Identifying Multiple Populations in M71 using CN
NASA Astrophysics Data System (ADS)
Gerber, Jeffrey M.; Friel, Eileen D.; Vesperini, Enrico
2018-01-01
It is now well established that globular clusters (GCs) host multiple stellar populations characterized by differences in several light elements. While these populations have been found in nearly all GCs, we still lack an entirely successful model to explain their formation. A key constraint to these models is the detailed pattern of light element abundances seen among the populations; different techniques for identifying these populations probe different elements and do not always yield the same results. We study a large sample of stars in the GC M71 for light elements C and N, using the CN and CH band strength to identify multiple populations. Our measurements come from low-resolution spectroscopy obtained with the WIYN-3.5m telescope for ~150 stars from the tip of the red-giant branch down to the main-sequence turn-off. The large number of stars and broad spatial coverage of our sample (out to ~3.5 half-light radii) allows us to carry out a comprehensive characterization of the multiple populations in M71. We use a combination of the various spectroscopic and photometric indicators to draw a more complete picture of the properties of the populations and to investigate the consistency of classifications using different techniques.
Identifying the Transgender Population in the Medicare Program
Proctor, Kimberly; Haffer, Samuel C.; Ewald, Erin; Hodge, Carla; James, Cara V.
2016-01-01
Abstract Purpose: To identify and describe the transgender population in the Medicare program using administrative data. Methods: Using a combination of International Classification of Diseases ninth edition (ICD-9) codes relating to transsexualism and gender identity disorder, we analyzed 100% of the 2013 Centers for Medicare & Medicaid Services (CMS) Medicare Fee-For-Service (FFS) “final action” claims from both institutional and noninstitutional providers (∼1 billion claims) to identify individuals who may be transgender Medicare beneficiaries. To confirm, we developed and applied a multistage validation process. Results: Four thousand ninety-eight transgender beneficiaries were identified, of which ∼90% had confirmatory diagnoses, billing codes, or evidence of a hormone prescription. In general, the racial, ethnic, and geographic distribution of the Medicare transgender population tends to reflect the broader Medicare population. However, age, original entitlement status, and disease burden of the transgender population appear substantially different. Conclusions: Using a variety of claims information, ranging from claims history to additional diagnoses, billing modifiers, and hormone prescriptions, we demonstrate that administrative data provide a valuable resource for identifying a lower bound of the Medicare transgender population. In addition, we provide a baseline description of the diversity and disease burden of the population and a framework for future research. PMID:28861539
O'Donnell, Peter H.; Gamazon, Eric; Zhang, Wei; Stark, Amy L.; Kistner-Griffin, Emily O.; Huang, R. Stephanie; Dolan, M. Eileen
2010-01-01
Objectives Clinical studies show that Asians (ASN) are more susceptible to toxicities associated with platinum-containing regimens. We hypothesized that studying ASN as an `enriched phenotype' population could enable the discovery of novel genetic determinants of platinum susceptibility. Methods Using well-genotyped lymphoblastoid cell lines from the HapMap, we determined cisplatin and carboplatin cytotoxicity phenotypes (IC50s) for ASN, Caucasians (CEU), and Africans (YRI). IC50s were used in genome-wide association studies. Results ASN were most sensitive to platinums, corroborating clinical findings. ASN genome-wide association studies produced 479 single-nucleotide polymorphisms (SNPs) associating with cisplatin susceptibility and 199 with carboplatin susceptibility (P<10−4). Considering only the most significant variants (P< 9.99 × 10−6), backwards elimination was then used to identify reduced-model SNPs, which robustly described the drug phenotypes within ASN. These SNPs comprised highly descriptive genetic signatures of susceptibility, with 12 SNPs explaining more than 95% of the susceptibility phenotype variation for cisplatin, and eight SNPs approximately 75% for carboplatin. To determine the possible function of these variants in ASN, the SNPs were tested for association with differential expression of target genes. SNPs were highly associated with the expression of multiple target genes, and notably, the histone H3 family was implicated for both drugs, suggesting a platinum-class mechanism. Histone H3 has repeatedly been described as regulating the formation of platinum-DNA adducts, but this is the first evidence that specific genetic variants might mediate these interactions in a pharmacogenetic manner. Finally, to determine whether any ASN-identified SNPs might also be important in other human populations, we interrogated all 479/199 SNPs for association with platinum susceptibility in an independent combined CEU/YRI population. Three unique SNPs
Different level of population differentiation among human genes.
Wu, Dong-Dong; Zhang, Ya-Ping
2011-01-14
During the colonization of the world, after dispersal out of African, modern humans encountered changeable environments and substantial phenotypic variations that involve diverse behaviors, lifestyles and cultures, were generated among the different modern human populations. Here, we study the level of population differentiation among different populations of human genes. Intriguingly, genes involved in osteoblast development were identified as being enriched with higher FST SNPs, a result consistent with the proposed role of the skeletal system in accounting for variation among human populations. Genes involved in the development of hair follicles, where hair is produced, were also found to have higher levels of population differentiation, consistent with hair morphology being a distinctive trait among human populations. Other genes that showed higher levels of population differentiation include those involved in pigmentation, spermatid, nervous system and organ development, and some metabolic pathways, but few involved with the immune system. Disease-related genes demonstrate excessive SNPs with lower levels of population differentiation, probably due to purifying selection. Surprisingly, we find that Mendelian-disease genes appear to have a significant excessive of SNPs with high levels of population differentiation, possibly because the incidence and susceptibility of these diseases show differences among populations. As expected, microRNA regulated genes show lower levels of population differentiation due to purifying selection. Our analysis demonstrates different level of population differentiation among human populations for different gene groups.
Huckins, Laura M; Boraska, Vesna; Franklin, Christopher S; Floyd, James A B; Southam, Lorraine; Sullivan, Patrick F; Bulik, Cynthia M; Collier, David A; Tyler-Smith, Chris; Zeggini, Eleftheria; Tachmazidou, Ioanna
2014-10-01
The Wellcome Trust Case Control Consortium 3 anorexia nervosa genome-wide association scan includes 2907 cases from 15 different populations of European origin genotyped on the Illumina 670K chip. We compared methods for identifying population stratification, and suggest list of markers that may help to counter this problem. It is usual to identify population structure in such studies using only common variants with minor allele frequency (MAF) >5%; we find that this may result in highly informative SNPs being discarded, and suggest that instead all SNPs with MAF >1% may be used. We established informative axes of variation identified via principal component analysis and highlight important features of the genetic structure of diverse European-descent populations, some studied for the first time at this scale. Finally, we investigated the substructure within each of these 15 populations and identified SNPs that help capture hidden stratification. This work can provide information regarding the designing and interpretation of association results in the International Consortia.
Ko, Wen-Ya; Rajan, Prianka; Gomez, Felicia; Scheinfeldt, Laura; An, Ping; Winkler, Cheryl A.; Froment, Alain; Nyambo, Thomas B.; Omar, Sabah A.; Wambebe, Charles; Ranciaro, Alessia; Hirbo, Jibril B.; Tishkoff, Sarah A.
2013-01-01
Disease susceptibility can arise as a consequence of adaptation to infectious disease. Recent findings have suggested that higher rates of chronic kidney disease (CKD) in individuals with recent African ancestry might be attributed to two risk alleles (G1 and G2) at the serum-resistance-associated (SRA)-interacting-domain-encoding region of APOL1. These two alleles appear to have arisen adaptively, possibly as a result of their protective effects against human African trypanosomiasis (HAT), or African sleeping sickness. In order to explore the distribution of potential functional variation at APOL1, we studied nucleotide variation in 187 individuals across ten geographically and genetically diverse African ethnic groups with exposure to two Trypanosoma brucei subspecies that cause HAT. We observed unusually high levels of nonsynonymous polymorphism in the regions encoding the functional domains that are required for lysing parasites. Whereas allele frequencies of G2 were similar across all populations (3%–8%), the G1 allele was only common in the Yoruba (39%). Additionally, we identified a haplotype (termed G3) that contains a nonsynonymous change at the membrane-addressing-domain-encoding region of APOL1 and is present in all populations except for the Yoruba. Analyses of long-range patterns of linkage disequilibrium indicate evidence of recent selection acting on the G3 haplotype in Fulani from Cameroon. Our results indicate that the G1 and G2 variants in APOL1 are geographically restricted and that there might be other functional variants that could play a role in HAT resistance and CKD risk in African populations. PMID:23768513
Ko, Wen-Ya; Rajan, Prianka; Gomez, Felicia; Scheinfeldt, Laura; An, Ping; Winkler, Cheryl A; Froment, Alain; Nyambo, Thomas B; Omar, Sabah A; Wambebe, Charles; Ranciaro, Alessia; Hirbo, Jibril B; Tishkoff, Sarah A
2013-07-11
Disease susceptibility can arise as a consequence of adaptation to infectious disease. Recent findings have suggested that higher rates of chronic kidney disease (CKD) in individuals with recent African ancestry might be attributed to two risk alleles (G1 and G2) at the serum-resistance-associated (SRA)-interacting-domain-encoding region of APOL1. These two alleles appear to have arisen adaptively, possibly as a result of their protective effects against human African trypanosomiasis (HAT), or African sleeping sickness. In order to explore the distribution of potential functional variation at APOL1, we studied nucleotide variation in 187 individuals across ten geographically and genetically diverse African ethnic groups with exposure to two Trypanosoma brucei subspecies that cause HAT. We observed unusually high levels of nonsynonymous polymorphism in the regions encoding the functional domains that are required for lysing parasites. Whereas allele frequencies of G2 were similar across all populations (3%-8%), the G1 allele was only common in the Yoruba (39%). Additionally, we identified a haplotype (termed G3) that contains a nonsynonymous change at the membrane-addressing-domain-encoding region of APOL1 and is present in all populations except for the Yoruba. Analyses of long-range patterns of linkage disequilibrium indicate evidence of recent selection acting on the G3 haplotype in Fulani from Cameroon. Our results indicate that the G1 and G2 variants in APOL1 are geographically restricted and that there might be other functional variants that could play a role in HAT resistance and CKD risk in African populations. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Kopelman, Naama M; Mayzel, Jonathan; Jakobsson, Mattias; Rosenberg, Noah A; Mayrose, Itay
2015-09-01
The identification of the genetic structure of populations from multilocus genotype data has become a central component of modern population-genetic data analysis. Application of model-based clustering programs often entails a number of steps, in which the user considers different modelling assumptions, compares results across different predetermined values of the number of assumed clusters (a parameter typically denoted K), examines multiple independent runs for each fixed value of K, and distinguishes among runs belonging to substantially distinct clustering solutions. Here, we present Clumpak (Cluster Markov Packager Across K), a method that automates the postprocessing of results of model-based population structure analyses. For analysing multiple independent runs at a single K value, Clumpak identifies sets of highly similar runs, separating distinct groups of runs that represent distinct modes in the space of possible solutions. This procedure, which generates a consensus solution for each distinct mode, is performed by the use of a Markov clustering algorithm that relies on a similarity matrix between replicate runs, as computed by the software Clumpp. Next, Clumpak identifies an optimal alignment of inferred clusters across different values of K, extending a similar approach implemented for a fixed K in Clumpp and simplifying the comparison of clustering results across different K values. Clumpak incorporates additional features, such as implementations of methods for choosing K and comparing solutions obtained by different programs, models, or data subsets. Clumpak, available at http://clumpak.tau.ac.il, simplifies the use of model-based analyses of population structure in population genetics and molecular ecology. © 2015 John Wiley & Sons Ltd.
Identifying Gifted Children: Congruence among Different IQ Measures
Fernández, Estrella; García, Trinidad; Arias-Gundín, Olga; Vázquez, Almudena; Rodríguez, Celestino
2017-01-01
This study has two main aims: (1) analysing the relationship between intellectual capacities and levels of creativity in a sample of Spanish students from the third and sixth grades; and (2) examining the discrimination capacities and degree of congruence among different tests of intellectual ability that are commonly used to identify high-ability students. The study sample comprised 236 primary school students. Participants completed different tests of intellectual ability, which were based on both fluid and crystallized intelligence, as well as creativity. Results indicated that it is advisable to use varying tests in the assessment process, and a complementary measure (i.e., creativity) in order to create a multi-criteria means of detection that can more efficiently distinguish this population of students. PMID:28775702
Bigham, Abigail; Bauchet, Marc; Pinto, Dalila; Mao, Xianyun; Akey, Joshua M; Mei, Rui; Scherer, Stephen W; Julian, Colleen G; Wilson, Megan J; López Herráez, David; Brutsaert, Tom; Parra, Esteban J; Moore, Lorna G; Shriver, Mark D
2010-09-09
High-altitude hypoxia (reduced inspired oxygen tension due to decreased barometric pressure) exerts severe physiological stress on the human body. Two high-altitude regions where humans have lived for millennia are the Andean Altiplano and the Tibetan Plateau. Populations living in these regions exhibit unique circulatory, respiratory, and hematological adaptations to life at high altitude. Although these responses have been well characterized physiologically, their underlying genetic basis remains unknown. We performed a genome scan to identify genes showing evidence of adaptation to hypoxia. We looked across each chromosome to identify genomic regions with previously unknown function with respect to altitude phenotypes. In addition, groups of genes functioning in oxygen metabolism and sensing were examined to test the hypothesis that particular pathways have been involved in genetic adaptation to altitude. Applying four population genetic statistics commonly used for detecting signatures of natural selection, we identified selection-nominated candidate genes and gene regions in these two populations (Andeans and Tibetans) separately. The Tibetan and Andean patterns of genetic adaptation are largely distinct from one another, with both populations showing evidence of positive natural selection in different genes or gene regions. Interestingly, one gene previously known to be important in cellular oxygen sensing, EGLN1 (also known as PHD2), shows evidence of positive selection in both Tibetans and Andeans. However, the pattern of variation for this gene differs between the two populations. Our results indicate that several key HIF-regulatory and targeted genes are responsible for adaptation to high altitude in Andeans and Tibetans, and several different chromosomal regions are implicated in the putative response to selection. These data suggest a genetic role in high-altitude adaption and provide a basis for future genotype/phenotype association studies necessary
Bigham, Abigail; Bauchet, Marc; Pinto, Dalila; Mao, Xianyun; Akey, Joshua M.; Mei, Rui; Scherer, Stephen W.; Julian, Colleen G.; Wilson, Megan J.; López Herráez, David; Brutsaert, Tom; Parra, Esteban J.; Moore, Lorna G.; Shriver, Mark D.
2010-01-01
High-altitude hypoxia (reduced inspired oxygen tension due to decreased barometric pressure) exerts severe physiological stress on the human body. Two high-altitude regions where humans have lived for millennia are the Andean Altiplano and the Tibetan Plateau. Populations living in these regions exhibit unique circulatory, respiratory, and hematological adaptations to life at high altitude. Although these responses have been well characterized physiologically, their underlying genetic basis remains unknown. We performed a genome scan to identify genes showing evidence of adaptation to hypoxia. We looked across each chromosome to identify genomic regions with previously unknown function with respect to altitude phenotypes. In addition, groups of genes functioning in oxygen metabolism and sensing were examined to test the hypothesis that particular pathways have been involved in genetic adaptation to altitude. Applying four population genetic statistics commonly used for detecting signatures of natural selection, we identified selection-nominated candidate genes and gene regions in these two populations (Andeans and Tibetans) separately. The Tibetan and Andean patterns of genetic adaptation are largely distinct from one another, with both populations showing evidence of positive natural selection in different genes or gene regions. Interestingly, one gene previously known to be important in cellular oxygen sensing, EGLN1 (also known as PHD2), shows evidence of positive selection in both Tibetans and Andeans. However, the pattern of variation for this gene differs between the two populations. Our results indicate that several key HIF-regulatory and targeted genes are responsible for adaptation to high altitude in Andeans and Tibetans, and several different chromosomal regions are implicated in the putative response to selection. These data suggest a genetic role in high-altitude adaption and provide a basis for future genotype/phenotype association studies necessary
A probabilistic method for testing and estimating selection differences between populations
He, Yungang; Wang, Minxian; Huang, Xin; Li, Ran; Xu, Hongyang; Xu, Shuhua; Jin, Li
2015-01-01
Human populations around the world encounter various environmental challenges and, consequently, develop genetic adaptations to different selection forces. Identifying the differences in natural selection between populations is critical for understanding the roles of specific genetic variants in evolutionary adaptation. Although numerous methods have been developed to detect genetic loci under recent directional selection, a probabilistic solution for testing and quantifying selection differences between populations is lacking. Here we report the development of a probabilistic method for testing and estimating selection differences between populations. By use of a probabilistic model of genetic drift and selection, we showed that logarithm odds ratios of allele frequencies provide estimates of the differences in selection coefficients between populations. The estimates approximate a normal distribution, and variance can be estimated using genome-wide variants. This allows us to quantify differences in selection coefficients and to determine the confidence intervals of the estimate. Our work also revealed the link between genetic association testing and hypothesis testing of selection differences. It therefore supplies a solution for hypothesis testing of selection differences. This method was applied to a genome-wide data analysis of Han and Tibetan populations. The results confirmed that both the EPAS1 and EGLN1 genes are under statistically different selection in Han and Tibetan populations. We further estimated differences in the selection coefficients for genetic variants involved in melanin formation and determined their confidence intervals between continental population groups. Application of the method to empirical data demonstrated the outstanding capability of this novel approach for testing and quantifying differences in natural selection. PMID:26463656
A probabilistic method for testing and estimating selection differences between populations.
He, Yungang; Wang, Minxian; Huang, Xin; Li, Ran; Xu, Hongyang; Xu, Shuhua; Jin, Li
2015-12-01
Human populations around the world encounter various environmental challenges and, consequently, develop genetic adaptations to different selection forces. Identifying the differences in natural selection between populations is critical for understanding the roles of specific genetic variants in evolutionary adaptation. Although numerous methods have been developed to detect genetic loci under recent directional selection, a probabilistic solution for testing and quantifying selection differences between populations is lacking. Here we report the development of a probabilistic method for testing and estimating selection differences between populations. By use of a probabilistic model of genetic drift and selection, we showed that logarithm odds ratios of allele frequencies provide estimates of the differences in selection coefficients between populations. The estimates approximate a normal distribution, and variance can be estimated using genome-wide variants. This allows us to quantify differences in selection coefficients and to determine the confidence intervals of the estimate. Our work also revealed the link between genetic association testing and hypothesis testing of selection differences. It therefore supplies a solution for hypothesis testing of selection differences. This method was applied to a genome-wide data analysis of Han and Tibetan populations. The results confirmed that both the EPAS1 and EGLN1 genes are under statistically different selection in Han and Tibetan populations. We further estimated differences in the selection coefficients for genetic variants involved in melanin formation and determined their confidence intervals between continental population groups. Application of the method to empirical data demonstrated the outstanding capability of this novel approach for testing and quantifying differences in natural selection. © 2015 He et al.; Published by Cold Spring Harbor Laboratory Press.
ERIC Educational Resources Information Center
Ram, Nilam; Grimm, Kevin J.
2009-01-01
Growth mixture modeling (GMM) is a method for identifying multiple unobserved sub-populations, describing longitudinal change within each unobserved sub-population, and examining differences in change among unobserved sub-populations. We provide a practical primer that may be useful for researchers beginning to incorporate GMM analysis into their…
A novel assay to identify the trafficking proteins that bind to specific vesicle populations
Bentley, Marvin; Banker, Gary
2016-01-01
Here we describe a method capable of identifying interactions between candidate trafficking proteins and a defined vesicle population in intact cells. The assay involves the expression of an FKBP12-rapamycin–binding domain (FRB)–tagged candidate vesicle-binding protein that can be inducibly linked to an FKBP-tagged molecular motor. If the FRB-tagged candidate protein binds the labeled vesicles, then linking the FRB and FKBP domains recruits motors to the vesicles and causes a predictable, highly distinctive change in vesicle trafficking. We describe two versions of the assay: a general protocol for use in cells with a typical microtubule-organizing center and a specialized protocol designed to detect protein-vesicle interactions in cultured neurons. We have successfully used this assay to identify kinesins and Rabs that bind to a variety of different vesicle populations. In principle, this assay could be used to investigate interactions between any category of vesicle trafficking proteins and any vesicle population that can be specifically labeled. PMID:26621371
Cruz, Taylor M
2017-02-01
How do we make a difference? This paper traces the connections made between quantified knowledge, population health, and social justice by examining the efforts of population scientists to assess sexuality as a point of difference within population-based data systems, including on national health and social surveys, electronic medical records, and the Census. Population scientists emphasize the importance of measuring social difference in order to identify and remedy structural disadvantage. This evaluation requires the assessment of difference and the comparison of distinct groups across standardized outcome measures. In quantifying social difference, however, population scientists obscure or minimize several difficulties in creating comparable populations. I explore some of these challenges by highlighting three central tensions: the separation of difference from other aspects and categories of social experience, the reduction of difference through the use of one over several possible measures, and the enactment of difference as quantified knowledge loops back into society. As a theoretical inquiry into the form of social difference as it is conceptualized, operationalized, and materialized across the science-society nexus, this paper identifies the various commitments made during processes of scientific evaluation. By attending to the values and priorities that exist within and through practices of quantification, I aim to address the problem of measuring social difference as it pertains to the issues of social justice and health equity. Copyright © 2016 Elsevier Ltd. All rights reserved.
Colonna, Vincenza; Ayub, Qasim; Chen, Yuan; Pagani, Luca; Luisi, Pierre; Pybus, Marc; Garrison, Erik; Xue, Yali; Tyler-Smith, Chris; Abecasis, Goncalo R; Auton, Adam; Brooks, Lisa D; DePristo, Mark A; Durbin, Richard M; Handsaker, Robert E; Kang, Hyun Min; Marth, Gabor T; McVean, Gil A
2014-06-30
Population differentiation has proved to be effective for identifying loci under geographically localized positive selection, and has the potential to identify loci subject to balancing selection. We have previously investigated the pattern of genetic differentiation among human populations at 36.8 million genomic variants to identify sites in the genome showing high frequency differences. Here, we extend this dataset to include additional variants, survey sites with low levels of differentiation, and evaluate the extent to which highly differentiated sites are likely to result from selective or other processes. We demonstrate that while sites with low differentiation represent sampling effects rather than balancing selection, sites showing extremely high population differentiation are enriched for positive selection events and that one half may be the result of classic selective sweeps. Among these, we rediscover known examples, where we actually identify the established functional SNP, and discover novel examples including the genes ABCA12, CALD1 and ZNF804, which we speculate may be linked to adaptations in skin, calcium metabolism and defense, respectively. We identify known and many novel candidate regions for geographically restricted positive selection, and suggest several directions for further research.
Singh, Tulika; Khandelwal, Niranjan; Singla, Veenu; Kumar, Dileep; Gupta, Madhu; Singh, Gurpreet; Bal, Amanjit
2018-05-01
Mammography is the only method presently considered appropriate for mass screening of breast cancer. However, higher breast density was strongly associated with lower mammographic sensitivity. Breast density is also identified as independent and strongest risk factors for breast cancer. Studies have shown women with high breast density have four to six times increased risk of breast cancer as compare to women with fatty breast. It varies between different age group it generally decreases with increasing age in postmenopausal women and it can be different in different ethnic groups and people from different geographical areas. This study evaluates the breast density in Indian population and its relationship with the age. We reviewed of all screening mammography examinations performed from May 2012 to January 2015 at our institute PGIMER, Chandigarh, INDIA. Descriptive analyses were used to examine the association between age and breast density. A total of 6132 screening mammograms were performed. Each subgroup categorized by decade of age. There was a significant inverse relationship between age and breast density (P < .001). Twenty-two percent of patients between 40 and 49 years old had dense breasts. This percentage decreased to 9% of women in their 50s. Only 7% of women in their 60s and 8% of women in their 70s had dense breasts. This data has been compared with the Western study done in New York University (NYU) shows there is significant difference (P value <.05) in the breast density in Indian and Western population with more Indians having ACR Grade 1 and 2 and Western population having 2 and 3. We found an inverse relationship between patient age and mammographic breast density. However, there were a large proportion of young women who had lower grades of mammographic density which could potentially benefit from the use of routine screening mammography in this subgroup of patients. Moreover, the breast density of Indian population is less when compared to
Pathological Differences in Heterodera schachtii Populations
Griffin, G. D.
