nature of the response heterogeneity. Experimental Design We performed gene expression analysis of 22 spontaneous canine sarcomas before and after the first hyperthermia treatment administered as an adjuvant to radiotherapy. In parallel, diffusion weighted MRI (DWI) was done prior to the treatment course and at the end of therapy. Results From the integrative analysis of gene expression and DWI, we identified significant correlation between tumor responses with genes involved in VEGF signaling, telomerase, DNA repair and inflammation. The treatment-induced changes in gene expression identified two distinct tumor subtypes with significant differences in their gene expression and treatment response, as defined by changes in DWI. The two tumor subtypes could also be readily identified by pre-treatment gene expression. The tumor subtypes, with stronger expression response and DWI increase, had higher levels of hsp70, POT1 and centrosomal proteins and lower levels of CD31, vWF and transferrin. Such differential gene expression between the two subtypes was used to interrogate connectivity map and identify linkages to an HSP90 inhibitor, geldanamycin. We further validated the ability of geldanamycin to enhance cell killing of human tumor cells with hyperthermia and radiotherapy in clonogenic assays. Conclusions To our knowledge, this is one of the first successful attempts to link changes in gene expression and functional imaging to understand the response heterogeneity and identify compounds enhancing thermoradiotherapy. This study also demonstrates the value of canine tumors to provide information generalizable to human tumors. PMID:21292819

  10. Identifying anti-cancer drug response related genes using an integrative analysis of transcriptomic and genomic variations with cell line-based drug perturbations.

    PubMed

    Sun, Yi; Zhang, Wei; Chen, Yunqin; Ma, Qin; Wei, Jia; Liu, Qi

    2016-02-23

    Clinical responses to anti-cancer therapies often only benefit a defined subset of patients. Predicting the best treatment strategy hinges on our ability to effectively translate genomic data into actionable information on drug responses. To achieve this goal, we compiled a comprehensive collection of baseline cancer genome data and drug response information derived from a large panel of cancer cell lines. This data set was applied to identify the signature genes relevant to drug sensitivity and their resistance by integrating CNVs and the gene expression of cell lines with in vitro drug responses. We presented an efficient in-silico pipeline for integrating heterogeneous cell line data sources with the simultaneous modeling of drug response values across all the drugs and cell lines. Potential signature genes correlated with drug response (sensitive or resistant) in different cancer types were identified. Using signature genes, our collaborative filtering-based drug response prediction model outperformed the 44 algorithms submitted to the DREAM competition on breast cancer cells. The functions of the identified drug response related signature genes were carefully analyzed at the pathway level and the synthetic lethality level. Furthermore, we validated these signature genes by applying them to the classification of the different subtypes of the TCGA tumor samples, and further uncovered their in vivo implications using clinical patient data. Our work may have promise in translating genomic data into customized marker genes relevant to the response of specific drugs for a specific cancer type of individual patients.

  11. Transcriptome analysis of nitric oxide-responsive genes in upland cotton (Gossypium hirsutum).

    PubMed

    Huang, Juan; Wei, Hengling; Li, Libei; Yu, Shuxun

    2018-01-01

    Nitric oxide (NO) is an important signaling molecule with diverse physiological functions in plants. It is therefore important to characterize the downstream genes and signal transduction networks modulated by NO. Here, we identified 1,932 differentially expressed genes (DEGs) responding to NO in upland cotton using high throughput tag sequencing. The results of quantitative real-time polymerase chain reaction (qRT-PCR) analysis of 25 DEGs showed good consistency. Gene Ontology (GO) and KEGG pathway were analyzed to gain a better understanding of these DEGs. We identified 157 DEGs belonging to 36 transcription factor (TF) families and 72 DEGs related to eight plant hormones, among which several TF families and hormones were involved in stress responses. Hydrogen peroxide and malondialdehyde (MDA) contents were increased, as well related genes after treatment with sodium nitroprusside (SNP) (an NO donor), suggesting a role for NO in the plant stress response. Finally, we compared of the current and previous data indicating a massive number of NO-responsive genes at the large-scale transcriptome level. This study evaluated the landscape of NO-responsive genes in cotton and identified the involvement of NO in the stress response. Some of the identified DEGs represent good candidates for further functional analysis in cotton.

  12. ChIP-Seq Analysis for Identifying Genome-Wide Histone Modifications Associated with Stress-Responsive Genes in Plants.

    PubMed

    Li, Guosheng; Jagadeeswaran, Guru; Mort, Andrew; Sunkar, Ramanjulu

    2017-01-01

    Histone modifications represent the crux of epigenetic gene regulation essential for most biological processes including abiotic stress responses in plants. Thus, identification of histone modifications at the genome-scale can provide clues for how some genes are 'turned-on' while some others are "turned-off" in response to stress. This chapter details a step-by-step protocol for identifying genome-wide histone modifications associated with stress-responsive gene regulation using chromatin immunoprecipitation (ChIP) followed by sequencing of the DNA (ChIP-seq).

  13. Genome-Wide and Gene-Based Meta-Analyses Identify Novel Loci Influencing Blood Pressure Response to Hydrochlorothiazide.

    PubMed

    Salvi, Erika; Wang, Zhiying; Rizzi, Federica; Gong, Yan; McDonough, Caitrin W; Padmanabhan, Sandosh; Hiltunen, Timo P; Lanzani, Chiara; Zaninello, Roberta; Chittani, Martina; Bailey, Kent R; Sarin, Antti-Pekka; Barcella, Matteo; Melander, Olle; Chapman, Arlene B; Manunta, Paolo; Kontula, Kimmo K; Glorioso, Nicola; Cusi, Daniele; Dominiczak, Anna F; Johnson, Julie A; Barlassina, Cristina; Boerwinkle, Eric; Cooper-DeHoff, Rhonda M; Turner, Stephen T

    2017-01-01

    This study aimed to identify novel loci influencing the antihypertensive response to hydrochlorothiazide monotherapy. A genome-wide meta-analysis of blood pressure (BP) response to hydrochlorothiazide was performed in 1739 white hypertensives from 6 clinical trials within the International Consortium for Antihypertensive Pharmacogenomics Studies, making it the largest study to date of its kind. No signals reached genome-wide significance (P<5×10 - 8 ), and the suggestive regions (P<10 -5 ) were cross-validated in 2 black cohorts treated with hydrochlorothiazide. In addition, a gene-based analysis was performed on candidate genes with previous evidence of involvement in diuretic response, in BP regulation, or in hypertension susceptibility. Using the genome-wide meta-analysis approach, with validation in blacks, we identified 2 suggestive regulatory regions linked to gap junction protein α1 gene (GJA1) and forkhead box A1 gene (FOXA1), relevant for cardiovascular and kidney function. With the gene-based approach, we identified hydroxy-delta-5-steroid dehydrogenase, 3 β- and steroid δ-isomerase 1 gene (HSD3B1) as significantly associated with BP response (P<2.28×10 - 4 ). HSD3B1 encodes the 3β-hydroxysteroid dehydrogenase enzyme and plays a crucial role in the biosynthesis of aldosterone and endogenous ouabain. By amassing all of the available pharmacogenomic studies of BP response to hydrochlorothiazide, and using 2 different analytic approaches, we identified 3 novel loci influencing BP response to hydrochlorothiazide. The gene-based analysis, never before applied to pharmacogenomics of antihypertensive drugs to our knowledge, provided a powerful strategy to identify a locus of interest, which was not identified in the genome-wide meta-analysis because of high allelic heterogeneity. These data pave the way for future investigations on new pathways and drug targets to enhance the current understanding of personalized antihypertensive treatment. © 2016 American Heart Association, Inc.

  14. Combining suppressive subtractive hybridization and cDNA microarrays to identify dietary phosphorus-responsive genes of the rainbow trout (Oncorhynchus mykiss) kidney.

    PubMed

    Lake, Jennifer; Gravel, Catherine; Koko, Gabriel Koffi D; Robert, Claude; Vandenberg, Grant W

    2010-03-01

    Phosphorus (P)-responsive genes and how they regulate renal adaptation to phosphorous-deficient diets in animals, including fish, are not well understood. RNA abundance profiling using cDNA microarrays is an efficient approach to study nutrient-gene interactions and identify these dietary P-responsive genes. To test the hypothesis that dietary P-responsive genes are differentially expressed in fish fed varying P levels, rainbow trout were fed a practical high-P diet (R20: 0.96% P) or a low-P diet (R0: 0.38% P) for 7 weeks. The differentially-expressed genes between dietary groups were identified and compared from the kidney by combining suppressive subtractive hybridization (SSH) with cDNA microarray analysis. A number of genes were confirmed by real-time PCR, and correlated with plasma and bone P concentrations. Approximately 54 genes were identified as potential dietary P-responsive after 7 weeks on a diet deficient in P according to cDNA microarray analysis. Of 18 selected genes, 13 genes were confirmed to be P-responsive at 7 weeks by real-time PCR analysis, including: iNOS, cytochrome b, cytochrome c oxidase subunit II , alpha-globin I, beta-globin, ATP synthase, hyperosmotic protein 21, COL1A3, Nkef, NDPK, glucose phosphate isomerase 1, Na+/H+ exchange protein and GDP dissociation inhibitor 2. Many of these dietary P-responsive genes responded in a moderate way (R0/R20 ratio: <2-3 or >0.5) and in a transient manner to dietary P limitation. In summary, renal adaptation to dietary P deficiency in trout involves changes in the expression of several genes, suggesting a profile of metabolic stress, since many of these differentially-expressed candidates are associated with the cellular adaptative responses. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.

  15. Human Adaptation Genetic Response Suites: Toward New Interventions and Countermeasures for Spaceflight

    NASA Technical Reports Server (NTRS)

    Sundaresan, A.; Pellis, N. R.

    2005-01-01

    Genetic response suites in human lymphocytes in response to microgravity are important to identify and further study in order to augment human physiological adaptation to novel environments. Emerging technologies, such as DNA micro array profiling, have the potential to identify novel genes that are involved in mediating adaptation to these environments. These genes may prove to be therapeutically valuable as new targets for countermeasures, or as predictive biomarkers of response to these new environments. Human lymphocytes cultured in lg and microgravity analog culture were analyzed for their differential gene expression response. Different groups of genes related to the immune response, cardiovascular system and stress response were then analyzed. Analysis of cells from multiple donors reveals a small shared set that are likely to be essential to adaptation. These three groups focus on human adaptation to new environments. The shared set contains genes related to T cell activation, immune response and stress response to analog microgravity.

  16. Image-guided genomic analysis of tissue response to laser-induced thermal stress

    NASA Astrophysics Data System (ADS)

    Mackanos, Mark A.; Helms, Mike; Kalish, Flora; Contag, Christopher H.

    2011-05-01

    The cytoprotective response to thermal injury is characterized by transcriptional activation of ``heat shock proteins'' (hsp) and proinflammatory proteins. Expression of these proteins may predict cellular survival. Microarray analyses were performed to identify spatially distinct gene expression patterns responding to thermal injury. Laser injury zones were identified by expression of a transgene reporter comprised of the 70 kD hsp gene and the firefly luciferase coding sequence. Zones included the laser spot, the surrounding region where hsp70-luc expression was increased, and a region adjacent to the surrounding region. A total of 145 genes were up-regulated in the laser irradiated region, while 69 were up-regulated in the adjacent region. At 7 hours the chemokine Cxcl3 was the highest expressed gene in the laser spot (24 fold) and adjacent region (32 fold). Chemokines were the most common up-regulated genes identified. Microarray gene expression was successfully validated using qRT- polymerase chain reaction for selected genes of interest. The early response genes are likely involved in cytoprotection and initiation of the healing response. Their regulatory elements will benefit creating the next generation reporter mice and controlling expression of therapeutic proteins. The identified genes serve as drug development targets that may prevent acute tissue damage and accelerate healing.

  17. Altered gene expression changes in Arabidopsis leaf tissues and protoplasts in response to Plum pox virus infection

    PubMed Central

    Babu, Mohan; Griffiths, Jonathan S; Huang, Tyng-Shyan; Wang, Aiming

    2008-01-01

    Background Virus infection induces the activation and suppression of global gene expression in the host. Profiling gene expression changes in the host may provide insights into the molecular mechanisms that underlie host physiological and phenotypic responses to virus infection. In this study, the Arabidopsis Affymetrix ATH1 array was used to assess global gene expression changes in Arabidopsis thaliana plants infected with Plum pox virus (PPV). To identify early genes in response to PPV infection, an Arabidopsis synchronized single-cell transformation system was developed. Arabidopsis protoplasts were transfected with a PPV infectious clone and global gene expression changes in the transfected protoplasts were profiled. Results Microarray analysis of PPV-infected Arabidopsis leaf tissues identified 2013 and 1457 genes that were significantly (Q ≤ 0.05) up- (≥ 2.5 fold) and downregulated (≤ -2.5 fold), respectively. Genes associated with soluble sugar, starch and amino acid, intracellular membrane/membrane-bound organelles, chloroplast, and protein fate were upregulated, while genes related to development/storage proteins, protein synthesis and translation, and cell wall-associated components were downregulated. These gene expression changes were associated with PPV infection and symptom development. Further transcriptional profiling of protoplasts transfected with a PPV infectious clone revealed the upregulation of defence and cellular signalling genes as early as 6 hours post transfection. A cross sequence comparison analysis of genes differentially regulated by PPV-infected Arabidopsis leaves against uniEST sequences derived from PPV-infected leaves of Prunus persica, a natural host of PPV, identified orthologs related to defence, metabolism and protein synthesis. The cross comparison of genes differentially regulated by PPV infection and by the infections of other positive sense RNA viruses revealed a common set of 416 genes. These identified genes, particularly the early responsive genes, may be critical in virus infection. Conclusion Gene expression changes in PPV-infected Arabidopsis are the molecular basis of stress and defence-like responses, PPV pathogenesis and symptom development. The differentially regulated genes, particularly the early responsive genes, and a common set of genes regulated by infections of PPV and other positive sense RNA viruses identified in this study are candidates suitable for further functional characterization to shed lights on molecular virus-host interactions. PMID:18613973

  18. Gene Deletions in Mycobacterium bovis BCG Stimulate Increased CD8+ T Cell Responses

    PubMed Central

    Panas, Michael W.; Sixsmith, Jaimie D.; White, KeriAnn; Korioth-Schmitz, Birgit; Shields, Shana T.; Moy, Brian T.; Lee, Sunhee; Schmitz, Joern E.; Jacobs, William R.; Porcelli, Steven A.; Haynes, Barton F.; Letvin, Norman L.

    2014-01-01

    Mycobacteria, the etiological agents of tuberculosis and leprosy, have coevolved with mammals for millions of years and have numerous ways of suppressing their host's immune response. It has been suggested that mycobacteria may contain genes that reduce the host's ability to elicit CD8+ T cell responses. We screened 3,290 mutant Mycobacterium bovis bacillus Calmette Guerin (BCG) strains to identify genes that decrease major histocompatibility complex (MHC) class I presentation of mycobacterium-encoded epitope peptides. Through our analysis, we identified 16 mutant BCG strains that generated increased transgene product-specific CD8+ T cell responses. The genes disrupted in these mutant strains had disparate predicted functions. Reconstruction of strains via targeted deletion of genes identified in the screen recapitulated the enhanced immunogenicity phenotype of the original mutant strains. When we introduced the simian immunodeficiency virus (SIV) gag gene into several of these novel BCG strains, we observed enhanced SIV Gag-specific CD8+ T cell responses in vivo. This study demonstrates that mycobacteria carry numerous genes that act to dampen CD8+ T cell responses and suggests that genetic modification of these genes may generate a novel group of recombinant BCG strains capable of serving as more effective and immunogenic vaccine vectors. PMID:25287928

  19. Gene deletions in Mycobacterium bovis BCG stimulate increased CD8+ T cell responses.

    PubMed

    Panas, Michael W; Sixsmith, Jaimie D; White, KeriAnn; Korioth-Schmitz, Birgit; Shields, Shana T; Moy, Brian T; Lee, Sunhee; Schmitz, Joern E; Jacobs, William R; Porcelli, Steven A; Haynes, Barton F; Letvin, Norman L; Gillard, Geoffrey O

    2014-12-01

    Mycobacteria, the etiological agents of tuberculosis and leprosy, have coevolved with mammals for millions of years and have numerous ways of suppressing their host's immune response. It has been suggested that mycobacteria may contain genes that reduce the host's ability to elicit CD8(+) T cell responses. We screened 3,290 mutant Mycobacterium bovis bacillus Calmette Guerin (BCG) strains to identify genes that decrease major histocompatibility complex (MHC) class I presentation of mycobacterium-encoded epitope peptides. Through our analysis, we identified 16 mutant BCG strains that generated increased transgene product-specific CD8(+) T cell responses. The genes disrupted in these mutant strains had disparate predicted functions. Reconstruction of strains via targeted deletion of genes identified in the screen recapitulated the enhanced immunogenicity phenotype of the original mutant strains. When we introduced the simian immunodeficiency virus (SIV) gag gene into several of these novel BCG strains, we observed enhanced SIV Gag-specific CD8(+) T cell responses in vivo. This study demonstrates that mycobacteria carry numerous genes that act to dampen CD8(+) T cell responses and suggests that genetic modification of these genes may generate a novel group of recombinant BCG strains capable of serving as more effective and immunogenic vaccine vectors. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  20. The allostatic impact of chronic ethanol on gene expression: A genetic analysis of chronic intermittent ethanol treatment in the BXD cohort

    PubMed Central

    van der Vaart, Andrew D.; Wolstenholme, Jennifer T.; Smith, Maren L.; Harris, Guy M.; Lopez, Marcelo F.; Wolen, Aaron R.; Becker, Howard C.; Williams, Robert W.; Miles, Michael F.

    2016-01-01

    The transition from acute to chronic ethanol exposure leads to lasting behavioral and physiological changes such as increased consumption, dependence, and withdrawal. Changes in brain gene expression are hypothesized to underlie these adaptive responses to ethanol. Previous studies on acute ethanol identified genetic variation in brain gene expression networks and behavioral responses to ethanol across the BXD panel of recombinant inbred mice. In this work, we have performed the first joint genetic and genomic analysis of transcriptome shifts in response to chronic intermittent ethanol (CIE) by vapor chamber exposure in a BXD cohort. CIE treatment is known to produce significant and sustained changes in ethanol consumption with repeated cycles of ethanol vapor. Using Affymetrix microarray analysis of prefrontal cortex (PFC) and nucleus accumbens (NAC) RNA, we compared CIE expression responses to those seen following acute ethanol treatment, and to voluntary ethanol consumption. Gene expression changes in PFC and NAC after CIE overlapped significantly across brain regions and with previously published expression following acute ethanol. Genes highly modulated by CIE were enriched for specific biological processes including synaptic transmission, neuron ensheathment, intracellular signaling, and neuronal projection development. Expression quantitative trait locus (eQTL) analyses identified genomic loci associated with ethanol-induced transcriptional changes with largely distinct loci identified between brain regions. Correlating CIE-regulated genes to ethanol consumption data identified specific genes highly associated with variation in the increase in drinking seen with repeated cycles of CIE. In particular, multiple myelin-related genes were identified. Furthermore, genetic variance in or near dynamin3 (Dnm3) on Chr1 at ~164 Mb may have a major regulatory role in CIE-responsive gene expression. Dnm3 expression correlates significantly with ethanol consumption, is contained in a highly ranked functional group of CIE-regulated genes in the NAC, and has a cis-eQTL within a genomic region linked with multiple CIE-responsive genes. PMID:27838001

  1. Identifying key genes in rheumatoid arthritis by weighted gene co-expression network analysis.

    PubMed

    Ma, Chunhui; Lv, Qi; Teng, Songsong; Yu, Yinxian; Niu, Kerun; Yi, Chengqin

    2017-08-01

    This study aimed to identify rheumatoid arthritis (RA) related genes based on microarray data using the WGCNA (weighted gene co-expression network analysis) method. Two gene expression profile datasets GSE55235 (10 RA samples and 10 healthy controls) and GSE77298 (16 RA samples and seven healthy controls) were downloaded from Gene Expression Omnibus database. Characteristic genes were identified using metaDE package. WGCNA was used to find disease-related networks based on gene expression correlation coefficients, and module significance was defined as the average gene significance of all genes used to assess the correlation between the module and RA status. Genes in the disease-related gene co-expression network were subject to functional annotation and pathway enrichment analysis using Database for Annotation Visualization and Integrated Discovery. Characteristic genes were also mapped to the Connectivity Map to screen small molecules. A total of 599 characteristic genes were identified. For each dataset, characteristic genes in the green, red and turquoise modules were most closely associated with RA, with gene numbers of 54, 43 and 79, respectively. These genes were enriched in totally enriched in 17 Gene Ontology terms, mainly related to immune response (CD97, FYB, CXCL1, IKBKE, CCR1, etc.), inflammatory response (CD97, CXCL1, C3AR1, CCR1, LYZ, etc.) and homeostasis (C3AR1, CCR1, PLN, CCL19, PPT1, etc.). Two small-molecule drugs sanguinarine and papaverine were predicted to have a therapeutic effect against RA. Genes related to immune response, inflammatory response and homeostasis presumably have critical roles in RA pathogenesis. Sanguinarine and papaverine have a potential therapeutic effect against RA. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  2. The Arabidopsis polyamine transporter LHR1/PUT3 modulates heat responsive gene expression by enhancing mRNA stability.

    PubMed

    Shen, Yun; Ruan, Qingxia; Chai, Haoxi; Yuan, Yongze; Yang, Wannian; Chen, Junping; Xin, Zhanguo; Shi, Huazhong

    2016-12-01

    Polyamines involve in gene regulation by interacting with and modulating the functions of various anionic macromolecules such as DNA, RNA and proteins. In this study, we identified an important function of the polyamine transporter LHR1 (LOWER EXPRESSION OF HEAT RESPONSIVE GENE1) in heat-inducible gene expression in Arabidopsis thaliana. The lhr1 mutant was isolated through a forward genetic screening for altered expression of the luciferase reporter gene driven by the promoter from the heat-inducible gene AtHSP18.2. The lhr1 mutant showed reduced induction of the luciferase gene in response to heat stress and was more sensitive to high temperature than the wild type. Map-based cloning identified that the LHR1 gene encodes the polyamine transporter PUT3 (POLYAMINE UPTAKE TRANSPORTER 3) localized in the plasma membrane. The LHR1/PUT3 is required for the uptake of extracellular polyamines and plays an important role in stabilizing the mRNAs of several crucial heat stress responsive genes under high temperature. Genome-wide gene expression analysis using RNA-seq identified an array of differentially expressed genes, among which the transcript levels of some of the heat shock protein genes significantly reduced in response to prolonged heat stress in the lhr1 mutant. Our findings revealed an important heat stress response and tolerance mechanism involving polyamine influx which modulates mRNA stability of heat-inducible genes under heat stress conditions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  3. Integrative Analysis of Response to Tamoxifen Treatment in ER-Positive Breast Cancer Using GWAS Information and Transcription Profiling.

    PubMed

    Hicks, Chindo; Kumar, Ranjit; Pannuti, Antonio; Miele, Lucio

    2012-01-01

    Variable response and resistance to tamoxifen treatment in breast cancer patients remains a major clinical problem. To determine whether genes and biological pathways containing SNPs associated with risk for breast cancer are dysregulated in response to tamoxifen treatment, we performed analysis combining information from 43 genome-wide association studies with gene expression data from 298 ER(+) breast cancer patients treated with tamoxifen and 125 ER(+) controls. We identified 95 genes which distinguished tamoxifen treated patients from controls. Additionally, we identified 54 genes which stratified tamoxifen treated patients into two distinct groups. We identified biological pathways containing SNPs associated with risk for breast cancer, which were dysregulated in response to tamoxifen treatment. Key pathways identified included the apoptosis, P53, NFkB, DNA repair and cell cycle pathways. Combining GWAS with transcription profiling provides a unified approach for associating GWAS findings with response to drug treatment and identification of potential drug targets.

  4. Identification of aluminum-regulated genes by cDNA-AFLP analysis of roots in two contrasting genotypes of highbush blueberry (Vaccinium corymbosum L.).

    PubMed

    Inostroza-Blancheteau, Claudio; Aquea, Felipe; Reyes-Díaz, Marjorie; Alberdi, Miren; Arce-Johnson, Patricio

    2011-09-01

    To investigate the molecular mechanisms of Al(3+)-stress in blueberry, a cDNA-amplified fragment length polymorphism (cDNA-AFLP) analysis was employed to identify Al-regulated genes in roots of contrasting genotypes of highbush blueberry (Brigitta, Al(3+)-resistant and Bluegold, Al(3+)-sensitive). Plants grown in hydroponic culture were treated with 0 and 100 μM Al(3+) and collected at different times over 48 h. Seventy transcript-derived fragments (TDFs) were identified as being Al(3+) responsive, 31 of which showed significant homology to genes with known or putative functions. Twelve TDFs were homologous to uncharacterized genes and 27 did not have significant matches. The expression pattern of several of the genes with known functions in other species was confirmed by quantitative relative real-time RT-PCR. Twelve genes of known or putative function were related to cellular metabolism, nine associated to stress responses and other transcription and transport facilitation processes. Genes involved in signal transduction, photosynthetic and energy processes were also identified, suggesting that a multitude of processes are implicated in the Al(3+)-stress response as reported previously for other species. The Al(3+)-stress response genes identified in this study could be involved in Al(3+)-resistance in woody plants.

  5. Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.

    PubMed

    Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H

    2009-05-01

    Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.

  6. Identification of NH4+-regulated genes of Herbaspirillum seropedicae by random insertional mutagenesis.

    PubMed

    Schwab, Stefan; Ramos, Humberto J; Souza, Emanuel M; Pedrosa, Fábio O; Yates, Marshall G; Chubatsu, Leda S; Rigo, Liu U

    2007-05-01

    Random mutagenesis using transposons with promoterless reporter genes has been widely used to examine differential gene expression patterns in bacteria. Using this approach, we have identified 26 genes of the endophytic nitrogen-fixing bacterium Herbaspirillum seropedicae regulated in response to ammonium content in the growth medium. These include nine genes involved in the transport of nitrogen compounds, such as the high-affinity ammonium transporter AmtB, and uptake systems for alternative nitrogen sources; nine genes coding for proteins responsible for restoring intracellular ammonium levels through enzymatic reactions, such as nitrogenase, amidase, and arginase; and a third group includes metabolic switch genes, coding for sensor kinases or transcription regulation factors, whose role in metabolism was previously unknown. Also, four genes identified were of unknown function. This paper describes their involvement in response to ammonium limitation. The results provide a preliminary profile of the metabolic response of Herbaspirillum seropedicae to ammonium stress.

  7. Gene interactions in the DNA damage-response pathway identified by genome-wide RNA-interference analysis of synthetic lethality

    PubMed Central

    van Haaften, Gijs; Vastenhouw, Nadine L.; Nollen, Ellen A. A.; Plasterk, Ronald H. A.; Tijsterman, Marcel

    2004-01-01

    Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect the germ line against DNA double-strand breaks. Besides known DNA-repair proteins such as the C. elegans orthologs of TopBP1, RPA2, and RAD51, eight genes previously unassociated with a double-strand-break response were identified. Knockdown of these genes increased sensitivity to ionizing radiation and camptothecin and resulted in increased chromosomal nondisjunction. All genes have human orthologs that may play a role in human carcinogenesis. PMID:15326288

  8. Knowledge-guided gene prioritization reveals new insights into the mechanisms of chemoresistance.

    PubMed

    Emad, Amin; Cairns, Junmei; Kalari, Krishna R; Wang, Liewei; Sinha, Saurabh

    2017-08-11

    Identification of genes whose basal mRNA expression predicts the sensitivity of tumor cells to cytotoxic treatments can play an important role in individualized cancer medicine. It enables detailed characterization of the mechanism of action of drugs. Furthermore, screening the expression of these genes in the tumor tissue may suggest the best course of chemotherapy or a combination of drugs to overcome drug resistance. We developed a computational method called ProGENI to identify genes most associated with the variation of drug response across different individuals, based on gene expression data. In contrast to existing methods, ProGENI also utilizes prior knowledge of protein-protein and genetic interactions, using random walk techniques. Analysis of two relatively new and large datasets including gene expression data on hundreds of cell lines and their cytotoxic responses to a large compendium of drugs reveals a significant improvement in prediction of drug sensitivity using genes identified by ProGENI compared to other methods. Our siRNA knockdown experiments on ProGENI-identified genes confirmed the role of many new genes in sensitivity to three chemotherapy drugs: cisplatin, docetaxel, and doxorubicin. Based on such experiments and extensive literature survey, we demonstrate that about 73% of our top predicted genes modulate drug response in selected cancer cell lines. In addition, global analysis of genes associated with groups of drugs uncovered pathways of cytotoxic response shared by each group. Our results suggest that knowledge-guided prioritization of genes using ProGENI gives new insight into mechanisms of drug resistance and identifies genes that may be targeted to overcome this phenomenon.

  9. Time-Series Transcriptomics Reveals That AGAMOUS-LIKE22 Affects Primary Metabolism and Developmental Processes in Drought-Stressed Arabidopsis[OPEN

    PubMed Central

    Penfold, Christopher A.; Jenkins, Dafyd J.; Legaie, Roxane; Lawson, Tracy; Vialet-Chabrand, Silvere R.M.; Subramaniam, Sunitha; Hickman, Richard; Feil, Regina; Bowden, Laura; Hill, Claire; Lunn, John E.; Finkenstädt, Bärbel; Buchanan-Wollaston, Vicky; Beynon, Jim; Wild, David L.; Ott, Sascha

    2016-01-01

    In Arabidopsis thaliana, changes in metabolism and gene expression drive increased drought tolerance and initiate diverse drought avoidance and escape responses. To address regulatory processes that link these responses, we set out to identify genes that govern early responses to drought. To do this, a high-resolution time series transcriptomics data set was produced, coupled with detailed physiological and metabolic analyses of plants subjected to a slow transition from well-watered to drought conditions. A total of 1815 drought-responsive differentially expressed genes were identified. The early changes in gene expression coincided with a drop in carbon assimilation, and only in the late stages with an increase in foliar abscisic acid content. To identify gene regulatory networks (GRNs) mediating the transition between the early and late stages of drought, we used Bayesian network modeling of differentially expressed transcription factor (TF) genes. This approach identified AGAMOUS-LIKE22 (AGL22), as key hub gene in a TF GRN. It has previously been shown that AGL22 is involved in the transition from vegetative state to flowering but here we show that AGL22 expression influences steady state photosynthetic rates and lifetime water use. This suggests that AGL22 uniquely regulates a transcriptional network during drought stress, linking changes in primary metabolism and the initiation of stress responses. PMID:26842464

  10. Human adaptation genetic response suites: Toward new interventions and countermeasures for spaceflight

    NASA Astrophysics Data System (ADS)

    Sundaresan, A.; Pellis, N. R.

    2005-08-01

    Genetic response suites in human lymphocytes in response to microgravity are important to identify and further study in order to augment human physiological adaptation to novel environments. Emerging technologies, such as DNA micro array profiling, have the potential to identify novel genes that are involved in mediating adaptation to these environments. These genes may prove to be therapeutically valuable as new targets for countermeasures, or as predictive biomarkers of response to these new environments. Human lymphocytes cultured in 1g and microgravity analog culture were analyzed for their differential gene expression response. Different groups of genes related to the immune response, cardiovascular system and stress response were then analyzed. Analysis of cells from multiple donors reveals a small shared set that are likely to be essential to adaptation. These three groups focus on human adaptation to new environments. The shared set contains genes related to T cell activation, immune response and stress response to analog microgravity.

  11. Prediction of chemo-response in serous ovarian cancer.

    PubMed

    Gonzalez Bosquet, Jesus; Newtson, Andreea M; Chung, Rebecca K; Thiel, Kristina W; Ginader, Timothy; Goodheart, Michael J; Leslie, Kimberly K; Smith, Brian J

    2016-10-19

    Nearly one-third of serous ovarian cancer (OVCA) patients will not respond to initial treatment with surgery and chemotherapy and die within one year of diagnosis. If patients who are unlikely to respond to current standard therapy can be identified up front, enhanced tumor analyses and treatment regimens could potentially be offered. Using the Cancer Genome Atlas (TCGA) serous OVCA database, we previously identified a robust molecular signature of 422-genes associated with chemo-response. Our objective was to test whether this signature is an accurate and sensitive predictor of chemo-response in serous OVCA. We first constructed prediction models to predict chemo-response using our previously described 422-gene signature that was associated with response to treatment in serous OVCA. Performance of all prediction models were measured with area under the curves (AUCs, a measure of the model's accuracy) and their respective confidence intervals (CIs). To optimize the prediction process, we determined which elements of the signature most contributed to chemo-response prediction. All prediction models were replicated and validated using six publicly available independent gene expression datasets. The 422-gene signature prediction models predicted chemo-response with AUCs of ~70 %. Optimization of prediction models identified the 34 most important genes in chemo-response prediction. These 34-gene models had improved performance, with AUCs approaching 80 %. Both 422-gene and 34-gene prediction models were replicated and validated in six independent datasets. These prediction models serve as the foundation for the future development and implementation of a diagnostic tool to predict response to chemotherapy for serous OVCA patients.

  12. Genome-wide identification of 99 autophagy-related (Atg) genes in the monogonont rotifer Brachionus spp. and transcriptional modulation in response to cadmium.

    PubMed

    Kang, Hye-Min; Lee, Jin-Sol; Kim, Min-Sub; Lee, Young Hwan; Jung, Jee-Hyun; Hagiwara, Atsushi; Zhou, Bingsheng; Lee, Jae-Seong; Jeong, Chang-Bum

    2018-05-30

    Autophagy originated from the common ancestor of all life forms, and its function is highly conserved from yeast to humans. Autophagy plays a key role in various fundamental biological processes including defense, and has developed through serial interactions of multiple gene sets referred to as autophagy-related (Atg) genes. Despite their significance in metazoan life and evolution, few studies have been conducted to identify these genes in aquatic invertebrates. In this study, we identified whole Atg genes in four Brachionus rotifer spp., namely B. calyciflorus, B. koreanus, B. plicatilis, and B. rotundiformis, through searches of their entire genomes; and we annotated them according to the yeast nomenclature. Twenty-four genes orthologous to yeast genes were present in all of the Brachionus spp. while three additional gene duplicates were identified in the genome of B. koreanus, indicating that these genes had diversified during the speciation. Also, their transcriptional responses to cadmium exposure indicated regulation by cadmium-induced oxidative-stress-related signaling pathways. This study provides valuable information on 99 conserved Atg genes involved in autophagosome formation in Brachionus spp., with transcriptional modulation in response to cadmium, in the context of the role of autophagy in the damage response. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Unity in defence: honeybee workers exhibit conserved molecular responses to diverse pathogens.

    PubMed

    Doublet, Vincent; Poeschl, Yvonne; Gogol-Döring, Andreas; Alaux, Cédric; Annoscia, Desiderato; Aurori, Christian; Barribeau, Seth M; Bedoya-Reina, Oscar C; Brown, Mark J F; Bull, James C; Flenniken, Michelle L; Galbraith, David A; Genersch, Elke; Gisder, Sebastian; Grosse, Ivo; Holt, Holly L; Hultmark, Dan; Lattorff, H Michael G; Le Conte, Yves; Manfredini, Fabio; McMahon, Dino P; Moritz, Robin F A; Nazzi, Francesco; Niño, Elina L; Nowick, Katja; van Rij, Ronald P; Paxton, Robert J; Grozinger, Christina M

    2017-03-02

    Organisms typically face infection by diverse pathogens, and hosts are thought to have developed specific responses to each type of pathogen they encounter. The advent of transcriptomics now makes it possible to test this hypothesis and compare host gene expression responses to multiple pathogens at a genome-wide scale. Here, we performed a meta-analysis of multiple published and new transcriptomes using a newly developed bioinformatics approach that filters genes based on their expression profile across datasets. Thereby, we identified common and unique molecular responses of a model host species, the honey bee (Apis mellifera), to its major pathogens and parasites: the Microsporidia Nosema apis and Nosema ceranae, RNA viruses, and the ectoparasitic mite Varroa destructor, which transmits viruses. We identified a common suite of genes and conserved molecular pathways that respond to all investigated pathogens, a result that suggests a commonality in response mechanisms to diverse pathogens. We found that genes differentially expressed after infection exhibit a higher evolutionary rate than non-differentially expressed genes. Using our new bioinformatics approach, we unveiled additional pathogen-specific responses of honey bees; we found that apoptosis appeared to be an important response following microsporidian infection, while genes from the immune signalling pathways, Toll and Imd, were differentially expressed after Varroa/virus infection. Finally, we applied our bioinformatics approach and generated a gene co-expression network to identify highly connected (hub) genes that may represent important mediators and regulators of anti-pathogen responses. Our meta-analysis generated a comprehensive overview of the host metabolic and other biological processes that mediate interactions between insects and their pathogens. We identified key host genes and pathways that respond to phylogenetically diverse pathogens, representing an important source for future functional studies as well as offering new routes to identify or generate pathogen resilient honey bee stocks. The statistical and bioinformatics approaches that were developed for this study are broadly applicable to synthesize information across transcriptomic datasets. These approaches will likely have utility in addressing a variety of biological questions.

  14. Deciphering molecular circuits from genetic variation underlying transcriptional responsiveness to stimuli

    PubMed Central

    Gat-Viks, Irit; Chevrier, Nicolas; Wilentzik, Roni; Eisenhaure, Thomas; Raychowdhury, Raktima; Steuerman, Yael; Shalek, Alex; Hacohen, Nir; Amit, Ido; Regev, Aviv

    2013-01-01

    Individual genetic variation affects gene expression in response to stimuli, often by influencing complex molecular circuits. Here we combine genomic and intermediate-scale transcriptional profiling with computational methods to identify variants that affect the responsiveness of genes to stimuli (responsiveness QTLs; reQTLs) and to position these variants in molecular circuit diagrams. We apply this approach to study variation in transcriptional responsiveness to pathogen components in dendritic cells from recombinant inbred mouse strains. We identify reQTLs that correlate with particular stimuli and position them in known pathways. For example, in response to a virus-like stimulus, a trans-acting variant acts as an activator of the antiviral response; using RNAi, we identify Rgs16 as the likely causal gene. Our approach charts an experimental and analytic path to decipher the mechanisms underlying genetic variation in circuits that control responses to stimuli. PMID:23503680

  15. Deciphering molecular circuits from genetic variation underlying transcriptional responsiveness to stimuli.

    PubMed

    Gat-Viks, Irit; Chevrier, Nicolas; Wilentzik, Roni; Eisenhaure, Thomas; Raychowdhury, Raktima; Steuerman, Yael; Shalek, Alex K; Hacohen, Nir; Amit, Ido; Regev, Aviv

    2013-04-01

    Individual genetic variation affects gene responsiveness to stimuli, often by influencing complex molecular circuits. Here we combine genomic and intermediate-scale transcriptional profiling with computational methods to identify variants that affect the responsiveness of genes to stimuli (responsiveness quantitative trait loci or reQTLs) and to position these variants in molecular circuit diagrams. We apply this approach to study variation in transcriptional responsiveness to pathogen components in dendritic cells from recombinant inbred mouse strains. We identify reQTLs that correlate with particular stimuli and position them in known pathways. For example, in response to a virus-like stimulus, a trans-acting variant responds as an activator of the antiviral response; using RNA interference, we identify Rgs16 as the likely causal gene. Our approach charts an experimental and analytic path to decipher the mechanisms underlying genetic variation in circuits that control responses to stimuli.

  16. Differential gene expression in response to Fusarium oxysporum infection in resistant and susceptible genotypes of flax (Linum usitatissimum L.).

    PubMed

    Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V

    2017-12-28

    Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the expression of pathogenesis-related protein-encoding genes and genes involved in ROS production or related to cell wall biogenesis. Furthermore, we identified genes that were upregulated specifically in flax genotypes resistant to Fusarium wilt. We suggest that the identified genes in resistant cultivars and BC 2 F 5 populations showing induced expression in response to F. oxysporum infection are the most promising resistance gene candidates.

  17. Transcriptional Profiling and Identification of Heat-Responsive Genes in Perennial Ryegrass by RNA-Sequencing

    PubMed Central

    Wang, Kehua; Liu, Yanrong; Tian, Jinli; Huang, Kunyong; Shi, Tianran; Dai, Xiaoxia; Zhang, Wanjun

    2017-01-01

    Perennial ryegrass (Lolium perenne) is one of the most widely used forage and turf grasses in the world due to its desirable agronomic qualities. However, as a cool-season perennial grass species, high temperature is a major factor limiting its performance in warmer and transition regions. In this study, a de novo transcriptome was generated using a cDNA library constructed from perennial ryegrass leaves subjected to short-term heat stress treatment. Then the expression profiling and identification of perennial ryegrass heat response genes by digital gene expression analyses was performed. The goal of this work was to produce expression profiles of high temperature stress responsive genes in perennial ryegrass leaves and further identify the potentially important candidate genes with altered levels of transcript, such as those genes involved in transcriptional regulation, antioxidant responses, plant hormones and signal transduction, and cellular metabolism. The de novo assembly of perennial ryegrass transcriptome in this study obtained more total and annotated unigenes compared to previously published ones. Many DEGs identified were genes that are known to respond to heat stress in plants, including HSFs, HSPs, and antioxidant related genes. In the meanwhile, we also identified four gene candidates mainly involved in C4 carbon fixation, and one TOR gene. Their exact roles in plant heat stress response need to dissect further. This study would be important by providing the gene resources for improving heat stress tolerance in both perennial ryegrass and other cool-season perennial grass plants. PMID:28680431

  18. Characterization of basal gene expression trends over a diurnal cycle in Xiphophorus maculatus skin, brain and liver.

    PubMed

    Lu, Yuan; Reyes, Jose; Walter, Sean; Gonzalez, Trevor; Medrano, Geraldo; Boswell, Mikki; Boswell, William; Savage, Markita; Walter, Ronald

    2018-06-01

    Evolutionarily conserved diurnal circadian mechanisms maintain oscillating patterns of gene expression based on the day-night cycle. Xiphophorus fish have been used to evaluate transcriptional responses after exposure to various light sources and it was determined that each source incites distinct genetic responses in skin tissue. However, basal expression levels of genes that show oscillating expression patterns in day-night cycle, may affect the outcomes of such experiments, since basal gene expression levels at each point in the circadian path may influence the profile of identified light responsive genes. Lack of knowledge regarding diurnal fluctuations in basal gene expression patterns may confound the understanding of genetic responses to external stimuli (e.g., light) since the dynamic nature of gene expression implies animals subjected to stimuli at different times may be at very different stages within the continuum of genetic homeostasis. We assessed basal gene expression changes over a 24-hour period in 200 select Xiphophorus gene targets known to transcriptionally respond to various types of light exposure. We identified 22 genes in skin, 36 genes in brain and 28 genes in liver that exhibit basal oscillation of expression patterns. These genes, including known circadian regulators, produced the expected expression patterns over a 24-hour cycle when compared to circadian regulatory genes identified in other species, especially human and other vertebrate animal models. Our results suggest the regulatory network governing diurnal oscillating gene expression is similar between Xiphophorus and other vertebrates for the three Xiphophorus organs tested. In addition, we were able to categorize light responsive gene sets in Xiphophorus that do, and do not, exhibit circadian based oscillating expression patterns. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L.) Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

    PubMed

    Bedre, Renesh; Rajasekaran, Kanniah; Mangu, Venkata Ramanarao; Sanchez Timm, Luis Eduardo; Bhatnagar, Deepak; Baisakh, Niranjan

    2015-01-01

    Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L.) pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

  20. Genetic predictors of antipsychotic response to lurasidone identified in a genome wide association study and by schizophrenia risk genes.

    PubMed

    Li, Jiang; Yoshikawa, Akane; Brennan, Mark D; Ramsey, Timothy L; Meltzer, Herbert Y

    2018-02-01

    Biomarkers which predict response to atypical antipsychotic drugs (AAPDs) increases their benefit/risk ratio. We sought to identify common variants in genes which predict response to lurasidone, an AAPD, by associating genome-wide association study (GWAS) data and changes (Δ) in Positive And Negative Syndrome Scale (PANSS) scores from two 6-week randomized, placebo-controlled trials of lurasidone in schizophrenia (SCZ) patients. We also included SCZ risk SNPs identified by the Psychiatric Genomics Consortium using a polygenic risk analysis. The top genomic loci, with uncorrected p<10 -4 , include: 1) synaptic adhesion (PTPRD, LRRC4C, NRXN1, ILIRAPL1, SLITRK1) and scaffolding (MAGI1, MAGI2, NBEA) genes, both essential for synaptic function; 2) other synaptic plasticity-related genes (NRG1/3 and KALRN); 3) the neuron-specific RNA splicing regulator, RBFOX1; and 4) ion channel genes, e.g. KCNA10, KCNAB1, KCNK9 and CACNA2D3). Some genes predicted response for patients with both European and African Ancestries. We replicated some SNPs reported to predict response to other atypical APDs in other GWAS. Although none of the biomarkers reached genome-wide significance, many of the genes and associated pathways have previously been linked to SCZ. Two polygenic modeling approaches, GCTA-GREML and PLINK-Polygenic Risk Score, demonstrated that some risk genes related to neurodevelopment, synaptic biology, immune response, and histones, also contributed to prediction of response. The top hits predicting response to lurasidone did not predict improvement with placebo. This is the first evidence from clinical trials that SCZ risk SNPs are related to clinical response to an AAPD. These results need to be replicated in an independent sample. Copyright © 2017. Published by Elsevier B.V.

  1. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    PubMed

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  2. Systems approach identifies an organic nitrogen-responsive gene network that is regulated by the master clock control gene CCA1.

    PubMed

    Gutiérrez, Rodrigo A; Stokes, Trevor L; Thum, Karen; Xu, Xiaodong; Obertello, Mariana; Katari, Manpreet S; Tanurdzic, Milos; Dean, Alexis; Nero, Damion C; McClung, C Robertson; Coruzzi, Gloria M

    2008-03-25

    Understanding how nutrients affect gene expression will help us to understand the mechanisms controlling plant growth and development as a function of nutrient availability. Nitrate has been shown to serve as a signal for the control of gene expression in Arabidopsis. There is also evidence, on a gene-by-gene basis, that downstream products of nitrogen (N) assimilation such as glutamate (Glu) or glutamine (Gln) might serve as signals of organic N status that in turn regulate gene expression. To identify genome-wide responses to such organic N signals, Arabidopsis seedlings were transiently treated with ammonium nitrate in the presence or absence of MSX, an inhibitor of glutamine synthetase, resulting in a block of Glu/Gln synthesis. Genes that responded to organic N were identified as those whose response to ammonium nitrate treatment was blocked in the presence of MSX. We showed that some genes previously identified to be regulated by nitrate are under the control of an organic N-metabolite. Using an integrated network model of molecular interactions, we uncovered a subnetwork regulated by organic N that included CCA1 and target genes involved in N-assimilation. We validated some of the predicted interactions and showed that regulation of the master clock control gene CCA1 by Glu or a Glu-derived metabolite in turn regulates the expression of key N-assimilatory genes. Phase response curve analysis shows that distinct N-metabolites can advance or delay the CCA1 phase. Regulation of CCA1 by organic N signals may represent a novel input mechanism for N-nutrients to affect plant circadian clock function.

  3. Microarray Meta-Analysis Focused on the Response of Genes Involved in Redox Homeostasis to Diverse Abiotic Stresses in Rice

    PubMed Central

    de Abreu Neto, Joao B.; Frei, Michael

    2016-01-01

    Plants are exposed to a wide range of abiotic stresses (AS), which often occur in combination. Because physiological investigations typically focus on one stress, our understanding of unspecific stress responses remains limited. The plant redox homeostasis, i.e., the production and removal of reactive oxygen species (ROS), may be involved in many environmental stress conditions. Therefore, this study intended to identify genes, which are activated in diverse AS, focusing on ROS-related pathways. We conducted a meta-analysis (MA) of microarray experiments, focusing on rice. Transcriptome data were mined from public databases and fellow researchers, which represented 36 different experiments and investigated diverse AS, including ozone stress, drought, heat, cold, salinity, and mineral deficiencies/toxicities. To overcome the inherent artifacts of different MA methods, data were processed using Fisher, rOP, REM, and product of rank (GeneSelector), and genes identified by most approaches were considered as shared differentially expressed genes (DEGs). Two MA strategies were adopted: first, datasets were separated into shoot, root, and seedling experiments, and these tissues were analyzed separately to identify shared DEGs. Second, shoot and seedling experiments were classed into oxidative stress (OS), i.e., ozone and hydrogen peroxide treatments directly producing ROS in plant tissue, and other AS, in which ROS production is indirect. In all tissues and stress conditions, genes a priori considered as ROS-related were overrepresented among the DEGs, as they represented 4% of all expressed genes but 7–10% of the DEGs. The combined MA approach was substantially more conservative than individual MA methods and identified 1001 shared DEGs in shoots, 837 shared DEGs in root, and 1172 shared DEGs in seedlings. Within the OS and AS groups, 990 and 1727 shared DEGs were identified, respectively. In total, 311 genes were shared between OS and AS, including many regulatory genes. Combined co-expression analysis identified among those a cluster of 42 genes, many involved in the photosynthetic apparatus and responsive to drought, iron deficiency, arsenic toxicity, and ozone. Our data demonstrate the importance of redox homeostasis in plant stress responses and the power of MA to identify candidate genes underlying unspecific signaling pathways. PMID:26793229

  4. Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury.

    PubMed

    Ryge, Jesper; Winther, Ole; Wienecke, Jacob; Sandelin, Albin; Westerdahl, Ann-Charlotte; Hultborn, Hans; Kiehn, Ole

    2010-06-09

    Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation of which potentially could be used to alter the transcriptional response to prevent the motor neurons from entering a state of hyper-excitability.

  5. Identification of radiation response genes and proteins from mouse pulmonary tissues after high-dose per fraction irradiation of limited lung volumes.

    PubMed

    Jin, Hee; Jeon, Seulgi; Kang, Ga-Young; Lee, Hae-June; Cho, Jaeho; Lee, Yun-Sil

    2017-02-01

    The molecular effects of focal exposure of limited lung volumes to high-dose per fraction irradiation (HDFR) such as stereotactic body radiotherapy (SBRT) have not been fully characterized. In this study, we used such an irradiation system and identified the genes and proteins after HDFR to mouse lung, similar to those associated with human therapy. High focal radiation (90 Gy) was applied to a 3-mm volume of the left lung of C57BL6 mice using a small-animal stereotactic irradiator. As well as histological examination for lungs, a cDNA micro array using irradiated lung tissues and a protein array of sera were performed until 4 weeks after irradiation, and radiation-responsive genes and proteins were identified. For comparison, the long-term effects (12 months) of 20 Gy radiation wide-field dose to the left lung were also investigated. The genes ermap, epb4.2, cd200r3 (up regulation) and krt15, hoxc4, gdf2, cst9, cidec, and bnc1 (down-regulation) and the proteins of AIF, laminin, bNOS, HSP27, β-amyloid (upregulation), and calponin (downregulation) were identified as being responsive to 90 Gy HDFR. The gdf2, cst9, and cidec genes also responded to 20 Gy, suggesting that they are universal responsive genes in irradiated lungs. No universal proteins were identified in both 90 Gy and 20 Gy. Calponin, which was downregulated in protein antibody array analysis, showed a similar pattern in microarray data, suggesting a possible HDFR responsive serum biomarker that reflects gene alteration of irradiated lung tissue. These genes and proteins also responded to the lower doses of 20 Gy and 50 Gy HDFR. These results suggest that identified candidate genes and proteins are HDFR-specifically expressed in lung damage induced by HDFR relevant to SBRT in humans.

  6. Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury

    PubMed Central

    2010-01-01

    Background Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Results Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. Conclusions This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation of which potentially could be used to alter the transcriptional response to prevent the motor neurons from entering a state of hyper-excitability. PMID:20534130

  7. Effects of immunostimulation on social behavior, chemical communication and genome-wide gene expression in honey bee workers (Apis mellifera)

    PubMed Central

    2012-01-01

    Background Social insects, such as honey bees, use molecular, physiological and behavioral responses to combat pathogens and parasites. The honey bee genome contains all of the canonical insect immune response pathways, and several studies have demonstrated that pathogens can activate expression of immune effectors. Honey bees also use behavioral responses, termed social immunity, to collectively defend their hives from pathogens and parasites. These responses include hygienic behavior (where workers remove diseased brood) and allo-grooming (where workers remove ectoparasites from nestmates). We have previously demonstrated that immunostimulation causes changes in the cuticular hydrocarbon profiles of workers, which results in altered worker-worker social interactions. Thus, cuticular hydrocarbons may enable workers to identify sick nestmates, and adjust their behavior in response. Here, we test the specificity of behavioral, chemical and genomic responses to immunostimulation by challenging workers with a panel of different immune stimulants (saline, Sephadex beads and Gram-negative bacteria E. coli). Results While only bacteria-injected bees elicited altered behavioral responses from healthy nestmates compared to controls, all treatments resulted in significant changes in cuticular hydrocarbon profiles. Immunostimulation caused significant changes in expression of hundreds of genes, the majority of which have not been identified as members of the canonical immune response pathways. Furthermore, several new candidate genes that may play a role in cuticular hydrocarbon biosynthesis were identified. Effects of immune challenge expression of several genes involved in immune response, cuticular hydrocarbon biosynthesis, and the Notch signaling pathway were confirmed using quantitative real-time PCR. Finally, we identified common genes regulated by pathogen challenge in honey bees and other insects. Conclusions These results demonstrate that honey bee genomic responses to immunostimulation are substantially broader than the previously identified canonical immune response pathways, and may mediate the behavioral changes associated with social immunity by orchestrating changes in chemical signaling. These studies lay the groundwork for future research into the genomic responses of honey bees to native honey bee parasites and pathogens. PMID:23072398

  8. Effects of immunostimulation on social behavior, chemical communication and genome-wide gene expression in honey bee workers (Apis mellifera).

    PubMed

    Richard, Freddie-Jeanne; Holt, Holly L; Grozinger, Christina M

    2012-10-16

    Social insects, such as honey bees, use molecular, physiological and behavioral responses to combat pathogens and parasites. The honey bee genome contains all of the canonical insect immune response pathways, and several studies have demonstrated that pathogens can activate expression of immune effectors. Honey bees also use behavioral responses, termed social immunity, to collectively defend their hives from pathogens and parasites. These responses include hygienic behavior (where workers remove diseased brood) and allo-grooming (where workers remove ectoparasites from nestmates). We have previously demonstrated that immunostimulation causes changes in the cuticular hydrocarbon profiles of workers, which results in altered worker-worker social interactions. Thus, cuticular hydrocarbons may enable workers to identify sick nestmates, and adjust their behavior in response. Here, we test the specificity of behavioral, chemical and genomic responses to immunostimulation by challenging workers with a panel of different immune stimulants (saline, Sephadex beads and Gram-negative bacteria E. coli). While only bacteria-injected bees elicited altered behavioral responses from healthy nestmates compared to controls, all treatments resulted in significant changes in cuticular hydrocarbon profiles. Immunostimulation caused significant changes in expression of hundreds of genes, the majority of which have not been identified as members of the canonical immune response pathways. Furthermore, several new candidate genes that may play a role in cuticular hydrocarbon biosynthesis were identified. Effects of immune challenge expression of several genes involved in immune response, cuticular hydrocarbon biosynthesis, and the Notch signaling pathway were confirmed using quantitative real-time PCR. Finally, we identified common genes regulated by pathogen challenge in honey bees and other insects. These results demonstrate that honey bee genomic responses to immunostimulation are substantially broader than the previously identified canonical immune response pathways, and may mediate the behavioral changes associated with social immunity by orchestrating changes in chemical signaling. These studies lay the groundwork for future research into the genomic responses of honey bees to native honey bee parasites and pathogens.

  9. Global gene expression analysis using RNA-seq uncovered a new role for SR1/CAMTA3 transcription factor in salt stress

    PubMed Central

    Prasad, Kasavajhala V. S. K.; Abdel-Hameed, Amira A. E.; Xing, Denghui; Reddy, Anireddy S. N.

    2016-01-01

    Abiotic and biotic stresses cause significant yield losses in all crops. Acquisition of stress tolerance in plants requires rapid reprogramming of gene expression. SR1/CAMTA3, a member of signal responsive transcription factors (TFs), functions both as a positive and a negative regulator of biotic stress responses and as a positive regulator of cold stress-induced gene expression. Using high throughput RNA-seq, we identified ~3000 SR1-regulated genes. Promoters of about 60% of the differentially expressed genes have a known DNA binding site for SR1, suggesting that they are likely direct targets. Gene ontology analysis of SR1-regulated genes confirmed previously known functions of SR1 and uncovered a potential role for this TF in salt stress. Our results showed that SR1 mutant is more tolerant to salt stress than the wild type and complemented line. Improved tolerance of sr1 seedlings to salt is accompanied with the induction of salt-responsive genes. Furthermore, ChIP-PCR results showed that SR1 binds to promoters of several salt-responsive genes. These results suggest that SR1 acts as a negative regulator of salt tolerance by directly repressing the expression of salt-responsive genes. Overall, this study identified SR1-regulated genes globally and uncovered a previously uncharacterized role for SR1 in salt stress response. PMID:27251464

  10. The Transcriptional Response of Drosophila melanogaster to Infection with the Sigma Virus (Rhabdoviridae)

    PubMed Central

    Baines, John F.; Roller, Julia; Saminadin-Peter, Sarah S.; Parsch, John; Jiggins, Francis M.

    2009-01-01

    Background Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. Principal Findings We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. Conclusions These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus. PMID:19718442

  11. The transcriptional response of Drosophila melanogaster to infection with the sigma virus (Rhabdoviridae).

    PubMed

    Carpenter, Jennifer; Hutter, Stephan; Baines, John F; Roller, Julia; Saminadin-Peter, Sarah S; Parsch, John; Jiggins, Francis M

    2009-08-31

    Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus.

  12. A framework to identify gene expression profiles in a model of inflammation induced by lipopolysaccharide after treatment with thalidomide

    PubMed Central

    2012-01-01

    Background Thalidomide is an anti-inflammatory and anti-angiogenic drug currently used for the treatment of several diseases, including erythema nodosum leprosum, which occurs in patients with lepromatous leprosy. In this research, we use DNA microarray analysis to identify the impact of thalidomide on gene expression responses in human cells after lipopolysaccharide (LPS) stimulation. We employed a two-stage framework. Initially, we identified 1584 altered genes in response to LPS. Modulation of this set of genes was then analyzed in the LPS stimulated cells treated with thalidomide. Results We identified 64 genes with altered expression induced by thalidomide using the rank product method. In addition, the lists of up-regulated and down-regulated genes were investigated by means of bioinformatics functional analysis, which allowed for the identification of biological processes affected by thalidomide. Confirmatory analysis was done in five of the identified genes using real time PCR. Conclusions The results showed some genes that can further our understanding of the biological mechanisms in the action of thalidomide. Of the five genes evaluated with real time PCR, three were down regulated and two were up regulated confirming the initial results of the microarray analysis. PMID:22695124

  13. Allelic variants of OsSUB1A cause differential expression of transcription factor genes in response to submergence in rice.

    PubMed

    Sharma, Niharika; Dang, Trang Minh; Singh, Namrata; Ruzicic, Slobodan; Mueller-Roeber, Bernd; Baumann, Ute; Heuer, Sigrid

    2018-01-08

    Flooding during seasonal monsoons affects millions of hectares of rice-cultivated areas across Asia. Submerged rice plants die within a week due to lack of oxygen, light and excessive elongation growth to escape the water. Submergence tolerance was first reported in an aus-type rice landrace, FR13A, and the ethylene-responsive transcription factor (TF) gene SUB1A-1 was identified as the major tolerance gene. Intolerant rice varieties generally lack the SUB1A gene but some intermediate tolerant varieties, such as IR64, carry the allelic variant SUB1A-2. Differential effects of the two alleles have so far not been addressed. As a first step, we have therefore quantified and compared the expression of nearly 2500 rice TF genes between IR64 and its derived tolerant near isogenic line IR64-Sub1, which carries the SUB1A-1 allele. Gene expression was studied in internodes, where the main difference in expression between the two alleles was previously shown. Nineteen and twenty-six TF genes were identified that responded to submergence in IR64 and IR64-Sub1, respectively. Only one gene was found to be submergence-responsive in both, suggesting different regulatory pathways under submergence in the two genotypes. These differentially expressed genes (DEGs) mainly included MYB, NAC, TIFY and Zn-finger TFs, and most genes were downregulated upon submergence. In IR64, but not in IR64-Sub1, SUB1B and SUB1C, which are also present in the Sub1 locus, were identified as submergence responsive. Four TFs were not submergence responsive but exhibited constitutive, genotype-specific differential expression. Most of the identified submergence responsive DEGs are associated with regulatory hormonal pathways, i.e. gibberellins (GA), abscisic acid (ABA), and jasmonic acid (JA), apart from ethylene. An in-silico promoter analysis of the two genotypes revealed the presence of allele-specific single nucleotide polymorphisms, giving rise to ABRE, DRE/CRT, CARE and Site II cis-elements, which can partly explain the observed differential TF gene expression. This study identified new gene targets with the potential to further enhance submergence tolerance in rice and provides insights into novel aspects of SUB1A-mediated tolerance.

  14. Genome-wide annotation of the soybean WRKY family and functional characterization of genes involved in response to Phakopsora pachyrhizi infection.

    PubMed

    Bencke-Malato, Marta; Cabreira, Caroline; Wiebke-Strohm, Beatriz; Bücker-Neto, Lauro; Mancini, Estefania; Osorio, Marina B; Homrich, Milena S; Turchetto-Zolet, Andreia Carina; De Carvalho, Mayra C C G; Stolf, Renata; Weber, Ricardo L M; Westergaard, Gastón; Castagnaro, Atílio P; Abdelnoor, Ricardo V; Marcelino-Guimarães, Francismar C; Margis-Pinheiro, Márcia; Bodanese-Zanettini, Maria Helena

    2014-09-10

    Many previous studies have shown that soybean WRKY transcription factors are involved in the plant response to biotic and abiotic stresses. Phakopsora pachyrhizi is the causal agent of Asian Soybean Rust, one of the most important soybean diseases. There are evidences that WRKYs are involved in the resistance of some soybean genotypes against that fungus. The number of WRKY genes already annotated in soybean genome was underrepresented. In the present study, a genome-wide annotation of the soybean WRKY family was carried out and members involved in the response to P. pachyrhizi were identified. As a result of a soybean genomic databases search, 182 WRKY-encoding genes were annotated and 33 putative pseudogenes identified. Genes involved in the response to P. pachyrhizi infection were identified using superSAGE, RNA-Seq of microdissected lesions and microarray experiments. Seventy-five genes were differentially expressed during fungal infection. The expression of eight WRKY genes was validated by RT-qPCR. The expression of these genes in a resistant genotype was earlier and/or stronger compared with a susceptible genotype in response to P. pachyrhizi infection. Soybean somatic embryos were transformed in order to overexpress or silence WRKY genes. Embryos overexpressing a WRKY gene were obtained, but they were unable to convert into plants. When infected with P. pachyrhizi, the leaves of the silenced transgenic line showed a higher number of lesions than the wild-type plants. The present study reports a genome-wide annotation of soybean WRKY family. The participation of some members in response to P. pachyrhizi infection was demonstrated. The results contribute to the elucidation of gene function and suggest the manipulation of WRKYs as a strategy to increase fungal resistance in soybean plants.

  15. Transcriptomics-based analysis using RNA-Seq of the coconut (Cocos nucifera) leaf in response to yellow decline phytoplasma infection.

    PubMed

    Nejat, Naghmeh; Cahill, David M; Vadamalai, Ganesan; Ziemann, Mark; Rookes, James; Naderali, Neda

    2015-10-01

    Invasive phytoplasmas wreak havoc on coconut palms worldwide, leading to high loss of income, food insecurity and extreme poverty of farmers in producing countries. Phytoplasmas as strictly biotrophic insect-transmitted bacterial pathogens instigate distinct changes in developmental processes and defence responses of the infected plants and manipulate plants to their own advantage; however, little is known about the cellular and molecular mechanisms underlying host-phytoplasma interactions. Further, phytoplasma-mediated transcriptional alterations in coconut palm genes have not yet been identified. This study evaluated the whole transcriptome profiles of naturally infected leaves of Cocos nucifera ecotype Malayan Red Dwarf in response to yellow decline phytoplasma from group 16SrXIV, using RNA-Seq technique. Transcriptomics-based analysis reported here identified genes involved in coconut innate immunity. The number of down-regulated genes in response to phytoplasma infection exceeded the number of genes up-regulated. Of the 39,873 differentially expressed unigenes, 21,860 unigenes were suppressed and 18,013 were induced following infection. Comparative analysis revealed that genes associated with defence signalling against biotic stimuli were significantly overexpressed in phytoplasma-infected leaves versus healthy coconut leaves. Genes involving cell rescue and defence, cellular transport, oxidative stress, hormone stimulus and metabolism, photosynthesis reduction, transcription and biosynthesis of secondary metabolites were differentially represented. Our transcriptome analysis unveiled a core set of genes associated with defence of coconut in response to phytoplasma attack, although several novel defence response candidate genes with unknown function have also been identified. This study constitutes valuable sequence resource for uncovering the resistance genes and/or susceptibility genes which can be used as genetic tools in disease resistance breeding.

  16. Integrative Transcriptomic Analysis Uncovers Novel Gene Modules That Underlie the Sulfate Response in Arabidopsis thaliana

    PubMed Central

    Henríquez-Valencia, Carlos; Arenas-M, Anita; Medina, Joaquín; Canales, Javier

    2018-01-01

    Sulfur is an essential nutrient for plant growth and development. Sulfur is a constituent of proteins, the plasma membrane and cell walls, among other important cellular components. To obtain new insights into the gene regulatory networks underlying the sulfate response, we performed an integrative meta-analysis of transcriptomic data from five different sulfate experiments available in public databases. This bioinformatic approach allowed us to identify a robust set of genes whose expression depends only on sulfate availability, indicating that those genes play an important role in the sulfate response. In relation to sulfate metabolism, the biological function of approximately 45% of these genes is currently unknown. Moreover, we found several consistent Gene Ontology terms related to biological processes that have not been extensively studied in the context of the sulfate response; these processes include cell wall organization, carbohydrate metabolism, nitrogen compound transport, and the regulation of proteolysis. Gene co-expression network analyses revealed relationships between the sulfate-responsive genes that were distributed among seven function-specific co-expression modules. The most connected genes in the sulfate co-expression network belong to a module related to the carbon response, suggesting that this biological function plays an important role in the control of the sulfate response. Temporal analyses of the network suggest that sulfate starvation generates a biphasic response, which involves that major changes in gene expression occur during both the early and late responses. Network analyses predicted that the sulfate response is regulated by a limited number of transcription factors, including MYBs, bZIPs, and NF-YAs. In conclusion, our analysis identified new candidate genes and provided new hypotheses to advance our understanding of the transcriptional regulation of sulfate metabolism in plants. PMID:29692794

  17. Integrative Transcriptomic Analysis Uncovers Novel Gene Modules That Underlie the Sulfate Response in Arabidopsis thaliana.

    PubMed

    Henríquez-Valencia, Carlos; Arenas-M, Anita; Medina, Joaquín; Canales, Javier

    2018-01-01

    Sulfur is an essential nutrient for plant growth and development. Sulfur is a constituent of proteins, the plasma membrane and cell walls, among other important cellular components. To obtain new insights into the gene regulatory networks underlying the sulfate response, we performed an integrative meta-analysis of transcriptomic data from five different sulfate experiments available in public databases. This bioinformatic approach allowed us to identify a robust set of genes whose expression depends only on sulfate availability, indicating that those genes play an important role in the sulfate response. In relation to sulfate metabolism, the biological function of approximately 45% of these genes is currently unknown. Moreover, we found several consistent Gene Ontology terms related to biological processes that have not been extensively studied in the context of the sulfate response; these processes include cell wall organization, carbohydrate metabolism, nitrogen compound transport, and the regulation of proteolysis. Gene co-expression network analyses revealed relationships between the sulfate-responsive genes that were distributed among seven function-specific co-expression modules. The most connected genes in the sulfate co-expression network belong to a module related to the carbon response, suggesting that this biological function plays an important role in the control of the sulfate response. Temporal analyses of the network suggest that sulfate starvation generates a biphasic response, which involves that major changes in gene expression occur during both the early and late responses. Network analyses predicted that the sulfate response is regulated by a limited number of transcription factors, including MYBs, bZIPs, and NF-YAs. In conclusion, our analysis identified new candidate genes and provided new hypotheses to advance our understanding of the transcriptional regulation of sulfate metabolism in plants.

  18. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    PubMed

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  19. Changes in expression of genes involved in apoptosis in activated human T-cells in response to modeled microgravity

    NASA Astrophysics Data System (ADS)

    Ward, Nancy E.; Pellis, Neal R.; Risin, Diana; Risin, Semyon A.; Liu, Wenbin

    2006-09-01

    Space flights result in remarkable effects on various physiological systems, including a decline in cellular immune functions. Previous studies have shown that exposure to microgravity, both true and modeled, can cause significant changes in numerous lymphocyte functions. The purpose of this study was to search for microgravity-sensitive genes, and specifically for apoptotic genes influenced by the microgravity environment and other genes related to immune response. The experiments were performed on anti-CD3 and IL-2 activated human T cells. To model microgravity conditions we have utilized the NASA rotating wall vessel bioreactor. Control lymphocytes were cultured in static 1g conditions. To assess gene expression we used DNA microarray chip technology. We had shown that multiple genes (approximately 3-8% of tested genes) respond to microgravity conditions by 1.5 and more fold change in expression. There is a significant variability in the response. However, a certain reproducible pattern in gene response could be identified. Among the genes showing reproducible changes in expression in modeled microgravity, several genes involved in apoptosis as well as in immune response were identified. These are IL-7 receptor, Granzyme B, Beta-3-endonexin, Apo2 ligand and STAT1. Possible functional consequences of these changes are discussed.

  20. Bridging the gap between high-throughput genetic and transcriptional data reveals cellular pathways responding to alpha-synuclein toxicity

    PubMed Central

    Yeger-Lotem, Esti; Riva, Laura; Su, Linhui Julie; Gitler, Aaron D.; Cashikar, Anil; King, Oliver D.; Auluck, Pavan K.; Geddie, Melissa L.; Valastyan, Julie S.; Karger, David R.; Lindquist, Susan; Fraenkel, Ernest

    2009-01-01

    Cells respond to stimuli by changes in various processes, including signaling pathways and gene expression. Efforts to identify components of these responses increasingly depend on mRNA profiling and genetic library screens, yet the functional roles of the genes identified by these assays often remain enigmatic. By comparing the results of these two assays across various cellular responses, we found that they are consistently distinct. Moreover, genetic screens tend to identify response regulators, while mRNA profiling frequently detects metabolic responses. We developed an integrative approach that bridges the gap between these data using known molecular interactions, thus highlighting major response pathways. We harnessed this approach to reveal cellular pathways related to alpha-synuclein, a small lipid-binding protein implicated in several neurodegenerative disorders including Parkinson disease. For this we screened an established yeast model for alpha-synuclein toxicity to identify genes that when overexpressed alter cellular survival. Application of our algorithm to these data and data from mRNA profiling provided functional explanations for many of these genes and revealed novel relations between alpha-synuclein toxicity and basic cellular pathways. PMID:19234470

  1. Lipopolysaccharide-induced early response genes in bovine peripheral blood mononuclear cells implicate GLG1/E-selectin as a key ligand–receptor interaction

    USDA-ARS?s Scientific Manuscript database

    This study uses a systems biology approach, integrating global gene expression information and knowledge of the regulatory events in cells to identify transcription networks controlling peripheral blood mononuclear cells’ (PBMCs) immune response to lipopolysaccharide (LPS) and to identify the molecu...

  2. Comparative analysis of chrysanthemum transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted wilt virus and Potato virus X.

    PubMed

    Choi, Hoseong; Jo, Yeonhwa; Lian, Sen; Jo, Kyoung-Min; Chu, Hyosub; Yoon, Ju-Yeon; Choi, Seung-Kook; Kim, Kook-Hyung; Cho, Won Kyong

    2015-06-01

    The chrysanthemum is one of popular flowers in the world and a host for several viruses. So far, molecular interaction studies between the chrysanthemum and viruses are limited. In this study, we carried out a transcriptome analysis of chrysanthemum in response to three different viruses including Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV) and Potato virus X (PVX). A chrysanthemum 135K microarray derived from expressed sequence tags was successfully applied for the expression profiles of the chrysanthemum at early stage of virus infection. Finally, we identified a total of 125, 70 and 124 differentially expressed genes (DEGs) for CMV, TSWV and PVX, respectively. Many DEGs were virus specific; however, 33 DEGs were commonly regulated by three viruses. Gene ontology (GO) enrichment analysis identified a total of 132 GO terms, and of them, six GO terms related stress response and MCM complex were commonly identified for three viruses. Several genes functioning in stress response such as chitin response and ethylene mediated signaling pathway were up-regulated indicating their involvement in establishment of host immune system. In particular, TSWV infection significantly down-regulated genes related to DNA metabolic process including DNA replication, chromatin organization, histone modification and cytokinesis, and they are mostly targeted to nucleosome and MCM complex. Taken together, our comparative transcriptome analysis revealed several genes related to hormone mediated viral stress response and DNA modification. The identified chrysanthemums genes could be good candidates for further functional study associated with resistant to various plant viruses.

  3. ARG1 Is a Novel Bronchodilator Response Gene

    PubMed Central

    Litonjua, Augusto A.; Lasky-Su, Jessica; Schneiter, Kady; Tantisira, Kelan G.; Lazarus, Ross; Klanderman, Barbara; Lima, John J.; Irvin, Charles G.; Peters, Stephen P.; Hanrahan, John P.; Liggett, Stephen B.; Hawkins, Gregory A.; Meyers, Deborah A.; Bleecker, Eugene R.; Lange, Christoph; Weiss, Scott T.

    2008-01-01

    Rationale: Inhaled β-agonists are one of the most widely used classes of drugs for the treatment of asthma. However, a substantial proportion of patients with asthma do not have a favorable response to these drugs, and identifying genetic determinants of drug response may aid in tailoring treatment for individual patients. Objectives: To screen variants in candidate genes in the steroid and β-adrenergic pathways for association with response to inhaled β-agonists. Methods: We genotyped 844 single nucleotide polymorphisms (SNPs) in 111 candidate genes in 209 children and their parents participating in the Childhood Asthma Management Program. We screened the association of these SNPs with acute response to inhaled β-agonists (bronchodilator response [BDR]) using a novel algorithm implemented in a family-based association test that ranked SNPs in order of statistical power. Genes that had SNPs with median power in the highest quartile were then taken for replication analyses in three other asthma cohorts. Measurements and Main Results: We identified 17 genes from the screening algorithm and genotyped 99 SNPs from these genes in a second population of patients with asthma. We then genotyped 63 SNPs from four genes with significant associations with BDR, for replication in a third and fourth population of patients with asthma. Evidence for association from the four asthma cohorts was combined, and SNPs from ARG1 were significantly associated with BDR. SNP rs2781659 survived Bonferroni correction for multiple testing (combined P value = 0.00048, adjusted P value = 0.047). Conclusions: These findings identify ARG1 as a novel gene for acute BDR in both children and adults with asthma. PMID:18617639

  4. A complex regulatory network controls aerobic ethanol oxidation in Pseudomonas aeruginosa: indication of four levels of sensor kinases and response regulators.

    PubMed

    Mern, Demissew S; Ha, Seung-Wook; Khodaverdi, Viola; Gliese, Nicole; Görisch, Helmut

    2010-05-01

    In addition to the known response regulator ErbR (former AgmR) and the two-component regulatory system EraSR (former ExaDE), three additional regulatory proteins have been identified as being involved in controlling transcription of the aerobic ethanol oxidation system in Pseudomonas aeruginosa. Two putative sensor kinases, ErcS and ErcS', and a response regulator, ErdR, were found, all of which show significant similarity to the two-component flhSR system that controls methanol and formaldehyde metabolism in Paracoccus denitrificans. All three identified response regulators, EraR (formerly ExaE), ErbR (formerly AgmR) and ErdR, are members of the luxR family. The three sensor kinases EraS (formerly ExaD), ErcS and ErcS' do not contain a membrane domain. Apparently, they are localized in the cytoplasm and recognize cytoplasmic signals. Inactivation of gene ercS caused an extended lag phase on ethanol. Inactivation of both genes, ercS and ercS', resulted in no growth at all on ethanol, as did inactivation of erdR. Of the three sensor kinases and three response regulators identified thus far, only the EraSR (formerly ExaDE) system forms a corresponding kinase/regulator pair. Using reporter gene constructs of all identified regulatory genes in different mutants allowed the hierarchy of a hypothetical complex regulatory network to be established. Probably, two additional sensor kinases and two additional response regulators, which are hidden among the numerous regulatory genes annotated in the genome of P. aeruginosa, remain to be identified.

  5. Transcriptomic analysis reveals tomato genes whose expression is induced specifically during effector-triggered immunity and identifies the Epk1 protein kinase which is required for the host response to three bacterial effector proteins.

    PubMed

    Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B

    2014-01-01

    Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.

  6. Genome-Wide Analyses of the Soybean F-Box Gene Family in Response to Salt Stress

    PubMed Central

    Jia, Qi; Xiao, Zhi-Xia; Wong, Fuk-Ling; Sun, Song; Liang, Kang-Jing; Lam, Hon-Ming

    2017-01-01

    The F-box family is one of the largest gene families in plants that regulate diverse life processes, including salt responses. However, the knowledge of the soybean F-box genes and their roles in salt tolerance remains limited. Here, we conducted a genome-wide survey of the soybean F-box family, and their expression analysis in response to salinity via in silico analysis of online RNA-sequencing (RNA-seq) data and quantitative reverse-transcription polymerase chain reaction (qRT-PCR) to predict their potential functions. A total of 725 potential F-box proteins encoded by 509 genes were identified and classified into 9 subfamilies. The gene structures, conserved domains and chromosomal distributions were characterized. There are 76 pairs of duplicate genes identified, including genome-wide segmental and tandem duplication events, which lead to the expansion of the number of F-box genes. The in silico expression analysis showed that these genes would be involved in diverse developmental functions and play an important role in salt response. Our qRT-PCR analysis confirmed 12 salt-responding F-box genes. Overall, our results provide useful information on soybean F-box genes, especially their potential roles in salt tolerance. PMID:28417911

  7. Genome-Wide Analyses of the Soybean F-Box Gene Family in Response to Salt Stress.

    PubMed

    Jia, Qi; Xiao, Zhi-Xia; Wong, Fuk-Ling; Sun, Song; Liang, Kang-Jing; Lam, Hon-Ming

    2017-04-12

    The F-box family is one of the largest gene families in plants that regulate diverse life processes, including salt responses. However, the knowledge of the soybean F-box genes and their roles in salt tolerance remains limited. Here, we conducted a genome-wide survey of the soybean F-box family, and their expression analysis in response to salinity via in silico analysis of online RNA-sequencing (RNA-seq) data and quantitative reverse-transcription polymerase chain reaction (qRT-PCR) to predict their potential functions. A total of 725 potential F-box proteins encoded by 509 genes were identified and classified into 9 subfamilies. The gene structures, conserved domains and chromosomal distributions were characterized. There are 76 pairs of duplicate genes identified, including genome-wide segmental and tandem duplication events, which lead to the expansion of the number of F-box genes. The in silico expression analysis showed that these genes would be involved in diverse developmental functions and play an important role in salt response. Our qRT-PCR analysis confirmed 12 salt-responding F-box genes. Overall, our results provide useful information on soybean F-box genes, especially their potential roles in salt tolerance.

  8. Transcriptional response of honey bee larvae infected with the bacterial pathogen Paenibacillus larvae.

    PubMed

    Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D

    2013-01-01

    American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis.

  9. Identification of host genes leading to West Nile virus encephalitis in mice brain using RNA-seq analysis

    PubMed Central

    Kumar, Mukesh; Belcaid, Mahdi; Nerurkar, Vivek R.

    2016-01-01

    Differential host responses may be critical determinants of distinct pathologies of West Nile virus (WNV) NY99 (pathogenic) and WNV Eg101 (non-pathogenic) strains. We employed RNA-seq technology to analyze global differential gene expression in WNV-infected mice brain and to identify the host cellular factors leading to lethal encephalitis. We identified 1,400 and 278 transcripts, which were differentially expressed after WNV NY99 and WNV Eg101 infections, respectively, and 147 genes were common to infection with both the viruses. Genes that were up-regulated in infection with both the viruses were mainly associated with interferon signaling. Genes associated with inflammation and cell death/apoptosis were only expressed after WNV NY99 infection. We demonstrate that differences in the activation of key pattern recognition receptors resulted in the induction of unique innate immune profiles, which corresponded with the induction of interferon and inflammatory responses. Pathway analysis of differentially expressed genes indicated that after WNV NY99 infection, TREM-1 mediated activation of toll-like receptors leads to the high inflammatory response. In conclusion, we have identified both common and specific responses to WNV NY99 and WNV Eg101 infections as well as genes linked to potential resistance to infection that may be targets for therapeutics. PMID:27211830

  10. Genome-wide screen for inositol auxotrophy in Saccharomyces cerevisiae implicates lipid metabolism in stress response signaling.

    PubMed

    Villa-García, Manuel J; Choi, Myung Sun; Hinz, Flora I; Gaspar, María L; Jesch, Stephen A; Henry, Susan A

    2011-02-01

    Inositol auxotrophy (Ino(-) phenotype) in budding yeast has classically been associated with misregulation of INO1 and other genes involved in lipid metabolism. To identify all non-essential yeast genes that are necessary for growth in the absence of inositol, we carried out a genome-wide phenotypic screening for deletion mutants exhibiting Ino(-) phenotypes under one or more growth conditions. We report the identification of 419 genes, including 385 genes not previously reported, which exhibit this phenotype when deleted. The identified genes are involved in a wide range of cellular processes, but are particularly enriched in those affecting transcription, protein modification, membrane trafficking, diverse stress responses, and lipid metabolism. Among the Ino(-) mutants involved in stress response, many exhibited phenotypes that are strengthened at elevated temperature and/or when choline is present in the medium. The role of inositol in regulation of lipid metabolism and stress response signaling is discussed.

  11. Alfalfa Cellulose Synthase Gene Expression under Abiotic Stress: A Hitchhiker’s Guide to RT-qPCR Normalization

    PubMed Central

    Guerriero, Gea; Legay, Sylvain; Hausman, Jean-Francois

    2014-01-01

    Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L.), no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress) at various time points (e.g. 0, 24, 72 and 96 h). We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots), under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses. PMID:25084115

  12. Genomic analysis of human lung fibroblasts exposed to vanadium pentoxide to identify candidate genes for occupational bronchitis

    PubMed Central

    Ingram, Jennifer L; Antao-Menezes, Aurita; Turpin, Elizabeth A; Wallace, Duncan G; Mangum, James B; Pluta, Linda J; Thomas, Russell S; Bonner, James C

    2007-01-01

    Background Exposure to vanadium pentoxide (V2O5) is a cause of occupational bronchitis. We evaluated gene expression profiles in cultured human lung fibroblasts exposed to V2O5 in vitro in order to identify candidate genes that could play a role in inflammation, fibrosis, and repair during the pathogenesis of V2O5-induced bronchitis. Methods Normal human lung fibroblasts were exposed to V2O5 in a time course experiment. Gene expression was measured at various time points over a 24 hr period using the Affymetrix Human Genome U133A 2.0 Array. Selected genes that were significantly changed in the microarray experiment were validated by RT-PCR. Results V2O5 altered more than 1,400 genes, of which ~300 were induced while >1,100 genes were suppressed. Gene ontology categories (GO) categories unique to induced genes included inflammatory response and immune response, while GO catogories unique to suppressed genes included ubiquitin cycle and cell cycle. A dozen genes were validated by RT-PCR, including growth factors (HBEGF, VEGF, CTGF), chemokines (IL8, CXCL9, CXCL10), oxidative stress response genes (SOD2, PIPOX, OXR1), and DNA-binding proteins (GAS1, STAT1). Conclusion Our study identified a variety of genes that could play pivotal roles in inflammation, fibrosis and repair during V2O5-induced bronchitis. The induction of genes that mediate inflammation and immune responses, as well as suppression of genes involved in growth arrest appear to be important to the lung fibrotic reaction to V2O5. PMID:17459161

  13. Use of natural variation reveals core genes in the transcriptome of iron-deficient Arabidopsis thaliana roots

    PubMed Central

    Stein, Ricardo J.; Waters, Brian M.

    2012-01-01

    Iron (Fe) is an essential mineral micronutrient for plants and animals. Plants respond to Fe deficiency by increasing root uptake capacity. Identification of gene networks for Fe uptake and homeostasis could result in improved crop growth and nutritional value. Previous studies have used microarrays to identify a large number of genes regulated by Fe deficiency in roots of three Arabidopsis ecotypes. However, a large proportion of these genes may be involved in secondary or genotype-influenced responses rather than in a universal role in Fe uptake or homeostasis. Here we show that a small percentage of the Fe deficiency transcriptome of two contrasting ecotypes, Kas-1 and Tsu-1, was shared with other ecotypes. Kas-1 and Tsu-1 had different timing and magnitude of ferric reductase activity upon Fe withdrawal, and different categories of overrepresented Fe-regulated genes. To gain insights into universal responses of Arabidopsis to Fe deficiency, the Kas-1 and Tsu-1 transcriptomes were compared with those of Col-0, Ler, and C24. In early Fe deficiency (24–48 h), no Fe-downregulated genes and only 10 upregulated genes were found in all ecotypes, and only 20 Fe-downregulated and 58 upregulated genes were found in at least three of the five ecotypes. Supernode gene networks were constructed to visualize conserved Fe homeostasis responses. Contrasting gene expression highlighted different responses to Fe deficiency between ecotypes. This study demonstrates the use of natural variation to identify central Fe-deficiency-regulated genes in plants, and identified genes with potential new roles in signalling during Fe deficiency. PMID:22039296

  14. Generation of novel pharmacogenomic candidates in the response to methotrexate in juvenile idiopathic arthritis: correlation between gene expression and genotype

    PubMed Central

    Moncrieffe, Halima; Hinks, Anne; Ursu, Simona; Kassoumeri, Laura; Etheridge, Angela; Hubank, Mike; Martin, Paul; Weiler, Tracey; Glass, David N; Thompson, Susan D.; Thomson, Wendy; Wedderburn, Lucy R

    2010-01-01

    Objectives Little is known about mechanisms of efficacy of methotrexate (MTX) in childhood arthritis, or genetic influences upon response to MTX. The aims of this study were to use gene expression profiling to identify novel pathways/genes altered by MTX and then investigate these genes for genotype associations with response to MTX treatment. Methods Gene expression profiling before and after MTX treatment was performed on 11 children with juvenile idiopathic arthritis (JIA) treated with MTX, in whom response at 6 months of treatment was defined. Genes showing the most differential gene expression after treatment were selected for SNP genotyping. Genotype frequencies were compared between non-responders and responders (ACR-Ped70). An independent cohort was available for validation. Results Gene expression profiling before and after MTX treatment revealed 1222 differentially expressed probes sets (fold change >1.7, p< 0.05) and 1065 when restricted to full responder cases only. Six highly differentially expressed genes were analysed for genetic association to response to MTX. Three SNPs in the SLC16A7 gene showed significant association with MTX response. One SNP showed validated association in an independent cohort. Conclusions This study is the first, to our knowledge, to evaluate gene expression profiles in children with JIA before and after MTX, and to analyse genetic variation in differentially expressed genes. We have identified a gene which may contribute to genetic variability in MTX response in JIA, and established as proof of principle that genes which are differentially expressed at mRNA level after drug administration may also be good candidates for genetic analysis. PMID:20827233

  15. Structural and Functional Analysis of the GRAS Gene Family in Grapevine Indicates a Role of GRAS Proteins in the Control of Development and Stress Responses

    PubMed Central

    Grimplet, Jérôme; Agudelo-Romero, Patricia; Teixeira, Rita T.; Martinez-Zapater, Jose M.; Fortes, Ana M.

    2016-01-01

    GRAS transcription factors are involved in many processes of plant growth and development (e.g., axillary shoot meristem formation, root radial patterning, nodule morphogenesis, arbuscular development) as well as in plant disease resistance and abiotic stress responses. However, little information is available concerning this gene family in grapevine (Vitis vinifera L.), an economically important woody crop. We performed a model curation of GRAS genes identified in the latest genome annotation leading to the identification of 52 genes. Gene models were improved and three new genes were identified that could be grapevine- or woody-plant specific. Phylogenetic analysis showed that GRAS genes could be classified into 13 groups that mapped on the 19 V. vinifera chromosomes. Five new subfamilies, previously not characterized in other species, were identified. Multiple sequence alignment showed typical GRAS domain in the proteins and new motifs were also described. As observed in other species, both segmental and tandem duplications contributed significantly to the expansion and evolution of the GRAS gene family in grapevine. Expression patterns across a variety of tissues and upon abiotic and biotic conditions revealed possible divergent functions of GRAS genes in grapevine development and stress responses. By comparing the information available for tomato and grapevine GRAS genes, we identified candidate genes that might constitute conserved transcriptional regulators of both climacteric and non-climacteric fruit ripening. Altogether this study provides valuable information and robust candidate genes for future functional analysis aiming at improving the quality of fleshy fruits. PMID:27065316

  16. Mining whole genomes and transcriptomes of Jatropha (Jatropha curcas) and Castor bean (Ricinus communis) for NBS-LRR genes and defense response associated transcription factors.