1981-01-01
Five populations of Heterodera schachtii Schm. from Oregon, Idaho, and Utah did not differ significantly in seedling penetration and rate of emergence and virulence. Another Utah H. schachtii population (Utah 2), however, differed from these five populations in all of the above-mentioned characteristics. More H. schachtii larvae of the Utah 2 population than the other populations penetrated sugarbeet seedlings at 10, 15, 20, and 25 C. Root and top weights of sugarbeet plants were signiticantly less when roots were parasitized by the Utah 2 population than when they were parasitized by larvae of the other nematode populations under similar experimental conditions. Also, the period of larval emergence was shorter in the Utah 2 population than in any of the other H. schachtii populations. PMID:19300743
Cridland, Julie M; Thornton, Kevin R
2010-01-13
Several recent studies have focused on the evolution of recently duplicated genes in Drosophila. Currently, however, little is known about the evolutionary forces acting upon duplications that are segregating in natural populations. We used a high-throughput, paired-end sequencing platform (Illumina) to identify structural variants in a population sample of African D. melanogaster. Polymerase chain reaction and sequencing confirmation of duplications detected by multiple, independent paired-ends showed that paired-end sequencing reliably uncovered the break points of structural rearrangements and allowed us to identify a number of tandem duplications segregating within a natural population. Our confirmation experiments show that rates of confirmation are very high, even at modest coverage. Our results also compare well with previous studies using microarrays (Emerson J, Cardoso-Moreira M, Borevitz JO, Long M. 2008. Natural selection shapes genome wide patterns of copy-number polymorphism in Drosophila melanogaster. Science. 320:1629-1631. and Dopman EB, Hartl DL. 2007. A portrait of copy-number polymorphism in Drosophila melanogaster. Proc Natl Acad Sci U S A. 104:19920-19925.), which both gives us confidence in the results of this study as well as confirms previous microarray results.We were also able to identify whole-gene duplications, such as a novel duplication of Or22a, an olfactory receptor, and identify copy-number differences in genes previously known to be under positive selection, like Cyp6g1, which confers resistance to dichlorodiphenyltrichloroethane. Several "hot spots" of duplications were detected in this study, which indicate that particular regions of the genome may be more prone to generating duplications. Finally, population frequency analysis of confirmed events also showed an excess of rare variants in our population, which indicates that duplications segregating in the population may be deleterious and ultimately destined to be lost from the
Identifying signatures of positive selection in pigmentation genes in two South Asian populations.
Jonnalagadda, Manjari; Bharti, Neeraj; Patil, Yatish; Ozarkar, Shantanu; K, Sunitha Manjari; Joshi, Rajendra; Norton, Heather
2017-09-10
Skin pigmentation is a polygenic trait showing wide phenotypic variations among global populations. While numerous pigmentation genes have been identified to be under positive selection among European and East populations, genes contributing to phenotypic variation in skin pigmentation within and among South Asian populations are still poorly understood. The present study uses data from the Phase 3 of the 1000 genomes project focusing on two South Asian populations-GIH (Gujarati Indian from Houston, Texas) and ITU (Indian Telugu from UK), so as to decode the genetic architecture involved in adaptation to ultraviolet radiation in South Asian populations. Statistical tests included were (1) tests to identify deviations of the Site Frequency Spectrum (SFS) from neutral expectations (Tajima's D, Fay and Wu's H and Fu and Li's D* and F*), (2) tests focused on the identification of high-frequency haplotypes with extended linkage disequilibrium (iHS and Rsb), and (3) tests based on genetic differentiation between populations (LSBL). Twenty-two pigmentation genes fall in the top 1% for at least one statistic in the GIH population, 5 of which (LYST, OCA2, SLC24A5, SLC45A2, and TYR) have been previously associated with normal variation in skin, hair, or eye color. In comparison, 17 genes fall in the top 1% for at least one statistic in the ITU population. Twelve loci which are identified as outliers in the ITU scan were also identified in the GIH population. These results suggest that selection may have affected these loci broadly across the region. © 2017 Wiley Periodicals, Inc.
Locke, Sarah J; Colt, Joanne S; Stewart, Patricia A; Armenti, Karla R; Baris, Dalsu; Blair, Aaron; Cerhan, James R; Chow, Wong-Ho; Cozen, Wendy; Davis, Faith; De Roos, Anneclaire J; Hartge, Patricia; Karagas, Margaret R; Johnson, Alison; Purdue, Mark P; Rothman, Nathaniel; Schwartz, Kendra; Schwenn, Molly; Severson, Richard; Silverman, Debra T; Friesen, Melissa C
2014-12-01
Growing evidence suggests that gender-blind assessment of exposure may introduce exposure misclassification, but few studies have characterised gender differences across occupations and industries. We pooled control responses to job-specific, industry-specific and exposure-specific questionnaires (modules) that asked detailed questions about work activities from three US population-based case-control studies to examine gender differences in work tasks and their frequencies. We calculated the ratio of female-to-male controls that completed each module. For four job modules (assembly worker, machinist, health professional, janitor/cleaner) and for subgroups of jobs that completed those modules, we evaluated gender differences in task prevalence and frequency using χ(2) and Mann-Whitney U tests, respectively. The 1360 female and 2245 male controls reported 6033 and 12 083 jobs, respectively. Gender differences in female:male module completion ratios were observed for 39 of 45 modules completed by ≥20 controls. Gender differences in task prevalence varied in direction and magnitude. For example, female janitors were significantly more likely to polish furniture (79% vs 44%), while male janitors were more likely to strip floors (73% vs 50%). Women usually reported more time spent on tasks than men. For example, the median hours per week spent degreasing for production workers in product manufacturing industries was 6.3 for women and 3.0 for men. Observed gender differences may reflect actual differences in tasks performed or differences in recall, reporting or perception, all of which contribute to exposure misclassification and impact relative risk estimates. Our findings reinforce the need to capture subject-specific information on work tasks. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Statham, Mark J.; Trut, Lyudmila N.; Sacks, Ben N.; Kharlamova, Anastasiya V.; Oskina, Irina N.; Gulevich, Rimma G.; Johnson, Jennifer L.; Temnykh, Svetlana V.; Acland, Gregory M.; Kukekova, Anna V.
2011-01-01
The foxes at Novosibirsk, Russia, are the only population of domesticated foxes in the world. These domesticated foxes originated from farm-bred silver foxes (Vulpes vulpes), whose genetic source is unknown. In this study we examined the origin of the domesticated strain of foxes and two other farm-bred fox populations (aggressive and unselected) maintained in Novosibirsk. To identify the phylogenetic origin of these populations we sequenced two regions of mtDNA, cytochrome b and D-loop, from 24 Novosibirsk foxes (8 foxes from each population) and compared them with corresponding sequences of native red foxes from Europe, Asia, Alaska and Western Canada, Eastern Canada, and the Western Mountains of the USA. We identified seven cytochrome b - D-loop haplotypes in Novosibirsk populations, four of which were previously observed in Eastern North America. The three remaining haplotypes differed by one or two base change from the most common haplotype in Eastern Canada. ΦST analysis showed significant differentiation between Novosibirsk populations and red fox populations from all geographic regions except Eastern Canada. No haplotypes of Eurasian origin were identified in the Novosibirsk populations. These results are consistent with historical records indicating that the original breeding stock of farm-bred foxes originated from Prince Edward Island, Canada. Mitochondrial DNA data together with historical records indicate two stages in the selection of domesticated foxes: the first includes captive breeding for ~50 years with unconscious selection for behaviour; the second corresponds to over 50 further years of intensive selection for tame behaviour. PMID:21625363
Papasozomenou, Panayiota; Athanasiadis, Apostolos P; Zafrakas, Menelaos; Panteris, Eleftherios; Loufopoulos, Aristoteles; Assimakopoulos, Efstratios; Tarlatzis, Basil C
2016-03-01
To compare normal ranges of ultrasonographically measured fetal nasal bone length in the second trimester between different ethnic groups. A prospective, non-interventional study in order to establish normal ranges of fetal nasal bone length in the second trimester in a Greek population was conducted in 1220 singleton fetuses between 18 completed weeks and 23 weeks and 6 days of gestation. A literature search followed in order to identify similar studies in different population groups. Fetal nasal bone length mean values and percentiles from different population groups were compared. Analysis of measurements in the Greek population showed a linear association, i.e., increasing nasal bone length with increasing gestational age from 5.73 mm at 18 weeks to 7.63 mm at 23 weeks. Eleven studies establishing normal ranges of fetal nasal bone length in the second trimester were identified. Comparison of fetal nasal bone length mean values between the 12 population groups showed statistically significant differences (P<0.0001). Normal ranges of fetal nasal bone length in the second trimester vary significantly between different ethnic groups. Hence, distinct ethnic nomograms of fetal nasal bone length in the second trimester should be used in a given population rather than an international model.
Rey, S; Boltana, S; Vargas, R; Roher, N; Mackenzie, S
2013-12-01
Resolving phenotype variation within a population in response to environmental perturbation is central to understanding biological adaptation. Relating meaningful adaptive changes at the level of the transcriptome requires the identification of processes that have a functional significance for the individual. This remains a major objective towards understanding the complex interactions between environmental demand and an individual's capacity to respond to such demands. The interpretation of such interactions and the significance of biological variation between individuals from the same or different populations remain a difficult and under-addressed question. Here, we provide evidence that variation in gene expression between individuals in a zebrafish population can be partially resolved by a priori screening for animal personality and accounts for >9% of observed variation in the brain transcriptome. Proactive and reactive individuals within a wild-type population exhibit consistent behavioural responses over time and context that relates to underlying differences in regulated gene networks and predicted protein-protein interactions. These differences can be mapped to distinct regions of the brain and provide a foundation towards understanding the coordination of underpinning adaptive molecular events within populations. © 2013 John Wiley & Sons Ltd.
Identifying Social Learning in Animal Populations: A New ‘Option-Bias’ Method
Kendal, Rachel L.; Kendal, Jeremy R.; Hoppitt, Will; Laland, Kevin N.
2009-01-01
Background Studies of natural animal populations reveal widespread evidence for the diffusion of novel behaviour patterns, and for intra- and inter-population variation in behaviour. However, claims that these are manifestations of animal ‘culture’ remain controversial because alternative explanations to social learning remain difficult to refute. This inability to identify social learning in social settings has also contributed to the failure to test evolutionary hypotheses concerning the social learning strategies that animals deploy. Methodology/Principal Findings We present a solution to this problem, in the form of a new means of identifying social learning in animal populations. The method is based on the well-established premise of social learning research, that - when ecological and genetic differences are accounted for - social learning will generate greater homogeneity in behaviour between animals than expected in its absence. Our procedure compares the observed level of homogeneity to a sampling distribution generated utilizing randomization and other procedures, allowing claims of social learning to be evaluated according to consensual standards. We illustrate the method on data from groups of monkeys provided with novel two-option extractive foraging tasks, demonstrating that social learning can indeed be distinguished from unlearned processes and asocial learning, and revealing that the monkeys only employed social learning for the more difficult tasks. The method is further validated against published datasets and through simulation, and exhibits higher statistical power than conventional inferential statistics. Conclusions/Significance The method is potentially a significant technological development, which could prove of considerable value in assessing the validity of claims for culturally transmitted behaviour in animal groups. It will also be of value in enabling investigation of the social learning strategies deployed in captive and natural
PopCORN: Hunting down the differences between binary population synthesis codes
NASA Astrophysics Data System (ADS)
Toonen, S.; Claeys, J. S. W.; Mennekens, N.; Ruiter, A. J.
2014-02-01
agreement on the characteristics of the double WD population. Regarding which progenitor systems lead to a single and double WD system and which systems do not, the four codes agree well. Most importantly, we find that for these two populations, the differences in the predictions from the four codes are not due to numerical differences, but because of different inherent assumptions. We identify critical assumptions for BPS studies that need to be studied in more detail. Appendices are available in electronic form at http://www.aanda.org
Using Latent Selection Difference to Model Persistence in a Declining Population
Erickson, Mara E.; Found-Jackson, Christine; Boyce, Mark S.
2014-01-01
Population persistence is a direct measure of the viability of a population. Monitoring the distribution of declining populations or subpopulations over time can yield estimates of persistence, which we show can be modeled as a latent selection difference (LSD) contrasting attributes of sites where populations have persisted versus those that have not. Predicted persistence can be modeled with predictor covariates to identify factors correlated with species persistence. We demonstrate how to model persistence based on changes in occupancy that can include adjustments for detection probability. Using a known historical distribution of the western grebe (Aechmophorus occidentalis), we adapted methods originally developed for occupancy modeling to evaluate how environmental covariates including emergent vegetation and human developments have affected western grebe persistence in Alberta. The relative probability of persistence was correlated with the extent of shoreline bulrush (Scirpus lacustris), which is important vegetation for nesting cover. We also documented that western grebe populations were less likely to persist on lakes in the boreal forest, primarily located on the northern boundary of the species' range. Factors influencing occupancy were different than those determining persistence by western grebes; persistence and occupancy were not correlated. Persistence was more likely on lakes with recreational development, reflecting reliance by grebes on the larger, fish-bearing waterbodies that also are attractive for lakeshore development. Unfortunately, the correlation with recreational development on Alberta's lakes puts grebes at risk for loss of brood-rearing habitats—primary threats to altricial birds—if steps are not taken to prevent disturbance to bulrush stands. Identifying factors related to the persistence of a species—especially one in decline—is a fundamental step in conservation management. PMID:24866172
Li, Ke; Cavaignac, Etienne; Xu, Wei; Cheng, Qiang; Telmon, Nobert; Huang, Wei
2018-02-20
Morphologic data of the knee is very important in the design of total knee prostheses. Generally, the designs of the total knee prostheses are based on the knee anatomy of Caucasian population. Moreover, in forensic medicine, a person's age and sex might be estimated by the shape of their knees. The aim of this study is to utilize three-dimensional morphometric analysis of the knee in Chinese population to reveal sexual dimorphism and age-related differences. Sexually dimorphic differences and age-related differences of the distal femur were studied by using geometric morphometric analysis of ten osteometric landmarks on three-dimensional reconstructions of 259 knees in Chinese population. General Procrustes analysis, PCA, and other discriminant analysis such as Mahalanobis and Goodall's F test were conducted for the knee to identify sexually dimorphism and age-related differences of the knee. The shape of distal femur between the male and female is significantly different. A difference between males and females in distal femur shape was identified by PCA; PC1 and PC2 accounted for 61.63% of the variance measured. The correct sex was assigned in 84.9% of cases by CVA, and the cross-validation revealed a 81.1% rate of correct sex estimation. The osteometric analysis also showed significant differences between the three age-related subgroups (< 40, 40-60, > 60 years, p < 0.005). This study showed both sex-related difference and age-related difference in the distal femur in Chinese population by 3D geometric morphometric analysis. Our bone measurements and geometric morphometric analysis suggest that population characteristics should be taken into account and may provide references for design of total knee prostheses in a Chinese population. Moreover, this reliable, accurate method could be used to perform diachronic and interethnic comparisons.
Bhaskar, Anand; Song, Yun S
2014-01-01
The sample frequency spectrum (SFS) is a widely-used summary statistic of genomic variation in a sample of homologous DNA sequences. It provides a highly efficient dimensional reduction of large-scale population genomic data and its mathematical dependence on the underlying population demography is well understood, thus enabling the development of efficient inference algorithms. However, it has been recently shown that very different population demographies can actually generate the same SFS for arbitrarily large sample sizes. Although in principle this nonidentifiability issue poses a thorny challenge to statistical inference, the population size functions involved in the counterexamples are arguably not so biologically realistic. Here, we revisit this problem and examine the identifiability of demographic models under the restriction that the population sizes are piecewise-defined where each piece belongs to some family of biologically-motivated functions. Under this assumption, we prove that the expected SFS of a sample uniquely determines the underlying demographic model, provided that the sample is sufficiently large. We obtain a general bound on the sample size sufficient for identifiability; the bound depends on the number of pieces in the demographic model and also on the type of population size function in each piece. In the cases of piecewise-constant, piecewise-exponential and piecewise-generalized-exponential models, which are often assumed in population genomic inferences, we provide explicit formulas for the bounds as simple functions of the number of pieces. Lastly, we obtain analogous results for the "folded" SFS, which is often used when there is ambiguity as to which allelic type is ancestral. Our results are proved using a generalization of Descartes' rule of signs for polynomials to the Laplace transform of piecewise continuous functions.
Coates, Peter S.; Prochazka, Brian G.; Ricca, Mark A.; Wann, Gregory T.; Aldridge, Cameron L.; Hanser, Steven E.; Doherty, Kevin E.; O'Donnell, Michael S.; Edmunds, David R.; Espinosa, Shawn P.
2017-08-10
Population ecologists have long recognized the importance of ecological scale in understanding processes that guide observed demographic patterns for wildlife species. However, directly incorporating spatial and temporal scale into monitoring strategies that detect whether trajectories are driven by local or regional factors is challenging and rarely implemented. Identifying the appropriate scale is critical to the development of management actions that can attenuate or reverse population declines. We describe a novel example of a monitoring framework for estimating annual rates of population change for greater sage-grouse (Centrocercus urophasianus) within a hierarchical and spatially nested structure. Specifically, we conducted Bayesian analyses on a 17-year dataset (2000–2016) of lek counts in Nevada and northeastern California to estimate annual rates of population change, and compared trends across nested spatial scales. We identified leks and larger scale populations in immediate need of management, based on the occurrence of two criteria: (1) crossing of a destabilizing threshold designed to identify significant rates of population decline at a particular nested scale; and (2) crossing of decoupling thresholds designed to identify rates of population decline at smaller scales that decouple from rates of population change at a larger spatial scale. This approach establishes how declines affected by local disturbances can be separated from those operating at larger scales (for example, broad-scale wildfire and region-wide drought). Given the threshold output from our analysis, this adaptive management framework can be implemented readily and annually to facilitate responsive and effective actions for sage-grouse populations in the Great Basin. The rules of the framework can also be modified to identify populations responding positively to management action or demonstrating strong resilience to disturbance. Similar hierarchical approaches might be beneficial
Locke, Sarah J.; Colt, Joanne S.; Stewart, Patricia A.; Armenti, Karla R.; Baris, Dalsu; Blair, Aaron; Cerhan, James R.; Chow, Wong-Ho; Cozen, Wendy; Davis, Faith; De Roos, Anneclaire J.; Hartge, Patricia; Karagas, Margaret R.; Johnson, Alison; Purdue, Mark P.; Rothman, Nathaniel; Schwartz, Kendra; Schwenn, Molly; Severson, Richard; Silverman, Debra T.; Friesen, Melissa C.
2014-01-01
Objectives Growing evidence suggests that gender-blind assessment of exposure may introduce exposure misclassification, but few studies have characterized gender differences across occupations and industries. We pooled control responses to job-, industry-, and exposure-specific questionnaires (modules) that asked detailed questions about work activities from three US population-based case-control studies to examine gender differences in work tasks and their frequencies. Methods We calculated the ratio of female to male controls that completed each module. For four job modules (assembly worker, machinist, health professional, janitor/cleaner) and for subgroups of jobs that completed those modules, we evaluated gender differences in task prevalence and frequency using Chi-square and Mann-Whitney U-tests, respectively. Results The 1,360 female and 2,245 male controls reported 6,033 and 12,083 jobs, respectively. Gender differences in female:male module completion ratios were observed for 39 of 45 modules completed by ≥20 controls. Gender differences in task prevalence varied in direction and magnitude. For example, female janitors were significantly more likely to polish furniture (79% vs. 44%), while male janitors were more likely to strip floors (73% vs. 50%). Women usually reported more time spent on tasks than men. For example, the median hours per week spent degreasing for production workers in product manufacturing industries was 6.3 for women and 3.0 for men. Conclusions Observed gender differences may reflect actual differences in tasks performed or differences in recall, reporting, or perception, all of which contribute to exposure misclassification and impact relative risk estimates. Our findings reinforce the need to capture subject-specific information on work tasks. PMID:24683012
Population differences in dysmorphic features among children with fetal alcohol spectrum disorders.
May, Philip A; Gossage, J Phillip; Smith, Matthew; Tabachnick, Barbara G; Robinson, Luther K; Manning, Melanie; Cecanti, Mauro; Jones, Kenneth Lyons; Khaole, Nathaniel; Buckley, David; Kalberg, Wendy O; Trujillo, Phyllis M; Hoyme, H Eugene
2010-05-01
To examine the variation in significant dysmorphic features in children from 3 different populations with the most dysmorphic forms of fetal alcohol spectrum disorders, fetal alcohol syndrome (FAS), and partial fetal alcohol syndrome (PFAS). Advanced multiple regression techniques are used to determine the discriminating physical features in the diagnosis of FAS and PFAS among children from Northern Plains Indian communities, South Africa, and Italy. Within the range of physical features used to identify children with fetal alcohol spectrum disorders, specifically FAS and PFAS, there is some significant variation in salient diagnostic features from one population to the next. Intraclass correlations in diagnostic features between these 3 populations is 0.20, indicating that about 20% of the variability in dysmorphology core features is associated with location and, therefore, specific racial/ethnic population. The highly significant diagnostic indicators present in each population are identified for the full samples of FAS, PFAS, and normals and also among children with FAS only. A multilevel model for these populations combined indicates that these variables predict dysmorphology unambiguously: small palpebral fissures, narrow vermillion, smooth philtrum, flat nasal bridge, and fifth finger clinodactyly. Long philtrum varies substantially as a predictor in the 3 populations. Predictors not significantly related to fetal alcohol spectrum disorders dysmorphology across the 3 populations are centile of height (except in Italy) strabismus, interpupilary distance, intercanthal distance, and heart murmurs. The dysmorphology associated with FAS and PFAS vary across populations, yet a particular array of common features occurs in each population, which permits a consistent diagnosis across populations.
Ring, Caroline L; Pearce, Robert G; Setzer, R Woodrow; Wetmore, Barbara A; Wambaugh, John F
2017-09-01
The thousands of chemicals present in the environment (USGAO, 2013) must be triaged to identify priority chemicals for human health risk research. Most chemicals have little of the toxicokinetic (TK) data that are necessary for relating exposures to tissue concentrations that are believed to be toxic. Ongoing efforts have collected limited, in vitro TK data for a few hundred chemicals. These data have been combined with biomonitoring data to estimate an approximate margin between potential hazard and exposure. The most "at risk" 95th percentile of adults have been identified from simulated populations that are generated either using standard "average" adult human parameters or very specific cohorts such as Northern Europeans. To better reflect the modern U.S. population, we developed a population simulation using physiologies based on distributions of demographic and anthropometric quantities from the most recent U.S. Centers for Disease Control and Prevention National Health and Nutrition Examination Survey (NHANES) data. This allowed incorporation of inter-individual variability, including variability across relevant demographic subgroups. Variability was analyzed with a Monte Carlo approach that accounted for the correlation structure in physiological parameters. To identify portions of the U.S. population that are more at risk for specific chemicals, physiologic variability was incorporated within an open-source high-throughput (HT) TK modeling framework. We prioritized 50 chemicals based on estimates of both potential hazard and exposure. Potential hazard was estimated from in vitro HT screening assays (i.e., the Tox21 and ToxCast programs). Bioactive in vitro concentrations were extrapolated to doses that produce equivalent concentrations in body tissues using a reverse dosimetry approach in which generic TK models are parameterized with: 1) chemical-specific parameters derived from in vitro measurements and predicted from chemical structure; and 2) with
Identifying consumer-resource population dynamics using paleoecological data.
Einarsson, Árni; Hauptfleisch, Ulf; Leavitt, Peter R; Ives, Anthony R
2016-02-01
Ecologists have long been fascinated by cyclic population fluctuations, because they suggest strong interactions between exploiter and victim species. Nonetheless, even for populations showing high-amplitude fluctuations, it is often hard to identify which species are the key drivers of the dynamics, because data are generally only available for a single species. Here, we use a paleoecological approach to investigate fluctuations in the midge population in Lake Mývatn, Iceland, which ranges over several orders of magnitude in irregular, multigeneration cycles. Previous circumstantial evidence points to consumer-resource interactions between midges and their primary food, diatoms, as the cause of these high-amplitude fluctuations. Using a pair of sediment cores from the lake, we reconstructed 26 years of dynamics of midges using egg remains and of algal groups using diagnostic pigments. We analyzed these data using statistical methods that account for both the autocorrelated nature of paleoecological data and measurement error caused by the mixing of sediment layers. The analyses revealed a signature of consumer-resource interactions in the fluctuations of midges and diatoms: diatom abundance (as inferred from biomarker pigment diatoxanthin) increased when midge abundance was low, and midge abundance (inferred from egg capsules) decreased when diatom abundance was low. Similar patterns were not found for pigments characterizing the other dominant primary producer group in the lake (cyanobacteria), subdominant algae (cryptophytes), or ubiquitous but chemically unstable biomarkers of total algal abundance (chlorophyll a); however, a significant but weaker pattern was found for the chemically stable indicator of total algal populations (β-carotene) to which diatoms are the dominant contributor. These analyses provide the first paleoecological evaluation of specific trophic interactions underlying high amplitude population fluctuations in lakes.
Sex differences in fingerprint ridge density in the Mataco-Mataguayo population.
Gutiérrez-Redomero, E; Alonso, M C; Dipierri, J E
2011-12-01
Ridge density (RD), the number of digital ridges per unit area, varies according to sex, age, and population origin. The main objective of this study was to determine the extent of sexual dimorphism in RD and to set the age at which it appears, in an Amerindian sample from the Mataco-Mataguayo population. The sample studied for this research consisted of 99 males and 110 females, between 6 and 25 years old, which amounts to a total of 2090 fingerprints. Ridge count was carried out on distal radial and distal ulnar and on proximal regions of each finger to explore the RD patterns in order to identify similarities and differences among samples, areas, age groups, and sexes. RD decreased with age and, at all ages, RD was higher on the distal (radial and ulnar) areas, followed by the proximal sides. Females were found to have higher RD than males when older than 12 years, but not when younger. In the radial area, the Mataco-Mataguayo population, in both sexes, presented the RD similar to Spanish samples, but higher than all other populations analysed to date using this method. Variations in RD in the Amerindian population based on sex, age, and topology were confirmed in this work, and it is postulated that these variations are due to developmental differences among individuals and populations. A comparison between the Mataco-Mataguayo and Spanish populations is presented. Copyright © 2011 Elsevier GmbH. All rights reserved.
Differences in Fusarium Species in brown midrib Sorghum and in Air Populations in Production Fields.
Funnell-Harris, Deanna L; Scully, Erin D; Sattler, Scott E; French, Roy C; O'Neill, Patrick M; Pedersen, Jeffrey F
2017-11-01
Several Fusarium spp. cause sorghum (Sorghum bicolor) grain mold, resulting in deterioration and mycotoxin production in the field and during storage. Fungal isolates from the air (2005 to 2006) and from leaves and grain from wild-type and brown midrib (bmr)-6 and bmr12 plants (2002 to 2003) were collected from two locations. Compared with the wild type, bmr plants have reduced lignin content, altered cell wall composition, and different levels of phenolic intermediates. Multilocus maximum-likelihood analysis identified two Fusarium thapsinum operational taxonomic units (OTU). One was identified at greater frequency in grain and leaves of bmr and wild-type plants but was infrequently detected in air. Nine F. graminearum OTU were identified: one was detected at low levels in grain and leaves while the rest were only detected in air. Wright's F statistic (F ST ) indicated that Fusarium air populations differentiated between locations during crop anthesis but did not differ during vegetative growth, grain development, and maturity. F ST also indicated that Fusarium populations from wild-type grain were differentiated from those in bmr6 or bmr12 grain at one location but, at the second location, populations from wild-type and bmr6 grain were more similar. Thus, impairing monolignol biosynthesis substantially effected Fusarium populations but environment had a strong influence.
Identifying vulnerable populations to death and injuries from residential fires.
Gilbert, Stanley W; Butry, David T
2017-08-03
This study proposes and evaluates the theory that people who are susceptible to injury in residential fires are not susceptible to death in residential fires and vice versa. It is proposed that the population vulnerable to death in residential fires can be proxied by 'frailty', which is measured as age-gender adjusted fatality rates due to natural causes. This study uses an ecological approach and controls for exposure to estimate the vulnerability of different population groups to death and injury in residential fires. It allows fatalities and injuries to be estimated by different models. Frailty explains fire-related death in adults while not explaining injuries, which is consistent with the idea that deaths and injuries affect disjoint populations. Deaths and injuries in fire are drawn from different populations. People who are susceptible to dying in fires are unlikely to be injured in fires, and the people who are susceptible to injury are unlikely to die in fires. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
NASA Astrophysics Data System (ADS)
Mei, Ran; Narihiro, Takashi; Nobu, Masaru K.; Kuroda, Kyohei; Liu, Wen-Tso
2016-09-01
Anaerobic digestion is a common technology to biologically stabilize wasted solids produced in municipal wastewater treatment. Its efficiency is usually evaluated by calculating the reduction in volatile solids, which assumes no biomass growth associated with digestion. To determine whether this assumption is valid and further evaluate digestion efficiency, this study sampled 35 digester sludge from different reactors at multiple time points together with the feed biomass in a full-scale water reclamation plant at Chicago, Illinois. The microbial communities were characterized using Illumina sequencing technology based on 16S rRNA and 16S rRNA gene (rDNA). 74 core microbial populations were identified and represented 58.7% of the entire digester community. Among them, active populations were first identified using the ratio of 16S rRNA and 16S rDNA (rRNA/rDNA) for individual populations, but this approach failed to generate consistent results. Subsequently, a recently proposed mass balance model was applied to calculate the specific growth rate (μ), and this approach successfully identified active microbial populations in digester (positive μ) that could play important roles than those with negative μ. It was further estimated that 82% of microbial populations in the feed sludge were digested in comparison with less than 50% calculated using current equations.
Moonesinghe, Ramal; Ioannidis, John P A; Flanders, W Dana; Yang, Quanhe; Truman, Benedict I; Khoury, Muin J
2012-08-01
Genome-wide association studies have identified multiple genetic susceptibility variants to several complex human diseases. However, risk-genotype frequency at loci showing robust associations might differ substantially among different populations. In this paper, we present methods to assess the contribution of genetic variants to the difference in the incidence of disease between different population groups for different scenarios. We derive expressions for the contribution of a single genetic variant, multiple genetic variants, and the contribution of the joint effect of a genetic variant and an environmental factor to the difference in the incidence of disease. The contribution of genetic variants to the difference in incidence increases with increasing difference in risk-genotype frequency, but declines with increasing difference in incidence between the two populations. The contribution of genetic variants also increases with increasing relative risk and the contribution of joint effect of genetic and environmental factors increases with increasing relative risk of the gene-environmental interaction. The contribution of genetic variants to the difference in incidence between two populations can be expressed as a function of the population attributable risks of the genetic variants in the two populations. The contribution of a group of genetic variants to the disparity in incidence of disease could change considerably by adding one more genetic variant to the group. Any estimate of genetic contribution to the disparity in incidence of disease between two populations at this stage seems to be an elusive goal.
Moonesinghe, Ramal; Ioannidis, John PA; Flanders, W Dana; Yang, Quanhe; Truman, Benedict I; Khoury, Muin J
2012-01-01
Genome-wide association studies have identified multiple genetic susceptibility variants to several complex human diseases. However, risk-genotype frequency at loci showing robust associations might differ substantially among different populations. In this paper, we present methods to assess the contribution of genetic variants to the difference in the incidence of disease between different population groups for different scenarios. We derive expressions for the contribution of a single genetic variant, multiple genetic variants, and the contribution of the joint effect of a genetic variant and an environmental factor to the difference in the incidence of disease. The contribution of genetic variants to the difference in incidence increases with increasing difference in risk-genotype frequency, but declines with increasing difference in incidence between the two populations. The contribution of genetic variants also increases with increasing relative risk and the contribution of joint effect of genetic and environmental factors increases with increasing relative risk of the gene–environmental interaction. The contribution of genetic variants to the difference in incidence between two populations can be expressed as a function of the population attributable risks of the genetic variants in the two populations. The contribution of a group of genetic variants to the disparity in incidence of disease could change considerably by adding one more genetic variant to the group. Any estimate of genetic contribution to the disparity in incidence of disease between two populations at this stage seems to be an elusive goal. PMID:22333905
Leukocyte Populations in Human Preterm and Term Breast Milk Identified by Multicolour Flow Cytometry
Trend, Stephanie; de Jong, Emma; Lloyd, Megan L.; Kok, Chooi Heen; Richmond, Peter; Doherty, Dorota A.; Simmer, Karen; Kakulas, Foteini; Strunk, Tobias; Currie, Andrew
2015-01-01
Background Extremely preterm infants are highly susceptible to bacterial infections but breast milk provides some protection. It is unknown if leukocyte numbers and subsets in milk differ between term and preterm breast milk. This study serially characterised leukocyte populations in breast milk of mothers of preterm and term infants using multicolour flow cytometry methods for extended differential leukocyte counts in blood. Methods Sixty mothers of extremely preterm (<28 weeks gestational age), very preterm (28–31 wk), and moderately preterm (32–36 wk), as well as term (37–41 wk) infants were recruited. Colostrum (d2–5), transitional (d8–12) and mature milk (d26–30) samples were collected, cells isolated, and leukocyte subsets analysed using flow cytometry. Results The major CD45+ leukocyte populations circulating in blood were also detectable in breast milk but at different frequencies. Progression of lactation was associated with decreasing CD45+ leukocyte concentration, as well as increases in the relative frequencies of neutrophils and immature granulocytes, and decreases in the relative frequencies of eosinophils, myeloid and B cell precursors, and CD16- monocytes. No differences were observed between preterm and term breast milk in leukocyte concentration, though minor differences between preterm groups in some leukocyte frequencies were observed. Conclusions Flow cytometry is a useful tool to identify and quantify leukocyte subsets in breast milk. The stage of lactation is associated with major changes in milk leukocyte composition in this population. Fresh preterm breast milk is not deficient in leukocytes, but shorter gestation may be associated with minor differences in leukocyte subset frequencies in preterm compared to term breast milk. PMID:26288195
Identifying Frailty Among Vulnerable Populations
Salem, Benissa E.; Nyamathi, Adeline; Phillips, Linda R.; Mentes, Janet; Sarkisian, Catherine; Brecht, Lynn
2014-01-01
Frailty is a significant public health issue which is experienced by homeless and other vulnerable adults; to date, a frailty framework has not been proposed to guide researchers who study this hard-to-reach population. The Frailty Framework among Homeless and other Vulnerable Populations (FFHVP) has been developed from empirical research and consultation with frailty experts in an effort to characterize antecedents, i.e. situational, health-related, behavioral, resource, biological, and environmental factors which contribute to physical, psychological and social frailty domains and impact adverse outcomes. As vulnerable populations continue to age, a greater understanding of frailty will enable the development of nursing interventions. PMID:24469090
HOX and TALE signatures specify human stromal stem cell populations from different sources.
Picchi, Jacopo; Trombi, Luisa; Spugnesi, Laura; Barachini, Serena; Maroni, Giorgia; Brodano, Giovanni Barbanti; Boriani, Stefano; Valtieri, Mauro; Petrini, Mario; Magli, Maria Cristina
2013-04-01
Human stromal stem cell populations reside in different tissues and anatomical sites, however a critical question related to their efficient use in regenerative medicine is whether they exhibit equivalent biological properties. Here, we compared cellular and molecular characteristics of stromal stem cells derived from the bone marrow, at different body sites (iliac crest, sternum, and vertebrae) and other tissues (dental pulp and colon). In particular, we investigated whether homeobox genes of the HOX and TALE subfamilies might provide suitable markers to identify distinct stromal cell populations, as HOX proteins control cell positional identity and, together with their co-factors TALE, are involved in orchestrating differentiation of adult tissues. Our results show that stromal populations from different sources, although immunophenotypically similar, display distinct HOX and TALE signatures, as well as different growth and differentiation abilities. Stromal stem cells from different tissues are characterized by specific HOX profiles, differing in the number and type of active genes, as well as in their level of expression. Conversely, bone marrow-derived cell populations can be essentially distinguished for the expression levels of specific HOX members, strongly suggesting that quantitative differences in HOX activity may be crucial. Taken together, our data indicate that the HOX and TALE profiles provide positional, embryological and hierarchical identity of human stromal stem cells. Furthermore, our data suggest that cell populations derived from different body sites may not represent equivalent cell sources for cell-based therapeutical strategies for regeneration and repair of specific tissues. Copyright © 2012 Wiley Periodicals, Inc.
Lingley, Alexander J; Bowdridge, Joshua C; Farivar, Reza; Duffy, Kevin R
2018-04-30
A single histological marker applied to a slice of tissue often reveals myriad cytoarchitectonic characteristics that can obscure differences between neuron populations targeted for study. Isolation and measurement of a single feature from the tissue is possible through a variety of approaches, however, visualizing the data numerically or through graphs alone can preclude being able to identify important features and effects that are not obvious from direct observation of the tissue. We demonstrate an efficient, effective, and robust approach to quantify and visualize cytoarchitectural features in histologically prepared brain sections. We demonstrate that this approach is able to reveal small differences between populations of neurons that might otherwise have gone undiscovered. We used stereological methods to record the cross-sectional soma area and in situ position of neurons within sections of the cat, monkey, and human visual system. The two-dimensional coordinate of every measured cell was used to produce a scatter plot that recapitulated the natural spatial distribution of cells, and each point in the plot was color-coded according to its respective soma area. The final graphic display was a multi-dimensional map of neuron soma size that revealed subtle differences across neuron aggregations, permitted delineation of regional boundaries, and identified small differences between populations of neurons modified by a period of sensory deprivation. This approach to collecting and displaying cytoarchitectonic data is simple, efficient, and provides a means of investigating small differences between neuron populations. Copyright © 2018. Published by Elsevier B.V.
Face shape differs in phylogenetically related populations.
Hopman, Saskia M J; Merks, Johannes H M; Suttie, Michael; Hennekam, Raoul C M; Hammond, Peter
2014-11-01
3D analysis of facial morphology has delineated facial phenotypes in many medical conditions and detected fine grained differences between typical and atypical patients to inform genotype-phenotype studies. Next-generation sequencing techniques have enabled extremely detailed genotype-phenotype correlative analysis. Such comparisons typically employ control groups matched for age, sex and ethnicity and the distinction between ethnic categories in genotype-phenotype studies has been widely debated. The phylogenetic tree based on genetic polymorphism studies divides the world population into nine subpopulations. Here we show statistically significant face shape differences between two European Caucasian populations of close phylogenetic and geographic proximity from the UK and The Netherlands. The average face shape differences between the Dutch and UK cohorts were visualised in dynamic morphs and signature heat maps, and quantified for their statistical significance using both conventional anthropometry and state of the art dense surface modelling techniques. Our results demonstrate significant differences between Dutch and UK face shape. Other studies have shown that genetic variants influence normal facial variation. Thus, face shape difference between populations could reflect underlying genetic difference. This should be taken into account in genotype-phenotype studies and we recommend that in those studies reference groups be established in the same population as the individuals who form the subject of the study.
Lee, Sangjin; Ko, Young; Kwak, Chanyeong; Yim, Eun-Shil
2016-01-23
Gender is thought to be an important factor in metabolic syndrome and its outcomes. Despite a number of studies that have demonstrated differences in metabolism and its components that are dependent on gender, limited information about gender differences on the characteristics of metabolic syndrome and its components is available regarding the Korean old adult population. This study aimed to identify gender differences in characteristics of the metabolic syndrome and other risk factors for cardiovascular disease. Secondary analysis of data from a nationwide cross-sectional survey for health examination at the time of transitioning from midlife to old age was performed. Multiple logistic regression models were used to estimate adjusted odds ratios and 95% confidence intervals for gender differences among the Korean 66-year-old population with metabolic syndrome. Gender differences in metabolic syndrome components that contributed to the diagnosis of metabolic syndrome were identified. In males, the most common component was high blood sugar levels (87.5%), followed by elevated triglyceride levels (83.5%) and high blood pressure (83.1%). In females, the most commonly identified component was elevated triglyceride levels (79.0%), followed by high blood sugar levels (78.6%) and high blood pressure (78.5%). Gender differences for other risk factors for cardiovascular disease, including family history, health habits, and body mass index were observed. Gender-specific public health policies and management strategies to prevent cardiovascular disease among the older adult population should be developed for Koreans undergoing the physiological transition to old age.
Loci associated with skin pigmentation identified in African populations
Crawford, Nicholas G.; Kelly, Derek E.; Hansen, Matthew E. B.; Beltrame, Marcia H.; Fan, Shaohua; Bowman, Shanna L.; Jewett, Ethan; Ranciaro, Alessia; Thompson, Simon; Lo, Yancy; Pfeifer, Susanne P.; Jensen, Jeffrey D.; Campbell, Michael C.; Beggs, William; Hormozdiari, Farhad; Mpoloka, Sununguko Wata; Mokone, Gaonyadiwe George; Nyambo, Thomas; Meskel, Dawit Wolde; Belay, Gurja; Haut, Jake; Rothschild, Harriet; Zon, Leonard; Zhou, Yi; Kovacs, Michael A.; Xu, Mai; Zhang, Tongwu; Bishop, Kevin; Sinclair, Jason; Rivas, Cecilia; Elliot, Eugene; Choi, Jiyeon; Li, Shengchao A.; Hicks, Belynda; Burgess, Shawn; Abnet, Christian; Watkins-Chow, Dawn E.; Oceana, Elena; Song, Yun S.; Eskin, Eleazar; Brown, Kevin M.; Marks, Michael S.; Loftus, Stacie K.; Pavan, William J.; Yeager, Meredith; Chanock, Stephen; Tishkoff, Sarah
2017-01-01
Despite the wide range of skin pigmentation in humans, little is known about its genetic basis in global populations. Examining ethnically diverse African genomes, we identify variants in or near SLC24A5, MFSD12, DDB1, TMEM138, OCA2 and HERC2 that are significantly associated with skin pigmentation. Genetic evidence indicates that the light pigmentation variant at SLC24A5 was introduced into East Africa by gene flow from non-Africans. At all other loci, variants associated with dark pigmentation in Africans are identical by descent in southern Asian and Australo-Melanesian populations. Functional analyses indicate that MFSD12 encodes a lysosomal protein that affects melanogenesis in zebrafish and mice, and that mutations in melanocyte-specific regulatory regions near DDB1/TMEM138 correlate with expression of UV response genes under selection in Eurasians. PMID:29025994
Fottrell, E; Byass, P
2009-02-01
Effective early warning systems of humanitarian crises may help to avert substantial increases in mortality and morbidity, and prevent major population movements. The Butajira Rural Health Programme (BRHP) in Ethiopia has maintained a programme of epidemiological surveillance since 1987. Inspection of the BRHP data revealed large peaks of mortality in 1998 and 1999, well in excess of the normally observed year-to-year variation. Further investigation and enquiry revealed that these peaks related to a measles epidemic, and a serious episode of drought and consequent food insecurity that went undetected by the BRHP. This paper applies international humanitarian crisis threshold definitions to the BRHP data in an attempt to identify suitable mortality thresholds that may be used for the prospective detection of humanitarian crises in population surveillance sites in developing countries. Empirical investigation using secondary analysis of longitudinal population-based cohort data. The daily, weekly and monthly thresholds for crises in Butajira were applied to mortality data for the 5-year period incorporating the crisis periods of 1998-1999. Days, weeks and months in which mortality exceeded each threshold level were identified. Each threshold level was assessed in terms of prospectively identifying the true crisis periods in a timely manner whilst avoiding false alarms. The daily threshold definition is too sensitive to accurately detect impending or real crises in the population surveillance setting of the BRHP. However, the weekly threshold level is useful in identifying important increases in mortality in a timely manner without the excessive sensitivity of the daily threshold. The weekly threshold level detects the crisis periods approximately 2 weeks before the monthly threshold level. Mortality measures are highly specific indicators of the health status of populations, and simple procedures can be used to apply international crisis threshold definitions in
Imamura, Minako; Takahashi, Atsushi; Yamauchi, Toshimasa; Hara, Kazuo; Yasuda, Kazuki; Grarup, Niels; Zhao, Wei; Wang, Xu; Huerta-Chagoya, Alicia; Hu, Cheng; Moon, Sanghoon; Long, Jirong; Kwak, Soo Heon; Rasheed, Asif; Saxena, Richa; Ma, Ronald C. W.; Okada, Yukinori; Iwata, Minoru; Hosoe, Jun; Shojima, Nobuhiro; Iwasaki, Minaka; Fujita, Hayato; Suzuki, Ken; Danesh, John; Jørgensen, Torben; Jørgensen, Marit E.; Witte, Daniel R.; Brandslund, Ivan; Christensen, Cramer; Hansen, Torben; Mercader, Josep M.; Flannick, Jason; Moreno-Macías, Hortensia; Burtt, Noël P.; Zhang, Rong; Kim, Young Jin; Zheng, Wei; Singh, Jai Rup; Tam, Claudia H. T.; Hirose, Hiroshi; Maegawa, Hiroshi; Ito, Chikako; Kaku, Kohei; Watada, Hirotaka; Tanaka, Yasushi; Tobe, Kazuyuki; Kawamori, Ryuzo; Kubo, Michiaki; Cho, Yoon Shin; Chan, Juliana C. N.; Sanghera, Dharambir; Frossard, Philippe; Park, Kyong Soo; Shu, Xiao-Ou; Kim, Bong-Jo; Florez, Jose C.; Tusié-Luna, Teresa; Jia, Weiping; Tai, E Shyong; Pedersen, Oluf; Saleheen, Danish; Maeda, Shiro; Kadowaki, Takashi
2016-01-01
Genome-wide association studies (GWAS) have identified more than 80 susceptibility loci for type 2 diabetes (T2D), but most of its heritability still remains to be elucidated. In this study, we conducted a meta-analysis of GWAS for T2D in the Japanese population. Combined data from discovery and subsequent validation analyses (23,399 T2D cases and 31,722 controls) identify 7 new loci with genome-wide significance (P<5 × 10−8), rs1116357 near CCDC85A, rs147538848 in FAM60A, rs1575972 near DMRTA1, rs9309245 near ASB3, rs67156297 near ATP8B2, rs7107784 near MIR4686 and rs67839313 near INAFM2. Of these, the association of 4 loci with T2D is replicated in multi-ethnic populations other than Japanese (up to 65,936 T2Ds and 158,030 controls, P<0.007). These results indicate that expansion of single ethnic GWAS is still useful to identify novel susceptibility loci to complex traits not only for ethnicity-specific loci but also for common loci across different ethnicities. PMID:26818947
Bhaskar, Anand; Song, Yun S.