    PubMed

    Sood, Archit; Jaiswal, Varun; Chanumolu, Sree Krishna; Malhotra, Nikhil; Pal, Tarun; Chauhan, Rajinder Singh

    2014-11-01

    Jatropha (Jatropha curcas L.) and Castor bean (Ricinus communis) are oilseed crops of family Euphorbiaceae with the potential of producing high quality biodiesel and having industrial value. Both the bioenergy plants are becoming susceptible to various biotic stresses directly affecting the oil quality and content. No report exists as of today on analysis of Nucleotide Binding Site-Leucine Rich Repeat (NBS-LRR) gene repertoire and defense response transcription factors in both the plant species. In silico analysis of whole genomes and transcriptomes identified 47 new NBS-LRR genes in both the species and 122 and 318 defense response related transcription factors in Jatropha and Castor bean, respectively. The identified NBS-LRR genes and defense response transcription factors were mapped onto the respective genomes. Common and unique NBS-LRR genes and defense related transcription factors were identified in both the plant species. All NBS-LRR genes in both the species were characterized into Toll/interleukin-1 receptor NBS-LRRs (TNLs) and coiled-coil NBS-LRRs (CNLs), position on contigs, gene clusters and motifs and domains distribution. Transcript abundance or expression values were measured for all NBS-LRR genes and defense response transcription factors, suggesting their functional role. The current study provides a repertoire of NBS-LRR genes and transcription factors which can be used in not only dissecting the molecular basis of disease resistance phenotype but also in developing disease resistant genotypes in Jatropha and Castor bean through transgenic or molecular breeding approaches.

  17. Characterization of Arabidopsis Transcriptional Responses to Different Aphid Species Reveals Genes that Contribute to Host Susceptibility and Non-host Resistance

    PubMed Central

    Jaouannet, Maëlle; Morris, Jenny A.; Hedley, Peter E.; Bos, Jorunn I. B.

    2015-01-01

    Aphids are economically important pests that display exceptional variation in host range. The determinants of diverse aphid host ranges are not well understood, but it is likely that molecular interactions are involved. With significant progress being made towards understanding host responses upon aphid attack, the mechanisms underlying non-host resistance remain to be elucidated. Here, we investigated and compared Arabidopsis thaliana host and non-host responses to aphids at the transcriptional level using three different aphid species, Myzus persicae, Myzus cerasi and Rhopalosiphum pisum. Gene expression analyses revealed a high level of overlap in the overall gene expression changes during the host and non-host interactions with regards to the sets of genes differentially expressed and the direction of expression changes. Despite this overlap in transcriptional responses across interactions, there was a stronger repression of genes involved in metabolism and oxidative responses specifically during the host interaction with M. persicae. In addition, we identified a set of genes with opposite gene expression patterns during the host versus non-host interactions. Aphid performance assays on Arabidopsis mutants that were selected based on our transcriptome analyses identified novel genes contributing to host susceptibility, host defences during interactions with M. persicae as well to non-host resistance against R. padi. Understanding how plants respond to aphid species that differ in their ability to infest plant species, and identifying the genes and signaling pathways involved, is essential for the development of novel and durable aphid control in crop plants. PMID:25993686

  18. Feedback inhibition by thiols outranks glutathione depletion: a luciferase-based screen reveals glutathione-deficient γ -ECS and glutathione synthetase mutants impaired in cadmium-induced sulfate assimilation

    PubMed Central

    Jobe, Timothy O.; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A.; Mendoza-Cózatl, David G.; Schroeder, Julian I.

    2015-01-01

    Summary Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M2 seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. PMID:22283708

  19. Gene expression profiles associated with anaemia and ITPA genotypes in patients with chronic hepatitis C (CH-C).

    PubMed

    Birerdinc, A; Estep, M; Afendy, A; Stepanova, M; Younossi, I; Baranova, A; Younossi, Z M

    2012-06-01

    Anaemia is a common side effect of ribavirin (RBV) which is used for the treatment of hepatitis C. Inosine triphosphatase gene polymorphism (C to A) protects against RBV-induced anaemia. The aim of our study was to genotype patients for inosine triphosphatase gene polymorphism rs1127354 SNP (CC or CA) and associate treatment-induced anaemia with gene expression profile and genotypes. We used 67 hepatitis C patients with available gene expression, clinical, laboratory data and whole-blood samples. Whole blood was used to determine inosine triphosphatase gene polymorphism rs1127354 genotypes (CC or CA). The cohort with inosine triphosphatase gene polymorphism CA genotype revealed a distinct pattern of protection against anaemia and a lower drop in haemoglobin. A variation in the propensity of CC carriers to develop anaemia prompted us to look for additional predictors of anaemia during pegylated interferon (PEG-IFN) and RBV. Pretreatment blood samples of patients receiving a full course of PEG-IFN and RBV were used to assess expression of 153 genes previously implicated in host response to viral infections. The gene expression data were analysed according to presence of anaemia and inosine triphosphatase gene polymorphism genotypes. Thirty-six genes were associated with treatment-related anaemia, six of which are involved in the response to hypoxia pathway (HIF1A, AIF1, RHOC, PTEN, LCK and PDGFB). There was a substantial overlap between sustained virological response (SVR)-predicting and anaemia-related genes; however, of the nine JAK-STAT pathway-related genes associated with SVR, none were implicated in anaemia. These observations exclude the direct involvement of antiviral response in the development of anaemia associated with PEG-IFN and RBV treatment, whereas another, distinct component within the SVR-associated gene expression response may predict anaemia. We have identified baseline gene expression signatures associated with RBV-induced anaemia and identified its functional pathways. In particular, we identified the hypoxia response pathway and the apoptosis/survival-related gene network, as differentially expressed in chronic hepatitis C patients with anaemia. © 2011 Blackwell Publishing Ltd.

  20. Genome-Wide Profiling of Histone Modifications (H3K9me2 and H4K12ac) and Gene Expression in Rust (Uromyces appendiculatus) Inoculated Common Bean (Phaseolus vulgaris L.).

    PubMed

    Ayyappan, Vasudevan; Kalavacharla, Venu; Thimmapuram, Jyothi; Bhide, Ketaki P; Sripathi, Venkateswara R; Smolinski, Tomasz G; Manoharan, Muthusamy; Thurston, Yaqoob; Todd, Antonette; Kingham, Bruce

    2015-01-01

    Histone modifications such as methylation and acetylation play a significant role in controlling gene expression in unstressed and stressed plants. Genome-wide analysis of such stress-responsive modifications and genes in non-model crops is limited. We report the genome-wide profiling of histone methylation (H3K9me2) and acetylation (H4K12ac) in common bean (Phaseolus vulgaris L.) under rust (Uromyces appendiculatus) stress using two high-throughput approaches, chromatin immunoprecipitation sequencing (ChIP-Seq) and RNA sequencing (RNA-Seq). ChIP-Seq analysis revealed 1,235 and 556 histone methylation and acetylation responsive genes from common bean leaves treated with the rust pathogen at 0, 12 and 84 hour-after-inoculation (hai), while RNA-Seq analysis identified 145 and 1,763 genes differentially expressed between mock-inoculated and inoculated plants. The combined ChIP-Seq and RNA-Seq analyses identified some key defense responsive genes (calmodulin, cytochrome p450, chitinase, DNA Pol II, and LRR) and transcription factors (WRKY, bZIP, MYB, HSFB3, GRAS, NAC, and NMRA) in bean-rust interaction. Differential methylation and acetylation affected a large proportion of stress-responsive genes including resistant (R) proteins, detoxifying enzymes, and genes involved in ion flux and cell death. The genes identified were functionally classified using Gene Ontology (GO) and EuKaryotic Orthologous Groups (KOGs). The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis identified a putative pathway with ten key genes involved in plant-pathogen interactions. This first report of an integrated analysis of histone modifications and gene expression involved in the bean-rust interaction as reported here provides a comprehensive resource for other epigenomic regulation studies in non-model species under stress.

  1. Genome-Wide Profiling of Histone Modifications (H3K9me2 and H4K12ac) and Gene Expression in Rust (Uromyces appendiculatus) Inoculated Common Bean (Phaseolus vulgaris L.)

    PubMed Central

    Thimmapuram, Jyothi; Bhide, Ketaki P.; Sripathi, Venkateswara R.; Smolinski, Tomasz G.; Manoharan, Muthusamy; Thurston, Yaqoob; Todd, Antonette; Kingham, Bruce

    2015-01-01

    Histone modifications such as methylation and acetylation play a significant role in controlling gene expression in unstressed and stressed plants. Genome-wide analysis of such stress-responsive modifications and genes in non-model crops is limited. We report the genome-wide profiling of histone methylation (H3K9me2) and acetylation (H4K12ac) in common bean (Phaseolus vulgaris L.) under rust (Uromyces appendiculatus) stress using two high-throughput approaches, chromatin immunoprecipitation sequencing (ChIP-Seq) and RNA sequencing (RNA-Seq). ChIP-Seq analysis revealed 1,235 and 556 histone methylation and acetylation responsive genes from common bean leaves treated with the rust pathogen at 0, 12 and 84 hour-after-inoculation (hai), while RNA-Seq analysis identified 145 and 1,763 genes differentially expressed between mock-inoculated and inoculated plants. The combined ChIP-Seq and RNA-Seq analyses identified some key defense responsive genes (calmodulin, cytochrome p450, chitinase, DNA Pol II, and LRR) and transcription factors (WRKY, bZIP, MYB, HSFB3, GRAS, NAC, and NMRA) in bean-rust interaction. Differential methylation and acetylation affected a large proportion of stress-responsive genes including resistant (R) proteins, detoxifying enzymes, and genes involved in ion flux and cell death. The genes identified were functionally classified using Gene Ontology (GO) and EuKaryotic Orthologous Groups (KOGs). The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis identified a putative pathway with ten key genes involved in plant-pathogen interactions. This first report of an integrated analysis of histone modifications and gene expression involved in the bean-rust interaction as reported here provides a comprehensive resource for other epigenomic regulation studies in non-model species under stress. PMID:26167691

  2. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  3. Mechanical stretch is a highly selective regulator of gene expression in human bladder smooth muscle cells.

    PubMed

    Adam, Rosalyn M; Eaton, Samuel H; Estrada, Carlos; Nimgaonkar, Ashish; Shih, Shu-Ching; Smith, Lois E H; Kohane, Isaac S; Bägli, Darius; Freeman, Michael R

    2004-12-15

    Application of mechanical stimuli has been shown to alter gene expression in bladder smooth muscle cells (SMC). To date, only a limited number of "stretch-responsive" genes in this cell type have been reported. We employed oligonucleotide arrays to identify stretch-sensitive genes in primary culture human bladder SMC subjected to repetitive mechanical stimulation for 4 h. Differential gene expression between stretched and nonstretched cells was assessed using Significance Analysis of Microarrays (SAM). Expression of 20 out of 11,731 expressed genes ( approximately 0.17%) was altered >2-fold following stretch, with 19 genes induced and one gene (FGF-9) repressed. Using real-time RT-PCR, we tested independently the responsiveness of 15 genes to stretch and to platelet-derived growth factor-BB (PDGF-BB), another hypertrophic stimulus for bladder SMC. In response to both stimuli, expression of 13 genes increased, 1 gene (FGF-9) decreased, and 1 gene was unchanged. Six transcripts (HB-EGF, BMP-2, COX-2, LIF, PAR-2, and FGF-9) were evaluated using an ex vivo rat model of bladder distension. HB-EGF, BMP-2, COX-2, LIF, and PAR-2 increased with bladder stretch ex vivo, whereas FGF-9 decreased, consistent with expression changes observed in vitro. In silico analysis of microarray data using the FIRED algorithm identified c-jun, AP-1, ATF-2, and neurofibromin-1 (NF-1) as potential transcriptional mediators of stretch signals. Furthermore, the promoters of 9 of 13 stretch-responsive genes contained AP-1 binding sites. These observations identify stretch as a highly selective regulator of gene expression in bladder SMC. Moreover, they suggest that mechanical and growth factor signals converge on common transcriptional regulators that include members of the AP-1 family.

  4. Comparison of gene co-networks reveals the molecular mechanisms of the rice (Oryza sativa L.) response to Rhizoctonia solani AG1 IA infection.

    PubMed

    Zhang, Jinfeng; Zhao, Wenjuan; Fu, Rong; Fu, Chenglin; Wang, Lingxia; Liu, Huainian; Li, Shuangcheng; Deng, Qiming; Wang, Shiquan; Zhu, Jun; Liang, Yueyang; Li, Ping; Zheng, Aiping

    2018-05-05

    Rhizoctonia solani causes rice sheath blight, an important disease affecting the growth of rice (Oryza sativa L.). Attempts to control the disease have met with little success. Based on transcriptional profiling, we previously identified more than 11,947 common differentially expressed genes (TPM > 10) between the rice genotypes TeQing and Lemont. In the current study, we extended these findings by focusing on an analysis of gene co-expression in response to R. solani AG1 IA and identified gene modules within the networks through weighted gene co-expression network analysis (WGCNA). We compared the different genes assigned to each module and the biological interpretations of gene co-expression networks at early and later modules in the two rice genotypes to reveal differential responses to AG1 IA. Our results show that different changes occurred in the two rice genotypes and that the modules in the two groups contain a number of candidate genes possibly involved in pathogenesis, such as the VQ protein. Furthermore, these gene co-expression networks provide comprehensive transcriptional information regarding gene expression in rice in response to AG1 IA. The co-expression networks derived from our data offer ideas for follow-up experimentation that will help advance our understanding of the translational regulation of rice gene expression changes in response to AG1 IA.

  5. TimeXNet Web: Identifying cellular response networks from diverse omics time-course data.

    PubMed

    Tan, Phit Ling; López, Yosvany; Nakai, Kenta; Patil, Ashwini

    2018-05-14

    Condition-specific time-course omics profiles are frequently used to study cellular response to stimuli and identify associated signaling pathways. However, few online tools allow users to analyze multiple types of high-throughput time-course data. TimeXNet Web is a web server that extracts a time-dependent gene/protein response network from time-course transcriptomic, proteomic or phospho-proteomic data, and an input interaction network. It classifies the given genes/proteins into time-dependent groups based on the time of their highest activity and identifies the most probable paths connecting genes/proteins in consecutive groups. The response sub-network is enriched in activated genes/proteins and contains novel regulators that do not show any observable change in the input data. Users can view the resultant response network and analyze it for functional enrichment. TimeXNet Web supports the analysis of high-throughput data from multiple species by providing high quality, weighted protein-protein interaction networks for 12 model organisms. http://txnet.hgc.jp/. ashwini@hgc.jp. Supplementary data are available at Bioinformatics online.

  6. Combining classifiers to predict gene function in Arabidopsis thaliana using large-scale gene expression measurements.

    PubMed

    Lan, Hui; Carson, Rachel; Provart, Nicholas J; Bonner, Anthony J

    2007-09-21

    Arabidopsis thaliana is the model species of current plant genomic research with a genome size of 125 Mb and approximately 28,000 genes. The function of half of these genes is currently unknown. The purpose of this study is to infer gene function in Arabidopsis using machine-learning algorithms applied to large-scale gene expression data sets, with the goal of identifying genes that are potentially involved in plant response to abiotic stress. Using in house and publicly available data, we assembled a large set of gene expression measurements for A. thaliana. Using those genes of known function, we first evaluated and compared the ability of basic machine-learning algorithms to predict which genes respond to stress. Predictive accuracy was measured using ROC50 and precision curves derived through cross validation. To improve accuracy, we developed a method for combining these classifiers using a weighted-voting scheme. The combined classifier was then trained on genes of known function and applied to genes of unknown function, identifying genes that potentially respond to stress. Visual evidence corroborating the predictions was obtained using electronic Northern analysis. Three of the predicted genes were chosen for biological validation. Gene knockout experiments confirmed that all three are involved in a variety of stress responses. The biological analysis of one of these genes (At1g16850) is presented here, where it is shown to be necessary for the normal response to temperature and NaCl. Supervised learning methods applied to large-scale gene expression measurements can be used to predict gene function. However, the ability of basic learning methods to predict stress response varies widely and depends heavily on how much dimensionality reduction is used. Our method of combining classifiers can improve the accuracy of such predictions - in this case, predictions of genes involved in stress response in plants - and it effectively chooses the appropriate amount of dimensionality reduction automatically. The method provides a useful means of identifying genes in A. thaliana that potentially respond to stress, and we expect it would be useful in other organisms and for other gene functions.

  7. Compendium of Immune Signatures Identifies Conserved and Species-Specific Biology in Response to Inflammation.

    PubMed

    Godec, Jernej; Tan, Yan; Liberzon, Arthur; Tamayo, Pablo; Bhattacharya, Sanchita; Butte, Atul J; Mesirov, Jill P; Haining, W Nicholas

    2016-01-19

    Gene-expression profiling has become a mainstay in immunology, but subtle changes in gene networks related to biological processes are hard to discern when comparing various datasets. For instance, conservation of the transcriptional response to sepsis in mouse models and human disease remains controversial. To improve transcriptional analysis in immunology, we created ImmuneSigDB: a manually annotated compendium of ∼5,000 gene-sets from diverse cell states, experimental manipulations, and genetic perturbations in immunology. Analysis using ImmuneSigDB identified signatures induced in activated myeloid cells and differentiating lymphocytes that were highly conserved between humans and mice. Sepsis triggered conserved patterns of gene expression in humans and mouse models. However, we also identified species-specific biological processes in the sepsis transcriptional response: although both species upregulated phagocytosis-related genes, a mitosis signature was specific to humans. ImmuneSigDB enables granular analysis of transcriptomic data to improve biological understanding of immune processes of the human and mouse immune systems. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Functional genetic polymorphisms and female reproductive disorders: Part I: polycystic ovary syndrome and ovarian response

    PubMed Central

    Simoni, M.; Tempfer, C.B.; Destenaves, B.; Fauser, B.C.J.M.

    2008-01-01

    BACKGROUND The identification of polymorphisms associated with a disease can help to elucidate its pathogenesis, and this knowledge can be used to improve prognosis for women with a particular disorder, such as polycystic ovary syndrome (PCOS). Since an altered response to ovarian stimulation is also a characteristic of the disease, further knowledge about its aetiology could help in defining the parameters that determine the response of an individual to ovarian stimulation. METHODS PubMed and EMBASE databases were systematically searched for gene association studies published until the end of August 2007, using search criteria relevant to PCOS and ovarian response to stimulation. Data from additional papers identified through hand searches were also included; 139 publications were reviewed. RESULTS Several genes involved in ovarian function and metabolism are associated with increased susceptibility to PCOS, but none is strong enough to correlate alone with susceptibility to the disease, or response to therapy. A single-nucleotide polymorphism in exon 10 of the FSH receptor (FSHR) gene, FSHR p.N680S, was consistently identified as having a significant association with ovarian response to FSH. CONCLUSIONS No consistent association between gene polymorphism and PCOS could be identified. The FSHR gene may play a significant role in the success of ovarian stimulation, and can be used as a marker to predict differences in FSHR function and ovarian response to FSH. Genotyping the FSHR p.N680S polymorphism may provide a means of identifying a population of poor responders before in vitro fertilization procedures are initiated. PMID:18603647

  9. Comparative Analysis of AhR-Mediated TCDD-Elicited Gene Expression in Human Liver Adult Stem Cells

    PubMed Central

    Kim, Suntae; Dere, Edward; Burgoon, Lyle D.; Chang, Chia-Cheng; Zacharewski, Timothy R.

    2009-01-01

    Time course and dose-response studies were conducted in HL1-1 cells, a human liver cell line with stem cell–like characteristics, to assess the differential gene expression elicited by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) compared with other established models. Cells were treated with 0.001, 0.01, 0.1, 1, 10, or 100nM TCDD or dimethyl sulfoxide vehicle control for 12 h for the dose-response study, or with 10nM TCDD or vehicle for 1, 2, 4, 8, 12, 24, or 48 h for the time course study. Elicited changes were monitored using a human cDNA microarray with 6995 represented genes. Empirical Bayes analysis identified 144 genes differentially expressed at one or more time points following treatment. Most genes exhibited dose-dependent responses including CYP1A1, CYP1B1, ALDH1A3, and SLC7A5 genes. Comparative analysis of HL1-1 differential gene expression to human HepG2 data identified 74 genes with comparable temporal expression profiles including 12 putative primary responses. HL1-1–specific changes were related to lipid metabolism and immune responses, consistent with effects elicited in vivo. Furthermore, comparative analysis of HL1-1 cells with mouse Hepa1c1c7 hepatoma cell lines and C57BL/6 hepatic tissue identified 18 and 32 commonly regulated orthologous genes, respectively, with functions associated with signal transduction, transcriptional regulation, metabolism and transport. Although some common pathways are affected, the results suggest that TCDD elicits species- and model-specific gene expression profiles. PMID:19684285

  10. Changes in gene expression associated with response to neoadjuvant chemotherapy in breast cancer.

    PubMed

    Hannemann, Juliane; Oosterkamp, Hendrika M; Bosch, Cathy A J; Velds, Arno; Wessels, Lodewyk F A; Loo, Claudette; Rutgers, Emiel J; Rodenhuis, Sjoerd; van de Vijver, Marc J

    2005-05-20

    At present, clinically useful markers predicting response of primary breast carcinomas to either doxorubicin-cyclophosphamide (AC) or doxorubicin-docetaxel (AD) are lacking. We investigated whether gene expression profiles of the primary tumor could be used to predict treatment response to either of those chemotherapy regimens. Within a single-institution, randomized, phase II trial, patients with locally advanced breast cancer received six courses of either AC (n = 24) or AD (n = 24) neoadjuvant chemotherapy. Gene expression profiles were generated from core-needle biopsies obtained before treatment and correlated with the response of the primary tumor to the chemotherapy administered. Additionally, pretreatment gene expression profiles were compared with those in tumors remaining after chemotherapy. Ten (20%) of 48 patients showed a (near) pathologic complete remission of the primary tumor after treatment. No gene expression pattern correlating with response could be identified for all patients or for the AC or AD groups separately. The comparison of the pretreatment biopsy and the tumor excised after chemotherapy revealed differences in gene expression in tumors that showed a partial remission but not in tumors that did not respond to chemotherapy. No gene expression profile predicting the response of primary breast carcinomas to AC- or AD-based neoadjuvant chemotherapy could be detected in this interim analysis. More subtle differences in gene expression are likely to be present but can only be reliably identified by studying a larger group of patients. Response of a breast tumor to neoadjuvant chemotherapy results in alterations in gene expression.

  11. Tissue Non-Specific Genes and Pathways Associated with Diabetes: An Expression Meta-Analysis.

    PubMed

    Mei, Hao; Li, Lianna; Liu, Shijian; Jiang, Fan; Griswold, Michael; Mosley, Thomas

    2017-01-21

    We performed expression studies to identify tissue non-specific genes and pathways of diabetes by meta-analysis. We searched curated datasets of the Gene Expression Omnibus (GEO) database and identified 13 and five expression studies of diabetes and insulin responses at various tissues, respectively. We tested differential gene expression by empirical Bayes-based linear method and investigated gene set expression association by knowledge-based enrichment analysis. Meta-analysis by different methods was applied to identify tissue non-specific genes and gene sets. We also proposed pathway mapping analysis to infer functions of the identified gene sets, and correlation and independent analysis to evaluate expression association profile of genes and gene sets between studies and tissues. Our analysis showed that PGRMC1 and HADH genes were significant over diabetes studies, while IRS1 and MPST genes were significant over insulin response studies, and joint analysis showed that HADH and MPST genes were significant over all combined data sets. The pathway analysis identified six significant gene sets over all studies. The KEGG pathway mapping indicated that the significant gene sets are related to diabetes pathogenesis. The results also presented that 12.8% and 59.0% pairwise studies had significantly correlated expression association for genes and gene sets, respectively; moreover, 12.8% pairwise studies had independent expression association for genes, but no studies were observed significantly different for expression association of gene sets. Our analysis indicated that there are both tissue specific and non-specific genes and pathways associated with diabetes pathogenesis. Compared to the gene expression, pathway association tends to be tissue non-specific, and a common pathway influencing diabetes development is activated through different genes at different tissues.

  12. Comparative Digital Gene Expression Analysis of the Arabidopsis Response to Volatiles Emitted by Bacillus amyloliquefaciens

    PubMed Central

    Hao, Hai-Ting; Zhao, Xia; Shang, Qian-Han; Wang, Yun; Guo, Zhi-Hong; Zhang, Yu-Bao; Xie, Zhong-Kui; Wang, Ruo-Yu

    2016-01-01

    Some plant growth-promoting rhizobacteria (PGPR) regulated plant growth and elicited plant basal immunity by volatiles. The response mechanism to the Bacillus amyloliquefaciens volatiles in plant has not been well studied. We conducted global gene expression profiling in Arabidopsis after treatment with Bacillus amyloliquefaciens FZB42 volatiles by Illumina Digital Gene Expression (DGE) profiling of different growth stages (seedling and mature) and tissues (leaves and roots). Compared with the control, 1,507 and 820 differentially expressed genes (DEGs) were identified in leaves and roots at the seedling stage, respectively, while 1,512 and 367 DEGs were identified in leaves and roots at the mature stage. Seventeen genes with different regulatory patterns were validated using quantitative RT-PCR. Numerous DEGs were enriched for plant hormones, cell wall modifications, and protection against stress situations, which suggests that volatiles have effects on plant growth and immunity. Moreover, analyzes of transcriptome difference in tissues and growth stage using DGE profiling showed that the plant response might be tissue-specific and/or growth stage-specific. Thus, genes encoding flavonoid biosynthesis were downregulated in leaves and upregulated in roots, thereby indicating tissue-specific responses to volatiles. Genes related to photosynthesis were downregulated at the seedling stage and upregulated at the mature stage, respectively, thereby suggesting growth period-specific responses. In addition, the emission of bacterial volatiles significantly induced killing of cells of other organism pathway with up-regulated genes in leaves and the other three pathways (defense response to nematode, cell morphogenesis involved in differentiation and trichoblast differentiation) with up-regulated genes were significantly enriched in roots. Interestingly, some important alterations in the expression of growth-related genes, metabolic pathways, defense response to biotic stress and hormone-related genes were firstly founded response to FZB42 volatiles. PMID:27513952

  13. Identification and Functional Analysis of Healing Regulators in Drosophila

    PubMed Central

    Álvarez-Fernández, Carmen; Tamirisa, Srividya; Prada, Federico; Chernomoretz, Ariel; Podhajcer, Osvaldo; Blanco, Enrique; Martín-Blanco, Enrique

    2015-01-01

    Wound healing is an essential homeostatic mechanism that maintains the epithelial barrier integrity after tissue damage. Although we know the overall steps in wound healing, many of the underlying molecular mechanisms remain unclear. Genetically amenable systems, such as wound healing in Drosophila imaginal discs, do not model all aspects of the repair process. However, they do allow the less understood aspects of the healing response to be explored, e.g., which signal(s) are responsible for initiating tissue remodeling? How is sealing of the epithelia achieved? Or, what inhibitory cues cancel the healing machinery upon completion? Answering these and other questions first requires the identification and functional analysis of wound specific genes. A variety of different microarray analyses of murine and humans have identified characteristic profiles of gene expression at the wound site, however, very few functional studies in healing regulation have been carried out. We developed an experimentally controlled method that is healing-permissive and that allows live imaging and biochemical analysis of cultured imaginal discs. We performed comparative genome-wide profiling between Drosophila imaginal cells actively involved in healing versus their non-engaged siblings. Sets of potential wound-specific genes were subsequently identified. Importantly, besides identifying and categorizing new genes, we functionally tested many of their gene products by genetic interference and overexpression in healing assays. This non-saturated analysis defines a relevant set of genes whose changes in expression level are functionally significant for proper tissue repair. Amongst these we identified the TCP1 chaperonin complex as a key regulator of the actin cytoskeleton essential for the wound healing response. There is promise that our newly identified wound-healing genes will guide future work in the more complex mammalian wound healing response. PMID:25647511

  14. Gravity-regulated gene expression in Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

    Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

  15. The Genetics of Deafness in Domestic Animals

    PubMed Central

    Strain, George M.

    2015-01-01

    Although deafness can be acquired throughout an animal’s life from a variety of causes, hereditary deafness, especially congenital hereditary deafness, is a significant problem in several species. Extensive reviews exist of the genetics of deafness in humans and mice, but not for deafness in domestic animals. Hereditary deafness in many species and breeds is associated with loci for white pigmentation, where the cochlear pathology is cochleo-saccular. In other cases, there is no pigmentation association and the cochlear pathology is neuroepithelial. Late onset hereditary deafness has recently been identified in dogs and may be present but not yet recognized in other species. Few genes responsible for deafness have been identified in animals, but progress has been made for identifying genes responsible for the associated pigmentation phenotypes. Across species, the genes identified with deafness or white pigmentation patterns include MITF, PMEL, KIT, EDNRB, CDH23, TYR, and TRPM1 in dog, cat, horse, cow, pig, sheep, ferret, mink, camelid, and rabbit. Multiple causative genes are present in some species. Significant work remains in many cases to identify specific chromosomal deafness genes so that DNA testing can be used to identify carriers of the mutated genes and thereby reduce deafness prevalence. PMID:26664958

  16. Identifying Functional Mechanisms of Gene and Protein Regulatory Networks in Response to a Broader Range of Environmental Stresses

    PubMed Central

    Li, Cheng-Wei; Chen, Bor-Sen

    2010-01-01

    Cellular responses to sudden environmental stresses or physiological changes provide living organisms with the opportunity for final survival and further development. Therefore, it is an important topic to understand protective mechanisms against environmental stresses from the viewpoint of gene and protein networks. We propose two coupled nonlinear stochastic dynamic models to reconstruct stress-activated gene and protein regulatory networks via microarray data in response to environmental stresses. According to the reconstructed gene/protein networks, some possible mutual interactions, feedforward and feedback loops are found for accelerating response and filtering noises in these signaling pathways. A bow-tie core network is also identified to coordinate mutual interactions and feedforward loops, feedback inhibitions, feedback activations, and cross talks to cope efficiently with a broader range of environmental stresses with limited proteins and pathways. PMID:20454442

  17. Emerging trends in the functional genomics of the abiotic stress response in crop plants.

    PubMed

    Vij, Shubha; Tyagi, Akhilesh K

    2007-05-01

    Plants are exposed to different abiotic stresses, such as water deficit, high temperature, salinity, cold, heavy metals and mechanical wounding, under field conditions. It is estimated that such stress conditions can potentially reduce the yield of crop plants by more than 50%. Investigations of the physiological, biochemical and molecular aspects of stress tolerance have been conducted to unravel the intrinsic mechanisms developed during evolution to mitigate against stress by plants. Before the advent of the genomics era, researchers primarily used a gene-by-gene approach to decipher the function of the genes involved in the abiotic stress response. However, abiotic stress tolerance is a complex trait and, although large numbers of genes have been identified to be involved in the abiotic stress response, there remain large gaps in our understanding of the trait. The availability of the genome sequences of certain important plant species has enabled the use of strategies, such as genome-wide expression profiling, to identify the genes associated with the stress response, followed by the verification of gene function by the analysis of mutants and transgenics. Certain components of both abscisic acid-dependent and -independent cascades involved in the stress response have already been identified. Information originating from the genome-wide analysis of abiotic stress tolerance will help to provide an insight into the stress-responsive network(s), and may allow the modification of this network to reduce the loss caused by stress and to increase agricultural productivity.

  18. Integration of Genome-Wide Computation DRE Search, AhR ChIP-chip and Gene Expression Analyses of TCDD-Elicited Responses in the Mouse Liver

    PubMed Central

    2011-01-01

    Background The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor (TF) that mediates responses to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Integration of TCDD-induced genome-wide AhR enrichment, differential gene expression and computational dioxin response element (DRE) analyses further elucidate the hepatic AhR regulatory network. Results Global ChIP-chip and gene expression analyses were performed on hepatic tissue from immature ovariectomized mice orally gavaged with 30 μg/kg TCDD. ChIP-chip analysis identified 14,446 and 974 AhR enriched regions (1% false discovery rate) at 2 and 24 hrs, respectively. Enrichment density was greatest in the proximal promoter, and more specifically, within ± 1.5 kb of a transcriptional start site (TSS). AhR enrichment also occurred distal to a TSS (e.g. intergenic DNA and 3' UTR), extending the potential gene expression regulatory roles of the AhR. Although TF binding site analyses identified over-represented DRE sequences within enriched regions, approximately 50% of all AhR enriched regions lacked a DRE core (5'-GCGTG-3'). Microarray analysis identified 1,896 number of TCDD-responsive genes (|fold change| ≥ 1.5, P1(t) > 0.999). Integrating this gene expression data with our ChIP-chip and DRE analyses only identified 625 differentially expressed genes that involved an AhR interaction at a DRE. Functional annotation analysis of differentially regulated genes associated with AhR enrichment identified overrepresented processes related to fatty acid and lipid metabolism and transport, and xenobiotic metabolism, which are consistent with TCDD-elicited steatosis in the mouse liver. Conclusions Details of the AhR regulatory network have been expanded to include AhR-DNA interactions within intragenic and intergenic genomic regions. Moreover, the AhR can interact with DNA independent of a DRE core suggesting there are alternative mechanisms of AhR-mediated gene regulation. PMID:21762485

  19. A Novel Strategy for Selection and Validation of Reference Genes in Dynamic Multidimensional Experimental Design in Yeast

    PubMed Central

    Cankorur-Cetinkaya, Ayca; Dereli, Elif; Eraslan, Serpil; Karabekmez, Erkan; Dikicioglu, Duygu; Kirdar, Betul

    2012-01-01

    Background Understanding the dynamic mechanism behind the transcriptional organization of genes in response to varying environmental conditions requires time-dependent data. The dynamic transcriptional response obtained by real-time RT-qPCR experiments could only be correctly interpreted if suitable reference genes are used in the analysis. The lack of available studies on the identification of candidate reference genes in dynamic gene expression studies necessitates the identification and the verification of a suitable gene set for the analysis of transient gene expression response. Principal Findings In this study, a candidate reference gene set for RT-qPCR analysis of dynamic transcriptional changes in Saccharomyces cerevisiae was determined using 31 different publicly available time series transcriptome datasets. Ten of the twelve candidates (TPI1, FBA1, CCW12, CDC19, ADH1, PGK1, GCN4, PDC1, RPS26A and ARF1) we identified were not previously reported as potential reference genes. Our method also identified the commonly used reference genes ACT1 and TDH3. The most stable reference genes from this pool were determined as TPI1, FBA1, CDC19 and ACT1 in response to a perturbation in the amount of available glucose and as FBA1, TDH3, CCW12 and ACT1 in response to a perturbation in the amount of available ammonium. The use of these newly proposed gene sets outperformed the use of common reference genes in the determination of dynamic transcriptional response of the target genes, HAP4 and MEP2, in response to relaxation from glucose and ammonium limitations, respectively. Conclusions A candidate reference gene set to be used in dynamic real-time RT-qPCR expression profiling in yeast was proposed for the first time in the present study. Suitable pools of stable reference genes to be used under different experimental conditions could be selected from this candidate set in order to successfully determine the expression profiles for the genes of interest. PMID:22675547

  20. Identifying genetic loci affecting antidepressant drug response in depression using drug–gene interaction models

    PubMed Central

    Noordam, Raymond; Avery, Christy L; Visser, Loes E; Stricker, Bruno H

    2016-01-01

    Antidepressants are often only moderately successful in decreasing the severity of depressive symptoms. In part, antidepressant treatment response in patients with depression is genetically determined. However, although a large number of studies have been conducted aiming to identify genetic variants associated with antidepressant drug response in depression, only a few variants have been repeatedly identified. Within the present review, we will discuss the methodological challenges and limitations of the studies that have been conducted on this topic to date (e.g., ‘treated-only design’, statistical power) and we will discuss how specifically drug–gene interaction models can be used to be better able to identify genetic variants associated with antidepressant drug response in depression. PMID:27248517

  1. Medium term water deficit elicits distinct transcriptome responses in Eucalyptus species of contrasting environmental origin.

    PubMed

    Spokevicius, Antanas V; Tibbits, Josquin; Rigault, Philippe; Nolin, Marc-Alexandre; Müller, Caroline; Merchant, Andrew

    2017-04-07

    Climatic and edaphic conditions over geological timescales have generated enormous diversity of adaptive traits and high speciation within the genus Eucalyptus (L. Hér.). Eucalypt species occur from high rainfall to semi-arid zones and from the tropics to latitudes as high as 43°S. Despite several morphological and metabolomic characterizations, little is known regarding gene expression differences that underpin differences in tolerance to environmental change. Using species of contrasting taxonomy, morphology and physiology (E. globulus and E. cladocalyx), this study combines physiological characterizations with 'second-generation' sequencing to identify key genes involved in eucalypt responses to medium-term water limitation. One hundred twenty Million high-quality HiSeq reads were created from 14 tissue samples in plants that had been successfully subjected to a water deficit treatment or a well-watered control. Alignment to the E. grandis genome saw 23,623 genes of which 468 exhibited differential expression (FDR < 0.01) in one or both ecotypes in response to the treatment. Further analysis identified 80 genes that demonstrated a significant species-specific response of which 74 were linked to the 'dry' species E. cladocalyx where 23 of these genes were uncharacterised. The majority (approximately 80%) of these differentially expressed genes, were expressed in stem tissue. Key genes that differentiated species responses were linked to photoprotection/redox balance, phytohormone/signalling, primary photosynthesis/cellular metabolism and secondary metabolism based on plant metabolic pathway network analysis. These results highlight a more definitive response to water deficit by a 'dry' climate eucalypt, particularly in stem tissue, identifying key pathways and associated genes that are responsible for the differences between 'wet' and 'dry' climate eucalypts. This knowledge provides the opportunity to further investigate and understand the mechanisms and genetic variation linked to this important environmental response that will assist with genomic efforts in managing native populations as well as in tree improvement programs under future climate scenarios.

  2. Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L.) in response to fungal pathogens and hormone treatments.

    PubMed

    Yang, Bo; Jiang, Yuanqing; Rahman, Muhammad H; Deyholos, Michael K; Kav, Nat N V

    2009-06-03

    Members of plant WRKY transcription factor families are widely implicated in defense responses and various other physiological processes. For canola (Brassica napus L.), no WRKY genes have been described in detail. Because of the economic importance of this crop, and its evolutionary relationship to Arabidopsis thaliana, we sought to characterize a subset of canola WRKY genes in the context of pathogen and hormone responses. In this study, we identified 46 WRKY genes from canola by mining the expressed sequence tag (EST) database and cloned cDNA sequences of 38 BnWRKYs. A phylogenetic tree was constructed using the conserved WRKY domain amino acid sequences, which demonstrated that BnWRKYs can be divided into three major groups. We further compared BnWRKYs to the 72 WRKY genes from Arabidopsis and 91 WRKY from rice, and we identified 46 presumptive orthologs of AtWRKY genes. We examined the subcellular localization of four BnWRKY proteins using green fluorescent protein (GFP) and we observed the fluorescent green signals in the nucleus only.The responses of 16 selected BnWRKY genes to two fungal pathogens, Sclerotinia sclerotiorum and Alternaria brassicae, were analyzed by quantitative real time-PCR (qRT-PCR). Transcript abundance of 13 BnWRKY genes changed significantly following pathogen challenge: transcripts of 10 WRKYs increased in abundance, two WRKY transcripts decreased after infection, and one decreased at 12 h post-infection but increased later on (72 h). We also observed that transcript abundance of 13/16 BnWRKY genes was responsive to one or more hormones, including abscisic acid (ABA), and cytokinin (6-benzylaminopurine, BAP) and the defense signaling molecules jasmonic acid (JA), salicylic acid (SA), and ethylene (ET). We compared these transcript expression patterns to those previously described for presumptive orthologs of these genes in Arabidopsis and rice, and observed both similarities and differences in expression patterns. We identified a set of 13 BnWRKY genes from among 16 BnWRKY genes assayed, that are responsive to both fungal pathogens and hormone treatments, suggesting shared signaling mechanisms for these responses. This study suggests that a large number of BnWRKY proteins are involved in the transcriptional regulation of defense-related genes in response to fungal pathogens and hormone stimuli.

  3. [Genome-wide identification and expression analysis of auxin-related gene families in grape].

    PubMed

    Yuan, Hua-zhao; Zhao, Mi-zhen; Wu, Wei-min; Yu, Hong-Mei; Qian, Ya-ming; Wang, Zhuang-wei; Wang, Xi-cheng

    2015-07-01

    The auxin response gene family adjusts the auxin balance and the growth hormone signaling pathways in plants. Using bioinformatics methods, the auxin-response genes from the grape genome database are identified and their chromosomal location, gene collinearity and phylogenetic analysis are performed. Probable genes include 25 AUX_IAA, 19 ARF, 9 GH3 and 42 LBD genes, which are unevenly distributed on all 19 chromosomes and some of them formed distinct tandem duplicate gene clusters. The available grape microarray databases show that all of the auxin-response genes are expressed in fruit and leaf buds, and significant overexpressed during fruit color-changing, bud break and bud dormancy periods. This paper provides a resource for functional studies of auxin-response genes in grape leaf and fruit development.

  4. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava

    PubMed Central

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava. PMID:26904033

  5. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

    PubMed

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  6. Impaired Immune Response to Primary but Not to Booster Vaccination Against Hepatitis B in Older Adults.

    PubMed

    Weinberger, Birgit; Haks, Mariëlle C; de Paus, Roelof A; Ottenhoff, Tom H M; Bauer, Tanja; Grubeck-Loebenstein, Beatrix

    2018-01-01

    Many current vaccines are less immunogenic and less effective in elderly compared to younger adults due to age-related changes of the immune system. Most vaccines utilized in the elderly contain antigens, which the target population has had previous contact with due to previous vaccination or infection. Therefore, most studies investigating vaccine-induced immune responses in the elderly do not analyze responses to neo-antigens but rather booster responses. However, age-related differences in the immune response could differentially affect primary versus recall responses. We therefore investigated the impact of age on primary and recall antibody responses following hepatitis B vaccination in young and older adults. Focused gene expression profiling was performed before and 1 day after the vaccination in order to identify gene signatures predicting antibody responses. Young (20-40 years; n  = 24) and elderly (>60 years; n  = 17) healthy volunteers received either a primary series (no prior vaccination) or a single booster shot (documented primary vaccination more than 10 years ago). Antibody titers were determined at days 0, 7, and 28, as well as 6 months after the vaccination. After primary vaccination, antibody responses were lower and delayed in the elderly compared to young adults. Non-responders after the three-dose primary series were only observed in the elderly group. Maximum antibody concentrations after booster vaccination were similar in both age groups. Focused gene expression profiling identified 29 transcripts that correlated with age at baseline and clustered in a network centered around type I interferons and pro-inflammatory cytokines. In addition, smaller 8- and 6-gene signatures were identified at baseline that associated with vaccine responsiveness during primary and booster vaccination, respectively. When evaluating the kinetic changes in gene expression profiles before and after primary vaccination, a 33-gene signature, dominated by IFN-signaling, pro-inflammatory cytokines, inflammasome components, and immune cell subset markers, was uncovered that was associated with vaccine responsiveness. By contrast, no such transcripts were identified during booster vaccination. Our results document that primary differs from booster vaccination in old age, in regard to antibody responses as well as at the level of gene signatures. www.clinicaltrialsregister.eu, this trial was registered at the EU Clinical Trial Register (EU-CTR) with the EUDRACT-Nr. 2013-002589-38.

  7. Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

    PubMed

    Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

    2005-06-03

    We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

  8. Cloning and characterization of the ONAC106 gene from Oryza sativa cultivar Kuku Belang

    NASA Astrophysics Data System (ADS)

    Basri, Khairunnisa; Sukiran, Noor Liyana; Zainal, Zamri

    2016-11-01

    Plants possess different mechanisms in stress response, where induction of stress-responsive genes provides tolerance to unfavorable conditions. Stress-responsive genes are characterized for functional and regulatory genes that help in overcoming stress by molecular, biochemical and morphological adaptations. NAC transcription factors are one of the regulatory proteins that involved in stress signaling pathway. A putative NAC transcription factor, ONAC016 was identified from drought transcriptomic data. Our data suggested that ONAC106 was induced by drought, but its function in abiotic stress is still unclear. In silico analysis of ONAC106 showed that this gene encodes 334 amino acids, and its protein consists of NAM (No Apical Meristem) domain. The orthologue of ONAC106 was present in several Poaceae family members, suggesting that ONAC106 is unique to monocot plants only. We found that ONAC106 was induced by salt and cold stresses, indicating that this gene involves in abiotic stress response. In addition, we also found that ONAC106 might function in defense response to pathogen invasion. The ABRE (Abscisic Acid Regulatory Element) cis-element was identified in the promoter region of ONAC106, suggesting that it may involve in the abscisic acid (ABA)-dependent signaling pathway. Based on this preliminary result, we hypothesize that ONAC106 may play a role in abiotic stress response by regulating ABA-responsive genes.

  9. Structural, functional and evolutionary characterization of major drought transcription factors families in maize

    NASA Astrophysics Data System (ADS)

    Mittal, Shikha; Banduni, Pooja; Mallikarjuna, Mallana G.; Rao, Atmakuri R.; Jain, Prashant A.; Dash, Prasanta K.; Thirunavukkarasu, Nepolean

    2018-05-01

    Drought is one of the major threats to maize production. In order to improve the production and to breed tolerant hybrids, understanding the genes and regulatory mechanisms during drought stress is important. Transcription factors (TFs) play a major role in gene regulation and many TFs have been identified in response to drought stress. In our experiment, a set of 15 major TF families comprising 1436 genes was structurally and functionally characterized using in-silico tools and a gene expression assay. All 1436 genes were mapped on 10 chromosome of maize. The functional annotation indicated the involvement of these genes in ABA signaling, ROS scavenging, photosynthesis, stomatal regulation, and sucrose metabolism. Duplication was identified as the primary force in divergence and expansion of TF families. Phylogenetic relationship was developed individually for each TF family as well as combined TF families. Phylogenetic analysis grouped the TF family of genes into TF-specific and mixed groups. Phylogenetic analysis of genes belonging to various TF families suggested that the origin of TFs occurred in the lineage of maize evolution. Gene structure analysis revealed that more number of genes were intron-rich as compared to intronless genes. Drought-responsive CRE’s such as ABREA, ABREB, DRE1 and DRECRTCOREAT have been identified. Expression and interaction analyses identified leaf-specific bZIP TF, GRMZM2G140355, as a potential contributor toward drought tolerance in maize. We also analyzed protein-protein interaction network of 269 drought-responsive genes belonging to different drought-related TFs. The information generated on structural and functional characteristics, expression and interaction of the drought-related TF families will be useful to decipher the drought tolerance mechanisms and to derive drought-tolerant genotypes in maize.

  10. Transcriptome Analysis of ABA/JA-Dual Responsive Genes in Rice Shoot and Root.

    PubMed

    Kim, Jin-Ae; Bhatnagar, Nikita; Kwon, Soon Jae; Min, Myung Ki; Moon, Seok-Jun; Yoon, In Sun; Kwon, Taek-Ryoun; Kim, Sun Tae; Kim, Beom-Gi

    2018-01-01

    The phytohormone abscisic acid (ABA) enables plants to adapt to adverse environmental conditions through the modulation of metabolic pathways and of growth and developmental programs. We used comparative microarray analysis to identify genes exhibiting ABA-dependent expression and other hormone-dependent expression among them in Oryza sativa shoot and root. We identified 854 genes as significantly up- or down-regulated in root or shoot under ABA treatment condition. Most of these genes had similar expression profiles in root and shoot under ABA treatment condition, whereas 86 genes displayed opposite expression responses in root and shoot. To examine the crosstalk between ABA and other hormones, we compared the expression profiles of the ABA-dependently regulated genes under several different hormone treatment conditions. Interestingly, around half of the ABA-dependently expressed genes were also regulated by jasmonic acid based on microarray data analysis. We searched the promoter regions of these genes for cis-elements that could be responsible for their responsiveness to both hormones, and found that ABRE and MYC2 elements, among others, were common to the promoters of genes that were regulated by both ABA and JA. These results show that ABA and JA might have common gene expression regulation system and might explain why the JA could function for both abiotic and biotic stress tolerance.

  11. Exploring the abomasal lymph node transcriptome for genes associated with resistance to the sheep nematode Teladorsagia circumcincta

    PubMed Central

    2013-01-01

    This study exploited Blackface lambs that varied in their resistance to the abomasal nematode parasite, Teladorsagia circumcincta. Infection of these lambs over 3 months identified susceptible (high adult worm count, high faecal egg count and low IgA antibody) and resistant animals that had excluded all parasites. Previous work had shown that susceptibility and resistance is dependent on the differential immune response to the parasite, which occurs within the abomasal (gastric) lymph node (ALN) that drains the site of infection. The Affymetrix ovine gene array was used to interrogate the transcriptome of the ALN to identify genes and physiological pathways associated with resistance. We used a bovine RT-qPCR array of 84 genes to validate the gene array, and also report digital gene expression analysis on the same tissues, reanalysed using the Oar v3.1 sheep genome assembly. These analyses identified Humoral Immune Response, Protein Synthesis, Inflammatory Response and Hematological System Development and Function as the two top-ranked networks associated with resistance. Central genes within these networks were IL4, IL5, IL13RA2 and in particular IL13, which confirmed that differential activation of Th2 polarized responses is critical to the resistance phenotype. Furthermore, in resistant sheep there was up-regulation of genes linked to control and suppression of inflammation. The identity of differentially-expressed chemokines and receptors in the resistant and susceptible sheep also begins to explain the cellular nature of the host response to infection. This work will greatly help in the identification of candidate genes as potential selectable markers of genetic resistance. PMID:23927007

  12. Genome-wide analysis identifies chickpea (Cicer arietinum) heat stress transcription factors (Hsfs) responsive to heat stress at the pod development stage.

    PubMed

    Chidambaranathan, Parameswaran; Jagannadham, Prasanth Tej Kumar; Satheesh, Viswanathan; Kohli, Deshika; Basavarajappa, Santosh Halasabala; Chellapilla, Bharadwaj; Kumar, Jitendra; Jain, Pradeep Kumar; Srinivasan, R

    2018-05-01

    The heat stress transcription factors (Hsfs) play a prominent role in thermotolerance and eliciting the heat stress response in plants. Identification and expression analysis of Hsfs gene family members in chickpea would provide valuable information on heat stress responsive Hsfs. A genome-wide analysis of Hsfs gene family resulted in the identification of 22 Hsf genes in chickpea in both desi and kabuli genome. Phylogenetic analysis distinctly separated 12 A, 9 B, and 1 C class Hsfs, respectively. An analysis of cis-regulatory elements in the upstream region of the genes identified many stress responsive elements such as heat stress elements (HSE), abscisic acid responsive element (ABRE) etc. In silico expression analysis showed nine and three Hsfs were also expressed in drought and salinity stresses, respectively. Q-PCR expression analysis of Hsfs under heat stress at pod development and at 15 days old seedling stage showed that CarHsfA2, A6, and B2 were significantly upregulated in both the stages of crop growth and other four Hsfs (CarHsfA2, A6a, A6c, B2a) showed early transcriptional upregulation for heat stress at seedling stage of chickpea. These subclasses of Hsfs identified in this study can be further evaluated as candidate genes in the characterization of heat stress response in chickpea.

  13. Suppressors of systemin signaling identify genes in the tomato wound response pathway.

    PubMed Central

    Howe, G A; Ryan, C A

    1999-01-01

    In tomato plants, systemic induction of defense genes in response to herbivory or mechanical wounding is regulated by an 18-amino-acid peptide signal called systemin. Transgenic plants that overexpress prosystemin, the systemin precursor, from a 35S::prosystemin (35S::prosys) transgene exhibit constitutive expression of wound-inducible defense proteins including proteinase inhibitors and polyphenol oxidase. To study further the role of (pro)systemin in the wound response pathway, we isolated and characterized mutations that suppress 35S::prosys-mediated phenotypes. Ten recessive, extragenic suppressors were identified. Two of these define new alleles of def-1, a previously identified mutation that blocks both wound- and systemin-induced gene expression and renders plants susceptible to herbivory. The remaining mutants defined four loci designated Spr-1, Spr-2, Spr-3, and Spr-4 (for Suppressed in 35S::prosystemin-mediated responses). spr-3 and spr-4 mutants were not significantly affected in their response to either systemin or mechanical wounding. In contrast, spr-1 and spr-2 plants lacked systemic wound responses and were insensitive to systemin. These results confirm the function of (pro)systemin in the transduction of systemic wound signals and further establish that wounding, systemin, and 35S::prosys induce defensive gene expression through a common signaling pathway defined by at least three genes (Def-1, Spr-1, and Spr-2). PMID:10545469

  14. Identification of Transcriptional Modules and Key Genes in Chickens Infected with Salmonella enterica Serovar Pullorum Using Integrated Coexpression Analyses.

    PubMed

    Liu, Bao-Hong; Cai, Jian-Ping

    2017-01-01

    Salmonella enterica Pullorum is one of the leading causes of mortality in poultry. Understanding the molecular response in chickens in response to the infection by S. enterica is important in revealing the mechanisms of pathogenesis and disease progress. There have been studies on identifying genes associated with Salmonella infection by differential expression analysis, but the relationships among regulated genes have not been investigated. In this study, we employed weighted gene coexpression network analysis (WGCNA) and differential coexpression analysis (DCEA) to identify coexpression modules by exploring microarray data derived from chicken splenic tissues in response to the S. enterica infection. A total of 19 modules from 13,538 genes were associated with the Jak-STAT signaling pathway, the extracellular matrix, cytoskeleton organization, the regulation of the actin cytoskeleton, G-protein coupled receptor activity, Toll-like receptor signaling pathways, and immune system processes; among them, 14 differentially coexpressed modules (DCMs) and 2,856 differentially coexpressed genes (DCGs) were identified. The global expression of module genes between infected and uninfected chickens showed slight differences but considerable changes for global coexpression. Furthermore, DCGs were consistently linked to the hubs of the modules. These results will help prioritize candidate genes for future studies of Salmonella infection.

  15. Identification of Transcriptional Modules and Key Genes in Chickens Infected with Salmonella enterica Serovar Pullorum Using Integrated Coexpression Analyses

    PubMed Central

    2017-01-01

    Salmonella enterica Pullorum is one of the leading causes of mortality in poultry. Understanding the molecular response in chickens in response to the infection by S. enterica is important in revealing the mechanisms of pathogenesis and disease progress. There have been studies on identifying genes associated with Salmonella infection by differential expression analysis, but the relationships among regulated genes have not been investigated. In this study, we employed weighted gene coexpression network analysis (WGCNA) and differential coexpression analysis (DCEA) to identify coexpression modules by exploring microarray data derived from chicken splenic tissues in response to the S. enterica infection. A total of 19 modules from 13,538 genes were associated with the Jak-STAT signaling pathway, the extracellular matrix, cytoskeleton organization, the regulation of the actin cytoskeleton, G-protein coupled receptor activity, Toll-like receptor signaling pathways, and immune system processes; among them, 14 differentially coexpressed modules (DCMs) and 2,856 differentially coexpressed genes (DCGs) were identified. The global expression of module genes between infected and uninfected chickens showed slight differences but considerable changes for global coexpression. Furthermore, DCGs were consistently linked to the hubs of the modules. These results will help prioritize candidate genes for future studies of Salmonella infection. PMID:28529955

  16. Transcriptome response of the foundation plant Spartina alterniflora to the Deepwater Horizon oil spill.

    PubMed

    Alvarez, Mariano; Ferreira de Carvalho, Julie; Salmon, Armel; Ainouche, Malika L; Cavé-Radet, Armand; El Amrani, Abdelhak; Foster, Tammy E; Moyer, Sydney; Richards, Christina L

    2018-06-04

    Despite the severe impacts of the Deepwater Horizon oil spill, the foundation plant species Spartina alterniflora proved resilient to heavy oiling, providing an opportunity to identify mechanisms of response to the anthropogenic stress of crude oil exposure. We assessed plants from oil-affected and unaffected populations using a custom DNA microarray to identify genomewide transcription patterns and gene expression networks that respond to crude oil exposure. In addition, we used T-DNA insertion lines of the model grass Brachypodium distachyon to assess the contribution of four novel candidate genes to crude oil response. Responses in S. alterniflora to hydrocarbon exposure across the transcriptome as well as xenobiotic specific response pathways had little overlap with those previously identified in the model plant Arabidopsis thaliana. Among T-DNA insertion lines of B. distachyon, we found additional support for two candidate genes, one (ATTPS21) involved in volatile production, and the other (SUVH5) involved in epigenetic regulation of gene expression, that may be important in the response to crude oil. The architecture of crude oil response in S. alterniflora is unique from that of the model species A. thaliana, suggesting that xenobiotic response may be highly variable across plant species. In addition, further investigations of regulatory networks may benefit from more information about epigenetic response pathways. © 2018 John Wiley & Sons Ltd.

  17. Transcriptome analysis of salinity stress responses in common wheat using a 22k oligo-DNA microarray.

    PubMed

    Kawaura, Kanako; Mochida, Keiichi; Yamazaki, Yukiko; Ogihara, Yasunari

    2006-04-01

    In this study, we constructed a 22k wheat oligo-DNA microarray. A total of 148,676 expressed sequence tags of common wheat were collected from the database of the Wheat Genomics Consortium of Japan. These were grouped into 34,064 contigs, which were then used to design an oligonucleotide DNA microarray. Following a multistep selection of the sense strand, 21,939 60-mer oligo-DNA probes were selected for attachment on the microarray slide. This 22k oligo-DNA microarray was used to examine the transcriptional response of wheat to salt stress. More than 95% of the probes gave reproducible hybridization signals when targeted with RNAs extracted from salt-treated wheat shoots and roots. With the microarray, we identified 1,811 genes whose expressions changed more than 2-fold in response to salt. These included genes known to mediate response to salt, as well as unknown genes, and they were classified into 12 major groups by hierarchical clustering. These gene expression patterns were also confirmed by real-time reverse transcription-PCR. Many of the genes with unknown function were clustered together with genes known to be involved in response to salt stress. Thus, analysis of gene expression patterns combined with gene ontology should help identify the function of the unknown genes. Also, functional analysis of these wheat genes should provide new insight into the response to salt stress. Finally, these results indicate that the 22k oligo-DNA microarray is a reliable method for monitoring global gene expression patterns in wheat.

  18. Salt and drought stress and ABA responses related to bZIP genes from V. radiata and V. angularis.

    PubMed

    Wang, Lanfen; Zhu, Jifeng; Li, Xiaoming; Wang, Shumin; Wu, Jing

    2018-04-20

    Mung bean and adzuki bean are warm-season legumes widely cultivated in China. However, bean production in major producing regions is limited by biotic and abiotic stress, such as drought and salt stress. Basic leucine zipper (bZIP) genes play key roles in responses to various biotic and abiotic stresses. However, only several bZIP genes involved in drought and salt stress in legumes, especially Vigna radiata and Vigna angularis, have been identified. In this study, we identified 54 and 50 bZIP proteins from whole-genome sequences of V. radiata and V. angularis, respectively. First, we comprehensively surveyed the characteristics of all bZIP genes, including their gene structure, chromosome distribution and motif composition. Phylogenetic trees showed that VrbZIP and VabZIP proteins were divided into ten clades comprising nine known and one unknown subgroup. The results of the nucleotide substitution rate of the orthologous gene pairs showed that bZIP proteins have undergone strong purifying selection: V. radiata and V. angularis diverged 1.25 million years ago (mya) to 9.20 mya (average of 4.95 mya). We also found that many cis-acting regulatory elements (CAREs) involved in abiotic stress and plant hormone responses were detected in the putative promoter regions of the bZIP genes. Finally, using the quantitative real-time PCR (qRT-PCR) method, we performed expression profiling of the bZIP genes in response to drought, salt and abscisic acid (ABA). We identified several bZIP genes that may be involved in drought and salt responses. Generally, our results provided useful and rich resources of VrbZIP and VabZIP genes for the functional characterization and understanding of bZIP transcription factors (TFs) in warm-season legumes. In addition, our results revealed important and interesting data - a subset of VrbZIP and VabZIP gene expression profiles in response to drought, salt and ABA stress. These results provide gene expression evidence for the selection of candidate genes under drought and salt stress for future study. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Gravity Persistent Signal 1 (GPS1) reveals novel cytochrome P450s involved in gravitropism.

    PubMed

    Withers, John C; Shipp, Matthew J; Rupasinghe, Sanjeewa G; Sukumar, Poornima; Schuler, Mary A; Muday, Gloria K; Wyatt, Sarah E

    2013-01-01

    Gravity is an important environmental factor that affects growth and development of plants. In response to changes in gravity, directional growth occurs along the major axes and lateral branches of both shoots and roots. The gravity persistent signal (gps) mutants of Arabidopsis thaliana were previously identified as having an altered response to gravity when reoriented relative to the gravity vector in the cold, with the gps1 mutant exhibiting a complete loss of tropic response under these conditions. Thermal asymmetric interlaced (TAIL) PCR was used to identify the gene defective in gps1. Gene expression data, molecular modeling and computational substrate dockings, quantitative RT-PCR analyses, reporter gene fusions, and physiological analyses of knockout mutants were used to characterize the genes identified. Cloning of the gene defective in gps1 and genetic complementation revealed that GPS1 encodes CYP705A22, a cytochrome P450 monooxygenase (P450). CYP705A5, a closely related family member, was identified as expressed specifically in roots in response to gravistimulation, and a mutation affecting its expression resulted in a delayed gravity response, increased flavonol levels, and decreased basipetal auxin transport. Molecular modeling coupled with in silico substrate docking and diphenylboric acid 2-aminoethyl ester (DBPA) staining indicated that these P450s are involved in biosynthesis of flavonoids potentially involved in auxin transport. The characterization of two novel P450s (CYP705A22 and CYP705A5) and their role in the gravity response has offered new insights into the regulation of the genetic and physiological controls of plant gravitropism.

  20. A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

    PubMed

    He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

    2017-08-23

    The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

  1. Integrative analysis of DNA methylation and gene expression data identifies EPAS1 as a key regulator of COPD.

    PubMed

    Yoo, Seungyeul; Takikawa, Sachiko; Geraghty, Patrick; Argmann, Carmen; Campbell, Joshua; Lin, Luan; Huang, Tao; Tu, Zhidong; Foronjy, Robert F; Feronjy, Robert; Spira, Avrum; Schadt, Eric E; Powell, Charles A; Zhu, Jun

    2015-01-01

    Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA methylation, gene expression, and phenotype data in lung tissue from COPD and control samples. Our integrative analysis identified 126 key regulators of COPD. We identified EPAS1 as the only key regulator whose downstream genes significantly overlapped with multiple genes sets associated with COPD disease severity. EPAS1 is distinct in comparison with other key regulators in terms of methylation profile and downstream target genes. Genes predicted to be regulated by EPAS1 were enriched for biological processes including signaling, cell communications, and system development. We confirmed that EPAS1 protein levels are lower in human COPD lung tissue compared to non-disease controls and that Epas1 gene expression is reduced in mice chronically exposed to cigarette smoke. As EPAS1 downstream genes were significantly enriched for hypoxia responsive genes in endothelial cells, we tested EPAS1 function in human endothelial cells. EPAS1 knockdown by siRNA in endothelial cells impacted genes that significantly overlapped with EPAS1 downstream genes in lung tissue including hypoxia responsive genes, and genes associated with emphysema severity. Our first integrative analysis of genome-wide DNA methylation and gene expression profiles illustrates that not only does DNA methylation play a 'causal' role in the molecular pathophysiology of COPD, but it can be leveraged to directly identify novel key mediators of this pathophysiology.

  2. TransCONFIRM: Identification of a Genetic Signature of Response to Fulvestrant in Advanced Hormone Receptor-Positive Breast Cancer.

    PubMed

    Jeselsohn, Rinath; Barry, William T; Migliaccio, Ilenia; Biagioni, Chiara; Zhao, Jin; De Tribolet-Hardy, Jonas; Guarducci, Cristina; Bonechi, Martina; Laing, Naomi; Winer, Eric P; Brown, Myles; Leo, Angelo Di; Malorni, Luca

    2016-12-01

    Fulvestrant is an estrogen receptor (ER) antagonist and an approved treatment for metastatic estrogen receptor-positive (ER + ) breast cancer. With the exception of ER levels, there are no established predictive biomarkers of response to single-agent fulvestrant. We attempted to identify a gene signature of response to fulvestrant in advanced breast cancer. Primary tumor samples from 134 patients enrolled in the phase III CONFIRM study of patients with metastatic ER + breast cancer comparing treatment with either 250 mg or 500 mg fulvestrant were collected for genome-wide transcriptomic analysis. Gene expression profiling was performed using Affymetrix microarrays. An exploratory analysis was performed to identify biologic pathways and new signatures associated with response to fulvestrant. Pathway analysis demonstrated that increased EGF pathway and FOXA1 transcriptional signaling is associated with decreased response to fulvestrant. Using a multivariate Cox model, we identified a novel set of 37 genes with an expression that is independently associated with progression-free survival (PFS). TFAP2C, a known regulator of ER activity, was ranked second in this gene set, and high expression was associated with a decreased response to fulvestrant. The negative predictive value of TFAP2C expression at the protein level was confirmed by IHC. We identified biologic pathways and a novel gene signature in primary ER + breast cancers that predicts for response to treatment in the CONFIRM study. These results suggest potential new therapeutic targets and warrant further validation as predictive biomarkers of fulvestrant treatment in metastatic breast cancer. Clin Cancer Res; 22(23); 5755-64. ©2016 AACR. ©2016 American Association for Cancer Research.

  3. Transcriptome analysis identifies genes involved in ethanol response of Saccharomyces cerevisiae in Agave tequilana juice.

    PubMed

    Ramirez-Córdova, Jesús; Drnevich, Jenny; Madrigal-Pulido, Jaime Alberto; Arrizon, Javier; Allen, Kirk; Martínez-Velázquez, Moisés; Alvarez-Maya, Ikuri

    2012-08-01

    During ethanol fermentation, yeast cells are exposed to stress due to the accumulation of ethanol, cell growth is altered and the output of the target product is reduced. For Agave beverages, like tequila, no reports have been published on the global gene expression under ethanol stress. In this work, we used microarray analysis to identify Saccharomyces cerevisiae genes involved in the ethanol response. Gene expression of a tequila yeast strain of S. cerevisiae (AR5) was explored by comparing global gene expression with that of laboratory strain S288C, both after ethanol exposure. Additionally, we used two different culture conditions, cells grown in Agave tequilana juice as a natural fermentation media or grown in yeast-extract peptone dextrose as artificial media. Of the 6368 S. cerevisiae genes in the microarray, 657 genes were identified that had different expression responses to ethanol stress due to strain and/or media. A cluster of 28 genes was found over-expressed specifically in the AR5 tequila strain that could be involved in the adaptation to tequila yeast fermentation, 14 of which are unknown such as yor343c, ylr162w, ygr182c, ymr265c, yer053c-a or ydr415c. These could be the most suitable genes for transforming tequila yeast to increase ethanol tolerance in the tequila fermentation process. Other genes involved in response to stress (RFC4, TSA1, MLH1, PAU3, RAD53) or transport (CYB2, TIP20, QCR9) were expressed in the same cluster. Unknown genes could be good candidates for the development of recombinant yeasts with ethanol tolerance for use in industrial tequila fermentation.

  4. Transcriptomic responses to wounding: meta-analysis of gene expression microarray data.

    PubMed

    Sass, Piotr Andrzej; Dąbrowski, Michał; Charzyńska, Agata; Sachadyn, Paweł

    2017-11-07

    A vast amount of microarray data on transcriptomic response to injury has been collected so far. We designed the analysis in order to identify the genes displaying significant changes in expression after wounding in different organisms and tissues. This meta-analysis is the first study to compare gene expression profiles in response to wounding in as different tissues as heart, liver, skin, bones, and spinal cord, and species, including rat, mouse and human. We collected available microarray transcriptomic profiles obtained from different tissue injury experiments and selected the genes showing a minimum twofold change in expression in response to wounding in prevailing number of experiments for each of five wound healing stages we distinguished: haemostasis & early inflammation, inflammation, early repair, late repair and remodelling. During the initial phases after wounding, haemostasis & early inflammation and inflammation, the transcriptomic responses showed little consistency between different tissues and experiments. For the later phases, wound repair and remodelling, we identified a number of genes displaying similar transcriptional responses in all examined tissues. As revealed by ontological analyses, activation of certain pathways was rather specific for selected phases of wound healing, such as e.g. responses to vitamin D pronounced during inflammation. Conversely, we observed induction of genes encoding inflammatory agents and extracellular matrix proteins in all wound healing phases. Further, we selected several genes differentially upregulated throughout different stages of wound response, including established factors of wound healing in addition to those previously unreported  in this context such as PTPRC and AQP4. We found that transcriptomic responses to wounding showed similar traits in a diverse selection of tissues including skin, muscles, internal organs and nervous system. Notably, we distinguished transcriptional induction of inflammatory genes not only in the initial response to wounding, but also later, during wound repair and tissue remodelling.

  5. Genome-Wide Linkage and Regional Association Study of Blood Pressure Response to the Cold Pressor Test in Han Chinese: The GenSalt Study

    PubMed Central

    Yang, Xueli; Gu, Dongfeng; He, Jiang; Hixson, James E.; Rao, Dabeeru C.; Lu, Fanghong; Mu, Jianjun; Jaquish, Cashell E.; Chen, Jing; Huang, Jianfeng; Shimmin, Lawrence C.; Rice, Treva K.; Chen, Jichun; Wu, Xigui; Liu, Depei; Kelly, Tanika N.

    2014-01-01

    Background Blood pressure (BP) response to cold pressor test (CPT) is associated with increased risk of cardiovascular disease. We performed a genome-wide linkage scan and regional association analysis to identify genetic determinants of BP response to CPT. Methods and Results A total of 1,961 Chinese participants completed the CPT. Multipoint quantitative trait linkage analysis was performed, followed by single-marker and gene-based analyses of variants in promising linkage regions (logarithm of odds, LOD ≥ 2). A suggestive linkage signal was identified for systolic BP (SBP) response to CPT at 20p13-20p12.3, with a maximum multipoint LOD score of 2.37. Based on regional association analysis with 1,351 SNPs in the linkage region, we found that marker rs2326373 at 20p13 was significantly associated with mean arterial pressure (MAP) responses to CPT (P = 8.8×10−6) after FDR adjustment for multiple comparisons. A similar trend was also observed for SBP response (P = 0.03) and DBP response (P = 4.6×10−5). Results of gene-based analyses showed that variants in genes MCM8 and SLC23A2 were associated with SBP response to CPT (P = 4.0×10−5 and 2.7×10−4, respectively), and variants in genes MCM8 and STK35 were associated with MAP response to CPT (P = 1.5×10−5 and 5.0×10−5, respectively). Conclusions Within a suggestive linkage region on chromosome 20, we identified a novel variant associated with BP responses to CPT. We also found gene-based associations of MCM8, SLC23A2 and STK35 in this region. Further work is warranted to confirm these findings. Clinical Trial Registration URL: http://www.clinicaltrials.gov; Unique identifier: NCT00721721. PMID:25028485

  6. [Fish interferon response and its molecular regulation: a review].

    PubMed

    Zhang, Yibing; Gui, Jianfang

    2011-05-01

    Interferon response is the first line of host defense against virus infection. Recent years have witnessed tremendous progress in understanding of fish innate response to virus infection, especially in fish interferon antiviral response. A line of fish genes involved in interferon antiviral response have been identified and functional studies further reveal that fish possess an IFN antiviral system similar to mammals. However, fish virus-induced interferon genes contain introns similar to mammalian type III interferon genes although they encode proteins similar to type I interferons, which makes it hard to understand the evolution of vertebrate interferon genes directly resulting in a debate on nomenclature of fish interferon genes. Actually, fish display some unique mechanisms underlying interferon antiviral response. This review documents the recent progress on fish interferon response and its molecular mechanism.

  7. Identification of 28 cytochrome P450 genes from the transcriptome of the marine rotifer Brachionus plicatilis and analysis of their expression.

    PubMed

    Kim, Hui-Su; Han, Jeonghoon; Kim, Hee-Jin; Hagiwara, Atsushi; Lee, Jae-Seong

    2017-09-01

    Whole transcriptomes of the rotifer Brachionus plicatilis were analyzed using an Illumina sequencer. De novo assembly was performed with 49,122,780 raw reads using Trinity software. Among the assembled 42,820 contigs, 27,437 putative open reading frame contigs were identified (average length 1235bp; N50=1707bp). Functional gene annotation with Gene Ontology and InterProScan, in addition to Kyoto Encyclopedia of Genes and Genomes pathway analysis, highlighted the metabolism of xenobiotics by cytochrome P450 (CYP). In addition, 28 CYP genes were identified, and their transcriptional responses to benzo[α]pyrene (B[α]P) were investigated. Most of the CYPs were significantly upregulated or downregulated (P<0.05) in response to B[α]P, suggesting that Bp-CYP genes play a crucial role in detoxification mechanisms in response to xenobiotics. This study sheds light on the molecular defense mechanisms of the rotifer B. plicatilis in response to exposure to various chemicals. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. An SSH library responsive to azadirachtin A constructed in Spodoptera litura Fabricius cell lines.

    PubMed

    Yan, Chao; Zhang, Zhi-Xiang; Xu, Han-Hong

    2012-05-31

    The present study revealed differentially expressed genes responsive to azadirachtin A (Aza) in Spodoptera litura cell line through suppression subtractive hybridization. In the Aza-responsive SSH library, approximately 270 sequences represent 53 different identified genes encoding proteins with various predicted functions, and the percentages of the gene clusters were 26.09% (genetic information processing), 11.41% (cell growth and death), 7.07% (metabolism), 6.52% (signal transduction/transport) and 2.72% (immunity), respectively. Eleven clones homologous to identified genes were selected to be confirmed through quantitative real time polymerase chain reaction. Among the eleven clones validated, all but one transcript of lipase showed an increase in SL cell line collected from ETA, whereas the transcripts of other genes were lower in the SL cell line collected from ETA compared with that of UETA. These genes were considered to be related to the response of SL cell line to Aza. These will provide a new clue to uncover the molecular mechanisms of Aza acting on SL cell line. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Identifying Stress Transcription Factors Using Gene Expression and TF-Gene Association Data

    PubMed Central

    Wu, Wei-Sheng; Chen, Bor-Sen

    2007-01-01

    Unicellular organisms such as yeasts have evolved to survive environmental stresses by rapidly reorganizing the genomic expression program to meet the challenges of harsh environments. The complex adaptation mechanisms to stress remain to be elucidated. In this study, we developed Stress Transcription Factor Identification Algorithm (STFIA), which integrates gene expression and TF-gene association data to identify the stress transcription factors (TFs) of six kinds of stresses. We identified some general stress TFs that are in response to various stresses, and some specific stress TFs that are in response to one specific stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs may be sufficient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the adaptation mechanisms to different stresses may have a bow-tie structure. Second, there may exist extensive regulatory cross-talk among different stress responses. In conclusion, this study proposes a network of the regulators of stress responses and their mechanism of action. PMID:20066130

  10. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    PubMed

    Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

  11. Multivariate inference of pathway activity in host immunity and response to therapeutics

    PubMed Central

    Goel, Gautam; Conway, Kara L.; Jaeger, Martin; Netea, Mihai G.; Xavier, Ramnik J.

    2014-01-01

    Developing a quantitative view of how biological pathways are regulated in response to environmental factors is central for understanding of disease phenotypes. We present a computational framework, named Multivariate Inference of Pathway Activity (MIPA), which quantifies degree of activity induced in a biological pathway by computing five distinct measures from transcriptomic profiles of its member genes. Statistical significance of inferred activity is examined using multiple independent self-contained tests followed by a competitive analysis. The method incorporates a new algorithm to identify a subset of genes that may regulate the extent of activity induced in a pathway. We present an in-depth evaluation of specificity, robustness, and reproducibility of our method. We benchmarked MIPA's false positive rate at less than 1%. Using transcriptomic profiles representing distinct physiological and disease states, we illustrate applicability of our method in (i) identifying gene–gene interactions in autophagy-dependent response to Salmonella infection, (ii) uncovering gene–environment interactions in host response to bacterial and viral pathogens and (iii) identifying driver genes and processes that contribute to wound healing and response to anti-TNFα therapy. We provide relevant experimental validation that corroborates the accuracy and advantage of our method. PMID:25147207

  12. Identification of genes differentially expressed in Mikania micrantha during Cuscuta campestris infection by suppression subtractive hybridization.

    PubMed

    Li, Dong-Mei; Staehelin, Christian; Zhang, Yi-Shun; Peng, Shao-Lin

    2009-09-01

    The influence of Cuscuta campestris on its host Mikania micrantha has been studied with respect to biomass accumulation, physiology and ecology. Molecular events of this parasitic plant-plant interaction are poorly understood, however. In this study, we identified novel genes from M. micrantha induced by C. campestris infection. Genes expressed upon parasitization by C. campestris at early post-penetration stages were investigated by construction and characterization of subtracted cDNA libraries from shoots and stems of M. micrantha. Three hundred and three presumably up-regulated expressed sequence tags (ESTs) were identified and classified in functional categories, such as "metabolism", "cell defence and stress", "transcription factor", "signal transduction", "transportation" and "photosynthesis". In shoots and stems of infected M. micrantha, genes associated with defence responses and cell wall modifications were induced, confirming similar data from other parasitic plant-plant interactions. However, gene expression profiles in infected shoots and stems were found to be different. Compared to infected shoots, more genes induced in response to biotic and abiotic stress factors were identified in infected stems. Furthermore, database comparisons revealed a notable number of M. micrantha ESTs that matched genes with unknown function. Expression analysis by quantitative real-time RT-PCR of 21 genes (from different functional categories) showed significantly increased levels for 13 transcripts in response to C. campestris infection. In conclusion, this study provides an overview of genes from parasitized M. micrantha at early post-penetration stages. The acquired data form the basis for a molecular understanding of host reactions in response to parasitic plants.

  13. Genomics of Mature and Immature Olfactory Sensory Neurons

    PubMed Central

    Nickell, Melissa D.; Breheny, Patrick; Stromberg, Arnold J.; McClintock, Timothy S.

    2014-01-01

    The continuous replacement of neurons in the olfactory epithelium provides an advantageous model for investigating neuronal differentiation and maturation. By calculating the relative enrichment of every mRNA detected in samples of mature mouse olfactory sensory neurons (OSNs), immature OSNs, and the residual population of neighboring cell types, and then comparing these ratios against the known expression patterns of >300 genes, enrichment criteria that accurately predicted the OSN expression patterns of nearly all genes were determined. We identified 847 immature OSN-specific and 691 mature OSN-specific genes. The control of gene expression by chromatin modification and transcription factors, and neurite growth, protein transport, RNA processing, cholesterol biosynthesis, and apoptosis via death domain receptors, were overrepresented biological processes in immature OSNs. Ion transport (ion channels), presynaptic functions, and cilia-specific processes were overrepresented in mature OSNs. Processes overrepresented among the genes expressed by all OSNs were protein and ion transport, ER overload response, protein catabolism, and the electron transport chain. To more accurately represent gradations in mRNA abundance and identify all genes expressed in each cell type, classification methods were used to produce probabilities of expression in each cell type for every gene. These probabilities, which identified 9,300 genes expressed in OSNs, were 96% accurate at identifying genes expressed in OSNs and 86% accurate at discriminating genes specific to mature and immature OSNs. This OSN gene database not only predicts the genes responsible for the major biological processes active in OSNs, but also identifies thousands of never before studied genes that support OSN phenotypes. PMID:22252456

  14. Diversity in Expression of Phosphorus (P) Responsive Genes in Cucumis melo L

    PubMed Central

    Fita, Ana; Bowen, Helen C.; Hayden, Rory M.; Nuez, Fernando; Picó, Belén; Hammond, John P.

    2012-01-01

    Background Phosphorus (P) is a major limiting nutrient for plant growth in many soils. Studies in model species have identified genes involved in plant adaptations to low soil P availability. However, little information is available on the genetic bases of these adaptations in vegetable crops. In this respect, sequence data for melon now makes it possible to identify melon orthologues of candidate P responsive genes, and the expression of these genes can be used to explain the diversity in the root system adaptation to low P availability, recently observed in this species. Methodology and Findings Transcriptional responses to P starvation were studied in nine diverse melon accessions by comparing the expression of eight candidate genes (Cm-PAP10.1, Cm-PAP10.2, Cm-RNS1, Cm-PPCK1, Cm-transferase, Cm-SQD1, Cm-DGD1 and Cm-SPX2) under P replete and P starved conditions. Differences among melon accessions were observed in response to P starvation, including differences in plant morphology, P uptake, P use efficiency (PUE) and gene expression. All studied genes were up regulated under P starvation conditions. Differences in the expression of genes involved in P mobilization and remobilization (Cm-PAP10.1, Cm-PAP10.2 and Cm-RNS1) under P starvation conditions explained part of the differences in P uptake and PUE among melon accessions. The levels of expression of the other studied genes were diverse among melon accessions, but contributed less to the phenotypical response of the accessions. Conclusions This is the first time that these genes have been described in the context of P starvation responses in melon. There exists significant diversity in gene expression levels and P use efficiency among melon accessions as well as significant correlations between gene expression levels and phenotypical measurements. PMID:22536378

  15. Dynamic gene expression response to altered gravity in human T cells.

    PubMed

    Thiel, Cora S; Hauschild, Swantje; Huge, Andreas; Tauber, Svantje; Lauber, Beatrice A; Polzer, Jennifer; Paulsen, Katrin; Lier, Hartwin; Engelmann, Frank; Schmitz, Burkhard; Schütte, Andreas; Layer, Liliana E; Ullrich, Oliver

    2017-07-12

    We investigated the dynamics of immediate and initial gene expression response to different gravitational environments in human Jurkat T lymphocytic cells and compared expression profiles to identify potential gravity-regulated genes and adaptation processes. We used the Affymetrix GeneChip® Human Transcriptome Array 2.0 containing 44,699 protein coding genes and 22,829 non-protein coding genes and performed the experiments during a parabolic flight and a suborbital ballistic rocket mission to cross-validate gravity-regulated gene expression through independent research platforms and different sets of control experiments to exclude other factors than alteration of gravity. We found that gene expression in human T cells rapidly responded to altered gravity in the time frame of 20 s and 5 min. The initial response to microgravity involved mostly regulatory RNAs. We identified three gravity-regulated genes which could be cross-validated in both completely independent experiment missions: ATP6V1A/D, a vacuolar H + -ATPase (V-ATPase) responsible for acidification during bone resorption, IGHD3-3/IGHD3-10, diversity genes of the immunoglobulin heavy-chain locus participating in V(D)J recombination, and LINC00837, a long intergenic non-protein coding RNA. Due to the extensive and rapid alteration of gene expression associated with regulatory RNAs, we conclude that human cells are equipped with a robust and efficient adaptation potential when challenged with altered gravitational environments.

  16. Transcriptome dynamics of a susceptible wheat upon Fusarium head blight reveals that molecular responses to Fusarium graminearum infection fit over the grain development processes.

    PubMed

    Chetouhi, Cherif; Bonhomme, Ludovic; Lasserre-Zuber, Pauline; Cambon, Florence; Pelletier, Sandra; Renou, Jean-Pierre; Langin, Thierry

    2016-03-01

    In many plant/pathogen interactions, host susceptibility factors are key determinants of disease development promoting pathogen growth and spreading in plant tissues. In the Fusarium head blight (FHB) disease, the molecular basis of wheat susceptibility is still poorly understood while it could provide new insights into the understanding of the wheat/Fusarium graminearum (Fg) interaction and guide future breeding programs to produce cultivars with sustainable resistance. To identify the wheat grain candidate genes, a genome-wide gene expression profiling was performed in the French susceptible wheat cultivar, Recital. Gene-specific two-way ANOVA of about 40 K transcripts at five grain developmental stages identified 1309 differentially expressed genes. Out of these, 536 were impacted by the Fg effect alone. Most of these Fg-responsive genes belonged to biological and molecular functions related to biotic and abiotic stresses indicating the activation of common stress pathways during susceptibility response of wheat grain to FHB. This analysis revealed also 773 other genes displaying either specific Fg-responsive profiles along with grain development stages or synergistic adjustments with the grain development effect. These genes were involved in various molecular pathways including primary metabolism, cell death, and gene expression reprogramming. An increasingly complex host response was revealed, as was the impact of both Fg infection and grain ontogeny on the transcription of wheat genes. This analysis provides a wealth of candidate genes and pathways involved in susceptibility responses to FHB and depicts new clues to the understanding of the susceptibility determinism in plant/pathogen interactions.

  17. Transcriptional Response of Honey Bee Larvae Infected with the Bacterial Pathogen Paenibacillus larvae

    PubMed Central

    Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D.

    2013-01-01

    American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis. PMID:23762370

  18. Microarray analysis reveals overlapping and specific transcriptional responses to different plant hormones in rice

    PubMed Central

    Garg, Rohini; Tyagi, Akhilesh K.; Jain, Mukesh

    2012-01-01

    Hormones exert pleiotropic effects on plant growth and development throughout the life cycle. Many of these effects are mediated at molecular level via altering gene expression. In this study, we investigated the exogenous effect of plant hormones, including auxin, cytokinin, abscisic acid, ethylene, salicylic acid and jasmonic acid, on the transcription of rice genes at whole genome level using microarray. Our analysis identified a total of 4171 genes involved in several biological processes, whose expression was altered significantly in the presence of different hormones. Further, 28% of these genes exhibited overlapping transcriptional responses in the presence of any two hormones, indicating crosstalk among plant hormones. In addition, we identified genes showing only a particular hormone-specific response, which can be used as hormone-specific markers. The results of this study will facilitate further studies in hormone biology in rice. PMID:22827941

  19. Transcriptomic Profiling during the Post-Harvest of Heat-Treated Dixiland Prunus persica Fruits: Common and Distinct Response to Heat and Cold

    PubMed Central

    Lauxmann, Martin A.; Brun, Bianca; Borsani, Julia; Bustamante, Claudia A.; Budde, Claudio O.; Lara, María V.; Drincovich, María F.

    2012-01-01

    Cold storage is extensively used to slow the rapid deterioration of peach (Prunus persica L. Batsch) fruit after harvest. However, peach fruit subjected to long periods of cold storage develop chilling injury (CI) symptoms. Post-harvest heat treatment (HT) of peach fruit prior to cold storage is effective in reducing some CI symptoms, maintaining fruit quality, preventing softening and controlling post-harvest diseases. To identify the molecular changes induced by HT, which may be associated to CI protection, the differential transcriptome of peach fruit subjected to HT was characterized by the differential display technique. A total of 127 differentially expressed unigenes (DEUs), with a presence-absence pattern, were identified comparing peach fruit ripening at 20°C with those exposed to a 39°C-HT for 3 days. The 127 DEUs were divided into four expression profile clusters, among which the heat-induced (47%) and heat-repressed (36%) groups resulted the most represented, including genes with unknown function, or involved in protein modification, transcription or RNA metabolism. Considering the CI-protection induced by HT, 23-heat-responsive genes were selected and analyzed during and after short-term cold storage of peach fruit. More than 90% of the genes selected resulted modified by cold, from which nearly 60% followed the same and nearly 40% opposite response to heat and cold. Moreover, by using available Arabidopsis microarray data, it was found that nearly 70% of the peach-heat responsive genes also respond to cold in Arabidopsis, either following the same trend or showing an opposite response. Overall, the high number of common responsive genes to heat and cold identified in the present work indicates that HT of peach fruit after harvest induces a cold response involving complex cellular processes; identifying genes that are involved in the better preparation of peach fruit for cold-storage and unraveling the basis for the CI protection induced by HT. PMID:23236430

  20. Identification and molecular characterization of a trans-acting small interfering RNA producing locus regulating leaf rust responsive gene expression in wheat (Triticum aestivum L.).

    PubMed

    Dutta, Summi; Kumar, Dhananjay; Jha, Shailendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-11-01

    A novel leaf rust responsive ta-siRNA-producing locus was identified in wheat showing similarity to 28S rRNA and generated four differentially expressing ta-siRNAs by phasing which targeted stress responsive genes. Trans-acting-small interfering RNAs (Ta-siRNAs) are plant specific molecules generally involved in development and are also stress responsive. Ta-siRNAs identified in wheat till date are all responsive to abiotic stress only. Wheat cultivation is severely affected by rusts and leaf rust particularly affects grain filling. This study reports a novel ta-siRNA producing locus (TAS) in wheat which is a segment of 28S ribosomal RNA but shows differential expression during leaf rust infestation. Four small RNA libraries prepared from wheat Near Isogenic Lines were treated with leaf rust pathogen and compared with untreated controls. A TAS with the ability to generate four ta-siRNAs by phasing events was identified along with the microRNA TamiR16 as the phase initiator. The targets of the ta-siRNAs included α-gliadin, leucine rich repeat, trans-membrane proteins, glutathione-S-transferase, and fatty acid desaturase among others, which are either stress responsive genes or are essential for normal growth and development of plants. Expression of the TAS, its generated ta-siRNAs, and their target genes were profiled at five different time points after pathogen inoculation of susceptible and resistant wheat isolines and compared with mock-inoculated controls. Comparative analysis of expression unveiled differential and reciprocal relationship as well as discrete patterns between susceptible and resistant isolines. The expression profiles of the target genes of the identified ta-siRNAs advocate more towards effector triggered susceptibility favouring pathogenesis. The study helps in discerning the functions of wheat genes regulated by ta-siRNAs in response to leaf rust.

  1. Host genetics of response to porcine reproductive and respiratory syndrome in nursery pigs.

    PubMed

    Dekkers, Jack; Rowland, Raymond R R; Lunney, Joan K; Plastow, Graham

    2017-09-01

    PRRS is the most costly disease in the US pig industry. While vaccination, biosecurity and eradication effort have had some success, the variability and infectiousness of PRRS virus strains have hampered the effectiveness of these measures. We propose the use of genetic selection of pigs as an additional and complementary effort. Several studies have shown that host response to PRRS infection has a sizeable genetic component and recent advances in genomics provide opportunities to capitalize on these genetic differences and improve our understanding of host response to PRRS. While work is also ongoing to understand the genetic basis of host response to reproductive PRRS, the focus of this review is on research conducted on host response to PRRS in the nursery and grow-finish phase as part of the PRRS Host Genetics Consortium. Using experimental infection of large numbers of commercial nursery pigs, combined with deep phenotyping and genomics, this research has identified a major gene that is associated with host response to PRRS. Further functional genomics work identified the GBP5 gene as harboring the putative causative mutation. GBP5 is associated with innate immune response. Subsequent work has validated the effect of this genomic region on host response to a second PRRSV strain and to PRRS vaccination and co-infection of nursery pigs with PRRSV and PCV2b. A genetic marker near GBP5 is available to the industry for use in selection. Genetic differences in host response beyond GBP5 appear to be highly polygenic, i.e. controlled by many genes across the genome, each with a small effect. Such effects can by capitalized on in a selection program using genomic prediction on large numbers of genetic markers across the genome. Additional work has also identified the genetic basis of antibody response to PRRS, which could lead to the use of vaccine response as an indicator trait to select for host response to PRRS. Other genomic analyses, including gene expression analyses, have identified genes and modules of genes that are associated with differences in host response to PRRS and can be used to further understand and utilize differences in host response. Together, these results demonstrate that genetic selection can be an additional and complementary tool to combat PRRS in the swine industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Transcriptome analysis and identification of induced genes in the response of Harmonia axyridis to cold hardiness.

    PubMed

    Tang, Bin; Liu, Xiao-Jun; Shi, Zuo-Kun; Shen, Qi-Da; Xu, Yan-Xia; Wang, Su; Zhang, Fan; Wang, Shi-Gui

    2017-06-01

    Harmonia axyridis is an important predatory lady beetle that is a natural enemy of agricultural and forestry pests. In this research, the cold hardiness induced genes and their expression changes in H. axyridis were screened and detected by the way of the transcriptome and qualitative real-time PCR under normal and low temperatures, using high-throughput transcriptome and digital gene-expression-tag technologies. We obtained a 10Gb transcriptome and an 8Mb gene expression tag pool using Illumina deep sequencing technology and RNA-Seq analysis (accession number SRX540102). Of the 46,980 non-redundant unigenes identified, 28,037 (59.7%) were matched to known genes in GenBank, 21,604 (46.0%) in Swiss-Prot, 19,482 (41.5%) in Kyoto Encyclopedia of Genes and Genomes and 13,193 (28.1%) in Gene Ontology databases. Seventy-five percent of the unigene sequences had top matches with gene sequences from Tribolium castaneum. Results indicated that 60 genes regulated the entire cold-acclimation response, and, of these, seven genes were always up-regulated and five genes always down-regulated. Further screening revealed that six cold-resistant genes, E3 ubiquitin-protein ligase, transketolase, trehalase, serine/arginine repetitive matrix protein 2, glycerol kinase and sugar transporter SWEET1-like, play key roles in the response. Expression from a number of the differentially expressed genes was confirmed with quantitative real-time PCR (HaCS_Trans). The paper attempted to identify cold-resistance response genes, and study the potential mechanism by which cold acclimation enhances the insect's cold endurance. Information on these cold-resistance response genes will improve the development of low-temperature storage technology of natural enemy insects for future use in biological control. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Allele specific expression analysis identifies regulatory variation associated with stress-related genes in the Mexican highland maize landrace Palomero Toluqueño

    PubMed Central

    González-Segovia, Eric; Ross-Ibarra, Jeffrey; Simpson, June K.

    2017-01-01

    Background Gene regulatory variation has been proposed to play an important role in the adaptation of plants to environmental stress. In the central highlands of Mexico, farmer selection has generated a unique group of maize landraces adapted to the challenges of the highland niche. In this study, gene expression in Mexican highland maize and a reference maize breeding line were compared to identify evidence of regulatory variation in stress-related genes. It was hypothesised that local adaptation in Mexican highland maize would be associated with a transcriptional signature observable even under benign conditions. Methods Allele specific expression analysis was performed using the seedling-leaf transcriptome of an F1 individual generated from the cross between the highland adapted Mexican landrace Palomero Toluqueño and the reference line B73, grown under benign conditions. Results were compared with a published dataset describing the transcriptional response of B73 seedlings to cold, heat, salt and UV treatments. Results A total of 2,386 genes were identified to show allele specific expression. Of these, 277 showed an expression difference between Palomero Toluqueño and B73 alleles under benign conditions that anticipated the response of B73 cold, heat, salt and/or UV treatments, and, as such, were considered to display a prior stress response. Prior stress response candidates included genes associated with plant hormone signaling and a number of transcription factors. Construction of a gene co-expression network revealed further signaling and stress-related genes to be among the potential targets of the transcription factors candidates. Discussion Prior activation of responses may represent the best strategy when stresses are severe but predictable. Expression differences observed here between Palomero Toluqueño and B73 alleles indicate the presence of cis-acting regulatory variation linked to stress-related genes in Palomero Toluqueño. Considered alongside gene annotation and population data, allele specific expression analysis of plants grown under benign conditions provides an attractive strategy to identify functional variation potentially linked to local adaptation. PMID:28852597

  4. Genome-wide gene expression effects in B6C3F1 mouse intestinal epithelia following 7 and 90 days of exposure to hexavalent chromium in drinking water

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kopec, Anna K.; Kim, Suntae; Forgacs, Agnes L.

    2012-02-15

    Chronic administration of high doses of hexavalent chromium [Cr(VI)] as sodium dichromate dihydrate (SDD) elicits alimentary cancers in mice. To further elucidate key events underlying tumor formation, a 90-day drinking water study was conducted in B6C3F1 mice. Differential gene expression was examined in duodenal and jejunal epithelial samples following 7 or 90 days of exposure to 0, 0.3, 4, 14, 60, 170 or 520 mg/L SDD in drinking water. Genome-wide microarray analyses identified 6562 duodenal and 4448 jejunal unique differentially expressed genes at day 8, and 4630 and 4845 unique changes, respectively, in the duodenum and jejunum at day 91.more » Comparative analysis identified significant overlap in duodenal and jejunal differential gene expression. Automated dose–response modeling identified > 80% of the differentially expressed genes exhibited sigmoidal dose–response curves with EC{sub 50} values ranging from 10 to 100 mg/L SDD. Only 16 genes satisfying the dose-dependent differential expression criteria had EC{sub 50} values < 10 mg/L SDD, 3 of which were regulated by Nrf2, suggesting oxidative stress in response to SDD at low concentrations. Analyses of differentially expressed genes identified over-represented functions associated with oxidative stress, cell cycle, lipid metabolism, and immune responses consistent with the reported effects on redox status and histopathology at corresponding SDD drinking water concentrations. Collectively, these data are consistent with a mode of action involving oxidative stress and cytotoxicity as early key events. This suggests that the tumorigenic effects of chronic Cr(VI) oral exposure likely require chronic tissue damage and compensatory epithelial cell proliferation. Highlights: ► Mouse small intestine gene expression is highly responsive to hexavalent chromium [Cr(VI)]. ► Cr(VI) elicits more differential gene expression after 7 days of exposure than 90 days of exposure. ► Oral exposure to Cr(VI) leads to oxidative stress, cell cycle, lipid and immune dysregulation. ► Cr(VI) elicits dose-dependent changes in gene expression with an overall median EC{sub 50} of 47 mg/L SDD.« less

  5. Integrating microarray analysis and the soybean genome to understand the soybeans iron deficiency response

    PubMed Central

    2009-01-01

    Background Soybeans grown in the upper Midwestern United States often suffer from iron deficiency chlorosis, which results in yield loss at the end of the season. To better understand the effect of iron availability on soybean yield, we identified genes in two near isogenic lines with changes in expression patterns when plants were grown in iron sufficient and iron deficient conditions. Results Transcriptional profiles of soybean (Glycine max, L. Merr) near isogenic lines Clark (PI548553, iron efficient) and IsoClark (PI547430, iron inefficient) grown under Fe-sufficient and Fe-limited conditions were analyzed and compared using the Affymetrix® GeneChip® Soybean Genome Array. There were 835 candidate genes in the Clark (PI548553) genotype and 200 candidate genes in the IsoClark (PI547430) genotype putatively involved in soybean's iron stress response. Of these candidate genes, fifty-eight genes in the Clark genotype were identified with a genetic location within known iron efficiency QTL and 21 in the IsoClark genotype. The arrays also identified 170 single feature polymorphisms (SFPs) specific to either Clark or IsoClark. A sliding window analysis of the microarray data and the 7X genome assembly coupled with an iterative model of the data showed the candidate genes are clustered in the genome. An analysis of 5' untranslated regions in the promoter of candidate genes identified 11 conserved motifs in 248 differentially expressed genes, all from the Clark genotype, representing 129 clusters identified earlier, confirming the cluster analysis results. Conclusion These analyses have identified the first genes with expression patterns that are affected by iron stress and are located within QTL specific to iron deficiency stress. The genetic location and promoter motif analysis results support the hypothesis that the differentially expressed genes are co-regulated. The combined results of all analyses lead us to postulate iron inefficiency in soybean is a result of a mutation in a transcription factor(s), which controls the expression of genes required in inducing an iron stress response. PMID:19678937

  6. MYC2 Orchestrates a Hierarchical Transcriptional Cascade That Regulates Jasmonate-Mediated Plant Immunity in Tomato.

    PubMed

    Du, Minmin; Zhao, Jiuhai; Tzeng, David T W; Liu, Yuanyuan; Deng, Lei; Yang, Tianxia; Zhai, Qingzhe; Wu, Fangming; Huang, Zhuo; Zhou, Ming; Wang, Qiaomei; Chen, Qian; Zhong, Silin; Li, Chang-Bao; Li, Chuanyou

    2017-08-01

    The hormone jasmonate (JA), which functions in plant immunity, regulates resistance to pathogen infection and insect attack through triggering genome-wide transcriptional reprogramming in plants. We show that the basic helix-loop-helix transcription factor (TF) MYC2 in tomato ( Solanum lycopersicum ) acts downstream of the JA receptor to orchestrate JA-mediated activation of both the wounding and pathogen responses. Using chromatin immunoprecipitation sequencing (ChIP-seq) coupled with RNA sequencing (RNA-seq) assays, we identified 655 MYC2-targeted JA-responsive genes. These genes are highly enriched in Gene Ontology categories related to TFs and the early response to JA, indicating that MYC2 functions at a high hierarchical level to regulate JA-mediated gene transcription. We also identified a group of MYC2-targeted TFs (MTFs) that may directly regulate the JA-induced transcription of late defense genes. Our findings suggest that MYC2 and its downstream MTFs form a hierarchical transcriptional cascade during JA-mediated plant immunity that initiates and amplifies transcriptional output. As proof of concept, we showed that during plant resistance to the necrotrophic pathogen Botrytis cinerea , MYC2 and the MTF JA2-Like form a transcription module that preferentially regulates wounding-responsive genes, whereas MYC2 and the MTF ETHYLENE RESPONSE FACTOR.C3 form a transcription module that preferentially regulates pathogen-responsive genes. © 2017 American Society of Plant Biologists. All rights reserved.

  7. MYC2 Orchestrates a Hierarchical Transcriptional Cascade That Regulates Jasmonate-Mediated Plant Immunity in Tomato[OPEN

    PubMed Central

    Liu, Yuanyuan; Deng, Lei; Wu, Fangming; Huang, Zhuo; Zhou, Ming; Chen, Qian; Zhong, Silin

    2017-01-01

    The hormone jasmonate (JA), which functions in plant immunity, regulates resistance to pathogen infection and insect attack through triggering genome-wide transcriptional reprogramming in plants. We show that the basic helix-loop-helix transcription factor (TF) MYC2 in tomato (Solanum lycopersicum) acts downstream of the JA receptor to orchestrate JA-mediated activation of both the wounding and pathogen responses. Using chromatin immunoprecipitation sequencing (ChIP-seq) coupled with RNA sequencing (RNA-seq) assays, we identified 655 MYC2-targeted JA-responsive genes. These genes are highly enriched in Gene Ontology categories related to TFs and the early response to JA, indicating that MYC2 functions at a high hierarchical level to regulate JA-mediated gene transcription. We also identified a group of MYC2-targeted TFs (MTFs) that may directly regulate the JA-induced transcription of late defense genes. Our findings suggest that MYC2 and its downstream MTFs form a hierarchical transcriptional cascade during JA-mediated plant immunity that initiates and amplifies transcriptional output. As proof of concept, we showed that during plant resistance to the necrotrophic pathogen Botrytis cinerea, MYC2 and the MTF JA2-Like form a transcription module that preferentially regulates wounding-responsive genes, whereas MYC2 and the MTF ETHYLENE RESPONSE FACTOR.C3 form a transcription module that preferentially regulates pathogen-responsive genes. PMID:28733419

  8. Feedback inhibition by thiols outranks glutathione depletion: a luciferase-based screen reveals glutathione-deficient γ-ECS and glutathione synthetase mutants impaired in cadmium-induced sulfate assimilation.

    PubMed

    Jobe, Timothy O; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A; Mendoza-Cózatl, David G; Schroeder, Julian I

    2012-06-01

    Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M(2) seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  9. Genome-Wide Mapping of Cystitis Due to Streptococcus agalactiae and Escherichia coli in Mice Identifies a Unique Bladder Transcriptome That Signifies Pathogen-Specific Antimicrobial Defense against Urinary Tract Infection

    PubMed Central

    Tan, Chee K.; Carey, Alison J.; Cui, Xiangqin; Webb, Richard I.; Ipe, Deepak; Crowley, Michael; Cripps, Allan W.; Benjamin, William H.; Ulett, Kimberly B.; Schembri, Mark A.

    2012-01-01

    The most common causes of urinary tract infections (UTIs) are Gram-negative pathogens such as Escherichia coli; however, Gram-positive organisms, including Streptococcus agalactiae, or group B streptococcus (GBS), also cause UTI. In GBS infection, UTI progresses to cystitis once the bacteria colonize the bladder, but the host responses triggered in the bladder immediately following infection are largely unknown. Here, we used genome-wide expression profiling to map the bladder transcriptome of GBS UTI in mice infected transurethrally with uropathogenic GBS that was cultured from a 35-year-old women with cystitis. RNA from bladders was applied to Affymetrix Gene-1.0ST microarrays; quantitative reverse transcriptase PCR (qRT-PCR) was used to analyze selected gene responses identified in array data sets. A surprisingly small significant-gene list of 172 genes was identified at 24 h; this compared to 2,507 genes identified in a side-by-side comparison with uropathogenic E. coli (UPEC). No genes exhibited significantly altered expression at 2 h in GBS-infected mice according to arrays despite high bladder bacterial loads at this early time point. The absence of a marked early host response to GBS juxtaposed with broad-based bladder responses activated by UPEC at 2 h. Bioinformatics analyses, including integrative system-level network mapping, revealed multiple activated biological pathways in the GBS bladder transcriptome that regulate leukocyte activation, inflammation, apoptosis, and cytokine-chemokine biosynthesis. These findings define a novel, minimalistic type of bladder host response triggered by GBS UTI, which comprises collective antimicrobial pathways that differ dramatically from those activated by UPEC. Overall, this study emphasizes the unique nature of bladder immune activation mechanisms triggered by distinct uropathogens. PMID:22733575

  10. Integrated analysis of rice transcriptomic and metabolomic responses to elevated night temperatures identifies sensitivity- and tolerance-related profiles.

    PubMed

    Glaubitz, Ulrike; Li, Xia; Schaedel, Sandra; Erban, Alexander; Sulpice, Ronan; Kopka, Joachim; Hincha, Dirk K; Zuther, Ellen

    2017-01-01

    Transcript and metabolite profiling were performed on leaves from six rice cultivars under high night temperature (HNT) condition. Six genes were identified as central for HNT response encoding proteins involved in transcription regulation, signal transduction, protein-protein interactions, jasmonate response and the biosynthesis of secondary metabolites. Sensitive cultivars showed specific changes in transcript abundance including abiotic stress responses, changes of cell wall-related genes, of ABA signaling and secondary metabolism. Additionally, metabolite profiles revealed a highly activated TCA cycle under HNT and concomitantly increased levels in pathways branching off that could be corroborated by enzyme activity measurements. Integrated data analysis using clustering based on one-dimensional self-organizing maps identified two profiles highly correlated with HNT sensitivity. The sensitivity profile included genes of the functional bins abiotic stress, hormone metabolism, cell wall, signaling, redox state, transcription factors, secondary metabolites and defence genes. In the tolerance profile, similar bins were affected with slight differences in hormone metabolism and transcription factor responses. Metabolites of the two profiles revealed involvement of GABA signaling, thus providing a link to the TCA cycle status in sensitive cultivars and of myo-inositol as precursor for inositol phosphates linking jasmonate signaling to the HNT response specifically in tolerant cultivars. © 2016 John Wiley & Sons Ltd.

  11. Identification and Expression Profiling of the Auxin Response Factors in Dendrobium officinale under Abiotic Stresses

    PubMed Central

    Chen, Zhehao; Yuan, Ye; Fu, Di; Shen, Chenjia; Yang, Yanjun

    2017-01-01

    Auxin response factor (ARF) proteins play roles in plant responses to diverse environmental stresses by binding specifically to the auxin response element in the promoters of target genes. Using our latest public Dendrobium transcriptomes, a comprehensive characterization and analysis of 14 DnARF genes were performed. Three selected DnARFs, including DnARF1, DnARF4, and DnARF6, were confirmed to be nuclear proteins according to their transient expression in epidermal cells of Nicotiana benthamiana leaves. Furthermore, the transcription activation abilities of DnARF1, DnARF4, and DnARF6 were tested in a yeast system. Our data showed that DnARF6 is a transcriptional activator in Dendrobium officinale. To uncover the basic information of DnARF gene responses to abiotic stresses, we analyzed their expression patterns under various hormones and abiotic treatments. Based on our data, several hormones and significant stress responsive DnARF genes have been identified. Since auxin and ARF genes have been identified in many plant species, our data is imperative to reveal the function of ARF mediated auxin signaling in the adaptation to the challenging Dendrobium environment. PMID:28471373

  12. Identification and Expression Profiling of the Auxin Response Factors in Dendrobium officinale under Abiotic Stresses.

    PubMed

    Chen, Zhehao; Yuan, Ye; Fu, Di; Shen, Chenjia; Yang, Yanjun

    2017-05-04

    Auxin response factor (ARF) proteins play roles in plant responses to diverse environmental stresses by binding specifically to the auxin response element in the promoters of target genes. Using our latest public Dendrobium transcriptomes, a comprehensive characterization and analysis of 14 DnARF genes were performed. Three selected DnARFs , including DnARF1 , DnARF4 , and DnARF6 , were confirmed to be nuclear proteins according to their transient expression in epidermal cells of Nicotiana benthamiana leaves. Furthermore, the transcription activation abilities of DnARF1 , DnARF4 , and DnARF6 were tested in a yeast system. Our data showed that DnARF6 is a transcriptional activator in Dendrobium officinale . To uncover the basic information of DnARF gene responses to abiotic stresses, we analyzed their expression patterns under various hormones and abiotic treatments. Based on our data, several hormones and significant stress responsive DnARF genes have been identified. Since auxin and ARF genes have been identified in many plant species, our data is imperative to reveal the function of ARF mediated auxin signaling in the adaptation to the challenging Dendrobium environment.

  13. integIRTy: a method to identify genes altered in cancer by accounting for multiple mechanisms of regulation using item response theory.

    PubMed

    Tong, Pan; Coombes, Kevin R

    2012-11-15

    Identifying genes altered in cancer plays a crucial role in both understanding the mechanism of carcinogenesis and developing novel therapeutics. It is known that there are various mechanisms of regulation that can lead to gene dysfunction, including copy number change, methylation, abnormal expression, mutation and so on. Nowadays, all these types of alterations can be simultaneously interrogated by different types of assays. Although many methods have been proposed to identify altered genes from a single assay, there is no method that can deal with multiple assays accounting for different alteration types systematically. In this article, we propose a novel method, integration using item response theory (integIRTy), to identify altered genes by using item response theory that allows integrated analysis of multiple high-throughput assays. When applied to a single assay, the proposed method is more robust and reliable than conventional methods such as Student's t-test or the Wilcoxon rank-sum test. When used to integrate multiple assays, integIRTy can identify novel-altered genes that cannot be found by looking at individual assay separately. We applied integIRTy to three public cancer datasets (ovarian carcinoma, breast cancer, glioblastoma) for cross-assay type integration which all show encouraging results. The R package integIRTy is available at the web site http://bioinformatics.mdanderson.org/main/OOMPA:Overview. kcoombes@mdanderson.org. Supplementary data are available at Bioinformatics online.

  14. De novo assembly of the sea trout (Salmo trutta m. trutta) skin transcriptome to identify putative genes involved in the immune response and epidermal mucus secretion

    PubMed Central

    Wenne, Roman; Burzynski, Artur

    2017-01-01

    In fish, the skin is a multifunctional organ and the first barrier against pathogens. Salmonids differ in their susceptibility to microorganisms due to varied skin morphology and gene expression patterns. The brown trout is a salmonid species with important commercial and ecological value in Europe. However, there is a lack of knowledge regarding the genes involved in the immune response and mucus secretion in the skin of this fish. Thus, we characterized the skin transcriptome of anadromous brown trout using next-generation sequencing (NGS). A total of 1,348,306 filtered reads were obtained and assembled into 75,970 contigs. Of these contigs 48.57% were identified using BLAST tool searches against four public databases. KEGG pathway and Gene Ontology analyses revealed that 13.40% and 34.57% of the annotated transcripts, respectively, represent a variety of biological processes and functions. Among the identified KEGG Orthology categories, the best represented were signal transduction (23.28%) and immune system (8.82%), with a variety of genes involved in immune pathways, implying the differentiation of immune responses in the trout skin. We also identified and transcriptionally characterized 8 types of mucin proteins–the main structural components of the mucosal layer. Moreover, 140 genes involved in mucin synthesis were identified, and 1,119 potential simple sequence repeats (SSRs) were detected in 3,134 transcripts. PMID:28212382

  15. De novo transcriptome assembly and analysis of differential gene expression following peptidoglycan (PGN) challenge in Antheraea pernyi.

    PubMed

    Liu, Yu; Xin, Zhao-Zhe; Zhang, Dai-Zhen; Zhu, Xiao-Yu; Wang, Ying; Chen, Li; Tang, Bo-Ping; Zhou, Chun-Lin; Chai, Xin-Yue; Tian, Ji-Wu; Liu, Qiu-Ning

    2018-06-01

    Antheraea pernyi is not only an important economic insect, it is increasingly employed as a model organism due to a variety of advantages, including ease of rearing and experimental manipulation compared with other Lepidoptera. Peptidoglycan (PGN) is a major component of the bacterial cell wall, and interactions between PGN and A. pernyi cause a series of physiological changes in the insect. In the present study, we constructed cDNA libraries from a A. pernyi PGN-infected group and a control group stimulated with phosphate-buffered saline (PBS). The transcriptome was de novo assembled using the Trinity platform, and 1698 differentially expressed genes (DEGs) were identified, comprising 894 up-regulated and 804 down-regulated genes. To further investigate immune-related DEGs, gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment were performed. GO analysis identified major immune-related GO terms and KEGG enrichment indicated gene responses to three pathways related to the insect immune system. Several homologous genes related to the immune response of the A. pernyi fat body post-PGN infection were identified and categorised. Taken together, the results provide insight into the complex molecular mechanisms of the responses to bacterial infection at the transcriptional level. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Ancestral multipartite units in light-responsive plant promoters have structural features correlating with specific phototransduction pathways.

    PubMed Central

    Argüello-Astorga, G R; Herrera-Estrella, L R

    1996-01-01

    Regulation of plant gene transcription by light is mediated by multipartite cis-regulatory units. Previous attempts to identify structural features that are common to all light-responsive elements (LREs) have been unsuccessful. To address the question of what is needed to confer photoresponsiveness to a promoter, the upstream sequences from more than 110 light-regulated plant genes were analyzed by a new, phylogenetic-structural method. As a result, 30 distinct conserved DNA module arrays (CMAs) associated with light-responsive promoter regions were identified. Several of these CMAs have remained invariant throughout the evolutionary radiation of angiosperms and are conserved between homologous genes as well as between members of different gene families. The identified CMAs share a gene superfamily-specific core that correlates with the particular phytochrome-dependent transduction pathway that controls their expression, i.e. ACCTA(A/C)C(A/C) for the cGMP-dependent phenylpropanoid metabolism-associated genes, and GATA(A/T)GR for the Ca2+/calmodulin-dependent photosynthesis-associated nuclear genes. In addition to suggesting a general model for the functional and structural organization of LREs, the data obtained in this study indicate that angiosperm LREs probably evolved from complex cis-acting elements involved in regulatory processes other than photoregulation in gymnosperms. PMID:8938415

  17. Combining gene expression and genetic analyses to identify candidate genes involved in cold responses in pea.

    PubMed

    Legrand, Sylvain; Marque, Gilles; Blassiau, Christelle; Bluteau, Aurélie; Canoy, Anne-Sophie; Fontaine, Véronique; Jaminon, Odile; Bahrman, Nasser; Mautord, Julie; Morin, Julie; Petit, Aurélie; Baranger, Alain; Rivière, Nathalie; Wilmer, Jeroen; Delbreil, Bruno; Lejeune-Hénaut, Isabelle

    2013-09-01

    Cold stress affects plant growth and development. In order to better understand the responses to cold (chilling or freezing tolerance), we used two contrasted pea lines. Following a chilling period, the Champagne line becomes tolerant to frost whereas the Terese line remains sensitive. Four suppression subtractive hybridisation libraries were obtained using mRNAs isolated from pea genotypes Champagne and Terese. Using quantitative polymerase chain reaction (qPCR) performed on 159 genes, 43 and 54 genes were identified as differentially expressed at the initial time point and during the time course study, respectively. Molecular markers were developed from the differentially expressed genes and were genotyped on a population of 164 RILs derived from a cross between Champagne and Terese. We identified 5 candidate genes colocalizing with 3 different frost damage quantitative trait loci (QTL) intervals and a protein quantity locus (PQL) rich region previously reported. This investigation revealed the role of constitutive differences between both genotypes in the cold responses, in particular with genes related to glycine degradation pathway that could confer to Champagne a better frost tolerance. We showed that freezing tolerance involves a decrease of expression of genes related to photosynthesis and the expression of a gene involved in the production of cysteine and methionine that could act as cryoprotectant molecules. Although it remains to be confirmed, this study could also reveal the involvement of the jasmonate pathway in the cold responses, since we observed that two genes related to this pathway were mapped in a frost damage QTL interval and in a PQL rich region interval, respectively. Copyright © 2013 Elsevier GmbH. All rights reserved.

  18. Gene Expression Profiles of Chicken Embryo Fibroblasts in Response to Salmonella Enteritidis Infection

    PubMed Central

    Szmolka, Ama; Wiener, Zoltán; Matulova, Marta Elsheimer; Varmuzova, Karolina; Rychlik, Ivan

    2015-01-01

    The response of chicken to non-typhoidal Salmonella infection is becoming well characterised but the role of particular cell types in this response is still far from being understood. Therefore, in this study we characterised the response of chicken embryo fibroblasts (CEFs) to infection with two different S. Enteritidis strains by microarray analysis. The expression of chicken genes identified as significantly up- or down-regulated (≥3-fold) by microarray analysis was verified by real-time PCR followed by functional classification of the genes and prediction of interactions between the proteins using Gene Ontology and STRING Database. Finally the expression of the newly identified genes was tested in HD11 macrophages and in vivo in chickens. Altogether 19 genes were induced in CEFs after S. Enteritidis infection. Twelve of them were also induced in HD11 macrophages and thirteen in the caecum of orally infected chickens. The majority of these genes were assigned different functions in the immune response, however five of them (LOC101750351, K123, BU460569, MOBKL2C and G0S2) have not been associated with the response of chicken to Salmonella infection so far. K123 and G0S2 were the only ’non-immune’ genes inducible by S. Enteritidis in fibroblasts, HD11 macrophages and in the caecum after oral infection. The function of K123 is unknown but G0S2 is involved in lipid metabolism and in β-oxidation of fatty acids in mitochondria. PMID:26046914

  19. Gene Expression Profiles of Chicken Embryo Fibroblasts in Response to Salmonella Enteritidis Infection.

    PubMed

    Szmolka, Ama; Wiener, Zoltán; Matulova, Marta Elsheimer; Varmuzova, Karolina; Rychlik, Ivan

    2015-01-01

    The response of chicken to non-typhoidal Salmonella infection is becoming well characterised but the role of particular cell types in this response is still far from being understood. Therefore, in this study we characterised the response of chicken embryo fibroblasts (CEFs) to infection with two different S. Enteritidis strains by microarray analysis. The expression of chicken genes identified as significantly up- or down-regulated (≥3-fold) by microarray analysis was verified by real-time PCR followed by functional classification of the genes and prediction of interactions between the proteins using Gene Ontology and STRING Database. Finally the expression of the newly identified genes was tested in HD11 macrophages and in vivo in chickens. Altogether 19 genes were induced in CEFs after S. Enteritidis infection. Twelve of them were also induced in HD11 macrophages and thirteen in the caecum of orally infected chickens. The majority of these genes were assigned different functions in the immune response, however five of them (LOC101750351, K123, BU460569, MOBKL2C and G0S2) have not been associated with the response of chicken to Salmonella infection so far. K123 and G0S2 were the only 'non-immune' genes inducible by S. Enteritidis in fibroblasts, HD11 macrophages and in the caecum after oral infection. The function of K123 is unknown but G0S2 is involved in lipid metabolism and in β-oxidation of fatty acids in mitochondria.

  20. Dynamic network reconstruction from gene expression data applied to immune response during bacterial infection.

    PubMed

    Guthke, Reinhard; Möller, Ulrich; Hoffmann, Martin; Thies, Frank; Töpfer, Susanne

    2005-04-15

    The immune response to bacterial infection represents a complex network of dynamic gene and protein interactions. We present an optimized reverse engineering strategy aimed at a reconstruction of this kind of interaction networks. The proposed approach is based on both microarray data and available biological knowledge. The main kinetics of the immune response were identified by fuzzy clustering of gene expression profiles (time series). The number of clusters was optimized using various evaluation criteria. For each cluster a representative gene with a high fuzzy-membership was chosen in accordance with available physiological knowledge. Then hypothetical network structures were identified by seeking systems of ordinary differential equations, whose simulated kinetics could fit the gene expression profiles of the cluster-representative genes. For the construction of hypothetical network structures singular value decomposition (SVD) based methods and a newly introduced heuristic Network Generation Method here were compared. It turned out that the proposed novel method could find sparser networks and gave better fits to the experimental data. Reinhard.Guthke@hki-jena.de.

  1. Schistosoma mansoni: resistant specific infection-induced gene expression in Biomphalaria glabrata identified by fluorescent-based differential display.

    PubMed

    Lockyer, Anne E; Noble, Leslie R; Rollinson, David; Jones, Catherine S

    2004-01-01

    The freshwater tropical snail Biomphalaria glabrata is an intermediate host for Schistosoma mansoni, the causative agent of human intestinal schistosomiasis, and strains differ in their susceptibility to parasite infection. Changes in gene expression in response to parasite infection have been simultaneously examined in a susceptible strain (NHM1742) and a resistant strain (NHM1981) using a newly developed fluorescent-based differential display method. Such RNA profiling techniques allow the examination of changes in gene expression in response to parasite infection, without requiring previous sequence knowledge, or selecting candidate genes that may be involved in the complex neuroendocrine or defence systems of the snail. Thus, novel genes may be identified. Ten transcripts were initially identified, present only in the profiles derived from snails of the resistant strain when exposed to infection. The differential expression of five of these genes, including HSP70 and several novel transcripts with one containing at least two globin-like domains, has been confirmed by semi-quantitative RT-PCR.

  2. Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

    PubMed

    Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

    2012-04-01

    Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

  3. Genome-Wide Gene Expression Analysis Shows AKAP13-Mediated PKD1 Signaling Regulates the Transcriptional Response to Cardiac Hypertrophy.

    PubMed

    Johnson, Keven R; Nicodemus-Johnson, Jessie; Spindler, Mathew J; Carnegie, Graeme K

    2015-01-01

    In the heart, scaffolding proteins such as A-Kinase Anchoring Proteins (AKAPs) play a crucial role in normal cellular function by serving as a signaling hub for multiple protein kinases including protein kinase D1 (PKD1). Under cardiac hypertrophic conditions AKAP13 anchored PKD1 activates the transcription factor MEF2 leading to subsequent fetal gene activation and hypertrophic response. We used an expression microarray to identify the global transcriptional response in the hearts of wild-type mice expressing the native form of AKAP13 compared to a gene-trap mouse model expressing a truncated form of AKAP13 that is unable to bind PKD1 (AKAP13-ΔPKD1). Microarray analysis showed that AKAP13-ΔPKD1 mice broadly failed to exhibit the transcriptional profile normally associated with compensatory cardiac hypertrophy following trans-aortic constriction (TAC). The identified differentially expressed genes in WT and AKAP13-ΔPKD1 hearts are vital for the compensatory hypertrophic response to pressure-overload and include myofilament, apoptotic, and cell growth/differentiation genes in addition to genes not previously identified as affected by AKAP13-anchored PKD1. Our results show that AKAP13-PKD1 signaling is critical for transcriptional regulation of key contractile, cell death, and metabolic pathways during the development of compensatory hypertrophy in vivo.

  4. Genome-Wide Gene Expression Analysis Shows AKAP13-Mediated PKD1 Signaling Regulates the Transcriptional Response to Cardiac Hypertrophy

    PubMed Central

    Johnson, Keven R.; Nicodemus-Johnson, Jessie; Spindler, Mathew J.

    2015-01-01

    In the heart, scaffolding proteins such as A-Kinase Anchoring Proteins (AKAPs) play a crucial role in normal cellular function by serving as a signaling hub for multiple protein kinases including protein kinase D1 (PKD1). Under cardiac hypertrophic conditions AKAP13 anchored PKD1 activates the transcription factor MEF2 leading to subsequent fetal gene activation and hypertrophic response. We used an expression microarray to identify the global transcriptional response in the hearts of wild-type mice expressing the native form of AKAP13 compared to a gene-trap mouse model expressing a truncated form of AKAP13 that is unable to bind PKD1 (AKAP13-ΔPKD1). Microarray analysis showed that AKAP13-ΔPKD1 mice broadly failed to exhibit the transcriptional profile normally associated with compensatory cardiac hypertrophy following trans-aortic constriction (TAC). The identified differentially expressed genes in WT and AKAP13-ΔPKD1 hearts are vital for the compensatory hypertrophic response to pressure-overload and include myofilament, apoptotic, and cell growth/differentiation genes in addition to genes not previously identified as affected by AKAP13-anchored PKD1. Our results show that AKAP13-PKD1 signaling is critical for transcriptional regulation of key contractile, cell death, and metabolic pathways during the development of compensatory hypertrophy in vivo. PMID:26192751

  5. Analysis of genomic responses in a rat lung model treated with a humidifier sterilizer containing polyhexamethyleneguanidine phosphate.

    PubMed

    Kim, Min-Seok; Jeong, Seok Won; Choi, Seong-Jin; Han, Jin-Young; Kim, Sung-Hwan; Yoon, Seokjoo; Oh, Jung-Hwa; Lee, Kyuhong

    2017-02-15

    The antimicrobial biocide polyhexamethyleneguanidine (PHMG) phosphate is the main ingredient in the commercially available humidifier disinfectant. PHMG phosphate-based humidifier disinfectants can cause pulmonary fibrosis and induce inflammatory and fibrotic responses both in vivo and in vitro. However, toxicological mechanisms including genomic alterations induced by inhalation exposure to PHMG phosphate have not been elucidated. Therefore, this study evaluated the toxicological effects of the PHMG phosphate-containing humidifier disinfectant. We used DNA microarray to identify global gene expression changes in rats treated with PHMG phosphate-containing humidifier disinfectant for 4 weeks and 10 weeks. Functional significance of differentially expressed genes (DEGs) was estimated by gene ontology (GO) analysis. Four weeks post-exposure, 320 and 392 DEGs were identified in female and male rats, respectively (>2-fold, p<0.05). Ten weeks post-exposure, 1290 and 995 DEGs were identified in females and males, respectively. Of these, 119 and 556 genes overlapped between females and males at 4 weeks and 10 weeks, respectively, post-PHMG phosphate exposure. In addition, 21 genes were upregulated and 4 genes were downregulated in response to PHMG phosphate in a time-dependent manner. Thus, we predict that changes in genomic responses could be a significant molecular mechanism underlying PHMG phosphate toxicity. Further studies are required to determine the detailed mechanism of PHMG phosphate-induced pulmonary toxicity. Copyright © 2016. Published by Elsevier B.V.

  6. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways

    PubMed Central

    Shore, David E.; Carr, Christopher E.; Ruvkun, Gary

    2012-01-01

    Many genetic and physiological treatments that extend lifespan also confer resistance to a variety of stressors, suggesting that cytoprotective mechanisms underpin the regulation of longevity. It has not been established, however, whether the induction of cytoprotective pathways is essential for lifespan extension or merely correlated. Using a panel of GFP-fused stress response genes, we identified the suites of cytoprotective pathways upregulated by 160 gene inactivations known to increase Caenorhabditis elegans longevity, including the mitochondrial UPR (hsp-6, hsp-60), the ER UPR (hsp-4), ROS response (sod-3, gst-4), and xenobiotic detoxification (gst-4). We then screened for other gene inactivations that disrupt the induction of these responses by xenobiotic or genetic triggers, identifying 29 gene inactivations required for cytoprotective gene expression. If cytoprotective responses contribute directly to lifespan extension, inactivation of these genes would be expected to compromise the extension of lifespan conferred by decreased insulin/IGF-1 signaling, caloric restriction, or the inhibition of mitochondrial function. We find that inactivation of 25 of 29 cytoprotection-regulatory genes shortens the extension of longevity normally induced by decreased insulin/IGF-1 signaling, disruption of mitochondrial function, or caloric restriction, without disrupting normal longevity nearly as dramatically. These data demonstrate that induction of cytoprotective pathways is central to longevity extension and identify a large set of new genetic components of the pathways that detect cellular damage and couple that detection to downstream cytoprotective effectors. PMID:22829775

  7. Genome-wide gene expression effects in B6C3F1 mouse intestinal epithelia following 7 and 90days of exposure to hexavalent chromium in drinking water.

    PubMed

    Kopec, Anna K; Kim, Suntae; Forgacs, Agnes L; Zacharewski, Timothy R; Proctor, Deborah M; Harris, Mark A; Haws, Laurie C; Thompson, Chad M

    2012-02-15

    Chronic administration of high doses of hexavalent chromium [Cr(VI)] as sodium dichromate dihydrate (SDD) elicits alimentary cancers in mice. To further elucidate key events underlying tumor formation, a 90-day drinking water study was conducted in B6C3F1 mice. Differential gene expression was examined in duodenal and jejunal epithelial samples following 7 or 90days of exposure to 0, 0.3, 4, 14, 60, 170 or 520mg/L SDD in drinking water. Genome-wide microarray analyses identified 6562 duodenal and 4448 jejunal unique differentially expressed genes at day 8, and 4630 and 4845 unique changes, respectively, in the duodenum and jejunum at day 91. Comparative analysis identified significant overlap in duodenal and jejunal differential gene expression. Automated dose-response modeling identified >80% of the differentially expressed genes exhibited sigmoidal dose-response curves with EC(50) values ranging from 10 to 100mg/L SDD. Only 16 genes satisfying the dose-dependent differential expression criteria had EC(50) values <10mg/L SDD, 3 of which were regulated by Nrf2, suggesting oxidative stress in response to SDD at low concentrations. Analyses of differentially expressed genes identified over-represented functions associated with oxidative stress, cell cycle, lipid metabolism, and immune responses consistent with the reported effects on redox status and histopathology at corresponding SDD drinking water concentrations. Collectively, these data are consistent with a mode of action involving oxidative stress and cytotoxicity as early key events. This suggests that the tumorigenic effects of chronic Cr(VI) oral exposure likely require chronic tissue damage and compensatory epithelial cell proliferation. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. Integrative Analysis of DNA Methylation and Gene Expression Data Identifies EPAS1 as a Key Regulator of COPD

    PubMed Central

    Yoo, Seungyeul; Takikawa, Sachiko; Geraghty, Patrick; Argmann, Carmen; Campbell, Joshua; Lin, Luan; Huang, Tao; Tu, Zhidong; Feronjy, Robert; Spira, Avrum; Schadt, Eric E.; Powell, Charles A.; Zhu, Jun

    2015-01-01

    Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA methylation, gene expression, and phenotype data in lung tissue from COPD and control samples. Our integrative analysis identified 126 key regulators of COPD. We identified EPAS1 as the only key regulator whose downstream genes significantly overlapped with multiple genes sets associated with COPD disease severity. EPAS1 is distinct in comparison with other key regulators in terms of methylation profile and downstream target genes. Genes predicted to be regulated by EPAS1 were enriched for biological processes including signaling, cell communications, and system development. We confirmed that EPAS1 protein levels are lower in human COPD lung tissue compared to non-disease controls and that Epas1 gene expression is reduced in mice chronically exposed to cigarette smoke. As EPAS1 downstream genes were significantly enriched for hypoxia responsive genes in endothelial cells, we tested EPAS1 function in human endothelial cells. EPAS1 knockdown by siRNA in endothelial cells impacted genes that significantly overlapped with EPAS1 downstream genes in lung tissue including hypoxia responsive genes, and genes associated with emphysema severity. Our first integrative analysis of genome-wide DNA methylation and gene expression profiles illustrates that not only does DNA methylation play a ‘causal’ role in the molecular pathophysiology of COPD, but it can be leveraged to directly identify novel key mediators of this pathophysiology. PMID:25569234

  9. [Genome-wide identification and analysis of WRKY transcription factors in Medicago truncatula].

    PubMed

    Song, Hui; Nan, Zhibiao

    2014-02-01

    WRKY gene family plays important roles in plant by involving in transcriptional regulations during various physiologically processes such as development, metabolism and responses to biotic and abiotic stresses. WRKY genes have been identified in various plants. However, only few WRKY genes in Medicago truncatula have been identified with systematic analysis and comparison. In this study, we identified 93 WRKY genes through analyses of M. truncatula genome. These genes include 19 type-I genes, 49 type II genes and 13 type-III genes, and 12 non-regular type genes. All of these genes were characterized through analyses of gene duplication, chromosomal locations, structural diversity, conserved protein motifs and phylogenetic relations. The results showed that 11 times of gene duplication event occurred in WRKY gene family involving 24 genes. WRKY genes, containing 6 gene clusters, are unevenly distributed into chromosome 1 to 6, and there is the purifying selection pressure in WRKY group III genes.

  10. Genetic analysis of Physcomitrella patens identifies ABSCISIC ACID NON-RESPONSIVE, a regulator of ABA responses unique to basal land plants and required for desiccation tolerance

    DOE PAGES

    Stevenson, Sean Ross; Kamisugi, Yasuko; Trinh, Chi H.; ...

    2016-05-18

    The anatomically simple plants that first colonized land must have acquired molecular and biochemical adaptations to drought stress. Abscisic acid (ABA) coordinates responses leading to desiccation tolerance in all land plants. We identified ABA nonresponsive mutants in the model bryophyte Physcomitrella patens and genotyped a segregating population to map and identify the ABA NON-RESPONSIVE (ANR) gene encoding a modular protein kinase comprising an N-terminal PAS domain, a central EDR domain, and a C-terminal MAPKKK-like domain. anr mutants fail to accumulate dehydration tolerance-associated gene products in response to drought, ABA, or osmotic stress and do not acquire ABA-dependent desiccation tolerance. Themore » crystal structure of the PAS domain, determined to 1.7-Å resolution, shows a conserved PAS-fold that dimerizes through a weak dimerization interface. Targeted mutagenesis of a conserved tryptophan residue within the PAS domain generates plants with ABA nonresponsive growth and strongly attenuated ABA-responsive gene expression, whereas deleting this domain retains a fully ABA-responsive phenotype. ANR orthologs are found in early-diverging land plant lineages and aquatic algae but are absent from more recently diverged vascular plants. Lastly, we propose that ANR genes represent an ancestral adaptation that enabled drought stress survival of the first terrestrial colonizers but were lost during land plant evolution.« less

  11. Genetic analysis of Physcomitrella patens identifies ABSCISIC ACID NON-RESPONSIVE, a regulator of ABA responses unique to basal land plants and required for desiccation tolerance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stevenson, Sean Ross; Kamisugi, Yasuko; Trinh, Chi H.

    The anatomically simple plants that first colonized land must have acquired molecular and biochemical adaptations to drought stress. Abscisic acid (ABA) coordinates responses leading to desiccation tolerance in all land plants. We identified ABA nonresponsive mutants in the model bryophyte Physcomitrella patens and genotyped a segregating population to map and identify the ABA NON-RESPONSIVE (ANR) gene encoding a modular protein kinase comprising an N-terminal PAS domain, a central EDR domain, and a C-terminal MAPKKK-like domain. anr mutants fail to accumulate dehydration tolerance-associated gene products in response to drought, ABA, or osmotic stress and do not acquire ABA-dependent desiccation tolerance. Themore » crystal structure of the PAS domain, determined to 1.7-Å resolution, shows a conserved PAS-fold that dimerizes through a weak dimerization interface. Targeted mutagenesis of a conserved tryptophan residue within the PAS domain generates plants with ABA nonresponsive growth and strongly attenuated ABA-responsive gene expression, whereas deleting this domain retains a fully ABA-responsive phenotype. ANR orthologs are found in early-diverging land plant lineages and aquatic algae but are absent from more recently diverged vascular plants. Lastly, we propose that ANR genes represent an ancestral adaptation that enabled drought stress survival of the first terrestrial colonizers but were lost during land plant evolution.« less

  12. Analysis of Gene Regulatory Networks of Maize in Response to Nitrogen.

    PubMed

    Jiang, Lu; Ball, Graham; Hodgman, Charlie; Coules, Anne; Zhao, Han; Lu, Chungui

    2018-03-08

    Nitrogen (N) fertilizer has a major influence on the yield and quality. Understanding and optimising the response of crop plants to nitrogen fertilizer usage is of central importance in enhancing food security and agricultural sustainability. In this study, the analysis of gene regulatory networks reveals multiple genes and biological processes in response to N. Two microarray studies have been used to infer components of the nitrogen-response network. Since they used different array technologies, a map linking the two probe sets to the maize B73 reference genome has been generated to allow comparison. Putative Arabidopsis homologues of maize genes were used to query the Biological General Repository for Interaction Datasets (BioGRID) network, which yielded the potential involvement of three transcription factors (TFs) (GLK5, MADS64 and bZIP108) and a Calcium-dependent protein kinase. An Artificial Neural Network was used to identify influential genes and retrieved bZIP108 and WRKY36 as significant TFs in both microarray studies, along with genes for Asparagine Synthetase, a dual-specific protein kinase and a protein phosphatase. The output from one study also suggested roles for microRNA (miRNA) 399b and Nin-like Protein 15 (NLP15). Co-expression-network analysis of TFs with closely related profiles to known Nitrate-responsive genes identified GLK5, GLK8 and NLP15 as candidate regulators of genes repressed under low Nitrogen conditions, while bZIP108 might play a role in gene activation.

  13. Genome-Wide Analysis of Polymorphisms Associated with Cytokine Responses in Smallpox Vaccine Recipients

    PubMed Central

    Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, V. Shane; Haralambieva, Iana H.; Vierkant, Robert A.; Poland, Gregory A.

    2014-01-01

    The role that genetics plays in response to infection or disease is becoming increasingly clear as we learn more about immunogenetics and host-pathogen interactions. Here we report a genome-wide analysis of the effects of host genetic variation on cytokine responses to vaccinia virus stimulation in smallpox vaccine recipients. Our data show that vaccinia stimulation of immune individuals results in secretion of inflammatory and Th1 cytokines. We identified multiple SNPs significantly associated with variations in cytokine secretion. These SNPs are found in genes with known immune function, as well as in genes encoding for proteins involved in signal transduction, cytoskeleton, membrane channels and ion transport, as well as others with no previously identified connection to immune responses. The large number of significant SNP associations implies that cytokine secretion in response to vaccinia virus is a complex process controlled by multiple genes and gene families. Follow-up studies to replicate these findings and then pursue mechanistic studies will provide a greater understanding of how genetic variation influences vaccine responses. PMID:22610502

  14. Conditional clustering of temporal expression profiles

    PubMed Central

    Wang, Ling; Montano, Monty; Rarick, Matt; Sebastiani, Paola

    2008-01-01

    Background Many microarray experiments produce temporal profiles in different biological conditions but common cluster techniques are not able to analyze the data conditional on the biological conditions. Results This article presents a novel technique to cluster data from time course microarray experiments performed across several experimental conditions. Our algorithm uses polynomial models to describe the gene expression patterns over time, a full Bayesian approach with proper conjugate priors to make the algorithm invariant to linear transformations, and an iterative procedure to identify genes that have a common temporal expression profile across two or more experimental conditions, and genes that have a unique temporal profile in a specific condition. Conclusion We use simulated data to evaluate the effectiveness of this new algorithm in finding the correct number of clusters and in identifying genes with common and unique profiles. We also use the algorithm to characterize the response of human T cells to stimulations of antigen-receptor signaling gene expression temporal profiles measured in six different biological conditions and we identify common and unique genes. These studies suggest that the methodology proposed here is useful in identifying and distinguishing uniquely stimulated genes from commonly stimulated genes in response to variable stimuli. Software for using this clustering method is available from the project home page. PMID:18334028

  15. Genome-Wide Characterization of Transcriptional Patterns in High and Low Antibody Responders to Rubella Vaccination

    PubMed Central

    Haralambieva, Iana H.; Oberg, Ann L.; Ovsyannikova, Inna G.; Kennedy, Richard B.; Grill, Diane E.; Middha, Sumit; Bot, Brian M.; Wang, Vivian W.; Smith, David I.; Jacobson, Robert M.; Poland, Gregory A.

    2013-01-01

    Immune responses to current rubella vaccines demonstrate significant inter-individual variability. We performed mRNA-Seq profiling on PBMCs from high and low antibody responders to rubella vaccination to delineate transcriptional differences upon viral stimulation. Generalized linear models were used to assess the per gene fold change (FC) for stimulated versus unstimulated samples or the interaction between outcome and stimulation. Model results were evaluated by both FC and p-value. Pathway analysis and self-contained gene set tests were performed for assessment of gene group effects. Of 17,566 detected genes, we identified 1,080 highly significant differentially expressed genes upon viral stimulation (p<1.00E−15, FDR<1.00E−14), including various immune function and inflammation-related genes, genes involved in cell signaling, cell regulation and transcription, and genes with unknown function. Analysis by immune outcome and stimulation status identified 27 genes (p≤0.0006 and FDR≤0.30) that responded differently to viral stimulation in high vs. low antibody responders, including major histocompatibility complex (MHC) class I genes (HLA-A, HLA-B and B2M with p = 0.0001, p = 0.0005 and p = 0.0002, respectively), and two genes related to innate immunity and inflammation (EMR3 and MEFV with p = 1.46E−08 and p = 0.0004, respectively). Pathway and gene set analysis also revealed transcriptional differences in antigen presentation and innate/inflammatory gene sets and pathways between high and low responders. Using mRNA-Seq genome-wide transcriptional profiling, we identified antigen presentation and innate/inflammatory genes that may assist in explaining rubella vaccine-induced immune response variations. Such information may provide new scientific insights into vaccine-induced immunity useful in rational vaccine development and immune response monitoring. PMID:23658707

  16. Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins.

    PubMed

    Shaw, Joseph R; Colbourne, John K; Davey, Jennifer C; Glaholt, Stephen P; Hampton, Thomas H; Chen, Celia Y; Folt, Carol L; Hamilton, Joshua W

    2007-12-21

    Genomic research tools such as microarrays are proving to be important resources to study the complex regulation of genes that respond to environmental perturbations. A first generation cDNA microarray was developed for the environmental indicator species Daphnia pulex, to identify genes whose regulation is modulated following exposure to the metal stressor cadmium. Our experiments revealed interesting changes in gene transcription that suggest their biological roles and their potentially toxicological features in responding to this important environmental contaminant. Our microarray identified genes reported in the literature to be regulated in response to cadmium exposure, suggested functional attributes for genes that share no sequence similarity to proteins in the public databases, and pointed to genes that are likely members of expanded gene families in the Daphnia genome. Genes identified on the microarray also were associated with cadmium induced phenotypes and population-level outcomes that we experimentally determined. A subset of genes regulated in response to cadmium exposure was independently validated using quantitative-realtime (Q-RT)-PCR. These microarray studies led to the discovery of three genes coding for the metal detoxication protein metallothionein (MT). The gene structures and predicted translated sequences of D. pulex MTs clearly place them in this gene family. Yet, they share little homology with previously characterized MTs. The genomic information obtained from this study represents an important first step in characterizing microarray patterns that may be diagnostic to specific environmental contaminants and give insights into their toxicological mechanisms, while also providing a practical tool for evolutionary, ecological, and toxicological functional gene discovery studies. Advances in Daphnia genomics will enable the further development of this species as a model organism for the environmental sciences.

  17. Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins

    PubMed Central

    Shaw, Joseph R; Colbourne, John K; Davey, Jennifer C; Glaholt, Stephen P; Hampton, Thomas H; Chen, Celia Y; Folt, Carol L; Hamilton, Joshua W

    2007-01-01

    Background Genomic research tools such as microarrays are proving to be important resources to study the complex regulation of genes that respond to environmental perturbations. A first generation cDNA microarray was developed for the environmental indicator species Daphnia pulex, to identify genes whose regulation is modulated following exposure to the metal stressor cadmium. Our experiments revealed interesting changes in gene transcription that suggest their biological roles and their potentially toxicological features in responding to this important environmental contaminant. Results Our microarray identified genes reported in the literature to be regulated in response to cadmium exposure, suggested functional attributes for genes that share no sequence similarity to proteins in the public databases, and pointed to genes that are likely members of expanded gene families in the Daphnia genome. Genes identified on the microarray also were associated with cadmium induced phenotypes and population-level outcomes that we experimentally determined. A subset of genes regulated in response to cadmium exposure was independently validated using quantitative-realtime (Q-RT)-PCR. These microarray studies led to the discovery of three genes coding for the metal detoxication protein metallothionein (MT). The gene structures and predicted translated sequences of D. pulex MTs clearly place them in this gene family. Yet, they share little homology with previously characterized MTs. Conclusion The genomic information obtained from this study represents an important first step in characterizing microarray patterns that may be diagnostic to specific environmental contaminants and give insights into their toxicological mechanisms, while also providing a practical tool for evolutionary, ecological, and toxicological functional gene discovery studies. Advances in Daphnia genomics will enable the further development of this species as a model organism for the environmental sciences. PMID:18154678

  18. Transcriptional profiling of the host cell response to feline immunodeficiency virus infection.

    PubMed

    Ertl, Reinhard; Klein, Dieter

    2014-03-19

    Feline immunodeficiency virus (FIV) is a widespread pathogen of the domestic cat and an important animal model for human immunodeficiency virus (HIV) research. In contrast to HIV, only limited information is available on the transcriptional host cell response to FIV infections. This study aims to identify FIV-induced gene expression changes in feline T-cells during the early phase of the infection. Illumina RNA-sequencing (RNA-seq) was used identify differentially expressed genes (DEGs) at 24 h after FIV infection. After removal of low-quality reads, the remaining sequencing data were mapped against the cat genome and the numbers of mapping reads were counted for each gene. Regulated genes were identified through the comparison of FIV and mock-infected data sets. After statistical analysis and the removal of genes with insufficient coverage, we detected a total of 69 significantly DEGs (44 up- and 25 down-regulated genes) upon FIV infection. The results obtained by RNA-seq were validated by reverse transcription qPCR analysis for 10 genes. Out of the most distinct DEGs identified in this study, several genes are already known to interact with HIV in humans, indicating comparable effects of both viruses on the host cell gene expression and furthermore, highlighting the importance of FIV as a model system for HIV. In addition, a set of new genes not previously linked to virus infections could be identified. The provided list of virus-induced genes may represent useful information for future studies focusing on the molecular mechanisms of virus-host interactions in FIV pathogenesis.

  19. Discriminating between adaptive and carcinogenic liver hypertrophy in rat studies using logistic ridge regression analysis of toxicogenomic data: The mode of action and predictive models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Shujie; Kawamoto, Taisuke; Morita, Osamu

    Chemical exposure often results in liver hypertrophy in animal tests, characterized by increased liver weight, hepatocellular hypertrophy, and/or cell proliferation. While most of these changes are considered adaptive responses, there is concern that they may be associated with carcinogenesis. In this study, we have employed a toxicogenomic approach using a logistic ridge regression model to identify genes responsible for liver hypertrophy and hypertrophic hepatocarcinogenesis and to develop a predictive model for assessing hypertrophy-inducing compounds. Logistic regression models have previously been used in the quantification of epidemiological risk factors. DNA microarray data from the Toxicogenomics Project-Genomics Assisted Toxicity Evaluation System weremore » used to identify hypertrophy-related genes that are expressed differently in hypertrophy induced by carcinogens and non-carcinogens. Data were collected for 134 chemicals (72 non-hypertrophy-inducing chemicals, 27 hypertrophy-inducing non-carcinogenic chemicals, and 15 hypertrophy-inducing carcinogenic compounds). After applying logistic ridge regression analysis, 35 genes for liver hypertrophy (e.g., Acot1 and Abcc3) and 13 genes for hypertrophic hepatocarcinogenesis (e.g., Asns and Gpx2) were selected. The predictive models built using these genes were 94.8% and 82.7% accurate, respectively. Pathway analysis of the genes indicates that, aside from a xenobiotic metabolism-related pathway as an adaptive response for liver hypertrophy, amino acid biosynthesis and oxidative responses appear to be involved in hypertrophic hepatocarcinogenesis. Early detection and toxicogenomic characterization of liver hypertrophy using our models may be useful for predicting carcinogenesis. In addition, the identified genes provide novel insight into discrimination between adverse hypertrophy associated with carcinogenesis and adaptive hypertrophy in risk assessment. - Highlights: • Hypertrophy (H) and hypertrophic carcinogenesis (C) were studied by toxicogenomics. • Important genes for H and C were selected by logistic ridge regression analysis. • Amino acid biosynthesis and oxidative responses may be involved in C. • Predictive models for H and C provided 94.8% and 82.7% accuracy, respectively. • The identified genes could be useful for assessment of liver hypertrophy.« less

  20. Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa

    PubMed Central

    Dong, Xiangshu; Yi, Hankuil; Lee, Jeongyeo; Nou, Ill-Sup; Han, Ching-Tack; Hur, Yoonkang

    2015-01-01

    Genome-wide dissection of the heat stress response (HSR) is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5– 4 h at 45°C (high temperature, HT): 5.2% (2,142 genes) in Chiifu and 3.7% (1,535 genes) in Kenshin. The most enriched GO (Gene Ontology) items included ‘response to heat’, ‘response to reactive oxygen species (ROS)’, ‘response to temperature stimulus’, ‘response to abiotic stimulus’, and ‘MAPKKK cascade’. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps) and heat shock factor (Hsf)-like proteins such as HsfB2A (Bra029292), whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853), protein kinases, and phosphatases. Among heat stress (HS) marker genes in Arabidopsis, only exportin 1A (XPO1A) (Bra008580, Bra006382) can be applied to B. rapa for basal thermotolerance (BT) and short-term acquired thermotolerance (SAT) gene. CYP707A3 (Bra025083, Bra021965), which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF) genes, including DREB2A (Bra005852), were involved in HS tolerance in both lines, Bra024224 (MYB41) and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1]) were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a springboard for developing molecular markers of HS and for engineering HS tolerant B. rapa. PMID:26102990

  1. Predicting multi-level drug response with gene expression profile in multiple myeloma using hierarchical ordinal regression.

    PubMed

    Zhang, Xinyan; Li, Bingzong; Han, Huiying; Song, Sha; Xu, Hongxia; Hong, Yating; Yi, Nengjun; Zhuang, Wenzhuo

    2018-05-10

    Multiple myeloma (MM), like other cancers, is caused by the accumulation of genetic abnormalities. Heterogeneity exists in the patients' response to treatments, for example, bortezomib. This urges efforts to identify biomarkers from numerous molecular features and build predictive models for identifying patients that can benefit from a certain treatment scheme. However, previous studies treated the multi-level ordinal drug response as a binary response where only responsive and non-responsive groups are considered. It is desirable to directly analyze the multi-level drug response, rather than combining the response to two groups. In this study, we present a novel method to identify significantly associated biomarkers and then develop ordinal genomic classifier using the hierarchical ordinal logistic model. The proposed hierarchical ordinal logistic model employs the heavy-tailed Cauchy prior on the coefficients and is fitted by an efficient quasi-Newton algorithm. We apply our hierarchical ordinal regression approach to analyze two publicly available datasets for MM with five-level drug response and numerous gene expression measures. Our results show that our method is able to identify genes associated with the multi-level drug response and to generate powerful predictive models for predicting the multi-level response. The proposed method allows us to jointly fit numerous correlated predictors and thus build efficient models for predicting the multi-level drug response. The predictive model for the multi-level drug response can be more informative than the previous approaches. Thus, the proposed approach provides a powerful tool for predicting multi-level drug response and has important impact on cancer studies.

  2. Structural and functional annotation of the porcine immunome

    PubMed Central

    2013-01-01

    Background The domestic pig is known as an excellent model for human immunology and the two species share many pathogens. Susceptibility to infectious disease is one of the major constraints on swine performance, yet the structure and function of genes comprising the pig immunome are not well-characterized. The completion of the pig genome provides the opportunity to annotate the pig immunome, and compare and contrast pig and human immune systems. Results The Immune Response Annotation Group (IRAG) used computational curation and manual annotation of the swine genome assembly 10.2 (Sscrofa10.2) to refine the currently available automated annotation of 1,369 immunity-related genes through sequence-based comparison to genes in other species. Within these genes, we annotated 3,472 transcripts. Annotation provided evidence for gene expansions in several immune response families, and identified artiodactyl-specific expansions in the cathelicidin and type 1 Interferon families. We found gene duplications for 18 genes, including 13 immune response genes and five non-immune response genes discovered in the annotation process. Manual annotation provided evidence for many new alternative splice variants and 8 gene duplications. Over 1,100 transcripts without porcine sequence evidence were detected using cross-species annotation. We used a functional approach to discover and accurately annotate porcine immune response genes. A co-expression clustering analysis of transcriptomic data from selected experimental infections or immune stimulations of blood, macrophages or lymph nodes identified a large cluster of genes that exhibited a correlated positive response upon infection across multiple pathogens or immune stimuli. Interestingly, this gene cluster (cluster 4) is enriched for known general human immune response genes, yet contains many un-annotated porcine genes. A phylogenetic analysis of the encoded proteins of cluster 4 genes showed that 15% exhibited an accelerated evolution as compared to 4.1% across the entire genome. Conclusions This extensive annotation dramatically extends the genome-based knowledge of the molecular genetics and structure of a major portion of the porcine immunome. Our complementary functional approach using co-expression during immune response has provided new putative immune response annotation for over 500 porcine genes. Our phylogenetic analysis of this core immunome cluster confirms rapid evolutionary change in this set of genes, and that, as in other species, such genes are important components of the pig’s adaptation to pathogen challenge over evolutionary time. These comprehensive and integrated analyses increase the value of the porcine genome sequence and provide important tools for global analyses and data-mining of the porcine immune response. PMID:23676093

  3. Osmolality/salinity-responsive enhancers (OSREs) control induction of osmoprotective genes in euryhaline fish

    PubMed Central

    Wang, Xiaodan; Kültz, Dietmar

    2017-01-01

    Fish respond to salinity stress by transcriptional induction of many genes, but the mechanism of their osmotic regulation is unknown. We developed a reporter assay using cells derived from the brain of the tilapia Oreochromis mossambicus (OmB cells) to identify osmolality/salinity-responsive enhancers (OSREs) in the genes of O. mossambicus. Genomic DNA comprising the regulatory regions of two strongly salinity-induced genes, inositol monophosphatase 1 (IMPA1.1) and myo-inositol phosphate synthase (MIPS), was isolated and analyzed with dual luciferase enhancer trap reporter assays. We identified five sequences (two in IMPA1.1 and three in MIPS) that share a common consensus element (DDKGGAAWWDWWYDNRB), which we named “OSRE1.” Additional OSREs that were less effective in conferring salinity-induced trans-activation and do not match the OSRE1 consensus also were identified in both MIPS and IMPA1.1. Although OSRE1 shares homology with the mammalian osmotic-response element/tonicity-responsive enhancer (ORE/TonE) enhancer, the latter is insufficient to confer osmotic induction in fish. Like other enhancers, OSRE1 trans-activates genes independent of orientation. We conclude that OSRE1 is a cis-regulatory element (CRE) that enhances the hyperosmotic induction of osmoregulated genes in fish. Our study also shows that tailored reporter assays developed for OmB cells facilitate the identification of CREs in fish genomes. Knowledge of the OSRE1 motif allows affinity-purification of the corresponding transcription factor and computational approaches for enhancer screening of fish genomes. Moreover, our study enables targeted inactivation of OSRE1 enhancers, a method superior to gene knockout for functional characterization because it confines impairment of gene function to a specific context (salinity stress) and eliminates pitfalls of constitutive gene knockouts (embryonic lethality, developmental compensation). PMID:28289196

  4. Phylogenetic analysis of IDD gene family and characterization of its expression in response to flower induction in Malus.

    PubMed

    Fan, Sheng; Zhang, Dong; Xing, Libo; Qi, Siyan; Du, Lisha; Wu, Haiqin; Shao, Hongxia; Li, Youmei; Ma, Juanjuan; Han, Mingyu

    2017-08-01

    Although INDETERMINATE DOMAIN (IDD) genes encoding specific plant transcription factors have important roles in plant growth and development, little is known about apple IDD (MdIDD) genes and their potential functions in the flower induction. In this study, we identified 20 putative IDD genes in apple and named them according to their chromosomal locations. All identified MdIDD genes shared a conserved IDD domain. A phylogenetic analysis separated MdIDDs and other plant IDD genes into four groups. Bioinformatic analysis of chemical characteristics, gene structure, and prediction of protein-protein interactions demonstrated the functional and structural diversity of MdIDD genes. To further uncover their potential functions, we performed analysis of tandem, synteny, and gene duplications, which indicated several paired homologs of IDD genes between apple and Arabidopsis. Additionally, genome duplications also promoted the expansion and evolution of the MdIDD genes. Quantitative real-time PCR revealed that all the MdIDD genes showed distinct expression levels in five different tissues (stems, leaves, buds, flowers, and fruits). Furthermore, the expression levels of candidate MdIDD genes were also investigated in response to various circumstances, including GA treatment (decreased the flowering rate), sugar treatment (increased the flowering rate), alternate-bearing conditions, and two varieties with different-flowering intensities. Parts of them were affected by exogenous treatments and showed different expression patterns. Additionally, changes in response to alternate-bearing and different-flowering varieties of apple trees indicated that they were also responsive to flower induction. Taken together, our comprehensive analysis provided valuable information for further analysis of IDD genes aiming at flower induction.

  5. Identification of potential transcriptomic markers in developing pediatric sepsis: a weighted gene co-expression network analysis and a case-control validation study.

    PubMed

    Li, Yiping; Li, Yanhong; Bai, Zhenjiang; Pan, Jian; Wang, Jian; Fang, Fang

    2017-12-13

    Sepsis represents a complex disease with the dysregulated inflammatory response and high mortality rate. The goal of this study was to identify potential transcriptomic markers in developing pediatric sepsis by a co-expression module analysis of the transcriptomic dataset. Using the R software and Bioconductor packages, we performed a weighted gene co-expression network analysis to identify co-expression modules significantly associated with pediatric sepsis. Functional interpretation (gene ontology and pathway analysis) and enrichment analysis with known transcription factors and microRNAs of the identified candidate modules were then performed. In modules significantly associated with sepsis, the intramodular analysis was further performed and "hub genes" were identified and validated by quantitative real-time PCR (qPCR) in this study. 15 co-expression modules in total were detected, and four modules ("midnight blue", "cyan", "brown", and "tan") were most significantly associated with pediatric sepsis and suggested as potential sepsis-associated modules. Gene ontology analysis and pathway analysis revealed that these four modules strongly associated with immune response. Three of the four sepsis-associated modules were also enriched with known transcription factors (false discovery rate-adjusted P < 0.05). Hub genes were identified in each of the four modules. Four of the identified hub genes (MYB proto-oncogene like 1, killer cell lectin like receptor G1, stomatin, and membrane spanning 4-domains A4A) were further validated to be differentially expressed between septic children and controls by qPCR. Four pediatric sepsis-associated co-expression modules were identified in this study. qPCR results suggest that hub genes in these modules are potential transcriptomic markers for pediatric sepsis diagnosis. These results provide novel insights into the pathogenesis of pediatric sepsis and promote the generation of diagnostic gene sets.

  6. IL-32 is a molecular marker of a host defense network in human tuberculosis.

    PubMed

    Montoya, Dennis; Inkeles, Megan S; Liu, Phillip T; Realegeno, Susan; Teles, Rosane M B; Vaidya, Poorva; Munoz, Marcos A; Schenk, Mirjam; Swindell, William R; Chun, Rene; Zavala, Kathryn; Hewison, Martin; Adams, John S; Horvath, Steve; Pellegrini, Matteo; Bloom, Barry R; Modlin, Robert L

    2014-08-20

    Tuberculosis is a leading cause of infectious disease-related death worldwide; however, only 10% of people infected with Mycobacterium tuberculosis develop disease. Factors that contribute to protection could prove to be promising targets for M. tuberculosis therapies. Analysis of peripheral blood gene expression profiles of active tuberculosis patients has identified correlates of risk for disease or pathogenesis. We sought to identify potential human candidate markers of host defense by studying gene expression profiles of macrophages, cells that, upon infection by M. tuberculosis, can mount an antimicrobial response. Weighted gene coexpression network analysis revealed an association between the cytokine interleukin-32 (IL-32) and the vitamin D antimicrobial pathway in a network of interferon-γ- and IL-15-induced "defense response" genes. IL-32 induced the vitamin D-dependent antimicrobial peptides cathelicidin and DEFB4 and to generate antimicrobial activity in vitro, dependent on the presence of adequate 25-hydroxyvitamin D. In addition, the IL-15-induced defense response macrophage gene network was integrated with ranked pairwise comparisons of gene expression from five different clinical data sets of latent compared with active tuberculosis or healthy controls and a coexpression network derived from gene expression in patients with tuberculosis undergoing chemotherapy. Together, these analyses identified eight common genes, including IL-32, as molecular markers of latent tuberculosis and the IL-15-induced gene network. As maintaining M. tuberculosis in a latent state and preventing transition to active disease may represent a form of host resistance, these results identify IL-32 as one functional marker and potential correlate of protection against active tuberculosis. Copyright © 2014, American Association for the Advancement of Science.

  7. Systems analysis of transcriptome data provides new hypotheses about Arabidopsis root response to nitrate treatments

    PubMed Central

    Canales, Javier; Moyano, Tomás C.; Villarroel, Eva; Gutiérrez, Rodrigo A.

    2014-01-01

    Nitrogen (N) is an essential macronutrient for plant growth and development. Plants adapt to changes in N availability partly by changes in global gene expression. We integrated publicly available root microarray data under contrasting nitrate conditions to identify new genes and functions important for adaptive nitrate responses in Arabidopsis thaliana roots. Overall, more than 2000 genes exhibited changes in expression in response to nitrate treatments in Arabidopsis thaliana root organs. Global regulation of gene expression by nitrate depends largely on the experimental context. However, despite significant differences from experiment to experiment in the identity of regulated genes, there is a robust nitrate response of specific biological functions. Integrative gene network analysis uncovered relationships between nitrate-responsive genes and 11 highly co-expressed gene clusters (modules). Four of these gene network modules have robust nitrate responsive functions such as transport, signaling, and metabolism. Network analysis hypothesized G2-like transcription factors are key regulatory factors controlling transport and signaling functions. Our meta-analysis highlights the role of biological processes not studied before in the context of the nitrate response such as root hair development and provides testable hypothesis to advance our understanding of nitrate responses in plants. PMID:24570678

  8. Impact of Cigarette Smoke on the Human and Mouse Lungs: A Gene-Expression Comparison Study

    PubMed Central

    Morissette, Mathieu C.; Lamontagne, Maxime; Bérubé, Jean-Christophe; Gaschler, Gordon; Williams, Andrew; Yauk, Carole; Couture, Christian; Laviolette, Michel; Hogg, James C.; Timens, Wim; Halappanavar, Sabina; Stampfli, Martin R.; Bossé, Yohan

    2014-01-01

    Cigarette smoke is well known for its adverse effects on human health, especially on the lungs. Basic research is essential to identify the mechanisms involved in the development of cigarette smoke-related diseases, but translation of new findings from pre-clinical models to the clinic remains difficult. In the present study, we aimed at comparing the gene expression signature between the lungs of human smokers and mice exposed to cigarette smoke to identify the similarities and differences. Using human and mouse whole-genome gene expression arrays, changes in gene expression, signaling pathways and biological functions were assessed. We found that genes significantly modulated by cigarette smoke in humans were enriched for genes modulated by cigarette smoke in mice, suggesting a similar response of both species. Sixteen smoking-induced genes were in common between humans and mice including six newly reported to be modulated by cigarette smoke. In addition, we identified a new conserved pulmonary response to cigarette smoke in the induction of phospholipid metabolism/degradation pathways. Finally, the majority of biological functions modulated by cigarette smoke in humans were also affected in mice. Altogether, the present study provides information on similarities and differences in lung gene expression response to cigarette smoke that exist between human and mouse. Our results foster the idea that animal models should be used to study the involvement of pathways rather than single genes in human diseases. PMID:24663285

  9. GENE EXPRESSION CHANGES IN MOUSE BLADDER TISSUE IN RESPONSE TO INORGANIC ARSENIC

    EPA Science Inventory

    Chronic human exposures to high arsenic concentrations are associated with lung, skin, and bladder cancer. Considerable controversy exists concerning arsenic mode of action and low dose extrapolation. This investigation was designed to identify dose-response changes in gene expre...

  10. Convergent genetic and expression data implicate immunity in Alzheimer's disease

    PubMed Central

    Jones, Lesley; Lambert, Jean-Charles; Wang, Li-San; Choi, Seung-Hoan; Harold, Denise; Vedernikov, Alexey; Escott-Price, Valentina; Stone, Timothy; Richards, Alexander; Bellenguez, Céline; Ibrahim-Verbaas, Carla A; Naj, Adam C; Sims, Rebecca; Gerrish, Amy; Jun, Gyungah; DeStefano, Anita L; Bis, Joshua C; Beecham, Gary W; Grenier-Boley, Benjamin; Russo, Giancarlo; Thornton-Wells, Tricia A; Jones, Nicola; Smith, Albert V; Chouraki, Vincent; Thomas, Charlene; Ikram, M Arfan; Zelenika, Diana; Vardarajan, Badri N; Kamatani, Yoichiro; Lin, Chiao-Feng; Schmidt, Helena; Kunkle, Brian; Dunstan, Melanie L; Ruiz, Agustin; Bihoreau, Marie-Thérèse; Reitz, Christiane; Pasquier, Florence; Hollingworth, Paul; Hanon, Olivier; Fitzpatrick, Annette L; Buxbaum, Joseph D; Campion, Dominique; Crane, Paul K; Becker, Tim; Gudnason, Vilmundur; Cruchaga, Carlos; Craig, David; Amin, Najaf; Berr, Claudine; Lopez, Oscar L; De Jager, Philip L; Deramecourt, Vincent; Johnston, Janet A; Evans, Denis; Lovestone, Simon; Letteneur, Luc; Kornhuber, Johanes; Tárraga, Lluís; Rubinsztein, David C; Eiriksdottir, Gudny; Sleegers, Kristel; Goate, Alison M; Fiévet, Nathalie; Huentelman, Matthew J; Gill, Michael; Emilsson, Valur; Brown, Kristelle; Kamboh, M Ilyas; Keller, Lina; Barberger-Gateau, Pascale; McGuinness, Bernadette; Larson, Eric B; Myers, Amanda J; Dufouil, Carole; Todd, Stephen; Wallon, David; Love, Seth; Kehoe, Pat; Rogaeva, Ekaterina; Gallacher, John; George-Hyslop, Peter St; Clarimon, Jordi; Lleὀ, Alberti; Bayer, Anthony; Tsuang, Debby W; Yu, Lei; Tsolaki, Magda; Bossù, Paola; Spalletta, Gianfranco; Proitsi, Petra; Collinge, John; Sorbi, Sandro; Garcia, Florentino Sanchez; Fox, Nick; Hardy, John; Naranjo, Maria Candida Deniz; Razquin, Cristina; Bosco, Paola; Clarke, Robert; Brayne, Carol; Galimberti, Daniela; Mancuso, Michelangelo; Moebus, Susanne; Mecocci, Patrizia; del Zompo, Maria; Maier, Wolfgang; Hampel, Harald; Pilotto, Alberto; Bullido, Maria; Panza, Francesco; Caffarra, Paolo; Nacmias, Benedetta; Gilbert, John R; Mayhaus, Manuel; Jessen, Frank; Dichgans, Martin; Lannfelt, Lars; Hakonarson, Hakon; Pichler, Sabrina; Carrasquillo, Minerva M; Ingelsson, Martin; Beekly, Duane; Alavarez, Victoria; Zou, Fanggeng; Valladares, Otto; Younkin, Steven G; Coto, Eliecer; Hamilton-Nelson, Kara L; Mateo, Ignacio; Owen, Michael J; Faber, Kelley M; Jonsson, Palmi V; Combarros, Onofre; O'Donovan, Michael C; Cantwell, Laura B; Soininen, Hilkka; Blacker, Deborah; Mead, Simon; Mosley, Thomas H; Bennett, David A; Harris, Tamara B; Fratiglioni, Laura; Holmes, Clive; de Bruijn, Renee FAG; Passmore, Peter; Montine, Thomas J; Bettens, Karolien; Rotter, Jerome I; Brice, Alexis; Morgan, Kevin; Foroud, Tatiana M; Kukull, Walter A; Hannequin, Didier; Powell, John F; Nalls, Michael A; Ritchie, Karen; Lunetta, Kathryn L; Kauwe, John SK; Boerwinkle, Eric; Riemenschneider, Matthias; Boada, Mercè; Hiltunen, Mikko; Martin, Eden R; Pastor, Pau; Schmidt, Reinhold; Rujescu, Dan; Dartigues, Jean-François; Mayeux, Richard; Tzourio, Christophe; Hofman, Albert; Nöthen, Markus M; Graff, Caroline; Psaty, Bruce M; Haines, Jonathan L; Lathrop, Mark; Pericak-Vance, Margaret A; Launer, Lenore J; Farrer, Lindsay A; van Duijn, Cornelia M; Van Broekhoven, Christine; Ramirez, Alfredo; Schellenberg, Gerard D; Seshadri, Sudha; Amouyel, Philippe; Holmans, Peter A

    2015-01-01

    Background Late–onset Alzheimer's disease (AD) is heritable with 20 genes showing genome wide association in the International Genomics of Alzheimer's Project (IGAP). To identify the biology underlying the disease we extended these genetic data in a pathway analysis. Methods The ALIGATOR and GSEA algorithms were used in the IGAP data to identify associated functional pathways and correlated gene expression networks in human brain. Results ALIGATOR identified an excess of curated biological pathways showing enrichment of association. Enriched areas of biology included the immune response (p = 3.27×10-12 after multiple testing correction for pathways), regulation of endocytosis (p = 1.31×10-11), cholesterol transport (p = 2.96 × 10-9) and proteasome-ubiquitin activity (p = 1.34×10-6). Correlated gene expression analysis identified four significant network modules, all related to the immune response (corrected p 0.002 – 0.05). Conclusions The immune response, regulation of endocytosis, cholesterol transport and protein ubiquitination represent prime targets for AD therapeutics. PMID:25533204

  11. Convergent genetic and expression data implicate immunity in Alzheimer's disease.

    PubMed

    2015-06-01

    Late-onset Alzheimer's disease (AD) is heritable with 20 genes showing genome-wide association in the International Genomics of Alzheimer's Project (IGAP). To identify the biology underlying the disease, we extended these genetic data in a pathway analysis. The ALIGATOR and GSEA algorithms were used in the IGAP data to identify associated functional pathways and correlated gene expression networks in human brain. ALIGATOR identified an excess of curated biological pathways showing enrichment of association. Enriched areas of biology included the immune response (P = 3.27 × 10(-12) after multiple testing correction for pathways), regulation of endocytosis (P = 1.31 × 10(-11)), cholesterol transport (P = 2.96 × 10(-9)), and proteasome-ubiquitin activity (P = 1.34 × 10(-6)). Correlated gene expression analysis identified four significant network modules, all related to the immune response (corrected P = .002-.05). The immune response, regulation of endocytosis, cholesterol transport, and protein ubiquitination represent prime targets for AD therapeutics. Copyright © 2015. Published by Elsevier Inc.

  12. Predicting response to primary chemotherapy: gene expression profiling of paraffin-embedded core biopsy tissue.

    PubMed

    Mina, Lida; Soule, Sharon E; Badve, Sunil; Baehner, Fredrick L; Baker, Joffre; Cronin, Maureen; Watson, Drew; Liu, Mei-Lan; Sledge, George W; Shak, Steve; Miller, Kathy D

    2007-06-01

    Primary chemotherapy provides an ideal opportunity to correlate gene expression with response to treatment. We used paraffin-embedded core biopsies from a completed phase II trial to identify genes that correlate with response to primary chemotherapy. Patients with newly diagnosed stage II or III breast cancer were treated with sequential doxorubicin 75 mg/M2 q2 wks x 3 and docetaxel 40 mg/M2 weekly x 6; treatment order was randomly assigned. Pretreatment core biopsy samples were interrogated for genes that might correlate with pathologic complete response (pCR). In addition to the individual genes, the correlation of the Oncotype DX Recurrence Score with pCR was examined. Of 70 patients enrolled in the parent trial, core biopsies samples with sufficient RNA for gene analyses were available from 45 patients; 9 (20%) had inflammatory breast cancer (IBC). Six (14%) patients achieved a pCR. Twenty-two of the 274 candidate genes assessed correlated with pCR (p < 0.05). Genes correlating with pCR could be grouped into three large clusters: angiogenesis-related genes, proliferation related genes, and invasion-related genes. Expression of estrogen receptor (ER)-related genes and Recurrence Score did not correlate with pCR. In an exploratory analysis we compared gene expression in IBC to non-inflammatory breast cancer; twenty-four (9%) of the genes were differentially expressed (p < 0.05), 5 were upregulated and 19 were downregulated in IBC. Gene expression analysis on core biopsy samples is feasible and identifies candidate genes that correlate with pCR to primary chemotherapy. Gene expression in IBC differs significantly from noninflammatory breast cancer.

  13. Global Expression Profiling in Atopic Eczema Reveals Reciprocal Expression of Inflammatory and Lipid Genes

    PubMed Central

    Sääf, Annika M.; Tengvall-Linder, Maria; Chang, Howard Y.; Adler, Adam S.; Wahlgren, Carl-Fredrik; Scheynius, Annika; Nordenskjöld, Magnus; Bradley, Maria

    2008-01-01

    Background Atopic eczema (AE) is a common chronic inflammatory skin disorder. In order to dissect the genetic background several linkage and genetic association studies have been performed. Yet very little is known about specific genes involved in this complex skin disease, and the underlying molecular mechanisms are not fully understood. Methodology/Findings We used human DNA microarrays to identify a molecular picture of the programmed responses of the human genome to AE. The transcriptional program was analyzed in skin biopsy samples from lesional and patch-tested skin from AE patients sensitized to Malassezia sympodialis (M. sympodialis), and corresponding biopsies from healthy individuals. The most notable feature of the global gene-expression pattern observed in AE skin was a reciprocal expression of induced inflammatory genes and repressed lipid metabolism genes. The overall transcriptional response in M. sympodialis patch-tested AE skin was similar to the gene-expression signature identified in lesional AE skin. In the constellation of genes differentially expressed in AE skin compared to healthy control skin, we have identified several potential susceptibility genes that may play a critical role in the pathological condition of AE. Many of these genes, including genes with a role in immune responses, lipid homeostasis, and epidermal differentiation, are localized on chromosomal regions previously linked to AE. Conclusions/Significance Through genome-wide expression profiling, we were able to discover a distinct reciprocal expression pattern of induced inflammatory genes and repressed lipid metabolism genes in skin from AE patients. We found a significant enrichment of differentially expressed genes in AE with cytobands associated to the disease, and furthermore new chromosomal regions were found that could potentially guide future region-specific linkage mapping in AE. The full data set is available at http://microarray-pubs.stanford.edu/eczema. PMID:19107207

  14. The NAC transcription factor family in maritime pine (Pinus Pinaster): molecular regulation of two genes involved in stress responses.

    PubMed

    Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción

    2015-10-24

    NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.

  15. A Peripheral Blood Signature of Vasodilator-Responsive Pulmonary Arterial Hypertension

    PubMed Central

    Hemnes, Anna R.; Trammell, Aaron W.; Archer, Stephen L.; Rich, Stuart; Yu, Chang; Nian, Hui; Penner, Niki; Funke, Mitchell; Wheeler, Lisa; Robbins, Ivan M.; Austin, Eric D.; Newman, John H.; West, James

    2014-01-01

    Background Heterogeneity in response to treatment of pulmonary arterial hypertension (PAH) is a major challenge to improving outcome in this disease. Although vasodilator responsive PAH (VR-PAH) accounts for a minority of cases, VR-PAH has a pronounced response to calcium channel blockers and better survival than non-responsive PAH (VN-PAH). We hypothesized that VR-PAH has a different molecular etiology from VN-PAH that can be detected in the peripheral blood. Methods and Results Microarrays of cultured lymphocytes from VR-PAH and VN-PAH patients followed at Vanderbilt University were performed with quantitative PCR performed on peripheral blood for the 25 most different genes. We developed a decision tree to identify VR-PAH patients based on the results with validation in a second VR-PAH cohort from the University of Chicago. We found broad differences in gene expression patterns on microarray analysis including cell-cell adhesion factors, cytoskeletal and rho/GTPase genes. 13/25 genes tested in whole blood were significantly different: EPDR1, DSG2, SCD5, P2RY5, MGAT5, RHOQ, UCHL1, ZNF652, RALGPS2, TPD52, MKNL1, RAPGEF2 and PIAS1. Seven decision trees were built using expression levels of two genes as the primary genes: DSG2, a desmosomal cadherin involved in Wnt/β-catenin signaling, and RHOQ, which encodes a cytoskeletal protein involved in insulin-mediated signaling. These trees correctly identified 5/5 VR-PAH in the validation cohort. Conclusions VR-PAH and VN-PAH can be differentiated using RNA expression patterns in peripheral blood. These differences may reflect different molecular etiologies of the two PAH phenotypes. This biomarker methodology may identify PAH patients that have a favorable treatment response. PMID:25361553

  16. Genes essential for phototrophic growth by a purple alphaproteobacterium: Genes for phototrophic growth

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Jianming; Yin, Liang; Lessner, Faith H.

    Anoxygenic purple phototrophic bacteria have served as important models for studies of photophosphorylation. The pigment-protein complexes responsible for converting light energy to ATP are relatively simple and these bacteria can grow heterotrophically under aerobic conditions, thus allowing for the study of mutants defective in photophosphorylation. In the past, genes responsible for anoxygenic phototrophic growth have been identified in a number of different bacterial species. Here we systematically studied the genetic basis for this metabolism by using Tn-seq to identify genes essential for the anaerobic growth of the purple bacterium Rhodopseudomonas palustris on acetate in light. We identified 171 genes requiredmore » for growth in this condition, 35 of which are annotated as photosynthesis genes. Among these are a few new genes not previously shown to be essential for phototrophic growth. We verified the essentiality of many of the genes we identified by analyzing the phenotypes of mutants we generated by Tn mutagenesis that had altered pigmentation. We used directed mutagenesis to verify that the R. palustris NADH:quinone oxidoreductase complex IE is essential for phototrophic growth. As a complement to the genetic data, we carried out proteomics experiments in which we found that 429 proteins were present in significantly higher amounts in cells grown anaerobically in light compared to aerobically. Among these were proteins encoded by subset of the phototrophic growth-essential genes.« less

  17. Identification of AUXIN RESPONSE FACTOR gene family from Prunus sibirica and its expression analysis during mesocarp and kernel development.