2016-01-01
The sample frequency spectrum (SFS) is a widely-used summary statistic of genomic variation in a sample of homologous DNA sequences. It provides a highly efficient dimensional reduction of large-scale population genomic data and its mathematical dependence on the underlying population demography is well understood, thus enabling the development of efficient inference algorithms. However, it has been recently shown that very different population demographies can actually generate the same SFS for arbitrarily large sample sizes. Although in principle this nonidentifiability issue poses a thorny challenge to statistical inference, the population size functions involved in the counterexamples are arguably not so biologically realistic. Here, we revisit this problem and examine the identifiability of demographic models under the restriction that the population sizes are piecewise-defined where each piece belongs to some family of biologically-motivated functions. Under this assumption, we prove that the expected SFS of a sample uniquely determines the underlying demographic model, provided that the sample is sufficiently large. We obtain a general bound on the sample size sufficient for identifiability; the bound depends on the number of pieces in the demographic model and also on the type of population size function in each piece. In the cases of piecewise-constant, piecewise-exponential and piecewise-generalized-exponential models, which are often assumed in population genomic inferences, we provide explicit formulas for the bounds as simple functions of the number of pieces. Lastly, we obtain analogous results for the “folded” SFS, which is often used when there is ambiguity as to which allelic type is ancestral. Our results are proved using a generalization of Descartes’ rule of signs for polynomials to the Laplace transform of piecewise continuous functions. PMID:28018011
Clark, Christopher E; Taylor, Rod S; Shore, Angela C; Campbell, John L
2016-01-01
Background Various prevalence figures have been reported for inter-arm differences in blood pressure (IAD); variation may be explained by differing population vascular risk and by measurement method. Aim To review the literature to derive robust estimates of IAD prevalence relevant to community populations. Design and setting Systematic review and meta-analysis. Method MEDLINE, Embase, and CINAHL were searched for cross-sectional studies likely to represent general or primary care populations, reporting prevalence of IAD and employing a simultaneous method of measurement. Using study-level data, pooled estimates of mean prevalence of systolic IADs were calculated and compared using a random effects model. Results Eighty IAD studies were identified. Sixteen met inclusion criteria: pooled estimates of prevalence for systolic IAD ≥10 mmHg were 11.2% (95% confidence interval [CI] = 9.1 to 13.6) in hypertension, 7.4% (95% CI = 5.8 to 9.2) in diabetes, and 3.6% (95% CI = 2.3 to 5.0) for a general adult population (P<0.001 for subgroup differences). Differences persisted for higher cut-off values. Prevalences were lower for East Asian than for Western populations and were overestimated by sequential measurement where this could be compared with simultaneous measurement within studies (relative risk for IAD: 2.9 [95% CI = 2.1 to 4.1]). Studies with higher mean absolute systolic pressures had higher prevalences for a systolic IAD ≥10 mmHg (P = 0.04). Conclusion Prevalences of IADs rise in relation to underlying cardiovascular comorbidities of the population studied, and are overestimated threefold when sequential measurement is used. Population-specific variation in prevalences of IAD should be taken into account in delivering clinical care and in planning future studies. PMID:27789511
Clark, Christopher E; Taylor, Rod S; Shore, Angela C; Campbell, John L
2016-11-01
Various prevalence figures have been reported for inter-arm differences in blood pressure (IAD); variation may be explained by differing population vascular risk and by measurement method. To review the literature to derive robust estimates of IAD prevalence relevant to community populations. Systematic review and meta-analysis. MEDLINE, Embase, and CINAHL were searched for cross-sectional studies likely to represent general or primary care populations, reporting prevalence of IAD and employing a simultaneous method of measurement. Using study-level data, pooled estimates of mean prevalence of systolic IADs were calculated and compared using a random effects model. Eighty IAD studies were identified. Sixteen met inclusion criteria: pooled estimates of prevalence for systolic IAD ≥10 mmHg were 11.2% (95% confidence interval [CI] = 9.1 to 13.6) in hypertension, 7.4% (95% CI = 5.8 to 9.2) in diabetes, and 3.6% (95% CI = 2.3 to 5.0) for a general adult population (P<0.001 for subgroup differences). Differences persisted for higher cut-off values. Prevalences were lower for East Asian than for Western populations and were overestimated by sequential measurement where this could be compared with simultaneous measurement within studies (relative risk for IAD: 2.9 [95% CI = 2.1 to 4.1]). Studies with higher mean absolute systolic pressures had higher prevalences for a systolic IAD ≥10 mmHg (P = 0.04). Prevalences of IADs rise in relation to underlying cardiovascular comorbidities of the population studied, and are overestimated threefold when sequential measurement is used. Population-specific variation in prevalences of IAD should be taken into account in delivering clinical care and in planning future studies. © British Journal of General Practice 2016.
Differences in mammographic density between Asian and Caucasian populations: a comparative analysis.
Rajaram, Nadia; Mariapun, Shivaani; Eriksson, Mikael; Tapia, Jose; Kwan, Pui Yoke; Ho, Weang Kee; Harun, Faizah; Rahmat, Kartini; Czene, Kamila; Taib, Nur Aishah Mohd; Hall, Per; Teo, Soo Hwang
2017-01-01
Mammographic density is a measurable and modifiable biomarker that is strongly and independently associated with breast cancer risk. Paradoxically, although Asian women have lower risk of breast cancer, studies of minority Asian women in predominantly Caucasian populations have found that Asian women have higher percent density. In this cross-sectional study, we compared the distribution of mammographic density for a matched cohort of Asian women from Malaysia and Caucasian women from Sweden, and determined if variations in mammographic density could be attributed to population differences in breast cancer risk factors. Volumetric mammographic density was compared for 1501 Malaysian and 4501 Swedish healthy women, matched on age and body mass index. We used multivariable log-linear regression to determine the risk factors associated with mammographic density and mediation analysis to identify factors that account for differences in mammographic density between the two cohorts. Compared to Caucasian women, percent density was 2.0% higher among Asian women (p < 0.001), and dense volume was 5.7 cm 3 higher among pre-menopausal Asian women (p < 0.001). Dense volume was 3.0 cm 3 lower among post-menopausal Asian women (p = 0.009) compared to post-menopausal Caucasian women, and this difference was attributed to population differences in height, weight, and parity (p < 0.001). Our analysis suggests that among post-menopausal women, population differences in mammographic density and risk to breast cancer may be accounted for by height, weight, and parity. Given that pre-menopausal Asian and Caucasian women have similar population risk to breast cancer but different dense volume, development of more appropriate biomarkers of risk in pre-menopausal women is required.
Grimm, Annegret; Gruber, Bernd; Henle, Klaus
2014-01-01
Reliable estimates of population size are fundamental in many ecological studies and biodiversity conservation. Selecting appropriate methods to estimate abundance is often very difficult, especially if data are scarce. Most studies concerning the reliability of different estimators used simulation data based on assumptions about capture variability that do not necessarily reflect conditions in natural populations. Here, we used data from an intensively studied closed population of the arboreal gecko Gehyra variegata to construct reference population sizes for assessing twelve different population size estimators in terms of bias, precision, accuracy, and their 95%-confidence intervals. Two of the reference populations reflect natural biological entities, whereas the other reference populations reflect artificial subsets of the population. Since individual heterogeneity was assumed, we tested modifications of the Lincoln-Petersen estimator, a set of models in programs MARK and CARE-2, and a truncated geometric distribution. Ranking of methods was similar across criteria. Models accounting for individual heterogeneity performed best in all assessment criteria. For populations from heterogeneous habitats without obvious covariates explaining individual heterogeneity, we recommend using the moment estimator or the interpolated jackknife estimator (both implemented in CAPTURE/MARK). If data for capture frequencies are substantial, we recommend the sample coverage or the estimating equation (both models implemented in CARE-2). Depending on the distribution of catchabilities, our proposed multiple Lincoln-Petersen and a truncated geometric distribution obtained comparably good results. The former usually resulted in a minimum population size and the latter can be recommended when there is a long tail of low capture probabilities. Models with covariates and mixture models performed poorly. Our approach identified suitable methods and extended options to evaluate the
Saha, Anjana; Sharma, Swarkar; Bhat, Audesh; Pandit, Awadesh; Bamezai, Ramesh
2005-01-01
Four binary polymorphisms and four multiallelic short tandem repeat (STR) loci from the nonrecombining region of the human Y-chromosome were typed in different Indian population groups from Uttar Pradeh (UP), Bihar (BI), Punjab (PUNJ), and Bengal (WB) speaking the Indo-Aryan dialects and from South India (SI) with the root in the Dravidian language. We identified four major haplogroups [(P) 1+, (C and F) 2+, (R1a) 3, (K) 26+] and 114 combinations of Y-STR haplotypes. Analyses of the haplogroups indicated no single origin from any lineage but a result of a conglomeration of different lineages from time to time. The phylogenetic analyses indicate a high degree of population admixture and a greater genetic proximity for the studied population groups when compared with other world populations.
Zhang, Bo; Cohen, Joanna E; OʼConnor, Shawn
2014-01-01
Selection of priority groups is important for health interventions. However, no quantitative method has been developed. To develop a quantitative method to support the process of selecting priority groups for public health interventions based on both high risk and population health burden. Secondary data analysis of the 2010 Canadian Community Health Survey. Canadian population. Survey respondents. We identified priority groups for 3 diseases: heart disease, stroke, and chronic lower respiratory diseases. Three measures--prevalence, population counts, and adjusted odds ratios (OR)--were calculated for subpopulations (sociodemographic characteristics and other risk factors). A Priority Group Index (PGI) was calculated by summing the rank scores of these 3 measures. Of the 30 priority groups identified by the PGI (10 for each of the 3 disease outcomes), 7 were identified on the basis of high prevalence only, 5 based on population count only, 3 based on high OR only, and the remainder based on combinations of these. The identified priority groups were all in line with the literature as risk factors for the 3 diseases, such as elderly people for heart disease and stroke and those with low income for chronic lower respiratory diseases. The PGI was thus able to balance both high risk and population burden approaches in selecting priority groups, and thus it would address health inequities as well as disease burden in the overall population. The PGI is a quantitative method to select priority groups for public health interventions; it has the potential to enhance the effective use of limited public resources.
Biasi, Antonio; Martin, Frank N; Cacciola, Santa O; di San Lio, Gaetano Magnano; Grünwald, Niklaus J; Schena, Leonardo
2016-09-01
In all, 231 isolates of Phytophthora nicotianae representing 14 populations from different host genera, including agricultural crops (Citrus, Nicotiana, and Lycopersicon), potted ornamental species in nurseries (Lavandula, Convolvulus, Myrtus, Correa, and Ruta), and other plant genera were characterized using simple-sequence repeat markers. In total, 99 multilocus genotypes (MLG) were identified, revealing a strong association between genetic grouping and host of recovery, with most MLG being associated with a single host genus. Significant differences in the structure of populations were revealed but clonality prevailed in all populations. Isolates from Citrus were found to be genetically related regardless of their geographic origin and were characterized by high genetic uniformity and high inbreeding coefficients. Higher variability was observed for other populations and a significant geographical structuring was determined for isolates from Nicotiana. Detected differences were related to the propagation and cultivation systems of different crops. Isolates obtained from Citrus spp. are more likely to be distributed worldwide with infected plant material whereas Nicotiana and Lycopersicon spp. are propagated by seed, which would not contribute to the spread of the pathogen and result in a greater chance for geographic isolation of lineages. With regard to ornamental species in nurseries, the high genetic variation is likely the result of the admixture of diverse pathogen genotypes through the trade of infected plant material from various geographic origins, the presence of several hosts in the same nursery, and genetic recombination through sexual reproduction of this heterothallic species.
Dierker, Lisa; Rose, Jennifer; Tan, Xianming; Li, Runze
2010-12-01
This paper describes and compares a selection of available modeling techniques for identifying homogeneous population subgroups in the interest of informing targeted substance use intervention. We present a nontechnical review of the common and unique features of three methods: (a) trajectory analysis, (b) functional hierarchical linear modeling (FHLM), and (c) decision tree methods. Differences among the techniques are described, including required data features, strengths and limitations in terms of the flexibility with which outcomes and predictors can be modeled, and the potential of each technique for helping to inform the selection of targets and timing of substance intervention programs.
SOCIODEMOGRAPHIC DATA USED FOR IDENTIFYING ...
Due to unique social and demographic characteristics, various segments of the population may experience exposures different from those of the general population, which, in many cases, may be greater. When risk assessments do not characterize subsets of the general population, the populations that may experience the greatest risk remain unidentified. When such populations are not identified, the social and demographic data relevant to these populations is not considered when preparing exposure estimates, which can underestimate exposure and risk estimates for at-risk populations. Thus, it is necessary for risk or exposure assessors characterizing a diverse population, to first identify and then enumerate certain groups within the general population who are at risk for greater contaminant exposures. The document entitled Sociodemographic Data Used for Identifying Potentially Highly Exposed Populations (also referred to as the Highly Exposed Populations document), assists assessors in identifying and enumerating potentially highly exposed populations. This document presents data relating to factors which potentially impact an individual or group's exposure to environmental contaminants based on activity patterns (how time is spent), microenvironments (locations where time is spent), and other socio-demographic data such as age, gender, race and economic status. Populations potentially more exposed to various chemicals of concern, relative to the general population
Ben-Shimol, Shalom; Sagi, Orli; Greenberg, David
2014-04-01
Intestinal parasites cause significant morbidity worldwide, particularly in developing populations. At least three pediatric populations reside in southern Israel: the Bedouin population, the general Jewish population and Jewish children of Ethiopian origin. Our aim was to compare intestinal parasite prevalence between the three pediatric populations in southern Israel. This is a retrospective, laboratory, population-based surveillance. Most ova and parasite (O&P) tests in southern Israel (hospital and community obtained) are performed by the hospital parasitology laboratory. All pediatric stool O&P tests examined by the hospital laboratory between 2007 and 2011 were included. Overall, 45,978 samples were examined; 27,354, 16,969 and 1655 from Bedouin, non-Ethiopian Jewish and Ethiopian children, respectively. 16,317 parasites were identified in 12,325 (26.8%) positive samples. Total prevalences were 36%, 11% and 46% for Bedouin, non-Ethiopian Jewish and Ethiopian children, respectively. Blastocystis hominis, Giardia lamblia and Entamoeba species were the most common parasites identified, constituting ≥80% of positive samples in all groups. Hymenolepis nana was rarely identified in non-Ethiopian Jewish children (0.04% of isolates compared with 2.6% and 0.5% in Bedouin and Ethiopian children, respectively). Other helminths, excluding H. nana and Enterobius vermicularis, were identified almost exclusively in Ethiopian children ≥5years of age. In conclusion, the Bedouin and Ethiopian children were characterized by higher parasite prevalence in stool, compared with the non-Ethiopian Jewish children, probably reflecting higher intestinal parasitic disease rates. Certain helminthic infections were identified almost exclusively in the Ethiopian children. These differences may be associated with lifestyle differences between the three populations. © 2013.
Hinz, Andreas; Kittel, Jörg; Karoff, Marthin; Daig, Isolde
2011-01-01
Anxiety and depression are often found in cardiac patients, but also in the general population. Therefore, evaluation of these symptoms in patients requires a comparison with norm values. The purpose of this study was to explore differences between cardiac patients and the general population in age dependency of anxiety and depression, and to discuss possible reasons for these differences. A sample of German cardiac patients (n = 2,696) and a sample of the German general population (n = 2,037) were tested using the Hospital Anxiety and Depression Scale (HADS). While we confirmed a linear age trend of anxiety and depression in the general population, we observed an inverted U-shaped age dependency in the patient sample. Young patients are especially affected by anxiety and depression. Five items of the HADS that mainly contributed to the age differences were identified. Formal characteristics of these 5 items could not explain the age differences. Concerning the meaning of the items, however, most of the items refer to worrying about the future. The relatively low rates of anxiety and depression in older patients (compared with the general population) indicate that adaptation processes took place, which should be taken into account in studies concerning the psychological status of patients. Young patients need special attention when dealing with mental distress. Copyright © 2011 S. Karger AG, Basel.
Chen, Jun; Källman, Thomas; Ma, Xiao-Fei; Zaina, Giusi; Morgante, Michele; Lascoux, Martin
2016-01-01
The joint inference of selection and past demography remain a costly and demanding task. We used next generation sequencing of two pools of 48 Norway spruce mother trees, one corresponding to the Fennoscandian domain, and the other to the Alpine domain, to assess nucleotide polymorphism at 88 nuclear genes. These genes are candidate genes for phenological traits, and most belong to the photoperiod pathway. Estimates of population genetic summary statistics from the pooled data are similar to previous estimates, suggesting that pooled sequencing is reliable. The nonsynonymous SNPs tended to have both lower frequency differences and lower FST values between the two domains than silent ones. These results suggest the presence of purifying selection. The divergence between the two domains based on synonymous changes was around 5 million yr, a time similar to a recent phylogenetic estimate of 6 million yr, but much larger than earlier estimates based on isozymes. Two approaches, one of them novel and that considers both FST and difference in allele frequencies between the two domains, were used to identify SNPs potentially under diversifying selection. SNPs from around 20 genes were detected, including genes previously identified as main target for selection, such as PaPRR3 and PaGI. PMID:27172202
Chen, Jun; Källman, Thomas; Ma, Xiao-Fei; Zaina, Giusi; Morgante, Michele; Lascoux, Martin
2016-07-07
The joint inference of selection and past demography remain a costly and demanding task. We used next generation sequencing of two pools of 48 Norway spruce mother trees, one corresponding to the Fennoscandian domain, and the other to the Alpine domain, to assess nucleotide polymorphism at 88 nuclear genes. These genes are candidate genes for phenological traits, and most belong to the photoperiod pathway. Estimates of population genetic summary statistics from the pooled data are similar to previous estimates, suggesting that pooled sequencing is reliable. The nonsynonymous SNPs tended to have both lower frequency differences and lower FST values between the two domains than silent ones. These results suggest the presence of purifying selection. The divergence between the two domains based on synonymous changes was around 5 million yr, a time similar to a recent phylogenetic estimate of 6 million yr, but much larger than earlier estimates based on isozymes. Two approaches, one of them novel and that considers both FST and difference in allele frequencies between the two domains, were used to identify SNPs potentially under diversifying selection. SNPs from around 20 genes were detected, including genes previously identified as main target for selection, such as PaPRR3 and PaGI. Copyright © 2016 Chen et al.
Kale, Prashant; Shukla, Manoj; Soni, Gunjan; Patel, Ronak; Gupta, Shailendra
2014-01-01
Prashant Kale has 22 years of immense experience in the analytical and bioanalytical domain. He is Senior Vice President, Bioequivalence Operations of Lambda Therapeutic Research, India which includes Bioanalytical, Clinics, Clinical data management, Pharmacokinetics and Biostatistics, Protocol writing, Clinical lab and Quality Assurance departments. He has been with Lambda for over 14 years. By qualification he is a M.Sc. and an MBA. Mr. Kale is responsible for the management, technical and administrative functions of the BE unit located at Ahmedabad and Mumbai, India. He is also responsible for leading the process of integration between bioanalytical laboratories and services offered by Lambda at global locations (India and Canada). Mr. Kale has faced several regulatory audits and inspections from leading regulatory bodies including but not limited to DCGI, USFDA, ANVISA, Health Canada, UK MHRA, Turkey MoH, WHO. There are many challenges involved in the application of bioanalytical method on different populations. This includes difference in equipment, material and environment across laboratories, variations in the matrix characteristics in different populations, differences in techniques between analysts such as sample processing and handling and others. Additionally, there is variability in the PK of a drug in different populations. This article shows the effect of different populations on validated bioanalytical method and on the PK of a drug. Hence, the bioanalytical method developed and validated for a specific population may need required modification when applied to another population. Critical consideration of all such aspects is the key to successful implementation of a validated method on different populations.
Similar traits, different genes? Examining convergent evolution in related weedy rice populations.
Thurber, Carrie S; Jia, Melissa H; Jia, Yulin; Caicedo, Ana L
2013-02-01
Convergent phenotypic evolution may or may not be associated with convergent genotypic evolution. Agricultural weeds have repeatedly been selected for weed-adaptive traits such as rapid growth, increased seed dispersal and dormancy, thus providing an ideal system for the study of convergent evolution. Here, we identify QTL underlying weedy traits and compare their genetic architecture to assess the potential for convergent genetic evolution in two distinct populations of weedy rice. F(2) offspring from crosses between an indica cultivar and two individuals from genetically differentiated U.S. weedy rice populations were used to map QTL for four quantitative (heading date, seed shattering, plant height and growth rate) and two qualitative traits. We identified QTL on nine of the twelve rice chromosomes, yet most QTL locations do not overlap between the two populations. Shared QTL among weed groups were only seen for heading date, a trait for which weedy groups have diverged from their cultivated ancestors and from each other. Sharing of some QTL with wild rice also suggests a possible role in weed evolution for genes under selection during domestication. The lack of overlapping QTL for the remaining traits suggests that, despite a close evolutionary relationship, weedy rice groups have adapted to the same agricultural environment through different genetic mechanisms. © 2012 Blackwell Publishing Ltd.
Gardner, Bethany T.; Dale, Ann Marie; Buckner-Petty, Skye; Rachford, Robert; Strickland, Jaime; Kaskutas, Vicki; Evanoff, Bradley
2017-01-01
Purpose Few studies have explored measures of function across a range of health outcomes in a general working population. Using four upper extremity (UE) case definitions from the scientific literature, we described the performance of functional measures of work, activities of daily living, and overall health. Methods A sample of 573 workers completed several functional measures: modified recall versions of the QuickDASH, Levine Functional Status Scale (FSS), DASH Work module (DASH-W), and standard SF-8 physical component score. We determined case status based on four UE case definitions: 1) UE symptoms, 2) UE musculoskeletal disorders (MSD), 3) carpal tunnel syndrome (CTS), and 4) work limitations due to UE symptoms. We calculated effect sizes for each case definition to show the magnitude of the differences that were detected between cases and non-cases for each case definition on each functional measure. Sensitivity and specificity analyses showed how well each measure identified functional impairments across the UE case definitions. Results All measures discriminated between cases and non-cases for each case definition with the largest effect sizes for CTS and work limitations, particularly for the modified FSS and DASH-W measures. Specificity was high and sensitivity was low for outcomes of UE symptoms and UE MSD in all measures. Sensitivity was high for CTS and work limitations. Conclusions Functional measures developed specifically for use in clinical, treatment-seeking populations may identify mild levels of impairment in relatively healthy, active working populations, but measures performed better among workers with CTS or those reporting limitations at work. PMID:26091980
Population differences in brain morphology: Need for population specific brain template.
Rao, Naren P; Jeelani, Haris; Achalia, Rashmin; Achalia, Garima; Jacob, Arpitha; Bharath, Rose Dawn; Varambally, Shivarama; Venkatasubramanian, Ganesan; K Yalavarthy, Phaneendra
2017-07-30
Brain templates provide a standard anatomical platform for population based morphometric assessments. Typically, standard brain templates for such assessments are created using Caucasian brains, which may not be ideal to analyze brains from other ethnicities. To effectively demonstrate this, we compared brain morphometric differences between T1 weighted structural MRI images of 27 healthy Indian and Caucasian subjects of similar age and same sex ratio. Furthermore, a population specific brain template was created from MRI images of healthy Indian subjects and compared with standard Montreal Neurological Institute (MNI-152) template. We also examined the accuracy of registration of by acquiring a different T1 weighted MRI data set and registering them to newly created Indian template and MNI-152 template. The statistical analysis indicates significant difference in global brain measures and regional brain structures of Indian and Caucasian subjects. Specifically, the global brain measurements of the Indian brain template were smaller than that of the MNI template. Also, Indian brain images were better realigned to the newly created template than to the MNI-152 template. The notable variations in Indian and Caucasian brains convey the need to build a population specific Indian brain template and atlas. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.
Jackson, Matthew A; Bonder, Marc Jan; Kuncheva, Zhana; Zierer, Jonas; Fu, Jingyuan; Kurilshikov, Alexander; Wijmenga, Cisca; Zhernakova, Alexandra; Bell, Jordana T; Spector, Tim D; Steves, Claire J
2018-01-01
Microbes in the gut microbiome form sub-communities based on shared niche specialisations and specific interactions between individual taxa. The inter-microbial relationships that define these communities can be inferred from the co-occurrence of taxa across multiple samples. Here, we present an approach to identify comparable communities within different gut microbiota co-occurrence networks, and demonstrate its use by comparing the gut microbiota community structures of three geographically diverse populations. We combine gut microbiota profiles from 2,764 British, 1,023 Dutch, and 639 Israeli individuals, derive co-occurrence networks between their operational taxonomic units, and detect comparable communities within them. Comparing populations we find that community structure is significantly more similar between datasets than expected by chance. Mapping communities across the datasets, we also show that communities can have similar associations to host phenotypes in different populations. This study shows that the community structure within the gut microbiota is stable across populations, and describes a novel approach that facilitates comparative community-centric microbiome analyses.
Hirata, Satoshi; Kojima, Kaname; Misawa, Kazuharu; Gervais, Olivier; Kawai, Yosuke; Nagasaki, Masao
2018-05-01
Forensic DNA typing is widely used to identify missing persons and plays a central role in forensic profiling. DNA typing usually uses capillary electrophoresis fragment analysis of PCR amplification products to detect the length of short tandem repeat (STR) markers. Here, we analyzed whole genome data from 1,070 Japanese individuals generated using massively parallel short-read sequencing of 162 paired-end bases. We have analyzed 843,473 STR loci with two to six basepair repeat units and cataloged highly polymorphic STR loci in the Japanese population. To evaluate the performance of the cataloged STR loci, we compared 23 STR loci, widely used in forensic DNA typing, with capillary electrophoresis based STR genotyping results in the Japanese population. Seventeen loci had high correlations and high call rates. The other six loci had low call rates or low correlations due to either the limitations of short-read sequencing technology, the bioinformatics tool used, or the complexity of repeat patterns. With these analyses, we have also purified the suitable 218 STR loci with four basepair repeat units and 53 loci with five basepair repeat units both for short read sequencing and PCR based technologies, which would be candidates to the actual forensic DNA typing in Japanese population.
Functional brain activation differences in stuttering identified with a rapid fMRI sequence
Kraft, Shelly Jo; Choo, Ai Leen; Sharma, Harish; Ambrose, Nicoline G.
2011-01-01
The purpose of this study was to investigate whether brain activity related to the presence of stuttering can be identified with rapid functional MRI (fMRI) sequences that involved overt and covert speech processing tasks. The long-term goal is to develop sensitive fMRI approaches with developmentally appropriate tasks to identify deviant speech motor and auditory brain activity in children who stutter closer to the age at which recovery from stuttering is documented. Rapid sequences may be preferred for individuals or populations who do not tolerate long scanning sessions. In this report, we document the application of a picture naming and phoneme monitoring task in three minute fMRI sequences with adults who stutter (AWS). If relevant brain differences are found in AWS with these approaches that conform to previous reports, then these approaches can be extended to younger populations. Pairwise contrasts of brain BOLD activity between AWS and normally fluent adults indicated the AWS showed higher BOLD activity in the right inferior frontal gyrus (IFG), right temporal lobe and sensorimotor cortices during picture naming and and higher activity in the right IFG during phoneme monitoring. The right lateralized pattern of BOLD activity together with higher activity in sensorimotor cortices is consistent with previous reports, which indicates rapid fMRI sequences can be considered for investigating stuttering in younger participants. PMID:22133409
Morach, Marina; Stephan, Roger; Schmitt, Sarah; Ewers, Christa; Zschöck, Michael; Reyes-Velez, Julian; Gilli, Urs; Del Pilar Crespo-Ortiz, María; Crumlish, Margaret; Gunturu, Revathi; Daubenberger, Claudia A; Ip, Margaret; Regli, Walter; Johler, Sophia
2018-03-01
Streptococcus agalactiae is a leading cause of morbidity and mortality among neonates and causes severe infections in pregnant women and nonpregnant predisposed adults, in addition to various animal species worldwide. Still, information on the population structure of S. agalactiae and the geographical distribution of different clones is limited. Further data are urgently needed to identify particularly successful clones and obtain insights into possible routes of transmission within one host species and across species borders. We aimed to determine the population structure and virulence gene profiles of S. agalactiae strains from a diverse set of sources and geographical origins. To this end, 373 S. agalactiae isolates obtained from humans and animals from five different continents were typed by DNA microarray profiling. A total of 242 different S. agalactiae strains were identified and further analyzed. Particularly successful clonal lineages, hybridization patterns, and strains were identified that were spread across different continents and/or were present in more than one host species. In particular, several strains were detected in both humans and cattle, and several canine strains were also detected in samples from human, bovine, and porcine hosts. The findings of our study suggest that although S. agalactiae is well adapted to various hosts including humans, cattle, dogs, rodents, and fish, interspecies transmission is possible and occurs between humans and cows, dogs, and rabbits. The virulence and resistance gene profiles presented enable new insights into interspecies transmission and make a crucial contribution to the identification of suitable targets for therapeutic agents and vaccines.
Ziels, Ryan M; Sousa, Diana Z; Stensel, H David; Beck, David A C
2018-01-01
Fats, oils and greases (FOG) are energy-dense wastes that can be added to anaerobic digesters to substantially increase biomethane recovery via their conversion through long-chain fatty acids (LCFAs). However, a better understanding of the ecophysiology of syntrophic LCFA-degrading microbial communities in anaerobic digesters is needed to develop operating strategies that mitigate inhibitory LCFA accumulation from FOG. In this research, DNA stable isotope probing (SIP) was coupled with metagenomic sequencing for a genome-centric comparison of oleate (C18:1)-degrading populations in two anaerobic codigesters operated with either a pulse feeding or continuous-feeding strategy. The pulse-fed codigester microcosms converted oleate into methane at over 20% higher rates than the continuous-fed codigester microcosms. Differential coverage binning was demonstrated for the first time to recover population genome bins (GBs) from DNA-SIP metagenomes. About 70% of the 13C-enriched GBs were taxonomically assigned to the Syntrophomonas genus, thus substantiating the importance of Syntrophomonas species to LCFA degradation in anaerobic digesters. Phylogenetic comparisons of 13C-enriched GBs showed that phylogenetically distinct Syntrophomonas GBs were unique to each codigester. Overall, these results suggest that syntrophic populations in anaerobic digesters can have different adaptive capacities, and that selection for divergent populations may be achieved by adjusting reactor operating conditions to maximize biomethane recovery. PMID:28895946
Brucker, Eric
2009-01-01
International comparisons of the economic impact of population aging across nations can give valuable insights regarding which policies are most effective in addressing aging-related economic issues. Traditional old-age dependency ratios, by not accounting for differences in labor force participation rates, can be misleading. A new measure, the difference between an age group's share of total employment and its share of the total adult population, is developed and shown to be empirically sensitive to different policy actions. The analysis is built upon readily available and comparable International Labour Organization age-group data on population and labor force participation rates.
Bunten, H; Liang, W J; Pounder, D J; Seneviratne, C; Osselton, D
2011-09-01
Methadone is used worldwide for the treatment of heroin addiction; however, fatal poisonings are increasingly reported. The prevalence of CYP2B6 and μ-opioid receptor (OPRM1) gene variations were examined between a postmortem population where the deaths were associated with methadone and a live nondrug-using control population using Taqman™ SNP Genotyping assays. The CYP2B6*6 allele was higher in the postmortem population, but the difference was not significant (P = 0.92). The CYP2B6 T750C promoter variation was similar in frequency for both populations. Linkage between T750C and CYP2B6*6 was identified for both populations (P < 0.01). The prevalence of the OPRM1 A118G variation was significantly higher in the control population (P = 0.0046), which might indicate a protective mechanism against opioid toxicity. Individual susceptibility to methadone may be determined by screening for CYP2B6*6.
Bernhard, M.C.; Evans, M.B.; Kent, S.T.; Johnson, E.; Threadgill, S.L.; Tyson, S.; Becker, S.M.; Gohlke, J.M.
2013-01-01
Objectives Understanding and effectively addressing persistent health disparities in minority communities requires a clear picture of members’ concerns and priorities. This study was intended to engage residents in urban and rural communities in order to identify environmental health priorities. Specific emphasis was placed on how the communities defined the term environment, their perceptions of environmental exposures as affecting their health, specific priorities in their communities, and differences in urban versus rural populations. Study design A community-engaged approach was used to develop and implement focus groups and compare environmental health priorities in urban versus rural communities. Methods A total of eight focus groups were conducted: four in rural and four in urban communities. Topics included defining the term environment, how the environment may affect health, and environmental priorities within their communities, using both open discussion and a predefined list. Data were analysed both qualitatively and quantitatively to identify patterns and trends. Results There were important areas of overlap in priorities between urban and rural communities; both emphasized the importance of the social environment and shared a concern over air pollution from industrial sources. In contrast, for urban focus groups, abandoned houses and their social and physical sequelae were a high priority while concerns about adequate sewer and water services and road maintenance were high priorities in rural communities. Conclusions This study was able to identify environmental health priorities in urban versus rural minority communities. In contrast to some previous risk perception research, the results of this study suggest prioritization of tangible, known risks in everyday life instead of rare, disaster-related events, even in communities that have recently experienced devastating damage from tornadoes. The findings can help inform future efforts to study
The Reliability of Difference Scores in Populations and Samples
ERIC Educational Resources Information Center
Zimmerman, Donald W.
2009-01-01
This study was an investigation of the relation between the reliability of difference scores, considered as a parameter characterizing a population of examinees, and the reliability estimates obtained from random samples from the population. The parameters in familiar equations for the reliability of difference scores were redefined in such a way…
Effects of different sources of physically effective fiber on rumen microbial populations.
Shaw, C N; Kim, M; Eastridge, M L; Yu, Z
2016-03-01
Physically effective fiber is needed by dairy cattle to prevent ruminal acidosis. This study aimed to examine the effects of different sources of physically effective fiber on the populations of fibrolytic bacteria and methanogens. Five ruminally cannulated Holstein cows were each fed five diets differing in physically effective fiber sources over 15 weeks (21 days/period) in a Latin Square design: (1) 44.1% corn silage, (2) 34.0% corn silage plus 11.5% alfalfa hay, (3) 34.0% corn silage plus 5.1% wheat straw, (4) 36.1% corn silage plus 10.1% wheat straw, and (5) 34.0% corn silage plus 5.5% corn stover. The impact of the physically effective fiber sources on total bacteria and archaea were examined using denaturing gradient gel electrophoresis. Specific real-time PCR assays were used to quantify total bacteria, total archaea, the genus Butyrivibrio, Fibrobacter succinogenes, Ruminococcus albus, Ruminococcus flavefaciens and three uncultured rumen bacteria that were identified from adhering ruminal fractions in a previous study. No significant differences were observed among the different sources of physical effective fiber with respect to the microbial populations quantified. Any of the physically effective fiber sources may be fed to dairy cattle without negative impact on the ruminal microbial community.
van Dillen, Jeroen; Stekelenburg, Jelle; Schutte, Joke; Walraven, Gijs; van Roosmalen, Jos
2007-01-01
To illustrate how maternal mortality audit identifies different causes of and contributing factors to maternal deaths in different settings in low- and high-income countries and how this can lead to local solutions in reducing maternal deaths. Descriptive study of maternal mortality from different settings and review of data on the history of reducing maternal mortality in what are now high-income countries. Kalabo district in Zambia, Farafenni division in The Gambia, Onandjokwe district in Namibia, and the Netherlands. Population of rural areas in Zambia and The Gambia, peri-urban population in Namibia and nationwide data from the Netherlands. Data from facility-based maternal mortality audits from three African hospitals and data from the latest confidential enquiry in the Netherlands. Maternal mortality ratio (MMR), causes (direct and indirect) and characteristics. MMR ranged from 10 per 100,000 (the Netherlands) to 1,540 per 100,000 (The Gambia). Differences in causes of deaths were characterized by HIV/AIDS in Namibia, sepsis and HIV/AIDS in Zambia, (pre-)eclampsia in The Netherlands and obstructed labour in The Gambia. Differences in maternal mortality are more than just differences between the rich and poor. Acknowledging the magnitude of maternal mortality and harnessing a strong political will to tackle the issues are important factors. However, there is no single, general solution to reduce maternal mortality, and identification of problems needs to be promoted through audit, both national and local.
Identifying and Assessing Interesting Subgroups in a Heterogeneous Population.
Lee, Woojoo; Alexeyenko, Andrey; Pernemalm, Maria; Guegan, Justine; Dessen, Philippe; Lazar, Vladimir; Lehtiö, Janne; Pawitan, Yudi
2015-01-01
Biological heterogeneity is common in many diseases and it is often the reason for therapeutic failures. Thus, there is great interest in classifying a disease into subtypes that have clinical significance in terms of prognosis or therapy response. One of the most popular methods to uncover unrecognized subtypes is cluster analysis. However, classical clustering methods such as k-means clustering or hierarchical clustering are not guaranteed to produce clinically interesting subtypes. This could be because the main statistical variability--the basis of cluster generation--is dominated by genes not associated with the clinical phenotype of interest. Furthermore, a strong prognostic factor might be relevant for a certain subgroup but not for the whole population; thus an analysis of the whole sample may not reveal this prognostic factor. To address these problems we investigate methods to identify and assess clinically interesting subgroups in a heterogeneous population. The identification step uses a clustering algorithm and to assess significance we use a false discovery rate- (FDR-) based measure. Under the heterogeneity condition the standard FDR estimate is shown to overestimate the true FDR value, but this is remedied by an improved FDR estimation procedure. As illustrations, two real data examples from gene expression studies of lung cancer are provided.
Identifying and Assessing Interesting Subgroups in a Heterogeneous Population
Lee, Woojoo; Alexeyenko, Andrey; Pernemalm, Maria; Guegan, Justine; Dessen, Philippe; Lazar, Vladimir; Lehtiö, Janne; Pawitan, Yudi
2015-01-01
Biological heterogeneity is common in many diseases and it is often the reason for therapeutic failures. Thus, there is great interest in classifying a disease into subtypes that have clinical significance in terms of prognosis or therapy response. One of the most popular methods to uncover unrecognized subtypes is cluster analysis. However, classical clustering methods such as k-means clustering or hierarchical clustering are not guaranteed to produce clinically interesting subtypes. This could be because the main statistical variability—the basis of cluster generation—is dominated by genes not associated with the clinical phenotype of interest. Furthermore, a strong prognostic factor might be relevant for a certain subgroup but not for the whole population; thus an analysis of the whole sample may not reveal this prognostic factor. To address these problems we investigate methods to identify and assess clinically interesting subgroups in a heterogeneous population. The identification step uses a clustering algorithm and to assess significance we use a false discovery rate- (FDR-) based measure. Under the heterogeneity condition the standard FDR estimate is shown to overestimate the true FDR value, but this is remedied by an improved FDR estimation procedure. As illustrations, two real data examples from gene expression studies of lung cancer are provided. PMID:26339613
Yao, Youyuan; Xu, Miao; Liang, Liming; Zhang, Haojiong; Xu, Ruihua; Feng, Qisheng; Feng, Lin; Luo, Bing; Zeng, Yi-Xin
2017-10-01
Epstein-Barr virus is a ubiquitous virus and is associated with several human malignances, including the significant subset of gastric carcinoma, Epstein-Barr virus-associated gastric carcinoma. Some Epstein-Barr virus-associated diseases are uniquely prevalent in populations with different geographic origins. However, the features of the disease and geographically associated Epstein-Barr virus genetic variation as well as the roles that the variation plays in carcinogenesis and evolution remain unclear. Therefore, in this study, we sequenced 95 geographically distinct Epstein-Barr virus isolates from Epstein-Barr virus-associated gastric carcinoma biopsies and saliva of healthy donors to detect variants and genes associated with gastric carcinoma and population structure from a genome-wide spectrum. We demonstrated that Epstein-Barr virus revealed the population structure between North China and South China. In addition, we observed population stratification between Epstein-Barr virus strains from gastric carcinoma and healthy controls, indicating that certain Epstein-Barr virus subtypes are associated with different gastric carcinoma risks. We identified that the BRLF1, BBRF3, and BBLF2/BBLF3 genes had significant associations with gastric carcinoma. LMP1 and BNLF2a genes were strongly geographically associated genes in Epstein-Barr virus. Our study provides insights into the genetic basis of oncogenic Epstein-Barr virus for gastric carcinoma, and the genetic variants associated with gastric carcinoma can serve as biomarkers for oncogenic Epstein-Barr virus.
Computer simulation models as tools for identifying research needs: A black duck population model
Ringelman, J.K.; Longcore, J.R.
1980-01-01
Existing data on the mortality and production rates of the black duck (Anas rubripes) were used to construct a WATFIV computer simulation model. The yearly cycle was divided into 8 phases: hunting, wintering, reproductive, molt, post-molt, and juvenile dispersal mortality, and production from original and renesting attempts. The program computes population changes for sex and age classes during each phase. After completion of a standard simulation run with all variable default values in effect, a sensitivity analysis was conducted by changing each of 50 input variables, 1 at a time, to assess the responsiveness of the model to changes in each variable. Thirteen variables resulted in a substantial change in population level. Adult mortality factors were important during hunting and wintering phases. All production and mortality associated with original nesting attempts were sensitive, as was juvenile dispersal mortality. By identifying those factors which invoke the greatest population change, and providing an indication of the accuracy required in estimating these factors, the model helps to identify those variables which would be most profitable topics for future research.
Design Factors Affect User Experience for Different Cultural Populations
ERIC Educational Resources Information Center
Chu, Sauman
2016-01-01
With increasing changes in our demographic populations and new immigrants settling in the US, there is an increasing need for visual communications that address the diversity of our populations. This paper draws from the results of the researcher's several past research and teaching projects that worked with different cultural populations. These…
Kopelman, Naama M; Stone, Lewi; Wang, Chaolong; Gefel, Dov; Feldman, Marcus W; Hillel, Jossi; Rosenberg, Noah A
2009-12-08
Genetic studies have often produced conflicting results on the question of whether distant Jewish populations in different geographic locations share greater genetic similarity to each other or instead, to nearby non-Jewish populations. We perform a genome-wide population-genetic study of Jewish populations, analyzing 678 autosomal microsatellite loci in 78 individuals from four Jewish groups together with similar data on 321 individuals from 12 non-Jewish Middle Eastern and European populations. We find that the Jewish populations show a high level of genetic similarity to each other, clustering together in several types of analysis of population structure. Further, Bayesian clustering, neighbor-joining trees, and multidimensional scaling place the Jewish populations as intermediate between the non-Jewish Middle Eastern and European populations. These results support the view that the Jewish populations largely share a common Middle Eastern ancestry and that over their history they have undergone varying degrees of admixture with non-Jewish populations of European descent.
2009-01-01
Background Genetic studies have often produced conflicting results on the question of whether distant Jewish populations in different geographic locations share greater genetic similarity to each other or instead, to nearby non-Jewish populations. We perform a genome-wide population-genetic study of Jewish populations, analyzing 678 autosomal microsatellite loci in 78 individuals from four Jewish groups together with similar data on 321 individuals from 12 non-Jewish Middle Eastern and European populations. Results We find that the Jewish populations show a high level of genetic similarity to each other, clustering together in several types of analysis of population structure. Further, Bayesian clustering, neighbor-joining trees, and multidimensional scaling place the Jewish populations as intermediate between the non-Jewish Middle Eastern and European populations. Conclusion These results support the view that the Jewish populations largely share a common Middle Eastern ancestry and that over their history they have undergone varying degrees of admixture with non-Jewish populations of European descent. PMID:19995433
Density-based clustering analyses to identify heterogeneous cellular sub-populations
NASA Astrophysics Data System (ADS)
Heaster, Tiffany M.; Walsh, Alex J.; Landman, Bennett A.; Skala, Melissa C.
2017-02-01
Autofluorescence microscopy of NAD(P)H and FAD provides functional metabolic measurements at the single-cell level. Here, density-based clustering algorithms were applied to metabolic autofluorescence measurements to identify cell-level heterogeneity in tumor cell cultures. The performance of the density-based clustering algorithm, DENCLUE, was tested in samples with known heterogeneity (co-cultures of breast carcinoma lines). DENCLUE was found to better represent the distribution of cell clusters compared to Gaussian mixture modeling. Overall, DENCLUE is a promising approach to quantify cell-level heterogeneity, and could be used to understand single cell population dynamics in cancer progression and treatment.
Medfly populations differ in diel and age patterns of sexual signalling
Diamantidis, Alexandros D.; Papadopoulos, Nikos T.; Carey, James R.
2009-01-01
Insect populations may differ in several life history traits, including behavioural ones such as sexual signalling. We tested whether male Mediterranean fruit fly (medlfy), Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), populations obtained from geographically isolated areas exhibit differences in quantitative and qualitative aspects of male sexual signalling. Male sexual signalling was studied in four medfly populations (originating from Brazil, Portugal, Kenya, and Greece) under identical laboratory conditions (25 °C, 60% r.h., and L14:D10). The four populations had been reared for one generation in the laboratory. Sexual signalling was studied in the F1 progeny that were fed one of two diets (yeast hydrolysate plus sugar or sugar only). On both diets, the four populations differed significantly in the progress of maturity (indicated by the average number of males exhibiting sexual signalling) and in the quantity of signalling after attaining maturity. Yeast availability significantly increased sexual signalling; however, it had a different impact on the quantity of signalling in the different populations. A bimodal pattern of sexual signalling, with one peak at approximately 08:00–09:00 hours and the second at approximately 13:00–14:00 hours, was recorded for all populations and diets. However, quantitative differences among the populations within the ‘sexually active’ period of the day resulted in significant differences in the daily pattern of sexual signalling. The significance of these findings for understanding adaptations of geographically-isolated medfly populations to different ecosystems, as well as its practical importance for the application of the Sterile Insect Technique (SIT) against C. capitata, is discussed. PMID:19774092
USDA-ARS?s Scientific Manuscript database
Individualized copy number variation (CNV) maps have highlighted the need for population surveys of cattle to detect rare and common variants. While SNP and comparative genomic hybridization (CGH) arrays have provided preliminary data, next-generation sequence (NGS) data analysis offers an increased...
A Method for Identifying Prevalent Chemical Combinations in the U.S. Population
Wambaugh, John F.; Ring, Caroline L.; Tornero-Velez, Rogelio; Setzer, R. Woodrow
2017-01-01
Background: Through the food and water they ingest, the air they breathe, and the consumer products with which they interact at home and at work, humans are exposed to tens of thousands of chemicals, many of which have not been evaluated to determine their potential toxicities. Furthermore, while current chemical testing tends to focus on individual chemicals, the exposures that people actually experience involve mixtures of chemicals. Unfortunately, the number of mixtures that can be formed from the thousands of environmental chemicals is enormous, and testing all of them would be impossible. Objectives: We seek to develop and demonstrate a method for identifying those mixtures that are most prevalent in humans. Methods: We applied frequent itemset mining, a technique traditionally used for market basket analysis, to biomonitoring data from the 2009–2010 cycle of the continuous National Health and Nutrition Examination Survey (NHANES) to identify combinations of chemicals that frequently co-occur in people. Results: We identified 90 chemical combinations consisting of relatively few chemicals that occur in at least 30% of the U.S. population, as well as three supercombinations consisting of relatively many chemicals that occur in a small but nonnegligible proportion of the U.S. population. Conclusions: We demonstrated how FIM can be used in conjunction with biomonitoring data to narrow a large number of possible chemical combinations down to a smaller set of prevalent chemical combinations. https://doi.org/10.1289/EHP1265 PMID:28858827
Stam, Remco; Scheikl, Daniela; Tellier, Aurélien
2016-01-01
Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. PMID:27189991
Comparison of Y-STR polymorphisms in three different Slovak population groups.
Petrejcíková, Eva; Siváková, Daniela; Soták, Miroslav; Bernasovská, Jarmila; Bernasovský, Ivan; Rebała, Krzysztof; Boronová, Iveta; Bôziková, Alexandra; Sovicová, Adriana; Gabriková, Dana; Maceková, Sona; Svícková, Petra; Carnogurská, Jana
2010-01-01
Eleven Y-chromosomal microsatellite loci included in the Powerplex Y multiplex kit were analyzed in different Slovak population samples: Habans (n = 39), Romanies (n = 100) and Slovak Caucasian (n = 148) individuals, respectively, from different regions of Slovakia. The analysis of molecular variance between populations indicated that 89.27% of the haplotypic variations were found within populations and only 10.72% between populations (Fst = 0.1027; p = 0.0000). The haplotype diversities were ranging from 0.9258 to 0.9978, and indicated a high potential for differentiating between male individuals. The study reports differences in allele frequencies between the Romanies, Habans and Slovak Caucasian men. Selected loci showed that both the Romany and Haban population belonged to endogamous and relatively small founder population groups, which developed in relatively reproductive isolated groups surrounded by the Slovak Caucasian population.
Yu, Haixin; Ji, Rui; Ye, Wenfeng; Chen, Hongdan; Lai, Wenxiang; Fu, Qiang; Lou, Yonggen
2014-01-01
The brown planthopper (BPH), Nilaparvata lugens (Stål), one of the most serious rice insect pests in Asia, can quickly overcome rice resistance by evolving new virulent populations. The insect fat body plays essential roles in the life cycles of insects and in plant-insect interactions. However, whether differences in fat body transcriptomes exist between insect populations with different virulence levels and whether the transcriptomic differences are related to insect virulence remain largely unknown. In this study, we performed transcriptome-wide analyses on the fat bodies of two BPH populations with different virulence levels in rice. The populations were derived from rice variety TN1 (TN1 population) and Mudgo (M population). In total, 33,776 and 32,332 unigenes from the fat bodies of TN1 and M populations, respectively, were generated using Illumina technology. Gene ontology annotations and Kyoto Encyclopedia of Genes and Genomes (KEGG) orthology classifications indicated that genes related to metabolism and immunity were significantly active in the fat bodies. In addition, a total of 339 unigenes showed homology to genes of yeast-like symbionts (YLSs) from 12 genera and endosymbiotic bacteria Wolbachia. A comparative analysis of the two transcriptomes generated 7,860 differentially expressed genes. GO annotations and enrichment analysis of KEGG pathways indicated these differentially expressed transcripts might be involved in metabolism and immunity. Finally, 105 differentially expressed genes from YLSs and Wolbachia were identified, genes which might be associated with the formation of different virulent populations. This study was the first to compare the fat-body transcriptomes of two BPH populations having different virulence traits and to find genes that may be related to this difference. Our findings provide a molecular resource for future investigations of fat bodies and will be useful in examining the interactions between the fat body and virulence
Aging and differentiation in yeast populations: elders with different properties and functions.