    PubMed

    Niu, Jun; Bi, Quanxin; Deng, Shuya; Chen, Huiping; Yu, Haiyan; Wang, Libing; Lin, Shanzhi

    2018-01-24

    Auxin response factors (ARFs) in auxin signaling pathway are an important component that can regulate the transcription of auxin-responsive genes involved in almost all aspects of plant growth and development. To our knowledge, the comprehensive and systematic characterization of ARF genes has never been reported in Prunus sibirica, a novel woody biodiesel feedstock in China. In this study, we identified 14 PsARF genes with a perfect open reading frame (ORF) in P. sibirica by using its previous transcriptomic data. Conserved motif analysis showed that all identified PsARF proteins had typical DNA-binding and ARF domain, but 5 members (PsARF3, 8 10, 16 and 17) lacked the dimerization domain. Phylogenetic analysis of the ARF proteins generated from various plant species indicated that ARFs could be categorized into 4 major groups (Class I, II, III and IV), in which all identified ARFs from P. sibirica showed a closest relationship with those from P. mume. Comparison of the expression profiles of 14 PsARF genes in different developmental stages of Siberian apricot mesocarp (SAM) and kernel (SAK) reflected distinct temporal or spatial expression patterns for PsARF genes. Additionally, based on the expressed data from fruit and seed development of multiple plant species, we identified 1514 ARF-correlated genes using weighted gene co-expression network analysis (WGCNA). And the major portion of ARF-correlated gene was characterized to be involved in protein, nucleic acid and carbohydrate metabolic, transport and regulatory processes. In summary, we systematically and comprehensively analyzed the structure, expression pattern and co-expression network of ARF gene family in P. sibirica. All our findings provide theoretical foundation for the PsARF gene family and will pave the way for elucidating the precise role of PsARF genes in SAM and SAK development.

  18. Genome-wide organization and expression profiling of the NAC transcription factor family in potato (Solanum tuberosum L.).

    PubMed

    Singh, Anil Kumar; Sharma, Vishal; Pal, Awadhesh Kumar; Acharya, Vishal; Ahuja, Paramvir Singh

    2013-08-01

    NAC [no apical meristem (NAM), Arabidopsis thaliana transcription activation factor [ATAF1/2] and cup-shaped cotyledon (CUC2)] proteins belong to one of the largest plant-specific transcription factor (TF) families and play important roles in plant development processes, response to biotic and abiotic cues and hormone signalling. Our genome-wide analysis identified 110 StNAC genes in potato encoding for 136 proteins, including 14 membrane-bound TFs. The physical map positions of StNAC genes on 12 potato chromosomes were non-random, and 40 genes were found to be distributed in 16 clusters. The StNAC proteins were phylogenetically clustered into 12 subgroups. Phylogenetic analysis of StNACs along with their Arabidopsis and rice counterparts divided these proteins into 18 subgroups. Our comparative analysis has also identified 36 putative TNAC proteins, which appear to be restricted to Solanaceae family. In silico expression analysis, using Illumina RNA-seq transcriptome data, revealed tissue-specific, biotic, abiotic stress and hormone-responsive expression profile of StNAC genes. Several StNAC genes, including StNAC072 and StNAC101that are orthologs of known stress-responsive Arabidopsis RESPONSIVE TO DEHYDRATION 26 (RD26) were identified as highly abiotic stress responsive. Quantitative real-time polymerase chain reaction analysis largely corroborated the expression profile of StNAC genes as revealed by the RNA-seq data. Taken together, this analysis indicates towards putative functions of several StNAC TFs, which will provide blue-print for their functional characterization and utilization in potato improvement.

  19. Comparative transcriptome analysis of pepper (Capsicum annuum) revealed common regulons in multiple stress conditions and hormone treatments.

    PubMed

    Lee, Sanghyeob; Choi, Doil

    2013-09-01

    Global transcriptome analysis revealed common regulons for biotic/abiotic stresses, and some of these regulons encoding signaling components in both stresses were newly identified in this study. In this study, we aimed to identify plant responses to multiple stress conditions and discover the common regulons activated under a variety of stress conditions. Global transcriptome analysis revealed that salicylic acid (SA) may affect the activation of abiotic stress-responsive genes in pepper. Our data indicate that methyl jasmonate (MeJA) and ethylene (ET)-responsive genes were primarily activated by biotic stress, while abscisic acid (ABA)-responsive genes were activated under both types of stresses. We also identified differentially expressed gene (DEG) responses to specific stress conditions. Biotic stress induces more DEGs than those induced by abiotic and hormone applications. The clustering analysis using DEGs indicates that there are common regulons for biotic or abiotic stress conditions. Although SA and MeJA have an antagonistic effect on gene expression levels, SA and MeJA show a largely common regulation as compared to the regulation at the DEG expression level induced by other hormones. We also monitored the expression profiles of DEG encoding signaling components. Twenty-two percent of these were commonly expressed in both stress conditions. The importance of this study is that several genes commonly regulated by both stress conditions may have future applications for creating broadly stress-tolerant pepper plants. This study revealed that there are complex regulons in pepper plant to both biotic and abiotic stress conditions.

  20. Expression of drought tolerance genes in tropical upland rice cultivars (Oryza sativa).

    PubMed

    Silveira, R D D; Abreu, F R M; Mamidi, S; McClean, P E; Vianello, R P; Lanna, A C; Carneiro, N P; Brondani, C

    2015-07-27

    Gene expression related to drought response in the leaf tissues of two Brazilian upland cultivars, the drought-tolerant Douradão and the drought-sensitive Primavera, was analyzed. RNA-seq identified 27,618 transcripts in the Douradão cultivar, with 24,090 (87.2%) homologous to the rice database, and 27,221 transcripts in the Primavera cultivar, with 23,663 (86.9%) homologous to the rice database. Gene-expression analysis between control and water-deficient treatments revealed 493 and 1154 differentially expressed genes in Douradão and Primavera cultivars, respectively. Genes exclusively expressed under drought were identified for Douradão, including two genes of particular interest coding for the protein peroxidase precursor, which is involved in three distinct metabolic pathways. Comparisons between the two drought-exposed cultivars revealed 2314 genes were differentially expressed (978 upregulated, 1336 downregulated in Douradão). Six genes distributed across 4 different transcription factor families (bHLH, MYB, NAC, and WRKY) were identified, all of which were upregulated in Douradão compared to Primavera during drought. Most of the genes identified in Douradão activate metabolic pathways responsible for production of secondary metabolites and genes coding for enzymatically active signaling receptors. Quantitative PCR validation showed that most gene expression was in agreement with computational prediction of these transcripts. The transcripts identified here will define molecular markers for identification of Cis-acting elements to search for allelic variants of these genes through analysis of polymorphic SNPs in GenBank accessions of upland rice, aiming to develop cultivars with the best combination of these alleles, resulting in materials with high yield potential in the event of drought during the reproductive phase.

  1. Comparative Transcriptional Profiling of the Axolotl Limb Identifies a Tripartite Regeneration-Specific Gene Program

    PubMed Central

    Knapp, Dunja; Schulz, Herbert; Rascon, Cynthia Alexander; Volkmer, Michael; Scholz, Juliane; Nacu, Eugen; Le, Mu; Novozhilov, Sergey; Tazaki, Akira; Protze, Stephanie; Jacob, Tina; Hubner, Norbert; Habermann, Bianca; Tanaka, Elly M.

    2013-01-01

    Understanding how the limb blastema is established after the initial wound healing response is an important aspect of regeneration research. Here we performed parallel expression profile time courses of healing lateral wounds versus amputated limbs in axolotl. This comparison between wound healing and regeneration allowed us to identify amputation-specific genes. By clustering the expression profiles of these samples, we could detect three distinguishable phases of gene expression – early wound healing followed by a transition-phase leading to establishment of the limb development program, which correspond to the three phases of limb regeneration that had been defined by morphological criteria. By focusing on the transition-phase, we identified 93 strictly amputation-associated genes many of which are implicated in oxidative-stress response, chromatin modification, epithelial development or limb development. We further classified the genes based on whether they were or were not significantly expressed in the developing limb bud. The specific localization of 53 selected candidates within the blastema was investigated by in situ hybridization. In summary, we identified a set of genes that are expressed specifically during regeneration and are therefore, likely candidates for the regulation of blastema formation. PMID:23658691

  2. Biomarker discovery and transcriptomic responses in Daphnia magna exposed to munitions constituents.

    PubMed

    Garcia-Reyero, Natalia; Poynton, Helen C; Kennedy, Alan J; Guan, Xin; Escalon, B Lynn; Chang, Bonnie; Varshavsky, Julia; Loguinov, Alex V; Vulpe, Chris D; Perkins, Edward J

    2009-06-01

    Ecotoxicogenomic approaches are emerging as alternative methods in environmental monitoring because they allow insight into pollutant modes of action and help assess the causal agents and potential toxicity beyond the traditional end points of death, growth, and reproduction. Gene expression analysis has shown particular promise for identifying gene expression biomarkers of chemical exposure that can be further used to monitor specific chemical exposures in the environment. We focused on the development of gene expression markers to detect and discriminate between chemical exposures. Using a custom cDNA microarray for Daphnia magna, we identified distinct expression fingerprints in response to exposure at sublethal concentrations of Cu, Zn, Pb, and munitions constituents. Using the results obtained from microarray analysis, we chose a suite of potential biomarkers for each of the specific exposures. The selected potential biomarkers were tested in independent chemical exposures for specificity using quantitative reverse transcription polymerase chain reaction. Six genes were confirmed as differentially regulated bythe selected chemical exposures. Furthermore, each exposure was identified by response of a unique combination (suite) of individual gene expression biomarkers. These results demonstrate the potential for discovery and validation of novel biomarkers of chemical exposures using gene expression analysis, which could have broad applicability in environmental monitoring.

  3. Transcriptome Analysis of the Role of GlnD/GlnBK in Nitrogen Stress Adaptation by Sinorhizobium meliloti Rm1021

    PubMed Central

    Yurgel, Svetlana N.; Rice, Jennifer; Kahn, Michael L.

    2013-01-01

    Transcriptional changes in the nitrogen stress response (NSR) of wild type S. meliloti Rm1021, and isogenic strains missing both PII proteins, GlnB and GlnK, or carrying a ΔglnD-sm2 mutation were analyzed using whole-genome microarrays. This approach allowed us to identify a number of new genes involved in the NSR and showed that the response of these bacteria to nitrogen stress overlaps with other stress responses, including induction of the fixK2 transcriptional activator and genes that are part of the phosphate stress response. Our data also show that GlnD and GlnBK proteins may regulate many genes that are not part of the NSR. Analysis of transcriptome profiles of the Rm1021 ΔglnD-sm2 strain allowed us to identify several genes that appear to be regulated by GlnD without the participation of the PII proteins. PMID:23516427

  4. Dual-seq transcriptomics reveals the battle for iron during Pseudomonas aeruginosa acute murine pneumonia

    PubMed Central

    Damron, F. Heath; Oglesby-Sherrouse, Amanda G.; Wilks, Angela; Barbier, Mariette

    2016-01-01

    Determining bacterial gene expression during infection is fundamental to understand pathogenesis. In this study, we used dual RNA-seq to simultaneously measure P. aeruginosa and the murine host’s gene expression and response to respiratory infection. Bacterial genes encoding products involved in metabolism and virulence were differentially expressed during infection and the type III and VI secretion systems were highly expressed in vivo. Strikingly, heme acquisition, ferric-enterobactin transport, and pyoverdine biosynthesis genes were found to be significantly up-regulated during infection. In the mouse, we profiled the acute immune response to P. aeruginosa and identified the pro-inflammatory cytokines involved in acute response to the bacterium in the lung. Additionally, we also identified numerous host iron sequestration systems upregulated during infection. Overall, this work sheds light on how P. aeruginosa triggers a pro-inflammatory response and competes for iron with the host during infection, as iron is one of the central elements for which both pathogen and host fight during acute pneumonia. PMID:27982111

  5. Identification of Genes in Saccharomyces cerevisiae that Are Haploinsufficient for Overcoming Amino Acid Starvation

    PubMed Central

    Bae, Nancy S.; Seberg, Andrew P.; Carroll, Leslie P.; Swanson, Mark J.

    2017-01-01

    The yeast Saccharomyces cerevisiae responds to amino acid deprivation by activating a pathway conserved in eukaryotes to overcome the starvation stress. We have screened the entire yeast heterozygous deletion collection to identify strains haploinsufficient for growth in the presence of sulfometuron methyl, which causes starvation for isoleucine and valine. We have discovered that cells devoid of MET15 are sensitive to sulfometuron methyl, and loss of heterozygosity at the MET15 locus can complicate screening the heterozygous deletion collection. We identified 138 cases of loss of heterozygosity in this screen. After eliminating the issues of the MET15 loss of heterozygosity, strains isolated from the collection were retested on sulfometuron methyl. To determine the general effect of the mutations for a starvation response, SMM-sensitive strains were tested for the ability to grow in the presence of canavanine, which induces arginine starvation, and strains that were MET15 were also tested for growth in the presence of ethionine, which causes methionine starvation. Many of the genes identified in our study were not previously identified as starvation-responsive genes, including a number of essential genes that are not easily screened in a systematic way. The genes identified span a broad range of biological functions, including many involved in some level of gene expression. Several unnamed proteins have also been identified, giving a clue as to possible functions of the encoded proteins. PMID:28209762

  6. RNA interference-mediated silencing of genes involved in the immune responses of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Olethreutidae).

    PubMed

    Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin; Meng, Fanli

    2018-01-01

    RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella ), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods.

  7. RNA interference-mediated silencing of genes involved in the immune responses of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Olethreutidae)

    PubMed Central

    Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods. PMID:29910977

  8. Deciphering the metabolic response of M ycobacterium tuberculosis to nitrogen stress

    PubMed Central

    Williams, Kerstin J.; Jenkins, Victoria A.; Barton, Geraint R.; Bryant, William A.; Krishnan, Nitya

    2015-01-01

    Summary A key component to the success of M ycobacterium tuberculosis as a pathogen is the ability to sense and adapt metabolically to the diverse range of conditions encountered in vivo, such as oxygen tension, environmental pH and nutrient availability. Although nitrogen is an essential nutrient for every organism, little is known about the genes and pathways responsible for nitrogen assimilation in M . tuberculosis. In this study we have used transcriptomics and chromatin immunoprecipitation and high‐throughput sequencing to address this. In response to nitrogen starvation, a total of 185 genes were significantly differentially expressed (96 up‐regulated and 89 down regulated; 5% genome) highlighting several significant areas of metabolic change during nitrogen limitation such as nitrate/nitrite metabolism, aspartate metabolism and changes in cell wall biosynthesis. We identify GlnR as a regulator involved in the nitrogen response, controlling the expression of at least 33 genes in response to nitrogen limitation. We identify a consensus GlnR binding site and relate its location to known transcriptional start sites. We also show that the GlnR response regulator plays a very different role in M . tuberculosis to that in non‐pathogenic mycobacteria, controlling genes involved in nitric oxide detoxification and intracellular survival instead of genes involved in nitrogen scavenging. PMID:26077160

  9. Establishing glucose- and ABA-regulated transcription networks in Arabidopsis by microarray analysis and promoter classification using a Relevance Vector Machine.

    PubMed

    Li, Yunhai; Lee, Kee Khoon; Walsh, Sean; Smith, Caroline; Hadingham, Sophie; Sorefan, Karim; Cawley, Gavin; Bevan, Michael W

    2006-03-01

    Establishing transcriptional regulatory networks by analysis of gene expression data and promoter sequences shows great promise. We developed a novel promoter classification method using a Relevance Vector Machine (RVM) and Bayesian statistical principles to identify discriminatory features in the promoter sequences of genes that can correctly classify transcriptional responses. The method was applied to microarray data obtained from Arabidopsis seedlings treated with glucose or abscisic acid (ABA). Of those genes showing >2.5-fold changes in expression level, approximately 70% were correctly predicted as being up- or down-regulated (under 10-fold cross-validation), based on the presence or absence of a small set of discriminative promoter motifs. Many of these motifs have known regulatory functions in sugar- and ABA-mediated gene expression. One promoter motif that was not known to be involved in glucose-responsive gene expression was identified as the strongest classifier of glucose-up-regulated gene expression. We show it confers glucose-responsive gene expression in conjunction with another promoter motif, thus validating the classification method. We were able to establish a detailed model of glucose and ABA transcriptional regulatory networks and their interactions, which will help us to understand the mechanisms linking metabolism with growth in Arabidopsis. This study shows that machine learning strategies coupled to Bayesian statistical methods hold significant promise for identifying functionally significant promoter sequences.

  10. Differential Effect of Active Smoking on Gene Expression in Male and Female Smokers

    PubMed Central

    Paul, Sunirmal; Amundson, Sally A

    2015-01-01

    Smoking is the second leading cause of preventable death in the United States. Cohort epidemiological studies have demonstrated that women are more vulnerable to cigarette-smoking induced diseases than their male counterparts, however, the molecular basis of these differences has remained unknown. In this study, we explored if there were differences in the gene expression patterns between male and female smokers, and how these patterns might reflect different sex-specific responses to the stress of smoking. Using whole genome microarray gene expression profiling, we found that a substantial number of oxidant related genes were expressed in both male and female smokers, however, smoking-responsive genes did indeed differ greatly between male and female smokers. Gene set enrichment analysis (GSEA) against reference oncogenic signature gene sets identified a large number of oncogenic pathway gene-sets that were significantly altered in female smokers compared to male smokers. In addition, functional annotation with Ingenuity Pathway Analysis (IPA) identified smoking-correlated genes associated with biological functions in male and female smokers that are directly relevant to well-known smoking related pathologies. However, these relevant biological functions were strikingly overrepresented in female smokers compared to male smokers. IPA network analysis with the functional categories of immune and inflammatory response gene products suggested potential interactions between smoking response and female hormones. Our results demonstrate a striking dichotomy between male and female gene expression responses to smoking. This is the first genome-wide expression study to compare the sex-specific impacts of smoking at a molecular level and suggests a novel potential connection between sex hormone signaling and smoking-induced diseases in female smokers. PMID:25621181

  11. Identification of human cell responses to benzene and benzene metabolites.

    PubMed

    Gillis, Bruce; Gavin, Igor M; Arbieva, Zarema; King, Stephen T; Jayaraman, Sundararajan; Prabhakar, Bellur S

    2007-09-01

    Benzene is a common air pollutant and confirmed carcinogen, especially in reference to the hematopoietic system. In the present study we analyzed cytokine/chemokine production by, and gene expression induction in, human peripheral blood mononuclear cells upon their exposure to the benzene metabolites catechol, hydroquinone, 1,2,4-benzenetriol, and p-benzoquinone. Protein profiling showed that benzene metabolites can stimulate the production of chemokines, the proinflammatory cytokines TNF-alpha and IL-6, and the Th2 cytokines IL-4 and IL-5. Activated cells showed concurrent suppression of anti-inflammatory cytokine IL-10 expression. We also identified changes in global gene expression patterns in response to benzene metabolite challenges by using high-density oligonucleotide microarrays. Treatment with 1,2,4-benzenetriol resulted in the suppression of genes related to the regulation of protein expression and a concomitant activation of genes that encode heat shock proteins and cytochrome P450 family members. Protein and gene expression profiling identified unique human cellular responses upon exposure to benzene and benzene metabolites.

  12. Genome-wide gene phylogeny of CIPK family in cassava and expression analysis of partial drought-induced genes

    PubMed Central

    Hu, Wei; Xia, Zhiqiang; Yan, Yan; Ding, Zehong; Tie, Weiwei; Wang, Lianzhe; Zou, Meiling; Wei, Yunxie; Lu, Cheng; Hou, Xiaowan; Wang, Wenquan; Peng, Ming

    2015-01-01

    Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs) have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava. PMID:26579161

  13. Transcriptome responses in alfalfa associated with tolerance to intensive animal grazing

    PubMed Central

    Wang, Junjie; Zhao, Yan; Ray, Ian; Song, Mingzhou

    2016-01-01

    Tolerance of alfalfa (Medicago sativa L.) to animal grazing varies widely within the species. However, the molecular mechanisms influencing the grazing tolerant phenotype remain uncharacterized. The objective of this study was to identify genes and pathways that control grazing response in alfalfa. We analyzed whole-plant de novo transcriptomes from grazing tolerant and intolerant populations of M. sativa ssp. falcata subjected to grazing by sheep. Among the Gene Ontology terms which were identified as grazing responsive in the tolerant plants and differentially enriched between the tolerant and intolerant populations (both grazed), most were associated with the ribosome and translation-related activities, cell wall processes, and response to oxygen levels. Twenty-one grazing responsive pathways were identified that also exhibited differential expression between the tolerant and intolerant populations. These pathways were associated with secondary metabolite production, primary carbohydrate metabolic pathways, shikimate derivative dependent pathways, ribosomal subunit composition, hormone signaling, wound response, cell wall formation, and anti-oxidant defense. Sequence polymorphisms were detected among several differentially expressed homologous transcripts between the tolerant and intolerant populations. These differentially responsive genes and pathways constitute potential response mechanisms for grazing tolerance in alfalfa. They also provide potential targets for molecular breeding efforts to develop grazing-tolerant cultivars of alfalfa. PMID:26763747

  14. NCI-60 Whole Exome Sequencing and Pharmacological CellMiner Analyses

    PubMed Central

    Reinhold, William C.; Varma, Sudhir; Sousa, Fabricio; Sunshine, Margot; Abaan, Ogan D.; Davis, Sean R.; Reinhold, Spencer W.; Kohn, Kurt W.; Morris, Joel; Meltzer, Paul S.; Doroshow, James H.; Pommier, Yves

    2014-01-01

    Exome sequencing provides unprecedented insights into cancer biology and pharmacological response. Here we assess these two parameters for the NCI-60, which is among the richest genomic and pharmacological publicly available cancer cell line databases. Homozygous genetic variants that putatively affect protein function were identified in 1,199 genes (approximately 6% of all genes). Variants that are either enriched or depleted compared to non-cancerous genomes, and thus may be influential in cancer progression and differential drug response were identified for 2,546 genes. Potential gene knockouts are made available. Assessment of cell line response to 19,940 compounds, including 110 FDA-approved drugs, reveals ≈80-fold range in resistance versus sensitivity response across cell lines. 103,422 gene variants were significantly correlated with at least one compound (at p<0.0002). These include genes of known pharmacological importance such as IGF1R, BRAF, RAD52, MTOR, STAT2 and TSC2 as well as a large number of candidate genes such as NOM1, TLL2, and XDH. We introduce two new web-based CellMiner applications that enable exploration of variant-to-compound relationships for a broad range of researchers, especially those without bioinformatics support. The first tool, “Genetic variant versus drug visualization”, provides a visualization of significant correlations between drug activity-gene variant combinations. Examples are given for the known vemurafenib-BRAF, and novel ifosfamide-RAD52 pairings. The second, “Genetic variant summation” allows an assessment of cumulative genetic variations for up to 150 combined genes together; and is designed to identify the variant burden for molecular pathways or functional grouping of genes. An example of its use is provided for the EGFR-ERBB2 pathway gene variant data and the identification of correlated EGFR, ERBB2, MTOR, BRAF, MEK and ERK inhibitors. The new tools are implemented as an updated web-based CellMiner version, for which the present publication serves as a compendium. PMID:25032700

  15. Repressor- and Activator-Type Ethylene Response Factors Functioning in Jasmonate Signaling and Disease Resistance Identified via a Genome-Wide Screen of Arabidopsis Transcription Factor Gene Expression[w

    PubMed Central

    McGrath, Ken C.; Dombrecht, Bruno; Manners, John M.; Schenk, Peer M.; Edgar, Cameron I.; Maclean, Donald J.; Scheible, Wolf-Rüdiger; Udvardi, Michael K.; Kazan, Kemal

    2005-01-01

    To identify transcription factors (TFs) involved in jasmonate (JA) signaling and plant defense, we screened 1,534 Arabidopsis (Arabidopsis thaliana) TFs by real-time quantitative reverse transcription-PCR for their altered transcript at 6 h following either methyl JA treatment or inoculation with the incompatible pathogen Alternaria brassicicola. We identified 134 TFs that showed a significant change in expression, including many APETALA2/ethylene response factor (AP2/ERF), MYB, WRKY, and NAC TF genes with unknown functions. Twenty TF genes were induced by both the pathogen and methyl JA and these included 10 members of the AP2/ERF TF family, primarily from the B1a and B3 subclusters. Functional analysis of the B1a TF AtERF4 revealed that AtERF4 acts as a novel negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. In contrast, functional analysis of the B3 TF AtERF2 showed that AtERF2 is a positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. Our results suggest that plants coordinately express multiple repressor- and activator-type AP2/ERFs during pathogen challenge to modulate defense gene expression and disease resistance. PMID:16183832

  16. A novel transcription factor gene FHS1 is involved in the DNA damage response in Fusarium graminearum

    PubMed Central

    Son, Hokyoung; Fu, Minmin; Lee, Yoonji; Lim, Jae Yun; Min, Kyunghun; Kim, Jin-Cheol; Choi, Gyung Ja; Lee, Yin-Won

    2016-01-01

    Cell cycle regulation and the maintenance of genome integrity are crucial for the development and virulence of the pathogenic plant fungus Fusarium graminearum. To identify transcription factors (TFs) related to these processes, four DNA-damaging agents were applied to screen a F. graminearum TF mutant library. Sixteen TFs were identified to be likely involved in DNA damage responses. Fhs1 is a fungal specific Zn(II)2Cys6 TF that localises exclusively to nuclei. fhs1 deletion mutants were hypersensitive to hydroxyurea and defective in mitotic cell division. Moreover, deletion of FHS1 resulted in defects in perithecia production and virulence and led to the accumulation of DNA damage. Our genetic evidence demonstrated that the FHS1-associated signalling pathway for DNA damage response is independent of the ATM or ATR pathways. This study identified sixteen genes involved in the DNA damage response and is the first to characterise the novel transcription factor gene FHS1, which is involved in the DNA damage response. The results provide new insights into mechanisms underlying DNA damage responses in fungi, including F. graminearum. PMID:26888604

  17. Sex-dependent genetic effects on immune responses to a parasitic nematode.

    PubMed

    Hayes, Kelly S; Hager, Reinmar; Grencis, Richard K

    2014-03-14

    Many disease aetiologies have sex specific effects, which have important implications for disease management. It is now becoming increasingly evident that such effects are the result of the differential expression of autosomal genes rather than sex-specific genes. Such sex-specific variation in the response to Trichuris muris, a murine parasitic nematode infection and model for the human parasitic nematode T. trichiura, has been well documented, however, the underlying genetic causes of these differences have been largely neglected. We used the BXD mouse set of recombinant inbred strains to identify sex-specific loci that contribute to immune phenotypes in T. muris infection. Response phenotypes to T. muris infection were found to be highly variable between different lines of BXD mice. A significant QTL on chromosome 5 (TM5) associated with IFN-γ production was found in male mice but not in female mice. This QTL was in the same location as a suggestive QTL for TNF-α and IL-6 production in male mice suggesting a common control of these pro-inflammatory cytokines. A second QTL was identified on chromosome 4 (TM4) affecting worm burden in both male and female cohorts. We have identified several genes as potential candidates for modifying responses to T. muris infection. We have used the largest mammalian genetic model system, the BXD mouse population, to identify candidate genes with sex-specific effects in immune responses to T. muris infection. Some of these genes may be differentially expressed in male and female mice leading to the difference in immune response between the sexes reported in previous studies. Our study further highlights the importance of considering sex as an important factor in investigations of immune response at the genome-wide level, in particular the bias that can be introduced when generalizing results obtained from only one sex or a mixed sex population. Rather, analyses of interaction effects between sex and genotype should be part of future studies.

  18. Identifying signatures of natural selection in Tibetan and Andean populations using dense genome scan data.

    PubMed

    Bigham, Abigail; Bauchet, Marc; Pinto, Dalila; Mao, Xianyun; Akey, Joshua M; Mei, Rui; Scherer, Stephen W; Julian, Colleen G; Wilson, Megan J; López Herráez, David; Brutsaert, Tom; Parra, Esteban J; Moore, Lorna G; Shriver, Mark D

    2010-09-09

    High-altitude hypoxia (reduced inspired oxygen tension due to decreased barometric pressure) exerts severe physiological stress on the human body. Two high-altitude regions where humans have lived for millennia are the Andean Altiplano and the Tibetan Plateau. Populations living in these regions exhibit unique circulatory, respiratory, and hematological adaptations to life at high altitude. Although these responses have been well characterized physiologically, their underlying genetic basis remains unknown. We performed a genome scan to identify genes showing evidence of adaptation to hypoxia. We looked across each chromosome to identify genomic regions with previously unknown function with respect to altitude phenotypes. In addition, groups of genes functioning in oxygen metabolism and sensing were examined to test the hypothesis that particular pathways have been involved in genetic adaptation to altitude. Applying four population genetic statistics commonly used for detecting signatures of natural selection, we identified selection-nominated candidate genes and gene regions in these two populations (Andeans and Tibetans) separately. The Tibetan and Andean patterns of genetic adaptation are largely distinct from one another, with both populations showing evidence of positive natural selection in different genes or gene regions. Interestingly, one gene previously known to be important in cellular oxygen sensing, EGLN1 (also known as PHD2), shows evidence of positive selection in both Tibetans and Andeans. However, the pattern of variation for this gene differs between the two populations. Our results indicate that several key HIF-regulatory and targeted genes are responsible for adaptation to high altitude in Andeans and Tibetans, and several different chromosomal regions are implicated in the putative response to selection. These data suggest a genetic role in high-altitude adaption and provide a basis for future genotype/phenotype association studies necessary to confirm the role of selection-nominated candidate genes and gene regions in adaptation to altitude.

  19. Meta-type analysis of dopaminergic effects on gene expression in the neuroendocrine brain of female goldfish.

    PubMed

    Popesku, Jason T; Martyniuk, Christopher J; Trudeau, Vance L

    2012-01-01

    Dopamine (DA) is a major neurotransmitter important for neuroendocrine control and recent studies have described genomic signaling pathways activated and inhibited by DA agonists and antagonists in the goldfish brain. Here we perform a meta-type analysis using microarray datasets from experiments conducted with female goldfish to characterize the gene expression responses that underlie dopaminergic signaling. Sexually mature, pre-spawning [gonadosomatic index (GSI) = 4.5 ± 1.3%] or sexually regressing (GSI = 3 ± 0.4%) female goldfish (15-40 g) injected intraperitoneally with either SKF 38393, LY 171555, SCH 23390, sulpiride, or a combination of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and α-methyl-p-tyrosine. Microarray meta-type analysis identified 268 genes in the telencephalon and hypothalamus as having reciprocal (i.e., opposite between agonism and antagonism/depletion) fold change responses, suggesting that these transcripts are likely targets for DA-mediated regulation. Noteworthy genes included ependymin, vimentin, and aromatase, genes that support the significance of DA in neuronal plasticity and tissue remodeling. Sub-network enrichment analysis (SNEA) was used to identify common gene regulators and binding proteins associated with the differentially expressed genes mediated by DA. SNEA analysis identified gene expression targets that were related to three major categories that included cell signaling (STAT3, SP1, SMAD, Jun/Fos), immune response (IL-6, IL-1β, TNFs, cytokine, NF-κB), and cell proliferation and growth (IGF1, TGFβ1). These gene networks are also known to be associated with neurodegenerative disorders such as Parkinsons' disease, well-known to be associated with loss of dopaminergic neurons. This study identifies genes and networks that underlie DA signaling in the vertebrate CNS and provides targets that may be key neuroendocrine regulators. The results provide a foundation for future work on dopaminergic regulation of gene expression in fish model systems.

  20. Meta-Type Analysis of Dopaminergic Effects on Gene Expression in the Neuroendocrine Brain of Female Goldfish

    PubMed Central

    Popesku, Jason T.; Martyniuk, Christopher J.; Trudeau, Vance L.

    2012-01-01

    Dopamine (DA) is a major neurotransmitter important for neuroendocrine control and recent studies have described genomic signaling pathways activated and inhibited by DA agonists and antagonists in the goldfish brain. Here we perform a meta-type analysis using microarray datasets from experiments conducted with female goldfish to characterize the gene expression responses that underlie dopaminergic signaling. Sexually mature, pre-spawning [gonadosomatic index (GSI) = 4.5 ± 1.3%] or sexually regressing (GSI = 3 ± 0.4%) female goldfish (15–40 g) injected intraperitoneally with either SKF 38393, LY 171555, SCH 23390, sulpiride, or a combination of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and α-methyl-p-tyrosine. Microarray meta-type analysis identified 268 genes in the telencephalon and hypothalamus as having reciprocal (i.e., opposite between agonism and antagonism/depletion) fold change responses, suggesting that these transcripts are likely targets for DA-mediated regulation. Noteworthy genes included ependymin, vimentin, and aromatase, genes that support the significance of DA in neuronal plasticity and tissue remodeling. Sub-network enrichment analysis (SNEA) was used to identify common gene regulators and binding proteins associated with the differentially expressed genes mediated by DA. SNEA analysis identified gene expression targets that were related to three major categories that included cell signaling (STAT3, SP1, SMAD, Jun/Fos), immune response (IL-6, IL-1β, TNFs, cytokine, NF-κB), and cell proliferation and growth (IGF1, TGFβ1). These gene networks are also known to be associated with neurodegenerative disorders such as Parkinsons’ disease, well-known to be associated with loss of dopaminergic neurons. This study identifies genes and networks that underlie DA signaling in the vertebrate CNS and provides targets that may be key neuroendocrine regulators. The results provide a foundation for future work on dopaminergic regulation of gene expression in fish model systems. PMID:23130016

  1. Identifying Signatures of Natural Selection in Tibetan and Andean Populations Using Dense Genome Scan Data

    PubMed Central

    Bigham, Abigail; Bauchet, Marc; Pinto, Dalila; Mao, Xianyun; Akey, Joshua M.; Mei, Rui; Scherer, Stephen W.; Julian, Colleen G.; Wilson, Megan J.; López Herráez, David; Brutsaert, Tom; Parra, Esteban J.; Moore, Lorna G.; Shriver, Mark D.

    2010-01-01

    High-altitude hypoxia (reduced inspired oxygen tension due to decreased barometric pressure) exerts severe physiological stress on the human body. Two high-altitude regions where humans have lived for millennia are the Andean Altiplano and the Tibetan Plateau. Populations living in these regions exhibit unique circulatory, respiratory, and hematological adaptations to life at high altitude. Although these responses have been well characterized physiologically, their underlying genetic basis remains unknown. We performed a genome scan to identify genes showing evidence of adaptation to hypoxia. We looked across each chromosome to identify genomic regions with previously unknown function with respect to altitude phenotypes. In addition, groups of genes functioning in oxygen metabolism and sensing were examined to test the hypothesis that particular pathways have been involved in genetic adaptation to altitude. Applying four population genetic statistics commonly used for detecting signatures of natural selection, we identified selection-nominated candidate genes and gene regions in these two populations (Andeans and Tibetans) separately. The Tibetan and Andean patterns of genetic adaptation are largely distinct from one another, with both populations showing evidence of positive natural selection in different genes or gene regions. Interestingly, one gene previously known to be important in cellular oxygen sensing, EGLN1 (also known as PHD2), shows evidence of positive selection in both Tibetans and Andeans. However, the pattern of variation for this gene differs between the two populations. Our results indicate that several key HIF-regulatory and targeted genes are responsible for adaptation to high altitude in Andeans and Tibetans, and several different chromosomal regions are implicated in the putative response to selection. These data suggest a genetic role in high-altitude adaption and provide a basis for future genotype/phenotype association studies necessary to confirm the role of selection-nominated candidate genes and gene regions in adaptation to altitude. PMID:20838600

  2. High expression of ID family and IGJ genes signature as predictor of low induction treatment response and worst survival in adult Hispanic patients with B-acute lymphoblastic leukemia.

    PubMed

    Cruz-Rodriguez, Nataly; Combita, Alba L; Enciso, Leonardo J; Quijano, Sandra M; Pinzon, Paula L; Lozano, Olga C; Castillo, Juan S; Li, Li; Bareño, Jose; Cardozo, Claudia; Solano, Julio; Herrera, Maria V; Cudris, Jennifer; Zabaleta, Jovanny

    2016-04-05

    B-Acute lymphoblastic leukemia (B-ALL) represents a hematologic malignancy with poor clinical outcome and low survival rates in adult patients. Remission rates in Hispanic population are almost 30% lower and Overall Survival (OS) nearly two years inferior than those reported in other ethnic groups. Only 61% of Colombian adult patients with ALL achieve complete remission (CR), median overall survival is 11.3 months and event-free survival (EFS) is 7.34 months. Identification of prognostic factors is crucial for the application of proper treatment strategies and subsequently for successful outcome. Our goal was to identify a gene expression signature that might correlate with response to therapy and evaluate the utility of these as prognostic tool in hispanic patients. We included 43 adult patients newly diagnosed with B-ALL. We used microarray analysis in order to identify genes that distinguish poor from good response to treatment using differential gene expression analysis. The expression profile was validated by real-time PCR (RT-PCT). We identified 442 differentially expressed genes between responders and non-responders to induction treatment. Hierarchical analysis according to the expression of a 7-gene signature revealed 2 subsets of patients that differed in their clinical characteristics and outcome. Our study suggests that response to induction treatment and clinical outcome of Hispanic patients can be predicted from the onset of the disease and that gene expression profiles can be used to stratify patient risk adequately and accurately. The present study represents the first that shows the gene expression profiling of B-ALL Colombian adults and its relevance for stratification in the early course of disease.

  3. Using RNA-seq to Profile Gene Expression of Spikelet Development in Response to Temperature and Nitrogen during Meiosis in Rice (Oryza sativa L.).

    PubMed

    Yang, Jun; Chen, Xiaorong; Zhu, Changlan; Peng, Xiaosong; He, Xiaopeng; Fu, Junru; Ouyang, Linjuan; Bian, Jianmin; Hu, Lifang; Sun, Xiaotang; Xu, Jie; He, Haohua

    2015-01-01

    Rice reproductive development is sensitive to high temperature and soil nitrogen supply, both of which are predicted to be increased threats to rice crop yield. Rice spikelet development is a critical process that determines yield, yet little is known about the transcriptional regulation of rice spikelet development in response to the combination of heat stress and low nitrogen availability. Here, we profiled gene expression of rice spikelet development during meiosis under heat stress and different nitrogen levels using RNA-seq. We subjected plants to four treatments: 1) NN: normal nitrogen level (165 kg ha-1) with normal temperature (30°C); 2) HH: high nitrogen level (264 kg ha-1) with high temperature (37°C); 3) NH: normal nitrogen level and high temperature; and 4) HN: high nitrogen level and normal temperature. The de novo transcriptome assembly resulted in 52,250,482 clean reads aligned with 76,103 unigenes, which were then used to compare differentially expressed genes (DEGs) in the different treatments. Comparing gene expression in samples with the same nitrogen levels but different temperatures, we identified 70 temperature-responsive DEGs in normal nitrogen levels (NN vs NH) and 135 DEGs in high nitrogen levels (HN vs HH), with 27 overlapping DEGs. We identified 17 and seven nitrogen-responsive DEGs by comparing changes in nitrogen levels in lower temperature (NN vs HN) and higher temperature (NH vs HH), with one common DEG. The temperature-responsive genes were principally associated with cytochrome, heat shock protein, peroxidase, and ubiquitin, while the nitrogen-responsive genes were mainly involved in glutamine synthetase, amino acid transporter, pollen development, and plant hormone. Rice spikelet fertility was significantly reduced under high temperature, but less reduced under high-nitrogen treatment. In the high temperature treatments, we observed downregulation of genes involved in spikelet development, such as pollen tube growth, pollen maturation, especially sporopollenin biosynthetic process, and pollen exine formation. Moreover, we observed higher expression levels of the co-expressed DEGs in HN vs HH compared to NN vs NH. These included the six downregulated genes (one pollen maturation and five pollen exine formation genes), as well as the four upregulated DEGs in response to heat. This suggests that high-nitrogen treatment may enhance the gene expression levels to mitigate aspects of heat-stress. The spikelet genes identified in this study may play important roles in response to the combined effects of high temperature and high nitrogen, and may serve as candidates for crop improvement.

  4. Genome-Wide Functional and Stress Response Profiling Reveals Toxic Mechanism and Genes Required for Tolerance to Benzo[a]pyrene in S. cerevisiae

    PubMed Central

    O’Connor, Sean Timothy Francis; Lan, Jiaqi; North, Matthew; Loguinov, Alexandre; Zhang, Luoping; Smith, Martyn T.; Gu, April Z.; Vulpe, Chris

    2012-01-01

    Benzo[a]pyrene (BaP) is a ubiquitous, potent, and complete carcinogen resulting from incomplete organic combustion. BaP can form DNA adducts but other mechanisms may play a role in toxicity. We used a functional toxicology approach in S. cerevisiae to assess the genetic requirements for cellular resistance to BaP. In addition, we examined translational activities of key genes involved in various stress response pathways. We identified multiple genes and processes involved in modulating BaP toxicity in yeast which support DNA damage as a primary mechanism of toxicity, but also identify other potential toxicity pathways. Gene ontology enrichment analysis indicated that DNA damage and repair as well as redox homeostasis and oxidative stress are key processes in cellular response to BaP suggesting a similar mode of action of BaP in yeast and mammals. Interestingly, toxicant export is also implicated as a potential novel modulator of cellular susceptibility. In particular, we identified several transporters with human orthologs (solute carrier family 22) which may play a role in mammalian systems. PMID:23403841

  5. Whole genome re-sequencing identifies a mutation in an ABC transporter (mdr2) in a Plasmodium chabaudi clone with altered susceptibility to antifolate drugs☆

    PubMed Central

    Martinelli, Axel; Henriques, Gisela; Cravo, Pedro; Hunt, Paul

    2011-01-01

    In malaria parasites, mutations in two genes of folate biosynthesis encoding dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) modify responses to antifolate therapies which target these enzymes. However, the involvement of other genes which modify the availability of exogenous folate, for example, has been proposed. Here, we used short-read whole-genome re-sequencing to determine the mutations in a clone of the rodent malaria parasite, Plasmodium chabaudi, which has altered susceptibility to both sulphadoxine and pyrimethamine. This clone bears a previously identified S106N mutation in dhfr and no mutation in dhps. Instead, three additional point mutations in genes on chromosomes 2, 13 and 14 were identified. The mutated gene on chromosome 13 (mdr2 K392Q) encodes an ABC transporter. Because Quantitative Trait Locus analysis previously indicated an association of genetic markers on chromosome 13 with responses to individual and combined antifolates, MDR2 is proposed to modulate antifolate responses, possibly mediated by the transport of folate intermediates. PMID:20858498

  6. Identification of drought-responsive genes in a drought-tolerant cotton (Gossypium hirsutum L.) cultivar under reduced irrigation field conditions and development of candidate gene markers for drought tolerance

    USDA-ARS?s Scientific Manuscript database

    Cotton productivity is affected by water deficit, and little is known about the molecular basis of drought tolerance in cotton. In this study, microarray analysis was conducted to identify drought-responsive genes in the third topmost leaves of the field-grown drought-tolerant cotton (Gossypium hirs...

  7. GAS6 is an estrogen-inducible gene in mammary epithelial cells

    PubMed Central

    Mo, Rigen; Zhu, Yiwei Tony; Zhang, Zhongyi; Rao, Sambasiva M.; Zhu, Yi-Jun

    2007-01-01

    To identify estrogen responsive genes in mammary glands, microarray assays were performed. Twenty genes were found to be up-regulated while 16 genes were repressed in the 9h estrogen treated glands. The induction of GAS6, one of the genes up-regulated by estrogen, was confirmed by RNase protection assay. Furthermore, GAS6 was also demonstrated to be induced by estrogen in ER positive breast cancer cells. Analysis of GAS6 promoter revealed that GAS6 promoter was regulated by estrogen. An estrogen response element (ERE) was identified in the GAS6 promoter. Electrophoretic mobility shift assay revealed that ERα interacted with the ERE in the GAS6 promoter. Chromatin immunoprecipitation demonstrated that ERα was recruited to the GAS6 promoter upon estrogen stimulation. These results suggested that GAS6 is an estrogen target gene in mammary epithelial cells. PMID:17174935

  8. Mannosyltransferase is required for cell wall biosynthesis, morphology and control of asexual development in Neurospora crassa.

    PubMed

    Bowman, Shaun M; Piwowar, Amy; Ciocca, Maria; Free, Stephen J

    2005-01-01

    Two Neurospora mutants with a phenotype that includes a tight colonial growth pattern, an inability to form conidia and an inability to form protoperithecia have been isolated and characterized. The relevant mutations were mapped to the same locus on the sequenced Neurospora genome. The mutations responsible for the mutant phenotype then were identified by examining likely candidate genes from the mutant genomes at the mapped locus with PCR amplification and a sequencing assay. The results demonstrate that a map and sequence strategy is a feasible way to identify mutant genes in Neurospora. The gene responsible for the phenotype is a putative alpha-1,2-mannosyltransferase gene. The mutant cell wall has an altered composition demonstrating that the gene functions in cell wall biosynthesis. The results demonstrate that the mnt-1 gene is required for normal cell wall biosynthesis, morphology and for the regulation of asexual development.

  9. Polymorphisms in adenosine receptor genes are associated with infarct size in patients with ischemic cardiomyopathy.

    PubMed

    Tang, Z; Diamond, M A; Chen, J-M; Holly, T A; Bonow, R O; Dasgupta, A; Hyslop, T; Purzycki, A; Wagner, J; McNamara, D M; Kukulski, T; Wos, S; Velazquez, E J; Ardlie, K; Feldman, A M

    2007-10-01

    The goal of this experiment was to identify the presence of genetic variants in the adenosine receptor genes and assess their relationship to infarct size in a population of patients with ischemic cardiomyopathy. Adenosine receptors play an important role in protecting the heart during ischemia and in mediating the effects of ischemic preconditioning. We sequenced DNA samples from 273 individuals with ischemic cardiomyopathy and from 203 normal controls to identify the presence of genetic variants in the adenosine receptor genes. Subsequently, we analyzed the relationship between the identified genetic variants and infarct size, left ventricular size, and left ventricular function. Three variants in the 3'-untranslated region of the A(1)-adenosine gene (nt 1689 C/A, nt 2206 Tdel, nt 2683del36) and an informative polymorphism in the coding region of the A3-adenosine gene (nt 1509 A/C I248L) were associated with changes in infarct size. These results suggest that genetic variants in the adenosine receptor genes may predict the heart's response to ischemia or injury and might also influence an individual's response to adenosine therapy.

  10. Dose-response relationships in gene expression profiles in rainbow trout, Oncorhyncus mykiss, exposed to ethynylestradiol.

    PubMed

    Hook, Sharon E; Skillman, Ann D; Small, Jack A; Schultz, Irvin R

    2006-07-01

    Determining how gene expression profiles change with toxicant dose will improve the utility of arrays in identifying biomarkers and modes of toxic action. Isogenic rainbow trout, Oncorhyncus mykiss,were exposed to 10, 50 or 100 ng/L ethynylestradiol (a xeno-estrogen) for 7 days. Following exposure hepatic RNA was extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNAs. Transcript expression in treated vs control fish was analyzed via Genespring (Silicon Genetics) to identify genes with altered expression, as well as to determine gene clustering patterns that can be used as "expression signatures". Array results were confirmed via qRT PCR. Our analysis indicates that gene expression profiles varied somewhat with dose. Established biomarkers of exposure to estrogenic chemicals, such as vitellogenin, vitelline envelope proteins, and the estrogen receptor alpha, were induced at every dose. Other genes were dose specific, suggesting that different doses induce distinct physiological responses. These findings demonstrate that cDNA microarrays could be used to identify both toxicant class and relative dose.

  11. Identification of Early Nuclear Target Genes of Plastidial Redox Signals that Trigger the Long-Term Response of Arabidopsis to Light Quality Shifts.

    PubMed

    Dietzel, Lars; Gläßer, Christine; Liebers, Monique; Hiekel, Stefan; Courtois, Florence; Czarnecki, Olaf; Schlicke, Hagen; Zubo, Yan; Börner, Thomas; Mayer, Klaus; Grimm, Bernhard; Pfannschmidt, Thomas

    2015-08-01

    Natural illumination conditions are highly variable and because of their sessile life style, plants are forced to acclimate to them at the cellular and molecular level. Changes in light intensity or quality induce changes in the reduction/oxidation (redox) state of the photosynthetic electron chain that acts as a trigger for compensatory acclimation responses comprising functional and structural adjustments of photosynthesis and metabolism. Such responses include redox-controlled changes in plant gene expression in the nucleus and organelles. Here we describe a strategy for the identification of early redox-regulated genes (ERGs) in the nucleus of the model organism Arabidopsis thaliana that respond significantly 30 or 60 min after the generation of a reduction signal in the photosynthetic electron transport chain. By comparing the response of wild-type plants with that of the acclimation mutant stn7, we could specifically identify ERGs. The results reveal a significant impact of chloroplast redox signals on distinct nuclear gene groups including genes for the mitochondrial electron transport chain, tetrapyrrole biosynthesis, carbohydrate metabolism, and signaling lipid synthesis. These expression profiles are clearly different from those observed in response to the reduction of photosynthetic electron transport by high light treatments. Thus, the ERGs identified are unique to redox imbalances in photosynthetic electron transport and were then used for analyzing potential redox-responsive cis-elements, trans-factors, and chromosomal regulatory hot spots. The data identify a novel redox-responsive element and indicate extensive redox control at transcriptional and chromosomal levels that point to an unprecedented impact of redox signals on epigenetic processes. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  12. Global Expression Profiling of Low Temperature Induced Genes in the Chilling Tolerant Japonica Rice Jumli Marshi

    PubMed Central

    Chawade, Aakash; Lindlöf, Angelica; Olsson, Björn; Olsson, Olof

    2013-01-01

    Low temperature is a key factor that limits growth and productivity of many important agronomical crops worldwide. Rice (Oryza sativa L.) is negatively affected already at temperatures below +10°C and is therefore denoted as chilling sensitive. However, chilling tolerant rice cultivars exist and can be commercially cultivated at altitudes up to 3,050 meters with temperatures reaching as low as +4°C. In this work, the global transcriptional response to cold stress (+4°C) was studied in the Nepalese highland variety Jumli Marshi (spp. japonica) and 4,636 genes were identified as significantly differentially expressed within 24 hours of cold stress. Comparison with previously published microarray data from one chilling tolerant and two sensitive rice cultivars identified 182 genes differentially expressed (DE) upon cold stress in all four rice cultivars and 511 genes DE only in the chilling tolerant rice. Promoter analysis of the 182 genes suggests a complex cross-talk between ABRE and CBF regulons. Promoter analysis of the 511 genes identified over-represented ABRE motifs but not DRE motifs, suggesting a role for ABA signaling in cold tolerance. Moreover, 2,101 genes were DE in Jumli Marshi alone. By chromosomal localization analysis, 473 of these cold responsive genes were located within 13 different QTLs previously identified as cold associated. PMID:24349120

  13. Transcriptome-wide analysis of WRKY transcription factors in wheat and their leaf rust responsive expression profiling.

    PubMed

    Satapathy, Lopamudra; Singh, Dharmendra; Ranjan, Prashant; Kumar, Dhananjay; Kumar, Manish; Prabhu, Kumble Vinod; Mukhopadhyay, Kunal

    2014-12-01

    WRKY, a plant-specific transcription factor family, has important roles in pathogen defense, abiotic cues and phytohormone signaling, yet little is known about their roles and molecular mechanism of function in response to rust diseases in wheat. We identified 100 TaWRKY sequences using wheat Expressed Sequence Tag database of which 22 WRKY sequences were novel. Identified proteins were characterized based on their zinc finger motifs and phylogenetic analysis clustered them into six clades consisting of class IIc and class III WRKY proteins. Functional annotation revealed major functions in metabolic and cellular processes in control plants; whereas response to stimuli, signaling and defense in pathogen inoculated plants, their major molecular function being binding to DNA. Tag-based expression analysis of the identified genes revealed differential expression between mock and Puccinia triticina inoculated wheat near isogenic lines. Gene expression was also performed with six rust-related microarray experiments at Gene Expression Omnibus database. TaWRKY10, 15, 17 and 56 were common in both tag-based and microarray-based differential expression analysis and could be representing rust specific WRKY genes. The obtained results will bestow insight into the functional characterization of WRKY transcription factors responsive to leaf rust pathogenesis that can be used as candidate genes in molecular breeding programs to improve biotic stress tolerance in wheat.

  14. The ethylene response pathway in Arabidopsis

    NASA Technical Reports Server (NTRS)

    Kieber, J. J.; Evans, M. L. (Principal Investigator)

    1997-01-01

    The simple gas ethylene influences a diverse array of plant growth and developmental processes including germination, senescence, cell elongation, and fruit ripening. This review focuses on recent molecular genetic studies, principally in Arabidopsis, in which components of the ethylene response pathway have been identified. The isolation and characterization of two of these genes has revealed that ethylene sensing involves a protein kinase cascade. One of these genes encodes a protein with similarity to the ubiquitous Raf family of Ser/Thr protein kinases. A second gene shows similarity to the prokaryotic two-component histidine kinases and most likely encodes an ethylene receptor. Additional elements involved in ethylene signaling have only been identified genetically. The characterization of these genes and mutants will be discussed.

  15. Blood gene expression profiling of an early acetaminophen response.

    PubMed

    Bushel, P R; Fannin, R D; Gerrish, K; Watkins, P B; Paules, R S

    2017-06-01

    Acetaminophen can adversely affect the liver especially when overdosed. We used whole blood as a surrogate to identify genes as potential early indicators of an acetaminophen-induced response. In a clinical study, healthy human subjects were dosed daily with 4 g of either acetaminophen or placebo pills for 7 days and evaluated over the course of 14 days. Alanine aminotransferase (ALT) levels for responders to acetaminophen increased between days 4 and 9 after dosing, and 12 genes were detected with expression profiles significantly altered within 24 h. The early responsive genes separated the subjects by class and dose period. In addition, the genes clustered patients who overdosed on acetaminophen apart from controls and also predicted the exposure classifications with 100% accuracy. The responsive genes serve as early indicators of an acetaminophen exposure, and their gene expression profiles can potentially be evaluated as molecular indicators for further consideration.

  16. Blood Gene Expression Profiling of an Early Acetaminophen Response

    PubMed Central

    Bushel, Pierre R.; Fannin, Rick D.; Gerrish, Kevin; Watkins, Paul B.; Paules, Richard S.

    2018-01-01

    Acetaminophen can adversely affect the liver especially when overdosed. We used whole blood as a surrogate to identify genes as potential early indicators of an acetaminophen-induced response. In a clinical study, healthy human subjects were dosed daily with 4g of either acetaminophen or placebo pills for 7 days and evaluated over the course of 14 days. Alanine aminotransferase (ALT) levels for responders to acetaminophen increased between days 4 and 9 after dosing and 12 genes were detected with expression profiles significantly altered within 24 hrs. The early responsive genes separated the subjects by class and dose period. In addition, the genes clustered patients who overdosed on acetaminophen apart from controls and also predicted the exposure classifications with 100% accuracy. The responsive genes serve as early indicators of an acetaminophen exposure and their gene expression profiles can potentially be evaluated as molecular indicators for further consideration. PMID:26927286

  17. A Kinetic Analysis of the Auxin Transcriptome Reveals Cell Wall Remodeling Proteins That Modulate Lateral Root Development in Arabidopsis[W][OPEN

    PubMed Central

    Lewis, Daniel R.; Olex, Amy L.; Lundy, Stacey R.; Turkett, William H.; Fetrow, Jacquelyn S.; Muday, Gloria K.

    2013-01-01

    To identify gene products that participate in auxin-dependent lateral root formation, a high temporal resolution, genome-wide transcript abundance analysis was performed with auxin-treated Arabidopsis thaliana roots. Data analysis identified 1246 transcripts that were consistently regulated by indole-3-acetic acid (IAA), partitioning into 60 clusters with distinct response kinetics. We identified rapidly induced clusters containing auxin-response functional annotations and clusters exhibiting delayed induction linked to cell division temporally correlated with lateral root induction. Several clusters were enriched with genes encoding proteins involved in cell wall modification, opening the possibility for understanding mechanistic details of cell structural changes that result in root formation following auxin treatment. Mutants with insertions in 72 genes annotated with a cell wall remodeling function were examined for alterations in IAA-regulated root growth and development. This reverse-genetic screen yielded eight mutants with root phenotypes. Detailed characterization of seedlings with mutations in CELLULASE3/GLYCOSYLHYDROLASE9B3 and LEUCINE RICH EXTENSIN2, genes not normally linked to auxin response, revealed defects in the early and late stages of lateral root development, respectively. The genes identified here using kinetic insight into expression changes lay the foundation for mechanistic understanding of auxin-mediated cell wall remodeling as an essential feature of lateral root development. PMID:24045021

  18. Large-scale functional RNAi screen in C. elegans identifies genes that regulate the dysfunction of mutant polyglutamine neurons

    PubMed Central

    2012-01-01

    Background A central goal in Huntington's disease (HD) research is to identify and prioritize candidate targets for neuroprotective intervention, which requires genome-scale information on the modifiers of early-stage neuron injury in HD. Results Here, we performed a large-scale RNA interference screen in C. elegans strains that express N-terminal huntingtin (htt) in touch receptor neurons. These neurons control the response to light touch. Their function is strongly impaired by expanded polyglutamines (128Q) as shown by the nearly complete loss of touch response in adult animals, providing an in vivo model in which to manipulate the early phases of expanded-polyQ neurotoxicity. In total, 6034 genes were examined, revealing 662 gene inactivations that either reduce or aggravate defective touch response in 128Q animals. Several genes were previously implicated in HD or neurodegenerative disease, suggesting that this screen has effectively identified candidate targets for HD. Network-based analysis emphasized a subset of high-confidence modifier genes in pathways of interest in HD including metabolic, neurodevelopmental and pro-survival pathways. Finally, 49 modifiers of 128Q-neuron dysfunction that are dysregulated in the striatum of either R/2 or CHL2 HD mice, or both, were identified. Conclusions Collectively, these results highlight the relevance to HD pathogenesis, providing novel information on the potential therapeutic targets for neuroprotection in HD. PMID:22413862

  19. Large-scale functional RNAi screen in C. elegans identifies genes that regulate the dysfunction of mutant polyglutamine neurons.

    PubMed

    Lejeune, François-Xavier; Mesrob, Lilia; Parmentier, Frédéric; Bicep, Cedric; Vazquez-Manrique, Rafael P; Parker, J Alex; Vert, Jean-Philippe; Tourette, Cendrine; Neri, Christian

    2012-03-13

    A central goal in Huntington's disease (HD) research is to identify and prioritize candidate targets for neuroprotective intervention, which requires genome-scale information on the modifiers of early-stage neuron injury in HD. Here, we performed a large-scale RNA interference screen in C. elegans strains that express N-terminal huntingtin (htt) in touch receptor neurons. These neurons control the response to light touch. Their function is strongly impaired by expanded polyglutamines (128Q) as shown by the nearly complete loss of touch response in adult animals, providing an in vivo model in which to manipulate the early phases of expanded-polyQ neurotoxicity. In total, 6034 genes were examined, revealing 662 gene inactivations that either reduce or aggravate defective touch response in 128Q animals. Several genes were previously implicated in HD or neurodegenerative disease, suggesting that this screen has effectively identified candidate targets for HD. Network-based analysis emphasized a subset of high-confidence modifier genes in pathways of interest in HD including metabolic, neurodevelopmental and pro-survival pathways. Finally, 49 modifiers of 128Q-neuron dysfunction that are dysregulated in the striatum of either R/2 or CHL2 HD mice, or both, were identified. Collectively, these results highlight the relevance to HD pathogenesis, providing novel information on the potential therapeutic targets for neuroprotection in HD. © 2012 Lejeune et al; licensee BioMed Central Ltd.

  20. Characterizing Cancer Drug Response and Biological Correlates: A Geometric Network Approach.

    PubMed

    Pouryahya, Maryam; Oh, Jung Hun; Mathews, James C; Deasy, Joseph O; Tannenbaum, Allen R

    2018-04-23

    In the present work, we apply a geometric network approach to study common biological features of anticancer drug response. We use for this purpose the panel of 60 human cell lines (NCI-60) provided by the National Cancer Institute. Our study suggests that mathematical tools for network-based analysis can provide novel insights into drug response and cancer biology. We adopted a discrete notion of Ricci curvature to measure, via a link between Ricci curvature and network robustness established by the theory of optimal mass transport, the robustness of biological networks constructed with a pre-treatment gene expression dataset and coupled the results with the GI50 response of the cell lines to the drugs. Based on the resulting drug response ranking, we assessed the impact of genes that are likely associated with individual drug response. For genes identified as important, we performed a gene ontology enrichment analysis using a curated bioinformatics database which resulted in biological processes associated with drug response across cell lines and tissue types which are plausible from the point of view of the biological literature. These results demonstrate the potential of using the mathematical network analysis in assessing drug response and in identifying relevant genomic biomarkers and biological processes for precision medicine.

  1. Clinical and molecular characterisation of 300 patients with congenital hyperinsulinism

    PubMed Central

    Kapoor, Ritika R; Flanagan, Sarah E; Arya, Ved Bhushan; Shield, Julian P; Ellard, Sian; Hussain, Khalid

    2013-01-01

    Background Congenital hyperinsulinism (CHI) is a clinically heterogeneous condition. Mutations in eight genes (ABCC8, KCNJ11, GLUD1, GCK, HADH, SLC16A1, HNF4A and HNF1A) are known to cause CHI. Aim To characterise the clinical and molecular aspects of a large cohort of patients with CHI. Methodology Three hundred patients were recruited and clinical information was collected before genotyping. ABCC8 and KCNJ11 genes were analysed in all patients. Mutations in GLUD1, HADH, GCK and HNF4A genes were sought in patients with diazoxide-responsive CHI with hyperammonaemia (GLUD1), raised 3-hydroxybutyrylcarnitine and/or consanguinity (HADH), positive family history (GCK) or when CHI was diagnosed within the first week of life (HNF4A). Results Mutations were identified in 136/300 patients (45.3%). Mutations in ABCC8/KCNJ11 were the commonest genetic cause identified (n=109, 36.3%). Among diazoxide-unresponsive patients (n=105), mutations in ABCC8/KCNJ11 were identified in 92 (87.6%) patients, of whom 63 patients had recessively inherited mutations while four patients had dominantly inherited mutations. A paternal mutation in the ABCC8/KCNJ11 genes was identified in 23 diazoxide-unresponsive patients, of whom six had diffuse disease. Among the diazoxide-responsive patients (n=183), mutations were identified in 41 patients (22.4%). These include mutations in ABCC8/KCNJ11 (n=15), HNF4A (n=7), GLUD1 (n=16) and HADH (n=3). Conclusions A genetic diagnosis was made for 45.3% of patients in this large series. Mutations in the ABCC8 gene were the commonest identifiable cause. The vast majority of patients with diazoxide-responsive CHI (77.6%) had no identifiable mutations, suggesting other genetic and/or environmental mechanisms. PMID:23345197

  2. Evaluation of a toxicogenomic approach to the local lymph node assay (LLNA).

    PubMed

    Boverhof, Darrell R; Gollapudi, B Bhaskar; Hotchkiss, Jon A; Osterloh-Quiroz, Mandy; Woolhiser, Michael R

    2009-02-01

    Genomic technologies have the potential to enhance and complement existing toxicology endpoints; however, assessment of these approaches requires a systematic evaluation including a robust experimental design with genomic endpoints anchored to traditional toxicology endpoints. The present study was conducted to assess the sensitivity of genomic responses when compared with the traditional local lymph node assay (LLNA) endpoint of lymph node cell proliferation and to evaluate the responses for their ability to provide insights into mode of action. Female BALB/c mice were treated with the sensitizer trimellitic anhydride (TMA), following the standard LLNA dosing regimen, at doses of 0.1, 1, or 10% and traditional tritiated thymidine ((3)HTdR) incorporation and gene expression responses were monitored in the auricular lymph nodes. Additional mice dosed with either vehicle or 10% TMA and sacrificed on day 4 or 10, were also included to examine temporal effects on gene expression. Analysis of (3)HTdR incorporation revealed TMA-induced stimulation indices of 2.8, 22.9, and 61.0 relative to vehicle with an EC(3) of 0.11%. Examination of the dose-response gene expression responses identified 9, 833, and 2122 differentially expressed genes relative to vehicle for the 0.1, 1, and 10% TMA dose groups, respectively. Calculation of EC(3) values for differentially expressed genes did not identify a response that was more sensitive than the (3)HTdR value, although a number of genes displayed comparable sensitivity. Examination of temporal responses revealed 1760, 1870, and 953 differentially expressed genes at the 4-, 6-, and 10-day time points respectively. Functional analysis revealed many responses displayed dose- and time-specific induction patterns within the functional categories of cellular proliferation and immune response, including numerous immunoglobin genes which were highly induced at the day 10 time point. Overall, these experiments have systematically illustrated the potential utility of genomic endpoints to enhance the LLNA and support further exploration of this approach through examination of a more diverse array of chemicals.

  3. Global transcriptome analysis of grapevine (Vitis vinifera L.) leaves under salt stress reveals differential response at early and late stages of stress in table grape cv. Thompson Seedless.

    PubMed

    Upadhyay, Anuradha; Gaonkar, Tulsi; Upadhyay, Ajay Kumar; Jogaiah, Satisha; Shinde, Manisha P; Kadoo, Narendra Y; Gupta, Vidya S

    2018-05-31

    Among the different abiotic stresses, salt stress has a significant effect on the growth and yield of grapevine (Vitis vinifera L.). In this study, we employed RNA sequence based transcriptome analysis to study salinity stress response in grape variety Thompson Seedless. Salt stress adversely affected the growth related and physiological parameters and the effect on physiological parameters was significant within 10 days of stress imposition. A total of 343 genes were differentially expressed in response to salt stress. Among the differentially expressed genes (DEGs) only 42 genes were common at early and late stages of stress. The gene enrichment analysis revealed that GO terms related to transcription factors were over-represented. Among the DEGs, 52 were transcription factors belonging to WRKY, EREB, MYB, NAC and bHLH families. Salt stress significantly affected several pathways like metabolic pathways, biosynthesis of secondary metabolites, membrane transport development related pathways etc. 343 DEGs were distributed on all the 19 chromosomes, however clustered regions of DEGs were present on chromosomes 2, 5, 6 and 12 suggesting probable QTLs for imparting tolerance to salt and other abiotic stresses. Real-time PCR of selected genes in control and treated samples of grafted and own root vines demonstrated that rootstock influenced expression of salt stress responsive genes. Microsatellite regions were identified in ten selected salt responsive genes and highly polymorphic markers were identified using fifteen grape genotypes. This information will be useful for the identification of key genes involved in salt stress tolerance in grape. The identified DEGs could also be useful for genome wide analysis for the identification of polymorphic markers for their subsequent use in molecular breeding for developing salt tolerant grape genotypes. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  4. The transcriptome of a complete episode of acute otitis media.

    PubMed

    Hernandez, Michelle; Leichtle, Anke; Pak, Kwang; Webster, Nicholas J; Wasserman, Stephen I; Ryan, Allen F

    2015-04-03

    Otitis media is the most common disease of childhood, and represents an important health challenge to the 10-15% of children who experience chronic/recurrent middle ear infections. The middle ear undergoes extensive modifications during otitis media, potentially involving changes in the expression of many genes. Expression profiling offers an opportunity to discover novel genes and pathways involved in this common childhood disease. The middle ears of 320 WBxB6 F1 hybrid mice were inoculated with non-typeable Haemophilus influenzae (NTHi) or PBS (sham control). Two independent samples were generated for each time point and condition, from initiation of infection to resolution. RNA was profiled on Affymetrix mouse 430 2.0 whole-genome microarrays. Approximately 8% of the sampled transcripts defined the signature of acute NTHi-induced otitis media across time. Hierarchical clustering of signal intensities revealed several temporal gene clusters. Network and pathway enrichment analysis of these clusters identified sets of genes involved in activation of the innate immune response, negative regulation of immune response, changes in epithelial and stromal cell markers, and the recruitment/function of neutrophils and macrophages. We also identified key transcriptional regulators related to events in otitis media, which likely determine the expression of these gene clusters. A list of otitis media susceptibility genes, derived from genome-wide association and candidate gene studies, was significantly enriched during the early induction phase and the middle re-modeling phase of otitis but not in the resolution phase. Our results further indicate that positive versus negative regulation of inflammatory processes occur with highly similar kinetics during otitis media, underscoring the importance of anti-inflammatory responses in controlling pathogenesis. The results characterize the global gene response during otitis media and identify key signaling and transcription factor networks that control the defense of the middle ear against infection. These networks deserve further attention, as dysregulated immune defense and inflammatory responses may contribute to recurrent or chronic otitis in children.

  5. Expression of Arabidopsis FCS-Like Zinc finger genes is differentially regulated by sugars, cellular energy level, and abiotic stress.

    PubMed

    Jamsheer K, Muhammed; Laxmi, Ashverya

    2015-01-01

    Cellular energy status is an important regulator of plant growth, development, and stress mitigation. Environmental stresses ultimately lead to energy deficit in the cell which activates the SNF1-RELATED KINASE 1 (SnRK1) signaling cascade which eventually triggering a massive reprogramming of transcription to enable the plant to survive under low-energy conditions. The role of Arabidopsis thaliana FCS-Like Zinc finger (FLZ) gene family in energy and stress signaling is recently come to highlight after their interaction with kinase subunits of SnRK1 were identified. In a detailed expression analysis in different sugars, energy starvation, and replenishment series, we identified that the expression of most of the FLZ genes is differentially modulated by cellular energy level. It was found that FLZ gene family contains genes which are both positively and negatively regulated by energy deficit as well as energy-rich conditions. Genetic and pharmacological studies identified the role of HEXOKINASE 1- dependent and energy signaling pathways in the sugar-induced expression of FLZ genes. Further, these genes were also found to be highly responsive to different stresses as well as abscisic acid. In over-expression of kinase subunit of SnRK1, FLZ genes were found to be differentially regulated in accordance with their response toward energy fluctuation suggesting that these genes may work downstream to the established SnRK1 signaling under low-energy stress. Taken together, the present study provides a conceptual framework for further studies related to SnRK1-FLZ interaction in relation to sugar and energy signaling and stress response.

  6. Initial leukemic gene expression profiles of patients with poor in vivo prednisone response are similar to those of blasts persisting under prednisone treatment in childhood acute lymphoblastic leukemia.

    PubMed

    Cario, Gunnar; Fetz, Andrea; Bretscher, Christian; Möricke, Anja; Schrauder, Andre; Stanulla, Martin; Schrappe, Martin

    2008-09-01

    Response to initial glucocorticoid (GC) treatment is a strong prognostic factor in childhood acute lymphoblastic leukemia (ALL). Patients with a poor prednisone response (PPR) have a poor event-free survival as compared to those with a good prednisone response (PGR). Causes of prednisone resistance are still not well understood. We hypothesized that GC resistance is an intrinsic feature of ALL cells which is reflected in the gene expression pattern and analyzed genome-wide gene expression using microarrays. A case-control study was performed comparing gene expression profiles from initial ALL samples of 20 patients with PPR and those of 20 patients with PGR. Differential gene expression of a subset of genes was confirmed by real-time quantitative polymerase chain reaction analysis and validation was performed in a second independent patient sample (n=20). We identified 121 genes that clearly distinguished prednisone-resistant from sensitive ALL samples (FDR<5%, fold change>or=1.5). Differential gene expression of 21 of these genes could be validated in a second independent set. Of importance, there was a remarkable concordance of genes identified by comparing expression signatures of PPR and PGR cells at diagnosis and those previously described to be up- or downregulated in leukemic cells persisting under GC treatment. Thus, GC resistance seems at least in part to be an intrinsic feature of leukemic cells. Leukemic cells of patients with PPR are characterized by gene expression pattern which are similar to those of resistant cells persisting under glucocorticoid treatment.

  7. Dynamics of the yeast transcriptome during wine fermentation reveals a novel fermentation stress response

    PubMed Central

    Marks, Virginia D.; Ho Sui, Shannan J.; Erasmus, Daniel; van der Merwe, George K.; Brumm, Jochen; Wasserman, Wyeth W.; Bryan, Jennifer; van Vuuren, Hennie J. J.

    2016-01-01

    In this study, genome-wide expression analyses were used to study the response of Saccharomyces cerevisiae to stress throughout a 15-day wine fermentation. Forty per cent of the yeast genome significantly changed expression levels to mediate long-term adaptation to fermenting grape must. Among the genes that changed expression levels, a group of 223 genes was identified, which was designated as fermentation stress response (FSR) genes that were dramatically induced at various points during fermentation. FSR genes sustain high levels of induction up to the final time point and exhibited changes in expression levels ranging from four- to 80-fold. The FSR is novel; 62% of the genes involved have not been implicated in global stress responses and 28% of the FSR genes have no functional annotation. Genes involved in respiratory metabolism and gluconeogenesis were expressed during fermentation despite the presence of high concentrations of glucose. Ethanol, rather than nutrient depletion, seems to be responsible for entry of yeast cells into the stationary phase. PMID:18215224

  8. Proteomic characterization of the Rph15 barley resistance gene-mediated defence responses to leaf rust

    PubMed Central

    2012-01-01

    Background Leaf rust, caused by the biotrophic fungal pathogen Puccinia hordei, is one of the most important foliar disease of barley (Hordeum vulgare) and represents a serious threat in many production regions of the world. The leaf rust resistance gene Rph15 is of outstanding interest for resistance breeding because it confers resistance to over 350 Puccinia hordei isolates collected from around the world. Molecular and biochemical mechanisms responsible for the Rph15 effectiveness are currently not investigated. The aim of the present work was to study the Rph15-based defence responses using a proteomic approach. Results Protein pattern changes in response to the leaf rust pathogen infection were investigated in two barley near isogenic lines (NILs), Bowman (leaf rust susceptible) and Bowman-Rph15 (leaf rust resistant), differing for the introgression of the leaf rust resistance gene Rph15. Two infection time points, 24 hours and four days post inoculation (dpi), were analysed. No statistically significant differences were identified at the early time point, while at 4 dpi eighteen protein spots were significantly up or down regulated with a fold-change equal or higher than two in response to pathogen infection. Almost all the pathogen-responsive proteins were identified in the Bowman-Rph15 resistant NIL. Protein spots were characterized by LC-MS/MS analysis and found to be involved in photosynthesis and energy metabolism, carbohydrate metabolism, protein degradation and defence. Proteomic data were complemented by transcriptional analysis of the respective genes. The identified proteins can be related to modulation of the photosynthetic apparatus components, re-direction of the metabolism to sustain defence responses and deployment of defence proteins. Conclusions The identification of leaf rust infection-modulated defence responses restricted to the resistant NIL support the hypothesis that basal defence responses of Bowman, but not the Rph15 resistance gene-based ones, are suppressed or delayed by pathogen effectors to levels below the detection power of the adopted proteomic approach. Additionally, Rph15-mediated resistance processes identified mainly resides on a modulation of primary metabolism, affecting photosyntesis and carbohydrate pool. PMID:23167439

  9. Genome-wide screen identifies a novel p97/CDC-48-dependent pathway regulating ER-stress-induced gene transcription.

    PubMed

    Marza, Esther; Taouji, Saïd; Barroso, Kim; Raymond, Anne-Aurélie; Guignard, Léo; Bonneu, Marc; Pallares-Lupon, Néstor; Dupuy, Jean-William; Fernandez-Zapico, Martin E; Rosenbaum, Jean; Palladino, Francesca; Dupuy, Denis; Chevet, Eric

    2015-03-01

    The accumulation of misfolded proteins in the endoplasmic reticulum (ER) activates the Unfolded Protein Response (UPR(ER)) to restore ER homeostasis. The AAA(+) ATPase p97/CDC-48 plays key roles in ER stress by promoting both ER protein degradation and transcription of UPR(ER) genes. Although the mechanisms associated with protein degradation are now well established, the molecular events involved in the regulation of gene transcription by p97/CDC-48 remain unclear. Using a reporter-based genome-wide RNAi screen in combination with quantitative proteomic analysis in Caenorhabditis elegans, we have identified RUVB-2, a AAA(+) ATPase, as a novel repressor of a subset of UPR(ER) genes. We show that degradation of RUVB-2 by CDC-48 enhances expression of ER stress response genes through an XBP1-dependent mechanism. The functional interplay between CDC-48 and RUVB-2 in controlling transcription of select UPR(ER) genes appears conserved in human cells. Together, these results describe a novel role for p97/CDC-48, whereby its role in protein degradation is integrated with its role in regulating expression of ER stress response genes. © 2015 The Authors.

  10. Genome-wide screen identifies a novel p97/CDC-48-dependent pathway regulating ER-stress-induced gene transcription

    PubMed Central

    Marza, Esther; Taouji, Saïd; Barroso, Kim; Raymond, Anne-Aurélie; Guignard, Léo; Bonneu, Marc; Pallares-Lupon, Néstor; Dupuy, Jean-William; Fernandez-Zapico, Martin E; Rosenbaum, Jean; Palladino, Francesca; Dupuy, Denis; Chevet, Eric

    2015-01-01

    The accumulation of misfolded proteins in the endoplasmic reticulum (ER) activates the Unfolded Protein Response (UPRER) to restore ER homeostasis. The AAA+ ATPase p97/CDC-48 plays key roles in ER stress by promoting both ER protein degradation and transcription of UPRER genes. Although the mechanisms associated with protein degradation are now well established, the molecular events involved in the regulation of gene transcription by p97/CDC-48 remain unclear. Using a reporter-based genome-wide RNAi screen in combination with quantitative proteomic analysis in Caenorhabditis elegans, we have identified RUVB-2, a AAA+ ATPase, as a novel repressor of a subset of UPRER genes. We show that degradation of RUVB-2 by CDC-48 enhances expression of ER stress response genes through an XBP1-dependent mechanism. The functional interplay between CDC-48 and RUVB-2 in controlling transcription of select UPRER genes appears conserved in human cells. Together, these results describe a novel role for p97/CDC-48, whereby its role in protein degradation is integrated with its role in regulating expression of ER stress response genes. PMID:25652260

  11. Transcriptomic profiling of TK2 deficient human skeletal muscle suggests a role for the p53 signalling pathway and identifies growth and differentiation factor-15 as a potential novel biomarker for mitochondrial myopathies

    PubMed Central

    2014-01-01

    Background Mutations in the gene encoding thymidine kinase 2 (TK2) result in the myopathic form of mitochondrial DNA depletion syndrome which is a mitochondrial encephalomyopathy presenting in children. In order to unveil some of the mechanisms involved in this pathology and to identify potential biomarkers and therapeutic targets we have investigated the gene expression profile of human skeletal muscle deficient for TK2 using cDNA microarrays. Results We have analysed the whole transcriptome of skeletal muscle from patients with TK2 mutations and compared it to normal muscle and to muscle from patients with other mitochondrial myopathies. We have identified a set of over 700 genes which are differentially expressed in TK2 deficient muscle. Bioinformatics analysis reveals important changes in muscle metabolism, in particular, in glucose and glycogen utilisation, and activation of the starvation response which affects aminoacid and lipid metabolism. We have identified those transcriptional regulators which are likely to be responsible for the observed changes in gene expression. Conclusion Our data point towards the tumor suppressor p53 as the regulator at the centre of a network of genes which are responsible for a coordinated response to TK2 mutations which involves inflammation, activation of muscle cell death by apoptosis and induction of growth and differentiation factor 15 (GDF-15) in muscle and serum. We propose that GDF-15 may represent a potential novel biomarker for mitochondrial dysfunction although further studies are required. PMID:24484525

  12. Identification and expression profiles of multiple genes in Nile tilapia in response to bacterial infections

    USDA-ARS?s Scientific Manuscript database

    To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...

  13. Cadmium, cobalt and lead cause stress response, cell cycle deregulation and increased steroid as well as xenobiotic metabolism in primary normal human bronchial epithelial cells which is coordinated by at least nine transcription factors.

    PubMed

    Glahn, Felix; Schmidt-Heck, Wolfgang; Zellmer, Sebastian; Guthke, Reinhard; Wiese, Jan; Golka, Klaus; Hergenröder, Roland; Degen, Gisela H; Lehmann, Thomas; Hermes, Matthias; Schormann, Wiebke; Brulport, Marc; Bauer, Alexander; Bedawy, Essam; Gebhardt, Rolf; Hengstler, Jan G; Foth, Heidi

    2008-08-01

    Workers occupationally exposed to cadmium, cobalt and lead have been reported to have increased levels of DNA damage. To analyze whether in vivo relevant concentrations of heavy metals cause systematic alterations in RNA expression patterns, we performed a gene array study using primary normal human bronchial epithelial cells. Cells were incubated with 15 microg/l Cd(II), 25 microg/l Co(II) and 550 microg/l Pb(II) either with individual substances or in combination. Differentially expressed genes were filtered out and used to identify enriched GO categories as well as KEGG pathways and to identify transcription factors whose binding sites are enriched in a given set of promoters. Interestingly, combined exposure to Cd(II), Co(II) and Pb(II) caused a coordinated response of at least seven stress response-related transcription factors, namely Oct-1, HIC1, TGIF, CREB, ATF4, SRF and YY1. A stress response was further corroborated by up regulation of genes involved in glutathione metabolism. A second major response to heavy metal exposure was deregulation of the cell cycle as evidenced by down regulation of the transcription factors ELK-1 and the Ets transcription factor GABP, as well as deregulation of genes involved in purine and pyrimidine metabolism. A third and surprising response was up regulation of genes involved in steroid metabolism, whereby promoter analysis identified up regulation of SRY that is known to play a role in sex determination. A forth response was up regulation of xenobiotic metabolising enzymes, particularly of dihydrodiol dehydrogenases 1 and 2 (AKR1C1, AKR1C2). Incubations with individual heavy metals showed that the response of AKR1C1 and AKR1C2 was predominantly caused by lead. In conclusion, we have shown that in vivo relevant concentrations of Cd(II), Co(II) and Pb(II) cause a complex and coordinated response in normal human bronchial epithelial cells. This study gives an overview of the most responsive genes.

  14. Identification of the Full 46 Cytochrome P450 (CYP) Complement and Modulation of CYP Expression in Response to Water-Accommodated Fractions of Crude Oil in the Cyclopoid Copepod Paracyclopina nana.

    PubMed

    Han, Jeonghoon; Won, Eun-Ji; Kim, Hui-Su; Nelson, David R; Lee, Su-Jae; Park, Heum Gi; Lee, Jae-Seong

    2015-06-02

    The 46 cytochrome P450 (CYP) gene superfamily was identified in the marine copepod Paracyclopina nana after searching an RNA-seq database and comparing it with other copepod CYP gene families. To annotate the 46 Pn-CYP genes, a phylogenetic analysis of CYP genes was performed using a Bayesian method. Pn-CYP genes were separated into five different clans: CYP2, CYP3, CYP20, CYP26, and mitochondrial. Among these, the principal Pn-CYP genes involved in detoxification were identified by comparing them with those of the copepod Tigriopus japonicus and were examined with respect to their responses to exposure to a water-accommodated fraction (WAF) of crude oil and to the alkylated forms of two polycyclic aromatic hydrocarbons (PAHs; phenanthrene and fluorene). The expression of two Pn-CYP3027 genes (CYP3027F1 and CYP3027F2) was increased in response to WAF exposure and also was upregulated in response to the two alkylated PAHs. In particular, Pn-CYP3027F2 showed the most notable increase in response to 80% WAF exposure. These two responsive CYP genes (Pn-CYP3027F1 and CYP3027F2) were also phylogenetically clustered into the same clade of the WAF- and alkylated PAH-specific CYP genes of the copepod T. japonicus, suggesting that these CYP genes would be those chiefly involved in detoxification in response to WAF exposure in copepods. In this paper, we provide information on the copepod P. nana CYP gene superfamily and also speculate on its potential role in the detoxification of PAHs in marine copepods. Despite the nonlethality of WAF, Pn-CYP3027F2 was rapidly and significantly upregulated in response to WAF that may serve as a useful biomarker of 40% or higher concentration of WAF exposure. This paper will be helpful to better understand the molecular mechanistic events underlying the metabolism of environmental toxicants in copepods.

  15. Methyl jasmonate as a vital substance in plants.

    PubMed

    Cheong, Jong-Joo; Choi, Yang Do

    2003-07-01

    The plant floral scent methyl jasmonate (MeJA) has been identified as a vital cellular regulator that mediates diverse developmental processes and defense responses against biotic and abiotic stresses. The pleiotropic effects of MeJA have raised numerous questions about its regulation for biogenesis and mode of action. Characterization of the gene encoding jasmonic acid carboxyl methyltransferase has provided basic information on the role(s) of this phytohormone in gene-activation control and systemic long-distance signaling. Recent approaches using functional genomics and bioinformatics have identified a whole set of MeJA-responsive genes, and provide insights into how plants use volatile signals to withstand diverse and variable environments.

  16. Identification and fine mapping of a stay-green gene (Brnye1) in pakchoi (Brassica campestris L. ssp. chinensis).

    PubMed

    Wang, Nan; Liu, Zhiyong; Zhang, Yun; Li, Chengyu; Feng, Hui

    2018-03-01

    Using bulked segregant analysis combined with next-generation sequencing, we delimited the Brnye1 gene responsible for the stay-green trait of nye in pakchoi. Sequence analysis identified Bra019346 as the candidate gene. "Stay-green" refers to a plant trait whereby leaves remain green during senescence. This trait is useful in the cultivation of pakchoi (Brassica campestris L. ssp. chinensis), which is marketed as a green leaf product. This study aimed to identify the gene responsible for the stay-green trait in pakchoi. We identified a stay-green mutant in pakchoi, which we termed "nye". Genetic analysis revealed that the stay-green trait is controlled by a single recessive gene, Brnye1. Using the BSA-seq method, a 3.0-Mb candidate region was mapped on chromosome A03, which helped us localize Brnye1 to an 81.01-kb interval between SSR markers SSRWN27 and SSRWN30 via linkage analysis in an F 2 population. We identified 12 genes in this region, 11 of which were annotated based on the Brassica rapa annotation database, and one was a functionally unknown gene. An orthologous gene of the Arabidopsis gene AtNYE1, Bra019346, was identified as the potential candidate for Brnye1. Sequence analysis revealed a 40-bp insertion in the second exon of Bra019346 in nye, which generated the TAA stop codon. A candidate gene-specific Indel marker in 1561 F 2 individuals showed perfect cosegregation with Brnye1 in the nye mutant. These results provide a foundation for uncovering the molecular mechanism of the stay-green trait in pakchoi.

  17. Heterogeneous activation of the TGFβ pathway in glioblastomas identified by gene expression-based classification using TGFβ-responsive genes

    PubMed Central

    Xu, Xie L; Kapoun, Ann M

    2009-01-01

    Background TGFβ has emerged as an attractive target for the therapeutic intervention of glioblastomas. Aberrant TGFβ overproduction in glioblastoma and other high-grade gliomas has been reported, however, to date, none of these reports has systematically examined the components of TGFβ signaling to gain a comprehensive view of TGFβ activation in large cohorts of human glioma patients. Methods TGFβ activation in mammalian cells leads to a transcriptional program that typically affects 5–10% of the genes in the genome. To systematically examine the status of TGFβ activation in high-grade glial tumors, we compiled a gene set of transcriptional response to TGFβ stimulation from tissue culture and in vivo animal studies. These genes were used to examine the status of TGFβ activation in high-grade gliomas including a large cohort of glioblastomas. Unsupervised and supervised classification analysis was performed in two independent, publicly available glioma microarray datasets. Results Unsupervised and supervised classification using the TGFβ-responsive gene list in two independent glial tumor gene expression data sets revealed various levels of TGFβ activation in these tumors. Among glioblastomas, one of the most devastating human cancers, two subgroups were identified that showed distinct TGFβ activation patterns as measured from transcriptional responses. Approximately 62% of glioblastoma samples analyzed showed strong TGFβ activation, while the rest showed a weak TGFβ transcriptional response. Conclusion Our findings suggest heterogeneous TGFβ activation in glioblastomas, which may cause potential differences in responses to anti-TGFβ therapies in these two distinct subgroups of glioblastomas patients. PMID:19192267

  18. Transcriptome analysis of reproductive-stage Arabidopsis plants exposed gamma-ray irradiation at various doses.

    PubMed

    Hwang, Sun-Goo; Kim, Dong Sub; Kim, Jin-Baek; Hwang, Jung Eun; Park, Hyun Mi; Kim, Jin Hyuk; Jang, Cheol Seong

    2016-08-01

    Gamma rays (GR) induce significant changes in the structure and expression of genes involved in the regulation of diverse biochemical and physiological processes. Arabidopsis plants exhibit different growth and development patterns in response to exposure to GR. The effects on gene expression of different radiation doses of GR (100 and 800 Gy) administered to Arabidopsis plants were examined at the reproductive stage. We irradiated 26-day-old plants with three replications [developmental stages 5.1-6.0, according to Boyes et al. ( 2001 )] using a GR irradiator (60 Co, ca. 150 TBq capacity, Atomic Energy of Canada Limited, Ontario, Canada) at the Korea Atomic Energy Research Institute. Plants were treated with 100, 200, 300, 400, 800, 1200, 1600, or 2000 Gy, and the doses were made from varying the distance to the source. We conducted a high-throughput screening analysis and detected 883 GR-responsive genes that showed significant changes; these were involved in several putative metabolic pathways related to biotic stress. Additionally, five overrepresented cis-regulatory elements were identified in the 1-kb upstream regions of GR-responsive genes by using motif enrichment analysis. We also detected three GR-responsive genes associated with stamen development and confirmed their co-regulation with functionally interacting genes. This finding suggests that a network-based analysis is a viable approach to identify significant GR-responsive genes associated with the reproductive stage of Arabidopsis. Our results provide further insights into the complex biological systems involved in the response to different doses of GR in plants.

  19. Common Marker Genes Identified from Various Sample Types for Systemic Lupus Erythematosus.

    PubMed

    Bing, Peng-Fei; Xia, Wei; Wang, Lan; Zhang, Yong-Hong; Lei, Shu-Feng; Deng, Fei-Yan

    2016-01-01

    Systemic lupus erythematosus (SLE) is a complex auto-immune disease. Gene expression studies have been conducted to identify SLE-related genes in various types of samples. It is unknown whether there are common marker genes significant for SLE but independent of sample types, which may have potentials for follow-up translational research. The aim of this study is to identify common marker genes across various sample types for SLE. Based on four public microarray gene expression datasets for SLE covering three representative types of blood-born samples (monocyte; peripheral blood mononuclear cell, PBMC; whole blood), we utilized three statistics (fold-change, FC; t-test p value; false discovery rate adjusted p value) to scrutinize genes simultaneously regulated with SLE across various sample types. For common marker genes, we conducted the Gene Ontology enrichment analysis and Protein-Protein Interaction analysis to gain insights into their functions. We identified 10 common marker genes associated with SLE (IFI6, IFI27, IFI44L, OAS1, OAS2, EIF2AK2, PLSCR1, STAT1, RNASE2, and GSTO1). Significant up-regulation of IFI6, IFI27, and IFI44L with SLE was observed in all the studied sample types, though the FC was most striking in monocyte, compared with PBMC and whole blood (8.82-251.66 vs. 3.73-74.05 vs. 1.19-1.87). Eight of the above 10 genes, except RNASE2 and GSTO1, interact with each other and with known SLE susceptibility genes, participate in immune response, RNA and protein catabolism, and cell death. Our data suggest that there exist common marker genes across various sample types for SLE. The 10 common marker genes, identified herein, deserve follow-up studies to dissert their potentials as diagnostic or therapeutic markers to predict SLE or treatment response.

  20. An Alternative σ Factor, σ8, Controls Avermectin Production and Multiple Stress Responses in Streptomyces avermitilis.

    PubMed

    Sun, Di; Wang, Qian; Chen, Zhi; Li, Jilun; Wen, Ying

    2017-01-01

    Alternative σ factors in bacteria redirect RNA polymerase to recognize alternative promoters, thereby facilitating coordinated gene expression necessary for adaptive responses. The gene sig8 ( sav_741 ) in Streptomyces avermitilis encodes an alternative σ factor, σ 8 , highly homologous to σ B in Streptomyces coelicolor . Studies reported here demonstrate that σ 8 is an important regulator of both avermectin production and stress responses in S. avermitilis . σ 8 inhibited avermectin production by indirectly repressing expression of cluster-situated activator gene aveR , and by directly initiating transcription of its downstream gene sav_742 , which encodes a direct repressor of ave structural genes. σ 8 had no effect on cell growth or morphological differentiation under normal growth conditions. Growth of a sig8- deletion mutant was less than that of wild-type strain on YMS plates following treatment with heat, H 2 O 2 , diamide, NaCl, or KCl. sig8 transcription was strongly induced by these environmental stresses, indicating response by σ 8 itself. A series of σ 8 -dependent genes responsive to heat, oxidative and osmotic stress were identified by EMSAs, qRT-PCR and in vitro transcription experiments. These findings indicate that σ 8 plays an important role in mediating protective responses to various stress conditions by activating transcription of its target genes. Six σ 8 -binding promoter sequences were determined and consensus binding sequence BGVNVH-N 15 -GSNNHH (B: C, T or G, V: A, C or G, S: C or G, H: A, C or T, N: any nucleotide) was identified, leading to prediction of the σ 8 regulon. The list consists of 940 putative σ 8 target genes, assignable to 17 functional groups, suggesting the wide range of cellular functions controlled by σ 8 in S. avermitilis .

  1. Gene Expression Ratios Lead to Accurate and Translatable Predictors of DR5 Agonism across Multiple Tumor Lineages.

    PubMed

    Reddy, Anupama; Growney, Joseph D; Wilson, Nick S; Emery, Caroline M; Johnson, Jennifer A; Ward, Rebecca; Monaco, Kelli A; Korn, Joshua; Monahan, John E; Stump, Mark D; Mapa, Felipa A; Wilson, Christopher J; Steiger, Janine; Ledell, Jebediah; Rickles, Richard J; Myer, Vic E; Ettenberg, Seth A; Schlegel, Robert; Sellers, William R; Huet, Heather A; Lehár, Joseph

    2015-01-01

    Death Receptor 5 (DR5) agonists demonstrate anti-tumor activity in preclinical models but have yet to demonstrate robust clinical responses. A key limitation may be the lack of patient selection strategies to identify those most likely to respond to treatment. To overcome this limitation, we screened a DR5 agonist Nanobody across >600 cell lines representing 21 tumor lineages and assessed molecular features associated with response. High expression of DR5 and Casp8 were significantly associated with sensitivity, but their expression thresholds were difficult to translate due to low dynamic ranges. To address the translational challenge of establishing thresholds of gene expression, we developed a classifier based on ratios of genes that predicted response across lineages. The ratio classifier outperformed the DR5+Casp8 classifier, as well as standard approaches for feature selection and classification using genes, instead of ratios. This classifier was independently validated using 11 primary patient-derived pancreatic xenograft models showing perfect predictions as well as a striking linearity between prediction probability and anti-tumor response. A network analysis of the genes in the ratio classifier captured important biological relationships mediating drug response, specifically identifying key positive and negative regulators of DR5 mediated apoptosis, including DR5, CASP8, BID, cFLIP, XIAP and PEA15. Importantly, the ratio classifier shows translatability across gene expression platforms (from Affymetrix microarrays to RNA-seq) and across model systems (in vitro to in vivo). Our approach of using gene expression ratios presents a robust and novel method for constructing translatable biomarkers of compound response, which can also probe the underlying biology of treatment response.

  2. Gene Expression Ratios Lead to Accurate and Translatable Predictors of DR5 Agonism across Multiple Tumor Lineages

    PubMed Central

    Reddy, Anupama; Growney, Joseph D.; Wilson, Nick S.; Emery, Caroline M.; Johnson, Jennifer A.; Ward, Rebecca; Monaco, Kelli A.; Korn, Joshua; Monahan, John E.; Stump, Mark D.; Mapa, Felipa A.; Wilson, Christopher J.; Steiger, Janine; Ledell, Jebediah; Rickles, Richard J.; Myer, Vic E.; Ettenberg, Seth A.; Schlegel, Robert; Sellers, William R.

    2015-01-01

    Death Receptor 5 (DR5) agonists demonstrate anti-tumor activity in preclinical models but have yet to demonstrate robust clinical responses. A key limitation may be the lack of patient selection strategies to identify those most likely to respond to treatment. To overcome this limitation, we screened a DR5 agonist Nanobody across >600 cell lines representing 21 tumor lineages and assessed molecular features associated with response. High expression of DR5 and Casp8 were significantly associated with sensitivity, but their expression thresholds were difficult to translate due to low dynamic ranges. To address the translational challenge of establishing thresholds of gene expression, we developed a classifier based on ratios of genes that predicted response across lineages. The ratio classifier outperformed the DR5+Casp8 classifier, as well as standard approaches for feature selection and classification using genes, instead of ratios. This classifier was independently validated using 11 primary patient-derived pancreatic xenograft models showing perfect predictions as well as a striking linearity between prediction probability and anti-tumor response. A network analysis of the genes in the ratio classifier captured important biological relationships mediating drug response, specifically identifying key positive and negative regulators of DR5 mediated apoptosis, including DR5, CASP8, BID, cFLIP, XIAP and PEA15. Importantly, the ratio classifier shows translatability across gene expression platforms (from Affymetrix microarrays to RNA-seq) and across model systems (in vitro to in vivo). Our approach of using gene expression ratios presents a robust and novel method for constructing translatable biomarkers of compound response, which can also probe the underlying biology of treatment response. PMID:26378449

  3. Mechanical Stress Induces Biotic and Abiotic Stress Responses via a Novel cis-Element

    PubMed Central

    Walley, Justin W; Coughlan, Sean; Hudson, Matthew E; Covington, Michael F; Kaspi, Roy; Banu, Gopalan; Harmer, Stacey L; Dehesh, Katayoon

    2007-01-01

    Plants are continuously exposed to a myriad of abiotic and biotic stresses. However, the molecular mechanisms by which these stress signals are perceived and transduced are poorly understood. To begin to identify primary stress signal transduction components, we have focused on genes that respond rapidly (within 5 min) to stress signals. Because it has been hypothesized that detection of physical stress is a mechanism common to mounting a response against a broad range of environmental stresses, we have utilized mechanical wounding as the stress stimulus and performed whole genome microarray analysis of Arabidopsis thaliana leaf tissue. This led to the identification of a number of rapid wound responsive (RWR) genes. Comparison of RWR genes with published abiotic and biotic stress microarray datasets demonstrates a large overlap across a wide range of environmental stresses. Interestingly, RWR genes also exhibit a striking level and pattern of circadian regulation, with induced and repressed genes displaying antiphasic rhythms. Using bioinformatic analysis, we identified a novel motif overrepresented in the promoters of RWR genes, herein designated as the Rapid Stress Response Element (RSRE). We demonstrate in transgenic plants that multimerized RSREs are sufficient to confer a rapid response to both biotic and abiotic stresses in vivo, thereby establishing the functional involvement of this motif in primary transcriptional stress responses. Collectively, our data provide evidence for a novel cis-element that is distributed across the promoters of an array of diverse stress-responsive genes, poised to respond immediately and coordinately to stress signals. This structure suggests that plants may have a transcriptional network resembling the general stress signaling pathway in yeast and that the RSRE element may provide the key to this coordinate regulation. PMID:17953483

  4. Pre-silencing of genes involved in the electron transport chain (ETC) pathway is associated with responsiveness to abatacept in rheumatoid arthritis.

    PubMed

    Derambure, C; Dzangue-Tchoupou, G; Berard, C; Vergne, N; Hiron, M; D'Agostino, M A; Musette, P; Vittecoq, O; Lequerré, T

    2017-05-25

    In the current context of personalized medicine, one of the major challenges in the management of rheumatoid arthritis (RA) is to identify biomarkers that predict drug responsiveness. From the European APPRAISE trial, our main objective was to identify a gene expression profile associated with responsiveness to abatacept (ABA) + methotrexate (MTX) and to understand the involvement of this signature in the pathophysiology of RA. Whole human genome microarrays (4 × 44 K) were performed from a first subset of 36 patients with RA. Data validation by quantitative reverse-transcription (qRT)-PCR was performed from a second independent subset of 32 patients with RA. Gene Ontology and WikiPathways database allowed us to highlight the specific biological mechanisms involved in predicting response to ABA/MTX. From the first subset of 36 patients with RA, a combination including 87 transcripts allowed almost perfect separation between responders and non-responders to ABA/MTX. Next, the second subset of patients 32 with RA allowed validation by qRT-PCR of a minimal signature with only four genes. This latter signature categorized 81% of patients with RA with 75% sensitivity, 85% specificity and 85% negative predictive value. This combination showed a significant enrichment of genes involved in electron transport chain (ETC) pathways. Seven transcripts from ETC pathways (NDUFA6, NDUFA4, UQCRQ, ATP5J, COX7A2, COX7B, COX6A1) were significantly downregulated in responders versus non-responders to ABA/MTX. Moreover, dysregulation of these genes was independent of inflammation and was specific to ABA response. Pre-silencing of ETC genes is associated with future response to ABA/MTX and might be a crucial key to susceptibility to ABA response.

  5. Expression profiling of marker genes responsive to the defence-associated phytohormones salicylic acid, jasmonic acid and ethylene in Brachypodium distachyon.

    PubMed

    Kouzai, Yusuke; Kimura, Mamiko; Yamanaka, Yurie; Watanabe, Megumi; Matsui, Hidenori; Yamamoto, Mikihiro; Ichinose, Yuki; Toyoda, Kazuhiro; Onda, Yoshihiko; Mochida, Keiichi; Noutoshi, Yoshiteru

    2016-03-02

    Brachypodium distachyon is a promising model plants for grasses. Infections of Brachypodium by various pathogens that severely impair crop production have been reported, and the species accordingly provides an alternative platform for investigating molecular mechanisms of pathogen virulence and plant disease resistance. To date, we have a broad picture of plant immunity only in Arabidopsis and rice; therefore, Brachypodium may constitute a counterpart that displays the commonality and uniqueness of defence systems among plant species. Phytohormones play key roles in plant biotic stress responses, and hormone-responsive genes are used to qualitatively and quantitatively evaluate disease resistance responses during pathogen infection. For these purposes, defence-related phytohormone marker genes expressed at time points suitable for defence-response monitoring are needed. Information about their expression profiles over time as well as their response specificity is also helpful. However, useful marker genes are still rare in Brachypodium. We selected 34 candidates for Brachypodium marker genes on the basis of protein-sequence similarity to known marker genes used in Arabidopsis and rice. Brachypodium plants were treated with the defence-related phytohormones salicylic acid, jasmonic acid and ethylene, and their transcription levels were measured 24 and 48 h after treatment. Two genes for salicylic acid, 7 for jasmonic acid and 2 for ethylene were significantly induced at either or both time points. We then focused on 11 genes encoding pathogenesis-related (PR) 1 protein and compared their expression patterns with those of Arabidopsis and rice. Phylogenetic analysis suggested that Brachypodium contains several PR1-family genes similar to rice genes. Our expression profiling revealed that regulation patterns of some PR1 genes as well as of markers identified for defence-related phytohormones are closely related to those in rice. We propose that the Brachypodium immune hormone marker genes identified in this study will be useful to plant pathologists who use Brachypodium as a model pathosystem, because the timing of their transcriptional activation matches that of the disease resistance response. Our results using Brachypodium also suggest that monocots share a characteristic immune system, defined as the common defence system, that is different from that of dicots.

  6. Transcriptome mining: Multigene panel to test delousing drug response in the sea louse Caligus rogercresseyi.

    PubMed

    Valenzuela-Muñoz, V; Gallardo-Escárate, C

    2016-02-01

    Controlling infestations of copepodid ectoparasites in the salmon industry is increasingly problematic given higher instances of drug resistance or loss of sensitivity. Despite the importance of this issue, the molecular mechanisms and genes implicated in resistance/susceptibility are only scarcely understood. The objective of the present study was to identify and evaluate the expression levels of candidate genes associated with delousing drug response in the sea louse Caligus rogercresseyi. From RNA-seq data obtained for adult male and female sea lice, 62.48 M reads were assembled in 70,349 high-quality contigs. BLASTX analysis against UniprotKB/Swiss-Prot and the ESTs available for crustaceans in the NCBI database identified 870 transcripts previously related to genes associated with delousing drug response. Furthermore, 14 candidate genes were validated through RT-qPCR and were evaluated with deltamethrin and azamethiphos bioassays. The results evidenced an overregulation of genes involved in ion transport in salmon lice treated with deltamethrin, while those treated with azamethiphos evidenced an overregulation of genes such as cytochrome P450, Carboxylesterase, and acetylcholine receptors. The present study provides a multigene panel to test delousing drug response to pyrethroids and organophosphates in a highly prevalent pathogen of the Chilean salmon industry. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Genome-Wide Identification and Characterization of Warming-Related Genes in Brassica rapa ssp. pekinensis.

    PubMed

    Song, Hayoung; Dong, Xiangshu; Yi, Hankuil; Ahn, Ju Young; Yun, Keunho; Song, Myungchul; Han, Ching-Tack; Hur, Yoonkang

    2018-06-11

    For sustainable crop cultivation in the face of global warming, it is important to unravel the genetic mechanisms underlying plant adaptation to a warming climate and apply this information to breeding. Thermomorphogenesis and ambient temperature signaling pathways have been well studied in model plants, but little information is available for vegetable crops. Here, we investigated genes responsive to warming conditions from two Brassica rapa inbred lines with different geographic origins: subtropical (Kenshin) and temperate (Chiifu). Genes in Gene Ontology categories “response to heat”, “heat acclimation”, “response to light intensity”, “response to oxidative stress”, and “response to temperature stimulus” were upregulated under warming treatment in both lines, but genes involved in “response to auxin stimulus” were upregulated only in Kenshin under both warming and minor-warming conditions. We identified 16 putative high temperature (HT) adaptation-related genes, including 10 heat-shock response genes, 2 transcription factor genes, 1 splicing factor gene, and 3 others. BrPIF4 , BrROF2 , and BrMPSR1 are candidate genes that might function in HT adaptation. Auxin response, alternative splicing of BrHSFA2 , and heat shock memory appear to be indispensable for HT adaptation in B. rapa . These results lay the foundation for molecular breeding and marker development to improve warming tolerance in B. rapa .

  8. Transcriptome profiling reveals the immune response of goose T cells under selenium stimuli.

    PubMed

    Cao, Nan; Li, Wanyan; Li, Bingxin; Tian, Yunbo; Xu, Danning

    2017-12-01

    The goose is an economically important poultry species and a principal natural host of avian viruses. This study aimed to determine the effects of selenium on the immune response of geese. Under selenium stimulation, gene expression profiling was investigated using transcriptome sequencing. The selenoproteins were promoted by selenium stimulation, while the heat shock proteins, interleukin and interferons were mainly down-regulated. After comparison, 2228 differentially expressed genes were primarily involved in immune and environmental response, and infectious disease and genetic information processing related pathways were identified. Specifically, the enzymes of the lysosomes which acted as a safeguard in preventing pathogens were mostly up-regulated and six randomly selected differentially expressed genes were validated by quantitative polymerase chain reaction. In addition, the most proportional increased transcription factor family basic helix-loop-helix (bHLH) located in the 5' flank of selenoprotein P-like protein for selenium metabolism was identified by response to the selenium stimulation in this study. These analyses show that selenium can promote immune function by activating selenoproteins, transcript factors and lysosome pathway related genes, while weakening cytokine content genes in geese. © 2017 Japanese Society of Animal Science.

  9. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    PubMed

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  10. Pathway-Enriched Gene Signature Associated with 53BP1 Response to PARP Inhibition in Triple-Negative Breast Cancer.

    PubMed

    Hassan, Saima; Esch, Amanda; Liby, Tiera; Gray, Joe W; Heiser, Laura M

    2017-12-01

    Effective treatment of patients with triple-negative (ER-negative, PR-negative, HER2-negative) breast cancer remains a challenge. Although PARP inhibitors are being evaluated in clinical trials, biomarkers are needed to identify patients who will most benefit from anti-PARP therapy. We determined the responses of three PARP inhibitors (veliparib, olaparib, and talazoparib) in a panel of eight triple-negative breast cancer cell lines. Therapeutic responses and cellular phenotypes were elucidated using high-content imaging and quantitative immunofluorescence to assess markers of DNA damage (53BP1) and apoptosis (cleaved PARP). We determined the pharmacodynamic changes as percentage of cells positive for 53BP1, mean number of 53BP1 foci per cell, and percentage of cells positive for cleaved PARP. Inspired by traditional dose-response measures of cell viability, an EC 50 value was calculated for each cellular phenotype and each PARP inhibitor. The EC 50 values for both 53BP1 metrics strongly correlated with IC 50 values for each PARP inhibitor. Pathway enrichment analysis identified a set of DNA repair and cell cycle-associated genes that were associated with 53BP1 response following PARP inhibition. The overall accuracy of our 63 gene set in predicting response to olaparib in seven breast cancer patient-derived xenograft tumors was 86%. In triple-negative breast cancer patients who had not received anti-PARP therapy, the predicted response rate of our gene signature was 45%. These results indicate that 53BP1 is a biomarker of response to anti-PARP therapy in the laboratory, and our DNA damage response gene signature may be used to identify patients who are most likely to respond to PARP inhibition. Mol Cancer Ther; 16(12); 2892-901. ©2017 AACR . ©2017 American Association for Cancer Research.

  11. Expression analysis in response to drought stress in soybean: Shedding light on the regulation of metabolic pathway genes.

    PubMed

    Guimarães-Dias, Fábia; Neves-Borges, Anna Cristina; Viana, Antonio Americo Barbosa; Mesquita, Rosilene Oliveira; Romano, Eduardo; de Fátima Grossi-de-Sá, Maria; Nepomuceno, Alexandre Lima; Loureiro, Marcelo Ehlers; Alves-Ferreira, Márcio

    2012-06-01

    Metabolomics analysis of wild type Arabidopsis thaliana plants, under control and drought stress conditions revealed several metabolic pathways that are induced under water deficit. The metabolic response to drought stress is also associated with ABA dependent and independent pathways, allowing a better understanding of the molecular mechanisms in this model plant. Through combining an in silico approach and gene expression analysis by quantitative real-time PCR, the present work aims at identifying genes of soybean metabolic pathways potentially associated with water deficit. Digital expression patterns of Arabidopsis genes, which were selected based on the basis of literature reports, were evaluated under drought stress condition by Genevestigator. Genes that showed strong induction under drought stress were selected and used as bait to identify orthologs in the soybean genome. This allowed us to select 354 genes of putative soybean orthologs of 79 Arabidopsis genes belonging to 38 distinct metabolic pathways. The expression pattern of the selected genes was verified in the subtractive libraries available in the GENOSOJA project. Subsequently, 13 genes from different metabolic pathways were selected for validation by qPCR experiments. The expression of six genes was validated in plants undergoing drought stress in both pot-based and hydroponic cultivation systems. The results suggest that the metabolic response to drought stress is conserved in Arabidopsis and soybean plants.

  12. Aging-dependent alterations in gene expression and a mitochondrial signature of responsiveness to human influenza vaccination.

    PubMed

    Thakar, Juilee; Mohanty, Subhasis; West, A Phillip; Joshi, Samit R; Ueda, Ikuyo; Wilson, Jean; Meng, Hailong; Blevins, Tamara P; Tsang, Sui; Trentalange, Mark; Siconolfi, Barbara; Park, Koonam; Gill, Thomas M; Belshe, Robert B; Kaech, Susan M; Shadel, Gerald S; Kleinstein, Steven H; Shaw, Albert C

    2015-01-01

    To elucidate gene expression pathways underlying age-associated impairment in influenza vaccine response, we screened young (age 21-30) and older (age≥65) adults receiving influenza vaccine in two consecutive seasons and identified those with strong or absent response to vaccine, including a subset of older adults meeting criteria for frailty. PBMCs obtained prior to vaccination (Day 0) and at day 2 or 4, day 7 and day 28 post-vaccine were subjected to gene expression microarray analysis. We defined a response signature and also detected induction of a type I interferon response at day 2 and a plasma cell signature at day 7 post-vaccine in young responders. The response signature was dysregulated in older adults, with the plasma cell signature induced at day 2, and was never induced in frail subjects (who were all non-responders). We also identified a mitochondrial signature in young vaccine responders containing genes mediating mitochondrial biogenesis and oxidative phosphorylation that was consistent in two different vaccine seasons and verified by analyses of mitochondrial content and protein expression. These results represent the first genome-wide transcriptional profiling analysis of age-associated dynamics following influenza vaccination, and implicate changes in mitochondrial biogenesis and function as a critical factor in human vaccine responsiveness.

  13. Comparative Response of the Hepatic Transcriptomes of Domesticated and Wild Turkey to Aflatoxin B₁.

    PubMed

    Reed, Kent M; Mendoza, Kristelle M; Abrahante, Juan E; Coulombe, Roger A

    2018-01-13

    The food-borne mycotoxin aflatoxin B₁ (AFB₁) poses a significant risk to poultry, which are highly susceptible to its hepatotoxic effects. Domesticated turkeys ( Meleagris gallopavo ) are especially sensitive, whereas wild turkeys ( M. g. silvestris ) are more resistant. AFB₁ toxicity entails bioactivation by hepatic cytochrome P450s to the electrophilic exo-AFB₁-8,9-epoxide (AFBO). Domesticated turkeys lack functional hepatic GST-mediated detoxification of AFBO, and this is largely responsible for the differences in resistance between turkey types. This study was designed to characterize transcriptional changes induced in turkey livers by AFB₁, and to contrast the response of domesticated (susceptible) and wild (more resistant) birds. Gene expression responses to AFB₁ were examined using RNA-sequencing. Statistically significant differences in gene expression were observed among treatment groups and between turkey types. Expression analysis identified 4621 genes with significant differential expression (DE) in AFB₁-treated birds compared to controls. Characterization of DE transcripts revealed genes dis-regulated in response to toxic insult with significant association of Phase I and Phase II genes and others important in cellular regulation, modulation of apoptosis, and inflammatory responses. Constitutive expression of GSTA3 was significantly higher in wild birds and was significantly higher in AFB₁-treated birds when compared to controls for both genetic groups. This pattern was also observed by qRT-PCR in other wild and domesticated turkey strains. Results of this study emphasize the differential response of these genetically distinct birds, and identify genes and pathways that are differentially altered in aflatoxicosis.

  14. Similarities in temperature-dependent gene expression plasticity across timescales in threespine stickleback (Gasterosteus aculeatus).

    PubMed

    Metzger, David C H; Schulte, Patricia M

    2018-04-14

    Phenotypic plasticity occurs at a variety of timescales, but little is known about the degree to which plastic responses at different timescales are associated with similar underlying molecular processes, which is critical for assessing the effects of plasticity on evolutionary trajectories. To address this issue, we identified differential gene expression in response to developmental temperature in the muscle transcriptome of adult threespine stickleback (Gasterosteus aculeatus) exposed to 12, 18 and 24°C until hatch and then held at 18°C for 9 months and compared these results to differential gene expression in response to adult thermal acclimation in stickleback developed at 18°C and then acclimated to 5 and 25°C as adults. Adult thermal acclimation affected the expression of 7,940 and 7,015 genes in response to cold and warm acclimation, respectively, and 4,851 of these genes responded in both treatments. In contrast, the expression of only 33 and 29 genes was affected by cold and warm development, respectively. The majority of the genes affected by developmental temperature were also affected by adult acclimation temperature. Many genes that were differentially expressed as a result of adult acclimation were associated with previously identified temperature-dependent effects on DNA methylation patterns, suggesting a role of epigenetic mechanisms in regulating gene expression plasticity during acclimation. Taken together, these results demonstrate similarities between the persistent effects of developmental plasticity on gene expression and the effects of adult thermal acclimation, emphasizing the potential for mechanistic links between plasticity acting at these different life stages. © 2018 John Wiley & Sons Ltd.

  15. Integrated analysis of miRNAs and transcriptomes in Aedes albopictus midgut reveals the differential expression profiles of immune-related genes during dengue virus serotype-2 infection.

    PubMed

    Liu, Yan-Xia; Li, Fen-Xiang; Liu, Zhuan-Zhuan; Jia, Zhi-Rong; Zhou, Yan-He; Zhang, Hao; Yan, Hui; Zhou, Xian-Qiang; Chen, Xiao-Guang

    2016-06-01

    Mosquito microRNAs (miRNAs) are involved in host-virus interaction, and have been reported to be altered by dengue virus (DENV) infection in Aedes albopictus (Diptera: Culicidae). However, little is known about the molecular mechanisms of Aedes albopictus midgut-the first organ to interact with DENV-involved in its resistance to DENV. Here we used high-throughput sequencing to characterize miRNA and messenger RNA (mRNA) expression patterns in Aedes albopictus midgut in response to dengue virus serotype 2. A total of three miRNAs and 777 mRNAs were identified to be differentially expressed upon DENV infection. For the mRNAs, we identified 198 immune-related genes and 31 of them were differentially expressed. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses also showed that the differentially expressed immune-related genes were involved in immune response. Then the differential expression patterns of six immune-related genes and three miRNAs were confirmed by real-time reverse transcription polymerase chain reaction. Furthermore, seven known miRNA-mRNA interaction pairs were identified by aligning our two datasets. These analyses of miRNA and mRNA transcriptomes provide valuable information for uncovering the DENV response genes and provide a basis for future study of the resistance mechanisms in Aedes albopictus midgut. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  16. Up-regulated transcripts in a compatible powdery mildew-grapevine interaction.

    PubMed

    Fekete, Csaba; Fung, Raymond W M; Szabó, Zoltán; Qiu, Wenping; Chang, Le; Schachtman, Daniel P; Kovács, László G

    2009-08-01

    Powdery mildews (Erysiphales) are obligate biotrophic pathogens that invade susceptible plant cells without triggering cell death. This suggests a highly adept mechanism of parasitism which enables powdery mildews to avoid detection or evade defenses by their host. To better understand this plant-pathogen interaction, we employed suppression subtractive hybridization (SSH), differential hybridization and quantitative real-time (qRT) PCR for the identification of grapevine (Vitis vinifera L.) genes that were specifically up-regulated in response to the grape powdery mildew Erysiphe necator Schwein. We identified 25 grapevine transcripts that increased in abundance upon infection in leaves of the susceptible host V. vinifera Cabernet Sauvignon. Despite the compatible interaction between the pathogen and plant, several of the E. necator-induced transcripts represented typical defense response genes. Among the transcripts identified were those that encoded a leucine-rich repeat serine/threonine kinase-like receptor, an MYB transcription factor, and two ubiquitination-associated proteins, indicating the stimulation of intracellular signal transduction and regulatory functions. A number of genes characteristic of senescence processes, including metallothioneins, a deoxyribonuclease, an aspartyl protease and a subtilase-like serine protease, also were identified. These transcripts expanded the list of previously identified E. necator-responsive grapevine genes and facilitated a more comprehensive view of the molecular events that underlie this economically important plant-pathogen interaction.

  17. Two novel male-associated peroxinectin genes are downregulated by exposure to delousing drugs in Caligus rogercresseyi.

    PubMed

    Núñez-Acuña, Gustavo; Gallardo-Escárate, Cristian

    2015-02-15

    Peroxinectin (PX) is a protein involved in cell adhesion, peroxidase activities, and the encapsulation of invaders in diverse species, including parasitic copepods. Recently, a transcript denoted peroxinectin-like was identified in the salmon louse Lepeophtheirus salmonis, and this was significantly correlated with the immune response of host fish. Thus, the PX gene is a potential candidate to evaluate host-parasite interactions, as well as to analyze responses to delousing drugs used in the salmon aquaculture industry worldwide. The objective of this study was to identify Peroxinectin transcripts in the Chilean salmon louse Caligus rogercresseyi, and to determine expression levels after exposition to the antiparasitics deltamethrin and azamethiphos. Two novel transcript homologs to peroxinectins were identified from a transcriptomic library of C. rogercresseyi. Moreover, in silico gene transcription levels were evaluated through RNA-seq analyses based on unique gene read levels in transcriptomic libraries that were constructed from sea lice exposed to delousing drugs. The identified transcripts were named Peroxinectin-Cr1 and Peroxinectin-Cr2, which, respectively, had lengths of 2543 and 2555 base pairs. Both PX transcripts were highly associated with male adults, and transcription levels were significantly reduced by deltamethrin and azamethiphos. This result suggests a modulation of peroxinectin in response to delousing drugs. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

    PubMed

    Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

    2005-09-01

    We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

  19. Genome-wide gene-based analysis suggests an association between Neuroligin 1 (NLGN1) and post-traumatic stress disorder.

    PubMed

    Kilaru, V; Iyer, S V; Almli, L M; Stevens, J S; Lori, A; Jovanovic, T; Ely, T D; Bradley, B; Binder, E B; Koen, N; Stein, D J; Conneely, K N; Wingo, A P; Smith, A K; Ressler, K J

    2016-05-24

    Post-traumatic stress disorder (PTSD) develops in only some people following trauma exposure, but the mechanisms differentially explaining risk versus resilience remain largely unknown. PTSD is heritable but candidate gene studies and genome-wide association studies (GWAS) have identified only a modest number of genes that reliably contribute to PTSD. New gene-based methods may help identify additional genes that increase risk for PTSD development or severity. We applied gene-based testing to GWAS data from the Grady Trauma Project (GTP), a primarily African American cohort, and identified two genes (NLGN1 and ZNRD1-AS1) that associate with PTSD after multiple test correction. Although the top SNP from NLGN1 did not replicate, we observed gene-based replication of NLGN1 with PTSD in the Drakenstein Child Health Study (DCHS) cohort from Cape Town. NLGN1 has previously been associated with autism, and it encodes neuroligin 1, a protein involved in synaptogenesis, learning, and memory. Within the GTP dataset, a single nucleotide polymorphism (SNP), rs6779753, underlying the gene-based association, associated with the intermediate phenotypes of higher startle response and greater functional magnetic resonance imaging activation of the amygdala, orbitofrontal cortex, right thalamus and right fusiform gyrus in response to fearful faces. These findings support a contribution of the NLGN1 gene pathway to the neurobiological underpinnings of PTSD.

  20. Genome-wide gene-based analysis suggests an association between Neuroligin 1 (NLGN1) and post-traumatic stress disorder

    PubMed Central

    Kilaru, V; Iyer, S V; Almli, L M; Stevens, J S; Lori, A; Jovanovic, T; Ely, T D; Bradley, B; Binder, E B; Koen, N; Stein, D J; Conneely, K N; Wingo, A P; Smith, A K; Ressler, K J

    2016-01-01

    Post-traumatic stress disorder (PTSD) develops in only some people following trauma exposure, but the mechanisms differentially explaining risk versus resilience remain largely unknown. PTSD is heritable but candidate gene studies and genome-wide association studies (GWAS) have identified only a modest number of genes that reliably contribute to PTSD. New gene-based methods may help identify additional genes that increase risk for PTSD development or severity. We applied gene-based testing to GWAS data from the Grady Trauma Project (GTP), a primarily African American cohort, and identified two genes (NLGN1 and ZNRD1-AS1) that associate with PTSD after multiple test correction. Although the top SNP from NLGN1 did not replicate, we observed gene-based replication of NLGN1 with PTSD in the Drakenstein Child Health Study (DCHS) cohort from Cape Town. NLGN1 has previously been associated with autism, and it encodes neuroligin 1, a protein involved in synaptogenesis, learning, and memory. Within the GTP dataset, a single nucleotide polymorphism (SNP), rs6779753, underlying the gene-based association, associated with the intermediate phenotypes of higher startle response and greater functional magnetic resonance imaging activation of the amygdala, orbitofrontal cortex, right thalamus and right fusiform gyrus in response to fearful faces. These findings support a contribution of the NLGN1 gene pathway to the neurobiological underpinnings of PTSD. PMID:27219346

  1. Early gene expression during natural spinal cord regeneration in the salamander Ambystoma mexicanum.

    PubMed

    Monaghan, James R; Walker, John A; Page, Robert B; Putta, Srikrishna; Beachy, Christopher K; Voss, S Randal

    2007-04-01

    In contrast to mammals, salamanders have a remarkable ability to regenerate their spinal cord and recover full movement and function after tail amputation. To identify genes that may be associated with this greater regenerative ability, we designed an oligonucleotide microarray and profiled early gene expression during natural spinal cord regeneration in Ambystoma mexicanum. We sampled tissue at five early time points after tail amputation and identified genes that registered significant changes in mRNA abundance during the first 7 days of regeneration. A list of 1036 statistically significant genes was identified. Additional statistical and fold change criteria were applied to identify a smaller list of 360 genes that were used to describe predominant expression patterns and gene functions. Our results show that a diverse injury response is activated in concert with extracellular matrix remodeling mechanisms during the early acute phase of natural spinal cord regeneration. We also report gene expression similarities and differences between our study and studies that have profiled gene expression after spinal cord injury in rat. Our study illustrates the utility of a salamander model for identifying genes and gene functions that may enhance regenerative ability in mammals.

  2. The human apolipoprotein AV gene is regulated by peroxisome proliferator-activated receptor-alpha and contains a novel farnesoid X-activated receptor response element.

    PubMed

    Prieur, Xavier; Coste, Herve; Rodriguez, Joan C

    2003-07-11

    The newly identified apolipoprotein AV (apoAV) gene is a key player in determining plasma triglyceride concentrations. Because hypertriglyceridemia is a major independent risk factor in coronary artery disease, the understanding of the regulation of the expression of this gene is of considerable importance. We presently characterize the structure, the transcription start site, and the promoter of the human apoAV gene. Since the peroxisome proliferator-activated receptor-alpha (PPARalpha) and the farnesoid X-activated receptor (FXR) have been shown to modulate the expression of genes involved in triglyceride metabolism, we evaluated the potential role of these nuclear receptors in the regulation of apoAV transcription. Bile acids and FXR induced the apoAV gene promoter activity. 5'-Deletion, mutagenesis, and gel shift analysis identified a heretofore unknown element at positions -103/-84 consisting of an inverted repeat of two consensus receptor-binding hexads separated by 8 nucleotides (IR8), which was required for the response to bile acid-activated FXR. The isolated IR8 element conferred FXR responsiveness on a heterologous promoter. On the other hand, in apoAV-expressing human hepatic Hep3B cells, transfection of PPARalpha specifically enhanced apoAV promoter activity. By deletion, site-directed mutagenesis, and binding analysis, a PPARalpha response element located 271 bp upstream of the transcription start site was identified. Finally, treatment with a specific PPARalpha activator led to a significant induction of apoAV mRNA expression in hepatocytes. The identification of apoAV as a PPARalpha target gene has major implications with respect to mechanisms whereby pharmacological PPARalpha agonists may exert their beneficial hypotriglyceridemic actions.

  3. Discriminating between adaptive and carcinogenic liver hypertrophy in rat studies using logistic ridge regression analysis of toxicogenomic data: The mode of action and predictive models.

    PubMed

    Liu, Shujie; Kawamoto, Taisuke; Morita, Osamu; Yoshinari, Kouichi; Honda, Hiroshi

    2017-03-01

    Chemical exposure often results in liver hypertrophy in animal tests, characterized by increased liver weight, hepatocellular hypertrophy, and/or cell proliferation. While most of these changes are considered adaptive responses, there is concern that they may be associated with carcinogenesis. In this study, we have employed a toxicogenomic approach using a logistic ridge regression model to identify genes responsible for liver hypertrophy and hypertrophic hepatocarcinogenesis and to develop a predictive model for assessing hypertrophy-inducing compounds. Logistic regression models have previously been used in the quantification of epidemiological risk factors. DNA microarray data from the Toxicogenomics Project-Genomics Assisted Toxicity Evaluation System were used to identify hypertrophy-related genes that are expressed differently in hypertrophy induced by carcinogens and non-carcinogens. Data were collected for 134 chemicals (72 non-hypertrophy-inducing chemicals, 27 hypertrophy-inducing non-carcinogenic chemicals, and 15 hypertrophy-inducing carcinogenic compounds). After applying logistic ridge regression analysis, 35 genes for liver hypertrophy (e.g., Acot1 and Abcc3) and 13 genes for hypertrophic hepatocarcinogenesis (e.g., Asns and Gpx2) were selected. The predictive models built using these genes were 94.8% and 82.7% accurate, respectively. Pathway analysis of the genes indicates that, aside from a xenobiotic metabolism-related pathway as an adaptive response for liver hypertrophy, amino acid biosynthesis and oxidative responses appear to be involved in hypertrophic hepatocarcinogenesis. Early detection and toxicogenomic characterization of liver hypertrophy using our models may be useful for predicting carcinogenesis. In addition, the identified genes provide novel insight into discrimination between adverse hypertrophy associated with carcinogenesis and adaptive hypertrophy in risk assessment. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Inference of cancer-specific gene regulatory networks using soft computing rules.

    PubMed

    Wang, Xiaosheng; Gotoh, Osamu

    2010-03-24

    Perturbations of gene regulatory networks are essentially responsible for oncogenesis. Therefore, inferring the gene regulatory networks is a key step to overcoming cancer. In this work, we propose a method for inferring directed gene regulatory networks based on soft computing rules, which can identify important cause-effect regulatory relations of gene expression. First, we identify important genes associated with a specific cancer (colon cancer) using a supervised learning approach. Next, we reconstruct the gene regulatory networks by inferring the regulatory relations among the identified genes, and their regulated relations by other genes within the genome. We obtain two meaningful findings. One is that upregulated genes are regulated by more genes than downregulated ones, while downregulated genes regulate more genes than upregulated ones. The other one is that tumor suppressors suppress tumor activators and activate other tumor suppressors strongly, while tumor activators activate other tumor activators and suppress tumor suppressors weakly, indicating the robustness of biological systems. These findings provide valuable insights into the pathogenesis of cancer.

  5. Physiological and molecular characterization of drought responses and identification of candidate tolerance genes in cassava

    PubMed Central

    Turyagyenda, Laban F.; Kizito, Elizabeth B.; Ferguson, Morag; Baguma, Yona; Agaba, Morris; Harvey, Jagger J. W.; Osiru, David S. O.

    2013-01-01

    Cassava is an important root crop to resource-poor farmers in marginal areas, where its production faces drought stress constraints. Given the difficulties associated with cassava breeding, a molecular understanding of drought tolerance in cassava will help in the identification of markers for use in marker-assisted selection and genes for transgenic improvement of drought tolerance. This study was carried out to identify candidate drought-tolerance genes and expression-based markers of drought stress in cassava. One drought-tolerant (improved variety) and one drought-susceptible (farmer-preferred) cassava landrace were grown in the glasshouse under well-watered and water-stressed conditions. Their morphological, physiological and molecular responses to drought were characterized. Morphological and physiological measurements indicate that the tolerance of the improved variety is based on drought avoidance, through reduction of water loss via partial stomatal closure. Ten genes that have previously been biologically validated as conferring or being associated with drought tolerance in other plant species were confirmed as being drought responsive in cassava. Four genes (MeALDH, MeZFP, MeMSD and MeRD28) were identified as candidate cassava drought-tolerance genes, as they were exclusively up-regulated in the drought-tolerant genotype to comparable levels known to confer drought tolerance in other species. Based on these genes, we hypothesize that the basis of the tolerance at the cellular level is probably through mitigation of the oxidative burst and osmotic adjustment. This study provides an initial characterization of the molecular response of cassava to drought stress resembling field conditions. The drought-responsive genes can now be used as expression-based markers of drought stress tolerance in cassava, and the candidate tolerance genes tested in the context of breeding (as possible quantitative trait loci) and engineering drought tolerance in transgenics. PMID:23519782

  6. Evolutionary history of mitogen-activated protein kinase (MAPK) genes in Lotus, Medicago, and Phaseolus

    PubMed Central

    Neupane, Achal; Nepal, Madhav P; Benson, Benjamin V; MacArthur, Kenton J; Piya, Sarbottam

    2013-01-01

    Mitogen-Activated Protein Kinase (MAPK) genes encode proteins that mediate various signaling pathways associated with biotic and abiotic stress responses in eukaryotes. The MAPK genes form a 3-tier signal transduction cascade between cellular stimuli and physiological responses. Recent identification of soybean MAPKs and availability of genome sequences from other legume species allowed us to identify their MAPK genes. The main objectives of this study were to identify MAPKs in 3 legume species, Lotus japonicus, Medicago truncatula, and Phaseolus vulgaris, and to assess their phylogenetic relationships. We used approaches in comparative genomics for MAPK gene identification and named the newly identified genes following Arabidopsis MAPK nomenclature model. We identified 19, 18, and 15 MAPKs and 7, 4, and 9 MAPKKs in the genome of Lotus japonicus, Medicago truncatula, and Phaseolus vulgaris, respectively. Within clade placement of MAPKs and MAPKKs in the 3 legume species were consistent with those in soybean and Arabidopsis. Among 5 clades of MAPKs, 4 founder clades were consistent to MAPKs of other plant species and orthologs of MAPK genes in the fifth clade-"Clade E" were consistent with those in soybean. Our results also indicated that some gene duplication events might have occurred prior to eudicot-monocot divergence. Highly diversified MAPKs in soybean relative to those in 3 other legume species are attributable to the polyploidization events in soybean. The identification of the MAPK genes in the legume species is important for the legume crop improvement; and evolutionary relationships and functional divergence of these gene members provide insights into plant genome evolution. PMID:24317362

  7. Gene expression profiles characterize early graft response in living donor small bowel transplantation: a case report.

    PubMed

    Bradley, S P; Pahari, M; Uknis, M E; Rastellini, C; Cicalese, L

    2006-01-01

    The cellular and histological events that occur during the regeneration process in invertebrates have been studied in the field of visceral regeneration. We would like to explore the molecular aspects of the regeneration process in the small intestine. The aim of this study was to characterize the gene expression profiles of the intestinal graft to identify which genes may have a role in regeneration of graft tissue posttransplant. In a patient undergoing living related small bowel transplantation (LRSBTx) in our institution, mucosal biopsies were obtained from the recipient intestine and donor graft at the time of transplant and at weeks 1, 2, 3, and 6 posttransplant. Total RNA was isolated from sample biopsies followed by gene expression profiles determined from the replicate samples (n = 3) for each biopsy using the Affymetrix U133 Plus 2.0 Human GeneChip set. Two profiles were obtained from the data. One profile showed rapid increase of 45 genes immediately after transplant by week 1 with significant changes (P < .05) greater than threefold including the chemokine CXC9 and glutathione-related stress factors, GPX2 and GSTA4. The second profile identified 133 genes that were significantly decreased by threefold or greater immediately after transplant week 1, including UCC1, the human homolog of the Ependymin gene. We have identified two gene expression profiles representing early graft responses to small bowel transplantation. These profiles will serve to identify and study those genes whose products may play a role in accelerating tissue regeneration following segmental LRSBTx.

  8. Differential Gene Expression between Leaf and Rhizome in Atractylodes lancea: A Comparative Transcriptome Analysis

    PubMed Central

    Huang, Qianqian; Huang, Xiao; Deng, Juan; Liu, Hegang; Liu, Yanwen; Yu, Kun; Huang, Bisheng

    2016-01-01

    The rhizome of Atractylodes lancea is extensively used in the practice of Traditional Chinese Medicine because of its broad pharmacological activities. This study was designed to characterize the transcriptome profiling of the rhizome and leaf of Atractylodes lancea in an attempt to uncover the molecular mechanisms regulating rhizome formation and growth. Over 270 million clean reads were assembled into 92,366 unigenes, 58% of which are homologous with sequences in public protein databases (NR, Swiss-Prot, GO, and KEGG). Analysis of expression levels showed that genes involved in photosynthesis, stress response, and translation were the most abundant transcripts in the leaf, while transcripts involved in stress response, transcription regulation, translation, and metabolism were dominant in the rhizome. Tissue-specific gene analysis identified distinct gene families active in the leaf and rhizome. Differential gene expression analysis revealed a clear difference in gene expression pattern, identifying 1518 up-regulated genes and 3464 down-regulated genes in the rhizome compared with the leaf, including a series of genes related to signal transduction, primary and secondary metabolism. Transcription factor (TF) analysis identified 42 TF families, with 67 and 60 TFs up-regulated in the rhizome and leaf, respectively. A total of 104 unigenes were identified as candidates for regulating rhizome formation and development. These data offer an overview of the gene expression pattern of the rhizome and leaf and provide essential information for future studies on the molecular mechanisms of controlling rhizome formation and growth. The extensive transcriptome data generated in this study will be a valuable resource for further functional genomics studies of A. lancea. PMID:27066021

  9. Identification of aryl hydrocarbon receptor binding targets in mouse hepatic tissue treated with 2,3,7,8-tetrachlorodibenzo-p-dioxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lo, Raymond; Celius, Trine; Forgacs, Agnes L.

    2011-11-15

    Genome-wide, promoter-focused ChIP-chip analysis of hepatic aryl hydrocarbon receptor (AHR) binding sites was conducted in 8-week old female C57BL/6 treated with 30 {mu}g/kg/body weight 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) for 2 h and 24 h. These studies identified 1642 and 508 AHR-bound regions at 2 h and 24 h, respectively. A total of 430 AHR-bound regions were common between the two time points, corresponding to 403 unique genes. Comparison with previous AHR ChIP-chip studies in mouse hepatoma cells revealed that only 62 of the putative target genes overlapped with the 2 h AHR-bound regions in vivo. Transcription factor binding site analysis revealed anmore » over-representation of aryl hydrocarbon response elements (AHREs) in AHR-bound regions with 53% (2 h) and 68% (24 h) of them containing at least one AHRE. In addition to AHREs, E2f-Myc activator motifs previously implicated in AHR function, as well as a number of other motifs, including Sp1, nuclear receptor subfamily 2 factor, and early growth response factor motifs were also identified. Expression microarray studies identified 133 unique genes differentially regulated after 4 h treatment with TCDD. Of which, 39 were identified as AHR-bound genes at 2 h. Ingenuity Pathway Analysis on the 39 AHR-bound TCDD responsive genes identified potential perturbation in biological processes such as lipid metabolism, drug metabolism, and endocrine system development as a result of TCDD-mediated AHR activation. Our findings identify direct AHR target genes in vivo, highlight in vitro and in vivo differences in AHR signaling and show that AHR recruitment does not necessarily result in changes in target gene expression. -- Highlights: Black-Right-Pointing-Pointer ChIP-chip analysis of hepatic AHR binding after 2 h and 24 h of TCDD. Black-Right-Pointing-Pointer We identified 1642 and 508 AHR-bound regions at 2 h and 24 h. Black-Right-Pointing-Pointer 430 regions were common to both time points and highly enriched with AHREs. Black-Right-Pointing-Pointer Only 62 putative target regions overlapped AHR-bound regions in hepatoma cells. Black-Right-Pointing-Pointer Microarrays identified 133 TCDD-regulated genes; of which 39 were also bound by AHR.« less

  10. The auxin response factor gene family in banana: genome-wide identification and expression analyses during development, ripening, and abiotic stress

    PubMed Central

    Hu, Wei; Zuo, Jiao; Hou, Xiaowan; Yan, Yan; Wei, Yunxie; Liu, Juhua; Li, Meiying; Xu, Biyu; Jin, Zhiqiang

    2015-01-01

    Auxin signaling regulates various auxin-responsive genes via two types of transcriptional regulators, Auxin Response Factors (ARF) and Aux/IAA. ARF transcription factors act as critical components of auxin signaling that play important roles in modulating various biological processes. However, limited information about this gene family in fruit crops is currently available. Herein, 47 ARF genes were identified in banana based on its genome sequence. Phylogenetic analysis of the ARFs from banana, rice, and Arabidopsis suggested that the ARFs could be divided into four subgroups, among which most ARFs from the banana showed a closer relationship with those from rice than those from Arabidopsis. Conserved motif analysis showed that all identified MaARFs had typical DNA-binding and ARF domains, but 12 members lacked the dimerization domain. Gene structure analysis showed that the number of exons in MaARF genes ranged from 5 to 21, suggesting large variation amongst banana ARF genes. The comprehensive expression profiles of MaARF genes yielded useful information about their involvement in diverse tissues, different stages of fruit development and ripening, and responses to abiotic stresses in different varieties. Interaction networks and co-expression assays indicated the strong transcriptional response of banana ARFs and ARF-mediated networks in early fruit development for different varieties. Our systematic analysis of MaARFs revealed robust tissue-specific, development-dependent, and abiotic stress-responsive candidate MaARF genes for further functional assays in planta. These findings could lead to potential applications in the genetic improvement of banana cultivars, and yield new insights into the complexity of the control of MaARF gene expression at the transcriptional level. Finally, they support the hypothesis that ARFs are a crucial component of the auxin signaling pathway, which regulates a wide range of physiological processes. PMID:26442055

  11. Crude oil exposure results in oxidative stress-mediated dysfunctional development and reproduction in the copepod Tigriopus japonicus and modulates expression of cytochrome P450 (CYP) genes.

    PubMed

    Han, Jeonghoon; Won, Eun-Ji; Hwang, Dae-Sik; Shin, Kyung-Hoon; Lee, Yong Sung; Leung, Kenneth Mei-Yee; Lee, Su-Jae; Lee, Jae-Seong

    2014-07-01

    In this study, we investigated the effects of the water-accommodated fraction (WAF) of crude oil on the development and reproduction of the intertidal copepod Tigriopus japonicus through life-cycle experiments. Furthermore, we investigated the mechanisms underlying the toxic effects of WAF on this benthic organism by studying expression patterns of cytochrome P450 (CYP) genes. Development of T. japonicus was delayed and molting was interrupted in response to WAF exposure. Hatching rate was also significantly reduced in response to WAF exposure. Activities of antioxidant enzymes such as glutathione S-transferase (GST), glutathione reductase (GR), and catalase (CAT) were increased by WAF exposure in a concentration-dependent manner. These results indicated that WAF exposure resulted in oxidative stress, which in turn was associated with dysfunctional development and reproduction. To evaluate the involvement of cytochrome P450 (CYP) genes, we cloned the entire repertoire of CYP genes in T. japonicus (n=52) and found that the CYP genes belonged to five different clans (i.e., Clans 2, 3, 4, mitochondrial, and 20). We then examined expression patterns of these 52 CYP genes in response to WAF exposure. Three TJ-CYP genes (CYP3024A2, CYP3024A3, and CYP3027C2) belonging to CYP clan 3 were significantly induced by WAF exposure in a time- and concentration-dependent manner. We identified aryl hydrocarbon responsive elements (AhRE), xenobiotic responsive elements (XREs), and metal response elements (MRE) in the promoter regions of these three CYP genes, suggesting that these genes are involved in detoxification of toxicants. Overall, our results indicate that WAF can trigger oxidative stress and thus induce dysfunctional development and reproduction in the copepod T. japonicus. Furthermore, we identified three TJ-CYP genes that represent potential biomarkers of oil pollution. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Identifying gnostic predictors of the vaccine response.

    PubMed

    Haining, W Nicholas; Pulendran, Bali

    2012-06-01

    Molecular predictors of the response to vaccination could transform vaccine development. They would allow larger numbers of vaccine candidates to be rapidly screened, shortening the development time for new vaccines. Gene-expression based predictors of vaccine response have shown early promise. However, a limitation of gene-expression based predictors is that they often fail to reveal the mechanistic basis of their ability to classify response. Linking predictive signatures to the function of their component genes would advance basic understanding of vaccine immunity and also improve the robustness of vaccine prediction. New analytic tools now allow more biological meaning to be extracted from predictive signatures. Functional genomic approaches to perturb gene expression in mammalian cells permit the function of predictive genes to be surveyed in highly parallel experiments. The challenge for vaccinologists is therefore to use these tools to embed mechanistic insights into predictors of vaccine response. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Identifying gnostic predictors of the vaccine response

    PubMed Central

    Haining, W. Nicholas; Pulendran, Bali

    2012-01-01

    Molecular predictors of the response to vaccination could transform vaccine development. They would allow larger numbers of vaccine candidates to be rapidly screened, shortening the development time for new vaccines. Gene-expression based predictors of vaccine response have shown early promise. However, a limitation of gene-expression based predictors is that they often fail to reveal the mechanistic basis for their ability to classify response. Linking predictive signatures to the function of their component genes would advance basic understanding of vaccine immunity and also improve the robustness of outcome classification. New analytic tools now allow more biological meaning to be extracted from predictive signatures. Functional genomic approaches to perturb gene expression in mammalian cells permit the function of predictive genes to be surveyed in highly parallel experiments. The challenge for vaccinologists is therefore to use these tools to embed mechanistic insights into predictors of vaccine response. PMID:22633886

  14. Interactome analysis of longitudinal pharyngeal infection of cynomolgus macaques by group A Streptococcus.

    PubMed

    Shea, Patrick R; Virtaneva, Kimmo; Kupko, John J; Porcella, Stephen F; Barry, William T; Wright, Fred A; Kobayashi, Scott D; Carmody, Aaron; Ireland, Robin M; Sturdevant, Daniel E; Ricklefs, Stacy M; Babar, Imran; Johnson, Claire A; Graham, Morag R; Gardner, Donald J; Bailey, John R; Parnell, Michael J; Deleo, Frank R; Musser, James M

    2010-03-09

    Relatively little is understood about the dynamics of global host-pathogen transcriptome changes that occur during bacterial infection of mucosal surfaces. To test the hypothesis that group A Streptococcus (GAS) infection of the oropharynx provokes a distinct host transcriptome response, we performed genome-wide transcriptome analysis using a nonhuman primate model of experimental pharyngitis. We also identified host and pathogen biological processes and individual host and pathogen gene pairs with correlated patterns of expression, suggesting interaction. For this study, 509 host genes and seven biological pathways were differentially expressed throughout the entire 32-day infection cycle. GAS infection produced an initial widespread significant decrease in expression of many host genes, including those involved in cytokine production, vesicle formation, metabolism, and signal transduction. This repression lasted until day 4, at which time a large increase in expression of host genes was observed, including those involved in protein translation, antigen presentation, and GTP-mediated signaling. The interactome analysis identified 73 host and pathogen gene pairs with correlated expression levels. We discovered significant correlations between transcripts of GAS genes involved in hyaluronic capsule production and host endocytic vesicle formation, GAS GTPases and host fibrinolytic genes, and GAS response to interaction with neutrophils. We also identified a strong signal, suggesting interaction between host gammadelta T cells and genes in the GAS mevalonic acid synthesis pathway responsible for production of isopentenyl-pyrophosphate, a short-chain phospholipid that stimulates these T cells. Taken together, our results are unique in providing a comprehensive understanding of the host-pathogen interactome during mucosal infection by a bacterial pathogen.

  15. Gene expression markers in circulating tumor cells may predict bone metastasis and response to hormonal treatment in breast cancer

    PubMed Central

    WANG, HAIYING; MOLINA, JULIAN; JIANG, JOHN; FERBER, MATTHEW; PRUTHI, SANDHYA; JATKOE, TIMOTHY; DERECHO, CARLO; RAJPUROHIT, YASHODA; ZHENG, JIAN; WANG, YIXIN

    2013-01-01

    Circulating tumor cells (CTCs) have recently attracted attention due to their potential as prognostic and predictive markers for the clinical management of metastatic breast cancer patients. The isolation of CTCs from patients may enable the molecular characterization of these cells, which may help establish a minimally invasive assay for the prediction of metastasis and further optimization of treatment. Molecular markers of proven clinical value may therefore be useful in predicting disease aggressiveness and response to treatment. In our earlier study, we identified a gene signature in breast cancer that appears to be significantly associated with bone metastasis. Among the genes that constitute this signature, trefoil factor 1 (TFF1) was identified as the most differentially expressed gene associated with bone metastasis. In this study, we investigated 25 candidate gene markers in the CTCs of metastatic breast cancer patients with different metastatic sites. The panel of the 25 markers was investigated in 80 baseline samples (first blood draw of CTCs) and 30 follow-up samples. In addition, 40 healthy blood donors (HBDs) were analyzed as controls. The assay was performed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) with RNA extracted from CTCs captured by the CellSearch system. Our study indicated that 12 of the genes were uniquely expressed in CTCs and 10 were highly expressed in the CTCs obtained from patients compared to those obtained from HBDs. Among these genes, the expression of keratin 19 was highly correlated with the CTC count. The TFF1 expression in CTCs was a strong predictor of bone metastasis and the patients with a high expression of estrogen receptor β in CTCs exhibited a better response to hormonal treatment. Molecular characterization of these genes in CTCs may provide a better understanding of the mechanism underlying tumor metastasis and identify gene markers in CTCs for predicting disease progression and response to treatment. PMID:24649289

  16. Gene expression markers in circulating tumor cells may predict bone metastasis and response to hormonal treatment in breast cancer.

    PubMed

    Wang, Haiying; Molina, Julian; Jiang, John; Ferber, Matthew; Pruthi, Sandhya; Jatkoe, Timothy; Derecho, Carlo; Rajpurohit, Yashoda; Zheng, Jian; Wang, Yixin

    2013-11-01

    Circulating tumor cells (CTCs) have recently attracted attention due to their potential as prognostic and predictive markers for the clinical management of metastatic breast cancer patients. The isolation of CTCs from patients may enable the molecular characterization of these cells, which may help establish a minimally invasive assay for the prediction of metastasis and further optimization of treatment. Molecular markers of proven clinical value may therefore be useful in predicting disease aggressiveness and response to treatment. In our earlier study, we identified a gene signature in breast cancer that appears to be significantly associated with bone metastasis. Among the genes that constitute this signature, trefoil factor 1 (TFF1) was identified as the most differentially expressed gene associated with bone metastasis. In this study, we investigated 25 candidate gene markers in the CTCs of metastatic breast cancer patients with different metastatic sites. The panel of the 25 markers was investigated in 80 baseline samples (first blood draw of CTCs) and 30 follow-up samples. In addition, 40 healthy blood donors (HBDs) were analyzed as controls. The assay was performed using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) with RNA extracted from CTCs captured by the CellSearch system. Our study indicated that 12 of the genes were uniquely expressed in CTCs and 10 were highly expressed in the CTCs obtained from patients compared to those obtained from HBDs. Among these genes, the expression of keratin 19 was highly correlated with the CTC count. The TFF1 expression in CTCs was a strong predictor of bone metastasis and the patients with a high expression of estrogen receptor β in CTCs exhibited a better response to hormonal treatment. Molecular characterization of these genes in CTCs may provide a better understanding of the mechanism underlying tumor metastasis and identify gene markers in CTCs for predicting disease progression and response to treatment.

  17. The Streptococcus agalactiae Stringent Response Enhances Virulence and Persistence in Human Blood

    PubMed Central

    Hooven, Thomas A.; Catomeris, Andrew J.; Bonakdar, Maryam; Tallon, Luke J.; Santana-Cruz, Ivette; Ott, Sandra; Daugherty, Sean C.; Tettelin, Hervé

    2017-01-01

    ABSTRACT Streptococcus agalactiae (group B Streptococcus [GBS]) causes serious infections in neonates. We previously reported a transposon sequencing (Tn-seq) system for performing genomewide assessment of gene fitness in GBS. In order to identify molecular mechanisms required for GBS to transition from a mucosal commensal lifestyle to bloodstream invasion, we performed Tn-seq on GBS strain A909 with human whole blood. Our analysis identified 16 genes conditionally essential for GBS survival in blood, of which 75% were members of the capsular polysaccharide (cps) operon. Among the non-cps genes identified as conditionally essential was relA, which encodes an enzyme whose activity is central to the bacterial stringent response—a conserved adaptation to environmental stress. We used blood coincubation studies of targeted knockout strains to confirm the expected growth defects of GBS deficient in capsule or stringent response activation. Unexpectedly, we found that the relA knockout strains demonstrated decreased expression of β-hemolysin/cytolysin, an important cytotoxin implicated in facilitating GBS invasion. Furthermore, chemical activation of the stringent response with serine hydroxamate increased β-hemolysin/cytolysin expression. To establish a mechanism by which the stringent response leads to increased cytotoxicity, we performed transcriptome sequencing (RNA-seq) on two GBS strains grown under stringent response or control conditions. This revealed a conserved decrease in the expression of genes in the arginine deiminase pathway during stringent response activation. Through coincubation with supplemental arginine and the arginine antagonist canavanine, we show that arginine availability is a determinant of GBS cytotoxicity and that the pathway between stringent response activation and increased virulence is arginine dependent. PMID:29109175

  18. FAS Death Receptor: A Breast Cancer Subtype-Specific Radiation Response Biomarker and Potential Therapeutic Target

    PubMed Central

    Horton, Janet K.; Siamakpour-Reihani, Sharareh; Lee, Chen-Ting; Zhou, Ying; Chen, Wei; Geradts, Joseph; Fels, Diane R.; Hoang, Peter; Ashcraft, Kathleen A.; Groth, Jeff; Kung, Hsiu-Ni; Dewhirst, Mark W.; Chi, Jen-Tsan A.

    2015-01-01

    Although a standardized approach to radiotherapy has been used to treat breast cancer, regardless of subtype (e.g., luminal, basal), recent clinical data suggest that radiation response may vary significantly among subtypes. We hypothesized that this clinical variability may be due, in part, to differences in cellular radiation response. In this study, we utilized RNA samples for microarray analysis from two sources: 1. Paired pre- and postirradiation breast tumor tissue from 32 early-stage breast cancer patients treated in our unique preoperative radiation Phase I trial; and 2. Sixteen biologically diverse breast tumor cell lines exposed to 0 and 5 Gy irradiation. The transcriptome response to radiation exposure was derived by comparing gene expression in samples before and after irradiation. Genes with the highest coefficient of variation were selected for further evaluation and validated at the RNA and protein level. Gene editing and agonistic antibody treatment were performed to assess the impact of gene modulation on radiation response. Gene expression in our cohort of luminal breast cancer patients was distinctly different before and after irradiation. Further, two distinct patterns of gene expression were observed in our biologically diverse group of breast cancer cell lines pre- versus postirradiation. Cell lines that showed significant change after irradiation were largely luminal subtype, while gene expression in the basal and HER2+ cell lines was minimally impacted. The 100 genes with the most significant response to radiation in patients were identified and analyzed for differential patterns of expression in the radiation-responsive versus nonresponsive cell lines. Fourteen genes were identified as significant, including FAS, a member of the tumor necrosis factor receptor family known to play a critical role in programed cell death. Modulation of FAS in breast cancer cell lines altered radiation response phenotype and enhanced radiation sensitivity in radioresistant basal cell lines. Our findings suggest that cell-type-specific, radiation-induced FAS contributes to subtype-specific breast cancer radiation response and that activation of FAS pathways may be exploited for biologically tailored radiotherapy. PMID:26488758

  19. Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl; Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht; Institute for Risk Assessment Sciences

    2013-10-01

    The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol andmore » saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.« less

  20. Genetic Variation in the MAPK/ERK Pathway Affects Contact Hypersensitivity Responses.

    PubMed

    Legrand, Julien M D; Roy, Edwige; Baz, Batoul; Mukhopadhyay, Pamela; Wong, Ho Yi; Ram, Ramesh; Morahan, Grant; Walker, Graeme; Khosrotehrani, Kiarash

    2018-05-10

    Using a genetic resource that enables rapid mapping of genes for complex traits, we demonstrate dramatic diversity between murine strains in response to immune challenge. We identified several candidate genes that point to the MAPK/ERK pathway as a key modulator of this process. Copyright © 2018. Published by Elsevier Inc.

  1. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    ERIC Educational Resources Information Center

    Curtis-Ducey, Carol Dianne

    2009-01-01

    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  2. Physiological and Transcriptional Responses of Saccharomyces cerevisiae to Zinc Limitation in Chemostat Cultures †

    PubMed Central

    De Nicola, Raffaele; Hazelwood, Lucie A.; De Hulster, Erik A. F.; Walsh, Michael C.; Knijnenburg, Theo A.; Reinders, Marcel J. T.; Walker, Graeme M.; Pronk, Jack T.; Daran, Jean-Marc; Daran-Lapujade, Pascale

    2007-01-01

    Transcriptional responses of the yeast Saccharomyces cerevisiae to Zn availability were investigated at a fixed specific growth rate under limiting and abundant Zn concentrations in chemostat culture. To investigate the context dependency of this transcriptional response and eliminate growth rate-dependent variations in transcription, yeast was grown under several chemostat regimens, resulting in various carbon (glucose), nitrogen (ammonium), zinc, and oxygen supplies. A robust set of genes that responded consistently to Zn limitation was identified, and the set enabled the definition of the Zn-specific Zap1p regulon, comprised of 26 genes and characterized by a broader zinc-responsive element consensus (MHHAACCBYNMRGGT) than so far described. Most surprising was the Zn-dependent regulation of genes involved in storage carbohydrate metabolism. Their concerted down-regulation was physiologically relevant as revealed by a substantial decrease in glycogen and trehalose cellular content under Zn limitation. An unexpectedly large number of genes were synergistically or antagonistically regulated by oxygen and Zn availability. This combinatorial regulation suggested a more prominent involvement of Zn in mitochondrial biogenesis and function than hitherto identified. PMID:17933919

  3. Comprehensive analysis of GASA family members in the Malus domestica genome: identification, characterization, and their expressions in response to apple flower induction.

    PubMed

    Fan, Sheng; Zhang, Dong; Zhang, Lizhi; Gao, Cai; Xin, Mingzhi; Tahir, Muhammad Mobeen; Li, Youmei; Ma, Juanjuan; Han, Mingyu

    2017-10-27

    The plant-specific gibberellic acid stimulated Arabidopsis (GASA) gene family is critical for plant development. However, little is known about these genes, particularly in fruit tree species. We identified 15 putative Arabidopsis thaliana GASA (AtGASA) and 26 apple GASA (MdGASA) genes. The identified genes were then characterized (e.g., chromosomal location, structure, and evolutionary relationships). All of the identified A. thaliana and apple GASA proteins included a conserved GASA domain and exhibited similar characteristics. Specifically, the MdGASA expression levels in various tissues and organs were analyzed based on an online gene expression profile and by qRT-PCR. These genes were more highly expressed in the leaves, buds, and fruits compared with the seeds, roots, and seedlings. MdGASA genes were also responsive to gibberellic acid (GA 3 ) and abscisic acid treatments. Additionally, transcriptome sequencing results revealed seven potential flowering-related MdGASA genes. We analyzed the expression levels of these genes in response to flowering-related treatments (GA 3 , 6-benzylaminopurine, and sugar) and in apple varieties that differed in terms of flowering ('Nagafu No. 2' and 'Yanfu No. 6') during the flower induction period. These candidate MdGASA genes exhibited diverse expression patterns. The expression levels of six MdGASA genes were inhibited by GA 3 , while the expression of one gene was up-regulated. Additionally, there were expression-level differences induced by the 6-benzylaminopurine and sugar treatments during the flower induction stage, as well as in the different flowering varieties. This study represents the first comprehensive investigation of the A. thaliana and apple GASA gene families. Our data may provide useful clues for future studies and may support the hypotheses regarding the role of GASA proteins during the flower induction stage in fruit tree species.

  4. Clinical significance of In vivo Cytarabine Induced Gene Expression Signature in AML

    PubMed Central

    Lamba, Jatinder K.; Pounds, Stanley; Cao, Xueyuan; Crews, Kristine R.; Cogle, Christopher R.; Bhise, Neha; Raimondi, Susana C.; Downing, James R.; Baker, Sharyn D.; Ribeiro, Raul C.; Rubnitz, Jeffrey E.

    2016-01-01

    Despite initial remission, approximately 60-70% of adult and 30% of pediatric patients experience relapse or refractory AML. Studies so far have identified base line gene expression profiles of pathogenic and prognostic significance in AML, however extent of change in gene expression post-initiation of treatment has not been investigated. Exposure of leukemic cells to chemotherapeutic agents such as cytarabine, a mainstay of AML chemotherapy can trigger adaptive response by influencing leukemic cell transcriptome and hence development of resistance or refractory disease. It is however challenging to perform such a study due to lack of availability of specimens post-drug treatment. In this study our primary objective was to identify in vivo cytarabine induced changes in leukemia cell transcriptome and to evaluate their impact on clinical outcome. Our results highlight genes relevant to cytarabine resistance and support the concept of targeting cytarabine-induced genes as a means of improving response. PMID:26366682

  5. Clinical significance of in vivo cytarabine-induced gene expression signature in AML.

    PubMed

    Lamba, Jatinder K; Pounds, Stanley; Cao, Xueyuan; Crews, Kristine R; Cogle, Christopher R; Bhise, Neha; Raimondi, Susana C; Downing, James R; Baker, Sharyn D; Ribeiro, Raul C; Rubnitz, Jeffrey E

    2016-01-01

    Despite initial remission, ∼60-70% of adult and 30% of pediatric patients experience relapse or refractory AML. Studies so far have identified base line gene expression profiles of pathogenic and prognostic significance in AML; however, the extent of change in gene expression post-initiation of treatment has not been investigated. Exposure of leukemic cells to chemotherapeutic agents such as cytarabine, a mainstay of AML chemotherapy, can trigger adaptive response by influencing leukemic cell transcriptome and, hence, development of resistance or refractory disease. It is, however, challenging to perform such a study due to lack of availability of specimens post-drug treatment. The primary objective of this study was to identify in vivo cytarabine-induced changes in leukemia cell transcriptome and to evaluate their impact on clinical outcome. The results highlight genes relevant to cytarabine resistance and support the concept of targeting cytarabine-induced genes as a means of improving response.

  6. Expansion and stress responses of the AP2/EREBP superfamily in cotton.

    PubMed

    Liu, Chunxiao; Zhang, Tianzhen

    2017-01-31

    The allotetraploid cotton originated from one hybridization event between an extant progenitor of Gosssypium herbaceum (A 1 ) or G. arboreum (A 2 ) and another progenitor, G. raimondii Ulbrich (D 5 ) 1-1.5 million years ago (Mya). The APETALA2/ethylene-responsive element binding protein (AP2/EREBP) transcription factors constitute one of the largest and most conserved gene families in plants. They are characterized by their AP2 domain, which comprises 60-70 amino acids, and are classified into four main subfamilies: the APETALA2 (AP2), Related to ABI3/VP1 (RAV), Dehydration-Responsive Element Binding protein (DREB) and Ethylene-Responsive Factor (ERF) subfamilies. The AP2/EREBP genes play crucial roles in plant growth, development and biotic and abiotic stress responses. Hence, understanding the molecular characteristics of cotton stress tolerance and gene family expansion would undoubtedly facilitate cotton resistance breeding and evolution research. A total of 269 AP2/EREBP genes were identified in the G. raimondii (D5) cotton genome. The protein domain architecture and intron/exon structure are simple and relatively conserved within each subfamily. They are distributed throughout all chromosomes but are clustered on various chromosomes due to genomic tandem duplication. We identified 73 tandem duplicated genes and 221 segmental duplicated gene pairs which contributed to the expansion of AP2/EREBP superfamily. Of them, tandem duplication was the most important force of the expansion of the B3 group. Transcriptome analysis showed that 504 AP2/EREBP genes were expressed in at least one tested G. hirsutum TM-1 tissues. In G. hirsutum, 151 non-repeated genes of the DREB and ERF subfamily genes were responsive to different stresses: 132 genes were induced by cold, 63 genes by drought and 94 genes by heat. qRT-PCR confirmed that 13 GhDREB and 15 GhERF genes were induced by cold and/or drought. No transcripts detected for 53 of the 111 tandem duplicated genes in TM-1. In addition, some homoeologous genes showed biased expression toward either A-or D-subgenome. The AP2/EREBP genes were obviously expanded in Gossypium. The GhDREB and GhERF genes play crucial roles in cotton stress responses. Our genome-wide analysis of AP2/EREBP genes in cotton provides valuable information for characterizing the molecular functions of AP2/EREBP genes and reveals insights into their evolution in polyploid plants.

  7. Gene-based association identifies SPATA13-AS1 as a pharmacogenomic predictor of inhaled short-acting beta-agonist response in multiple population groups.

    PubMed

    Padhukasahasram, B; Yang, J J; Levin, A M; Yang, M; Burchard, E G; Kumar, R; Kwok, P-Y; Seibold, M A; Lanfear, D E; Williams, L K

    2014-08-01

    Inhaled short-acting beta-agonist (SABA) medication is commonly used in asthma patients to rapidly reverse airway obstruction and improve acute symptoms. We performed a genome-wide association study of SABA medication response using gene-based association tests. A linear mixed model approach was first used for single-nucleotide polymorphism associations, and the results were later combined using GATES to generate gene-based associations. Our results identified SPATA13-AS1 as being significantly associated with SABA bronchodilator response in 328 healthy African Americans. In replication, this gene was associated with SABA response among the two separate groups of African Americans with asthma (n=1073, P=0.011 and n=1968, P=0.014), 149 healthy African Americans (P=0.003) and 556 European Americans with asthma (P=0.041). SPATA13-AS1 was also associated with longitudinal SABA medication usage in the two separate groups of African Americans with asthma (n=658, P=0.047 and n=1968, P=0.025). Future studies are needed to delineate the precise mechanism by which SPATA13-AS1 may influence SABA response.

  8. Hypoxia-induced HIF1α targets in melanocytes reveal a molecular profile associated with poor melanoma prognosis

    PubMed Central

    Loftus, Stacie K.; Baxter, Laura L.; Cronin, Julia C.; Fufa, Temesgen D.; Pavan, William J.

    2017-01-01

    Summary Hypoxia and HIF1α signaling direct tissue-specific gene responses regulating tumor progression, invasion and metastasis. By integrating HIF1α knockdown and hypoxia-induced gene expression changes, this study identifies a melanocyte-specific, HIF1α-dependent/hypoxia-responsive gene expression signature. Integration of these gene expression changes with HIF1α ChIP-Seq analysis identifies 81 HIF1α direct target genes in melanocytes. The expression levels for ten of the HIF1α direct targets – GAPDH, PKM, PPAT, DARS, DTWD1, SEH1L, ZNF292, RLF, AGTRAP, and GPC6 – are significantly correlated with reduced time of Disease Free Status (DFS) in melanoma by logistic regression (P-value =0.0013) and ROC curve analysis (AUC= 0.826, P-value<0.0001). This HIF1α-regulated profile defines a melanocyte-specific response under hypoxia, and demonstrates the role of HIF1α as an invasive cell state gatekeeper in regulating cellular metabolism, chromatin and transcriptional regulation, vascularization and invasion. PMID:28168807

  9. Genome-Wide Identification of Medicago Peptides Involved in Macronutrient Responses and Nodulation1[OPEN

    PubMed Central

    Dai, Xinbin; Zhuang, Zhaohong; Torres-Jerez, Ivone; Nogales, Joaquina

    2017-01-01

    Growing evidence indicates that small, secreted peptides (SSPs) play critical roles in legume growth and development, yet the annotation of SSP-coding genes is far from complete. Systematic reannotation of the Medicago truncatula genome identified 1,970 homologs of established SSP gene families and an additional 2,455 genes that are potentially novel SSPs, previously unreported in the literature. The expression patterns of known and putative SSP genes based on 144 RNA sequencing data sets covering various stages of macronutrient deficiencies and symbiotic interactions with rhizobia and mycorrhiza were investigated. Focusing on those known or suspected to act via receptor-mediated signaling, 240 nutrient-responsive and 365 nodulation-responsive Signaling-SSPs were identified, greatly expanding the number of SSP gene families potentially involved in acclimation to nutrient deficiencies and nodulation. Synthetic peptide applications were shown to alter root growth and nodulation phenotypes, revealing additional regulators of legume nutrient acquisition. Our results constitute a powerful resource enabling further investigations of specific SSP functions via peptide treatment and reverse genetics. PMID:29030416

  10. The Genome Sequence of the Cyanobacterium Oscillatoria sp. PCC 6506 Reveals Several Gene Clusters Responsible for the Biosynthesis of Toxins and Secondary Metabolites▿

    PubMed Central

    Méjean, Annick; Mazmouz, Rabia; Mann, Stéphane; Calteau, Alexandra; Médigue, Claudine; Ploux, Olivier

    2010-01-01

    We report a draft sequence of the genome of Oscillatoria sp. PCC 6506, a cyanobacterium that produces anatoxin-a and homoanatoxin-a, two neurotoxins, and cylindrospermopsin, a cytotoxin. Beside the clusters of genes responsible for the biosynthesis of these toxins, we have found other clusters of genes likely involved in the biosynthesis of not-yet-identified secondary metabolites. PMID:20675499

  11. Co-regulation analysis of co-expressed modules under cold and pathogen stress conditions in tomato.

    PubMed

    Abedini, Davar; Rashidi Monfared, Sajad

    2018-06-01

    A primary mechanism for controlling the development of multicellular organisms is transcriptional regulation, which carried out by transcription factors (TFs) that recognize and bind to their binding sites on promoter region. The distance from translation start site, order, orientation, and spacing between cis elements are key factors in the concentration of active nuclear TFs and transcriptional regulation of target genes. In this study, overrepresented motifs in cold and pathogenesis responsive genes were scanned via Gibbs sampling method, this method is based on detection of overrepresented motifs by means of a stochastic optimization strategy that searches for all possible sets of short DNA segments. Then, identified motifs were checked by TRANSFAC, PLACE and Soft Berry databases in order to identify putative TFs which, interact to the motifs. Several cis/trans regulatory elements were found using these databases. Moreover, cross-talk between cold and pathogenesis responsive genes were confirmed. Statistical analysis was used to determine distribution of identified motifs on promoter region. In addition, co-regulation analysis results, illustrated genes in pathogenesis responsive module are divided into two main groups. Also, promoter region was crunched to six subareas in order to draw the pattern of distribution of motifs in promoter subareas. The result showed the majority of motifs are concentrated on 700 nucleotides upstream of the translational start site (ATG). In contrast, this result isn't true in another group. In other words, there was no difference between total and compartmentalized regions in cold responsive genes.

  12. Identification of key microRNAs and genes in preeclampsia by bioinformatics analysis

    PubMed Central

    Luo, Shouling; Cao, Nannan; Tang, Yao; Gu, Weirong

    2017-01-01

    Preeclampsia is a leading cause of perinatal maternal–foetal mortality and morbidity. The aim of this study is to identify the key microRNAs and genes in preeclampsia and uncover their potential functions. We downloaded the miRNA expression profile of GSE84260 and the gene expression profile of GSE73374 from the Gene Expression Omnibus database. Differentially expressed miRNAs and genes were identified and compared to miRNA-target information from MiRWalk 2.0, and a total of 65 differentially expressed miRNAs (DEMIs), including 32 up-regulated miRNAs and 33 down-regulated miRNAs, and 91 differentially expressed genes (DEGs), including 83 up-regulated genes and 8 down-regulated genes, were identified. The pathway enrichment analyses of the DEMIs showed that the up-regulated DEMIs were enriched in the Hippo signalling pathway and MAPK signalling pathway, and the down-regulated DEMIs were enriched in HTLV-I infection and miRNAs in cancers. The gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes pathway (KEGG) enrichment analyses of the DEGs were performed using Multifaceted Analysis Tool for Human Transcriptome. The up-regulated DEGs were enriched in biological processes (BPs), including the response to cAMP, response to hydrogen peroxide and cell-cell adhesion mediated by integrin; no enrichment of down-regulated DEGs was identified. KEGG analysis showed that the up-regulated DEGs were enriched in the Hippo signalling pathway and pathways in cancer. A PPI network of the DEGs was constructed by using Cytoscape software, and FOS, STAT1, MMP14, ITGB1, VCAN, DUSP1, LDHA, MCL1, MET, and ZFP36 were identified as the hub genes. The current study illustrates a characteristic microRNA profile and gene profile in preeclampsia, which may contribute to the interpretation of the progression of preeclampsia and provide novel biomarkers and therapeutic targets for preeclampsia. PMID:28594854

  13. Molecular genetic responses to lysergic acid diethylamide include transcriptional activation of MAP kinase phosphatase-1, C/EBP-beta and ILAD-1, a novel gene with homology to arrestins.

    PubMed

    Nichols, Charles D; Sanders-Bush, Elaine

    2004-08-01

    We recently demonstrated that the potent hallucinogenic drug lysergic acid diethylamide (LSD) dynamically influences the expression of a small collection of genes within the mammalian prefrontal cortex. Towards generating a greater understanding of the molecular genetic effects of hallucinogens and how they may relate to alterations in behavior, we have identified and characterized expression patterns of a new collection of three genes increased in expression by acute LSD administration. These genes were identified through additional screens of Affymetrix DNA microarrays and examined in experiments to assess dose-response, time course and the receptor mediating the expression changes. The first induced gene, C/EBP-beta, is a transcription factor. The second gene, MKP-1, suggests that LSD activates the MAP (mitogen activated protein) kinase pathway. The third gene, ILAD-1, demonstrates sequence similarity to the arrestins. The increase in expression of each gene was partially mediated through LSD interactions at 5-HT2A (serotonin) receptors. There is evidence of alternative splicing at the ILAD-1 locus. Furthermore, data suggests that various splice isoforms of ILAD-1 respond differently at the transcriptional level to LSD. The genes thus far found to be responsive to LSD are beginning to give a more complete picture of the complex intracellular events initiated by hallucinogens.

  14. Integrated Module and Gene-Specific Regulatory Inference Implicates Upstream Signaling Networks

    PubMed Central

    Roy, Sushmita; Lagree, Stephen; Hou, Zhonggang; Thomson, James A.; Stewart, Ron; Gasch, Audrey P.

    2013-01-01

    Regulatory networks that control gene expression are important in diverse biological contexts including stress response and development. Each gene's regulatory program is determined by module-level regulation (e.g. co-regulation via the same signaling system), as well as gene-specific determinants that can fine-tune expression. We present a novel approach, Modular regulatory network learning with per gene information (MERLIN), that infers regulatory programs for individual genes while probabilistically constraining these programs to reveal module-level organization of regulatory networks. Using edge-, regulator- and module-based comparisons of simulated networks of known ground truth, we find MERLIN reconstructs regulatory programs of individual genes as well or better than existing approaches of network reconstruction, while additionally identifying modular organization of the regulatory networks. We use MERLIN to dissect global transcriptional behavior in two biological contexts: yeast stress response and human embryonic stem cell differentiation. Regulatory modules inferred by MERLIN capture co-regulatory relationships between signaling proteins and downstream transcription factors thereby revealing the upstream signaling systems controlling transcriptional responses. The inferred networks are enriched for regulators with genetic or physical interactions, supporting the inference, and identify modules of functionally related genes bound by the same transcriptional regulators. Our method combines the strengths of per-gene and per-module methods to reveal new insights into transcriptional regulation in stress and development. PMID:24146602

  15. Genome-Wide Identification, Phylogeny, and Expression Analyses of the 14-3-3 Family Reveal Their Involvement in the Development, Ripening, and Abiotic Stress Response in Banana

    PubMed Central

    Li, Meiying; Ren, Licheng; Xu, Biyu; Yang, Xiaoliang; Xia, Qiyu; He, Pingping; Xiao, Susheng; Guo, Anping; Hu, Wei; Jin, Zhiqiang

    2016-01-01

    Plant 14-3-3 proteins act as critical components of various cellular signaling processes and play an important role in regulating multiple physiological processes. However, less information is known about the 14-3-3 gene family in banana. In this study, 25 14-3-3 genes were identified from the banana genome. Based on the evolutionary analysis, banana 14-3-3 proteins were clustered into ε and non-ε groups. Conserved motif analysis showed that all identified banana 14-3-3 genes had the typical 14-3-3 motif. The gene structure of banana 14-3-3 genes showed distinct class-specific divergence between the ε group and the non-ε group. Most banana 14-3-3 genes showed strong transcript accumulation changes during fruit development and postharvest ripening in two banana varieties, indicating that they might be involved in regulating fruit development and ripening. Moreover, some 14-3-3 genes also showed great changes after osmotic, cold, and salt treatments in two banana varieties, suggested their potential role in regulating banana response to abiotic stress. Taken together, this systemic analysis reveals the involvement of banana 14-3-3 genes in fruit development, postharvest ripening, and response to abiotic stress and provides useful information for understanding the functions of 14-3-3 genes in banana. PMID:27713761

  16. The role of HPV RNA transcription, immune response-related gene expression and disruptive TP53 mutations in diagnostic and prognostic profiling of head and neck cancer.

    PubMed

    Wichmann, Gunnar; Rosolowski, Maciej; Krohn, Knut; Kreuz, Markus; Boehm, Andreas; Reiche, Anett; Scharrer, Ulrike; Halama, Dirk; Bertolini, Julia; Bauer, Ulrike; Holzinger, Dana; Pawlita, Michael; Hess, Jochen; Engel, Christoph; Hasenclever, Dirk; Scholz, Markus; Ahnert, Peter; Kirsten, Holger; Hemprich, Alexander; Wittekind, Christian; Herbarth, Olf; Horn, Friedemann; Dietz, Andreas; Loeffler, Markus

    2015-12-15

    Stratification of head and neck squamous cell carcinomas (HNSCC) based on HPV16 DNA and RNA status, gene expression patterns, and mutated candidate genes may facilitate patient treatment decision. We characterize head and neck squamous cell carcinomas (HNSCC) with different HPV16 DNA and RNA (E6*I) status from 290 consecutively recruited patients by gene expression profiling and targeted sequencing of 50 genes. We show that tumors with transcriptionally inactive HPV16 (DNA+ RNA-) are similar to HPV-negative (DNA-) tumors regarding gene expression and frequency of TP53 mutations (47%, 8/17 and 43%, 72/167, respectively). We also find that an immune response-related gene expression cluster is associated with lymph node metastasis, independent of HPV16 status and that disruptive TP53 mutations are associated with lymph node metastasis in HPV16 DNA- tumors. We validate each of these associations in another large data set. Four gene expression clusters which we identify differ moderately but significantly in overall survival. Our findings underscore the importance of measuring the HPV16 RNA (E6*I) and TP53-mutation status for patient stratification and identify associations of an immune response-related gene expression cluster and TP53 mutations with lymph node metastasis in HNSCC. © 2015 UICC.

  17. Omics and Environmental Science Genomic Approaches With Natural Fish Populations From Polluted Environments

    PubMed Central

    Bozinovic, Goran; Oleksiak, Marjorie F.