Palková, Zdena; Wilkinson, Derek; Váchová, Libuše
2014-02-01
Over the past decade, it has become evident that similarly to cells forming metazoan tissues, yeast cells have the ability to differentiate and form specialized cell types. Examples of yeast cellular differentiation have been identified both in yeast liquid cultures and within multicellular structures occupying solid surfaces. Most current knowledge on different cell types comes from studies of the spatiotemporal internal architecture of colonies developing on various media. With a few exceptions, yeast cell differentiation often concerns nongrowing, stationary-phase cells and leads to the formation of cell subpopulations differing in stress resistance, cell metabolism, respiration, ROS production, and others. These differences can affect longevity of particular subpopulations. In contrast to liquid cultures, where various cell types are dispersed within stationary-phase populations, cellular differentiation depends on the specific position of particular cells within multicellular colonies. Differentiated colonies, thus, resemble primitive multicellular organisms, in which the gradients of certain compounds and the position of cells within the structure affect cellular differentiation. In this review, we summarize and compare the properties of diverse types of differentiated chronologically aging yeast cells that have been identified in colonies growing on different media, as well as of those found in liquid cultures. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Bradley, Paul W; Gervasi, Stephanie S; Hua, Jessica; Cothran, Rickey D; Relyea, Rick A; Olson, Deanna H; Blaustein, Andrew R
2015-10-01
Contributing to the worldwide biodiversity crisis are emerging infectious diseases, which can lead to extirpations and extinctions of hosts. For example, the infectious fungal pathogen Batrachochytrium dendrobatidis (Bd) is associated with worldwide amphibian population declines and extinctions. Sensitivity to Bd varies with species, season, and life stage. However, there is little information on whether sensitivity to Bd differs among populations, which is essential for understanding Bd-infection dynamics and for formulating conservation strategies. We experimentally investigated intraspecific differences in host sensitivity to Bd across 10 populations of wood frogs (Lithobates sylvaticus) raised from eggs to metamorphosis. We exposed the post-metamorphic wood frogs to Bd and monitored survival for 30 days under controlled laboratory conditions. Populations differed in overall survival and mortality rate. Infection load also differed among populations but was not correlated with population differences in risk of mortality. Such population-level variation in sensitivity to Bd may result in reservoir populations that may be a source for the transmission of Bd to other sensitive populations or species. Alternatively, remnant populations that are less sensitive to Bd could serve as sources for recolonization after epidemic events. © 2015 Society for Conservation Biology.
Identifying dietary differences between Scotland and England: a rapid review of the literature.
Chambers, Stephanie; Barton, Karen L; Albani, Viviana; Anderson, Annie S; Wrieden, Wendy L
2017-10-01
Rates of premature mortality have been higher in Scotland than in England since the 1970s. Given the known association of diet with chronic disease, the study objective was to identify and synthesise evidence on current and historical differences in food and nutrient intakes in Scotland and England. A rapid review of the peer-reviewed and grey literature was carried out. After an initial scoping search, Medline, CINAHL, Embase and Web of Science were searched. Relevant grey literature was also included. Inclusion criteria were: any date; measures of dietary intake; representative populations; cross-sectional or observational cohort studies; and English-language publications. Study quality was assessed using the Quality Assessment Tool for Observational Cohort and Cross-sectional Studies. A narrative synthesis of extracted information was conducted. Fifty publications and reports were included in the review. Results indicated that children and adults in Scotland had lower intakes of vegetables and vitamins compared with those living in England. Higher intakes of salt in Scotland were also identified. Data were limited by small Scottish samples, difficulty in finding England-level data, lack of statistical testing and adjustment for key confounders. Further investigation of adequately powered and analysed surveys is required to examine more fully dietary differences between Scotland and England. This would provide greater insight into potential causes of excess mortality in Scotland compared with England and suitable policy recommendations to address these inequalities.
Are There Different Populations of Flux Ropes in the Solar Wind?
NASA Astrophysics Data System (ADS)
Janvier, M.; Démoulin, P.; Dasso, S.
2014-07-01
Flux ropes are twisted magnetic structures that can be detected by in-situ measurements in the solar wind. However, different properties of detected flux ropes suggest different types of flux-rope populations. As such, are there different populations of flux ropes? The answer is positive and is the result of the analysis of four lists of flux ropes, including magnetic clouds (MCs), observed at 1 AU. The in-situ data for the four lists were fitted with the same cylindrical force-free field model, which provides an estimate of the local flux-rope parameters such as its radius and orientation. Since the flux-rope distributions have a broad dynamic range, we went beyond a simple histogram analysis by developing a partition technique that uniformly distributes the statistical fluctuations across the radius range. By doing so, we found that small flux ropes with radius R<0.1 AU have a steep power-law distribution in contrast to the larger flux ropes (identified as MCs), which have a Gaussian-like distribution. Next, from four CME catalogs, we estimated the expected flux-rope frequency per year at 1 AU. We found that the predicted numbers are similar to the frequencies of MCs observed in-situ. However, we also found that small flux ropes are at least ten times too abundant to correspond to CMEs, even to narrow ones. Investigating the different possible scenarios for the origin of these small flux ropes, we conclude that these twisted structures can be formed by blowout jets in the low corona or in coronal streamers.
Peltzer, Karl
2017-05-09
The study aims to investigate sleep duration in four different population groups in a national probability sample of older South Africans who participated in the Study of Global Ageing and Adult Health (SAGE) Wave 1. A national population-based cross-sectional study with a sample of 3284 aged 50 years or older in South Africa was conducted in 2008. The questionnaire included socio-demographic characteristics, health variables, and self-reported sleep duration. Results indicate that White Africans compared to other population groups had the lowest mean sleep duration (7.88 h among men and 7.46 h among women). The prevalence of short sleep was the highest among both men and women among the White African (18.8% in men and 16.9% in women) and Indian or Asian African population groups (14.5% in men and 17.1% in women), and lowest among both men and women in the Black African (7.0% in men and 6.5% in women) and multi-ancestry population groups (15.6% in men and 12.7% in women). The prevalence of long sleep was among both men and women the highest in the Black African population group (56.2% in men and 58.5% in women), and the lowest in the White African population group (36.4% in men and 24.3% in women). In a Poisson regression model, adjusted for sociodemographics and chronic disease status, coming from the male and female White African population group was associated with short sleep. In addition, coming from the Indian or Asian African population group was associated with short sleep. No population group differences were found regarding long sleep prevalence. White Africans reported more short sleep duration than the other population groups, while there were no racial or ethnic differences in long sleep. White Africans are more likely to have sleep durations that are associated with negative health outcomes. An explanation of the high short sleep prevalence among White Africans may be related to their racial or ethnic minority status in South Africa.
Differences in Sleep Duration among Four Different Population Groups of Older Adults in South Africa
Peltzer, Karl
2017-01-01
The study aims to investigate sleep duration in four different population groups in a national probability sample of older South Africans who participated in the Study of Global Ageing and Adult Health (SAGE) Wave 1. A national population-based cross-sectional study with a sample of 3284 aged 50 years or older in South Africa was conducted in 2008. The questionnaire included socio-demographic characteristics, health variables, and self-reported sleep duration. Results indicate that White Africans compared to other population groups had the lowest mean sleep duration (7.88 h among men and 7.46 h among women). The prevalence of short sleep was the highest among both men and women among the White African (18.8% in men and 16.9% in women) and Indian or Asian African population groups (14.5% in men and 17.1% in women), and lowest among both men and women in the Black African (7.0% in men and 6.5% in women) and multi-ancestry population groups (15.6% in men and 12.7% in women). The prevalence of long sleep was among both men and women the highest in the Black African population group (56.2% in men and 58.5% in women), and the lowest in the White African population group (36.4% in men and 24.3% in women). In a Poisson regression model, adjusted for sociodemographics and chronic disease status, coming from the male and female White African population group was associated with short sleep. In addition, coming from the Indian or Asian African population group was associated with short sleep. No population group differences were found regarding long sleep prevalence. White Africans reported more short sleep duration than the other population groups, while there were no racial or ethnic differences in long sleep. White Africans are more likely to have sleep durations that are associated with negative health outcomes. An explanation of the high short sleep prevalence among White Africans may be related to their racial or ethnic minority status in South Africa. PMID:28486421
Wu, Chen; Yang, Handong; Yu, Dianke; Yang, Xiaobo; Zhang, Xiaomin; Wang, Yiqin; Sun, Jielin; Gao, Yong; Tan, Aihua; He, Yunfeng; Zhang, Haiying; Qin, Xue; Zhu, Jingwen; Li, Huaixing; Lin, Xu; Zhu, Jiang; Min, Xinwen; Lang, Mingjian; Li, Dongfeng; Zhai, Kan; Chang, Jiang; Tan, Wen; Yuan, Jing; Chen, Weihong; Wang, Youjie; Wei, Sheng; Miao, Xiaoping; Wang, Feng; Fang, Weimin; Liang, Yuan; Deng, Qifei; Dai, Xiayun; Lin, Dafeng; Huang, Suli; Guo, Huan; Lilly Zheng, S.; Xu, Jianfeng; Lin, Dongxin; Hu, Frank B.; Wu, Tangchun
2013-01-01
Plasma lipid levels are important risk factors for cardiovascular disease and are influenced by genetic and environmental factors. Recent genome wide association studies (GWAS) have identified several lipid-associated loci, but these loci have been identified primarily in European populations. In order to identify genetic markers for lipid levels in a Chinese population and analyze the heterogeneity between Europeans and Asians, especially Chinese, we performed a meta-analysis of two genome wide association studies on four common lipid traits including total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL) and high-density lipoprotein cholesterol (HDL) in a Han Chinese population totaling 3,451 healthy subjects. Replication was performed in an additional 8,830 subjects of Han Chinese ethnicity. We replicated eight loci associated with lipid levels previously reported in a European population. The loci genome wide significantly associated with TC were near DOCK7, HMGCR and ABO; those genome wide significantly associated with TG were near APOA1/C3/A4/A5 and LPL; those genome wide significantly associated with LDL were near HMGCR, ABO and TOMM40; and those genome wide significantly associated with HDL were near LPL, LIPC and CETP. In addition, an additive genotype score of eight SNPs representing the eight loci that were found to be associated with lipid levels was associated with higher TC, TG and LDL levels (P = 5.52×10-16, 1.38×10-6 and 5.59×10-9, respectively). These findings suggest the cumulative effects of multiple genetic loci on plasma lipid levels. Comparisons with previous GWAS of lipids highlight heterogeneity in allele frequency and in effect size for some loci between Chinese and European populations. The results from our GWAS provided comprehensive and convincing evidence of the genetic determinants of plasma lipid levels in a Chinese population. PMID:24386095
Hierarchical differences in population coding within auditory cortex.
Downer, Joshua D; Niwa, Mamiko; Sutter, Mitchell L
2017-08-01
Most models of auditory cortical (AC) population coding have focused on primary auditory cortex (A1). Thus our understanding of how neural coding for sounds progresses along the cortical hierarchy remains obscure. To illuminate this, we recorded from two AC fields: A1 and middle lateral belt (ML) of rhesus macaques. We presented amplitude-modulated (AM) noise during both passive listening and while the animals performed an AM detection task ("active" condition). In both fields, neurons exhibit monotonic AM-depth tuning, with A1 neurons mostly exhibiting increasing rate-depth functions and ML neurons approximately evenly distributed between increasing and decreasing functions. We measured noise correlation ( r noise ) between simultaneously recorded neurons and found that whereas engagement decreased average r noise in A1, engagement increased average r noise in ML. This finding surprised us, because attentive states are commonly reported to decrease average r noise We analyzed the effect of r noise on AM coding in both A1 and ML and found that whereas engagement-related shifts in r noise in A1 enhance AM coding, r noise shifts in ML have little effect. These results imply that the effect of r noise differs between sensory areas, based on the distribution of tuning properties among the neurons within each population. A possible explanation of this is that higher areas need to encode nonsensory variables (e.g., attention, choice, and motor preparation), which impart common noise, thus increasing r noise Therefore, the hierarchical emergence of r noise -robust population coding (e.g., as we observed in ML) enhances the ability of sensory cortex to integrate cognitive and sensory information without a loss of sensory fidelity. NEW & NOTEWORTHY Prevailing models of population coding of sensory information are based on a limited subset of neural structures. An important and under-explored question in neuroscience is how distinct areas of sensory cortex differ in their
267 Spanish Exomes Reveal Population-Specific Differences in Disease-Related Genetic Variation
Dopazo, Joaquín; Amadoz, Alicia; Bleda, Marta; Garcia-Alonso, Luz; Alemán, Alejandro; García-García, Francisco; Rodriguez, Juan A.; Daub, Josephine T.; Muntané, Gerard; Rueda, Antonio; Vela-Boza, Alicia; López-Domingo, Francisco J.; Florido, Javier P.; Arce, Pablo; Ruiz-Ferrer, Macarena; Méndez-Vidal, Cristina; Arnold, Todd E.; Spleiss, Olivia; Alvarez-Tejado, Miguel; Navarro, Arcadi; Bhattacharya, Shomi S.; Borrego, Salud; Santoyo-López, Javier; Antiñolo, Guillermo
2016-01-01
Recent results from large-scale genomic projects suggest that allele frequencies, which are highly relevant for medical purposes, differ considerably across different populations. The need for a detailed catalog of local variability motivated the whole-exome sequencing of 267 unrelated individuals, representative of the healthy Spanish population. Like in other studies, a considerable number of rare variants were found (almost one-third of the described variants). There were also relevant differences in allelic frequencies in polymorphic variants, including ∼10,000 polymorphisms private to the Spanish population. The allelic frequencies of variants conferring susceptibility to complex diseases (including cancer, schizophrenia, Alzheimer disease, type 2 diabetes, and other pathologies) were overall similar to those of other populations. However, the trend is the opposite for variants linked to Mendelian and rare diseases (including several retinal degenerative dystrophies and cardiomyopathies) that show marked frequency differences between populations. Interestingly, a correspondence between differences in allelic frequencies and disease prevalence was found, highlighting the relevance of frequency differences in disease risk. These differences are also observed in variants that disrupt known drug binding sites, suggesting an important role for local variability in population-specific drug resistances or adverse effects. We have made the Spanish population variant server web page that contains population frequency information for the complete list of 170,888 variant positions we found publicly available (http://spv.babelomics.org/), We show that it if fundamental to determine population-specific variant frequencies to distinguish real disease associations from population-specific polymorphisms. PMID:26764160
Stam, Remco; Scheikl, Daniela; Tellier, Aurélien
2016-06-02
Nod-like receptors (NLRs) are nucleotide-binding domain and leucine-rich repeats containing proteins that are important in plant resistance signaling. Many of the known pathogen resistance (R) genes in plants are NLRs and they can recognize pathogen molecules directly or indirectly. As such, divergence and copy number variants at these genes are found to be high between species. Within populations, positive and balancing selection are to be expected if plants coevolve with their pathogens. In order to understand the complexity of R-gene coevolution in wild nonmodel species, it is necessary to identify the full range of NLRs and infer their evolutionary history. Here we investigate and reveal polymorphism occurring at 220 NLR genes within one population of the partially selfing wild tomato species Solanum pennellii. We use a combination of enrichment sequencing and pooling ten individuals, to specifically sequence NLR genes in a resource and cost-effective manner. We focus on the effects which different mapping and single nucleotide polymorphism calling software and settings have on calling polymorphisms in customized pooled samples. Our results are accurately verified using Sanger sequencing of polymorphic gene fragments. Our results indicate that some NLRs, namely 13 out of 220, have maintained polymorphism within our S. pennellii population. These genes show a wide range of πN/πS ratios and differing site frequency spectra. We compare our observed rate of heterozygosity with expectations for this selfing and bottlenecked population. We conclude that our method enables us to pinpoint NLR genes which have experienced natural selection in their habitat. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Differences in dehydration tolerance among populations of a gametophyte-only fern.
Chambers, Sally M; Watkins, J E; Sessa, Emily B
2017-04-01
For many plant species, historical climatic conditions may have left lasting imprints that are detectable in contemporary populations. Additionally, if these historical conditions also prevented gene flow among populations, these populations may be differentiated with respect to one another and their contemporary environmental conditions. For the fern, Vittaria appalachiana , one theory is that historical conditions during the Pleistocene largely shaped both the distribution and lack of sporophyte production. Our goals-based on this theory-were to examine physiological differences among and within populations spanning the species' geographic range, and the contribution of historical climatic conditions to this differentiation. We exposed explants from five populations to four drying treatments and examined differences in physiological response. Additionally, we examined the role of historical and current climatic conditions in driving the observed population differentiation. Populations differ in their ability to tolerate varying levels of dehydration, displaying a pattern of countergradient selection. Exposure to historical and contemporary climatic conditions, specifically variation in temperature and precipitation regimes, resulted in population divergence observed among contemporary populations. Historical conditions have shaped not only the distribution of V. appalachiana , but also its current physiological limitations. Results from this study support the hypothesis that climatic conditions during the Pleistocene are responsible for the distribution of this species, and may be responsible for the observed differences in dehydration tolerance. Additionally, dehydration tolerance may be the driving factor for previously reported patterns of countergradient selection in this species. © 2017 Botanical Society of America.
Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing
2014-12-01
Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.
267 Spanish Exomes Reveal Population-Specific Differences in Disease-Related Genetic Variation.
Dopazo, Joaquín; Amadoz, Alicia; Bleda, Marta; Garcia-Alonso, Luz; Alemán, Alejandro; García-García, Francisco; Rodriguez, Juan A; Daub, Josephine T; Muntané, Gerard; Rueda, Antonio; Vela-Boza, Alicia; López-Domingo, Francisco J; Florido, Javier P; Arce, Pablo; Ruiz-Ferrer, Macarena; Méndez-Vidal, Cristina; Arnold, Todd E; Spleiss, Olivia; Alvarez-Tejado, Miguel; Navarro, Arcadi; Bhattacharya, Shomi S; Borrego, Salud; Santoyo-López, Javier; Antiñolo, Guillermo
2016-05-01
Recent results from large-scale genomic projects suggest that allele frequencies, which are highly relevant for medical purposes, differ considerably across different populations. The need for a detailed catalog of local variability motivated the whole-exome sequencing of 267 unrelated individuals, representative of the healthy Spanish population. Like in other studies, a considerable number of rare variants were found (almost one-third of the described variants). There were also relevant differences in allelic frequencies in polymorphic variants, including ∼10,000 polymorphisms private to the Spanish population. The allelic frequencies of variants conferring susceptibility to complex diseases (including cancer, schizophrenia, Alzheimer disease, type 2 diabetes, and other pathologies) were overall similar to those of other populations. However, the trend is the opposite for variants linked to Mendelian and rare diseases (including several retinal degenerative dystrophies and cardiomyopathies) that show marked frequency differences between populations. Interestingly, a correspondence between differences in allelic frequencies and disease prevalence was found, highlighting the relevance of frequency differences in disease risk. These differences are also observed in variants that disrupt known drug binding sites, suggesting an important role for local variability in population-specific drug resistances or adverse effects. We have made the Spanish population variant server web page that contains population frequency information for the complete list of 170,888 variant positions we found publicly available (http://spv.babelomics.org/), We show that it if fundamental to determine population-specific variant frequencies to distinguish real disease associations from population-specific polymorphisms. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Selective Pressures Explain Differences in Flower Color among Gentiana lutea Populations.
Sobral, Mar; Veiga, Tania; Domínguez, Paula; Guitián, Javier A; Guitián, Pablo; Guitián, José M
2015-01-01
Flower color variation among plant populations might reflect adaptation to local conditions such as the interacting animal community. In the northwest Iberian Peninsula, flower color of Gentiana lutea varies longitudinally among populations, ranging from orange to yellow. We explored whether flower color is locally adapted and the role of pollinators and seed predators as agents of selection by analyzing the influence of flower color on (i) pollinator visitation rate and (ii) escape from seed predation and (iii) by testing whether differences in pollinator communities correlate with flower color variation across populations. Finally, (iv) we investigated whether variation in selective pressures explains flower color variation among 12 G. lutea populations. Flower color influenced pollinator visits and differences in flower color among populations were related to variation in pollinator communities. Selective pressures on flower color vary among populations and explain part of flower color differences among populations of G. lutea. We conclude that flower color in G. lutea is locally adapted and that pollinators play a role in this adaptation.
Selective Pressures Explain Differences in Flower Color among Gentiana lutea Populations
Domínguez, Paula; Guitián, Javier A.; Guitián, Pablo; Guitián, José M.