    2010-01-01

    Transcriptomics and population genomics are two complementary genomic approaches that can be used to gain insight into pollutant effects in natural populations. Transcriptomics identify altered gene expression pathways while population genomics approaches more directly target the causative genomic polymorphisms. Neither approach is restricted to a pre-determined set of genes or loci. Instead, both approaches allow a broad overview of genomic processes. Transcriptomics and population genomic approaches have been used to explore genomic responses in populations of fish from polluted environments and have identified sets of candidate genes and loci that appear biologically important in response to pollution. Often differences in gene expression or loci between polluted and reference populations are not conserved among polluted populations suggesting a biological complexity that we do not yet fully understand. As genomic approaches become less expensive with the advent of new sequencing and genotyping technologies, they will be more widely used in complimentary studies. However, while these genomic approaches are immensely powerful for identifying candidate gene and loci, the challenge of determining biological mechanisms that link genotypes and phenotypes remains. PMID:21072843

  18. Expression of Arabidopsis FCS-Like Zinc finger genes is differentially regulated by sugars, cellular energy level, and abiotic stress

    PubMed Central

    Jamsheer K, Muhammed; Laxmi, Ashverya

    2015-01-01

    Cellular energy status is an important regulator of plant growth, development, and stress mitigation. Environmental stresses ultimately lead to energy deficit in the cell which activates the SNF1-RELATED KINASE 1 (SnRK1) signaling cascade which eventually triggering a massive reprogramming of transcription to enable the plant to survive under low-energy conditions. The role of Arabidopsis thaliana FCS-Like Zinc finger (FLZ) gene family in energy and stress signaling is recently come to highlight after their interaction with kinase subunits of SnRK1 were identified. In a detailed expression analysis in different sugars, energy starvation, and replenishment series, we identified that the expression of most of the FLZ genes is differentially modulated by cellular energy level. It was found that FLZ gene family contains genes which are both positively and negatively regulated by energy deficit as well as energy-rich conditions. Genetic and pharmacological studies identified the role of HEXOKINASE 1- dependent and energy signaling pathways in the sugar-induced expression of FLZ genes. Further, these genes were also found to be highly responsive to different stresses as well as abscisic acid. In over-expression of kinase subunit of SnRK1, FLZ genes were found to be differentially regulated in accordance with their response toward energy fluctuation suggesting that these genes may work downstream to the established SnRK1 signaling under low-energy stress. Taken together, the present study provides a conceptual framework for further studies related to SnRK1-FLZ interaction in relation to sugar and energy signaling and stress response. PMID:26442059

  19. Liver transcriptome analysis reveals extensive transcriptional plasticity during acclimation to low salinity in Cynoglossus semilaevis.

    PubMed

    Si, Yufeng; Wen, Haishen; Li, Yun; He, Feng; Li, Jifang; Li, Siping; He, Huiwen

    2018-06-18

    Salinity is an important abiotic stress that influences the physiological and metabolic activity, reproduction, growth and development of marine fish. It has been suggested that half-smooth tongue sole (Cynoglossus semilaevis), a euryhaline fish species, uses a large amount of energy to maintain osmotic pressure balance when exposed to fluctuations in salinity. To delineate the molecular response of C. semilaevis to different levels of salinity, we performed RNA-seq analysis of the liver to identify the genes and molecular and biological processes involved in responding to salinity changes. The present study yielded 330.4 million clean reads, of which 83.9% were successfully mapped to the reference genome of C. semilaevis. One hundred twenty-eight differentially expressed genes (DEGs), including 43 up-regulated genes and 85 down-regulated genes, were identified. These DEGs were highly represented in metabolic pathways, steroid biosynthesis, terpenoid backbone biosynthesis, butanoate metabolism, glycerolipid metabolism and the 2-oxocarboxylic acid metabolism pathway. In addition, genes involved in metabolism, osmoregulation and ion transport, signal transduction, immune response and stress response, and cytoskeleton remodeling were affected during acclimation to low salinity. Genes acat2, fdps, hmgcr, hmgcs1, mvk, pmvk, ebp, lss, dhcr7, and dhcr24 were up-regulated and abat, ddc, acy1 were down-regulated in metabolic pathways. Genes aqp10 and slc6a6 were down-regulated in osmoregulation and ion transport. Genes abat, fdps, hmgcs1, mvk, pmvk and dhcr7 were first reported to be associated with salinity adaptation in teleosts. Our results revealed that metabolic pathways, especially lipid metabolism were important for salinity adaptation. The candidate genes identified from this study provide a basis for further studies to investigate the molecular mechanism of salinity adaptation and transcriptional plasticity in marine fish.

  20. Identification of novel drought-responsive microRNAs and trans-acting siRNAs from Sorghum bicolor (L.) Moench by high-throughput sequencing analysis

    PubMed Central

    Katiyar, Amit; Smita, Shuchi; Muthusamy, Senthilkumar K.; Chinnusamy, Viswanathan; Pandey, Dev M.; Bansal, Kailash C.

    2015-01-01

    Small non-coding RNAs (sRNAs) namely microRNAs (miRNAs) and trans-acting small interfering RNAs (tasi-RNAs) play a crucial role in post-transcriptional regulation of gene expression and thus the control plant development and stress responses. In order to identify drought-responsive miRNAs and tasi-RNAs in sorghum, we constructed small RNA libraries from a drought tolerant (M35-1) and susceptible (C43) sorghum genotypes grown under control and drought stress conditions, and sequenced by Illumina Genome Analyzer IIx. Ninety seven conserved and 526 novel miRNAs representing 472 unique miRNA families were identified from sorghum. Ninety-six unique miRNAs were found to be regulated by drought stress, of which 32 were up- and 49 were down-regulated (fold change ≥ 2 or ≤ −2) at least in one genotype, while the remaining 15 miRNAs showed contrasting drought-regulated expression pattern between genotypes. A maximum of 17 and 18 miRNAs was differentially regulated under drought stress condition in the sensitive and tolerant genotypes, respectively. These results suggest that genotype dependent stress responsive regulation of miRNAs may contribute, at least in part, to the differential drought tolerance of sorghum genotypes. We also identified two miR390-directed TAS3 gene homologs and the auxin response factors as tasi-RNA targets. We predicted more than 1300 unique target genes for the novel and conserved miRNAs. These target genes were predicted to be involved in different cellular, metabolic, response to stimulus, biological regulation, and developmental processes. Genome-wide identification of stress-responsive miRNAs, tasi-RNAs and their targets identified in this study will be useful in unraveling the molecular mechanisms underlying drought stress responses and genetic improvement of biomass production and stress tolerance in sorghum. PMID:26236318

  1. Transcriptome profiling of low temperature-treated cassava apical shoots showed dynamic responses of tropical plant to cold stress

    PubMed Central

    2012-01-01

    Background Cassava is an important tropical root crop adapted to a wide range of environmental stimuli such as drought and acid soils. Nevertheless, it is an extremely cold-sensitive tropical species. Thus far, there is limited information about gene regulation and signalling pathways related to the cold stress response in cassava. The development of microarray technology has accelerated the study of global transcription profiling under certain conditions. Results A 60-mer oligonucleotide microarray representing 20,840 genes was used to perform transcriptome profiling in apical shoots of cassava subjected to cold at 7°C for 0, 4 and 9 h. A total of 508 transcripts were identified as early cold-responsive genes in which 319 sequences had functional descriptions when aligned with Arabidopsis proteins. Gene ontology annotation analysis identified many cold-relevant categories, including 'Response to abiotic and biotic stimulus', 'Response to stress', 'Transcription factor activity', and 'Chloroplast'. Various stress-associated genes with a wide range of biological functions were found, such as signal transduction components (e.g., MAP kinase 4), transcription factors (TFs, e.g., RAP2.11), and reactive oxygen species (ROS) scavenging enzymes (e.g., catalase 2), as well as photosynthesis-related genes (e.g., PsaL). Seventeen major TF families including many well-studied members (e.g., AP2-EREBP) were also involved in the early response to cold stress. Meanwhile, KEGG pathway analysis uncovered many important pathways, such as 'Plant hormone signal transduction' and 'Starch and sucrose metabolism'. Furthermore, the expression changes of 32 genes under cold and other abiotic stress conditions were validated by real-time RT-PCR. Importantly, most of the tested stress-responsive genes were primarily expressed in mature leaves, stem cambia, and fibrous roots rather than apical buds and young leaves. As a response to cold stress in cassava, an increase in transcripts and enzyme activities of ROS scavenging genes and the accumulation of total soluble sugars (including sucrose and glucose) were also detected. Conclusions The dynamic expression changes reflect the integrative controlling and transcriptome regulation of the networks in the cold stress response of cassava. The biological processes involved in the signal perception and physiological response might shed light on the molecular mechanisms related to cold tolerance in tropical plants and provide useful candidate genes for genetic improvement. PMID:22321773

  2. Transcriptomic analysis of grape (Vitis vinifera L.) leaves during and after recovery from heat stress.

    PubMed

    Liu, Guo-Tian; Wang, Jun-Fang; Cramer, Grant; Dai, Zhan-Wu; Duan, Wei; Xu, Hong-Guo; Wu, Ben-Hong; Fan, Pei-Ge; Wang, Li-Jun; Li, Shao-Hua

    2012-09-28

    Grapes are a major fruit crop around the world. Heat stress can significantly reduce grape yield and quality. Changes at the molecular level in response to heat stress and subsequent recovery are poorly understood. To elucidate the effect of heat stress and subsequent recovery on expression of genes by grape leaves representing the classic heat stress response and thermotolerance mechanisms, transcript abundance of grape (Vitis vinifera L.) leaves was quantified using the Affymetrix Grape Genome oligonucleotide microarray (15,700 transcripts), followed by quantitative Real-Time PCR validation for some transcript profiles. We found that about 8% of the total probe sets were responsive to heat stress and/or to subsequent recovery in grape leaves. The heat stress and recovery responses were characterized by different transcriptional changes. The number of heat stress-regulated genes was almost twice the number of recovery-regulated genes. The responsive genes identified in this study belong to a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes), protein fate (i.e., HSPs), primary and secondary metabolism, transcription factors, signal transduction, and development. We have identified some common genes and heat shock factors (HSFs) that were modulated differentially by heat stress and recovery. Most HSP genes were upregulated by heat stress but were downregulated by the recovery. On the other hand, some specific HSP genes or HSFs were uniquely responsive to heat stress or recovery. The effect of heat stress and recovery on grape appears to be associated with multiple processes and mechanisms including stress-related genes, transcription factors, and metabolism. Heat stress and recovery elicited common up- or downregulated genes as well as unique sets of responsive genes. Moreover, some genes were regulated in opposite directions by heat stress and recovery. The results indicated HSPs, especially small HSPs, antioxidant enzymes (i.e., ascorbate peroxidase), and galactinol synthase may be important to thermotolerance of grape. HSF30 may be a key regulator for heat stress and recovery, while HSF7 and HSF1 may only be specific to recovery. The identification of heat stress or recovery responsive genes in this study provides novel insights into the molecular basis for heat tolerance in grape leaves.

  3. Aflatoxin formation and gene expression in response to carbon source media shift in Aspergillus parasiticus.

    PubMed

    Wilkinson, J R; Yu, J; Abbas, H K; Scheffler, B E; Kim, H S; Nierman, W C; Bhatnagar, D; Cleveland, T E

    2007-10-01

    Aflatoxins are toxic and carcinogenic polyketide metabolites produced by fungal species, including Aspergillus flavus and A. parasiticus. The biosynthesis of aflatoxins is modulated by many environmental factors, including the availability of a carbon source. The gene expression profile of A. parasiticus was evaluated during a shift from a medium with low concentration of simple sugars, yeast extract (YE), to a similar medium with sucrose, yeast extract sucrose (YES). Gene expression and aflatoxins (B1, B2, G1, and G2) were quantified from fungal mycelia harvested pre- and post-shifting. When compared with YE media, YES caused temporary reduction of the aflatoxin levels detected at 3-h post-shifting and they remained low well past 12 h post-shift. Aflatoxin levels did not exceed the levels in YE until 24 h post-shift, at which time point a tenfold increase was observed over YE. Microarray analysis comparing the RNA samples from the 48-h YE culture to the YES samples identified a total of 2120 genes that were expressed across all experiments, including most of the aflatoxin biosynthesis genes. One-way analysis of variance (ANOVA) identified 56 genes that were expressed with significant variation across all time points. Three genes responsible for converting norsolorinic acid to averantin were identified among these significantly expressed genes. The potential involvement of these genes in the regulation of aflatoxin biosynthesis is discussed.

  4. Characterization of in vitro transcriptional responses of dorsal root ganglia cultured in the presence and absence of blastema cells from regenerating salamander limbs

    PubMed Central

    Athippozhy, Antony; Lehrberg, Jeffrey; Monaghan, James R.; Gardiner, David M.

    2014-01-01

    Abstract During salamander limb regeneration, nerves provide signals that induce the formation of a mass of proliferative cells called the blastema. To better understand these signals, we developed a blastema−dorsal root ganglia (DRG) co‐culture model system to test the hypothesis that nerves differentially express genes in response to cues provided by the blastema. DRG with proximal and distal nerve trunks were isolated from axolotls (Ambystoma mexicanum), cultured for 5 days, and subjected to microarray analysis. Relative to freshly isolated DRG, 1541 Affymetrix probe sets were identified as differentially expressed and many of the predicted genes are known to function in injury and neurodevelopmental responses observed for mammalian DRG. We then cultured 5‐day DRG explants for an additional 5 days with or without co‐cultured blastema cells. On day 10, we identified 27 genes whose expression in cultured DRG was significantly affected by the presence or absence of blastema cells. Overall, our study established a DRG−blastema in vitro culture system and identified candidate genes for future investigations of axon regrowth, nerve−blastema signaling, and neural regulation of limb regeneration. PMID:25750744

  5. Genetic association of impulsivity in young adults: a multivariate study

    PubMed Central

    Khadka, S; Narayanan, B; Meda, S A; Gelernter, J; Han, S; Sawyer, B; Aslanzadeh, F; Stevens, M C; Hawkins, K A; Anticevic, A; Potenza, M N; Pearlson, G D

    2014-01-01

    Impulsivity is a heritable, multifaceted construct with clinically relevant links to multiple psychopathologies. We assessed impulsivity in young adult (N~2100) participants in a longitudinal study, using self-report questionnaires and computer-based behavioral tasks. Analysis was restricted to the subset (N=426) who underwent genotyping. Multivariate association between impulsivity measures and single-nucleotide polymorphism data was implemented using parallel independent component analysis (Para-ICA). Pathways associated with multiple genes in components that correlated significantly with impulsivity phenotypes were then identified using a pathway enrichment analysis. Para-ICA revealed two significantly correlated genotype–phenotype component pairs. One impulsivity component included the reward responsiveness subscale and behavioral inhibition scale of the Behavioral-Inhibition System/Behavioral-Activation System scale, and the second impulsivity component included the non-planning subscale of the Barratt Impulsiveness Scale and the Experiential Discounting Task. Pathway analysis identified processes related to neurogenesis, nervous system signal generation/amplification, neurotransmission and immune response. We identified various genes and gene regulatory pathways associated with empirically derived impulsivity components. Our study suggests that gene networks implicated previously in brain development, neurotransmission and immune response are related to impulsive tendencies and behaviors. PMID:25268255

  6. Dose–response relationships in gene expression profiles in rainbow trout, Oncorhyncus mykiss, exposed to ethynylestradiol

    PubMed Central

    Hook, Sharon E.; Skillman, Ann D.; Small, Jack A.; Schultz, Irvin R.

    2008-01-01

    Determining how gene expression profiles change with toxicant dose will improve the utility of arrays in identifying biomarkers and modes of toxic action. Isogenic rainbow trout, Oncorhyncus mykiss, were exposed to 10, 50 or 100 ng/L ethynylestradiol (a xeno-estrogen) for 7 days. Following exposure hepatic RNA was extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNAs. Transcript expression in treated vs control fish was analyzed via Genespring (Silicon Genetics) to identify genes with altered expression, as well as to determine gene clustering patterns that can be used as “expression signatures”. Array results were confirmed via qRT PCR. Our analysis indicates that gene expression profiles varied somewhat with dose. Established biomarkers of exposure to estrogenic chemicals, such as vitellogenin, vitelline envelope proteins, and the estrogen receptor alpha, were induced at every dose. Other genes were dose specific, suggesting that diffierent doses induce distinct physiological responses. These findings demonstrate that cDNA microarrays could be used to identify both toxicant class and relative dose. PMID:16725192

  7. New natural products isolated from Metarhizium robertsii ARSEF 23 by chemical screening and identification of the gene cluster through engineered biosynthesis in Aspergillus nidulans A1145.

    PubMed

    Kato, Hiroki; Tsunematsu, Yuta; Yamamoto, Tsuyoshi; Namiki, Takuya; Kishimoto, Shinji; Noguchi, Hiroshi; Watanabe, Kenji

    2016-07-01

    To rapidly identify novel natural products and their associated biosynthetic genes from underutilized and genetically difficult-to-manipulate microbes, we developed a method that uses (1) chemical screening to isolate novel microbial secondary metabolites, (2) bioinformatic analyses to identify a potential biosynthetic gene cluster and (3) heterologous expression of the genes in a convenient host to confirm the identity of the gene cluster and the proposed biosynthetic mechanism. The chemical screen was achieved by searching known natural product databases with data from liquid chromatographic and high-resolution mass spectrometric analyses collected on the extract from a target microbe culture. Using this method, we were able to isolate two new meroterpenes, subglutinols C (1) and D (2), from an entomopathogenic filamentous fungus Metarhizium robertsii ARSEF 23. Bioinformatics analysis of the genome allowed us to identify a gene cluster likely to be responsible for the formation of subglutinols. Heterologous expression of three genes from the gene cluster encoding a polyketide synthase, a prenyltransferase and a geranylgeranyl pyrophosphate synthase in Aspergillus nidulans A1145 afforded an α-pyrone-fused uncyclized diterpene, the expected intermediate of the subglutinol biosynthesis, thereby confirming the gene cluster to be responsible for the subglutinol biosynthesis. These results indicate the usefulness of our methodology in isolating new natural products and identifying their associated biosynthetic gene cluster from microbes that are not amenable to genetic manipulation. Our method should facilitate the natural product discovery efforts by expediting the identification of new secondary metabolites and their associated biosynthetic genes from a wider source of microbes.

  8. miRNA regulation in the early development of barley seed

    PubMed Central

    2012-01-01

    Background During the early stages of seed development many genes are under dynamic regulation to ensure the proper differentiation and establishment of the tissue that will constitute the mature grain. To investigate how miRNA regulation contributes to this process in barley, a combination of small RNA and mRNA degradome analyses were used to identify miRNAs and their targets. Results Our analysis identified 84 known miRNAs and 7 new miRNAs together with 96 putative miRNA target genes regulated through a slicing mechanism in grain tissues during the first 15 days post anthesis. We also identified many potential miRNAs including several belonging to known miRNA families. Our data gave us evidence for an increase in miRNA-mediated regulation during the transition between pre-storage and storage phases. Potential miRNA targets were found in various signalling pathways including components of four phytohormone pathways (ABA, GA, auxin, ethylene) and the defence response to powdery mildew infection. Among the putative miRNA targets we identified were two essential genes controlling the GA response, a GA3oxidase1 and a homolog of the receptor GID1, and a homolog of the ACC oxidase which catalyses the last step of ethylene biosynthesis. We found that two MLA genes are potentially miRNA regulated, establishing a direct link between miRNAs and the R gene response. Conclusion Our dataset provides a useful source of information on miRNA regulation during the early development of cereal grains and our analysis suggests that miRNAs contribute to the control of development of the cereal grain, notably through the regulation of phytohormone response pathways. PMID:22838835

  9. Epigenomic study identifies a novel mesenchyme homeobox2-GLI1 transcription axis involved in cancer drug resistance, overall survival and therapy prognosis in lung cancer patients

    PubMed Central

    Armas-López, Leonel; Piña-Sánchez, Patricia; Arrieta, Oscar; de Alba, Enrique Guzman; Ortiz-Quintero, Blanca; Santillán-Doherty, Patricio; Christiani, David C.; Zúñiga, Joaquín; Ávila-Moreno, Federico

    2017-01-01

    Several homeobox-related gene (HOX) transcription factors such as mesenchyme HOX-2 (MEOX2) have previously been associated with cancer drug resistance, malignant progression and/or clinical prognostic responses in lung cancer patients; however, the mechanisms involved in these responses have yet to be elucidated. Here, an epigenomic strategy was implemented to identify novel MEOX2 gene promoter transcription targets and propose a new molecular mechanism underlying lung cancer drug resistance and poor clinical prognosis. Chromatin immunoprecipitation (ChIP) assays derived from non-small cell lung carcinomas (NSCLC) hybridized on gene promoter tiling arrays and bioinformatics analyses were performed, and quantitative, functional and clinical validation were also carried out. We statistically identified a common profile consisting of 78 gene promoter targets, including Hedgehog-GLI1 gene promoter sequences (FDR≤0.1 and FDR≤0.2). The GLI-1 gene promoter region from −2,192 to −109 was occupied by MEOX2, accompanied by transcriptionally active RNA Pol II and was epigenetically linked to the active histones H3K27Ac and H3K4me3; these associations were quantitatively validated. Moreover, siRNA genetic silencing assays identified a MEOX2-GLI1 axis involved in cellular cytotoxic resistance to cisplatinum in a dose-dependent manner, as well as cellular migration and proliferation. Finally, Kaplan-Maier survival analyses identified significant MEOX2-dependent GLI-1 protein expression associated with clinical progression and poorer overall survival using an independent cohort of NSCLC patients undergoing platinum-based oncological therapy with both epidermal growth factor receptor (EGFR)-non-mutated and EGFR-mutated status. In conclusion, this is the first study to investigate epigenome-wide MEOX2-transcription factor occupation identifying a novel overexpressed MEOX2-GLI1 axis and its clinical association with platinum-based cancer drug resistance and EGFR-tyrosine kinase inhibitor (TKI)-based therapy responses in NSCLC patients. PMID:28978016

  10. Comparative transcriptome analysis of rice seedlings induced by different doses of heavy ion radiation

    NASA Astrophysics Data System (ADS)

    Zhao, Qian; Sun, Yeqing; Wang, Wei

    2016-07-01

    Highly ionizing radiation (HZE) in space is considered as a main factor causing biological effects on plant seeds. To investigate the different effects on genome-wide gene expression of low-dose and high-dose ion radiation, we carried out ground-base carbon particle HZE experiments with different cumulative doses (0Gy, 0.2Gy, 2Gy) to rice seeds and then performed comparative transcriptome analysis of the rice seedlings. We identified a total of 2551 and 1464 differentially expressed genes (DEGs) in low-dose and high-dose radiation groups, respectively. Gene ontology analyses indicated that low-dose and high-dose ion radiation both led to multiple physiological and biochemical activities changes in rice. By Gene Ontology analyses, the results showed that only one process-oxidation reduction process was enriched in the biological process category after high-dose ion radiation, while more processes such as response to biotic stimulus, heme binding, tetrapyrrole binding, oxidoreductase activity, catalytic activity and oxidoreductase activity were significantly enriched after low-dose ion radiation. The results indicated that the rice plants only focused on the process of oxidation reduction to response to high-dose ion radiation, whereas it was a coordination of multiple biological processes to response to low-dose ion radiation. To elucidate the transcriptional regulation of radiation stress-responsive genes, we identified several DEGs-encoding TFs. AP2/EREBP, bHLH, C2H2, MYB and WRKY TF families were altered significantly in response to ion radiation. Mapman analysis speculated that the biological effects on rice seedlings caused by the radiation stress might share similar mechanisms with the biotic stress. Our findings highlight important alterations in the expression of radiation response genes, metabolic pathways, and TF-encoding genes in rice seedlings exposed to low-dose and high-dose ion radiation.

  11. Fire blight disease reactome: RNA-seq transcriptional profile of apple host plant defense responses to Erwinia amylovora pathogen infection.

    PubMed

    Kamber, Tim; Buchmann, Jan P; Pothier, Joël F; Smits, Theo H M; Wicker, Thomas; Duffy, Brion

    2016-02-17

    The molecular basis of resistance and susceptibility of host plants to fire blight, a major disease threat to pome fruit production globally, is largely unknown. RNA-sequencing data from challenged and mock-inoculated flowers were analyzed to assess the susceptible response of apple to the fire blight pathogen Erwinia amylovora. In presence of the pathogen 1,080 transcripts were differentially expressed at 48 h post inoculation. These included putative disease resistance, stress, pathogen related, general metabolic, and phytohormone related genes. Reads, mapped to regions on the apple genome where no genes were assigned, were used to identify potential novel genes and open reading frames. To identify transcripts specifically expressed in response to E. amylovora, RT-PCRs were conducted and compared to the expression patterns of the fire blight biocontrol agent Pantoea vagans strain C9-1, another apple pathogen Pseudomonas syringae pv. papulans, and mock inoculated apple flowers. This led to the identification of a peroxidase superfamily gene that was lower expressed in response to E. amylovora suggesting a potential role in the susceptibility response. Overall, this study provides the first transcriptional profile by RNA-seq of the host plant during fire blight disease and insights into the response of susceptible apple plants to E. amylovora.

  12. Fire blight disease reactome: RNA-seq transcriptional profile of apple host plant defense responses to Erwinia amylovora pathogen infection

    PubMed Central

    Kamber, Tim; Buchmann, Jan P.; Pothier, Joël F.; Smits, Theo H. M.; Wicker, Thomas; Duffy, Brion

    2016-01-01

    The molecular basis of resistance and susceptibility of host plants to fire blight, a major disease threat to pome fruit production globally, is largely unknown. RNA-sequencing data from challenged and mock-inoculated flowers were analyzed to assess the susceptible response of apple to the fire blight pathogen Erwinia amylovora. In presence of the pathogen 1,080 transcripts were differentially expressed at 48 h post inoculation. These included putative disease resistance, stress, pathogen related, general metabolic, and phytohormone related genes. Reads, mapped to regions on the apple genome where no genes were assigned, were used to identify potential novel genes and open reading frames. To identify transcripts specifically expressed in response to E. amylovora, RT-PCRs were conducted and compared to the expression patterns of the fire blight biocontrol agent Pantoea vagans strain C9-1, another apple pathogen Pseudomonas syringae pv. papulans, and mock inoculated apple flowers. This led to the identification of a peroxidase superfamily gene that was lower expressed in response to E. amylovora suggesting a potential role in the susceptibility response. Overall, this study provides the first transcriptional profile by RNA-seq of the host plant during fire blight disease and insights into the response of susceptible apple plants to E. amylovora. PMID:26883568

  13. Age Dependent Variability in Gene Expression in Fischer 344 ...

    EPA Pesticide Factsheets

    Recent evidence suggests older adults may be a sensitive population with regard to environmental exposure to toxic compounds. One source of this sensitivity could be an enhanced variability in response. Studies on phenotypic differences have suggested that variation in response does increase with age. However, few reports address the question of variation in gene expression as an underlying cause for increased variability of phenotypic response in the aged. In this study, we utilized global analysis to compare variation in constitutive gene expression in the retinae of young (4 mos), middle-aged (11 mos) and aged (23 mos) Fischer 344 rats. Three hundred and forty transcripts were identified in which variance in expression increased from 4 to 23 mos of age, while only twelve transcripts were found for which it decreased. Functional roles for identified genes were clustered in basic biological categories including cell communication, function, metabolism and response to stimuli. Our data suggest that population stochastically-induced variability should be considered in assessing sensitivity due to old age. Recent evidence suggests older adults may be a sensitive population with regard to environmental exposure to toxic compounds. One source of this sensitivity could be an enhanced variability in response. Studies on phenotypic differences have suggested that variation in response does increase with age. However, few reports address the question of variation in

  14. Linking the salt transcriptome with physiological responses of a salt-resistant Populus species as a strategy to identify genes important for stress acclimation.

    PubMed

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A; Cullmann, Andreas D; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-12-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified.

  15. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    PubMed Central

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  16. Identification and characterization of nuclear genes involved in photosynthesis in Populus

    PubMed Central

    2014-01-01

    Background The gap between the real and potential photosynthetic rate under field conditions suggests that photosynthesis could potentially be improved. Nuclear genes provide possible targets for improving photosynthetic efficiency. Hence, genome-wide identification and characterization of the nuclear genes affecting photosynthetic traits in woody plants would provide key insights on genetic regulation of photosynthesis and identify candidate processes for improvement of photosynthesis. Results Using microarray and bulked segregant analysis strategies, we identified differentially expressed nuclear genes for photosynthesis traits in a segregating population of poplar. We identified 515 differentially expressed genes in this population (FC ≥ 2 or FC ≤ 0.5, P < 0.05), 163 up-regulated and 352 down-regulated. Real-time PCR expression analysis confirmed the microarray data. Singular Enrichment Analysis identified 48 significantly enriched GO terms for molecular functions (28), biological processes (18) and cell components (2). Furthermore, we selected six candidate genes for functional examination by a single-marker association approach, which demonstrated that 20 SNPs in five candidate genes significantly associated with photosynthetic traits, and the phenotypic variance explained by each SNP ranged from 2.3% to 12.6%. This revealed that regulation of photosynthesis by the nuclear genome mainly involves transport, metabolism and response to stimulus functions. Conclusions This study provides new genome-scale strategies for the discovery of potential candidate genes affecting photosynthesis in Populus, and for identification of the functions of genes involved in regulation of photosynthesis. This work also suggests that improving photosynthetic efficiency under field conditions will require the consideration of multiple factors, such as stress responses. PMID:24673936

  17. Use of RADs to identify canidate genes for response to crowding stress in rainbow trout

    USDA-ARS?s Scientific Manuscript database

    Fish under intensive rearing conditions experience various stressors which have negative impacts on survival, growth, reproduction and fillet quality. Identifying and characterizing the molecular mechanisms underlying stress responses will facilitate the development of strategies that aim to improve...

  18. 454 Pyrosequencing of Olive (Olea europaea L.) Transcriptome in Response to Salinity

    PubMed Central

    Bazakos, Christos; Manioudaki, Maria E.; Sarropoulou, Elena; Spano, Thodhoraq; Kalaitzis, Panagiotis

    2015-01-01

    Olive (Olea europaea L.) is one of the most important crops in the Mediterranean region. The expansion of cultivation in areas irrigated with low quality and saline water has negative effects on growth and productivity however the investigation of the molecular basis of salt tolerance in olive trees has been only recently initiated. To this end, we investigated the molecular response of cultivar Kalamon to salinity stress using next-generation sequencing technology to explore the transcriptome profile of olive leaves and roots and identify differentially expressed genes that are related to salt tolerance response. Out of 291,958 obtained trimmed reads, 28,270 unique transcripts were identified of which 35% are annotated, a percentage that is comparable to similar reports on non-model plants. Among the 1,624 clusters in roots that comprise more than one read, 24 were differentially expressed comprising 9 down- and 15 up-regulated genes. Respectively, inleaves, among the 2,642 clusters, 70 were identified as differentially expressed, with 14 down- and 56 up-regulated genes. Using next-generation sequencing technology we were able to identify salt-response-related transcripts. Furthermore we provide an annotated transcriptome of olive as well as expression data, which are both significant tools for further molecular studies in olive. PMID:26576008

  19. 454 Pyrosequencing of Olive (Olea europaea L.) Transcriptome in Response to Salinity.

    PubMed

    Bazakos, Christos; Manioudaki, Maria E; Sarropoulou, Elena; Spano, Thodhoraq; Kalaitzis, Panagiotis

    2015-01-01

    Olive (Olea europaea L.) is one of the most important crops in the Mediterranean region. The expansion of cultivation in areas irrigated with low quality and saline water has negative effects on growth and productivity however the investigation of the molecular basis of salt tolerance in olive trees has been only recently initiated. To this end, we investigated the molecular response of cultivar Kalamon to salinity stress using next-generation sequencing technology to explore the transcriptome profile of olive leaves and roots and identify differentially expressed genes that are related to salt tolerance response. Out of 291,958 obtained trimmed reads, 28,270 unique transcripts were identified of which 35% are annotated, a percentage that is comparable to similar reports on non-model plants. Among the 1,624 clusters in roots that comprise more than one read, 24 were differentially expressed comprising 9 down- and 15 up-regulated genes. Respectively, inleaves, among the 2,642 clusters, 70 were identified as differentially expressed, with 14 down- and 56 up-regulated genes. Using next-generation sequencing technology we were able to identify salt-response-related transcripts. Furthermore we provide an annotated transcriptome of olive as well as expression data, which are both significant tools for further molecular studies in olive.

  20. RNAseq reveals weed-induced PIF3-like as a candidate target to manipulate weed stress response in soybean.

    PubMed

    Horvath, David P; Hansen, Stephanie A; Moriles-Miller, Janet P; Pierik, Ronald; Yan, Changhui; Clay, David E; Scheffler, Brian; Clay, Sharon A

    2015-07-01

    Weeds reduce yield in soybeans (Glycine max) through incompletely defined mechanisms. The effects of weeds on the soybean transcriptome were evaluated in field conditions during four separate growing seasons. RNASeq data were collected from six biological samples of soybeans growing with or without weeds. Weed species and the methods to maintain weed-free controls varied between years to mitigate treatment effects, and to allow detection of general soybean weed responses. Soybean plants were not visibly nutrient- or water-stressed. We identified 55 consistently downregulated genes in weedy plots. Many of the downregulated genes were heat shock genes. Fourteen genes were consistently upregulated. Several transcription factors including a PHYTOCHROME INTERACTING FACTOR 3-like gene (PIF3) were included among the upregulated genes. Gene set enrichment analysis indicated roles for increased oxidative stress and jasmonic acid signaling responses during weed stress. The relationship of this weed-induced PIF3 gene to genes involved in shade avoidance responses in Arabidopsis provide evidence that this gene may be important in the response of soybean to weeds. These results suggest that the weed-induced PIF3 gene will be a target for manipulating weed tolerance in soybean. No claim to original US government works New Phytologist © 2015 New Phytologist Trust.

  1. An 80-gene set to predict response to preoperative chemoradiotherapy for rectal cancer by principle component analysis.

    PubMed

    Empuku, Shinichiro; Nakajima, Kentaro; Akagi, Tomonori; Kaneko, Kunihiko; Hijiya, Naoki; Etoh, Tsuyoshi; Shiraishi, Norio; Moriyama, Masatsugu; Inomata, Masafumi

    2016-05-01

    Preoperative chemoradiotherapy (CRT) for locally advanced rectal cancer not only improves the postoperative local control rate, but also induces downstaging. However, it has not been established how to individually select patients who receive effective preoperative CRT. The aim of this study was to identify a predictor of response to preoperative CRT for locally advanced rectal cancer. This study is additional to our multicenter phase II study evaluating the safety and efficacy of preoperative CRT using oral fluorouracil (UMIN ID: 03396). From April, 2009 to August, 2011, 26 biopsy specimens obtained prior to CRT were analyzed by cyclopedic microarray analysis. Response to CRT was evaluated according to a histological grading system using surgically resected specimens. To decide on the number of genes for dividing into responder and non-responder groups, we statistically analyzed the data using a dimension reduction method, a principle component analysis. Of the 26 cases, 11 were responders and 15 non-responders. No significant difference was found in clinical background data between the two groups. We determined that the optimal number of genes for the prediction of response was 80 of 40,000 and the functions of these genes were analyzed. When comparing non-responders with responders, genes expressed at a high level functioned in alternative splicing, whereas those expressed at a low level functioned in the septin complex. Thus, an 80-gene expression set that predicts response to preoperative CRT for locally advanced rectal cancer was identified using a novel statistical method.

  2. Avian influenza rapidly induces antiviral genes in duck lung and intestine

    PubMed Central

    Vanderven, Hillary A.; Petkau, Kristina; Ryan-Jean, Kieran E. E.; Aldridge, Jerry R.; Webster, Robert G.; Magor, Katharine E.

    2012-01-01

    Ducks are the natural reservoir of influenza A and survive infection by most strains. To characterize the duck immune response to influenza, we sought to identify innate immune genes expressed early in an infection. We used suppressive subtractive hybridization (SSH) to construct 3 libraries enriched in differentially expressed genes from lung RNA of a duck infected with highly pathogenic avian influenza virus A/Vietnam/1203/04 (H5N1), or lung and intestine RNA of a duck infected with low pathogenic avian influenza A/mallard/BC/500/05 (H5N2) compared to a mock-infected duck. Sequencing of 1687 clones identified a transcription profile enriched in genes involved in antiviral defense and other cellular processes. Major histocompatibility complex class I (MHC I), interferon induced protein with tricopeptide repeats 5 (IFIT5), and 2′–5′oligoadenylate synthetase-like gene (OASL) were increased more than 1000-fold in relative transcript abundance in duck lung at 1 dpi with highly pathogenic VN1203. These genes were induced much less in lung or intestine following infection with low pathogenic BC500. The expression of these genes following infection suggests that ducks initiate an immediate and robust response to a potentially lethal influenza strain, and a minimal response a low pathogenic strain. PMID:22534314

  3. UVB-induced gene expression in the skin of Xiphophorus maculatus Jp 163 B☆

    PubMed Central

    Yang, Kuan; Boswell, Mikki; Walter, Dylan J.; Downs, Kevin P.; Gaston-Pravia, Kimberly; Garcia, Tzintzuni; Shen, Yingjia; Mitchell, David L.; Walter, Ronald B.

    2014-01-01

    Xiphophorus fish and interspecies hybrids represent long-standing models to study the genetics underlying spontaneous and induced tumorigenesis. The recent release of the Xiphophorus maculatus genome sequence will allow global genetic regulation studies of genes involved in the inherited susceptibility to UVB-induced melanoma within select backcross hybrids. As a first step toward this goal, we report results of an RNA-Seq approach to identify genes and pathways showing modulated transcription within the skin of X. maculatus Jp 163 B upon UVB exposure. X. maculatus Jp 163 B were exposed to various doses of UVB followed by RNA-Seq analysis at each dose to investigate overall gene expression in each sample. A total of 357 genes with a minimum expression change of 4-fold (p-adj < 0.05) were identified as responsive to UVB. The molecular genetic response of Xiphophorus skin to UVB exposure permitted assessment of; (1) the basal expression level of each transcript for each skin sample, (2) the changes in expression levels for each gene in the transcriptome upon exposure to increasing doses of UVB, and (3) clusters of genes that exhibit similar patterns of change in expression upon UVB exposure. These data provide a foundation for understanding the molecular genetic response of fish skin to UVB exposure. PMID:24556253

  4. Wild soybean roots depend on specific transcription factors and oxidation reduction related genesin response to alkaline stress.

    PubMed

    DuanMu, Huizi; Wang, Yang; Bai, Xi; Cheng, Shufei; Deyholos, Michael K; Wong, Gane Ka-Shu; Li, Dan; Zhu, Dan; Li, Ran; Yu, Yang; Cao, Lei; Chen, Chao; Zhu, Yanming

    2015-11-01

    Soil alkalinity is an important environmental problem limiting agricultural productivity. Wild soybean (Glycine soja) shows strong alkaline stress tolerance, so it is an ideal plant candidate for studying the molecular mechanisms of alkaline tolerance and identifying alkaline stress-responsive genes. However, limited information is available about G. soja responses to alkaline stress on a genomic scale. Therefore, in the present study, we used RNA sequencing to compare transcript profiles of G. soja root responses to sodium bicarbonate (NaHCO3) at six time points, and a total of 68,138,478 pairs of clean reads were obtained using the Illumina GAIIX. Expression patterns of 46,404 G. soja genes were profiled in all six samples based on RNA-seq data using Cufflinks software. Then, t12 transcription factors from MYB, WRKY, NAC, bZIP, C2H2, HB, and TIFY families and 12 oxidation reduction related genes were chosen and verified to be induced in response to alkaline stress by using quantitative real-time polymerase chain reaction (qRT-PCR). The GO functional annotation analysis showed that besides "transcriptional regulation" and "oxidation reduction," these genes were involved in a variety of processes, such as "binding" and "response to stress." This is the first comprehensive transcriptome profiling analysis of wild soybean root under alkaline stress by RNA sequencing. Our results highlight changes in the gene expression patterns and identify a set of genes induced by NaHCO3 stress. These findings provide a base for the global analyses of G. soja alkaline stress tolerance mechanisms.

  5. EGFR Gene Amplification and KRAS Mutation Predict Response to Combination Targeted Therapy in Metastatic Colorectal Cancer.

    PubMed

    Khan, Sajid A; Zeng, Zhaoshi; Shia, Jinru; Paty, Philip B

    2017-07-01

    Genetic variability in KRAS and EGFR predicts response to cetuximab in irinotecan refractory colorectal cancer. Whether these markers or others remain predictive in combination biologic therapies including bevacizumab is unknown. We identified predictive biomarkers from patients with irinotecan refractory metastatic colorectal cancer treated with cetuximab plus bevacizumab. Patients who received cetuximab plus bevacizumab for irinotecan refractory colorectal cancer in either of two Phase II trials conducted were identified. Tumor tissue was available for 33 patients. Genomic DNA was extracted and used for mutational analysis of KRAS, BRAF, and p53 genes. Fluorescence in situ hybridization was performed to assess EGFR copy number. The status of single genes and various combinations were tested for association with response. Seven of 33 patients responded to treatment. KRAS mutations were found in 14/33 cases, and 0 responded to treatment (p = 0.01). EGFR gene amplification was seen in 3/33 of tumors and in every case was associated with response to treatment (p < 0.001). TP53 and BRAF mutations were found in 18/33 and 0/33 tumors, respectively, and there were no associations with response to either gene. EGFR gene amplification and KRAS mutations are predictive markers for patients receiving combination biologic therapy of cetuximab plus bevacizumab for metastatic colorectal cancer. One marker or the other is present in the tumor of half of all patients allowing treatment response to be predicted with a high degree of certainty. The role for molecular markers in combination biologic therapy seems promising.

  6. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    PubMed

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  7. Identification, characterization, and expression analysis of calmodulin and calmodulin-like genes in grapevine (Vitis vinifera) reveal likely roles in stress responses.

    PubMed

    Vandelle, Elodie; Vannozzi, Alessandro; Wong, Darren; Danzi, Davide; Digby, Anne-Marie; Dal Santo, Silvia; Astegno, Alessandra

    2018-06-04

    Calcium (Ca 2+ ) is an ubiquitous key second messenger in plants, where it modulates many developmental and adaptive processes in response to various stimuli. Several proteins containing Ca 2+ binding domain have been identified in plants, including calmodulin (CaM) and calmodulin-like (CML) proteins, which play critical roles in translating Ca 2+ signals into proper cellular responses. In this work, a genome-wide analysis conducted in Vitis vinifera identified three CaM- and 62 CML-encoding genes. We assigned gene family nomenclature, analyzed gene structure, chromosomal location and gene duplication, as well as protein motif organization. The phylogenetic clustering revealed a total of eight subgroups, including one unique clade of VviCaMs distinct from VviCMLs. VviCaMs were found to contain four EF-hand motifs whereas VviCML proteins have one to five. Most of grapevine CML genes were intronless, while VviCaMs were intron rich. All the genes were well spread among the 19 grapevine chromosomes and displayed a high level of duplication. The expression profiling of VviCaM/VviCML genes revealed a broad expression pattern across all grape organs and tissues at various developmental stages, and a significant modulation in biotic stress-related responses. Our results highlight the complexity of CaM/CML protein family also in grapevine, supporting the versatile role of its different members in modulating cellular responses to various stimuli, in particular to biotic stresses. This work lays the foundation for further functional and structural studies on specific grapevine CaMs/CMLs in order to better understand the role of Ca 2+ -binding proteins in grapevine and to explore their potential for further biotechnological applications. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  8. Association between the oxytocin receptor (OXTR) gene and mesolimbic responses to rewards.

    PubMed

    Damiano, Cara R; Aloi, Joseph; Dunlap, Kaitlyn; Burrus, Caley J; Mosner, Maya G; Kozink, Rachel V; McLaurin, Ralph Edward; Mullette-Gillman, O'Dhaniel A; Carter, Ronald McKell; Huettel, Scott A; McClernon, Francis Joseph; Ashley-Koch, Allison; Dichter, Gabriel S

    2014-01-31

    There has been significant progress in identifying genes that confer risk for autism spectrum disorders (ASDs). However, the heterogeneity of symptom presentation in ASDs impedes the detection of ASD risk genes. One approach to understanding genetic influences on ASD symptom expression is to evaluate relations between variants of ASD candidate genes and neural endophenotypes in unaffected samples. Allelic variations in the oxytocin receptor (OXTR) gene confer small but significant risk for ASDs for which the underlying mechanisms may involve associations between variability in oxytocin signaling pathways and neural response to rewards. The purpose of this preliminary study was to investigate the influence of allelic variability in the OXTR gene on neural responses to monetary rewards in healthy adults using functional magnetic resonance imaging (fMRI). The moderating effects of three single nucleotide polymorphisms (SNPs) (rs1042778, rs2268493 and rs237887) of the OXTR gene on mesolimbic responses to rewards were evaluated using a monetary incentive delay fMRI task. T homozygotes of the rs2268493 SNP demonstrated relatively decreased activation in mesolimbic reward circuitry (including the nucleus accumbens, amygdala, insula, thalamus and prefrontal cortical regions) during the anticipation of rewards but not during the outcome phase of the task. Allelic variation of the rs1042778 and rs237887 SNPs did not moderate mesolimbic activation during either reward anticipation or outcomes. This preliminary study suggests that the OXTR SNP rs2268493, which has been previously identified as an ASD risk gene, moderates mesolimbic responses during reward anticipation. Given previous findings of decreased mesolimbic activation during reward anticipation in ASD, the present results suggest that OXTR may confer ASD risk via influences on the neural systems that support reward anticipation.

  9. Transcriptome analysis reveals mucin 4 to be highly associated with periodontitis and identifies pleckstrin as a link to systemic diseases

    PubMed Central

    Lundmark, Anna; Davanian, Haleh; Båge, Tove; Johannsen, Gunnar; Koro, Catalin; Lundeberg, Joakim; Yucel-Lindberg, Tülay

    2015-01-01

    The multifactorial chronic inflammatory disease periodontitis, which is characterized by destruction of tooth-supporting tissues, has also been implicated as a risk factor for various systemic diseases. Although periodontitis has been studied extensively, neither disease-specific biomarkers nor therapeutic targets have been identified, nor its link with systemic diseases. Here, we analyzed the global transcriptome of periodontitis and compared its gene expression profile with those of other inflammatory conditions, including cardiovascular disease (CVD), rheumatoid arthritis (RA), and ulcerative colitis (UC). Gingival biopsies from 62 patients with periodontitis and 62 healthy subjects were subjected to RNA sequencing. The up-regulated genes in periodontitis were related to inflammation, wounding and defense response, and apoptosis, whereas down-regulated genes were related to extracellular matrix organization and structural support. The most highly up-regulated gene was mucin 4 (MUC4), and its protein product was confirmed to be over-expressed in periodontitis. When comparing the expression profile of periodontitis with other inflammatory diseases, several gene ontology categories, including inflammatory response, cell death, cell motion, and homeostatic processes, were identified as common to all diseases. Only one gene, pleckstrin (PLEK), was significantly overexpressed in periodontitis, CVD, RA, and UC, implicating this gene as an important networking link between these chronic inflammatory diseases. PMID:26686060

  10. Combined Chromatin and Expression Analysis Reveals Specific Regulatory Mechanisms within Cytokine Genes in the Macrophage Early Immune Response

    PubMed Central

    Emanuelsson, Olof; Sennblad, Bengt; Pirmoradian Najafabadi, Mohammad; Folkersen, Lasse; Mälarstig, Anders; Lagergren, Jens; Eriksson, Per; Hamsten, Anders; Odeberg, Jacob

    2012-01-01

    Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS). To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches - gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac) and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII), which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF), was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines), was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/−LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40%) was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at the chromatin level for specific genes and this study highlights the level of fine-tuning that occurs in the immune response. PMID:22384210

  11. Gingival transcriptome patterns during induction and resolution of experimental gingivitis in humans.

    PubMed

    Offenbacher, Steven; Barros, Silvana P; Paquette, David W; Winston, J Leslie; Biesbrock, Aaron R; Thomason, Ryan G; Gibb, Roger D; Fulmer, Andy W; Tiesman, Jay P; Juhlin, Kenton D; Wang, Shuo L; Reichling, Tim D; Chen, Ker-Sang; Ho, Begonia

    2009-12-01

    To our knowledge, changes in the patterns of whole-transcriptome gene expression that occur during the induction and resolution of experimental gingivitis in humans were not previously explored using bioinformatic tools. Gingival biopsy samples collected from 14 subjects during a 28-day stent-induced experimental gingivitis model, followed by treatment, and resolution at days 28 through 35 were analyzed using gene-expression arrays. Biopsy samples were collected at different sites within each subject at baseline (day 0), at the peak of gingivitis (day 28), and at resolution (day 35) and processed using whole-transcriptome gene-expression arrays. Gene-expression data were analyzed to identify biologic themes and pathways associated with changes in gene-expression profiles that occur during the induction and resolution of experimental gingivitis using bioinformatic tools. During disease induction and resolution, the dominant expression pathway was the immune response, with 131 immune response genes significantly up- or downregulated during induction, during resolution, or during both at P <0.05. During induction, there was significant transient increase in the expression of inflammatory and oxidative stress mediators, including interleukin (IL)-1 alpha (IL1A), IL-1 beta (IL1B), IL8, RANTES, colony stimulating factor 3 (CSF3), and superoxide dismutase 2 (SOD2), and a decreased expression of IP10, interferon inducible T-cell alpha chemoattractant (ITAC), matrix metalloproteinase 10 (MMP10), and beta 4 defensin (DEFB4). These genes reversed expression patterns upon resolution in parallel with the reversal of gingival inflammation. A relatively small subset (11.9%) of the immune response genes analyzed by array was transiently activated in response to biofilm overgrowth, suggesting a degree of specificity in the transcriptome-expression response. The fact that this same subset demonstrates a reversal in expression patterns during clinical resolution implicates these genes as being critical for maintaining tissue homeostasis at the biofilm-gingival interface. In addition to the immune response pathway as the dominant response theme, new candidate genes and pathways were identified as being selectively modulated in experimental gingivitis, including neural processes, epithelial defenses, angiogenesis, and wound healing.

  12. Heterologous oligonucleotide microarrays for transcriptomics in a non-model species; a proof-of-concept study of drought stress in Musa

    PubMed Central

    Davey, Mark W; Graham, Neil S; Vanholme, Bartel; Swennen, Rony; May, Sean T; Keulemans, Johan

    2009-01-01

    Background 'Systems-wide' approaches such as microarray RNA-profiling are ideally suited to the study of the complex overlapping responses of plants to biotic and abiotic stresses. However, commercial microarrays are only available for a limited number of plant species and development costs are so substantial as to be prohibitive for most research groups. Here we evaluate the use of cross-hybridisation to Affymetrix oligonucleotide GeneChip® microarrays to profile the response of the banana (Musa spp.) leaf transcriptome to drought stress using a genomic DNA (gDNA)-based probe-selection strategy to improve the efficiency of detection of differentially expressed Musa transcripts. Results Following cross-hybridisation of Musa gDNA to the Rice GeneChip® Genome Array, ~33,700 gene-specific probe-sets had a sufficiently high degree of homology to be retained for transcriptomic analyses. In a proof-of-concept approach, pooled RNA representing a single biological replicate of control and drought stressed leaves of the Musa cultivar 'Cachaco' were hybridised to the Affymetrix Rice Genome Array. A total of 2,910 Musa gene homologues with a >2-fold difference in expression levels were subsequently identified. These drought-responsive transcripts included many functional classes associated with plant biotic and abiotic stress responses, as well as a range of regulatory genes known to be involved in coordinating abiotic stress responses. This latter group included members of the ERF, DREB, MYB, bZIP and bHLH transcription factor families. Fifty-two of these drought-sensitive Musa transcripts were homologous to genes underlying QTLs for drought and cold tolerance in rice, including in 2 instances QTLs associated with a single underlying gene. The list of drought-responsive transcripts also included genes identified in publicly-available comparative transcriptomics experiments. Conclusion Our results demonstrate that despite the general paucity of nucleotide sequence data in Musa and only distant phylogenetic relations to rice, gDNA probe-based cross-hybridisation to the Rice GeneChip® is a highly promising strategy to study complex biological responses and illustrates the potential of such strategies for gene discovery in non-model species. PMID:19758430

  13. Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.

    PubMed

    He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan

    2012-07-01

    WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.

  14. Use of Mutant-Assisted Gene Identification and Characterization (MAGIC) to identify novel genetic loci that modify the maize hypersensitive response

    USDA-ARS?s Scientific Manuscript database

    The partially-dominant, autoactive maize disease resistance gene Rp1-D21 causes hypersensitive response (HR) lesions to form spontaneously on the leaves and stem in the absence of pathogen recognition. The maize nested association mapping (NAM) population consists of 25 200-line subpopulations each...

  15. The yajC gene from Lactobacillus buchneri and Escherichia coli and its role in ethanol tolerance

    USDA-ARS?s Scientific Manuscript database

    The yajC gene (Lbuc_0921)from Lactobacillus buchneri NRRL B-30929 was identified from proteomics analyses in response to ethanol treatment. This protein’s expression level was increased by 15 fold in response to 10% vs 0% ethanol. The yajC encodes the smaller subunit of the preprotein translocase co...

  16. A Global Genomic and Genetic Strategy to Identify, Validate and Use Gene Signatures of Xenobiotic-Responsive Transcription Factors in Prediction of Pathway Activation in the Mouse Liver

    EPA Science Inventory

    Many drugs and environmentally-relevant chemicals activate xenobiotic-responsive transcription factors. Identification of target genes of these factors would be useful in predicting pathway activation in in vitro chemical screening as well as their involvement in disease states. ...

  17. Gene Expression Signatures Characterized by Longitudinal Stability and Interindividual Variability Delineate Baseline Phenotypic Groups with Distinct Responses to Immune Stimulation.

    PubMed

    Scheid, Adam D; Van Keulen, Virginia P; Felts, Sara J; Neier, Steven C; Middha, Sumit; Nair, Asha A; Techentin, Robert W; Gilbert, Barry K; Jen, Jin; Neuhauser, Claudia; Zhang, Yuji; Pease, Larry R

    2018-03-01

    Human immunity exhibits remarkable heterogeneity among individuals, which engenders variable responses to immune perturbations in human populations. Population studies reveal that, in addition to interindividual heterogeneity, systemic immune signatures display longitudinal stability within individuals, and these signatures may reliably dictate how given individuals respond to immune perturbations. We hypothesize that analyzing relationships among these signatures at the population level may uncover baseline immune phenotypes that correspond with response outcomes to immune stimuli. To test this, we quantified global gene expression in peripheral blood CD4 + cells from healthy individuals at baseline and following CD3/CD28 stimulation at two time points 1 mo apart. Systemic CD4 + cell baseline and poststimulation molecular immune response signatures (MIRS) were defined by identifying genes expressed at levels that were stable between time points within individuals and differential among individuals in each state. Iterative differential gene expression analyses between all possible phenotypic groupings of at least three individuals using the baseline and stimulated MIRS gene sets revealed shared baseline and response phenotypic groupings, indicating the baseline MIRS contained determinants of immune responsiveness. Furthermore, significant numbers of shared phenotype-defining sets of determinants were identified in baseline data across independent healthy cohorts. Combining the cohorts and repeating the analyses resulted in identification of over 6000 baseline immune phenotypic groups, implying that the MIRS concept may be useful in many immune perturbation contexts. These findings demonstrate that patterns in complex gene expression variability can be used to define immune phenotypes and discover determinants of immune responsiveness. Copyright © 2018 by The American Association of Immunologists, Inc.

  18. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    PubMed

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  19. Identification of fever and vaccine-associated gene interaction networks using ontology-based literature mining

    PubMed Central

    2012-01-01

    Background Fever is one of the most common adverse events of vaccines. The detailed mechanisms of fever and vaccine-associated gene interaction networks are not fully understood. In the present study, we employed a genome-wide, Centrality and Ontology-based Network Discovery using Literature data (CONDL) approach to analyse the genes and gene interaction networks associated with fever or vaccine-related fever responses. Results Over 170,000 fever-related articles from PubMed abstracts and titles were retrieved and analysed at the sentence level using natural language processing techniques to identify genes and vaccines (including 186 Vaccine Ontology terms) as well as their interactions. This resulted in a generic fever network consisting of 403 genes and 577 gene interactions. A vaccine-specific fever sub-network consisting of 29 genes and 28 gene interactions was extracted from articles that are related to both fever and vaccines. In addition, gene-vaccine interactions were identified. Vaccines (including 4 specific vaccine names) were found to directly interact with 26 genes. Gene set enrichment analysis was performed using the genes in the generated interaction networks. Moreover, the genes in these networks were prioritized using network centrality metrics. Making scientific discoveries and generating new hypotheses were possible by using network centrality and gene set enrichment analyses. For example, our study found that the genes in the generic fever network were more enriched in cell death and responses to wounding, and the vaccine sub-network had more gene enrichment in leukocyte activation and phosphorylation regulation. The most central genes in the vaccine-specific fever network are predicted to be highly relevant to vaccine-induced fever, whereas genes that are central only in the generic fever network are likely to be highly relevant to generic fever responses. Interestingly, no Toll-like receptors (TLRs) were found in the gene-vaccine interaction network. Since multiple TLRs were found in the generic fever network, it is reasonable to hypothesize that vaccine-TLR interactions may play an important role in inducing fever response, which deserves a further investigation. Conclusions This study demonstrated that ontology-based literature mining is a powerful method for analyzing gene interaction networks and generating new scientific hypotheses. PMID:23256563

  20. Genomic response to Wnt signalling is highly context-dependent - Evidence from DNA microarray and chromatin immunoprecipitation screens of Wnt/TCF targets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Railo, Antti; Pajunen, Antti; Itaeranta, Petri

    2009-10-01

    Wnt proteins are important regulators of embryonic development, and dysregulated Wnt signalling is involved in the oncogenesis of several human cancers. Our knowledge of the downstream target genes is limited, however. We used a chromatin immunoprecipitation-based assay to isolate and characterize the actual gene segments through which Wnt-activatable transcription factors, TCFs, regulate transcription and an Affymetrix microarray analysis to study the global transcriptional response to the Wnt3a ligand. The anti-{beta}-catenin immunoprecipitation of DNA-protein complexes from mouse NIH3T3 fibroblasts expressing a fusion protein of {beta}-catenin and TCF7 resulted in the identification of 92 genes as putative TCF targets. GeneChip assays ofmore » gene expression performed on NIH3T3 cells and the rat pheochromocytoma cell line PC12 revealed 355 genes in NIH3T3 and 129 genes in the PC12 cells with marked changes in expression after Wnt3a stimulus. Only 2 Wnt-regulated genes were shared by both cell lines. Surprisingly, Disabled-2 was the only gene identified by the chromatin immunoprecipitation approach that displayed a marked change in expression in the GeneChip assay. Taken together, our approaches give an insight into the complex context-dependent nature of Wnt pathway transcriptional responses and identify Disabled-2 as a potential new direct target for Wnt signalling.« less

  1. Multiway real-time PCR gene expression profiling in yeast Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli.

    PubMed

    Ståhlberg, Anders; Elbing, Karin; Andrade-Garda, José Manuel; Sjögreen, Björn; Forootan, Amin; Kubista, Mikael

    2008-04-16

    The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.

  2. Multiway real-time PCR gene expression profiling in yeast Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli

    PubMed Central

    Ståhlberg, Anders; Elbing, Karin; Andrade-Garda, José Manuel; Sjögreen, Björn; Forootan, Amin; Kubista, Mikael

    2008-01-01

    Background The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. Results We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Conclusion Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains. PMID:18412983

  3. Genome-wide identification and characterization of WRKY transcriptional factor family in apple and analysis of their responses to waterlogging and drought stress.

    PubMed

    Meng, Dong; Li, Yuanyuan; Bai, Yang; Li, Mingjun; Cheng, Lailiang

    2016-06-01

    As one of the largest transcriptional factor families in plants, WRKY genes play significant roles in various biotic and abiotic stress responses. Although the WRKY gene family has been characterized in a few plant species, the details remain largely unknown in the apple (Malus domestica Borkh.). In this study, we identified a total of 127 MdWRKYs from the apple genome, which were divided into four subgroups according to the WRKY domains and zinc finger motif. Most of them were mapped onto the apple's 17 chromosomes and were expressed in more than one tissue, including shoot tips, mature leaves, fruit and apple calli. We then contrasted WRKY expression patterns between calli grown in solid medium (control) and liquid medium (representing waterlogging stress) and found that 34 WRKY genes were differentially expressed between the two growing conditions. Finally, we determined the expression patterns of 10 selected WRKY genes in an apple rootstock, G41, in response to waterlogging and drought stress, which identified candidate genes involved in responses to water stress for functional analysis. Our data provide interesting candidate MdWRKYs for future functional analysis and demonstrate that apple callus is a useful system for characterizing gene expression and function in apple. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  4. Understanding the immune system architecture and transcriptome responses to southern rice black-streaked dwarf virus in Sogatella furcifera.

    PubMed

    Wang, Lin; Tang, Nan; Gao, Xinlei; Guo, Dongyang; Chang, Zhaoxia; Fu, Yating; Akinyemi, Ibukun A; Wu, Qingfa

    2016-11-02

    Sogatella furcifera, the white-backed planthopper (WBPH), has become one of the most destructive pests in rice production owing to its plant sap-sucking behavior and efficient transmission of Southern rice black-streaked dwarf virus (SRBSDV) in a circulative, propagative and persistent manner. The dynamic and complex SRBSDV-WBPH-rice plant interaction is still poorly understood. In this study, based on a homology-based genome-wide analysis, 348 immune-related genes belonging to 28 families were identified in WBPH. A transcriptome analysis of non-viruliferous (NVF) and viruliferous groups with high viral titers (HVT) and median viral titers (MVT) revealed that feeding on SRBSDV-infected rice plants has a significant impact on gene expression, regardless of viral titers in insects. We identified 278 up-regulated and 406 down-regulated genes shared among the NVF, MVT, and HVT groups and detected significant down-regulation of primary metabolism-related genes and oxidoreductase. In viruliferous WBPH with viral titer-specific transcriptome changes, 1,906 and 1,467 genes exhibited strict monotonically increasing and decreasing expression, respectively. The RNAi pathway was the major antiviral response to increasing viral titers among diverse immune responses. These results clarify the responses of immune genes and the transcriptome of WBPH to SRBSDV and improve our knowledge of the functional relationship between pathogen, vector, and host.

  5. Gene Expression Profiling and Molecular Signaling of Various Cells in Response to Tricalcium Silicate Cements: A Systematic Review.

    PubMed

    Rathinam, Elanagai; Rajasekharan, Sivaprakash; Chitturi, Ravi Teja; Declercq, Heidi; Martens, Luc; De Coster, Peter

    2016-12-01

    The aim of this study was to present a systematic review investigating the gene expression of various cells (other than dental pulp cells) in response to different variants of tricalcium silicate cements (TSCs). A systematic search of the literature was performed by 2 independent reviewers followed by article selection and data extraction. Studies analyzing any cell type except dental pulp stem cells and any variant of tricalcium silicate cement either as the experimental or as the control group were included. A total of 41 relevant articles were included in this review. Among the included studies, ProRoot MTA (Dentsply, Tulsa, OK) was the most commonly studied (69.1%) TSC variant, and 11 cell types were identified, with 13 articles investigating gene expression in osteoblasts. A total of 39 different genes/molecules expressed were found in the selected studies. The experimental group (irrespective of the TSC variant) was identified to express significantly increased gene expression compared with the control group (untreated) in all included studies. Recent studies have provided useful insight into the gene expression and molecular signaling of various cells in response to TSCs, and new elements have been supplied on the pathways activated in this process. TSCs are capable of eliciting a favorable cellular response in periapical regeneration. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  6. Modeling forest ecosystem responses to elevated carbon dioxide and ozone using artificial neural networks.

    PubMed

    Larsen, Peter E; Cseke, Leland J; Miller, R Michael; Collart, Frank R

    2014-10-21

    Rising atmospheric levels of carbon dioxide and ozone will impact productivity and carbon sequestration in forest ecosystems. The scale of this process and the potential economic consequences provide an incentive for the development of models to predict the types and rates of ecosystem responses and feedbacks that result from and influence of climate change. In this paper, we use phenotypic and molecular data derived from the Aspen Free Air CO2 Enrichment site (Aspen-FACE) to evaluate modeling approaches for ecosystem responses to changing conditions. At FACE, it was observed that different aspen clones exhibit clone-specific responses to elevated atmospheric levels of carbon dioxide and ozone. To identify the molecular basis for these observations, we used artificial neural networks (ANN) to examine above and below-ground community phenotype responses to elevated carbon dioxide, elevated ozone and gene expression profiles. The aspen community models generated using this approach identified specific genes and subnetworks of genes associated with variable sensitivities for aspen clones. The ANN model also predicts specific co-regulated gene clusters associated with differential sensitivity to elevated carbon dioxide and ozone in aspen species. The results suggest ANN is an effective approach to predict relevant gene expression changes resulting from environmental perturbation and provides useful information for the rational design of future biological experiments. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Identification of early target genes of aflatoxin B1 in human hepatocytes, inter-individual variability and comparison with other genotoxic compounds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Josse, Rozenn; Dumont, Julie; Fautrel, Alain

    Gene expression profiling has recently emerged as a promising approach to identify early target genes and discriminate genotoxic carcinogens from non-genotoxic carcinogens and non-carcinogens. However, early gene changes induced by genotoxic compounds in human liver remain largely unknown. Primary human hepatocytes and differentiated HepaRG cells were exposed to aflatoxin B1 (AFB1) that induces DNA damage following enzyme-mediated bioactivation. Gene expression profile changes induced by a 24 h exposure of these hepatocyte models to 0.05 and 0.25 μM AFB1 were analyzed by using oligonucleotide pangenomic microarrays. The main altered signaling pathway was the p53 pathway and related functions such as cellmore » cycle, apoptosis and DNA repair. Direct involvement of the p53 protein in response to AFB1 was verified by using siRNA directed against p53. Among the 83 well-annotated genes commonly modulated in two pools of three human hepatocyte populations and HepaRG cells, several genes were identified as altered by AFB1 for the first time. In addition, a subset of 10 AFB1-altered genes, selected upon basis of their function or tumor suppressor role, was tested in four human hepatocyte populations and in response to other chemicals. Although they exhibited large variable inter-donor fold-changes, several of these genes, particularly FHIT, BCAS3 and SMYD3, were found to be altered by various direct and other indirect genotoxic compounds and unaffected by non-genotoxic compounds. Overall, this comprehensive analysis of early gene expression changes induced by AFB1 in human hepatocytes identified a gene subset that included several genes representing potential biomarkers of genotoxic compounds. -- Highlights: ► Gene expression profile changes induced by aflatoxin B1 in human hepatocytes. ► AFB1 modulates various genes including tumor suppressor genes and proto-oncogenes. ► Important inter-individual variations in the response to AFB1. ► Some genes also altered by other genotoxic compounds requiring or not bioactivation.« less

  8. Identification of bovine leukemia virus tax function associated with host cell transcription, signaling, stress response and immune response pathway by microarray-based gene expression analysis

    PubMed Central

    2012-01-01

    Background Bovine leukemia virus (BLV) is associated with enzootic bovine leukosis and is closely related to human T-cell leukemia virus type I. The Tax protein of BLV is a transcriptional activator of viral replication and a key contributor to oncogenic potential. We previously identified interesting mutant forms of Tax with elevated (TaxD247G) or reduced (TaxS240P) transactivation effects on BLV replication and propagation. However, the effects of these mutations on functions other than transcriptional activation are unknown. In this study, to identify genes that play a role in the cascade of signal events regulated by wild-type and mutant Tax proteins, we used a large-scale host cell gene-profiling approach. Results Using a microarray containing approximately 18,400 human mRNA transcripts, we found several alterations after the expression of Tax proteins in genes involved in many cellular functions such as transcription, signal transduction, cell growth, apoptosis, stress response, and immune response, indicating that Tax protein has multiple biological effects on various cellular environments. We also found that TaxD247G strongly regulated more genes involved in transcription, signal transduction, and cell growth functions, contrary to TaxS240P, which regulated fewer genes. In addition, the expression of genes related to stress response significantly increased in the presence of TaxS240P as compared to wild-type Tax and TaxD247G. By contrast, the largest group of downregulated genes was related to immune response, and the majority of these genes belonged to the interferon family. However, no significant difference in the expression level of downregulated genes was observed among the Tax proteins. Finally, the expression of important cellular factors obtained from the human microarray results were validated at the RNA and protein levels by real-time quantitative reverse transcription-polymerase chain reaction and western blotting, respectively, after transfecting Tax proteins into bovine cells and human HeLa cells. Conclusion A comparative analysis of wild-type and mutant Tax proteins indicates that Tax protein exerts a significant impact on cellular functions as diverse as transcription, signal transduction, cell growth, stress response and immune response. Importantly, our study is the first report that shows the extent to which BLV Tax regulates the innate immune response. PMID:22455445

  9. Fyn-Dependent Gene Networks in Acute Ethanol Sensitivity

    PubMed Central

    Farris, Sean P.; Miles, Michael F.

    2013-01-01

    Studies in humans and animal models document that acute behavioral responses to ethanol are predisposing factor for the risk of long-term drinking behavior. Prior microarray data from our laboratory document strain- and brain region-specific variation in gene expression profile responses to acute ethanol that may be underlying regulators of ethanol behavioral phenotypes. The non-receptor tyrosine kinase Fyn has previously been mechanistically implicated in the sedative-hypnotic response to acute ethanol. To further understand how Fyn may modulate ethanol behaviors, we used whole-genome expression profiling. We characterized basal and acute ethanol-evoked (3 g/kg) gene expression patterns in nucleus accumbens (NAC), prefrontal cortex (PFC), and ventral midbrain (VMB) of control and Fyn knockout mice. Bioinformatics analysis identified a set of Fyn-related gene networks differently regulated by acute ethanol across the three brain regions. In particular, our analysis suggested a coordinate basal decrease in myelin-associated gene expression within NAC and PFC as an underlying factor in sensitivity of Fyn null animals to ethanol sedation. An in silico analysis across the BXD recombinant inbred (RI) strains of mice identified a significant correlation between Fyn expression and a previously published ethanol loss-of-righting-reflex (LORR) phenotype. By combining PFC gene expression correlates to Fyn and LORR across multiple genomic datasets, we identified robust Fyn-centric gene networks related to LORR. Our results thus suggest that multiple system-wide changes exist within specific brain regions of Fyn knockout mice, and that distinct Fyn-dependent expression networks within PFC may be important determinates of the LORR due to acute ethanol. These results add to the interpretation of acute ethanol behavioral sensitivity in Fyn kinase null animals, and identify Fyn-centric gene networks influencing variance in ethanol LORR. Such networks may also inform future design of pharmacotherapies for the treatment and prevention of alcohol use disorders. PMID:24312422

  10. Identification of Crowding Stress Tolerance Co-Expression Networks Involved in Sweet Corn Yield

    PubMed Central

    Choe, Eunsoo; Drnevich, Jenny; Williams, Martin M.

    2016-01-01

    Tolerance to crowding stress has played a crucial role in improving agronomic productivity in field corn; however, commercial sweet corn hybrids vary greatly in crowding stress tolerance. The objectives were to 1) explore transcriptional changes among sweet corn hybrids with differential yield under crowding stress, 2) identify relationships between phenotypic responses and gene expression patterns, and 3) identify groups of genes associated with yield and crowding stress tolerance. Under conditions of crowding stress, three high-yielding and three low-yielding sweet corn hybrids were grouped for transcriptional and phenotypic analyses. Transcriptional analyses identified from 372 to 859 common differentially expressed genes (DEGs) for each hybrid. Large gene expression pattern variation among hybrids and only 26 common DEGs across all hybrid comparisons were identified, suggesting each hybrid has a unique response to crowding stress. Over-represented biological functions of DEGs also differed among hybrids. Strong correlation was observed between: 1) modules with up-regulation in high-yielding hybrids and yield traits, and 2) modules with up-regulation in low-yielding hybrids and plant/ear traits. Modules linked with yield traits may be important crowding stress response mechanisms influencing crop yield. Functional analysis of the modules and common DEGs identified candidate crowding stress tolerant processes in photosynthesis, glycolysis, cell wall, carbohydrate/nitrogen metabolic process, chromatin, and transcription regulation. Moreover, these biological functions were greatly inter-connected, indicating the importance of improving the mechanisms as a network. PMID:26796516

  11. RNAseq Analysis of the Drosophila Response to the Entomopathogenic Nematode Steinernema

    PubMed Central

    Yadav, Shruti; Daugherty, Sean; Shetty, Amol Carl; Eleftherianos, Ioannis

    2017-01-01

    Drosophila melanogaster is an outstanding model to study the molecular and functional basis of host–pathogen interactions. Currently, our knowledge of microbial infections in D. melanogaster is well understood; however, the response of flies to nematode infections is still in its infancy. Here, we have used the potent parasitic nematode Steinernema carpocapsae, which lives in mutualism with its endosymbiotic bacteria Xenorhabdus nematophila, to examine the transcriptomic basis of the interaction between D. melanogaster and entomopathogenic nematodes. We have employed next-generation RNA sequencing (RNAseq) to investigate the transcriptomic profile of D. melanogaster larvae in response to infection by S. carpocapsae symbiotic (carrying X. nematophila) or axenic (lacking X. nematophila) nematodes. Bioinformatic analyses have identified the strong induction of genes that are associated with the peritrophic membrane and the stress response, as well as several genes that participate in developmental processes. We have also found that genes with different biological functions are enriched in D. melanogaster larvae responding to either symbiotic or axenic nematodes. We further show that while symbiotic nematode infection enriched certain known immune-related genes, axenic nematode infection enriched several genes associated with chitin binding, lipid metabolic functions, and neuroactive ligand receptors. In addition, we have identified genes with a potential role in nematode recognition and genes with potential antinematode activity. Findings from this study will undoubtedly set the stage for the identification of key regulators of antinematode immune mechanisms in D. melanogaster, as well as in other insects of socioeconomic importance. PMID:28450373

  12. RNAseq Analysis of the Drosophila Response to the Entomopathogenic Nematode Steinernema.

    PubMed

    Yadav, Shruti; Daugherty, Sean; Shetty, Amol Carl; Eleftherianos, Ioannis

    2017-06-07

    Drosophila melanogaster is an outstanding model to study the molecular and functional basis of host-pathogen interactions. Currently, our knowledge of microbial infections in D. melanogaster is well understood; however, the response of flies to nematode infections is still in its infancy. Here, we have used the potent parasitic nematode Steinernema carpocapsae , which lives in mutualism with its endosymbiotic bacteria Xenorhabdus nematophila , to examine the transcriptomic basis of the interaction between D. melanogaster and entomopathogenic nematodes. We have employed next-generation RNA sequencing (RNAseq) to investigate the transcriptomic profile of D. melanogaster larvae in response to infection by S. carpocapsae symbiotic (carrying X. nematophila ) or axenic (lacking X. nematophila ) nematodes. Bioinformatic analyses have identified the strong induction of genes that are associated with the peritrophic membrane and the stress response, as well as several genes that participate in developmental processes. We have also found that genes with different biological functions are enriched in D. melanogaster larvae responding to either symbiotic or axenic nematodes. We further show that while symbiotic nematode infection enriched certain known immune-related genes, axenic nematode infection enriched several genes associated with chitin binding, lipid metabolic functions, and neuroactive ligand receptors. In addition, we have identified genes with a potential role in nematode recognition and genes with potential antinematode activity. Findings from this study will undoubtedly set the stage for the identification of key regulators of antinematode immune mechanisms in D. melanogaster , as well as in other insects of socioeconomic importance. Copyright © 2017 Yadav et al.

  13. The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color

    USDA-ARS?s Scientific Manuscript database

    Background: Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results: We describe the sequencing and assembly of...

  14. Genome-Wide Transcriptome Analysis Reveals Conserved and Distinct Molecular Mechanisms of Al Resistance in Buckwheat (Fagopyrum esculentum Moench) Leaves

    PubMed Central

    Chen, Wei Wei; Xu, Jia Meng; Jin, Jian Feng; Lou, He Qiang; Fan, Wei

    2017-01-01

    Being an Al-accumulating crop, buckwheat detoxifies and tolerates Al not only in roots but also in leaves. While much progress has recently been made toward Al toxicity and resistance mechanisms in roots, little is known about the molecular basis responsible for detoxification and tolerance processes in leaves. Here, we carried out transcriptome analysis of buckwheat leaves in response to Al stress (20 µM, 24 h). We obtained 33,931 unigenes with 26,300 unigenes annotated in the NCBI database, and identified 1063 upregulated and 944 downregulated genes under Al stress. Functional category analysis revealed that genes related to protein translation, processing, degradation and metabolism comprised the biological processes most affected by Al, suggesting that buckwheat leaves maintain flexibility under Al stress by rapidly reprogramming their physiology and metabolism. Analysis of genes related to transcription regulation revealed that a large proportion of chromatin-regulation genes are specifically downregulated by Al stress, whereas transcription factor genes are overwhelmingly upregulated. Furthermore, we identified 78 upregulated and 22 downregulated genes that encode transporters. Intriguingly, only a few genes were overlapped with root Al-regulated transporter genes, which include homologs of AtMATE, ALS1, STAR1, ALS3 and a divalent ion symporter. In addition, we identified a subset of genes involved in development, in which genes associated with flowering regulation were important. Based on these data, it is proposed that buckwheat leaves develop conserved and distinct mechanisms to cope with Al toxicity. PMID:28846612

  15. Genome-Wide Transcriptome Analysis Reveals Conserved and Distinct Molecular Mechanisms of Al Resistance in Buckwheat (Fagopyrum esculentum Moench) Leaves.

    PubMed

    Chen, Wei Wei; Xu, Jia Meng; Jin, Jian Feng; Lou, He Qiang; Fan, Wei; Yang, Jian Li

    2017-08-27

    Being an Al-accumulating crop, buckwheat detoxifies and tolerates Al not only in roots but also in leaves. While much progress has recently been made toward Al toxicity and resistance mechanisms in roots, little is known about the molecular basis responsible for detoxification and tolerance processes in leaves. Here, we carried out transcriptome analysis of buckwheat leaves in response to Al stress (20 µM, 24 h). We obtained 33,931 unigenes with 26,300 unigenes annotated in the NCBI database, and identified 1063 upregulated and 944 downregulated genes under Al stress. Functional category analysis revealed that genes related to protein translation, processing, degradation and metabolism comprised the biological processes most affected by Al, suggesting that buckwheat leaves maintain flexibility under Al stress by rapidly reprogramming their physiology and metabolism. Analysis of genes related to transcription regulation revealed that a large proportion of chromatin-regulation genes are specifically downregulated by Al stress, whereas transcription factor genes are overwhelmingly upregulated. Furthermore, we identified 78 upregulated and 22 downregulated genes that encode transporters. Intriguingly, only a few genes were overlapped with root Al-regulated transporter genes, which include homologs of AtMATE , ALS1 , STAR1 , ALS3 and a divalent ion symporter. In addition, we identified a subset of genes involved in development, in which genes associated with flowering regulation were important. Based on these data, it is proposed that buckwheat leaves develop conserved and distinct mechanisms to cope with Al toxicity.

  16. Novel candidate genes for alcoholism--transcriptomic analysis of prefrontal medial cortex, hippocampus and nucleus accumbens of Warsaw alcohol-preferring and non-preferring rats.

    PubMed

    Stankiewicz, Adrian M; Goscik, Joanna; Dyr, Wanda; Juszczak, Grzegorz R; Ryglewicz, Danuta; Swiergiel, Artur H; Wieczorek, Marek; Stefanski, Roman

    2015-12-01

    Animal models provide opportunity to study neurobiological aspects of human alcoholism. Changes in gene expression have been implicated in mediating brain functions, including reward system and addiction. The current study aimed to identify genes that may underlie differential ethanol preference in Warsaw High Preferring (WHP) and Warsaw Low Preferring (WLP) rats. Microarray analysis comparing gene expression in nucleus accumbens (NAc), hippocampus (HP) and medial prefrontal cortex (mPFC) was performed in male WHP and WLP rats bred for differences in ethanol preference. Differential and stable between biological repeats expression of 345, 254 and 129 transcripts in NAc, HP and mPFC was detected. Identified genes and processes included known mediators of ethanol response (Mx2, Fam111a, Itpr1, Gabra4, Agtr1a, LTP/LTD, renin-angiotensin signaling pathway), toxicity (Sult1c2a, Ces1, inflammatory response), as well as genes involved in regulation of important addiction-related brain systems such as dopamine, tachykinin or acetylcholine (Gng7, Tac4, Slc5a7). The identified candidate genes may underlie differential ethanol preference in an animal model of alcoholism. Names of genes are written in italics, while names of proteins are written in standard font. Names of human genes/proteins are written in all capital letters. Names of rodent genes/proteins are written in capital letter followed by small letters. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Impact of Heat Stress on Cellular and Transcriptional Adaptation of Mammary Epithelial Cells in Riverine Buffalo (Bubalus Bubalis)

    PubMed Central

    Kapila, Neha; Sharma, Ankita; Kishore, Amit; Sodhi, Monika; Tripathi, Pawan K.; Mohanty, Ashok K.

    2016-01-01

    The present study aims to identify the heat responsive genes and biological pathways in heat stressed buffalo mammary epithelial cells (MECs). The primary mammary epithelial cells of riverine buffalo were exposed to thermal stress at 42°C for one hour. The cells were subsequently allowed to recover at 37°C and harvested at different time intervals (30 min to 48 h) along with control samples (un-stressed). In order to assess the impact of heat stress in buffalo MECs, several in-vitro cellular parameters (lactate dehydrogenase activity, cell proliferation assay, cellular viability, cell death and apoptosis) and transcriptional studies were conducted. The heat stress resulted in overall decrease in cell viability and cell proliferation of MECs while induction of cellular apoptosis and necrosis. The transcriptomic profile of heat stressed MECs was generated using Agilent 44 K bovine oligonucleotide array and at cutoff criteria of ≥3-or ≤3 fold change, a total of 153 genes were observed to be upregulated while 8 genes were down regulated across all time points post heat stress. The genes that were specifically up-regulated or down-regulated were identified as heat responsive genes. The upregulated genes in heat stressed MECs belonged to heat shock family viz., HSPA6, HSPB8, DNAJB2, HSPA1A. Along with HSPs, genes like BOLA, MRPL55, PFKFB3, PSMC2, ENDODD1, ARID5A, and SENP3 were also upregulated. Microarray data revealed that the heat responsive genes belonged to different functional classes viz., chaperons; immune responsive; cell proliferation and metabolism related. Gene ontology analysis revealed enrichment of several biological processes like; cellular process, metabolic process, response to stimulus, biological regulation, immune system processes and signaling. The transcriptome analysis data was further validated by RT-qPCR studies. Several HSP (HSP40, HSP60, HSP70, HSP90, and HSPB1), apoptotic (Bax and Bcl2), immune (IL6, TNFα and NF-kβ) and oxidative stress (GPX1 and DUSP1) related genes showed differential expression profile at different time points post heat stress. The transcriptional data strongly indicated the induction of survival/apoptotic mechanism in heat stressed buffalo MECs. The overrepresented pathways across all time points were; electron transport chain, cytochrome P450, apoptosis, MAPK, FAS and stress induction of HSP regulation, delta Notch signaling, apoptosis modulation by HSP70, EGFR1 signaling, cytokines and inflammatory response, oxidative stress, TNF-alpha and NF- kB signaling pathway. The study thus identified several genes from different functional classes and biological pathways that could be termed as heat responsive in buffalo MEC. The responsiveness of buffalo MECs to heat stress in the present study clearly suggested its suitability as a model to understand the modulation of buffalo mammary gland expression signature in response to environmental heat load. PMID:27682256

  18. Gene expression profile analysis of rat cerebellum under acute alcohol intoxication.

    PubMed

    Zhang, Yu; Wei, Guangkuan; Wang, Yuehong; Jing, Ling; Zhao, Qingjie

    2015-02-25

    Acute alcohol intoxication, a common disease causing damage to the central nervous system (CNS) has been primarily studied on the aspects of alcohol addiction and chronic alcohol exposure. The understanding of gene expression change in the CNS during acute alcohol intoxication is still lacking. We established a model for acute alcohol intoxication in SD rats by oral gavage. A rat cDNA microarray was used to profile mRNA expression in the cerebella of alcohol-intoxicated rats (experimental group) and saline-treated rats (control group). A total of 251 differentially expressed genes were identified in response to acute alcohol intoxication, in which 208 of them were up-regulated and 43 were down-regulated. Gene ontology (GO) term enrichment analysis and pathway analysis revealed that the genes involved in the biological processes of immune response and endothelial integrity are among the most severely affected in response to acute alcohol intoxication. We discovered five transcription factors whose consensus binding motifs are overrepresented in the promoter region of differentially expressed genes. Additionally, we identified 20 highly connected hub genes by co-expression analysis, and validated the differential expression of these genes by real-time quantitative PCR. By determining novel biological pathways and transcription factors that have functional implication to acute alcohol intoxication, our study substantially contributes to the understanding of the molecular mechanism underlying the pathology of acute alcoholism. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Integration of Bioinformatics and Synthetic Promoters Leads to the Discovery of Novel Elicitor-Responsive cis-Regulatory Sequences in Arabidopsis1[C][W][OA

    PubMed Central

    Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J.; Hehl, Reinhard

    2012-01-01

    A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985

  20. Biologic Phenotyping of the Human Small Airway Epithelial Response to Cigarette Smoking

    PubMed Central

    Tilley, Ann E.; O'Connor, Timothy P.; Hackett, Neil R.; Strulovici-Barel, Yael; Salit, Jacqueline; Amoroso, Nancy; Zhou, Xi Kathy; Raman, Tina; Omberg, Larsson; Clark, Andrew; Mezey, Jason; Crystal, Ronald G.

    2011-01-01

    Background The first changes associated with smoking are in the small airway epithelium (SAE). Given that smoking alters SAE gene expression, but only a fraction of smokers develop chronic obstructive pulmonary disease (COPD), we hypothesized that assessment of SAE genome-wide gene expression would permit biologic phenotyping of the smoking response, and that a subset of healthy smokers would have a “COPD-like” SAE transcriptome. Methodology/Principal Findings SAE (10th–12th generation) was obtained via bronchoscopy of healthy nonsmokers, healthy smokers and COPD smokers and microarray analysis was used to identify differentially expressed genes. Individual responsiveness to smoking was quantified with an index representing the % of smoking-responsive genes abnormally expressed (ISAE), with healthy smokers grouped into “high” and “low” responders based on the proportion of smoking-responsive genes up- or down-regulated in each smoker. Smokers demonstrated significant variability in SAE transcriptome with ISAE ranging from 2.9 to 51.5%. While the SAE transcriptome of “low” responder healthy smokers differed from both “high” responders and smokers with COPD, the transcriptome of the “high” responder healthy smokers was indistinguishable from COPD smokers. Conclusion/Significance The SAE transcriptome can be used to classify clinically healthy smokers into subgroups with lesser and greater responses to cigarette smoking, even though these subgroups are indistinguishable by clinical criteria. This identifies a group of smokers with a “COPD-like” SAE transcriptome. PMID:21829517

  1. Transcriptome-wide analysis of DEAD-box RNA helicase gene family in an Antarctic psychrophilic alga Chlamydomonas sp. ICE-L.

    PubMed

    Liu, Chenlin; Huang, Xiaohang

    2015-09-01

    DEAD-box RNA helicase family proteins have been identified in almost all living organisms. Some of them play a crucial role in adaptation to environmental changes and stress response, especially in the low-temperature acclimation in different kinds of organisms. Compared with the full swing study in plants and bacteria, the characters and functions of DEAD-box family proteins had not been surveyed in algae. To identify genes critical for freezing acclimation in algae, we screened DEAD-box RNA helicase genes from the transcriptome sequences of a psychrophilic microalga Chlamydomonas sp. ICE-L which was isolated from Antarctic sea ice. Totally 39 DEAD-box RNA helicase genes had been identified. Most of the DEAD-box RNA helicase have 1:1 homologous relationships in Chlamydomonas reinhardtii and Chlamydomonas sp. ICE-L with several exceptions. The homologous proteins in ICE-L to the helicases critical for cold or freezing tolerance in Arabidopsis thaliana had been identified based on phylogenetic comparison studies. The response of these helicase genes is not always identical in the Chlamydomonas sp. ICE-L and Arabidopsis under the same low-temperature treatment. The expression of several DEAD-box RNA helicase genes including CiRH5, CiRH25, CiRH28, and CiRH55 were significantly up-regulated under freezing treatment of ICE-L and their function in freezing acclimation of ICE-L deserved further investigation.

  2. Hepatic Transcriptome Responses of Domesticated and Wild Turkey Embryos to Aflatoxin B₁.

    PubMed

    Monson, Melissa S; Cardona, Carol J; Coulombe, Roger A; Reed, Kent M

    2016-01-06

    The mycotoxin, aflatoxin B₁ (AFB₁) is a hepatotoxic, immunotoxic, and mutagenic contaminant of food and animal feeds. In poultry, AFB₁ can be maternally transferred to embryonated eggs, affecting development, viability and performance after hatch. Domesticated turkeys (Meleagris gallopavo) are especially sensitive to aflatoxicosis, while Eastern wild turkeys (M. g. silvestris) are likely more resistant. In ovo exposure provided a controlled AFB₁ challenge and comparison of domesticated and wild turkeys. Gene expression responses to AFB₁ in the embryonic hepatic transcriptome were examined using RNA-sequencing (RNA-seq). Eggs were injected with AFB₁ (1 μg) or sham control and dissected for liver tissue after 1 day or 5 days of exposure. Libraries from domesticated turkey (n = 24) and wild turkey (n = 15) produced 89.2 Gb of sequence. Approximately 670 M reads were mapped to a turkey gene set. Differential expression analysis identified 1535 significant genes with |log₂ fold change| ≥ 1.0 in at least one pair-wise comparison. AFB₁ effects were dependent on exposure time and turkey type, occurred more rapidly in domesticated turkeys, and led to notable up-regulation in cell cycle regulators, NRF2-mediated response genes and coagulation factors. Further investigation of NRF2-response genes may identify targets to improve poultry resistance.