2015-01-01
Flower color variation among plant populations might reflect adaptation to local conditions such as the interacting animal community. In the northwest Iberian Peninsula, flower color of Gentiana lutea varies longitudinally among populations, ranging from orange to yellow. We explored whether flower color is locally adapted and the role of pollinators and seed predators as agents of selection by analyzing the influence of flower color on (i) pollinator visitation rate and (ii) escape from seed predation and (iii) by testing whether differences in pollinator communities correlate with flower color variation across populations. Finally, (iv) we investigated whether variation in selective pressures explains flower color variation among 12 G. lutea populations. Flower color influenced pollinator visits and differences in flower color among populations were related to variation in pollinator communities. Selective pressures on flower color vary among populations and explain part of flower color differences among populations of G. lutea. We conclude that flower color in G. lutea is locally adapted and that pollinators play a role in this adaptation. PMID:26172378
Černá, Milena; Malý, Marek; Rudnai, Peter; Középesy, Szilvia; Náray, Miklós; Halzlová, Katarina; Jajcaj, Michal; Grafnetterová, Anna; Krsková, Andrea; Antošová, Danuše; Forysová, Kateřina; Den Hond, Elly; Schoeters, Greet; Joas, Reinhard; Casteleyn, Ludwine; Joas, Anke; Biot, Pierre; Aerts, Dominique; Angerer, Jürgen; Bloemen, Louis; Castaño, Argelia; Esteban, Marta; Koch, Holger M; Kolossa-Gehring, Marike; Gutleb, Arno C; Pavloušková, Jana; Vrbík, Karel
2015-08-01
Phthalates and their metabolites are classified as endocrine modulators. They affect the hormonal balance in both children and adults. The aim of this publication was to compare the urinary levels of phthalate metabolites in selected populations of the Czech Republic (CZ), Slovakia (SK), and Hungary (HU) in relation to the sources of phthalate exposure identified by means of questionnaire (personal care products, floor and wall coverings, plastic toys, and some kinds of foods). Data were obtained through the twin projects COPHES (COnsortium to Perform Human biomonitoring on a European Scale) and DEMOCOPHES (DEMOnstration of a study to COordinate and Perform Human biomonitoring on a European Scale) from 2009 to 2012. The target groups were children aged 6-11 years old and their mothers up to 45 years of age. The metabolites of phthalates (monomethyl phthalate (MMP), monoethyl phthalate (MEP), monobenzyl phthalate (MBzP), mono-cyclohexyl phthalate (MCHP), mono-(2-ethylhexyl) phthalate (MEHP), mono-(2-ethyl-5-hydroxyhexyl) phthalate (5OH-MEHP), and mono-(2-ethyl-5-oxohexyl) phthalate (5OXO-MEHP)) were analysed in first morning urine samples. After enzymatic glucuronide cleavage, the urine sample analyses were performed using ultra-high-performance liquid chromatography-electrospray ionization tandem mass spectrometry (UHPLC-ESI-MS/MS) in one laboratory that qualified in the External Quality Assessment exercises organised by COPHES. Significant differences in phthalate exposure between countries were revealed for children only but not for mothers. The concentrations of 5-OH-MEHP (P<0.001), 5OXO-MEHP (P<0.001), and their sum (P<0.001) were the highest in SK compared to CZ and HU. The health based guidance values for the sum of DEHP metabolites 5-OH MEHP and 5OXO-MEHP established by the German Commission for biomonitoring of 300 µg/L and 500 µg/L for women adults and children, respectively, were only exceeded in one mother and three boys. A significant difference was
Chen, Hongdan; Lai, Wenxiang; Fu, Qiang; Lou, Yonggen
2014-01-01
Background The brown planthopper (BPH), Nilaparvata lugens (Stål), one of the most serious rice insect pests in Asia, can quickly overcome rice resistance by evolving new virulent populations. The insect fat body plays essential roles in the life cycles of insects and in plant-insect interactions. However, whether differences in fat body transcriptomes exist between insect populations with different virulence levels and whether the transcriptomic differences are related to insect virulence remain largely unknown. Methodology/Principal Findings In this study, we performed transcriptome-wide analyses on the fat bodies of two BPH populations with different virulence levels in rice. The populations were derived from rice variety TN1 (TN1 population) and Mudgo (M population). In total, 33,776 and 32,332 unigenes from the fat bodies of TN1 and M populations, respectively, were generated using Illumina technology. Gene ontology annotations and Kyoto Encyclopedia of Genes and Genomes (KEGG) orthology classifications indicated that genes related to metabolism and immunity were significantly active in the fat bodies. In addition, a total of 339 unigenes showed homology to genes of yeast-like symbionts (YLSs) from 12 genera and endosymbiotic bacteria Wolbachia. A comparative analysis of the two transcriptomes generated 7,860 differentially expressed genes. GO annotations and enrichment analysis of KEGG pathways indicated these differentially expressed transcripts might be involved in metabolism and immunity. Finally, 105 differentially expressed genes from YLSs and Wolbachia were identified, genes which might be associated with the formation of different virulent populations. Conclusions/Significance This study was the first to compare the fat-body transcriptomes of two BPH populations having different virulence traits and to find genes that may be related to this difference. Our findings provide a molecular resource for future investigations of fat bodies and will be useful
Cousseau, L; Husemann, M; Foppen, R; Vangestel, C; Lens, L
2016-01-01
Dutch house sparrow (Passer domesticus) densities dropped by nearly 50% since the early 1980s, and similar collapses in population sizes have been reported across Europe. Whether, and to what extent, such relatively recent demographic changes are accompanied by concomitant shifts in the genetic population structure of this species needs further investigation. Therefore, we here explore temporal shifts in genetic diversity, genetic structure and effective sizes of seven Dutch house sparrow populations. To allow the most powerful statistical inference, historical populations were resampled at identical locations and each individual bird was genotyped using nine polymorphic microsatellites. Although the demographic history was not reflected by a reduction in genetic diversity, levels of genetic differentiation increased over time, and the original, panmictic population (inferred from the museum samples) diverged into two distinct genetic clusters. Reductions in census size were supported by a substantial reduction in effective population size, although to a smaller extent. As most studies of contemporary house sparrow populations have been unable to identify genetic signatures of recent population declines, results of this study underpin the importance of longitudinal genetic surveys to unravel cryptic genetic patterns. PMID:27273323
Zhu, Hong; Xia, Wei; Mo, Xing-Bo; Lin, Xiang; Qiu, Ying-Hua; Yi, Neng-Jun; Zhang, Yong-Hong; Deng, Fei-Yan; Lei, Shu-Feng
2016-01-01
Rheumatoid arthritis (RA) is a complex autoimmune disease. Using a gene-based association research strategy, the present study aims to detect unknown susceptibility to RA and to address the ethnic differences in genetic susceptibility to RA between European and Asian populations. Gene-based association analyses were performed with KGG 2.5 by using publicly available large RA datasets (14,361 RA cases and 43,923 controls of European subjects, 4,873 RA cases and 17,642 controls of Asian Subjects). For the newly identified RA-associated genes, gene set enrichment analyses and protein-protein interactions analyses were carried out with DAVID and STRING version 10.0, respectively. Differential expression verification was conducted using 4 GEO datasets. The expression levels of three selected 'highly verified' genes were measured by ELISA among our in-house RA cases and controls. A total of 221 RA-associated genes were newly identified by gene-based association study, including 71'overlapped', 76 'European-specific' and 74 'Asian-specific' genes. Among them, 105 genes had significant differential expressions between RA patients and health controls at least in one dataset, especially for 20 genes including 11 'overlapped' (ABCF1, FLOT1, HLA-F, IER3, TUBB, ZKSCAN4, BTN3A3, HSP90AB1, CUTA, BRD2, HLA-DMA), 5 'European-specific' (PHTF1, RPS18, BAK1, TNFRSF14, SUOX) and 4 'Asian-specific' (RNASET2, HFE, BTN2A2, MAPK13) genes whose differential expressions were significant at least in three datasets. The protein expressions of two selected genes FLOT1 (P value = 1.70E-02) and HLA-DMA (P value = 4.70E-02) in plasma were significantly different in our in-house samples. Our study identified 221 novel RA-associated genes and especially highlighted the importance of 20 candidate genes on RA. The results addressed ethnic genetic background differences for RA susceptibility between European and Asian populations and detected a long list of overlapped or ethnic specific RA genes. The
Retail food safety risks for populations of different races, ethnicities, and income levels.
Signs, Renata J; Darcey, Valerie L; Carney, Trish A; Evans, Alison A; Quinlan, Jennifer J
2011-10-01
Research has found that populations with low socioeconomic status (SES) and minority populations have greater access to small corner markets and less access to supermarkets than high-SES and Caucasian populations. This represents a significant difference in the farm-to-fork continuum that these populations experience. This research examined whether differential retail access to foods results in different food safety risks at the retail level for consumers with different demographics. U.S. Census Bureau census tracts with high African American, Asian, Hispanic, Caucasian, low-SES, and high-SES populations were identified in Philadelphia, PA. Approximately 60 retail food establishments were sampled in each census tract category from June 2008 to June 2010. Food samples collected at stores included milk, eggs, lunchmeat, sandwiches, and ready-to-eat (RTE) fresh fruit, greens, and herbs, when available. With the exception of milk and eggs, only food that had been handled and/or prepared at the retail level was sampled. Food samples were tested for temperature, aerobic plate count, coliforms, fecal coliforms, Escherichia coli, Staphylococcus aureus, and Listeria monocytogenes. The results indicated that internal egg temperatures were higher in samples from low-SES census tracts than in eggs from Caucasian census tracts, and eggs were more often found unrefrigerated in markets in low-SES and Asian census tracts. Milk samples from markets in Hispanic and low-SES census tracts had higher aerobic plate counts than high-SES census tract samples. Sandwiches from markets in high-SES census tracts had higher coliform counts than sandwiches from markets in all other census tract categories. Markets in Asian census tracts had a higher incidence of fecal coliform contamination on sandwiches than markets in Caucasian census tracts. Fecal coliforms were present in a percentage of RTE greens from markets in all census tracts except African American, with the highest percentages of
Identifying positive selection candidate loci for high-altitude adaptation in Andean populations
2009-01-01
High-altitude environments (>2,500 m) provide scientists with a natural laboratory to study the physiological and genetic effects of low ambient oxygen tension on human populations. One approach to understanding how life at high altitude has affected human metabolism is to survey genome-wide datasets for signatures of natural selection. In this work, we report on a study to identify selection-nominated candidate genes involved in adaptation to hypoxia in one highland group, Andeans from the South American Altiplano. We analysed dense microarray genotype data using four test statistics that detect departures from neutrality. Using a candidate gene, single nucleotide polymorphism-based approach, we identified genes exhibiting preliminary evidence of recent genetic adaptation in this population. These included genes that are part of the hypoxia-inducible transcription factor (HIF) pathway, a biochemical pathway involved in oxygen homeostasis, as well as three other genomic regions previously not known to be associated with high-altitude phenotypes. In addition to identifying selection-nominated candidate genes, we also tested whether the HIF pathway shows evidence of natural selection. Our results indicate that the genes of this biochemical pathway as a group show no evidence of having evolved in response to hypoxia in Andeans. Results from particular HIF-targeted genes, however, suggest that genes in this pathway could play a role in Andean adaptation to high altitude, even if the pathway as a whole does not show higher relative rates of evolution. These data suggest a genetic role in high-altitude adaptation and provide a basis for genotype/phenotype association studies that are necessary to confirm the role of putative natural selection candidate genes and gene regions in adaptation to altitude. PMID:20038496
Not only animal studies, but also population (ecologic) studies can contribute to the identification of endocrine disrupting chemicals. Population studies are fundamental in identifying public health hazards, and provide hypotheses for more targeted studies. Chlorophenoxy herb...
Kindall, J.L.; Muller, L.I.; Clark, J.D.; Lupardus, J.L.; Murrow, J.L.
2011-01-01
We used an individual-based population model to perform a viability analysis to simulate population growth (λ) of 167 elk (Cervus elaphus manitobensis; 71 male and 96 female) released in the Cumberland Mountains, Tennessee, to estimate sustainability (i.e., λ > 1.0) and identify the most appropriate options for managing elk restoration. We transported elk from Elk Island National Park, Alberta, Canada, and from Land Between the Lakes, Kentucky, and reintroduced them beginning in December 2000 and ending in February 2003. We estimated annual survival rates for 156 radio-collared elk from December 2000 until November 2004. We used data from a nearby elk herd in Great Smoky Mountains National Park to simulate pessimistic and optimistic recruitment and performed population viability analyses to evaluate sustainability over a 25-year period. Annual survival averaged 0.799 (Total SE = 0.023). The primary identifiable sources of mortality were poaching, disease from meningeal worm (Parelaphostrongylus tenuis), and accidents (environmental causes and unintentional harvest). Population growth given pessimistic recruitment rates averaged 0.895 over 25 years (0.955 in year 1 to 0.880 in year 25); population growth was not sustainable in 100% of the runs. With the most optimistic estimates of recruitment, mean λ increased to 0.967 (1.038 in year 1 to 0.956 in year 25) with 99.6% of the runs failing to be sustainable. We suggest that further translocation efforts to increase herd size will be ineffective unless survival rates are increased in the Cumberland Mountains.
Nutritional Differences between Two Orangutan Habitats: Implications for Population Density
Vogel, Erin R.; Harrison, Mark E.; Zulfa, Astri; Bransford, Timothy D.; Alavi, Shauhin E.; Husson, Simon; Morrogh-Bernard, Helen; Santiano; Firtsman, Twentinolosa; Utami-Atmoko, Sri Suci; van Noordwijk, Maria A.; Farida, Wartika Rosa
2015-01-01
Bottom-up regulatory factors have been proposed to exert a strong influence on mammalian population density. Studies relating habitat quality to population density have typically made comparisons among distant species or communities without considering variation in food quality among localities. We compared dietary nutritional quality of two Bornean orangutan populations with differing population densities in peatland habitats, Tuanan and Sabangau, separated by 63 km. We hypothesized that because Tuanan is alluvial, the plant species included in the orangutan diet would be of higher nutritional quality compared to Sabangau, resulting in higher daily caloric intake in Tuanan. We also predicted that forest productivity would be greater in Tuanan compared to Sabangau. In support of these hypotheses, the overall quality of the diet and the quality of matched dietary items were higher in Tuanan, resulting in higher daily caloric intake compared to Sabangau. These differences in dietary nutritional quality may provide insights into why orangutan population density is almost two times greater in Tuanan compared to Sabangau, in agreement with a potentially important influence of diet quality on primate population density. PMID:26466370
Nutritional Differences between Two Orangutan Habitats: Implications for Population Density.
Vogel, Erin R; Harrison, Mark E; Zulfa, Astri; Bransford, Timothy D; Alavi, Shauhin E; Husson, Simon; Morrogh-Bernard, Helen; Santiano; Firtsman, Twentinolosa; Utami-Atmoko, Sri Suci; van Noordwijk, Maria A; Farida, Wartika Rosa
2015-01-01
Bottom-up regulatory factors have been proposed to exert a strong influence on mammalian population density. Studies relating habitat quality to population density have typically made comparisons among distant species or communities without considering variation in food quality among localities. We compared dietary nutritional quality of two Bornean orangutan populations with differing population densities in peatland habitats, Tuanan and Sabangau, separated by 63 km. We hypothesized that because Tuanan is alluvial, the plant species included in the orangutan diet would be of higher nutritional quality compared to Sabangau, resulting in higher daily caloric intake in Tuanan. We also predicted that forest productivity would be greater in Tuanan compared to Sabangau. In support of these hypotheses, the overall quality of the diet and the quality of matched dietary items were higher in Tuanan, resulting in higher daily caloric intake compared to Sabangau. These differences in dietary nutritional quality may provide insights into why orangutan population density is almost two times greater in Tuanan compared to Sabangau, in agreement with a potentially important influence of diet quality on primate population density.
Udeh, N N; Eze, B I; Onwubiko, S N; Arinze, O C; Onwasigwe, E N; Umeh, R E
2014-06-01
To assess eye care service utilization, and identify access barriers in a south-eastern Nigerian albino population. The study was a population-based, cross-sectional survey conducted in Enugu state between August, 2011 and January, 2012. Using the data base of the state's Albino Foundation and tailored awareness creation, persons living with albinism were identified and recruited at two study centres. Data on participants' socio-demographics, perception of vision, visual needs, previous eye examination and or low vision assessment, use of glasses or low vision devices were collected. Reasons for non-utilisation of available vision care services were also obtained. Descriptive and comparative statistics were performed. A p < 0.05 was considered statistically significant. The participants (n = 153; males 70; females 83; sex ratio: 1:1.1) were aged 23.46 + 10.44 SD years (range 6-60 years). Most--95.4 % of the participants had no previous low vision assessment and none--0.0% had used low vision device. Of the participants, 82.4% reported previous eye examination, 33.3% had not used spectacles previously, despite the existing need. Ignorance--88.9% and poor access--8.5% were the main barriers to uptake of vision care services. In Enugu, Nigeria, there is poor awareness and low utilization of vision care services among people with albinism. The identified barriers to vision care access are amenable to awareness creation and logistic change in the provision of appropriate vision care services.
Coulter, Robert W.S.; Blosnich, John R.; Bukowski, Leigh A.; Herrick, A. L.; Siconolfi, Daniel E.; Stall, Ron D.
2015-01-01
Background Little is known about differences in alcohol use and alcohol-related problems between transgender- and nontransgender-identified populations. Using data from a large-scale health survey, we compare the drinking patterns and prevalence of alcohol-related problems of transgender-identified individuals to nontransgender-identified males and females. For transgender-identified people, we examine how various forms of victimization relate to heavy episodic drinking (HED). Methods Cross-sectional surveys were completed by 75,192 students aged 18–29 years attending 120 post-secondary educational institutions in the United States from 2011–2013. Self-reported measures included alcohol use, alcohol-related problems, victimization, and sociodemographics, including 3 gender-identity groups: transgender-identified individuals; nontransgender-identified males; and nontransgender-identified females. Results Compared to transgender-identified individuals, nontransgender-identified males were more likely to report HED in the past 2 weeks (relative risk=1.42; p=0.006); however, nontransgender-identified males and females reported HED on fewer days than transgender-identified people (incidence-rate ratios [IRRs] ranged from 0.28–0.43; p-values<0.001). Compared to transgender-identified people, nontransgender-identified males and females had lower odds of past-year alcohol-related sexual assault and suicidal ideation (odds ratios ranged from 0.24–0.45; p-values<0.05). Among transgender-identified people, individuals who were sexually assaulted (IRR=3.21, p=0.011) or verbally threatened (IRR=2.42, p=0.021) in the past year had greater HED days than those who did not experience those forms of victimization. Conclusions Compared to transgender-identified people, nontransgender-identified males and females: have fewer HED occasions (despite nontransgender-identified males having greater prevalence of HED); and are at lower risk for alcohol-related sexual assaults and
Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth
2015-01-01
Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.
Developing an online tool for identifying at-risk populations to wildfire smoke hazards.
Vaidyanathan, Ambarish; Yip, Fuyuen; Garbe, Paul
2018-04-01
Wildfire episodes pose a significant public health threat in the United States. Adverse health impacts associated with wildfires occur near the burn area as well as in places far downwind due to wildfire smoke exposures. Health effects associated with exposure to particulate matter arising from wildfires can range from mild eye and respiratory tract irritation to more serious outcomes such as asthma exacerbation, bronchitis, and decreased lung function. Real-time operational forecasts of wildfire smoke concentrations are available but they are not readily integrated with information on vulnerable populations necessary to identify at-risk communities during wildfire smoke episodes. Efforts are currently underway at the Centers for Disease Control and Prevention (CDC) to develop an online tool that utilizes short-term predictions and forecasts of smoke concentrations and integrates them with measures of population-level vulnerability for identifying at-risk populations to wildfire smoke hazards. The tool will be operationalized on a national scale, seeking input and assistance from several academic, federal, state, local, Tribal, and Territorial partners. The final product will then be incorporated into CDC's National Environmental Public Health Tracking Network (http://ephtracking.cdc.gov), providing users with access to a suite of mapping and display functionalities. A real-time vulnerability assessment tool incorporating standardized health and exposure datasets, and prevention guidelines related to wildfire smoke hazards is currently unavailable for public health practitioners and emergency responders. This tool could strengthen existing situational awareness competencies, and expedite future response and recovery efforts during wildfire episodes. Published by Elsevier B.V.
Bašić, Željana; Fox, Ayano R; Anterić, Ivana; Jerković, Ivan; Polašek, Ozren; Anđelinović, Šimun; Holland, Mitchell M; Primorac, Dragan
2015-06-01
To compare the population group from the Šopot graveyard with population groups from traditional Croatian medieval graveyards by using anthropological, craniometrics, and mitochondrial (mtDNA) analysis and to examine if the cultural differences between population groups reflect biological differences. We determined sex, age at death, pathological, and traumatic changes of skeletal remains from the Šopot graveyard and compared them with a cumulative medieval sample from the same region. We also performed principal component analysis to compare skeletal remains from Šopot with those from Ostrovica and other Central European samples according to 8 cranial measurements. Finally, we compared 46 skeletons from Šopot with medieval (Ostrovica) and contemporary populations using mDNA haplogroup profiling. The remains from Šopot were similar to the cumulative sample in lifestyle and quality of life markers. Principal component analysis showed that they were closely related to Eastern Adriatic coast sites (including Ostrovica and Šopot) in terms of cranial morphology, indicating similar biological makeup. According to mDNA testing, Šopot population showed no significant differences in the haplogroup prevalence from either medieval or contemporary populations. This study shows that the Šopot population does not significantly differ from other medieval populations from this area. Besides similar quality of life markers, these populations also had similar biological markers. Substantial archeological differences can therefore be attributed to apparent cultural influences, which in this case do not reflect biological differences.
Bašić, Željana; Fox, Ayano R; Anterić, Ivana; Jerković, Ivan; Polašek, Ozren; Anđelinović, Šimun; Holland, Mitchell M; Primorac, Dragan
2015-01-01
Aim To compare the population group from the Šopot graveyard with population groups from traditional Croatian medieval graveyards by using anthropological, craniometrics, and mitochondrial (mtDNA) analysis and to examine if the cultural differences between population groups reflect biological differences. Methods We determined sex, age at death, pathological, and traumatic changes of skeletal remains from the Šopot graveyard and compared them with a cumulative medieval sample from the same region. We also performed principal component analysis to compare skeletal remains from Šopot with those from Ostrovica and other Central European samples according to 8 cranial measurements. Finally, we compared 46 skeletons from Šopot with medieval (Ostrovica) and contemporary populations using mDNA haplogroup profiling. Results The remains from Šopot were similar to the cumulative sample in lifestyle and quality of life markers. Principal component analysis showed that they were closely related to Eastern Adriatic coast sites (including Ostrovica and Šopot) in terms of cranial morphology, indicating similar biological makeup. According to mDNA testing, Šopot population showed no significant differences in the haplogroup prevalence from either medieval or contemporary populations. Conclusion This study shows that the Šopot population does not significantly differ from other medieval populations from this area. Besides similar quality of life markers, these populations also had similar biological markers. Substantial archeological differences can therefore be attributed to apparent cultural influences, which in this case do not reflect biological differences. PMID:26088847
Efficient logistic regression designs under an imperfect population identifier.
Albert, Paul S; Liu, Aiyi; Nansel, Tonja
2014-03-01
Motivated by actual study designs, this article considers efficient logistic regression designs where the population is identified with a binary test that is subject to diagnostic error. We consider the case where the imperfect test is obtained on all participants, while the gold standard test is measured on a small chosen subsample. Under maximum-likelihood estimation, we evaluate the optimal design in terms of sample selection as well as verification. We show that there may be substantial efficiency gains by choosing a small percentage of individuals who test negative on the imperfect test for inclusion in the sample (e.g., verifying 90% test-positive cases). We also show that a two-stage design may be a good practical alternative to a fixed design in some situations. Under optimal and nearly optimal designs, we compare maximum-likelihood and semi-parametric efficient estimators under correct and misspecified models with simulations. The methodology is illustrated with an analysis from a diabetes behavioral intervention trial. © 2013, The International Biometric Society.
2011-01-01
Background To date, nine Parkinson disease (PD) genome-wide association studies in North American, European and Asian populations have been published. The majority of studies have confirmed the association of the previously identified genetic risk factors, SNCA and MAPT, and two studies have identified three new PD susceptibility loci/genes (PARK16, BST1 and HLA-DRB5). In a recent meta-analysis of datasets from five of the published PD GWAS an additional 6 novel candidate genes (SYT11, ACMSD, STK39, MCCC1/LAMP3, GAK and CCDC62/HIP1R) were identified. Collectively the associations identified in these GWAS account for only a small proportion of the estimated total heritability of PD suggesting that an 'unknown' component of the genetic architecture of PD remains to be identified. Methods We applied a GWAS approach to a relatively homogeneous Ashkenazi Jewish (AJ) population from New York to search for both 'rare' and 'common' genetic variants that confer risk of PD by examining any SNPs with allele frequencies exceeding 2%. We have focused on a genetic isolate, the AJ population, as a discovery dataset since this cohort has a higher sharing of genetic background and historically experienced a significant bottleneck. We also conducted a replication study using two publicly available datasets from dbGaP. The joint analysis dataset had a combined sample size of 2,050 cases and 1,836 controls. Results We identified the top 57 SNPs showing the strongest evidence of association in the AJ dataset (p < 9.9 × 10-5). Six SNPs located within gene regions had positive signals in at least one other independent dbGaP dataset: LOC100505836 (Chr3p24), LOC153328/SLC25A48 (Chr5q31.1), UNC13B (9p13.3), SLCO3A1(15q26.1), WNT3(17q21.3) and NSF (17q21.3). We also replicated published associations for the gene regions SNCA (Chr4q21; rs3775442, p = 0.037), PARK16 (Chr1q32.1; rs823114 (NUCKS1), p = 6.12 × 10-4), BST1 (Chr4p15; rs12502586, p = 0.027), STK39 (Chr2q24.3; rs3754775, p = 0
Gaussian Graphical Models Identify Networks of Dietary Intake in a German Adult Population.
Iqbal, Khalid; Buijsse, Brian; Wirth, Janine; Schulze, Matthias B; Floegel, Anna; Boeing, Heiner
2016-03-01
Data-reduction methods such as principal component analysis are often used to derive dietary patterns. However, such methods do not assess how foods are consumed in relation to each other. Gaussian graphical models (GGMs) are a set of novel methods that can address this issue. We sought to apply GGMs to derive sex-specific dietary intake networks representing consumption patterns in a German adult population. Dietary intake data from 10,780 men and 16,340 women of the European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam cohort were cross-sectionally analyzed to construct dietary intake networks. Food intake for each participant was estimated using a 148-item food-frequency questionnaire that captured the intake of 49 food groups. GGMs were applied to log-transformed intakes (grams per day) of 49 food groups to construct sex-specific food networks. Semiparametric Gaussian copula graphical models (SGCGMs) were used to confirm GGM results. In men, GGMs identified 1 major dietary network that consisted of intakes of red meat, processed meat, cooked vegetables, sauces, potatoes, cabbage, poultry, legumes, mushrooms, soup, and whole-grain and refined breads. For women, a similar network was identified with the addition of fried potatoes. Other identified networks consisted of dairy products and sweet food groups. SGCGMs yielded results comparable to those of GGMs. GGMs are a powerful exploratory method that can be used to construct dietary networks representing dietary intake patterns that reveal how foods are consumed in relation to each other. GGMs indicated an apparent major role of red meat intake in a consumption pattern in the studied population. In the future, identified networks might be transformed into pattern scores for investigating their associations with health outcomes. © 2016 American Society for Nutrition.