  3. Genome-wide identification of WRKY family genes and their response to cold stress in Vitis vinifera

    PubMed Central

    2014-01-01

    Background WRKY transcription factors are one of the largest families of transcriptional regulators in plants. WRKY genes are not only found to play significant roles in biotic and abiotic stress response, but also regulate growth and development. Grapevine (Vitis vinifera) production is largely limited by stressful climate conditions such as cold stress and the role of WRKY genes in the survival of grapevine under these conditions remains unknown. Results We identified a total of 59 VvWRKYs from the V. vinifera genome, belonging to four subgroups according to conserved WRKY domains and zinc-finger structure. The majority of VvWRKYs were expressed in more than one tissue among the 7 tissues examined which included young leaves, mature leaves, tendril, stem apex, root, young fruits and ripe fruits. Publicly available microarray data suggested that a subset of VvWRKYs was activated in response to diverse stresses. Quantitative real-time PCR (qRT-PCR) results demonstrated that the expression levels of 36 VvWRKYs are changed following cold exposure. Comparative analysis was performed on data from publicly available microarray experiments, previous global transcriptome analysis studies, and qRT-PCR. We identified 15 VvWRKYs in at least two of these databases which may relate to cold stress. Among them, the transcription of three genes can be induced by exogenous ABA application, suggesting that they can be involved in an ABA-dependent signaling pathway in response to cold stress. Conclusions We identified 59 VvWRKYs from the V. vinifera genome and 15 of them showed cold stress-induced expression patterns. These genes represented candidate genes for future functional analysis of VvWRKYs involved in the low temperature-related signal pathways in grape. PMID:24755338

  4. Transcriptomic and Proteomic Analyses of Resistant Host Responses in Arachis diogoi Challenged with Late Leaf Spot Pathogen, Phaeoisariopsis personata

    PubMed Central

    Kumar, Dilip; Kirti, Pulugurtha Bharadwaja

    2015-01-01

    Late leaf spot is a serious disease of peanut caused by the imperfect fungus, Phaeoisariopsis personata. Wild diploid species, Arachis diogoi. is reported to be highly resistant to this disease and asymptomatic. The objective of this study is to investigate the molecular responses of the wild peanut challenged with the late leaf spot pathogen using cDNA-AFLP and 2D proteomic study. A total of 233 reliable, differentially expressed genes were identified in Arachis diogoi. About one third of the TDFs exhibit no significant similarity with the known sequences in the data bases. Expressed sequence tag data showed that the characterized genes are involved in conferring resistance in the wild peanut to the pathogen challenge. Several genes for proteins involved in cell wall strengthening, hypersensitive cell death and resistance related proteins have been identified. Genes identified for other proteins appear to function in metabolism, signal transduction and defence. Nineteen TDFs based on the homology analysis of genes associated with defence, signal transduction and metabolism were further validated by quantitative real time PCR (qRT-PCR) analyses in resistant wild species in comparison with a susceptible peanut genotype in time course experiments. The proteins corresponding to six TDFs were differentially expressed at protein level also. Differentially expressed TDFs and proteins in wild peanut indicate its defence mechanism upon pathogen challenge and provide initial breakthrough of genes possibly involved in recognition events and early signalling responses to combat the pathogen through subsequent development of resistivity. This is the first attempt to elucidate the molecular basis of the response of the resistant genotype to the late leaf spot pathogen, and its defence mechanism. PMID:25646800

  5. Hepatic transcriptional profiling response to fava bean-induced oxidative stress in glucose-6-phosphate dehydrogenase-deficient mice.

    PubMed

    Du, Guankui; Xiao, Man; Wei, Xiuyu; Zhou, Chen; Li, Shuoshuo; Cai, Wangwei

    2018-04-30

    Favism is an acute hemolytic syndrome caused by the ingestion of fava bean (FB) in glucose 6-phosphate dehydrogenase (G6PD) deficient individuals. However, little is known about the global transcripts alteration in liver tissue after FB ingestion in G6PD-normal and -deficient states. In this study, deep sequencing was used to analyze liver genes expression alterations underlying the effects of FB in C3H (Wild Type, WT) and G6PD-deficient (G6PDx) mice and to evaluate and visualize the collective annotation of a list of genes to Gene Ontology (GO) terms associated with favism. Our results showed that FB resulted in a decrease of glutathione (GSH)-to-oxidized glutathione (GSSG) ratio and an increase of malondialdehyde (MDA) both in the G6PDx and WT-control check (CK) mice plasma. Significantly, liver transcript differences were observed between the control and FB-treated groups of both WT and G6PDx mice. A total of 320 differentially expressed transcripts were identified by comparison of G6PDx-CK with WT-CK and were associated with immune response and oxidation-reduction function. A total of 149 differentially expressed genes were identified by comparison of WT-FB with WT-CK. These genes were associated with immune response, steroid metabolic process, creatine kinase activity, and fatty acid metabolic process. A total of 438 differential genes were identified by comparing G6PDx-FB with G6PD-CK, associated with the negative regulation of fatty acid metabolic process, endoplasmic reticulum, iron binding, and glutathione transferase activity. These findings indicate that G6PD mutations may affect the functional categories such as immune response and oxidation-reduction. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. The Hypoxic Response Contributes to Altered Gene Expression and Pre-Capillary Pulmonary Hypertension in Patients with Sickle Cell Disease

    PubMed Central

    Zhang, Xu; Zhang, Wei; Ma, Shwu-Fan; Desai, Ankit A.; Saraf, Santosh; Miasniakova, Galina; Sergueeva, Adelina; Ammosova, Tatiana; Xu, Min; Nekhai, Sergei; Abbasi, Taimur; Casanova, Nancy G.; Steinberg, Martin H.; Baldwin, Clinton T.; Sebastiani, Paola; Prchal, Josef T.; Kittles, Rick; Garcia, Joe G. N.; Machado, Roberto F.; Gordeuk, Victor R.

    2014-01-01

    Background We postulated that the hypoxic response in sickle cell disease (SCD) contributes to altered gene expression and pulmonary hypertension, a complication associated with early mortality. Methods and Results To identify genes regulated by the hypoxic response and not other effects of chronic anemia, we compared expression variation in peripheral blood mononuclear cells from 13 SCD subjects with hemoglobin SS genotype and 15 Chuvash polycythemia subjects (VHLR200W homozygotes with constitutive up-regulation of hypoxia inducible factors in the absence of anemia or hypoxia). At 5% false discovery rate, 1040 genes exhibited >1.15 fold change in both conditions; 297 were up-regulated and 743 down-regulated including MAPK8 encoding a mitogen-activated protein kinase important for apoptosis, T-cell differentiation and inflammatory responses. Association mapping with a focus on local regulatory polymorphisms in 61 SCD patients identified expression quantitative trait loci (eQTL) for 103 of these hypoxia response genes. In a University of Illinois SCD cohort the A allele of a MAPK8 eQTL, rs10857560, was associated with pre-capillary pulmonary hypertension defined as mean pulmonary artery pressure ≥25 and pulmonary capillary wedge pressure ≤15 mm Hg at right heart catheterization (allele frequency=0.66; OR=13.8, P=0.00036, n=238). This association was confirmed in an independent Walk-PHaSST cohort (allele frequency=0.65; OR=11.3, P=0.0025, n=519). The homozygous AA genotype of rs10857560 was associated with decreased MAPK8 expression and present in all 14 identified pre-capillary pulmonary hypertension cases among the combined 757 patients. Conclusions Our study demonstrates a prominent hypoxic transcription component in SCD and a MAPK8 eQTL associated with pre-capillary pulmonary hypertension. PMID:24515990

  7. Microarray and differential display identify genes involved in jasmonate-dependent anther development.

    PubMed

    Mandaokar, Ajin; Kumar, V Dinesh; Amway, Matt; Browse, John

    2003-07-01

    Jasmonate (JA) is a signaling compound essential for anther development and pollen fertility in Arabidopsis. Mutations that block the pathway of JA synthesis result into male sterility. To understand the processes of anther and pollen maturation, we used microarray and differential display approaches to compare gene expression pattern in anthers of wild-type Arabidopsis and the male-sterile mutant, opr3. Microarray experiment revealed 25 genes that were up-regulated more than 1.8-fold in wild-type anthers as compared to mutant anthers. Experiments based on differential display identified 13 additional genes up-regulated in wild-type anthers compared to opr3 for a total of 38 differentially expressed genes. Searches of the Arabidopsis and non-redundant databases disclosed known or likely functions for 28 of the 38 genes identified, while 10 genes encode proteins of unknown function. Northern blot analysis of eight representative clones as probes confirmed low expression in opr3 anthers compared with wild-type anthers. JA responsiveness of these same genes was also investigated by northern blot analysis of anther RNA isolated from wild-type and opr3 plants, In these experiments, four genes were induced in opr3 anthers within 0.5-1 h of JA treatment while the remaining genes were up-regulated only 1-8 h after JA application. None of these genes was induced by JA in anthers of the coil mutant that is deficient in JA responsiveness. The four early-induced genes in opr3 encode lipoxygenase, a putative bHLH transcription factor, epithiospecifier protein and an unknown protein. We propose that these and other early components may be involved in JA signaling and in the initiation of developmental processes. The four late genes encode an extensin-like protein, a peptide transporter and two unknown proteins, which may represent components required later in anther and pollen maturation. Transcript profiling has provided a successful approach to identify genes involved in anther and pollen maturation in Arabidopsis.

  8. Genetic Factors of Autoimmune Thyroid Diseases in Japanese

    PubMed Central

    Ban, Yoshiyuki

    2012-01-01

    Autoimmune thyroid diseases (AITDs), including Graves' disease (GD) and Hashimoto's thyroiditis (HT), are caused by immune response to self-thyroid antigens and affect approximately 2–5% of the general population. Genetic susceptibility in combination with external factors, such as smoking, viral/bacterial infection, and chemicals, is believed to initiate the autoimmune response against thyroid antigens. Abundant epidemiological data, including family and twin studies, point to a strong genetic influence on the development of AITDs. Various techniques have been employed to identify genes contributing to the etiology of AITDs, including candidate gene analysis and whole genome screening. These studies have enabled the identification of several loci (genetic regions) that are linked to AITDs, and, in some of these loci, putative AITD susceptibility genes have been identified. Some of these genes/loci are unique to GD and HT and some are common to both diseases, indicating that there is a shared genetic susceptibility to GD and HT. Known AITD-susceptibility genes are classified into three groups: HLA genes, non-HLA immune-regulatory genes (e.g., CTLA-4, PTPN22, and CD40), and thyroid-specific genes (e.g., TSHR and Tg). In this paper, we will summarize the latest findings on AITD susceptibility genes in Japanese. PMID:22242199

  9. Transcriptome and metabolite analysis identifies nitrogen utilization genes in tea plant (Camellia sinensis).

    PubMed

    Li, Wei; Xiang, Fen; Zhong, Micai; Zhou, Lingyun; Liu, Hongyan; Li, Saijun; Wang, Xuewen

    2017-05-10

    Applied nitrogen (N) fertilizer significantly increases the leaf yield. However, most N is not utilized by the plant, negatively impacting the environment. To date, little is known regarding N utilization genes and mechanisms in the leaf production. To understand this, we investigated transcriptomes using RNA-seq and amino acid levels with N treatment in tea (Camellia sinensis), the most popular beverage crop. We identified 196 and 29 common differentially expressed genes in roots and leaves, respectively, in response to ammonium in two tea varieties. Among those genes, AMT, NRT and AQP for N uptake and GOGAT and GS for N assimilation were the key genes, validated by RT-qPCR, which expressed in a network manner with tissue specificity. Importantly, only AQP and three novel DEGs associated with stress, manganese binding, and gibberellin-regulated transcription factor were common in N responses across all tissues and varieties. A hypothesized gene regulatory network for N was proposed. A strong statistical correlation between key genes' expression and amino acid content was revealed. The key genes and regulatory network improve our understanding of the molecular mechanism of N usage and offer gene targets for plant improvement.

  10. Exposure to Cobalt Causes Transcriptomic and Proteomic Changes in Two Rat Liver Derived Cell Lines

    PubMed Central

    Permenter, Matthew G.; Dennis, William E.; Sutto, Thomas E.; Jackson, David A.; Lewis, John A.; Stallings, Jonathan D.

    2013-01-01

    Cobalt is a transition group metal present in trace amounts in the human diet, but in larger doses it can be acutely toxic or cause adverse health effects in chronic exposures. Its use in many industrial processes and alloys worldwide presents opportunities for occupational exposures, including military personnel. While the toxic effects of cobalt have been widely studied, the exact mechanisms of toxicity remain unclear. In order to further elucidate these mechanisms and identify potential biomarkers of exposure or effect, we exposed two rat liver-derived cell lines, H4-II-E-C3 and MH1C1, to two concentrations of cobalt chloride. We examined changes in gene expression using DNA microarrays in both cell lines and examined changes in cytoplasmic protein abundance in MH1C1 cells using mass spectrometry. We chose to closely examine differentially expressed genes and proteins changing in abundance in both cell lines in order to remove cell line specific effects. We identified enriched pathways, networks, and biological functions using commercial bioinformatic tools and manual annotation. Many of the genes, proteins, and pathways modulated by exposure to cobalt appear to be due to an induction of a hypoxic-like response and oxidative stress. Genes that may be differentially expressed due to a hypoxic-like response are involved in Hif-1α signaling, glycolysis, gluconeogenesis, and other energy metabolism related processes. Gene expression changes linked to oxidative stress are also known to be involved in the NRF2-mediated response, protein degradation, and glutathione production. Using microarray and mass spectrometry analysis, we were able to identify modulated genes and proteins, further elucidate the mechanisms of toxicity of cobalt, and identify biomarkers of exposure and effect in vitro, thus providing targets for focused in vivo studies. PMID:24386269

  11. Identification of drought-responsive genes in roots of upland rice (Oryza sativa L)

    PubMed Central

    Rabello, Aline R; Guimarães, Cléber M; Rangel, Paulo HN; da Silva, Felipe R; Seixas, Daniela; de Souza, Emanuel; Brasileiro, Ana CM; Spehar, Carlos R; Ferreira, Márcio E; Mehta, Ângela

    2008-01-01

    Background Rice (Oryza sativa L.) germplasm represents an extraordinary source of genes that control traits of agronomic importance such as drought tolerance. This diversity is the basis for the development of new cultivars better adapted to water restriction conditions, in particular for upland rice, which is grown under rainfall. The analyses of subtractive cDNA libraries and differential protein expression of drought tolerant and susceptible genotypes can contribute to the understanding of the genetic control of water use efficiency in rice. Results Two subtractive libraries were constructed using cDNA of drought susceptible and tolerant genotypes submitted to stress against cDNA of well-watered plants. In silico analysis revealed 463 reads, which were grouped into 282 clusters. Several genes expressed exclusively in the tolerant or susceptible genotypes were identified. Additionally, proteome analysis of roots from stressed plants was performed and 22 proteins putatively associated to drought tolerance were identified by mass spectrometry. Conclusion Several genes and proteins involved in drought-response, as well as genes with no described homologs were identified. Genes exclusively expressed in the tolerant genotype were, in general, related to maintenance of turgor and cell integrity. In contrast, in the susceptible genotype, expression of genes involved in protection against cell damage was not detected. Several protein families identified in the proteomic analysis were not detected in the cDNA analysis. There is an indication that the mechanisms of susceptibility to drought in upland rice are similar to those of lowland varieties. PMID:18922162

  12. Drought Response in Wheat: Key Genes and Regulatory Mechanisms Controlling Root System Architecture and Transpiration Efficiency.

    PubMed

    Kulkarni, Manoj; Soolanayakanahally, Raju; Ogawa, Satoshi; Uga, Yusaku; Selvaraj, Michael G; Kagale, Sateesh

    2017-01-01

    Abiotic stresses such as, drought, heat, salinity, and flooding threaten global food security. Crop genetic improvement with increased resilience to abiotic stresses is a critical component of crop breeding strategies. Wheat is an important cereal crop and a staple food source globally. Enhanced drought tolerance in wheat is critical for sustainable food production and global food security. Recent advances in drought tolerance research have uncovered many key genes and transcription regulators governing morpho-physiological traits. Genes controlling root architecture and stomatal development play an important role in soil moisture extraction and its retention, and therefore have been targets of molecular breeding strategies for improving drought tolerance. In this systematic review, we have summarized evidence of beneficial contributions of root and stomatal traits to plant adaptation to drought stress. Specifically, we discuss a few key genes such as, DRO1 in rice and ERECTA in Arabidopsis and rice that were identified to be the enhancers of drought tolerance via regulation of root traits and transpiration efficiency. Additionally, we highlight several transcription factor families, such as, ERF (ethylene response factors), DREB (dehydration responsive element binding), ZFP (zinc finger proteins), WRKY, and MYB that were identified to be both positive and negative regulators of drought responses in wheat, rice, maize, and/or Arabidopsis. The overall aim of this review is to provide an overview of candidate genes that have been identified as regulators of drought response in plants. The lack of a reference genome sequence for wheat and non-transgenic approaches for manipulation of gene functions in wheat in the past had impeded high-resolution interrogation of functional elements, including genes and QTLs, and their application in cultivar improvement. The recent developments in wheat genomics and reverse genetics, including the availability of a gold-standard reference genome sequence and advent of genome editing technologies, are expected to aid in deciphering of the functional roles of genes and regulatory networks underlying adaptive phenological traits, and utilizing the outcomes of such studies in developing drought tolerant cultivars.

  13. Comparative analysis of TCDD-induced AhR-mediated gene expression in human, mouse and rat primary B cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kovalova, Natalia, E-mail: kovalova@msu.edu

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a persistent environmental pollutant that activates the aryl hydrocarbon receptor (AhR) resulting in altered gene expression. In vivo, in vitro, and ex vivo studies have demonstrated that B cells are directly impaired by TCDD, and are a sensitive target as evidenced by suppression of antibody responses. The window of sensitivity to TCDD-induced suppression of IgM secretion among mouse, rat and human B cells is similar. Specifically, TCDD must be present within the initial 12 h post B cell stimulation, indicating that TCDD disrupts early signaling network(s) necessary for B lymphocyte activation and differentiation. Therefore, we hypothesized thatmore » TCDD treatment across three different species (mouse, rat and human) triggers a conserved, B cell-specific mechanism that is involved in TCDD-induced immunosuppression. RNA sequencing (RNA-Seq) was used to identify B cell-specific orthologous genes that are differentially expressed in response to TCDD in primary mouse, rat and human B cells. Time course studies identified TCDD-elicited differential expression of 515 human, 2371 mouse and 712 rat orthologous genes over the 24-h period. 28 orthologs were differentially expressed in response to TCDD in all three species. Overrepresented pathways enriched in all three species included cytokine-cytokine receptor interaction, ECM-receptor interaction, focal adhesion, regulation of actin cytoskeleton and pathways in cancer. Differentially expressed genes functionally associated with cell-cell signaling in humans, immune response in mice, and oxidation reduction in rats. Overall, these results suggest that despite the conservation of the AhR and its signaling mechanism, TCDD elicits species-specific gene expression changes. - Highlights: • Kovalova TAAP Highlights Nov. 2016 • RNA-Seq identified TCDD-induced gene expression in PWM-activated primary B cells. • TCDD elicited differential expression of 515 human, 2371 mouse and 712 rat orthologs. • 28 orthologs were differentially expressed in response to TCDD in all three species. • TCDD elicits mostly species-specific gene expression changes in activated B cells.« less

  14. Genome-wide data reveal novel genes for methotrexate response in a large cohort of juvenile idiopathic arthritis cases.

    PubMed

    Cobb, J; Cule, E; Moncrieffe, H; Hinks, A; Ursu, S; Patrick, F; Kassoumeri, L; Flynn, E; Bulatović, M; Wulffraat, N; van Zelst, B; de Jonge, R; Bohm, M; Dolezalova, P; Hirani, S; Newman, S; Whitworth, P; Southwood, T R; De Iorio, M; Wedderburn, L R; Thomson, W

    2014-08-01

    Clinical response to methotrexate (MTX) treatment for children with juvenile idiopathic arthritis (JIA) displays considerable heterogeneity. Currently, there are no reliable predictors to identify non-responders: earlier identification could lead to a targeted treatment. We genotyped 759 JIA cases from the UK, the Netherlands and Czech Republic. Clinical variables were measured at baseline and 6 months after start of the treatment. In Phase I analysis, samples were analysed for the association with MTX response using ordinal regression of ACR-pedi categories and linear regression of change in clinical variables, and identified 31 genetic regions (P<0.001). Phase II analysis increased SNP density in the most strongly associated regions, identifying 14 regions (P<1 × 10(-5)): three contain genes of particular biological interest (ZMIZ1, TGIF1 and CFTR). These data suggest a role for novel pathways in MTX response and further investigations within associated regions will help to reach our goal of predicting response to MTX in JIA.

  15. Genome-Wide Analysis of the GRF Family Reveals Their Involvement in Abiotic Stress Response in Cassava.

    PubMed

    Shang, Sang; Wu, Chunlai; Huang, Chao; Tie, Weiwei; Yan, Yan; Ding, Zehong; Xia, Zhiqiang; Wang, Wenquan; Peng, Ming; Tian, Libo; Hu, Wei

    2018-02-20

    GENERAL REGULATORY FACTOR (GRF) proteins play vital roles in the regulation of plant growth, development, and response to abiotic stress. However, little information is known for this gene family in cassava ( Manihot esculenta ). In this study, 15 MeGRFs were identified from the cassava genome and were clustered into the ε and the non-ε groups according to phylogenetic, conserved motif, and gene structure analyses. Transcriptomic analyses showed eleven Me GRFs with constitutively high expression in stems, leaves, and storage roots of two cassava genotypes. Expression analyses revealed that the majority of GRFs showed transcriptional changes under cold, osmotic, salt, abscisic acid (ABA), and H₂O₂ treatments. Six Me GRFs were found to be commonly upregulated by abiotic stress, ABA, and H₂O₂ treatments, which may be the converging points of multiple signaling pathways. Interaction network analysis identified 18 possible interactors of MeGRFs. Taken together, this study elucidates the transcriptional control of Me GRFs in tissue development and the responses of abiotic stress and related signaling in cassava. Some constitutively expressed, tissue-specific, and abiotic stress-responsive candidate MeGRF genes were identified for the further genetic improvement of crops.

  16. Arabidopsis Defense against Botrytis cinerea: Chronology and Regulation Deciphered by High-Resolution Temporal Transcriptomic Analysis[C][W

    PubMed Central

    Windram, Oliver; Madhou, Priyadharshini; McHattie, Stuart; Hill, Claire; Hickman, Richard; Cooke, Emma; Jenkins, Dafyd J.; Penfold, Christopher A.; Baxter, Laura; Breeze, Emily; Kiddle, Steven J.; Rhodes, Johanna; Atwell, Susanna; Kliebenstein, Daniel J.; Kim, Youn-sung; Stegle, Oliver; Borgwardt, Karsten; Zhang, Cunjin; Tabrett, Alex; Legaie, Roxane; Moore, Jonathan; Finkenstadt, Bärbel; Wild, David L.; Mead, Andrew; Rand, David; Beynon, Jim; Ott, Sascha; Buchanan-Wollaston, Vicky; Denby, Katherine J.

    2012-01-01

    Transcriptional reprogramming forms a major part of a plant’s response to pathogen infection. Many individual components and pathways operating during plant defense have been identified, but our knowledge of how these different components interact is still rudimentary. We generated a high-resolution time series of gene expression profiles from a single Arabidopsis thaliana leaf during infection by the necrotrophic fungal pathogen Botrytis cinerea. Approximately one-third of the Arabidopsis genome is differentially expressed during the first 48 h after infection, with the majority of changes in gene expression occurring before significant lesion development. We used computational tools to obtain a detailed chronology of the defense response against B. cinerea, highlighting the times at which signaling and metabolic processes change, and identify transcription factor families operating at different times after infection. Motif enrichment and network inference predicted regulatory interactions, and testing of one such prediction identified a role for TGA3 in defense against necrotrophic pathogens. These data provide an unprecedented level of detail about transcriptional changes during a defense response and are suited to systems biology analyses to generate predictive models of the gene regulatory networks mediating the Arabidopsis response to B. cinerea. PMID:23023172

  17. Transcriptomic characterization of temperature stress responses in larval zebrafish.

    PubMed

    Long, Yong; Li, Linchun; Li, Qing; He, Xiaozhen; Cui, Zongbin

    2012-01-01

    Temperature influences nearly all biochemical, physiological and life history activities of fish, but the molecular mechanisms underlying the temperature acclimation remains largely unknown. Previous studies have identified many temperature-regulated genes in adult tissues; however, the transcriptional responses of fish larvae to temperature stress are not well understood. In this study, we characterized the transcriptional responses in larval zebrafish exposed to cold or heat stress using microarray analysis. In comparison with genes expressed in the control at 28 °C, a total of 2680 genes were found to be affected in 96 hpf larvae exposed to cold (16 °C) or heat (34 °C) for 2 and 48h and most of these genes were expressed in a temperature-specific and temporally regulated manner. Bioinformatic analysis identified multiple temperature-regulated biological processes and pathways. Biological processes overrepresented among the earliest genes induced by temperature stress include regulation of transcription, nucleosome assembly, chromatin organization and protein folding. However, processes such as RNA processing, cellular metal ion homeostasis and protein transport and were enriched in genes up-regulated under cold exposure for 48 h. Pathways such as mTOR signalling, p53 signalling and circadian rhythm were enriched among cold-induced genes, while adipocytokine signalling, protein export and arginine and praline metabolism were enriched among heat-induced genes. Although most of these biological processes and pathways were specifically regulated by cold or heat, common responses to both cold and heat stresses were also found. Thus, these findings provide new interesting clues for elucidation of mechanisms underlying the temperature acclimation in fish.

  18. Generation and Analysis of Expressed Sequence Tags (ESTs) from Halophyte Atriplex canescens to Explore Salt-Responsive Related Genes

    PubMed Central

    Li, Jingtao; Sun, Xinhua; Yu, Gang; Jia, Chengguo; Liu, Jinliang; Pan, Hongyu

    2014-01-01

    Little information is available on gene expression profiling of halophyte A. canescens. To elucidate the molecular mechanism for stress tolerance in A. canescens, a full-length complementary DNA library was generated from A. canescens exposed to 400 mM NaCl, and provided 343 high-quality ESTs. In an evaluation of 343 valid EST sequences in the cDNA library, 197 unigenes were assembled, among which 190 unigenes (83.1% ESTs) were identified according to their significant similarities with proteins of known functions. All the 343 EST sequences have been deposited in the dbEST GenBank under accession numbers JZ535802 to JZ536144. According to Arabidopsis MIPS functional category and GO classifications, we identified 193 unigenes of the 311 annotations EST, representing 72 non-redundant unigenes sharing similarities with genes related to the defense response. The sets of ESTs obtained provide a rich genetic resource and 17 up-regulated genes related to salt stress resistance were identified by qRT-PCR. Six of these genes may contribute crucially to earlier and later stage salt stress resistance. Additionally, among the 343 unigenes sequences, 22 simple sequence repeats (SSRs) were also identified contributing to the study of A. canescens resources. PMID:24960361

  19. Identification of in vivo regulators of the Vibrio cholerae xds gene using a high-throughput genetic selection

    PubMed Central

    McDonough, EmilyKate; Lazinski, David W.; Camilli, Andrew

    2014-01-01

    Summary Vibrio cholerae, the causative agent of cholera, remains a threat to public health in areas with inadequate sanitation. As a waterborne pathogen, V. cholerae moves between two dissimilar environments, aquatic reservoirs and the intestinal tract of humans. Accordingly, this pathogen undergoes adaptive shifts in gene expression throughout the different stages of its lifecycle. One particular gene, xds, encodes a secreted exonuclease that was previously identified as being induced during infection. Here we sought to identify regulators responsible for the in vivo-specific induction of xds. A transcriptional fusion of xds to two consecutive antibiotic resistance genes was used to select transposon mutants that had inserted within or adjacent to regulatory genes and thereby caused increased expression of the xds fusion under non-inducing conditions. Large pools of selected insertion sites were sequenced in a high throughput manner using Tn-seq to identify potential mechanisms of xds regulation. Our selection identified the two-component system PhoB/R as the dominant activator of xds expression. In vitro validation confirmed that PhoB, a protein which is only active during phosphate limitation, was responsible for xds activation. Using xds expression as a biosensor of the extracellular phosphate level, we observed that the mouse small intestine is a phosphate-limited environment. PMID:24673931

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sardi, Maria; Rovinskiy, Nikolay; Zhang, Yaoping

    We report a major obstacle to sustainable lignocellulosic biofuel production is microbe inhibition by the combinatorial stresses in pretreated plant hydrolysate. Chemical biomass pretreatment releases a suite of toxins that interact with other stressors, including high osmolarity and temperature, which together can have poorly understood synergistic effects on cells. Improving tolerance in industrial strains has been hindered, in part because the mechanisms of tolerance reported in the literature often fail to recapitulate in other strain backgrounds. Here, we explored and then exploited variations in stress tolerance, toxin-induced transcriptomic responses, and fitness effects of gene overexpression in different Saccharomyces cerevisiae (yeast)more » strains to identify genes and processes linked to tolerance of hydrolysate stressors. Using six different S. cerevisiae strains that together maximized phenotypic and genetic diversity, first we explored transcriptomic differences between resistant and sensitive strains to identify common and strain-specific responses. This comparative analysis implicated primary cellular targets of hydrolysate toxins, secondary effects of defective defense strategies, and mechanisms of tolerance. Dissecting the responses to individual hydrolysate components across strains pointed to synergistic interactions between osmolarity, pH, hydrolysate toxins, and nutrient composition. By characterizing the effects of high-copy gene overexpression in three different strains, we revealed the breadth of the background-specific effects of gene fitness contributions in synthetic hydrolysate. Lastly, our approach identified new genes for engineering improved stress tolerance in diverse strains while illuminating the effects of genetic background on molecular mechanisms.« less

  1. An unbiased approach to identify genes involved in development in a turtle with temperature-dependent sex determination.

    PubMed

    Chojnowski, Jena L; Braun, Edward L

    2012-07-15

    Many reptiles exhibit temperature-dependent sex determination (TSD). The initial cue in TSD is incubation temperature, unlike genotypic sex determination (GSD) where it is determined by the presence of specific alleles (or genetic loci). We used patterns of gene expression to identify candidates for genes with a role in TSD and other developmental processes without making a priori assumptions about the identity of these genes (ortholog-based approach). We identified genes with sexually dimorphic mRNA accumulation during the temperature sensitive period of development in the Red-eared slider turtle (Trachemys scripta), a turtle with TSD. Genes with differential mRNA accumulation in response to estrogen (estradiol-17β; E(2)) exposure and developmental stages were also identified. Sequencing 767 clones from three suppression-subtractive hybridization libraries yielded a total of 581 unique sequences. Screening a macroarray with a subset of those sequences revealed a total of 26 genes that exhibited differential mRNA accumulation: 16 female biased and 10 male biased. Additional analyses revealed that C16ORF62 (an unknown gene) and MALAT1 (a long noncoding RNA) exhibited increased mRNA accumulation at the male producing temperature relative to the female producing temperature during embryonic sexual development. Finally, we identified four genes (C16ORF62, CCT3, MMP2, and NFIB) that exhibited a stage effect and five genes (C16ORF62, CCT3, MMP2, NFIB and NOTCH2) showed a response to E(2) exposure. Here we report a survey of genes identified using patterns of mRNA accumulation during embryonic development in a turtle with TSD. Many previous studies have focused on examining the turtle orthologs of genes involved in mammalian development. Although valuable, the limitations of this approach are exemplified by our identification of two genes (MALAT1 and C16ORF62) that are sexually dimorphic during embryonic development. MALAT1 is a noncoding RNA that has not been implicated in sexual differentiation in other vertebrates and C16ORF62 has an unknown function. Our results revealed genes that are candidates for having roles in turtle embryonic development, including TSD, and highlight the need to expand our search parameters beyond protein-coding genes.

  2. Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression.

    PubMed

    Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar

    1998-01-01

    The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

  3. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    PubMed

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  4. Identification of target genes of synovial sarcoma-associated fusion oncoprotein using human pluripotent stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hayakawa, Kazuo; Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto; Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya

    2013-03-22

    Highlights: ► We tried to identify targets of synovial sarcoma (SS)-associated SYT–SSX fusion gene. ► We established pluripotent stem cell (PSC) lines with inducible SYT–SSX gene. ► SYT–SSX responsive genes were identified by the induction of SYT–SSX in PSC. ► SS-related genes were selected from database by in silico analyses. ► 51 genes were finally identified among SS-related genes as targets of SYT–SSX in PSC. -- Abstract: Synovial sarcoma (SS) is a malignant soft tissue tumor harboring chromosomal translocation t(X; 18)(p11.2; q11.2), which produces SS-specific fusion gene, SYT–SSX. Although precise function of SYT–SSX remains to be investigated, accumulating evidences suggestmore » its role in gene regulation via epigenetic mechanisms, and the product of SYT–SSX target genes may serve as biomarkers of SS. Lack of knowledge about the cell-of-origin of SS, however, has placed obstacle in the way of target identification. Here we report a novel approach to identify SYT–SSX2 target genes using human pluripotent stem cells (hPSCs) containing a doxycycline-inducible SYT–SSX2 gene. SYT–SSX2 was efficiently induced both at mRNA and protein levels within three hours after doxycycline administration, while no morphological change of hPSCs was observed until 24 h. Serial microarray analyses identified genes of which the expression level changed more than twofold within 24 h. Surprisingly, the majority (297/312, 95.2%) were up-regulated genes and a result inconsistent with the current concept of SYT–SSX as a transcriptional repressor. Comparing these genes with SS-related genes which were selected by a series of in silico analyses, 49 and 2 genes were finally identified as candidates of up- and down-regulated target of SYT–SSX, respectively. Association of these genes with SYT–SSX in SS cells was confirmed by knockdown experiments. Expression profiles of SS-related genes in hPSCs and human mesenchymal stem cells (hMSCs) were strikingly different in response to the induction of SYT–SSX, and more than half of SYT–SSX target genes in hPSCs were not induced in hMSCs. These results suggest the importance of cellular context for correct understanding of SYT–SSX function, and demonstrated how our new system will help to overcome this issue.« less

  5. Mapping QTLs for water-use efficiency reveals the potential candidate genes involved in regulating the trait in apple under drought stress.

    PubMed

    Wang, Haibo; Zhao, Shuang; Mao, Ke; Dong, Qinglong; Liang, Bowen; Li, Chao; Wei, Zhiwei; Li, Mingjun; Ma, Fengwang

    2018-06-26

    Improvement of water-use efficiency (WUE) can effectively reduce production losses caused by drought stress. A better understanding of the genetic determination of WUE in crops under drought stress has great potential value for developing cultivars adapted to arid regions. To identify the genetic loci associated with WUE and reveal genes responsible for the trait in apple, we aim to map the quantitative trait loci (QTLs) for carbon isotope composition, the proxy for WUE, applying two contrasting irrigating regimes over the two-year experiment and search for the candidate genes encompassed in the mapped QTLs. We constructed a high-density genetic linkage map with 10,172 markers of apple, using single nucleotide polymorphism (SNP) markers obtained through restriction site-associated DNA sequencing (RADseq) and a final segregating population of 350 seedlings from the cross of Honeycrisp and Qinguan. In total, 33 QTLs were identified for carbon isotope composition in apple under both well-watered and drought-stressed conditions. Three QTLs were stable over 2 years under drought stress on linkage groups LG8, LG15 and LG16, as validated by Kompetitive Allele-Specific PCR (KASP) assays. In those validated QTLs, 258 genes were screened according to their Gene Ontology functional annotations. Among them, 28 genes were identified, which exhibited significant responses to drought stress in 'Honeycrisp' and/or 'Qinguan'. These genes are involved in signaling, photosynthesis, response to stresses, carbohydrate metabolism, protein metabolism and modification, hormone metabolism and transport, transport, respiration, transcriptional regulation, and development regulation. They, especially those for photoprotection and relevant signal transduction, are potential candidate genes connected with WUE regulation in drought-stressed apple. We detected three stable QTLs for carbon isotope composition in apple under drought stress over 2 years, and validated them by KASP assay. Twenty-eight candidate genes encompassed in these QTLs were identified. These stable genetic loci and series of genes provided here serve as a foundation for further studies on marker-assisted selection of high WUE and regulatory mechanism of WUE in apple exposed to drought conditions, respectively.

  6. Gene expression profiling of flax (Linum usitatissimum L.) under edaphic stress.

    PubMed

    Dmitriev, Alexey A; Kudryavtseva, Anna V; Krasnov, George S; Koroban, Nadezhda V; Speranskaya, Anna S; Krinitsina, Anastasia A; Belenikin, Maxim S; Snezhkina, Anastasiya V; Sadritdinova, Asiya F; Kishlyan, Natalya V; Rozhmina, Tatiana A; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Melnikova, Nataliya V

    2016-11-16

    Cultivated flax (Linum usitatissimum L.) is widely used for production of textile, food, chemical and pharmaceutical products. However, various stresses decrease flax production. Search for genes, which are involved in stress response, is necessary for breeding of adaptive cultivars. Imbalanced concentration of nutrient elements in soil decrease flax yields and also results in heritable changes in some flax lines. The appearance of Linum Insertion Sequence 1 (LIS-1) is the most studied modification. However, LIS-1 function is still unclear. High-throughput sequencing of transcriptome of flax plants grown under normal (N), phosphate deficient (P), and nutrient excess (NPK) conditions was carried out using Illumina platform. The assembly of transcriptome was performed, and a total of 34924, 33797, and 33698 unique transcripts for N, P, and NPK sequencing libraries were identified, respectively. We have not revealed any LIS-1 derived mRNA in our sequencing data. The analysis of high-throughput sequencing data allowed us to identify genes with potentially differential expression under imbalanced nutrition. For further investigation with qPCR, 15 genes were chosen and their expression levels were evaluated in the extended sampling of 31 flax plants. Significant expression alterations were revealed for genes encoding WRKY and JAZ protein families under P and NPK conditions. Moreover, the alterations of WRKY family genes differed depending on LIS-1 presence in flax plant genome. Besides, we revealed slight and LIS-1 independent mRNA level changes of KRP2 and ING1 genes, which are adjacent to LIS-1, under nutrition stress. Differentially expressed genes were identified in flax plants, which were grown under phosphate deficiency and excess nutrition, on the basis of high-throughput sequencing and qPCR data. We showed that WRKY and JAS gene families participate in flax response to imbalanced nutrient content in soil. Besides, we have not identified any mRNA, which could be derived from LIS-1, in our transcriptome sequencing data. Expression of LIS-1 flanking genes, ING1 and KRP2, was suggested not to be nutrient stress-induced. Obtained results provide new insights into edaphic stress response in flax and the role of LIS-1 in these process.

  7. The genomic view of genes responsive to the antagonistic phytohormones, abscisic acid, and gibberellin.

    PubMed

    Yazaki, Junshi; Kikuchi, Shoshi

    2005-01-01

    We now have the various genomics tools for monocot (Oryza sativa) and a dicot (Arabidopsis thaliana) plant. Plant is not only a very important agricultural resource but also a model organism for biological research. It is important that the interaction between ABA and GA is investigated for controlling the transition from embryogenesis to germination in seeds using genomics tools. These studies have investigated the relationship between dormancy and germination using genomics tools. Genomics tools identified genes that had never before been annotated as ABA- or GA-responsive genes in plant, detected new interactions between genes responsive to the two hormones, comprehensively characterized cis-elements of hormone-responsive genes, and characterized cis-elements of rice and Arabidopsis. In these research, ABA- and GA-regulated genes have been classified as functional proteins (proteins that probably function in stress or PR tolerance) and regulatory proteins (protein factors involved in further regulation of signal transduction). Comparison between ABA and/or GA-responsive genes in rice and those in Arabidopsis has shown that the cis-element has specificity in each species. cis-Elements for the dehydration-stress response have been specified in Arabidopsis but not in rice. cis-Elements for protein storage are remarkably richer in the upstream regions of the rice gene than in those of Arabidopsis.

  8. Repressors Nrg1 and Nrg2 Regulate a Set of Stress-Responsive Genes in Saccharomyces cerevisiae§

    PubMed Central

    Vyas, Valmik K.; Berkey, Cristin D.; Miyao, Takenori; Carlson, Marian

    2005-01-01

    The yeast Saccharomyces cerevisiae responds to environmental stress by rapidly altering the expression of large sets of genes. We report evidence that the transcriptional repressors Nrg1 and Nrg2 (Nrg1/Nrg2), which were previously implicated in glucose repression, regulate a set of stress-responsive genes. Genome-wide expression analysis identified 150 genes that were upregulated in nrg1Δ nrg2Δ double mutant cells, relative to wild-type cells, during growth in glucose. We found that many of these genes are regulated by glucose repression. Stress response elements (STREs) and STRE-like elements are overrepresented in the promoters of these genes, and a search of available expression data sets showed that many are regulated in response to a variety of environmental stress signals. In accord with these findings, mutation of NRG1 and NRG2 enhanced the resistance of cells to salt and oxidative stress and decreased tolerance to freezing. We present evidence that Nrg1/Nrg2 not only contribute to repression of target genes in the absence of stress but also limit induction in response to salt stress. We suggest that Nrg1/Nrg2 fine-tune the regulation of a set of stress-responsive genes. PMID:16278455

  9. Prospective Molecular Profiling of Melanoma Metastases Suggests Classifiers of Immune Responsiveness

    PubMed Central

    Wang, Ena; Miller, Lance D.; Ohnmacht, Galen A.; Mocellin, Simone; Perez-Diez, Ainhoa; Petersen, David; Zhao, Yingdong; Simon, Richard; Powell, John I.; Asaki, Esther; Alexander, H. Richard; Duray, Paul H.; Herlyn, Meenhard; Restifo, Nicholas P.; Liu, Edison T.; Rosenberg, Steven A.; Marincola, Francesco M.

    2008-01-01

    We amplified RNAs from 63 fine needle aspiration (FNA) samples from 37 s.c. melanoma metastases from 25 patients undergoing immunotherapy for hybridization to a 6108-gene human cDNA chip. By prospectively following the history of the lesions, we could correlate transcript patterns with clinical outcome. Cluster analysis revealed a tight relationship among autologous synchronously sampled tumors compared with unrelated lesions (average Pearson's r = 0.83 and 0.7, respectively, P < 0.0003). As reported previously, two subgroups of metastatic melanoma lesions were identified that, however, had no predictive correlation with clinical outcome. Ranking of gene expression data from pretreatment samples identified ∼30 genes predictive of clinical response (P < 0.001). Analysis of their annotations denoted that approximately half of them were related to T-cell regulation, suggesting that immune responsiveness might be predetermined by a tumor microenvironment conducive to immune recognition. PMID:12097256

  10. Quantitative trait loci analyses and RNA-seq identify genes affecting stress response in rainbow trout

    USDA-ARS?s Scientific Manuscript database

    Genomic analyses have the potential to impact aquaculture production traits by identifying markers as proxies for traits which are expensive or difficult to measure and characterizing genetic variation and biochemical mechanisms underlying phenotypic variation. One such trait is the response of rai...

  11. Genome-wide analysis of WRKY gene family in Cucumis sativus

    PubMed Central

    2011-01-01

    Background WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. Results We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Conclusions Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes. PMID:21955985

  12. Genome-wide analysis of WRKY gene family in Cucumis sativus.

    PubMed

    Ling, Jian; Jiang, Weijie; Zhang, Ying; Yu, Hongjun; Mao, Zhenchuan; Gu, Xingfang; Huang, Sanwen; Xie, Bingyan

    2011-09-28

    WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes.

  13. Cold Shock as a Screen for Genes Involved in Cold Acclimatization in Neurospora crassa

    PubMed Central

    Watters, Michael K.; Manzanilla, Victor; Howell, Holly; Mehreteab, Alexander; Rose, Erik; Walters, Nicole; Seitz, Nicholas; Nava, Jacob; Kekelik, Sienna; Knuth, Laura; Scivinsky, Brianna

    2018-01-01

    When subjected to rapid drops of temperature (cold shock), Neurospora responds with a temporary shift in its morphology. This report is the first to examine this response genetically. We report here the results of a screen of selected mutants from the Neurospora knockout library for alterations in their morphological response to cold shock. Three groups of knockouts were selected to be subject to this screen: genes previously suspected to be involved in hyphal development as well as knockouts resulting in morphological changes; transcription factors; and genes homologous to E. coli genes known to alter their expression in response to cold shock. A total of 344 knockout strains were subjected to cold shock. Of those, 118 strains were identified with altered responses. We report here the cold shock morphologies and GO categorizations of strains subjected to this screen. Of strains with knockouts in genes associated with hyphal growth or morphology, 33 of 131 tested (25%) showed an altered response to cold shock. Of strains with knockouts in transcription factor genes, 30 of 145 (20%) showed an altered response to cold shock. Of strains with knockouts in genes homologous to E. coli genes which display altered levels of transcription in response to cold shock, a total of 55 of 68 tested (81%) showed an altered cold shock response. This suggests that the response to cold shock in these two organisms is largely shared in common. PMID:29563189

  14. Microarray-based analysis of gene expression in lycopersicon esculentum seedling roots in response to cadmium, chromium, mercury, and lead.

    PubMed

    Hou, Jing; Liu, Xinhui; Wang, Juan; Zhao, Shengnan; Cui, Baoshan

    2015-02-03

    The effects of heavy metals in agricultural soils have received special attention due to their potential for accumulation in crops, which can affect species at all trophic levels. Therefore, there is a critical need for reliable bioassays for assessing risk levels due to heavy metals in agricultural soil. In the present study, we used microarrays to investigate changes in gene expression of Lycopersicon esculentum in response to Cd-, Cr-, Hg-, or Pb-spiked soil. Exposure to (1)/10 median lethal concentrations (LC50) of Cd, Cr, Hg, or Pb for 7 days resulted in expression changes in 29 Cd-specific, 58 Cr-specific, 192 Hg-specific and 864 Pb-specific genes as determined by microarray analysis, whereas conventional morphological and physiological bioassays did not reveal any toxicant stresses. Hierarchical clustering analysis showed that the characteristic gene expression profiles induced by Cd, Cr, Hg, and Pb were distinct from not only the control but also one another. Furthermore, a total of three genes related to "ion transport" for Cd, 14 genes related to "external encapsulating structure organization", "reproductive developmental process", "lipid metabolic process" and "response to stimulus" for Cr, 11 genes related to "cellular metabolic process" and "cellular response to stimulus" for Hg, 78 genes related to 20 biological processes (e.g., DNA metabolic process, monosaccharide catabolic process, cell division) for Pb were identified and selected as their potential biomarkers. These findings demonstrated that microarray-based analysis of Lycopersicon esculentum was a sensitive tool for the early detection of potential toxicity of heavy metals in agricultural soil, as well as an effective tool for identifying the heavy metal-specific genes, which should be useful for assessing risk levels due to heavy metals in agricultural soil.

  15. Poplar Interactome: Project Final Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaiswal, Pankaj

    The feedstock plant Poplar has many advantages over traditional crop plants. Not only Poplar needs low energy input and off season storage as compared to feedstocks such as corn, in the winter season Poplar biomass is stored on the stem/trunk, and Poplar plantations serve as large carbon sink. A key constraint to the expansion of cellulosic bioenergy sources such as in Poplar however, is the negative consequence of converting land use from food crops to energy crops. Therefore in order for Poplar to become a viable energy crop it needs to be grown mostly on marginal land unsuitable agricultural crops.more » For this we need a better understanding of abiotic stress and adaptation response in poplar. In the process we expected to find new and existing poplar genes and their function that respond to sustain abiotic stress. We carried out an extensive gene expression study on the control untreated and stress (drought, salinity, cold and heat) treated poplar plants. The samples were collected from the stem, leaf and root tissues. The RNA of protein coding genes and regulatory smallRNA genes were sequenced generating more than a billion reads. This is the first such known study in Poplar plants. These were used for quantification and genomic analysis to identify stress responsive genes in poplar. Based on the quantification and genomic analysis, a select set of genes were studied for gene-gene interactions to find their association to stress response. The data was also used to find novel stress responsive genes in poplar that were previously not identified in the Poplar reference genome. The data is made available to the public through the national and international genomic data archives.« less

  16. Cellular Dichotomy Between Anchorage-Independent Growth Responses to bFGF and TA Reflects Molecular Switch in Commitment to Carcinogenesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Waters, Katrina M.; Tan, Ruimin; Opresko, Lee K.

    2009-11-01

    We have investigated gene expression patterns underlying reversible and irreversible anchorage-independent growth (AIG) phenotypes to identify more sensitive markers of cell transformation for studies directed at interrogating carcinogenesis responses. In JB6 mouse epidermal cells, basic fibroblast growth factor (bFGF) induces an unusually efficient and reversible AIG response, relative to 12-O-tetradecanoyl phorbol-13-acetate (TPA)-induced AIG which is irreversible. The reversible and irreversible AIG phenotypes are characterized by largely non-overlapping global gene expression profiles. However, a subset of differentially expressed genes were identified as common to reversible and irreversible AIG phenotypes, including genes regulated in a reciprocal fashion. Hepatic leukemia factor (HLF) andmore » D-site albumin promoter-binding protein (DBP) were increased in both bFGF and TPA soft agar colonies and selected for functional validation. Ectopic expression of human HLF and DBP in JB6 cells resulted in a marked increase in TPA- and bFGF-regulated AIG responses. HLF and DBP expression were increased in soft agar colonies arising from JB6 cells exposed to gamma radiation and in a human basal cell carcinoma tumor tissue, relative to paired non-tumor tissue. Subsequent biological network analysis suggests that many of the differentially expressed genes that are common to bFGF- and TPA-dependent AIG are regulated by c-Myc, SP-1 and HNF-4 transcription factors. Collectively, we have identified a potential molecular switch that mediates the transition from reversible to irreversible AIG.« less

  17. Discovery of genes implicated in whirling disease infection and resistance in rainbow trout using genome-wide expression profiling

    PubMed Central

    Baerwald, Melinda R; Welsh, Amy B; Hedrick, Ronald P; May, Bernie

    2008-01-01

    Background Whirling disease, caused by the pathogen Myxobolus cerebralis, afflicts several salmonid species. Rainbow trout are particularly susceptible and may suffer high mortality rates. The disease is persistent and spreading in hatcheries and natural waters of several countries, including the U.S.A., and the economic losses attributed to whirling disease are substantial. In this study, genome-wide expression profiling using cDNA microarrays was conducted for resistant Hofer and susceptible Trout Lodge rainbow trout strains following pathogen exposure with the primary objective of identifying specific genes implicated in whirling disease resistance. Results Several genes were significantly up-regulated in skin following pathogen exposure for both the resistant and susceptible rainbow trout strains. For both strains, response to infection appears to be linked with the interferon system. Expression profiles for three genes identified with microarrays were confirmed with qRT-PCR. Ubiquitin-like protein 1 was up-regulated over 100 fold and interferon regulating factor 1 was up-regulated over 15 fold following pathogen exposure for both strains. Expression of metallothionein B, which has known roles in inflammation and immune response, was up-regulated over 5 fold in the resistant Hofer strain but was unchanged in the susceptible Trout Lodge strain following pathogen exposure. Conclusion The present study has provided an initial view into the genetic basis underlying immune response and resistance of rainbow trout to the whirling disease parasite. The identified genes have allowed us to gain insight into the molecular mechanisms implicated in salmonid immune response and resistance to whirling disease infection. PMID:18218127

  18. A transcriptome-wide association study of 229,000 women identifies new candidate susceptibility genes for breast cancer.

    PubMed

    Wu, Lang; Shi, Wei; Long, Jirong; Guo, Xingyi; Michailidou, Kyriaki; Beesley, Jonathan; Bolla, Manjeet K; Shu, Xiao-Ou; Lu, Yingchang; Cai, Qiuyin; Al-Ejeh, Fares; Rozali, Esdy; Wang, Qin; Dennis, Joe; Li, Bingshan; Zeng, Chenjie; Feng, Helian; Gusev, Alexander; Barfield, Richard T; Andrulis, Irene L; Anton-Culver, Hoda; Arndt, Volker; Aronson, Kristan J; Auer, Paul L; Barrdahl, Myrto; Baynes, Caroline; Beckmann, Matthias W; Benitez, Javier; Bermisheva, Marina; Blomqvist, Carl; Bogdanova, Natalia V; Bojesen, Stig E; Brauch, Hiltrud; Brenner, Hermann; Brinton, Louise; Broberg, Per; Brucker, Sara Y; Burwinkel, Barbara; Caldés, Trinidad; Canzian, Federico; Carter, Brian D; Castelao, J Esteban; Chang-Claude, Jenny; Chen, Xiaoqing; Cheng, Ting-Yuan David; Christiansen, Hans; Clarke, Christine L; Collée, Margriet; Cornelissen, Sten; Couch, Fergus J; Cox, David; Cox, Angela; Cross, Simon S; Cunningham, Julie M; Czene, Kamila; Daly, Mary B; Devilee, Peter; Doheny, Kimberly F; Dörk, Thilo; Dos-Santos-Silva, Isabel; Dumont, Martine; Dwek, Miriam; Eccles, Diana M; Eilber, Ursula; Eliassen, A Heather; Engel, Christoph; Eriksson, Mikael; Fachal, Laura; Fasching, Peter A; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Flyger, Henrik; Fritschi, Lin; Gabrielson, Marike; Gago-Dominguez, Manuela; Gapstur, Susan M; García-Closas, Montserrat; Gaudet, Mia M; Ghoussaini, Maya; Giles, Graham G; Goldberg, Mark S; Goldgar, David E; González-Neira, Anna; Guénel, Pascal; Hahnen, Eric; Haiman, Christopher A; Håkansson, Niclas; Hall, Per; Hallberg, Emily; Hamann, Ute; Harrington, Patricia; Hein, Alexander; Hicks, Belynda; Hillemanns, Peter; Hollestelle, Antoinette; Hoover, Robert N; Hopper, John L; Huang, Guanmengqian; Humphreys, Keith; Hunter, David J; Jakubowska, Anna; Janni, Wolfgang; John, Esther M; Johnson, Nichola; Jones, Kristine; Jones, Michael E; Jung, Audrey; Kaaks, Rudolf; Kerin, Michael J; Khusnutdinova, Elza; Kosma, Veli-Matti; Kristensen, Vessela N; Lambrechts, Diether; Le Marchand, Loic; Li, Jingmei; Lindström, Sara; Lissowska, Jolanta; Lo, Wing-Yee; Loibl, Sibylle; Lubinski, Jan; Luccarini, Craig; Lux, Michael P; MacInnis, Robert J; Maishman, Tom; Kostovska, Ivana Maleva; Mannermaa, Arto; Manson, JoAnn E; Margolin, Sara; Mavroudis, Dimitrios; Meijers-Heijboer, Hanne; Meindl, Alfons; Menon, Usha; Meyer, Jeffery; Mulligan, Anna Marie; Neuhausen, Susan L; Nevanlinna, Heli; Neven, Patrick; Nielsen, Sune F; Nordestgaard, Børge G; Olopade, Olufunmilayo I; Olson, Janet E; Olsson, Håkan; Peterlongo, Paolo; Peto, Julian; Plaseska-Karanfilska, Dijana; Prentice, Ross; Presneau, Nadege; Pylkäs, Katri; Rack, Brigitte; Radice, Paolo; Rahman, Nazneen; Rennert, Gad; Rennert, Hedy S; Rhenius, Valerie; Romero, Atocha; Romm, Jane; Rudolph, Anja; Saloustros, Emmanouil; Sandler, Dale P; Sawyer, Elinor J; Schmidt, Marjanka K; Schmutzler, Rita K; Schneeweiss, Andreas; Scott, Rodney J; Scott, Christopher G; Seal, Sheila; Shah, Mitul; Shrubsole, Martha J; Smeets, Ann; Southey, Melissa C; Spinelli, John J; Stone, Jennifer; Surowy, Harald; Swerdlow, Anthony J; Tamimi, Rulla M; Tapper, William; Taylor, Jack A; Terry, Mary Beth; Tessier, Daniel C; Thomas, Abigail; Thöne, Kathrin; Tollenaar, Rob A E M; Torres, Diana; Truong, Thérèse; Untch, Michael; Vachon, Celine; Van Den Berg, David; Vincent, Daniel; Waisfisz, Quinten; Weinberg, Clarice R; Wendt, Camilla; Whittemore, Alice S; Wildiers, Hans; Willett, Walter C; Winqvist, Robert; Wolk, Alicja; Xia, Lucy; Yang, Xiaohong R; Ziogas, Argyrios; Ziv, Elad; Dunning, Alison M; Pharoah, Paul D P; Simard, Jacques; Milne, Roger L; Edwards, Stacey L; Kraft, Peter; Easton, Douglas F; Chenevix-Trench, Georgia; Zheng, Wei

    2018-06-18

    The breast cancer risk variants identified in genome-wide association studies explain only a small fraction of the familial relative risk, and the genes responsible for these associations remain largely unknown. To identify novel risk loci and likely causal genes, we performed a transcriptome-wide association study evaluating associations of genetically predicted gene expression with breast cancer risk in 122,977 cases and 105,974 controls of European ancestry. We used data from the Genotype-Tissue Expression Project to establish genetic models to predict gene expression in breast tissue and evaluated model performance using data from The Cancer Genome Atlas. Of the 8,597 genes evaluated, significant associations were identified for 48 at a Bonferroni-corrected threshold of P < 5.82 × 10 -6 , including 14 genes at loci not yet reported for breast cancer. We silenced 13 genes and showed an effect for 11 on cell proliferation and/or colony-forming efficiency. Our study provides new insights into breast cancer genetics and biology.

  19. DupA: a key regulator of the amoebal MAP kinase response to Legionella pneumophila

    PubMed Central

    Li, Zhiru; Dugan, Aisling S.; Bloomfield, Gareth; Skelton, Jason; Ivens, Alasdair; Losick, Vicki; Isberg, Ralph R.

    2009-01-01

    SUMMARY The dupA gene, encoding a putative tyrosine kinase/dual specificity phosphatase (Dusp), was identified in a screen for Dictyostelium discoideum mutants altered in supporting Legionella pneumophila intracellular replication. The absence of dupA resulted in hyperphosphorylation of ERK1, consistent with the loss of a phosphatase activity, as well as degradation of ERK2. ERK1 hyperphosphorylation mimicked the response of this protein after bacterial challenge of wild type amoebae. Similar to Dusps in higher eukaryotic cells, the amoebal dupA gene was induced after bacterial contact, indicating a response of Dusps that is conserved from amoebae to mammals. A large set of genes was misregulated in the dupA− mutant that largely overlaps with genes responding to L. pneumophila infection. Some of the amoebal genes appear to be involved in a response similar to innate immunity in higher eukaryotes, indicating there was misregulation of a conserved response to bacteria. PMID:19748467

  20. Differential Modulation of Photosynthesis, Signaling, and Transcriptional Regulation between Tolerant and Sensitive Tomato Genotypes under Cold Stress

    PubMed Central

    Zhang, Junhong; Wang, Taotao; Li, Hanxia; Zhang, Yuyang; Yu, Chuying; Ye, Zhibiao

    2012-01-01

    The wild species Solanum habrochaites is more cold tolerant than the cultivated tomato (S. lycopersicum). To explore the mechanisms underlying cold tolerance of S. habrochaites, seedlings of S. habrochaites LA1777 introgression lines (ILs), as well as the two parents, were evaluated under low temperature (4°C). The IL LA3969 and its donor parent LA1777 were found to be more cold tolerant than the recurrent parent S. lycopersicum LA4024. The differences in physiology and global gene expression between cold-tolerant (LA1777 and LA3969) and -sensitive (LA4024) genotypes under cold stress were further investigated. Comparative transcriptome analysis identified 1613, 1456, and 1523 cold-responsive genes in LA1777, LA3969, and LA4024, respectively. Gene ontology (GO) term enrichment analysis revealed that more GO biological process terms were significantly enriched among the up-regulated genes in the two tolerant genotypes, whereas more biological processes were significantly repressed by cold stress in the sensitive one. A total of 92 genes with significant differential expression between tolerant and sensitive genotypes under cold stress were identified. Among these, many stress-related GO terms were significantly enriched, such as ‘response to stimulus’ and ‘response to stress’. Moreover, GO terms ‘response to hormone stimulus’, ‘response to reactive oxygen species (ROS)’, and ‘calcium-mediated signaling’ were also overrepresented. Several transcripts involved in hormone or ROS homeostasis were also differentially expressed. ROS, hormones, and calcium as signaling molecules may play important roles in regulating gene expression in response to cold stress. Moreover, the expression of various transcription factors, post-translational proteins, metabolic enzymes, and photosynthesis-related genes was also specifically modulated. These specific modifications may play pivotal roles in conferring cold tolerance in tomato. These results not only provide new insights into the molecular mechanisms of cold tolerance in tomato, but also provide potential candidate genes for genetic improvement. PMID:23226384

  1. Differential pathway dependency discovery associated with drug response across cancer cell lines* | Office of Cancer Genomics

    Cancer.gov

    The effort to personalize treatment plans for cancer patients involves the identification of drug treatments that can effectively target the disease while minimizing the likelihood of adverse reactions. In this study, the gene-expression profile of 810 cancer cell lines and their response data to 368 small molecules from the Cancer Therapeutics Research Portal (CTRP) are analyzed to identify pathways with significant rewiring between genes, or differential gene dependency, between sensitive and non-sensitive cell lines.

  2. Whole-transcriptome response to water stress in a California endemic oak, Quercus lobata.

    PubMed

    Gugger, Paul F; Peñaloza-Ramírez, Juan Manuel; Wright, Jessica W; Sork, Victoria L

    2017-05-01

    Reduced water availability during drought can create major stress for many plant species. Within a species, populations with a history of seasonal drought may have evolved the ability to tolerate drought more than those in areas of high precipitation and low seasonality. In this study, we assessed response to water stress in a California oak species, Quercus lobata Née, by measuring changes in gene expression profiles before and after a simulated drought stress treatment through water deprivation of seedlings in a greenhouse setting. Using whole-transcriptome sequencing from nine samples from three collection localities, we identified which genes are involved in response to drought stress and tested the hypothesis that seedlings sampled from climatically different regions of the species range respond to water stress differently. We observed a surprisingly massive transcriptional response to drought: 35,347 of 68,434 contigs (52%) were differentially expressed before versus after drought treatment, of which 18,111 were down-regulated and 17,236 were up-regulated. Genes functionally associated with abiotic stresses and death were enriched among the up-regulated genes, whereas metabolic and cell part-related genes were enriched among the down-regulated. We found 56 contigs that exhibited significantly different expression responses to the drought treatment among the three populations (treatment × population interaction), suggesting that those genes may be involved in local adaptation to drought stress. These genes have stress response (e.g., WRKY DNA-binding protein 51 and HSP20-like chaperones superfamily protein), metabolic (e.g., phosphoglycerate kinase and protein kinase superfamily protein), transport/transfer (e.g., cationic amino acid transporter 7 and K+ transporter) and regulatory functions (e.g., WRKY51 and Homeodomain-like transcriptional regulator). Baseline expression levels of 1310 unique contigs also differed among pairs of populations, and they were enriched for metabolic and cell part-related genes. Out of the large fraction of the transcriptome that was differentially expressed in response to our drought treatment, we identified several novel genes that are candidates for involvement in local adaptation to drought. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Saccharomyces cerevisiae gene expression changes during rotating wall vessel suspension culture

    NASA Technical Reports Server (NTRS)

    Johanson, Kelly; Allen, Patricia L.; Lewis, Fawn; Cubano, Luis A.; Hyman, Linda E.; Hammond, Timothy G.

    2002-01-01

    This study utilizes Saccharomyces cerevisiae to study genetic responses to suspension culture. The suspension culture system used in this study is the high-aspect-ratio vessel, one type of the rotating wall vessel, that provides a high rate of gas exchange necessary for rapidly dividing cells. Cells were grown in the high-aspect-ratio vessel, and DNA microarray and metabolic analyses were used to determine the resulting changes in yeast gene expression. A significant number of genes were found to be up- or downregulated by at least twofold as a result of rotational growth. By using Gibbs promoter alignment, clusters of genes were examined for promoter elements mediating these genetic changes. Candidate binding motifs similar to the Rap1p binding site and the stress-responsive element were identified in the promoter regions of differentially regulated genes. This study shows that, as in higher order organisms, S. cerevisiae changes gene expression in response to rotational culture and also provides clues for investigations into the signaling pathways involved in gravitational response.

  4. Small RNA-mediated responses to low- and high-temperature stresses in cotton

    PubMed Central

    Wang, Qiongshan; Liu, Nian; Yang, Xiyan; Tu, Lili; Zhang, Xianlong

    2016-01-01

    MicroRNAs (miRNAs) are one class of endogenous non-coding RNAs modulating the expression of target genes involved in plant development and stress tolerance, by degrading mRNA or repressing translation. In this study, small RNA and mRNA degradome sequencing were used to identify low- and high-temperature stress-responsive miRNAs and their targets in cotton (Gossypium hirsutum). Cotton seedlings were treated under different temperature conditions (4, 12, 25, 35, and 42 °C) and then the effects were investigated. In total, 319 known miRNAs and 800 novel miRNAs were identified, and 168 miRNAs were differentially expressed between different treatments. The targets of these miRNAs were further analysed by degradome sequencing. Based on studies from Gene Ontology and Kyoto Encyclopedia of Genes and Genomes, the majority of the miRNAs are from genes that are likely involved in response to hormone stimulus, oxidation-reduction reaction, photosynthesis, plant–pathogen interaction and plant hormone signal transduction pathways. This study provides new insight into the molecular mechanisms of plant response to extreme temperature stresses, and especially the roles of miRNAs under extreme temperatures. PMID:27752116

  5. DEAF-1 regulates immunity gene expression in Drosophila.

    PubMed

    Reed, Darien E; Huang, Xinhua M; Wohlschlegel, James A; Levine, Michael S; Senger, Kate

    2008-06-17

    Immunity genes are activated in the Drosophila fat body by Rel and GATA transcription factors. Here, we present evidence that an additional regulatory factor, deformed epidermal autoregulatory factor-1 (DEAF-1), also contributes to the immune response and is specifically important for the induction of two genes encoding antimicrobial peptides, Metchnikowin (Mtk) and Drosomycin (Drs). The systematic mutagenesis of a minimal Mtk 5' enhancer identified a sequence motif essential for both a response to LPS preparations in S2 cells and activation in the larval fat body in response to bacterial infection. Using affinity chromatography coupled to multidimensional protein identification technology (MudPIT), we identified DEAF-1 as a candidate regulator. DEAF-1 activates the expression of Mtk and Drs promoter-luciferase fusion genes in S2 cells. SELEX assays and footprinting data indicate that DEAF-1 binds to and activates Mtk and Drs regulatory DNAs via a TTCGGBT motif. The insertion of this motif into the Diptericin (Dpt) regulatory region confers DEAF-1 responsiveness to this normally DEAF-1-independent enhancer. The coexpression of DEAF-1 with Dorsal, Dif, and Relish results in the synergistic activation of transcription. We propose that DEAF-1 is a regulator of Drosophila immunity.

  6. Biomphalaria glabrata transcriptome: cDNA microarray profiling identifies resistant- and susceptible-specific gene expression in haemocytes from snail strains exposed to Schistosoma mansoni

    PubMed Central

    Lockyer, Anne E; Spinks, Jenny; Kane, Richard A; Hoffmann, Karl F; Fitzpatrick, Jennifer M; Rollinson, David; Noble, Leslie R; Jones, Catherine S

    2008-01-01

    Background Biomphalaria glabrata is an intermediate snail host for Schistosoma mansoni, one of the important schistosomes infecting man. B. glabrata/S. mansoni provides a useful model system for investigating the intimate interactions between host and parasite. Examining differential gene expression between S. mansoni-exposed schistosome-resistant and susceptible snail lines will identify genes and pathways that may be involved in snail defences. Results We have developed a 2053 element cDNA microarray for B. glabrata containing clones from ORESTES (Open Reading frame ESTs) libraries, suppression subtractive hybridization (SSH) libraries and clones identified in previous expression studies. Snail haemocyte RNA, extracted from parasite-challenged resistant and susceptible snails, 2 to 24 h post-exposure to S. mansoni, was hybridized to the custom made cDNA microarray and 98 differentially expressed genes or gene clusters were identified, 94 resistant-associated and 4 susceptible-associated. Quantitative PCR analysis verified the cDNA microarray results for representative transcripts. Differentially expressed genes were annotated and clustered using gene ontology (GO) terminology and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis. 61% of the identified differentially expressed genes have no known function including the 4 susceptible strain-specific transcripts. Resistant strain-specific expression of genes implicated in innate immunity of invertebrates was identified, including hydrolytic enzymes such as cathepsin L, a cysteine proteinase involved in lysis of phagocytosed particles; metabolic enzymes such as ornithine decarboxylase, the rate-limiting enzyme in the production of polyamines, important in inflammation and infection processes, as well as scavenging damaging free radicals produced during production of reactive oxygen species; stress response genes such as HSP70; proteins involved in signalling, such as importin 7 and copine 1, cytoplasmic intermediate filament (IF) protein and transcription enzymes such as elongation factor 1α and EF-2. Conclusion Production of the first cDNA microarray for profiling gene expression in B. glabrata provides a foundation for expanding our understanding of pathways and genes involved in the snail internal defence system (IDS). We demonstrate resistant strain-specific expression of genes potentially associated with the snail IDS, ranging from signalling and inflammation responses through to lysis of proteinacous products (encapsulated sporocysts or phagocytosed parasite components) and processing/degradation of these targeted products by ubiquitination. PMID:19114004

  7. Biomphalaria glabrata transcriptome: cDNA microarray profiling identifies resistant- and susceptible-specific gene expression in haemocytes from snail strains exposed to Schistosoma mansoni.

    PubMed

    Lockyer, Anne E; Spinks, Jenny; Kane, Richard A; Hoffmann, Karl F; Fitzpatrick, Jennifer M; Rollinson, David; Noble, Leslie R; Jones, Catherine S

    2008-12-29

    Biomphalaria glabrata is an intermediate snail host for Schistosoma mansoni, one of the important schistosomes infecting man. B. glabrata/S. mansoni provides a useful model system for investigating the intimate interactions between host and parasite. Examining differential gene expression between S. mansoni-exposed schistosome-resistant and susceptible snail lines will identify genes and pathways that may be involved in snail defences. We have developed a 2053 element cDNA microarray for B. glabrata containing clones from ORESTES (Open Reading frame ESTs) libraries, suppression subtractive hybridization (SSH) libraries and clones identified in previous expression studies. Snail haemocyte RNA, extracted from parasite-challenged resistant and susceptible snails, 2 to 24 h post-exposure to S. mansoni, was hybridized to the custom made cDNA microarray and 98 differentially expressed genes or gene clusters were identified, 94 resistant-associated and 4 susceptible-associated. Quantitative PCR analysis verified the cDNA microarray results for representative transcripts. Differentially expressed genes were annotated and clustered using gene ontology (GO) terminology and Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway analysis. 61% of the identified differentially expressed genes have no known function including the 4 susceptible strain-specific transcripts. Resistant strain-specific expression of genes implicated in innate immunity of invertebrates was identified, including hydrolytic enzymes such as cathepsin L, a cysteine proteinase involved in lysis of phagocytosed particles; metabolic enzymes such as ornithine decarboxylase, the rate-limiting enzyme in the production of polyamines, important in inflammation and infection processes, as well as scavenging damaging free radicals produced during production of reactive oxygen species; stress response genes such as HSP70; proteins involved in signalling, such as importin 7 and copine 1, cytoplasmic intermediate filament (IF) protein and transcription enzymes such as elongation factor 1alpha and EF-2. Production of the first cDNA microarray for profiling gene expression in B. glabrata provides a foundation for expanding our understanding of pathways and genes involved in the snail internal defence system (IDS). We demonstrate resistant strain-specific expression of genes potentially associated with the snail IDS, ranging from signalling and inflammation responses through to lysis of proteinacous products (encapsulated sporocysts or phagocytosed parasite components) and processing/degradation of these targeted products by ubiquitination.

  8. Identification of genes involved in the ACC-mediated control of root cell elongation in Arabidopsis thaliana

    PubMed Central

    2012-01-01

    Background Along the root axis of Arabidopsis thaliana, cells pass through different developmental stages. In the apical meristem repeated cycles of division increase the numbers of cells. Upon leaving the meristem, these cells pass the transition zone where they are physiologically and mechanically prepared to undergo subsequent rapid elongation. During the process of elongation epidermal cells increase their length by 300% in a couple of hours. When elongation ceases, the cells acquire their final size, shape and functions (in the differentiation zone). Ethylene administered as its precursor 1-aminocyclopropane-1-carboxylic acid (ACC) is capable of inhibiting elongation in a concentration-dependent way. Using a microarray analysis, genes and/or processes involved in this elongation arrest are identified. Results Using a CATMA-microarray analysis performed on control and 3h ACC-treated roots, 240 differentially expressed genes were identified. Quantitative Real-Time RT-PCR analysis of the 10 most up and down regulated genes combined with literature search confirmed the accurateness of the analysis. This revealed that inhibition of cell elongation is, at least partly, caused by restricting the events that under normal growth conditions initiate elongation and by increasing the processes that normally stop cellular elongation at the end of the elongation/onset of differentiation zone. Conclusions ACC interferes with cell elongation in the Arabidopsis thaliana roots by inhibiting cells from entering the elongation process and by immediately stimulating the formation of cross-links in cell wall components, diminishing the remaining elongation capacity. From the analysis of the differentially expressed genes, it becomes clear that many genes identified in this response, are also involved in several other kind of stress responses. This suggests that many responses originate from individual elicitors, but that somewhere in the downstream signaling cascade, these are converged to a ’common pathway’. Furthermore, several potential keyplayers, such as transcription factors and auxin-responsive genes, were identified by the microarray analysis. They await further analysis to reveal their exact role in the control of cell elongation. PMID:23134674

  9. Differences of RNA Expression in the Tendon According to Anatomic Outcomes in Rotator Cuff Repair.

    PubMed

    Ahn, Jin-Ok; Chung, Jin-Young; Kim, Do Hoon; Im, Wooseok; Kim, Sae Hoon

    2017-11-01

    Despite increased understanding of the pathophysiology of rotator cuff tears and the evolution of rotator cuff repair, healing failure remains a substantial problem. The critical roles played by biological factors have been emphasized, but little is known of the implications of gene expression profile differences at the time of repair. To document the relationship between the perioperative gene expression of healed and unhealed rotator cuffs by RNA microarray analysis. Case-control study; Level of evidence, 3. Superior (supraspinatus involvement) and posterosuperior (supraspinatus and infraspinatus involvement) tears were included in the study. Samples of rotator cuff tendons were prospectively collected during rotator cuff surgery. Three samples were harvested at the tendon ends of tears from the anterior, middle (apex), and posterior parts using an arthroscopic punch. Seven patients with an unhealed rotator cuff were matched one-to-one with patients with a healed rotator cuff by sex, age, tear size, and fatty degeneration of rotator cuff muscles. mRNA microarray analysis was used to identify genetic differences between healed and unhealed rotator cuff tendons. Gene ontology and gene association files were obtained from the Gene Ontology Consortium, and the Gene Ontology system in DAVID was used to identify enhanced biological processes. Microarray analyses identified 262 genes that were differentially expressed by at least 1.5-fold between the healed and unhealed groups. Overall, in the healed group, 103 genes were significantly downregulated, and 159 were significantly upregulated. DAVID Functional Annotation Cluster analysis showed that in the healed group, the genes most upregulated were related to the G protein-coupled receptor protein signaling pathway and to the neurological system. On the other hand, the genes most downregulated were related to immune and inflammatory responses. BMP5 was the gene most upregulated in the healed group, and the majority of downregulated genes were involved in the immune/inflammatory response. The downregulation of inflammatory response genes and the upregulation of cell differentiation genes in torn rotator cuffs at the time of surgery are related to rotator cuff healing. These results provide useful baseline information for future biological studies on rotator cuff healing.

  10. Host genetic variation influences gene expression response to rhinovirus infection.

    PubMed

    Çalışkan, Minal; Baker, Samuel W; Gilad, Yoav; Ober, Carole

    2015-04-01

    Rhinovirus (RV) is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs) from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs) in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs), namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5) and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3). The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.

  11. Dehydrin gene expression provides an indicator of low temperature and drought stress: transcriptome-based analysis of barley (Hordeum vulgare L.).

    PubMed

    Tommasini, Livia; Svensson, Jan T; Rodriguez, Edmundo M; Wahid, Abdul; Malatrasi, Marina; Kato, Kenji; Wanamaker, Steve; Resnik, Josh; Close, Timothy J

    2008-11-01

    Low temperature and drought have major influences on plant growth and productivity. To identify barley genes involved in responses to these stresses and to specifically test the hypothesis that the dehydrin (Dhn) multigene family can serve as an indicator of the entire transcriptome response, we investigated the response of barley cv. Morex to: (1) gradual drought over 21 days and (2) low temperature including chilling, freeze-thaw cycles, and deacclimation over 33 days. We found 4,153 genes that responded to at least one component of these two stress regimes, about one fourth of all genes called "present" under any condition. About 44% (1,822 of 4,153) responded specifically to drought, whereas only 3.8% (158 of 4,153) were chilling specific and 2.8% (119 of 4,153) freeze-thaw specific, with 34.1% responsive to freeze-thaw and drought. The intersection between chilling and drought (31.9%) was somewhat smaller than the intersection between freeze-thaw and drought, implying an element of osmotic stress response to freeze-thaw. About 82.4% of the responsive genes were similar to Arabidopsis genes. The expression of 13 barley Dhn genes mirrored the global clustering of all transcripts, with specific combinations of Dhn genes providing an excellent indicator of each stress response. Data from these studies provide a robust reference data set for abiotic stress.

  12. Response of Desulfovibrio vulgaris to Alkaline Stress▿ †

    PubMed Central

    Stolyar, Sergey; He, Qiang; Joachimiak, Marcin P.; He, Zhili; Yang, Zamin Koo; Borglin, Sharon E.; Joyner, Dominique C.; Huang, Katherine; Alm, Eric; Hazen, Terry C.; Zhou, Jizhong; Wall, Judy D.; Arkin, Adam P.; Stahl, David A.

    2007-01-01

    The response of exponentially growing Desulfovibrio vulgaris Hildenborough to pH 10 stress was studied using oligonucleotide microarrays and a study set of mutants with genes suggested by microarray data to be involved in the alkaline stress response deleted. The data showed that the response of D. vulgaris to increased pH is generally similar to that of Escherichia coli but is apparently controlled by unique regulatory circuits since the alternative sigma factors (sigma S and sigma E) contributing to this stress response in E. coli appear to be absent in D. vulgaris. Genes previously reported to be up-regulated in E. coli were up-regulated in D. vulgaris; these genes included three ATPase genes and a tryptophan synthase gene. Transcription of chaperone and protease genes (encoding ATP-dependent Clp and La proteases and DnaK) was also elevated in D. vulgaris. As in E. coli, genes involved in flagellum synthesis were down-regulated. The transcriptional data also identified regulators, distinct from sigma S and sigma E, that are likely part of a D. vulgaris Hildenborough-specific stress response system. Characterization of a study set of mutants with genes implicated in alkaline stress response deleted confirmed that there was protective involvement of the sodium/proton antiporter NhaC-2, tryptophanase A, and two putative regulators/histidine kinases (DVU0331 and DVU2580). PMID:17921288

  13. Transcriptome Profiling of the Pineapple under Low Temperature to Facilitate Its Breeding for Cold Tolerance

    PubMed Central

    Chen, Chengjie; Zhang, Yafeng; Xu, Zhiqiang; Luan, Aiping; Mao, Qi; Feng, Junting; Xie, Tao; Gong, Xue; Wang, Xiaoshuang; Chen, Hao; He, Yehua

    2016-01-01

    The pineapple (Ananas comosus) is cold sensitive. Most cultivars are injured during winter periods, especially in sub-tropical regions. There is a lack of molecular information on the pineapple’s response to cold stress. In this study, high-throughput transcriptome sequencing and gene expression analysis were performed on plantlets of a cold-tolerant genotype of the pineapple cultivar ‘Shenwan’ before and after cold treatment. A total of 1,186 candidate cold responsive genes were identified, and their credibility was confirmed by RT-qPCR. Gene set functional enrichment analysis indicated that genes related to cell wall properties, stomatal closure and ABA and ROS signal transduction play important roles in pineapple cold tolerance. In addition, a protein association network of CORs (cold responsive genes) was predicted, which could serve as an entry point to dissect the complex cold response network. Our study found a series of candidate genes and their association network, which will be helpful to cold stress response studies and pineapple breeding for cold tolerance. PMID:27656892

  14. IL-32 is a molecular marker of a host defense network in human tuberculosis

    PubMed Central

    Montoya, Dennis; Inkeles, Megan S.; Liu, Phillip T.; Realegeno, Susan; Teles, Rosane M. B.; Vaidya, Poorva; Munoz, Marcos A.; Schenk, Mirjam; Swindell, William R.; Chun, Rene; Zavala, Kathryn; Hewison, Martin; Adams, John S.; Horvath, Steve; Pellegrini, Matteo; Bloom, Barry R.; Modlin, Robert L.

    2014-01-01

    Tuberculosis is a leading cause of infectious disease–related death worldwide; however, only 10% of people infected with Mycobacterium tuberculosis develop disease. Factors that contribute to protection could prove to be promising targets for M. tuberculosis therapies. Analysis of peripheral blood gene expression profiles of active tuberculosis patients has identified correlates of risk for disease or pathogenesis. We sought to identify potential human candidate markers of host defense by studying gene expression profiles of macrophages, cells that, upon infection by M. tuberculosis, can mount an antimicrobial response. Weighted gene coexpression network analysis revealed an association between the cytokine interleukin-32 (IL-32) and the vitamin D antimicrobial pathway in a network of interferon-γ– and IL-15–induced “defense response” genes. IL-32 induced the vitamin D–dependent antimicrobial peptides cathelicidin and DEFB4 and to generate antimicrobial activity in vitro, dependent on the presence of adequate 25-hydroxyvitamin D. In addition, the IL-15–induced defense response macrophage gene network was integrated with ranked pairwise comparisons of gene expression from five different clinical data sets of latent compared with active tuberculosis or healthy controls and a coexpression network derived from gene expression in patients with tuberculosis undergoing chemotherapy. Together, these analyses identified eight common genes, including IL-32, as molecular markers of latent tuberculosis and the IL-15–induced gene network. As maintaining M. tuberculosis in a latent state and preventing transition to active disease may represent a form of host resistance, these results identify IL-32 as one functional marker and potential correlate of protection against active tuberculosis. PMID:25143364

  15. Identification of the invertase gene family (INVs) in tea plant and their expression analysis under abiotic stress.

    PubMed

    Qian, Wenjun; Yue, Chuan; Wang, Yuchun; Cao, Hongli; Li, Nana; Wang, Lu; Hao, Xinyuan; Wang, Xinchao; Xiao, Bin; Yang, Yajun

    2016-11-01

    Fourteen invertase genes were identified in the tea plant, all of which were shown to participate in regulating growth and development, as well as in responding to various abiotic stresses. Invertase (INV) can hydrolyze sucrose into glucose and fructose, which plays a principal role in regulating plant growth and development as well as the plants response to various abiotic and biotic stresses. However, currently, there is a lack of reported information, regarding the roles of INVs in either tea plant development or in the tea plants response to various stresses. In this study, 14 INV genes were identified from the transcriptome data of the tea plant (Camellia sinensis (L.) O. Kuntze), and named CsINV1-5 and CsINV7-15. Based on the results of a Blastx search and phylogenetic analysis, the CsINV genes could be clustered into 6 acid invertase (AI) genes and 8 alkaline/neutral invertase (A/N-Inv) genes. The results of tissue-specific expression analysis showed that the transcripts of all the identified CsINV genes are detectable in various tissues. Under various abiotic stress conditions, the expression patterns of the 14 CsINV genes were diverse in both the leaves and roots, and some of them were shown to be significantly expressed. Overall, we hypothesize that the identified CsINV genes all participate in regulating growth and development in the tea plant, and most likely through different signaling pathways that regulate the carbohydrate allocation and the ratio of hexose and sucrose for improving the resistance of the leaves and the roots of the tea plant to various abiotic stresses.

  16. The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses

    PubMed Central

    Bai, Yuling; Sunarti, Sri; Kissoudis, Christos; Visser, Richard G. F.; van der Linden, C. G.

    2018-01-01

    In the field, plants constantly face a plethora of abiotic and biotic stresses that can impart detrimental effects on plants. In response to multiple stresses, plants can rapidly reprogram their transcriptome through a tightly regulated and highly dynamic regulatory network where WRKY transcription factors can act as activators or repressors. WRKY transcription factors have diverse biological functions in plants, but most notably are key players in plant responses to biotic and abiotic stresses. In tomato there are 83 WRKY genes identified. Here we review recent progress on functions of these tomato WRKY genes and their homologs in other plant species, such as Arabidopsis and rice, with a special focus on their involvement in responses to abiotic and biotic stresses. In particular, we highlight WRKY genes that play a role in plant responses to a combination of abiotic and biotic stresses.

  17. RNA-Seq Analysis of the Response of the Halophyte, Mesembryanthemum crystallinum (Ice Plant) to High Salinity

    PubMed Central

    Tsukagoshi, Hironaka; Suzuki, Takamasa; Nishikawa, Kouki; Agarie, Sakae; Ishiguro, Sumie; Higashiyama, Tetsuya

    2015-01-01

    Understanding the molecular mechanisms that convey salt tolerance in plants is a crucial issue for increasing crop yield. The ice plant (Mesembryanthemum crystallinum) is a halophyte that is capable of growing under high salt conditions. For example, the roots of ice plant seedlings continue to grow in 140 mM NaCl, a salt concentration that completely inhibits Arabidopsis thaliana root growth. Identifying the molecular mechanisms responsible for this high level of salt tolerance in a halophyte has the potential of revealing tolerance mechanisms that have been evolutionarily successful. In the present study, deep sequencing (RNAseq) was used to examine gene expression in ice plant roots treated with various concentrations of NaCl. Sequencing resulted in the identification of 53,516 contigs, 10,818 of which were orthologs of Arabidopsis genes. In addition to the expression analysis, a web-based ice plant database was constructed that allows broad public access to the data. The results obtained from an analysis of the RNAseq data were confirmed by RT-qPCR. Novel patterns of gene expression in response to high salinity within 24 hours were identified in the ice plant when the RNAseq data from the ice plant was compared to gene expression data obtained from Arabidopsis plants exposed to high salt. Although ABA responsive genes and a sodium transporter protein (HKT1), are up-regulated and down-regulated respectively in both Arabidopsis and the ice plant; peroxidase genes exhibit opposite responses. The results of this study provide an important first step towards analyzing environmental tolerance mechanisms in a non-model organism and provide a useful dataset for predicting novel gene functions. PMID:25706745

  18. The human oxytocin gene promoter is regulated by estrogens.

    PubMed

    Richard, S; Zingg, H H

    1990-04-15

    Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be restricted to a subpopulation of OT neurons.

  19. Sequential Waves of Gene Expression in Patients with Clinically Defined Dengue Illnesses Reveal Subtle Disease Phases and Predict Disease Severity

    PubMed Central

    Sun, Peifang; García, Josefina; Comach, Guillermo; Vahey, Maryanne T.; Wang, Zhining; Forshey, Brett M.; Morrison, Amy C.; Sierra, Gloria; Bazan, Isabel; Rocha, Claudio; Vilcarromero, Stalin; Blair, Patrick J.; Scott, Thomas W.; Camacho, Daria E.; Ockenhouse, Christian F.; Halsey, Eric S.; Kochel, Tadeusz J.

    2013-01-01

    Background Dengue virus (DENV) infection can range in severity from mild dengue fever (DF) to severe dengue hemorrhagic fever (DHF) or dengue shock syndrome (DSS). Changes in host gene expression, temporally through the progression of DENV infection, especially during the early days, remains poorly characterized. Early diagnostic markers for DHF are also lacking. Methodology/Principal Findings In this study, we investigated host gene expression in a cohort of DENV-infected subjects clinically diagnosed as DF (n = 51) and DHF (n = 13) from Maracay, Venezuela. Blood specimens were collected daily from these subjects from enrollment to early defervescence and at one convalescent time-point. Using convalescent expression levels as baseline, two distinct groups of genes were identified: the “early” group, which included genes associated with innate immunity, type I interferon, cytokine-mediated signaling, chemotaxis, and complement activity peaked at day 0–1 and declined on day 3–4; the second “late” group, comprised of genes associated with cell cycle, emerged from day 4 and peaked at day 5–6. The up-regulation of innate immune response genes coincided with the down-regulation of genes associated with viral replication during day 0–3. Furthermore, DHF patients had lower expression of genes associated with antigen processing and presentation, MHC class II receptor, NK and T cell activities, compared to that of DF patients. These results suggested that the innate and adaptive immunity during the early days of the disease are vital in suppressing DENV replication and in affecting outcome of disease severity. Gene signatures of DHF were identified as early as day 1. Conclusions/Significance Our study reveals a broad and dynamic picture of host responses in DENV infected subjects. Host response to DENV infection can now be understood as two distinct phases with unique transcriptional markers. The DHF signatures identified during day 1–3 may have applications in developing early molecular diagnostics for DHF. PMID:23875036

  20. Gene length as a biological timer to establish temporal transcriptional regulation

    PubMed Central

    Kirkconnell, Killeen S.; Magnuson, Brian; Paulsen, Michelle T.; Lu, Brian; Bedi, Karan; Ljungman, Mats

    2017-01-01

    ABSTRACT Transcriptional timing is inherently influenced by gene length, thus providing a mechanism for temporal regulation of gene expression. While gene size has been shown to be important for the expression timing of specific genes during early development, whether it plays a role in the timing of other global gene expression programs has not been extensively explored. Here, we investigate the role of gene length during the early transcriptional response of human fibroblasts to serum stimulation. Using the nascent sequencing techniques Bru-seq and BruUV-seq, we identified immediate genome-wide transcriptional changes following serum stimulation that were linked to rapid activation of enhancer elements. We identified 873 significantly induced and 209 significantly repressed genes. Variations in gene size allowed for a large group of genes to be simultaneously activated but produce full-length RNAs at different times. The median length of the group of serum-induced genes was significantly larger than the median length of all expressed genes, housekeeping genes, and serum-repressed genes. These gene length relationships were also observed in corresponding mouse orthologs, suggesting that relative gene size is evolutionarily conserved. The sizes of transcription factor and microRNA genes immediately induced after serum stimulation varied dramatically, setting up a cascade mechanism for temporal expression arising from a single activation event. The retention and expansion of large intronic sequences during evolution have likely played important roles in fine-tuning the temporal expression of target genes in various cellular response programs. PMID:28055303

  1. Genome-Wide Identification and Expression Analysis of the KUP Family under Abiotic Stress in Cassava (Manihot esculenta Crantz).

    PubMed

    Ou, Wenjun; Mao, Xiang; Huang, Chao; Tie, Weiwei; Yan, Yan; Ding, Zehong; Wu, Chunlai; Xia, Zhiqiang; Wang, Wenquan; Zhou, Shiyi; Li, Kaimian; Hu, Wei

    2018-01-01

    KT/HAK/KUP (KUP) family is responsible for potassium ion (K + ) transport, which plays a vital role in the response of plants to abiotic stress by maintaining osmotic balance. However, our understanding of the functions of the KUP family in the drought-resistant crop cassava ( Manihot esculenta Crantz) is limited. In the present study, 21 cassava KUP genes ( MeKUPs ) were identified and classified into four clusters based on phylogenetic relationships, conserved motifs, and gene structure analyses. Transcriptome analysis revealed the expression diversity of cassava KUPs in various tissues of three genotypes. Comparative transcriptome analysis showed that the activation of MeKUP genes by drought was more in roots than that in leaves of Arg7 and W14 genotypes, whereas less in roots than that in leaves of SC124 variety. These findings indicate that different cassava genotypes utilize various drought resistance mechanism mediated by KUP genes. Specific KUP genes showed broad upregulation after exposure to salt, osmotic, cold, H 2 O 2 , and abscisic acid (ABA) treatments. Taken together, this study provides insights into the KUP -mediated drought response of cassava at transcription levels and identifies candidate genes that may be utilized in improving crop tolerance to abiotic stress.

  2. Whole genome detection of signature of positive selection in African cattle reveals selection for thermotolerance.

    PubMed

    Taye, Mengistie; Lee, Wonseok; Caetano-Anolles, Kelsey; Dessie, Tadelle; Hanotte, Olivier; Mwai, Okeyo Ally; Kemp, Stephen; Cho, Seoae; Oh, Sung Jong; Lee, Hak-Kyo; Kim, Heebal

    2017-12-01

    As African indigenous cattle evolved in a hot tropical climate, they have developed an inherent thermotolerance; survival mechanisms include a light-colored and shiny coat, increased sweating, and cellular and molecular mechanisms to cope with high environmental temperature. Here, we report the positive selection signature of genes in African cattle breeds which contribute for their heat tolerance mechanisms. We compared the genomes of five indigenous African cattle breeds with the genomes of four commercial cattle breeds using cross-population composite likelihood ratio (XP-CLR) and cross-population extended haplotype homozygosity (XP-EHH) statistical methods. We identified 296 (XP-EHH) and 327 (XP-CLR) positively selected genes. Gene ontology analysis resulted in 41 biological process terms and six Kyoto Encyclopedia of Genes and Genomes pathways. Several genes and pathways were found to be involved in oxidative stress response, osmotic stress response, heat shock response, hair and skin properties, sweat gland development and sweating, feed intake and metabolism, and reproduction functions. The genes and pathways identified directly or indirectly contribute to the superior heat tolerance mechanisms in African cattle populations. The result will improve our understanding of the biological mechanisms of heat tolerance in African cattle breeds and opens an avenue for further study. © 2017 Japanese Society of Animal Science.

  3. A novel heat shock protein alpha 8 (Hspa8) molecular network mediating responses to stress- and ethanol-related behaviors.

    PubMed

    Urquhart, Kyle R; Zhao, Yinghong; Baker, Jessica A; Lu, Ye; Yan, Lei; Cook, Melloni N; Jones, Byron C; Hamre, Kristin M; Lu, Lu

    2016-04-01

    Genetic differences mediate individual differences in susceptibility and responses to stress and ethanol, although, the specific molecular pathways that control these responses are not fully understood. Heat shock protein alpha 8 (Hspa8) is a molecular chaperone and member of the heat shock protein family that plays an integral role in the stress response and that has been implicated as an ethanol-responsive gene. Therefore, we assessed its role in mediating responses to stress and ethanol across varying genetic backgrounds. The hippocampus is an important mediator of these responses, and thus, was examined in the BXD family of mice in this study. We conducted bioinformatic analyses to dissect genetic factors modulating Hspa8 expression, identify downstream targets of Hspa8, and examined its role. Hspa8 is trans-regulated by a gene or genes on chromosome 14 and is part of a molecular network that regulates stress- and ethanol-related behaviors. To determine additional components of this network, we identified direct or indirect targets of Hspa8 and show that these genes, as predicted, participate in processes such as protein folding and organic substance metabolic processes. Two phenotypes that map to the Hspa8 locus are anxiety-related and numerous other anxiety- and/or ethanol-related behaviors significantly correlate with Hspa8 expression. To more directly assay this relationship, we examined differences in gene expression following exposure to stress or alcohol and showed treatment-related differential expression of Hspa8 and a subset of the members of its network. Our findings suggest that Hspa8 plays a vital role in genetic differences in responses to stress and ethanol and their interactions.

  4. Interaction between sleep and the immune response in Drosophila: a role for the NFkappaB relish.

    PubMed

    Williams, Julie A; Sathyanarayanan, Sriram; Hendricks, Joan C; Sehgal, Amita

    2007-04-01

    The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFkappaB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response.

  5. Interaction Between Sleep and the Immune Response in Drosophila: A Role for the NFκB Relish

    PubMed Central

    Williams, Julie A.; Sathyanarayanan, Sriram; Hendricks, Joan C.; Sehgal, Amita

    2010-01-01

    Study Objectives The regulation of sleep is poorly understood. While some molecules, including those involved in inflammatory/immune responses, have been implicated in the control of sleep, their role in this process remains unclear. The Drosophila model for sleep provides a powerful system to identify and test the role of sleep-relevant molecules. Design We conducted an unbiased screen for molecular candidates involved in sleep regulation by analyzing genome-wide changes in gene expression associated with sleep deprivation in Drosophila. To further examine a role of immune-related genes identified in the screen, we performed molecular assays, analysis of sleep behavior in relevant mutant and transgenic flies, and quantitative analysis of the immune response following sleep deprivation. Results A major class of genes that increased expression with sleep deprivation was that involved in the immune response. We found that immune genes were also upregulated during baseline conditions in the cyc01 sleep mutant. Since the expression of an NFκB, Relish, a central player in the inflammatory response, was increased with all manipulations that reduced sleep, we focused on this gene. Flies deficient in, but not lacking, Relish expression exhibited reduced levels of nighttime sleep, supporting a role for Relish in the control of sleep. This mutant phenotype was rescued by expression of a Relish transgene in fat bodies, which are the major site of inflammatory responses in Drosophila. Finally, sleep deprivation also affected the immune response, such that flies deprived of sleep for several hours were more resistant to bacterial infection than those flies not deprived of sleep. Conclusion These results demonstrate a conserved interaction between sleep and the immune system. Genetic manipulation of an immune component alters sleep, and likewise, acute sleep deprivation alters the immune response. PMID:17520783

  6. The identification of key genes and pathways in hepatocellular carcinoma by bioinformatics analysis of high-throughput data.

    PubMed

    Zhang, Chaoyang; Peng, Li; Zhang, Yaqin; Liu, Zhaoyang; Li, Wenling; Chen, Shilian; Li, Guancheng

    2017-06-01

    Liver cancer is a serious threat to public health and has fairly complicated pathogenesis. Therefore, the identification of key genes and pathways is of much importance for clarifying molecular mechanism of hepatocellular carcinoma (HCC) initiation and progression. HCC-associated gene expression dataset was downloaded from Gene Expression Omnibus database. Statistical software R was used for significance analysis of differentially expressed genes (DEGs) between liver cancer samples and normal samples. Gene Ontology (GO) term enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, based on R software, were applied for the identification of pathways in which DEGs significantly enriched. Cytoscape software was for the construction of protein-protein interaction (PPI) network and module analysis to find the hub genes and key pathways. Finally, weighted correlation network analysis (WGCNA) was conducted to further screen critical gene modules with similar expression pattern and explore their biological significance. Significance analysis identified 1230 DEGs with fold change >2, including 632 significantly down-regulated DEGs and 598 significantly up-regulated DEGs. GO term enrichment analysis suggested that up-regulated DEG significantly enriched in immune response, cell adhesion, cell migration, type I interferon signaling pathway, and cell proliferation, and the down-regulated DEG mainly enriched in response to endoplasmic reticulum stress and endoplasmic reticulum unfolded protein response. KEGG pathway analysis found DEGs significantly enriched in five pathways including complement and coagulation cascades, focal adhesion, ECM-receptor interaction, antigen processing and presentation, and protein processing in endoplasmic reticulum. The top 10 hub genes in HCC were separately GMPS, ACACA, ALB, TGFB1, KRAS, ERBB2, BCL2, EGFR, STAT3, and CD8A, which resulted from PPI network. The top 3 gene interaction modules in PPI network enriched in immune response, organ development, and response to other organism, respectively. WGCNA revealed that the confirmed eight gene modules significantly enriched in monooxygenase and oxidoreductase activity, response to endoplasmic reticulum stress, type I interferon signaling pathway, processing, presentation and binding of peptide antigen, cellular response to cadmium and zinc ion, cell locomotion and differentiation, ribonucleoprotein complex and RNA processing, and immune system process, respectively. In conclusion, we identified some key genes and pathways closely related with HCC initiation and progression by a series of bioinformatics analysis on DEGs. These screened genes and pathways provided for a more detailed molecular mechanism underlying HCC occurrence and progression, holding promise for acting as biomarkers and potential therapeutic targets.

  7. Molecular basis of recognition between phytophthora pathogens and their hosts.

    PubMed

    Tyler, Brett M

    2002-01-01

    Recognition is the earliest step in any direct plant-microbe interaction. Recognition between Phytophthora pathogens, which are oomycetes, phylogenetically distinct from fungi, has been studied at two levels. Recognition of the host by the pathogen has focused on recognition of chemical, electrical, and physical features of plant roots by zoospores. Both host-specific factors such as isoflavones, and host-nonspecific factors such as amino acids, calcium, and electrical fields, influence zoospore taxis, encystment, cyst germination, and hyphal chemotropism in guiding the pathogen to potential infection sites. Recognition of the pathogen by the host defense machinery has been analyzed using biochemical and genetic approaches. Biochemical approaches have identified chemical elicitors of host defense responses, and in some cases, their cognate receptors from the host. Some elicitors, such as glucans and fatty acids, have broad host ranges, whereas others such as elicitins have narrow host ranges. Most elicitors identified appear to contribute primarily to basic or nonhost resistance. Genetic analysis has identified host resistance (R) genes and pathogen avirulence (Avr) genes that interact in a gene-for-gene manner. One Phytophthora Avr gene, Avr1b from P. sojae, has been cloned and characterized. It encodes a secreted elicitor that triggers a system-wide defense response in soybean plants carrying the cognate R gene, Rps1b.

  8. Coding and non-coding gene regulatory networks underlie the immune response in liver cirrhosis.

    PubMed

    Gao, Bo; Zhang, Xueming; Huang, Yongming; Yang, Zhengpeng; Zhang, Yuguo; Zhang, Weihui; Gao, Zu-Hua; Xue, Dongbo

    2017-01-01

    Liver cirrhosis is recognized as being the consequence of immune-mediated hepatocyte damage and repair processes. However, the regulation of these immune responses underlying liver cirrhosis has not been elucidated. In this study, we used GEO datasets and bioinformatics methods to established coding and non-coding gene regulatory networks including transcription factor-/lncRNA-microRNA-mRNA, and competing endogenous RNA interaction networks. Our results identified 2224 mRNAs, 70 lncRNAs and 46 microRNAs were differentially expressed in liver cirrhosis. The transcription factor -/lncRNA- microRNA-mRNA network we uncovered that results in immune-mediated liver cirrhosis is comprised of 5 core microRNAs (e.g., miR-203; miR-219-5p), 3 transcription factors (i.e., FOXP3, ETS1 and FOS) and 7 lncRNAs (e.g., ENTS00000671336, ENST00000575137). The competing endogenous RNA interaction network we identified includes a complex immune response regulatory subnetwork that controls the entire liver cirrhosis network. Additionally, we found 10 overlapping GO terms shared by both liver cirrhosis and hepatocellular carcinoma including "immune response" as well. Interestingly, the overlapping differentially expressed genes in liver cirrhosis and hepatocellular carcinoma were enriched in immune response-related functional terms. In summary, a complex gene regulatory network underlying immune response processes may play an important role in the development and progression of liver cirrhosis, and its development into hepatocellular carcinoma.

  9. Long noncoding RNAs responsive to Fusarium oxysporum infection in Arabidopsis thaliana.

    PubMed

    Zhu, Qian-Hao; Stephen, Stuart; Taylor, Jennifer; Helliwell, Chris A; Wang, Ming-Bo

    2014-01-01

    Short noncoding RNAs have been demonstrated to play important roles in regulation of gene expression and stress responses, but the repertoire and functions of long noncoding RNAs (lncRNAs) remain largely unexplored, particularly in plants. To explore the role of lncRNAs in disease resistance, we used a strand-specific RNA-sequencing approach to identify lncRNAs responsive to Fusarium oxysporum infection in Arabidopsis thaliana. Antisense transcription was found in c. 20% of the annotated A. thaliana genes. Several noncoding natural antisense transcripts responsive to F. oxysporum infection were found in genes implicated in disease defense. While the majority of the novel transcriptionally active regions (TARs) were adjacent to annotated genes and could be an extension of the annotated transcripts, 159 novel intergenic TARs, including 20 F. oxysporum-responsive lncTARs, were identified. Ten F. oxysporum-induced lncTARs were functionally characterized using T-DNA insertion or RNA-interference knockdown lines, and five were demonstrated to be related to disease development. Promoter analysis suggests that some of the F. oxysporum-induced lncTARs are direct targets of transcription factor(s) responsive to pathogen attack. Our results demonstrated that strand-specific RNA sequencing is a powerful tool for uncovering hidden levels of transcriptome and that IncRNAs are important components of the antifungal networks in A. thaliana. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

  10. Genes Involved in the Balance between Neuronal Survival and Death during Inflammation

    PubMed Central

    Glezer, Isaias; Chernomoretz, Ariel; David, Samuel; Plante, Marie-Michèle; Rivest, Serge

    2007-01-01

    Glucocorticoids are potent regulators of the innate immune response, and alteration in this inhibitory feedback has detrimental consequences for the neural tissue. This study profiled and investigated functionally candidate genes mediating this switch between cell survival and death during an acute inflammatory reaction subsequent to the absence of glucocorticoid signaling. Oligonucleotide microarray analysis revealed that following lipopolysaccharide (LPS) intracerebral administration at striatum level, more modulated genes presented transcription impairment than exacerbation upon glucocorticoid receptor blockage. Among impaired genes we identified ceruloplasmin (Cp), which plays a key role in iron metabolism and is implicated in a neurodegenative disease. Microglial and endothelial induction of Cp is a natural neuroprotective mechanism during inflammation, because Cp-deficient mice exhibited increased iron accumulation and demyelination when exposed to LPS and neurovascular reactivity to pneumococcal meningitis. This study has identified genes that can play a critical role in programming the innate immune response, helping to clarify the mechanisms leading to protection or damage during inflammatory conditions in the CNS. PMID:17375196

  11. Estrogen receptor alpha regulates expression of the breast cancer 1 associated ring domain 1 (BARD1) gene through intronic DNA sequence.

    PubMed

    Creekmore, Amy L; Ziegler, Yvonne S; Bonéy, Jamie L; Nardulli, Ann M

    2007-03-15

    We have used a chromatin immunoprecipitation (ChIP)-based cloning strategy to isolate and identify genes associated with estrogen receptor alpha (ERalpha) in MCF-7 human breast cancer cells. One of the gene regions isolated was a 288bp fragment from the ninth intron of the breast cancer 1 associated ring domain (BARD1) gene. We demonstrated that ERalpha associated with this region of the endogenous BARD 1 gene in MCF-7 cells, that ERalpha bound to three of five ERE half sites located in the 288bp BARD1 region, and that this 288bp BARD1 region conferred estrogen responsiveness to a heterologous promoter. Importantly, treatment of MCF-7 cells with estrogen increased BARD1 mRNA and protein levels. These findings demonstrate that ChIP cloning strategies can be utilized to successfully isolate regulatory regions that are far removed from the transcription start site and assist in identifying cis elements involved in conferring estrogen responsiveness.

  12. Differentially expressed genes of Tetrahymena thermophila in response to tributyltin (TBT) identified by suppression subtractive hybridization and real time quantitative PCR.

    PubMed

    Feng, Lifang; Miao, Wei; Wu, Yuxuan

    2007-02-15

    Tributyltin (TBT) is widely used as antifouling paints, agriculture biocides, and plastic stabilizers around the world, resulting in great pollution problem in aquatic environments. However, it has been short of the biomonitor to detect TBT in freshwater. We constructed the suppression subtractive hybridization library of Tetrahymena thermophila exposed to TBT, and screened out 101 Expressed Sequence Tags whose expressions were significantly up- or down-regulated with TBT treatment. From this, a series of genes related to the TBT toxicity were discovered, such as glutathione-S-transferase gene (down-regulated), plasma membrane Ca2+ ATPase isoforms 3 gene (up-regulated) and NgoA (up-regulated). Furthermore, their expressions under different concentrations of TBT treatment (0.5-40 ppb) were detected by real time fluorescent quantitative PCR. The differentially expressed genes of T. thermophila in response to TBT were identified, which provide the basic to make Tetrahymena as a sensitive, rapid and convenient TBT biomonitor in freshwater based on rDNA inducible expression system.

  13. Evolutionary conservation of vertebrate notochord genes in the ascidian Ciona intestinalis.

    PubMed

    Kugler, Jamie E; Passamaneck, Yale J; Feldman, Taya G; Beh, Jeni; Regnier, Todd W; Di Gregorio, Anna

    2008-11-01

    To reconstruct a minimum complement of notochord genes evolutionarily conserved across chordates, we scanned the Ciona intestinalis genome using the sequences of 182 genes reported to be expressed in the notochord of different vertebrates and identified 139 candidate notochord genes. For 66 of these Ciona genes expression data were already available, hence we analyzed the expression of the remaining 73 genes and found notochord expression for 20. The predicted products of the newly identified notochord genes range from the transcription factors Ci-XBPa and Ci-miER1 to extracellular matrix proteins. We examined the expression of the newly identified notochord genes in embryos ectopically expressing Ciona Brachyury (Ci-Bra) and in embryos expressing a repressor form of this transcription factor in the notochord, and we found that while a subset of the genes examined are clearly responsive to Ci-Bra, other genes are not affected by alterations in its levels. We provide a first description of notochord genes that are not evidently influenced by the ectopic expression of Ci-Bra and we propose alternative regulatory mechanisms that might control their transcription. Copyright 2008 Wiley-Liss, Inc.

  14. Transcriptome-Level Signatures in Gene Expression and Gene Expression Variability during Bacterial Adaptive Evolution.

    PubMed

    Erickson, Keesha E; Otoupal, Peter B; Chatterjee, Anushree

    2017-01-01

    Antibiotic-resistant bacteria are an increasingly serious public health concern, as strains emerge that demonstrate resistance to almost all available treatments. One factor that contributes to the crisis is the adaptive ability of bacteria, which exhibit remarkable phenotypic and gene expression heterogeneity in order to gain a survival advantage in damaging environments. This high degree of variability in gene expression across biological populations makes it a challenging task to identify key regulators of bacterial adaptation. Here, we research the regulation of adaptive resistance by investigating transcriptome profiles of Escherichia coli upon adaptation to disparate toxins, including antibiotics and biofuels. We locate potential target genes via conventional gene expression analysis as well as using a new analysis technique examining differential gene expression variability. By investigating trends across the diverse adaptation conditions, we identify a focused set of genes with conserved behavior, including those involved in cell motility, metabolism, membrane structure, and transport, and several genes of unknown function. To validate the biological relevance of the observed changes, we synthetically perturb gene expression using clustered regularly interspaced short palindromic repeat (CRISPR)-dCas9. Manipulation of select genes in combination with antibiotic treatment promotes adaptive resistance as demonstrated by an increased degree of antibiotic tolerance and heterogeneity in MICs. We study the mechanisms by which identified genes influence adaptation and find that select differentially variable genes have the potential to impact metabolic rates, mutation rates, and motility. Overall, this work provides evidence for a complex nongenetic response, encompassing shifts in gene expression and gene expression variability, which underlies adaptive resistance. IMPORTANCE Even initially sensitive bacteria can rapidly thwart antibiotic treatment through stress response processes known as adaptive resistance. Adaptive resistance fosters transient tolerance increases and the emergence of mutations conferring heritable drug resistance. In order to extend the applicable lifetime of new antibiotics, we must seek to hinder the occurrence of bacterial adaptive resistance; however, the regulation of adaptation is difficult to identify due to immense heterogeneity emerging during evolution. This study specifically seeks to generate heterogeneity by adapting bacteria to different stresses and then examines gene expression trends across the disparate populations in order to pinpoint key genes and pathways associated with adaptive resistance. The targets identified here may eventually inform strategies for impeding adaptive resistance and prolonging the effectiveness of antibiotic treatment.

  15. Comparative Digital Gene Expression Analysis of Tissue-Cultured Plantlets of Highly Resistant and Susceptible Banana Cultivars in Response to Fusarium oxysporum

    PubMed Central

    Niu, Yuqing; Hu, Bei; Li, Xiaoquan; Chen, Houbin; Šamaj, Jozef; Xu, Chunxiang

    2018-01-01

    Banana Fusarium wilt caused by Fusarium oxysporum f. sp. cubense (Foc) is one of the most destructive soil-borne diseases. In this study, young tissue-cultured plantlets of banana (Musa spp. AAA) cultivars differing in Foc susceptibility were used to reveal their differential responses to this pathogen using digital gene expression (DGE). Data were evaluated by various bioinformatic tools (Venn diagrams, gene ontology (GO) annotation and Kyoto encyclopedia of genes and genomes (KEGG) pathway analyses) and immunofluorescence labelling method to support the identification of gene candidates determining the resistance of banana against Foc. Interestingly, we have identified MaWRKY50 as an important gene involved in both constitutive and induced resistance. We also identified new genes involved in the resistance of banana to Foc, including several other transcription factors (TFs), pathogenesis-related (PR) genes and some genes related to the plant cell wall biosynthesis or degradation (e.g., pectinesterases, β-glucosidases, xyloglucan endotransglucosylase/hydrolase and endoglucanase). The resistant banana cultivar shows activation of PR-3 and PR-4 genes as well as formation of different constitutive cell barriers to restrict spreading of the pathogen. These data suggest new mechanisms of banana resistance to Foc. PMID:29364855

  16. Genome-Wide Identification and Expression Analysis of WRKY Transcription Factors under Multiple Stresses in Brassica napus

    PubMed Central

    He, Yajun; Mao, Shaoshuai; Gao, Yulong; Zhu, Liying; Wu, Daoming; Cui, Yixin; Li, Jiana; Qian, Wei

    2016-01-01

    WRKY transcription factors play important roles in responses to environmental stress stimuli. Using a genome-wide domain analysis, we identified 287 WRKY genes with 343 WRKY domains in the sequenced genome of Brassica napus, 139 in the A sub-genome and 148 in the C sub-genome. These genes were classified into eight groups based on phylogenetic analysis. In the 343 WRKY domains, a total of 26 members showed divergence in the WRKY domain, and 21 belonged to group I. This finding suggested that WRKY genes in group I are more active and variable compared with genes in other groups. Using genome-wide identification and analysis of the WRKY gene family in Brassica napus, we observed genome duplication, chromosomal/segmental duplications and tandem duplication. All of these duplications contributed to the expansion of the WRKY gene family. The duplicate segments that were detected indicated that genome duplication events occurred in the two diploid progenitors B. rapa and B. olearecea before they combined to form B. napus. Analysis of the public microarray database and EST database for B. napus indicated that 74 WRKY genes were induced or preferentially expressed under stress conditions. According to the public QTL data, we identified 77 WRKY genes in 31 QTL regions related to various stress tolerance. We further evaluated the expression of 26 BnaWRKY genes under multiple stresses by qRT-PCR. Most of the genes were induced by low temperature, salinity and drought stress, indicating that the WRKYs play important roles in B. napus stress responses. Further, three BnaWRKY genes were strongly responsive to the three multiple stresses simultaneously, which suggests that these 3 WRKY may have multi-functional roles in stress tolerance and can potentially be used in breeding new rapeseed cultivars. We also found six tandem repeat pairs exhibiting similar expression profiles under the various stress conditions, and three pairs were mapped in the stress related QTL regions, indicating tandem duplicate WRKYs in the adaptive responses to environmental stimuli during the evolution process. Our results provide a framework for future studies regarding the function of WRKY genes in response to stress in B. napus. PMID:27322342

  17. Genome-Wide Identification and Expression Analysis of WRKY Transcription Factors under Multiple Stresses in Brassica napus.

    PubMed

    He, Yajun; Mao, Shaoshuai; Gao, Yulong; Zhu, Liying; Wu, Daoming; Cui, Yixin; Li, Jiana; Qian, Wei

    2016-01-01

    WRKY transcription factors play important roles in responses to environmental stress stimuli. Using a genome-wide domain analysis, we identified 287 WRKY genes with 343 WRKY domains in the sequenced genome of Brassica napus, 139 in the A sub-genome and 148 in the C sub-genome. These genes were classified into eight groups based on phylogenetic analysis. In the 343 WRKY domains, a total of 26 members showed divergence in the WRKY domain, and 21 belonged to group I. This finding suggested that WRKY genes in group I are more active and variable compared with genes in other groups. Using genome-wide identification and analysis of the WRKY gene family in Brassica napus, we observed genome duplication, chromosomal/segmental duplications and tandem duplication. All of these duplications contributed to the expansion of the WRKY gene family. The duplicate segments that were detected indicated that genome duplication events occurred in the two diploid progenitors B. rapa and B. olearecea before they combined to form B. napus. Analysis of the public microarray database and EST database for B. napus indicated that 74 WRKY genes were induced or preferentially expressed under stress conditions. According to the public QTL data, we identified 77 WRKY genes in 31 QTL regions related to various stress tolerance. We further evaluated the expression of 26 BnaWRKY genes under multiple stresses by qRT-PCR. Most of the genes were induced by low temperature, salinity and drought stress, indicating that the WRKYs play important roles in B. napus stress responses. Further, three BnaWRKY genes were strongly responsive to the three multiple stresses simultaneously, which suggests that these 3 WRKY may have multi-functional roles in stress tolerance and can potentially be used in breeding new rapeseed cultivars. We also found six tandem repeat pairs exhibiting similar expression profiles under the various stress conditions, and three pairs were mapped in the stress related QTL regions, indicating tandem duplicate WRKYs in the adaptive responses to environmental stimuli during the evolution process. Our results provide a framework for future studies regarding the function of WRKY genes in response to stress in B. napus.

  18. Identification and expression analysis of cold and freezing stress responsive genes of Brassica oleracea.

    PubMed

    Ahmed, Nasar Uddin; Jung, Hee-Jeong; Park, Jong-In; Cho, Yong-Gu; Hur, Yoonkang; Nou, Ill-Sup

    2015-01-10

    Cold and freezing stress is a major environmental constraint to the production of Brassica crops. Enhancement of tolerance by exploiting cold and freezing tolerance related genes offers the most efficient approach to address this problem. Cold-induced transcriptional profiling is a promising approach to the identification of potential genes related to cold and freezing stress tolerance. In this study, 99 highly expressed genes were identified from a whole genome microarray dataset of Brassica rapa. Blast search analysis of the Brassica oleracea database revealed the corresponding homologous genes. To validate their expression, pre-selected cold tolerant and susceptible cabbage lines were analyzed. Out of 99 BoCRGs, 43 were differentially expressed in response to varying degrees of cold and freezing stress in the contrasting cabbage lines. Among the differentially expressed genes, 18 were highly up-regulated in the tolerant lines, which is consistent with their microarray expression. Additionally, 12 BoCRGs were expressed differentially after cold stress treatment in two contrasting cabbage lines, and BoCRG54, 56, 59, 62, 70, 72 and 99 were predicted to be involved in cold regulatory pathways. Taken together, the cold-responsive genes identified in this study provide additional direction for elucidating the regulatory network of low temperature stress tolerance and developing cold and freezing stress resistant Brassica crops. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Evolutionary and Expression Analyses of the Apple Basic Leucine Zipper Transcription Factor Family

    PubMed Central

    Zhao, Jiao; Guo, Rongrong; Guo, Chunlei; Hou, Hongmin; Wang, Xiping; Gao, Hua

    2016-01-01

    Transcription factors (TFs) play essential roles in the regulatory networks controlling many developmental processes in plants. Members of the basic leucine (Leu) zipper (bZIP) TF family, which is unique to eukaryotes, are involved in regulating diverse processes, including flower and vascular development, seed maturation, stress signaling, and defense responses to pathogens. The bZIP proteins have a characteristic bZIP domain composed of a DNA-binding basic region and a Leu zipper dimerization region. In this study, we identified 112 apple (Malus domestica Borkh) bZIP TF-encoding genes, termed MdbZIP genes. Synteny analysis indicated that segmental and tandem duplication events, as well as whole genome duplication, have contributed to the expansion of the apple bZIP family. The family could be divided into 11 groups based on structural features of the encoded proteins, as well as on the phylogenetic relationship of the apple bZIP proteins to those of the model plant Arabidopsis thaliana (AtbZIP genes). Synteny analysis revealed that several paired MdbZIP genes and AtbZIP gene homologs were located in syntenic genomic regions. Furthermore, expression analyses of group A MdbZIP genes showed distinct expression levels in 10 different organs. Moreover, changes in these expression profiles in response to abiotic stress conditions and various hormone treatments identified MdbZIP genes that were responsive to high salinity and drought, as well as to different phytohormones. PMID:27066030

  20. Evolutionary and Expression Analyses of the Apple Basic Leucine Zipper Transcription Factor Family.

    PubMed

    Zhao, Jiao; Guo, Rongrong; Guo, Chunlei; Hou, Hongmin; Wang, Xiping; Gao, Hua

    2016-01-01

    Transcription factors (TFs) play essential roles in the regulatory networks controlling many developmental processes in plants. Members of the basic leucine (Leu) zipper (bZIP) TF family, which is unique to eukaryotes, are involved in regulating diverse processes, including flower and vascular development, seed maturation, stress signaling, and defense responses to pathogens. The bZIP proteins have a characteristic bZIP domain composed of a DNA-binding basic region and a Leu zipper dimerization region. In this study, we identified 112 apple (Malus domestica Borkh) bZIP TF-encoding genes, termed MdbZIP genes. Synteny analysis indicated that segmental and tandem duplication events, as well as whole genome duplication, have contributed to the expansion of the apple bZIP family. The family could be divided into 11 groups based on structural features of the encoded proteins, as well as on the phylogenetic relationship of the apple bZIP proteins to those of the model plant Arabidopsis thaliana (AtbZIP genes). Synteny analysis revealed that several paired MdbZIP genes and AtbZIP gene homologs were located in syntenic genomic regions. Furthermore, expression analyses of group A MdbZIP genes showed distinct expression levels in 10 different organs. Moreover, changes in these expression profiles in response to abiotic stress conditions and various hormone treatments identified MdbZIP genes that were responsive to high salinity and drought, as well as to different phytohormones.

  1. Induction of Senescence and Identification of Differentially Expressed Genes in Tomato in Response to Monoterpene

    PubMed Central

    Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis

    2013-01-01

    Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759

  2. Solar ultraviolet radiation is necessary to enhance grapevine fruit ripening transcriptional and phenolic responses.

    PubMed

    Carbonell-Bejerano, Pablo; Diago, Maria-Paz; Martínez-Abaigar, Javier; Martínez-Zapater, José M; Tardáguila, Javier; Núñez-Olivera, Encarnación

    2014-07-09

    Ultraviolet (UV) radiation modulates secondary metabolism in the skin of Vitis vinifera L. berries, which affects the final composition of both grapes and wines. The expression of several phenylpropanoid biosynthesis-related genes is regulated by UV radiation in grape berries. However, the complete portion of transcriptome and ripening processes influenced by solar UV radiation in grapes remains unknown. Whole genome arrays were used to identify the berry skin transcriptome modulated by the UV radiation received naturally in a mid-altitude Tempranillo vineyard. UV radiation-blocking and transmitting filters were used to generate the experimental conditions. The expression of 121 genes was significantly altered by solar UV radiation. Functional enrichment analysis of altered transcripts mainly pointed out that secondary metabolism-related transcripts were induced by UV radiation including VvFLS1, VvGT5 and VvGT6 flavonol biosynthetic genes and monoterpenoid biosynthetic genes. Berry skin phenolic composition was also analysed to search for correlation with gene expression changes and UV-increased flavonols accumulation was the most evident impact. Among regulatory genes, novel UV radiation-responsive transcription factors including VvMYB24 and three bHLH, together with known grapevine UV-responsive genes such as VvMYBF1, were identified. A transcriptomic meta-analysis revealed that genes up-regulated by UV radiation in the berry skin were also enriched in homologs of Arabidopsis UVR8 UV-B photoreceptor-dependent UV-B -responsive genes. Indeed, a search of the grapevine reference genomic sequence identified UV-B signalling pathway homologs and among them, VvHY5-1, VvHY5-2 and VvRUP were up-regulated by UV radiation in the berry skin. Results suggest that the UV-B radiation-specific signalling pathway is activated in the skin of grapes grown at mid-altitudes. The biosynthesis and accumulation of secondary metabolites, which are appreciated in winemaking and potentially confer cross-tolerance, were almost specifically triggered. This draws attention to viticultural practices that increase solar UV radiation on vineyards as they may improve grape features.

  3. Genome-Wide Analyses of the NAC Transcription Factor Gene Family in Pepper (Capsicum annuum L.): Chromosome Location, Phylogeny, Structure, Expression Patterns, Cis-Elements in the Promoter, and Interaction Network

    PubMed Central

    Diao, Weiping; Snyder, John C.; Liu, Jinbing; Pan, Baogui; Guo, Guangjun; Ge, Wei; Dawood, Mohammad Hasan Salman Ali

    2018-01-01

    The NAM, ATAF1/2, and CUC2 (NAC) transcription factors form a large plant-specific gene family, which is involved in the regulation of tissue development in response to biotic and abiotic stress. To date, there have been no comprehensive studies investigating chromosomal location, gene structure, gene phylogeny, conserved motifs, or gene expression of NAC in pepper (Capsicum annuum L.). The recent release of the complete genome sequence of pepper allowed us to perform a genome-wide investigation of Capsicum annuum L. NAC (CaNAC) proteins. In the present study, a comprehensive analysis of the CaNAC gene family in pepper was performed, and a total of 104 CaNAC genes were identified. Genome mapping analysis revealed that CaNAC genes were enriched on four chromosomes (chromosomes 1, 2, 3, and 6). In addition, phylogenetic analysis of the NAC domains from pepper, potato, Arabidopsis, and rice showed that CaNAC genes could be clustered into three groups (I, II, and III). Group III, which contained 24 CaNAC genes, was exclusive to the Solanaceae plant family. Gene structure and protein motif analyses showed that these genes were relatively conserved within each subgroup. The number of introns in CaNAC genes varied from 0 to 8, with 83 (78.9%) of CaNAC genes containing two or less introns. Promoter analysis confirmed that CaNAC genes are involved in pepper growth, development, and biotic or abiotic stress responses. Further, the expression of 22 selected CaNAC genes in response to seven different biotic and abiotic stresses [salt, heat shock, drought, Phytophthora capsici, abscisic acid, salicylic acid (SA), and methyl jasmonate (MeJA)] was evaluated by quantitative RT-PCR to determine their stress-related expression patterns. Several putative stress-responsive CaNAC genes, including CaNAC72 and CaNAC27, which are orthologs of the known stress-responsive Arabidopsis gene ANAC055 and potato gene StNAC30, respectively, were highly regulated by treatment with different types of stress. Our results also showed that CaNAC36 plays an important role in the interaction network, interacting with 48 genes. Most of these genes are in the mitogen-activated protein kinase (MAPK) family. Taken together, our results provide a platform for further studies to identify the biological functions of CaNAC genes. PMID:29596349

  4. Liver Transcriptome Analysis of the Large Yellow Croaker (Larimichthys crocea) during Fasting by Using RNA-Seq

    PubMed Central

    Qian, Baoying; Xue, Liangyi; Huang, Hongli

    2016-01-01

    The large yellow croaker (Larimichthys crocea) is an economically important fish species in Chinese mariculture industry. To understand the molecular basis underlying the response to fasting, Illumina HiSeqTM 2000 was used to analyze the liver transcriptome of fasting large yellow croakers. A total of 54,933,550 clean reads were obtained and assembled into 110,364 contigs. Annotation to the NCBI database identified a total of 38,728 unigenes, of which 19,654 were classified into Gene Ontology and 22,683 were found in Kyoto Encyclopedia of Genes and Genomes (KEGG). Comparative analysis of the expression profiles between fasting fish and normal-feeding fish identified a total of 7,623 differentially expressed genes (P < 0.05), including 2,500 upregulated genes and 5,123 downregulated genes. Dramatic differences were observed in the genes involved in metabolic pathways such as fat digestion and absorption, citrate cycle, and glycolysis/gluconeogenesis, and the similar results were also found in the transcriptome of skeletal muscle. Further qPCR analysis confirmed that the genes encoding the factors involved in those pathways significantly changed in terms of expression levels. The results of the present study provide insights into the molecular mechanisms underlying the metabolic response of the large yellow croaker to fasting as well as identified areas that require further investigation. PMID:26967898

  5. Transcriptome analysis of seed dormancy after rinsing and chilling in ornamental peaches (Prunus persica (L.) Batsch).

    PubMed

    Kanjana, Worarad; Suzuki, Tomohiro; Ishii, Kazuo; Kozaki, Toshinori; Iigo, Masayuki; Yamane, Kenji

    2016-08-08

    Ornamental peaches cv. 'Yaguchi' (Prunus persica (L.) Batsch) can be propagated via seeds. The establishment of efficient seed treatments for early germination and seedling growth is required to shorten nursery and breeding periods. It is important, therefore, to identify potential candidate genes responsible for the effects of rinsing and chilling on seed germination. We hypothesized that longer rinsing combined with chilling of seeds can alter the genes expression in related to dormancy and then raise the germination rate in the peach. To date, most molecular studies in peaches have involved structural genomics, and few transcriptome studies of seed germination have been conducted. In this study, we investigated the function of key seed dormancy-related genes using next-generation sequencing to profile the transcriptomes involved in seed dormancy in peaches. De novo assembly and analysis of the transcriptome identified differentially expressed and unique genes present in this fruit. De novo RNA-sequencing of peach was performed using the Illumina Miseq 2000 system. Paired-end sequence from mRNAs generated high quality sequence reads (9,049,964, 10,026,362 and 10,101,918 reads) from 'Yaguchi' peach seeds before rinsed (BR) and after rinsed for 2 or 7 days with a chilling period of 4 weeks (termed 2D4W and 7D4W), respectively. The germination rate of 7D4W was significantly higher than that of 2D4W. In total, we obtained 51,366 unique sequences. Differential expression analysis identified 7752, 8469 and 506 differentially expressed genes from BR vs 2D4W, BR vs 7D4W and 2D4W vs 7D4W libraries respectively, filtered based on p-value and an adjusted false discovery rate of less than 0.05. This study identified genes associated with the rinsing and chilling process that included those associated with phytohormones, the stress response and transcription factors. 7D4W treatment downregulated genes involved in ABA synthesis, catabolism and signaling pathways, which eventually suppressed abscisic acid activity and consequently promoted germination and seedling growth. Stress response genes were also downregulated by the 7D4W treatment, suggesting that this treatment released seeds from endodormancy. Transcription factors were upregulated by the BR and 2D4W treatment, suggesting that they play important roles in maintaining seed dormancy. This work indicated that longer rinsing combined with chilling affects gene expression and germination rate, and identified potential candidate genes responsible for dormancy progression in seeds of 'Yaguchi' peach. The results could be used to develop breeding programs and will aid future functional genomic research in peaches and other fruit trees.

  6. Transcriptional differences between smokers and non-smokers and variance by obesity as a risk factor for human sensitivity to environmental exposures.

    PubMed

    Nikodemova, Maria; Yee, Jeremiah; Carney, Patrick R; Bradfield, Christopher A; Malecki, Kristen Mc

    2018-04-01

    Obesity has been shown to alter response to air pollution and smoking but underlying biological mechanisms are largely unknown and few studies have explored mechanisms by which obesity increases human sensitivity to environmental exposures. Overall study goals were to investigate whole blood gene expression in smokers and non-smokers to examine associations between cigarette smoke and changes in gene expression by obesity status and test for effect modification. Relative fold-change in mRNA expression levels of 84 genes were analyzed using a Toxicity and Stress PCR array among 50 21-54 year old adults. Data on smoking status was confirmed using urinary cotinine levels. Adjusted models included age, gender, white blood cell count and body-mass index. Models comparing gene expression of smokers vs. non-smokers identified six differentially expressed genes associated with smoking after adjustments for covariates. Obesity was associated with 29 genes differentially expressed compared to non-obese. We also identified 9 genes with significant smoking/obesity interactions influencing mRNA levels in adjusted models comparing expression between smokers vs non-smokers for four DNA damage related genes (GADD45A, DDB2, RAD51 and P53), two oxidative stress genes (FTH1, TXN), two hypoxia response genes (BN1P3lL, ARNT), and one gene associated with unfolded protein response (ATF6B). Findings suggest that obesity alters human sensitivity to smoke exposures through several biological pathways by modifying gene expression. Additional studies are needed to fully understand the clinical impact of these effects, but risk assessments should consider underlying phenotypes, such as obesity, that may modulate sensitivity of vulnerable populations to environmental exposures. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Screening of Critical Genes and MicroRNAs in Blood Samples of Patients with Ruptured Intracranial Aneurysms by Bioinformatic Analysis of Gene Expression Data.

    PubMed

    Bo, Lijuan; Wei, Bo; Wang, Zhanfeng; Kong, Daliang; Gao, Zheng; Miao, Zhuang

    2017-09-20

    BACKGROUND This study aimed to identify more potential genes and miRNAs associated with the pathogenesis of intracranial aneurysms (IAs). MATERIAL AND METHODS The dataset of GSE36791 (accession number) was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened for in the blood samples from patients with ruptured IAs and controls, followed by functional and pathway enrichment analyses. In addition, gene co-expression network was constructed and significant modules were extracted from the network by WGCNA R package. Screening for miRNAs that could regulate DEGs in the modules was performed and an analysis of regulatory relationships was conducted. RESULTS A total of 304 DEGs (167 up-regulated and 137 down-regulated genes) were screened for in blood samples from patients with ruptured IAs compared with those from controls. Functional enrichment analysis showed that the up-regulated genes were mainly associated with immune response and the down-regulated DEGs were mainly concerned with the structure of ribosome and translation. Besides, six functional modules were significantly identified, including four modules enriched by up-regulated genes and two modules enriched by down-regulated genes. Thereinto, the blue, yellow, and turquoise modules of up-regulated genes were all linked with immune response. Additionally, 16 miRNAs were predicted to regulate DEGs in the three modules associated with immune response, such as hsa-miR-1304, hsa-miR-33b, hsa-miR-125b, and hsa-miR-125a-5p. CONCLUSIONS Several genes and miRNAs (such as miR-1304, miR-33b, IRS2 and KCNJ2) may take part in the pathogenesis of IAs.

  8. p53 Mediates Vast Gene Expression Changes That Contribute to Poor Chemotherapeutic Response in a Mouse Model of Breast Cancer.

    PubMed

    Tonnessen-Murray, Crystal; Ungerleider, Nathan A; Rao, Sonia G; Wasylishen, Amanda R; Frey, Wesley D; Jackson, James G

    2018-05-28

    p53 is a transcription factor that regulates expression of genes involved in cell cycle arrest, senescence, and apoptosis. TP53 harbors mutations that inactivate its transcriptional activity in roughly 30% of breast cancers, and these tumors are much more likely to undergo a pathological complete response to chemotherapy. Thus, the gene expression program activated by wild-type p53 contributes to a poor response. We used an in vivo genetic model system to comprehensively define the p53- and p21-dependent genes and pathways modulated in tumors following doxorubicin treatment. We identified genes differentially expressed in spontaneous mammary tumors harvested from treated MMTV-Wnt1 mice that respond poorly (Trp53+/+) or favorably (Trp53-null) and those that lack the critical senescence/arrest p53 target gene Cdkn1a. Trp53 wild-type tumors differentially expressed nearly 10-fold more genes than Trp53-null tumors after treatment. Pathway analyses showed that genes involved in cell cycle, senescence, and inflammation were enriched in treated Trp53 wild-type tumors; however, no genes/pathways were identified that adequately explain the superior cell death/tumor regression observed in Trp53-null tumors. Cdkn1a-null tumors that retained arrest capacity (responded poorly) and those that proliferated (responded well) after treatment had remarkably different gene regulation. For instance, Cdkn1a-null tumors that arrested upregulated Cdkn2a (p16), suggesting an alternative, p21-independent route to arrest. Live animal imaging of longitudinal gene expression of a senescence/inflammation gene reporter in Trp53+/+ tumors showed induction during and after chemotherapy treatment, while tumors were arrested, but expression rapidly diminished immediately upon relapse. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Genome-Wide Screening of Genes Showing Altered Expression in Liver Metastases of Human Colorectal Cancers by cDNA Microarray1

    PubMed Central

    Yanagawa, Rempei; Furukawa, Yoichi; Tsunoda, Tatsuhiko; Kitahara, Osamu; Kameyama, Masao; Murata, Kohei; Ishikawa, Osamu; Nakamura, Yusuke

    2001-01-01

    Abstract In spite of intensive and increasingly successful attempts to determine the multiple steps involved in colorectal carcinogenesis, the mechanisms responsible for metastasis of colorectal tumors to the liver remain to be clarified. To identify genes that are candidates for involvement in the metastatic process, we analyzed genome-wide expression profiles of 10 primary colorectal cancers and their corresponding metastatic lesions by means of a cDNA microarray consisting of 9121 human genes. This analysis identified 40 genes whose expression was commonly upregulated in metastatic lesions, and 7 that were commonly downregulated. The upregulated genes encoded proteins involved in cell adhesion, or remodeling of the actin cytoskeleton. Investigation of the functions of more of the altered genes should improve our understanding of metastasis and may identify diagnostic markers and/or novel molecular targets for prevention or therapy of metastatic lesions. PMID:11687950

  10. Genetic and genome-wide transcriptomic analyses identify co-regulation of oxidative response and hormone transcript abundance with vitamin C content in tomato fruit.

    PubMed

    Lima-Silva, Viviana; Rosado, Abel; Amorim-Silva, Vitor; Muñoz-Mérida, Antonio; Pons, Clara; Bombarely, Aureliano; Trelles, Oswaldo; Fernández-Muñoz, Rafael; Granell, Antonio; Valpuesta, Victoriano; Botella, Miguel Ángel

    2012-05-14

    L-ascorbic acid (AsA; vitamin C) is essential for all living plants where it functions as the main hydrosoluble antioxidant. It has diverse roles in the regulation of plant cell growth and expansion, photosynthesis, and hormone-regulated processes. AsA is also an essential component of the human diet, being tomato fruit one of the main sources of this vitamin. To identify genes responsible for AsA content in tomato fruit, transcriptomic studies followed by clustering analysis were applied to two groups of fruits with contrasting AsA content. These fruits were identified after AsA profiling of an F8 Recombinant Inbred Line (RIL) population generated from a cross between the domesticated species Solanum lycopersicum and the wild relative Solanum pimpinellifollium. We found large variability in AsA content within the RIL population with individual RILs with up to 4-fold difference in AsA content. Transcriptomic analysis identified genes whose expression correlated either positively (PVC genes) or negatively (NVC genes) with the AsA content of the fruits. Cluster analysis using SOTA allowed the identification of subsets of co-regulated genes mainly involved in hormones signaling, such as ethylene, ABA, gibberellin and auxin, rather than any of the known AsA biosynthetic genes. Data mining of the corresponding PVC and NVC orthologs in Arabidopis databases identified flagellin and other ROS-producing processes as cues resulting in differential regulation of a high percentage of the genes from both groups of co-regulated genes; more specifically, 26.6% of the orthologous PVC genes, and 15.5% of the orthologous NVC genes were induced and repressed, respectively, under flagellin22 treatment in Arabidopsis thaliana. Results here reported indicate that the content of AsA in red tomato fruit from our selected RILs are not correlated with the expression of genes involved in its biosynthesis. On the contrary, the data presented here supports that AsA content in tomato fruit co-regulates with genes involved in hormone signaling and they are dependent on the oxidative status of the fruit.

  11. Discovery of stimulation-responsive immune enhancers with CRISPR activation

    PubMed Central

    Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; Van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander

    2017-01-01

    The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues1–3. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption4–6, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa)7 to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs. PMID:28854172

  12. Discovery of stimulation-responsive immune enhancers with CRISPR activation.

    PubMed

    Simeonov, Dimitre R; Gowen, Benjamin G; Boontanrart, Mandy; Roth, Theodore L; Gagnon, John D; Mumbach, Maxwell R; Satpathy, Ansuman T; Lee, Youjin; Bray, Nicolas L; Chan, Alice Y; Lituiev, Dmytro S; Nguyen, Michelle L; Gate, Rachel E; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M; Mitros, Therese; Ray, Graham J; Curie, Gemma L; Naddaf, Nicki; Chu, Julia S; Ma, Hong; Boyer, Eric; Van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R; Schumann, Kathrin; Daly, Mark J; Farh, Kyle K; Ansel, K Mark; Ye, Chun J; Greenleaf, William J; Anderson, Mark S; Bluestone, Jeffrey A; Chang, Howard Y; Corn, Jacob E; Marson, Alexander

    2017-09-07

    The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa) to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (T H 17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs.

  13. Toxicogenomics and cancer risk assessment: a framework for key event analysis and dose-response assessment for nongenotoxic carcinogens.

    PubMed

    Bercu, Joel P; Jolly, Robert A; Flagella, Kelly M; Baker, Thomas K; Romero, Pedro; Stevens, James L

    2010-12-01

    In order to determine a threshold for nongenotoxic carcinogens, the traditional risk assessment approach has been to identify a mode of action (MOA) with a nonlinear dose-response. The dose-response for one or more key event(s) linked to the MOA for carcinogenicity allows a point of departure (POD) to be selected from the most sensitive effect dose or no-effect dose. However, this can be challenging because multiple MOAs and key events may exist for carcinogenicity and oftentimes extensive research is required to elucidate the MOA. In the present study, a microarray analysis was conducted to determine if a POD could be identified following short-term oral rat exposure with two nongenotoxic rodent carcinogens, fenofibrate and methapyrilene, using a benchmark dose analysis of genes aggregated in Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways and Gene Ontology (GO) biological processes, which likely encompass key event(s) for carcinogenicity. The gene expression response for fenofibrate given to rats for 2days was consistent with its MOA and known key events linked to PPARα activation. The temporal response from daily dosing with methapyrilene demonstrated biological complexity with waves of pathways/biological processes occurring over 1, 3, and 7days; nonetheless, the benchmark dose values were consistent over time. When comparing the dose-response of toxicogenomic data to tumorigenesis or precursor events, the toxicogenomics POD was slightly below any effect level. Our results suggest that toxicogenomic analysis using short-term studies can be used to identify a threshold for nongenotoxic carcinogens based on evaluation of potential key event(s) which then can be used within a risk assessment framework. Copyright © 2010 Elsevier Inc. All rights reserved.

  14. Discovery of stimulation-responsive immune enhancers with CRISPR activation

    NASA Astrophysics Data System (ADS)

    Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K.; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander

    2017-09-01

    The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa) to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs.

  15. Levetiracetam attenuates hippocampal expression of synaptic plasticity-related immediate early and late response genes in amygdala-kindled rats

    PubMed Central

    2010-01-01

    Background The amygdala-kindled rat is a model for human temporal lobe epilepsy and activity-dependent synaptic plasticity. Hippocampal RNA isolated from amygdala-kindled rats at different kindling stages was analyzed to identify kindling-induced genes. Furthermore, effects of the anti-epileptic drug levetiracetam on kindling-induced gene expression were examined. Results Cyclooxygenase-2 (Cox-2), Protocadherin-8 (Pcdh8) and TGF-beta-inducible early response gene-1 (TIEG1) were identified and verified as differentially expressed transcripts in the hippocampus of kindled rats by in situ hybridization and quantitative RT-PCR. In addition, we identified a panel of 16 additional transcripts which included Arc, Egr3/Pilot, Homer1a, Ania-3, MMP9, Narp, c-fos, NGF, BDNF, NT-3, Synaptopodin, Pim1 kinase, TNF-α, RGS2, Egr2/krox-20 and β-A activin that were differentially expressed in the hippocampus of amygdala-kindled rats. The list consists of many synaptic plasticity-related immediate early genes (IEGs) as well as some late response genes encoding transcription factors, neurotrophic factors and proteins that are known to regulate synaptic remodelling. In the hippocampus, induction of IEG expression was dependent on the afterdischarge (AD) duration. Levetiracetam, 40 mg/kg, suppressed the development of kindling measured as severity of seizures and AD duration. In addition, single animal profiling also showed that levetiracetam attenuated the observed kindling-induced IEG expression; an effect that paralleled the anti-epileptic effect of the drug on AD duration. Conclusions The present study provides mRNA expression data that suggest that levetiracetam attenuates expression of genes known to regulate synaptic remodelling. In the kindled rat, levetiracetam does so by shortening the AD duration thereby reducing the seizure-induced changes in mRNA expression in the hippocampus. PMID:20105316

  16. Transcriptome-wide identification of salt-responsive members of the WRKY gene family in Gossypium aridum.

    PubMed

    Fan, Xinqi; Guo, Qi; Xu, Peng; Gong, YuanYong; Shu, Hongmei; Yang, Yang; Ni, Wanchao; Zhang, Xianggui; Shen, Xinlian

    2015-01-01

    WRKY transcription factors are plant-specific, zinc finger-type transcription factors. The WRKY superfamily is involved in abiotic stress responses in many crops including cotton, a major fiber crop that is widely cultivated and consumed throughout the world. Salinity is an important abiotic stress that results in considerable yield losses. In this study, we identified 109 WRKY genes (GarWRKYs) in a salt-tolerant wild cotton species Gossypium aridum from transcriptome sequencing data to elucidate the roles of these factors in cotton salt tolerance. According to their structural features, the predicted members were divided into three groups (Groups I-III), as previously described for Arabidopsis. Furthermore, 28 salt-responsive GarWRKY genes were identified from digital gene expression data and subjected to real-time quantitative RT-PCR analysis. The expression patterns of most GarWRKY genes revealed by this analysis are in good agreement with those revealed by RNA-Seq analysis. RT-PCR analysis revealed that 27 GarWRKY genes were expressed in roots and one was exclusively expressed in roots. Analysis of gene orthology and motif compositions indicated that WRKY members from Arabidopsis, rice and soybean generally shared the similar motifs within the same subgroup, suggesting they have the similar function. Overexpression-GarWRKY17 and -GarWRKY104 in Arabidopsis revealed that they could positively regulate salt tolerance of transgenic Arabidopsis during different development stages. The comprehensive data generated in this study provide a platform for elucidating the functions of WRKY transcription factors in salt tolerance of G. aridum. In addition, GarWRKYs related to salt tolerance identified in this study will be potential candidates for genetic improvement of cultivated cotton salt stress tolerance.

  17. Involvement of potato (Solanum tuberosum L.) MKK6 in response to potato virus Y.

    PubMed

    Lazar, Ana; Coll, Anna; Dobnik, David; Baebler, Spela; Bedina-Zavec, Apolonija; Zel, Jana; Gruden, Kristina

    2014-01-01

    Mitogen-activated protein kinase (MAPK) cascades have crucial roles in the regulation of plant development and in plant responses to stress. Plant recognition of pathogen-associated molecular patterns or pathogen-derived effector proteins has been shown to trigger activation of several MAPKs. This then controls defence responses, including synthesis and/or signalling of defence hormones and activation of defence related genes. The MAPK cascade genes are highly complex and interconnected, and thus the precise signalling mechanisms in specific plant-pathogen interactions are still not known. Here we investigated the MAPK signalling network involved in immune responses of potato (Solanum tuberosum L.) to Potato virus Y, an important potato pathogen worldwide. Sequence analysis was performed to identify the complete MAPK kinase (MKK) family in potato, and to identify those regulated in the hypersensitive resistance response to Potato virus Y infection. Arabidopsis has 10 MKK family members, of which we identified five in potato and tomato (Solanum lycopersicum L.), and eight in Nicotiana benthamiana. Among these, StMKK6 is the most strongly regulated gene in response to Potato virus Y. The salicylic acid treatment revealed that StMKK6 is regulated by the hormone that is in agreement with the salicylic acid-regulated domains found in the StMKK6 promoter. The involvement of StMKK6 in potato defence response was confirmed by localisation studies, where StMKK6 accumulated strongly only in Potato-virus-Y-infected plants, and predominantly in the cell nucleus. Using a yeast two-hybrid method, we identified three StMKK6 targets downstream in the MAPK cascade: StMAPK4_2, StMAPK6 and StMAPK13. These data together provide further insight into the StMKK6 signalling module and its involvement in plant defence.

  18. Involvement of Potato (Solanum tuberosum L.) MKK6 in Response to Potato virus Y

    PubMed Central

    Lazar, Ana; Coll, Anna; Dobnik, David; Baebler, Špela; Bedina-Zavec, Apolonija; Žel, Jana; Gruden, Kristina

    2014-01-01

    Mitogen-activated protein kinase (MAPK) cascades have crucial roles in the regulation of plant development and in plant responses to stress. Plant recognition of pathogen-associated molecular patterns or pathogen-derived effector proteins has been shown to trigger activation of several MAPKs. This then controls defence responses, including synthesis and/or signalling of defence hormones and activation of defence related genes. The MAPK cascade genes are highly complex and interconnected, and thus the precise signalling mechanisms in specific plant–pathogen interactions are still not known. Here we investigated the MAPK signalling network involved in immune responses of potato (Solanum tuberosum L.) to Potato virus Y, an important potato pathogen worldwide. Sequence analysis was performed to identify the complete MAPK kinase (MKK) family in potato, and to identify those regulated in the hypersensitive resistance response to Potato virus Y infection. Arabidopsis has 10 MKK family members, of which we identified five in potato and tomato (Solanum lycopersicum L.), and eight in Nicotiana benthamiana. Among these, StMKK6 is the most strongly regulated gene in response to Potato virus Y. The salicylic acid treatment revealed that StMKK6 is regulated by the hormone that is in agreement with the salicylic acid-regulated domains found in the StMKK6 promoter. The involvement of StMKK6 in potato defence response was confirmed by localisation studies, where StMKK6 accumulated strongly only in Potato-virus-Y-infected plants, and predominantly in the cell nucleus. Using a yeast two-hybrid method, we identified three StMKK6 targets downstream in the MAPK cascade: StMAPK4_2, StMAPK6 and StMAPK13. These data together provide further insight into the StMKK6 signalling module and its involvement in plant defence. PMID:25111695

  19. RNA-Seq analysis of Citrus reticulata in the early stages of Xylella fastidiosa infection reveals auxin-related genes as a defense response.

    PubMed

    Rodrigues, Carolina M; de Souza, Alessandra A; Takita, Marco A; Kishi, Luciano T; Machado, Marcos A

    2013-10-03

    Citrus variegated chlorosis (CVC), caused by Xylella fastidiosa, is one the most important citrus diseases, and affects all varieties of sweet orange (Citrus sinensis L. Osb). On the other hand, among the Citrus genus there are different sources of resistance against X. fastidiosa. For these species identifying these defense genes could be an important step towards obtaining sweet orange resistant varieties through breeding or genetic engineering. To assess these genes we made use of mandarin (C. reticulata Blanco) that is known to be resistant to CVC and shares agronomical characteristics with sweet orange. Thus, we investigated the gene expression in Ponkan mandarin at one day after infection with X. fastidiosa, using RNA-seq. A set of genes considered key elements in the resistance was used to confirm its regulation in mandarin compared with the susceptible sweet orange. Gene expression analysis of mock inoculated and infected tissues of Ponkan mandarin identified 667 transcripts repressed and 724 significantly induced in the later. Among the induced transcripts, we identified genes encoding proteins similar to Pattern Recognition Receptors. Furthermore, many genes involved in secondary metabolism, biosynthesis and cell wall modification were upregulated as well as in synthesis of abscisic acid, jasmonic acid and auxin. This work demonstrated that the defense response to the perception of bacteria involves cell wall modification and activation of hormone pathways, which probably lead to the induction of other defense-related genes. We also hypothesized the induction of auxin-related genes indicates that resistant plants initially recognize X. fastidiosa as a necrotrophic pathogen.

  20. Differential gene expression of wheat progeny with contrasting levels of transpiration efficiency.

    PubMed

    Xue, Gang-Ping; McIntyre, C Lynne; Chapman, Scott; Bower, Neil I; Way, Heather; Reverter, Antonio; Clarke, Bryan; Shorter, Ray

    2006-08-01

    High water use efficiency or transpiration efficiency (TE) in wheat is a desirable physiological trait for increasing grain yield under water-limited environments. The identification of genes associated with this trait would facilitate the selection for genotypes with higher TE using molecular markers. We performed an expression profiling (microarray) analysis of approximately 16,000 unique wheat ESTs to identify genes that were differentially expressed between wheat progeny lines with contrasting TE levels from a cross between Quarrion (high TE) and Genaro 81 (low TE). We also conducted a second microarray analysis to identify genes responsive to drought stress in wheat leaves. Ninety-three genes that were differentially expressed between high and low TE progeny lines were identified. One fifth of these genes were markedly responsive to drought stress. Several potential growth-related regulatory genes, which were down-regulated by drought, were expressed at a higher level in the high TE lines than the low TE lines and are potentially associated with a biomass production component of the Quarrion-derived high TE trait. Eighteen of the TE differentially expressed genes were further analysed using quantitative RT-PCR on a separate set of plant samples from those used for microarray analysis. The expression levels of 11 of the 18 genes were positively correlated with the high TE trait, measured as carbon isotope discrimination (Delta(13)C). These data indicate that some of these TE differentially expressed genes are candidates for investigating processes that underlie the high TE trait or for use as expression quantitative trait loci (eQTLs) for TE.

  1. Transcriptome profiling and expression analyses of genes critical to wheat adaptation to low temperature

    USDA-ARS?s Scientific Manuscript database

    Background: To identify the genes involved in the development of low temperature (LT) tolerance in hexaploid wheat, we examined the global changes in expression in response to cold of the 55,052 potentially unique genes represented in the Affymetrix Wheat Genome microarray. We compared the expressi...

  2. Transcriptome analysis and identification of significantly differentially expressed genes in Holstein calves subjected to severe thermal stress

    NASA Astrophysics Data System (ADS)

    Srikanth, Krishnamoorthy; Lee, Eunjin; Kwan, Anam; Lim, Youngjo; Lee, Junyep; Jang, Gulwon; Chung, Hoyoung

    2017-11-01

    RNA-Seq analysis was used to characterize transcriptome response of Holstein calves to thermal stress. A total of eight animals aged between 2 and 3 months were randomly selected and subjected to thermal stress corresponding to a temperature humidity index of 95 in an environmentally controlled house for 12 h consecutively for 3 days. A set of 15,787 unigenes were found to be expressed and after a threshold of threefold change, and a Q value <0.05; 502, 394, and 376 genes were found to be differentially expressed on days 1, 2, and 3 out of which 343, 261 and 256 genes were upregulated and 159, 133, and 120 genes were downregulated. Only 356 genes out of these were expressed on all 3 days, and only they were considered as significantly differentially expressed. KEGG pathway analysis revealed that ten pathways were significantly enriched; the top two among them were protein processing in endoplasmic reticulum and MAPK signaling pathways. These results suggest that thermal stress triggered a complex response in Holstein calves and the animals adjusted their physiological and metabolic processes to survive. Many of the genes identified in this study have not been previously reported to be involved in thermal stress response. The results of this study extend our understanding of the animal's response to thermal stress and some of the identified genes may prove useful in the efforts to breed Holstein cattle with superior thermotolerance, which might help in minimizing production loss due to thermal stress.

  3. Prediction of response to preoperative chemoradiotherapy and establishment of individualized therapy in advanced rectal cancer.

    PubMed

    Nakao, Toshihiro; Iwata, Takashi; Hotchi, Masanori; Yoshikawa, Kozo; Higashijima, Jun; Nishi, Masaaki; Takasu, Chie; Eto, Shohei; Teraoku, Hiroki; Shimada, Mitsuo

    2015-10-01

    Preoperative chemoradiotherapy (CRT) has become the standard treatment for patients with locally advanced rectal cancer. However, no specific biomarker has been identified to predict a response to preoperative CRT. The aim of the present study was to assess the gene expression patterns of patients with advanced rectal cancer to predict their responses to preoperative CRT. Fifty-nine rectal cancer patients were subjected to preoperative CRT. Patients were randomly assigned to receive CRT with tegafur/gimeracil/oteracil (S-1 group, n=30) or tegafur-uracil (UFT group, n=29). Gene expression changes were studied with cDNA and miRNA microarray. The association between gene expression and response to CRT was evaluated. cDNA microarray showed that 184 genes were significantly differentially expressed between the responders and the non‑responders in the S-1 group. Comparatively, 193 genes were significantly differentially expressed in the responders in the UFT group. TBX18 upregulation was common to both groups whereas BTNL8, LOC375010, ADH1B, HRASLS2, LOC284232, GCNT3 and ALDH1A2 were significantly differentially lower in both groups when compared with the non-responders. Using miRNA microarray, we found that 7 and 16 genes were significantly differentially expressed between the responders and non-responders in the S-1 and UFT groups, respectively. miR-223 was significantly higher in the responders in the S-1 group and tended to be higher in the responders in the UFT group. The present study identified several genes likely to be useful for establishing individualized therapies for patients with rectal cancer.

  4. Genome-wide analysis of drought induced gene expression changes in flax (Linum usitatissimum).

    PubMed

    Dash, Prasanta K; Cao, Yongguo; Jailani, Abdul K; Gupta, Payal; Venglat, Prakash; Xiang, Daoquan; Rai, Rhitu; Sharma, Rinku; Thirunavukkarasu, Nepolean; Abdin, Malik Z; Yadava, Devendra K; Singh, Nagendra K; Singh, Jas; Selvaraj, Gopalan; Deyholos, Mike; Kumar, Polumetla Ananda; Datla, Raju

    2014-01-01

    A robust phenotypic plasticity to ward off adverse environmental conditions determines performance and productivity in crop plants. Flax (linseed), is an important cash crop produced for natural textile fiber (linen) or oilseed with many health promoting products. This crop is prone to drought stress and yield losses in many parts of the world. Despite recent advances in drought research in a number of important crops, related progress in flax is very limited. Since, response of this plant to drought stress has not been addressed at the molecular level; we conducted microarray analysis to capture transcriptome associated with induced drought in flax. This study identified 183 differentially expressed genes (DEGs) associated with diverse cellular, biophysical and metabolic programs in flax. The analysis also revealed especially the altered regulation of cellular and metabolic pathways governing photosynthesis. Additionally, comparative transcriptome analysis identified a plethora of genes that displayed differential regulation both spatially and temporally. These results revealed co-regulated expression of 26 genes in both shoot and root tissues with implications for drought stress response. Furthermore, the data also showed that more genes are upregulated in roots compared to shoots, suggesting that roots may play important and additional roles in response to drought in flax. With prolonged drought treatment, the number of DEGs increased in both tissue types. Differential expression of selected genes was confirmed by qRT-PCR, thus supporting the suggested functional association of these intrinsic genes in maintaining growth and homeostasis in response to imminent drought stress in flax. Together the present study has developed foundational and new transcriptome data sets for drought stress in flax.

  5. Functional architecture of Escherichia coli: new insights provided by a natural decomposition approach.

    PubMed

    Freyre-González, Julio A; Alonso-Pavón, José A; Treviño-Quintanilla, Luis G; Collado-Vides, Julio

    2008-10-27

    Previous studies have used different methods in an effort to extract the modular organization of transcriptional regulatory networks. However, these approaches are not natural, as they try to cluster strongly connected genes into a module or locate known pleiotropic transcription factors in lower hierarchical layers. Here, we unravel the transcriptional regulatory network of Escherichia coli by separating it into its key elements, thus revealing its natural organization. We also present a mathematical criterion, based on the topological features of the transcriptional regulatory network, to classify the network elements into one of two possible classes: hierarchical or modular genes. We found that modular genes are clustered into physiologically correlated groups validated by a statistical analysis of the enrichment of the functional classes. Hierarchical genes encode transcription factors responsible for coordinating module responses based on general interest signals. Hierarchical elements correlate highly with the previously studied global regulators, suggesting that this could be the first mathematical method to identify global regulators. We identified a new element in transcriptional regulatory networks never described before: intermodular genes. These are structural genes that integrate, at the promoter level, signals coming from different modules, and therefore from different physiological responses. Using the concept of pleiotropy, we have reconstructed the hierarchy of the network and discuss the role of feedforward motifs in shaping the hierarchical backbone of the transcriptional regulatory network. This study sheds new light on the design principles underpinning the organization of transcriptional regulatory networks, showing a novel nonpyramidal architecture composed of independent modules globally governed by hierarchical transcription factors, whose responses are integrated by intermodular genes.

  6. Data mining reveals a network of early-response genes as a consensus signature of drug-induced in vitro and in vivo toxicity.

    PubMed

    Zhang, J D; Berntenis, N; Roth, A; Ebeling, M

    2014-06-01

    Gene signatures of drug-induced toxicity are of broad interest, but they are often identified from small-scale, single-time point experiments, and are therefore of limited applicability. To address this issue, we performed multivariate analysis of gene expression, cell-based assays, and histopathological data in the TG-GATEs (Toxicogenomics Project-Genomics Assisted Toxicity Evaluation system) database. Data mining highlights four genes-EGR1, ATF3, GDF15 and FGF21-that are induced 2 h after drug administration in human and rat primary hepatocytes poised to eventually undergo cytotoxicity-induced cell death. Modelling and simulation reveals that these early stress-response genes form a functional network with evolutionarily conserved structure and intrinsic dynamics. This is underlined by the fact that early induction of this network in vivo predicts drug-induced liver and kidney pathology with high accuracy. Our findings demonstrate the value of early gene-expression signatures in predicting and understanding compound-induced toxicity. The identified network can empower first-line tests that reduce animal use and costs of safety evaluation.

  7. A novel mutation of the beta myosin heavy chain gene responsible for familial hypertrophic cardiomyopathy.

    PubMed

    Wang, Juan; Xu, Shi-Jie; Zhou, Hua; Wang, Li-Jie; Hu, Bo; Fang, Fang; Zhang, Xu-Min; Luo, Yi-Wei; He, Xiao-Yan; Zhuang, Shao-Wei; Li, Xin-Ming; Liu, Zhong-Ming; Hu, Da-Yi

    2009-09-01

    Hypertrophic cardiomyopathy (HCM) is the most common inherited cardiac disorder and shows high variability in genetic heterogeneity and phenotypic characteristics. The genetic etiology responsible for HCM in many individuals remains unclear. This instigation was sought to identify novel genetic determinants for familial hypertrophic cardiomyopathy. Six unrelated Chinese families with HCM were studied. For each of the 13 established HCM-susceptibility genes, 3 to 5 microsatellite markers were selected to perform genotyping and haplotype analysis. The linked genes were sequenced. Haplotype analyses on candidate genetic loci revealed cosegregation of the gene beta-myosin heavy chain (MYH7) with HCM in a single family. A novel double heterozygous missense mutation of Ala26Val plus Arg719Trp in MYH7 was subsequently identified by sequencing in this family and was associated with a severe phenotype of HCM. The novel double mutation of Ala26Val plus Arg719Trp in MYH7 identified in a Chinese family highlights the remarkable genetic heterogeneity of HCM, which provides important information for genetic counseling, accurate diagnosis, prognostic evaluation, and appropriate clinical management. Copyright 2009 Wiley Periodicals, Inc.

  8. Identification of the gene for Nance-Horan syndrome (NHS).

    PubMed

    Brooks, S P; Ebenezer, N D; Poopalasundaram, S; Lehmann, O J; Moore, A T; Hardcastle, A J

    2004-10-01

    The disease intervals for Nance-Horan syndrome (NHS [MIM 302350]) and X linked congenital cataract (CXN) overlap on Xp22. To identify the gene or genes responsible for these diseases. Families with NHS were ascertained. The refined locus for CXN was used to focus the search for candidate genes, which were screened by polymerase chain reaction and direct sequencing of potential exons and intron-exon splice sites. Genomic structures and homologies were determined using bioinformatics. Expression studies were undertaken using specific exonic primers to amplify human fetal cDNA and mouse RNA. A novel gene NHS, with no known function, was identified as causative for NHS. Protein truncating mutations were detected in all three NHS pedigrees, but no mutation was identified in a CXN family, raising the possibility that NHS and CXN may not be allelic. The NHS gene forms a new gene family with a closely related novel gene NHS-Like1 (NHSL1). NHS and NHSL1 lie in paralogous duplicated chromosomal intervals on Xp22 and 6q24, and NHSL1 is more broadly expressed than NHS in human fetal tissues. This study reports the independent identification of the gene causative for Nance-Horan syndrome and extends the number of mutations identified.

  9. Exome Sequencing and Linkage Analysis Identified Novel Candidate Genes in Recessive Intellectual Disability Associated with Ataxia.

    PubMed

    Jazayeri, Roshanak; Hu, Hao; Fattahi, Zohreh; Musante, Luciana; Abedini, Seyedeh Sedigheh; Hosseini, Masoumeh; Wienker, Thomas F; Ropers, Hans Hilger; Najmabadi, Hossein; Kahrizi, Kimia

    2015-10-01

    Intellectual disability (ID) is a neuro-developmental disorder which causes considerable socio-economic problems. Some ID individuals are also affected by ataxia, and the condition includes different mutations affecting several genes. We used whole exome sequencing (WES) in combination with homozygosity mapping (HM) to identify the genetic defects in five consanguineous families among our cohort study, with two affected children with ID and ataxia as major clinical symptoms. We identified three novel candidate genes, RIPPLY1, MRPL10, SNX14, and a new mutation in known gene SURF1. All are autosomal genes, except RIPPLY1, which is located on the X chromosome. Two are housekeeping genes, implicated in transcription and translation regulation and intracellular trafficking, and two encode mitochondrial proteins. The pathogenesis of these variants was evaluated by mutation classification, bioinformatic methods, review of medical and biological relevance, co-segregation studies in the particular family, and a normal population study. Linkage analysis and exome sequencing of a small number of affected family members is a powerful new technique which can be used to decrease the number of candidate genes in heterogenic disorders such as ID, and may even identify the responsible gene(s).

  10. Genome-Wide Analysis of the PYL Gene Family and Identification of PYL Genes That Respond to Abiotic Stress in Brassica napus

    PubMed Central

    Di, Feifei; Jian, Hongju; Wang, Tengyue; Chen, Xueping; Ding, Yiran; Du, Hai; Li, Jiana; Liu, Liezhao

    2018-01-01

    Abscisic acid (ABA) is an endogenous phytohormone that plays important roles in the regulation of plant growth, development, and stress responses. The pyrabactin resistance 1-like (PYR/PYL) protein is a core regulatory component of ABA signaling networks in plants. However, no details regarding this family in Brassica napus are available. Here, 46 PYLs were identified in the B. napus genome. Based on phylogenetic analysis, BnPYR1 and BnPYL1-3 belong to subfamily I, BnPYL7-10 belong to subfamily II, and BnPYL4-6 and BnPYL11-13 belong to subfamily III. Analysis of BnPYL conserved motifs showed that every subfamily contained four common motifs. By predicting cis-elements in the promoters, we found that all BnPYL members contained hormone- and stress-related elements and that expression levels of most BnPYLs were relatively higher in seeds at the germination stage than those in other organs or at other developmental stages. Gene Ontology (GO) enrichment showed that BnPYL genes mainly participate in responses to stimuli. To identify crucial PYLs mediating the response to abiotic stress in B. napus, expression changes in 14 BnPYL genes were determined by quantitative real-time RT-PCR after drought, heat, and salinity treatments, and identified BnPYR1-3, BnPYL1-2, and BnPYL7-2 in respond to abiotic stresses. The findings of this study lay a foundation for further investigations of PYL genes in B. napus. PMID:29534558

  11. Pas de deux: An Intricate Dance of Anther Smut and Its Host.

    PubMed

    San Toh, Su; Chen, Zehua; Rouchka, Eric C; Schultz, David J; Cuomo, Christina A; Perlin, Michael H

    2018-02-02

    The successful interaction between pathogen/parasite and host requires a delicate balance between fitness of the former and survival of the latter. To optimize fitness a parasite/pathogen must effectively create an environment conducive to reproductive success, while simultaneously avoiding or minimizing detrimental host defense response. The association between Microbotryum lychnidis-dioicae and its host Silene latifolia serves as an excellent model to examine such interactions. This fungus is part of a species complex that infects species of the Caryophyllaceae, replacing pollen with the fungal spores. In the current study, transcriptome analyses of the fungus and its host were conducted during discrete stages of bud development so as to identify changes in fungal gene expression that lead to spore development and to identify changes associated with infection in the host plant. In contrast to early biotrophic phase stages of infection for the fungus, the latter stages involve tissue necrosis and in the case of infected female flowers, further changes in the developmental program in which the ovary aborts and a pseudoanther is produced. Transcriptome analysis via Illumina RNA sequencing revealed enrichment of fungal genes encoding small secreted proteins, with hallmarks of effectors and genes found to be relatively unique to the Microbotryum species complex. Host gene expression analyses also identified interesting sets of genes up-regulated, including those involving stress response, host defense response, and several agamous-like MADS-box genes (AGL61 and AGL80), predicted to interact and be involved in male gametophyte development. Copyright © 2018 Toh et al.

  12. Transcriptome profiling to identify ATRA-responsive genes in human iPSC-derived endoderm for high-throughput point of departure analysis (SOT Annual Meeting)

    EPA Science Inventory

    Toxicological tipping points occur at chemical concentrations that overwhelm a cell’s adaptive response leading to permanent effects. We focused on retinoid signaling in differentiating endoderm to identify developmental pathways for tipping point analysis. Human induced pluripot...

  13. Genome-Wide Identification and Analysis of Biotic and Abiotic Stress Regulation of C4 Photosynthetic Pathway Genes in Rice.

    PubMed

    Muthusamy, Senthilkumar K; Lenka, Sangram K; Katiyar, Amit; Chinnusamy, Viswanathan; Singh, Ashok K; Bansal, Kailash C

    2018-06-19

    Photosynthetic fixation of CO 2 is more efficient in C 4 than in C 3 plants. Rice is a C 3 plant and a potential target for genetic engineering of the C 4 pathway. It is known that genes encoding C 4 enzymes are present in C 3 plants. However, no systematic analysis has been conducted to determine if these C 4 gene family members are expressed in diverse rice genotypes. In this study, we identified 15 genes belonging to the five C 4 gene families in rice genome through BLAST search using known maize C 4 photosynthetic pathway genes. Phylogenetic relationship of rice C 4 photosynthetic pathway genes and their isoforms with other grass genomes (Brachypodium, maize, Sorghum and Setaria), showed that these genes were highly conserved across grass genomes. Spatiotemporal, hormone, and abiotic stress specific expression pattern of the identified genes revealed constitutive as well as inductive responses of the C 4 photosynthetic pathway in different tissues and developmental stages of rice. Expression levels of C 4 specific gene family members in flag leaf during tillering stage were quantitatively analyzed in five rice genotypes covering three species, viz. Oryza sativa, ssp. japonica (cv. Nipponbare), Oryza sativa, ssp. indica (cv IR64, Swarna), and two wild species Oryza barthii and Oryza australiensis. The results showed that all the identified genes expressed in rice and exhibited differential expression pattern during different growth stages, and in response to biotic and abiotic stress conditions and hormone treatments. Our study concludes that C 4 photosynthetic pathway genes present in rice play a crucial role in stress regulation and might act as targets for C 4 pathway engineering via CRISPR-mediated breeding.

  14. Identification of key genes associated with the effect of estrogen on ovarian cancer using microarray analysis.

    PubMed

    Zhang, Shi-tao; Zuo, Chao; Li, Wan-nan; Fu, Xue-qi; Xing, Shu; Zhang, Xiao-ping

    2016-02-01

    To identify key genes related to the effect of estrogen on ovarian cancer. Microarray data (GSE22600) were downloaded from Gene Expression Omnibus. Eight estrogen and seven placebo treatment samples were obtained using a 2 × 2 factorial designs, which contained 2 cell lines (PEO4 and 2008) and 2 treatments (estrogen and placebo). Differentially expressed genes were identified by Bayesian methods, and the genes with P < 0.05 and |log2FC (fold change)| ≥0.5 were chosen as cut-off criterion. Differentially co-expressed genes (DCGs) and differentially regulated genes (DRGs) were, respectively, identified by DCe function and DRsort function in DCGL package. Topological structure analysis was performed on the important transcriptional factors (TFs) and genes in transcriptional regulatory network using tYNA. Functional enrichment analysis was, respectively, performed for DEGs and the important genes using Gene Ontology and KEGG databases. In total, 465 DEGs were identified. Functional enrichment analysis of DEGs indicated that ACVR2B, LTBP1, BMP7 and MYC involved in TGF-beta signaling pathway. The 2285 DCG pairs and 357 DRGs were identified. Topological structure analysis showed that 52 important TFs and 65 important genes were identified. Functional enrichment analysis of the important genes showed that TP53 and MLH1 participated in DNA damage response and the genes (ACVR2B, LTBP1, BMP7 and MYC) involved in TGF-beta signaling pathway. TP53, MLH1, ACVR2B, LTBP1 and BMP7 might participate in the pathogenesis of ovarian cancer.

  15. Differential Responses of Soleus and Plantaris Muscle Fibers to Overloading

    NASA Astrophysics Data System (ADS)

    Kawano, Fuminori; Shibaguchi, Tsubasa; Ohira, Takashi; Nakai, Naoya; Ohira, Yoshinobu

    2013-02-01

    Responses of slow and fast fibers in soleus and plantaris muscles of adult rats to overloading by the tendon transection of synergists were studied. Overloading-related hypertrophy was noted in the slow fibers of plantaris and soleus, although the magnitude was greater in plantaris. Five genes with minor expression in slow soleus muscle were identified by microarray analysis. Base-line expressions of these genes in slow fibers of plantaris were also low. Further, repressive effects of overloading on these genes were seen in some fast fibers of plantaris, not in whole plantaris and soleus. The data suggested that the repression of particular genes might be related to the pronounced morphological response of fibers expressing type II, including I+II, myosin heavy chain (MyHC), although these genes with lower base-line expression in slow fibers did not respond to overloading.

  16. Ossification of the posterior longitudinal ligament related genes identification using microarray gene expression profiling and bioinformatics analysis.

    PubMed

    He, Hailong; Mao, Lingzhou; Xu, Peng; Xi, Yanhai; Xu, Ning; Xue, Mingtao; Yu, Jiangming; Ye, Xiaojian

    2014-01-10

    Ossification of the posterior longitudinal ligament (OPLL) is a kind of disease with physical barriers and neurological disorders. The objective of this study was to explore the differentially expressed genes (DEGs) in OPLL patient ligament cells and identify the target sites for the prevention and treatment of OPLL in clinic. Gene expression data GSE5464 was downloaded from Gene Expression Omnibus; then DEGs were screened by limma package in R language, and changed functions and pathways of OPLL cells compared to normal cells were identified by DAVID (The Database for Annotation, Visualization and Integrated Discovery); finally, an interaction network of DEGs was constructed by string. A total of 1536 DEGs were screened, with 31 down-regulated and 1505 up-regulated genes. Response to wounding function and Toll-like receptor signaling pathway may involve in the development of OPLL. Genes, such as PDGFB, PRDX2 may involve in OPLL through response to wounding function. Toll-like receptor signaling pathway enriched genes such as TLR1, TLR5, and TLR7 may involve in spine cord injury in OPLL. PIK3R1 was the hub gene in the network of DEGs with the highest degree; INSR was one of the most closely related genes of it. OPLL related genes screened by microarray gene expression profiling and bioinformatics analysis may be helpful for elucidating the mechanism of OPLL. © 2013.

  17. Diversification, phylogeny and evolution of auxin response factor (ARF) family: insights gained from analyzing maize ARF genes.

    PubMed

    Wang, Yijun; Deng, Dexiang; Shi, Yating; Miao, Nan; Bian, Yunlong; Yin, Zhitong

    2012-03-01

    Auxin response factors (ARFs), member of the plant-specific B3 DNA binding superfamily, target specifically to auxin response elements (AuxREs) in promoters of primary auxin-responsive genes and heterodimerize with Aux/IAA proteins in auxin signaling transduction cascade. In previous research, we have isolated and characterized maize Aux/IAA genes in whole-genome scale. Here, we report the comprehensive analysis of ARF genes in maize. A total of 36 ARF genes were identified and validated from the B73 maize genome through an iterative strategy. Thirty-six maize ARF genes are distributed in all maize chromosomes except chromosome 7. Maize ARF genes expansion is mainly due to recent segmental duplications. Maize ARF proteins share one B3 DNA binding domain which consists of seven-stranded β sheets and two short α helixes. Twelve maize ARFs with glutamine-rich middle regions could be as activators in modulating expression of auxin-responsive genes. Eleven maize ARF proteins are lack of homo- and heterodimerization domains. Putative cis-elements involved in phytohormones and light signaling responses, biotic and abiotic stress adaption locate in promoters of maize ARF genes. Expression patterns vary greatly between clades and sister pairs of maize ARF genes. The B3 DNA binding and auxin response factor domains of maize ARF proteins are primarily subjected to negative selection during selective sweep. The mixed selective forces drive the diversification and evolution of genomic regions outside of B3 and ARF domains. Additionally, the dicot-specific proliferation of ARF genes was detected. Comparative genomics analysis indicated that maize, sorghum and rice duplicate chromosomal blocks containing ARF homologs are highly syntenic. This study provides insights into the distribution, phylogeny and evolution of ARF gene family.

  18. Changes in Global Transcriptional Profiling of Women Following Obesity Surgery Bypass.

    PubMed

    Pinhel, Marcela Augusta de Souza; Noronha, Natalia Yumi; Nicoletti, Carolina Ferreira; de Oliveira, Bruno Affonso Parente; Cortes-Oliveira, Cristiana; Pinhanelli, Vitor Caressato; Salgado Junior, Wilson; Machry, Ana Julia; da Silva Junior, Wilson Araújo; Souza, Dorotéia Rossi Silva; Marchini, Júlio Sérgio; Nonino, Carla Barbosa

    2018-01-01

    Differential gene expression in peripheral blood mononuclear cells (PBMCs) after Roux-en-Y gastric bypass (RYGB) is poorly characterized. Markers of these processes may provide a deeper understanding of the mechanisms that underlie these events. The main goal of this study was to identify changes in PBMC gene expression in women with obesity before and 6 months after RYGB-induced weight loss. The ribonucleic acid (RNA) of PBMCs from 13 obese women was analyzed before and 6 months after RYGB; the RNA of PBMCs from nine healthy women served as control. The gene expression levels were determined by microarray analysis. Significant differences in gene expression were validated by real-time quantitative polymerase chain reaction (RT-qPCR). Microarray analysis for comparison of the pre- and postoperative periods showed that 1366 genes were differentially expressed genes (DEGs). The main pathways were related to gene transcription; lipid, energy, and glycide metabolism; inflammatory and immunological response; cell differentiation; oxidative stress regulation; response to endogenous and exogenous stimuli; substrate oxidation; mTOR signaling pathway; interferon signaling; mitogen-activated protein kinases (MAPK), cAMP response element binding protein (CREB1), heat shock factor 1 (HSF1), and sterol regulatory element binding protein 1c (SREBP-1c) gene expression; adipocyte differentiation; and methylation. Six months after bariatric surgery and significant weight loss, many molecular pathways involved in obesity and metabolic diseases change. These findings are an important tool to identify potential targets for therapeutic intervention and clinical practice of nutritional genomics in obesity.

  19. Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

    PubMed

    Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

  20. Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

    PubMed Central

    Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

Top