Y-STR Haplogroup Diversity in the Jat Population Reveals Several Different Ancient Origins.
Mahal, David G; Matsoukas, Ianis G
2017-01-01
The Jats represent a large ethnic community that has inhabited the northwest region of India and Pakistan for several thousand years. It is estimated the community has a population of over 123 million people. Many historians and academics have asserted that the Jats are descendants of Aryans, Scythians, or other ancient people that arrived and lived in northern India at one time. Essentially, the specific origin of these people has remained a matter of contention for a long time. This study demonstrated that the origins of Jats can be clarified by identifying their Y-chromosome haplogroups and tracing their genetic markers on the Y-DNA haplogroup tree. A sample of 302 Y-chromosome haplotypes of Jats in India and Pakistan was analyzed. The results showed that the sample population had several different lines of ancestry and emerged from at least nine different geographical regions of the world. It also became evident that the Jats did not have a unique set of genes, but shared an underlying genetic unity with several other ethnic communities in the Indian subcontinent. A startling new assessment of the genetic ancient origins of these people was revealed with DNA science.
Inter-Arm Difference in Brachial Blood Pressure in the General Population of Koreans.
Song, Bo Mi; Kim, Hyeon Chang; Shim, Jee-Seon; Lee, Myung Ha; Choi, Dong Phil
2016-05-01
We investigated the inter-arm difference in blood pressure of the general Korean population to identify associated factors. A total of 806 participants aged 30 to 64 years without history of major cardiovascular disease were analyzed in this cross-sectional study. They participated in the Cardiovascular and Metabolic Disease Etiology Research Center cohort study that began in 2013. Brachial blood pressure was measured simultaneously for both arms using an automated oscillometric device equipped with two cuffs in seated position. After five minutes of rest, systolic blood pressure (SBP) and diastolic blood pressure (DBP) were measured three times. The average of the three measurements was used for analysis. Multivariate logistic regression models were used to identify factors associated with inter-arm differences in blood pressure. The mean inter-arm difference was 3.3 mmHg for SBP and 2.0 mmHg for DBP. Large inter-arm differences (≥10 mmHg) in SBP and in DBP were found in 3.7% and 0.9% of subjects, respectively. A large inter-arm difference in SBP was associated with mean SBP (p=0.002) and C-reactive protein (p=0.014) while a large inter-arm different in DBP was only associated with body mass index (p=0.015). Sex, age, and anti-hypertensive medication use were not associated with differences in inter-arm blood pressure. Large inter-arm difference in blood pressure is only present in a small portion of healthy Korean adults. Our findings suggest that high SBP, chronic inflammation, and obesity may be associated with larger difference in inter-arm blood pressure.
Gut microbiome and dietary patterns in different Saudi populations and monkeys.
Angelakis, Emmanouil; Yasir, Muhammad; Bachar, Dipankar; Azhar, Esam I; Lagier, Jean-Christophe; Bibi, Fehmida; Jiman-Fatani, Asif A; Alawi, Maha; Bakarman, Marwan A; Robert, Catherine; Raoult, Didier
2016-08-31
Host genetics, environment, lifestyle and proximity between hosts strongly influence the composition of the gut microbiome. To investigate the association of dietary variables with the gut microbiota, we used 16S rDNA sequencing to test the fecal microbiome of Bedouins and urban Saudis and we compared it to the gut microbiome of baboons living in close contact with Bedouins and eating their leftovers. We also analyzed fermented dairy products commonly consumed by Bedouins in order to investigate their impact on the gut microbiome of this population. We found that the gut microbiomes of westernized urban Saudis had significantly lower richness and biodiversity than the traditional Bedouin population. The gut microbiomes of baboons were more similar to that of Bedouins compared to urban Saudis, probably due the dietary overlap between baboons and Bedouins. Moreover, we found clusters that were compositionally similar to clusters identified in humans and baboons, characterized by differences in Acinetobacter, Turicibacter and Collinsella. The fermented food presented significantly more bacteria genera common to the gut microbiome of Bedouins compared to urban Saudis. These results support the hypothesis that dietary habits influence the composition of the gut microbiome.
2013-01-01
Background Adaptation, which induces differentiation between populations in relation to environmental conditions, can initiate divergence. The balance between gene flow and selection determines the maintenance of such a structure in sympatry. Studying these two antagonistic forces in plant pathogens is made possible because of the high ability of pathogens to disperse and of the strong selective pressures exerted by their hosts. In this article, we analysed the genetic structure of the population of the apple scab fungus, Venturia inaequalis, in a heterogeneous environment composed of various Malus species. Inferences were drawn from microsatellite and AFLP data obtained from 114 strains sampled in a single orchard on nine different Malus species to determine the forces that shape the genetic structure of the pathogen. Results Using clustering methods, we first identified two specialist subpopulations: (i) a virulent subpopulation sampled on Malus trees carrying the Rvi6 resistance gene; and (ii) a subpopulation infecting only Malus trees that did not carry this resistance gene. A genome scan of loci on these two subpopulations did not detect any locus under selection. Additionally, we did not detect any other particular substructure linked to different hosts. However, an isolation-by-distance (IBD) pattern at the orchard scale revealed free gene flow within each subpopulation. Conclusions Our work shows a rare example of a very strong effect of a resistance gene on pathogen populations. Despite the high diversity of Malus hosts, the presence of Rvi6 seems sufficient to explain the observed genetic structure. Moreover, detection of an IBD pattern at the orchard scale revealed a very low average dispersal distance that is particularly significant for epidemiologists and landscape managers for the design of scab control strategies PMID:23497223
Witt, Kelsey E; Judd, Kathleen; Kitchen, Andrew; Grier, Colin; Kohler, Timothy A; Ortman, Scott G; Kemp, Brian M; Malhi, Ripan S
2015-02-01
As dogs have traveled with humans to every continent, they can potentially serve as an excellent proxy when studying human migration history. Past genetic studies into the origins of Native American dogs have used portions of the hypervariable region (HVR) of mitochondrial DNA (mtDNA) to indicate that prior to European contact the dogs of Native Americans originated in Eurasia. In this study, we summarize past DNA studies of both humans and dogs to discuss their population histories in the Americas. We then sequenced a portion of the mtDNA HVR of 42 pre-Columbian dogs from three sites located in Illinois, coastal British Columbia, and Colorado, and identify four novel dog mtDNA haplotypes. Next, we analyzed a dataset comprised of all available ancient dog sequences from the Americas to infer the pre-Columbian population history of dogs in the Americas. Interestingly, we found low levels of genetic diversity for some populations consistent with the possibility of deliberate breeding practices. Furthermore, we identified multiple putative founding haplotypes in addition to dog haplotypes that closely resemble those of wolves, suggesting admixture with North American wolves or perhaps a second domestication of canids in the Americas. Notably, initial effective population size estimates suggest at least 1000 female dogs likely existed in the Americas at the time of the first known canid burial, and that population size increased gradually over time before stabilizing roughly 1200 years before present. Copyright © 2014 Elsevier Ltd. All rights reserved.
Ingasia, Luicer A; Cheruiyot, Jelagat; Okoth, Sheila Akinyi; Andagalu, Ben; Kamau, Edwin
2016-04-01
Transmission intensity, movement of human and vector hosts, biogeographical features, and malaria control measures are some of the important factors that determine Plasmodium falciparum parasite genetic variability and population structure. Kenya has different malaria ecologies which might require different disease intervention methods. Refined parasite population genetic studies are critical for informing malaria control and elimination strategies. This study describes the genetic diversity and population structure of P. falciparum parasites from the different malaria ecological zones in Kenya. Twelve multi-locus microsatellite (MS) loci previously described were genotyped in 225 P. falciparum isolates collected between 2012 and 2013 from five sites; three in lowland endemic regions (Kisumu, Kombewa, and Malindi) and two in highland, epidemic regions (Kisii and Kericho). Parasites from the lowland endemic and highland epidemic regions of western Kenya had high genetic diversity compared to coastal lowland endemic region of Kenya [Malindi]. The Kenyan parasites had a mean genetic differentiation index (FST) of 0.072 (p=0.011). The multi-locus genetic analysis of the 12 MS revealed all the parasites had unique haplotypes. Significant linkage disequilibrium (LD) was observed in all the five parasite populations. Kisumu had the most significant index of association values (0.16; p<0.0001) whereas Kisii had the least significant index of association values (0.03; p<0.0001). Our data suggest high genetic diversity in Kenyan parasite population with the exception of parasite from Malindi where malaria has been on the decline. The presence of significant LD suggests that there is occurrence of inbreeding in the parasite population. Parasite populations from Kisii showed the strongest evidence for epidemic population structure whereas the rest of the regions showed panmixia. Defining the genetic diversity of the parasites in different ecological regions of Kenya after
Zazzetta, M S; Gomes, G A O; Orlandi, F S; Gratão, A C M; Vasilceac, F A; Gramani-Say, K; Ponti, M A; Castro, P C; Pavarini, S C I; Menezes, A L C; Nascimento, C M C; Cominetti, M R
2017-01-01
This study aimed to investigate a vulnerable population living in the context of poverty in a Brazilian municipality, in order to identify the factors that are associated with frailty syndrome in elderly people. From the total population living in the area, a random sample of 363 community-dwelling people, 60 years and older, age and gender-stratified, was selected to participate in the research. After losses, a sample of 304 older adults was classified as non-frail, pre-frail and frail. According to the Fried frailty criteria, the prevalence was 12.2% for non-frail individuals, 60.5% pre-frail and 27.3% frail. The main factors associated with frailty in the studied sample were low level of physical activity (OR: 5.2, 95%CI: 2.5-11.0), the occurrence of two or more falls within 12 months (OR: 3.1, 95%CI: 1.4-7.1), mobility deficits (OR: 3.0, 95%CI: 1.5-5.8), and depressive symptoms (OR: 1.9, 95%CI: 1.1-3.7). This study identified the most important factors that must be evaluated to identify frailty syndrome in a socially vulnerable population in the context of poverty. The data should help to encourage effective strategies concerning public health policies for this population.
Najmi, Laeya Abdoli; Aukrust, Ingvild; Flannick, Jason; Molnes, Janne; Burtt, Noel; Molven, Anders; Groop, Leif; Altshuler, David; Johansson, Stefan; Njølstad, Pål Rasmus
2017-01-01
Variants in HNF1A encoding hepatocyte nuclear factor 1α (HNF-1A) are associated with maturity-onset diabetes of the young form 3 (MODY 3) and type 2 diabetes. We investigated whether functional classification of HNF1A rare coding variants can inform models of diabetes risk prediction in the general population by analyzing the effect of 27 HNF1A variants identified in well-phenotyped populations (n = 4,115). Bioinformatics tools classified 11 variants as likely pathogenic and showed no association with diabetes risk (combined minor allele frequency [MAF] 0.22%; odds ratio [OR] 2.02; 95% CI 0.73–5.60; P = 0.18). However, a different set of 11 variants that reduced HNF-1A transcriptional activity to <60% of normal (wild-type) activity was strongly associated with diabetes in the general population (combined MAF 0.22%; OR 5.04; 95% CI 1.99–12.80; P = 0.0007). Our functional investigations indicate that 0.44% of the population carry HNF1A variants that result in a substantially increased risk for developing diabetes. These results suggest that functional characterization of variants within MODY genes may overcome the limitations of bioinformatics tools for the purposes of presymptomatic diabetes risk prediction in the general population. PMID:27899486
Prevalence in vulnerable population of liver fibrosis identified by transient elastography.
Chávez-Tapia, Norberto; Torres-Sánchez, Jorge; Romero-Flores, Juan; Álvarez-Quiroz, Paulina; Ramírez-Álvarez, Sandra; Juárez-Hernández, Eva; Pérez-Jáuregui, José; Méndez-Sánchez, Nahum; Uribe, Misael
2015-01-01
Transient elastography (TE) is a useful tool for the assessment of hepatic fibrosis as an alternative to liver biopsy, but it has not been validated as a screening procedure in apparently healthy people. To determine the prevalence of advanced liver fibrosis diagnosed by TE in a socioeconomically challenged rural population. We enrolled 299 participants aged over 18 years old from a vulnerable population in Mexico who responded to an open invitation. All participants had their history recorded and underwent a general clinical examination and a liver stiffness measurement, performed by a single operator according to international standards. Overall, 7.35% participants were found to be at high risk for cirrhosis. Three variables correlated with a risk for a TE measure ≥ 9 kPa and significant fibrosis: history of alcohol intake [7.95 vs. 92.04%, odds ratio (OR) 4.47, 95% confidence interval (CI) 1.45-13.78, P = 0.0167], body mass index (BMI) ≥ 30 kg/m2 (30.87 vs. 69.12%, OR 4.25, 95%CI 1.04-6.10, P = 0.049), and history of diabetes mellitus (14.87 vs. 85.12%, OR 2.76, 95%CI 1.002-7.63, P = 0.0419). In the multivariate analyses BMI ≥ 30 kg/m2 was the only significant risk factor for advanced liver fibrosis or cirrhosis (OR 2.54, 95%CI 1.02-6.3, P = 0.0460). TE could be useful as a screening process to identify advanced liver fibrosis in the general and apparently healthy population.
Price, Nicholas; Moyers, Brook T; Lopez, Lua; Lasky, Jesse R; Monroe, J Grey; Mullen, Jack L; Oakley, Christopher G; Lin, Junjiang; Ågren, Jon; Schrider, Daniel R; Kern, Andrew D; McKay, John K
2018-05-08
Evidence for adaptation to different climates in the model species Arabidopsis thaliana is seen in reciprocal transplant experiments, but the genetic basis of this adaptation remains poorly understood. Field-based quantitative trait locus (QTL) studies provide direct but low-resolution evidence for the genetic basis of local adaptation. Using high-resolution population genomic approaches, we examine local adaptation along previously identified genetic trade-off (GT) and conditionally neutral (CN) QTLs for fitness between locally adapted Italian and Swedish A. thaliana populations [Ågren J, et al. (2013) Proc Natl Acad Sci USA 110:21077-21082]. We find that genomic regions enriched in high F ST SNPs colocalize with GT QTL peaks. Many of these high F ST regions also colocalize with regions enriched for SNPs significantly correlated to climate in Eurasia and evidence of recent selective sweeps in Sweden. Examining unfolded site frequency spectra across genes containing high F ST SNPs suggests GTs may be due to more recent adaptation in Sweden than Italy. Finally, we collapse a list of thousands of genes spanning GT QTLs to 42 genes that likely underlie the observed GTs and explore potential biological processes driving these trade-offs, from protein phosphorylation, to seed dormancy and longevity. Our analyses link population genomic analyses and field-based QTL studies of local adaptation, and emphasize that GTs play an important role in the process of local adaptation. Copyright © 2018 the Author(s). Published by PNAS.
Nightmares in the general population: identifying potential causal factors.
Rek, Stephanie; Sheaves, Bryony; Freeman, Daniel
2017-09-01
Nightmares are inherently distressing, prevent restorative sleep, and are associated with a number of psychiatric problems, but have rarely been the subject of empirical study. Negative affect, linked to stressful events, is generally considered the key trigger of nightmares; hence nightmares have most often been considered in the context of post-traumatic stress disorder (PTSD). However, many individuals with heightened negative affect do not have nightmares. The objective of this study was to identify mechanistically plausible factors, beyond negative affect, that may explain why individuals experience nightmares. 846 participants from the UK general population completed an online survey about nightmare occurrence and severity (pre-occupation, distress, and impairment), negative affect, worry, depersonalisation, hallucinatory experiences, paranoia, alcohol use, sleep duration, physical activity levels, PTSD symptoms, and stressful life events. Associations of nightmares with the putative predictive factors were tested controlling for levels of negative affect. Analyses were also repeated controlling for levels of PTSD and the recent occurrence of stressful life events. Nightmare occurrence, adjusting for negative affect, was associated with higher levels of worry, depersonalisation, hallucinatory experiences, paranoia, and sleep duration (odds ratios 1.25-1.45). Nightmare severity, controlling for negative affect, was associated with higher levels of worry, depersonalisation, hallucinatory experiences, and paranoia (R 2 s: 0.33-0.39). Alcohol use and physical activity levels were not associated with nightmares. The study identifies a number of potential predictors of the occurrence and severity of nightmares. Causal roles require testing in future longitudinal, experimental, and treatment studies.
Chang, Shang-Lin; Leu, Jun-Yi; Chang, Tien-Hsien
2015-08-01
Microbes have evolved ways of interference competition to gain advantage over their ecological competitors. The use of secreted killer toxins by yeast cells through acquiring double-stranded RNA viruses is one such prominent example. Although the killer behaviour has been well studied in laboratory yeast strains, our knowledge regarding how killer viruses are spread and maintained in nature and how yeast cells co-evolve with viruses remains limited. We investigated these issues using a panel of 81 yeast populations belonging to three Saccharomyces sensu stricto species isolated from diverse ecological niches and geographic locations. We found that killer strains are rare among all three species. In contrast, killer toxin resistance is widespread in Saccharomyces paradoxus populations, but not in Saccharomyces cerevisiae or Saccharomyces eubayanus populations. Genetic analyses revealed that toxin resistance in S. paradoxus is often caused by dominant alleles that have independently evolved in different populations. Molecular typing identified one M28 and two types of M1 killer viruses in those killer strains. We further showed that killer viruses of the same type could lead to distinct killer phenotypes under different host backgrounds, suggesting co-evolution between the viruses and hosts in different populations. Taken together, our data suggest that killer viruses vary in their evolutionary histories even within closely related yeast species. © 2015 John Wiley & Sons Ltd.
Comparison of Gender Differences in Intracerebral Hemorrhage in a Multi-Ethnic Asian Population.
Hsieh, Justin T; Ang, Beng Ti; Ng, Yew Poh; Allen, John C; King, Nicolas K K
2016-01-01
Intracerebral hemorrhage (ICH) accounts for 10-15% of all first time strokes and with incidence twice as high in the Asian compared to Western population. This study aims to investigate gender differences in ICH patient outcomes in a multi-ethnic Asian population. Data for 1,192 patients admitted for ICH were collected over a four-year period. Multivariate logistic regression was used to identify independent predictors and odds ratios were computed for 30-day mortality and Glasgow Outcome Scale (GOS) comparing males and females. Males suffered ICH at a younger age than females (62.2 ± 13.2 years vs. 66.3 ± 15.3 years; P<0.001). The occurrence of ICH was higher among males than females at all ages until 80 years old, beyond which the trend was reversed. Females exhibited increased severity on admission as measured by Glasgow Coma Scale compared to males (10.9 ± 4.03 vs. 11.4 ± 4.04; P = 0.030). No difference was found in 30-day mortality between females and males (F: 30.5% [155/508] vs. M: 27.0% [186/688]), with unadjusted and adjusted odds ratio (F/M) of 1.19 (P = 0.188) and 1.21 (P = 0.300). At discharge, there was a non-statistically significant but potentially clinically relevant morbidity difference between the genders as measured by GOS (dichotomized GOS of 4-5: F: 23.7% [119/503] vs. M: 28.7% [194/677]), with unadjusted and adjusted odds ratio (F/M) of 0.77 (P = 0.055) and 0.87 (P = 0.434). In our multi-ethnic Asian population, males developed ICH at a younger age and were more susceptible to ICH than women at all ages other than the beyond 80-year old age group. In contrast to the Western population, neurological status of female ICH patients at admission was poorer and their 30-day mortality was not reduced. Although the study was not powered to detect significance, female showed a trend toward worse 30-day morbidity at discharge.
Phylogeography of Trichuris populations isolated from different Cricetidae rodents.
Callejón, Rocío; De Rojas, Manuel; Feliú, Carlos; Balao, Francisco; Marrugal, Angela; Henttonen, Heikki; Guevara, Diego; Cutillas, Cristina
2012-11-01
The phylogeography of Trichuris populations (Nematoda) collected from Cricetidae rodents (Muroidea) from different geographical regions was studied. Ribosomal DNA (Internal Transcribed Spacers 1 and 2, and mitochondrial DNA (cytochrome c- oxidase subunit 1 partial gene) have been used as molecular markers. The nuclear internal transcribed spacers (ITSs) 1 and 2 showed 2 clear-cut geographical and genetic lineages: one of the Nearctic region (Oregon), although the second was widespread throughout the Palaearctic region and appeared as a star-like structure in the minimum spanning network. The mitochondrial results revealed that T. arvicolae populations from the Palaearctic region were separated into 3 clear-cut geographical and genetic lineages: populations from Northern Europe, populations from Southern (Spain) and Eastern Europe (Croatia, Belarus, Kazahstan), and populations from Italy and France (Eastern Pyrénean Mountains). Phylogenetic analysis obtained on the basis of ITS1-5·8S-ITS2 rDNA sequences did not show a differential geographical structure; however, these markers suggest a new Trichuris species parasitizing Chionomys roberti and Cricetulus barabensis. The mitochondrial results revealed that Trichuris populations from arvicolinae rodents show signals of a post-glacial northward population expansion starting from the Pyrenees and Italy. Apparently, the Pyrenees and the Alps were not barriers to the dispersal of Trichuris populations.
Inter-Arm Difference in Brachial Blood Pressure in the General Population of Koreans
Song, Bo Mi; Shim, Jee-Seon; Lee, Myung Ha; Choi, Dong Phil
2016-01-01
Background and Objectives We investigated the inter-arm difference in blood pressure of the general Korean population to identify associated factors. Subjects and Methods A total of 806 participants aged 30 to 64 years without history of major cardiovascular disease were analyzed in this cross-sectional study. They participated in the Cardiovascular and Metabolic Disease Etiology Research Center cohort study that began in 2013. Brachial blood pressure was measured simultaneously for both arms using an automated oscillometric device equipped with two cuffs in seated position. After five minutes of rest, systolic blood pressure (SBP) and diastolic blood pressure (DBP) were measured three times. The average of the three measurements was used for analysis. Multivariate logistic regression models were used to identify factors associated with inter-arm differences in blood pressure. Results The mean inter-arm difference was 3.3 mmHg for SBP and 2.0 mmHg for DBP. Large inter-arm differences (≥10 mmHg) in SBP and in DBP were found in 3.7% and 0.9% of subjects, respectively. A large inter-arm difference in SBP was associated with mean SBP (p=0.002) and C-reactive protein (p=0.014) while a large inter-arm different in DBP was only associated with body mass index (p=0.015). Sex, age, and anti-hypertensive medication use were not associated with differences in inter-arm blood pressure. Conclusion Large inter-arm difference in blood pressure is only present in a small portion of healthy Korean adults. Our findings suggest that high SBP, chronic inflammation, and obesity may be associated with larger difference in inter-arm blood pressure. PMID:27275174
Population Neuroscience: Dementia Epidemiology Serving Precision Medicine and Population Health.
Ganguli, Mary; Albanese, Emiliano; Seshadri, Sudha; Bennett, David A; Lyketsos, Constantine; Kukull, Walter A; Skoog, Ingmar; Hendrie, Hugh C
2018-01-01
Over recent decades, epidemiology has made significant contributions to our understanding of dementia, translating scientific discoveries into population health. Here, we propose reframing dementia epidemiology as "population neuroscience," blending techniques and models from contemporary neuroscience with those of epidemiology and biostatistics. On the basis of emerging evidence and newer paradigms and methods, population neuroscience will minimize the bias typical of traditional clinical research, identify the relatively homogenous subgroups that comprise the general population, and investigate broader and denser phenotypes of dementia and cognitive impairment. Long-term follow-up of sufficiently large study cohorts will allow the identification of cohort effects and critical windows of exposure. Molecular epidemiology and omics will allow us to unravel the key distinctions within and among subgroups and better understand individuals' risk profiles. Interventional epidemiology will allow us to identify the different subgroups that respond to different treatment/prevention strategies. These strategies will inform precision medicine. In addition, insights into interactions between disease biology, personal and environmental factors, and social determinants of health will allow us to measure and track disease in communities and improve population health. By placing neuroscience within a real-world context, population neuroscience can fulfill its potential to serve both precision medicine and population health.
Ji, Rui; Yu, Haixin; Fu, Qiang; Chen, Hongdan; Ye, Wenfeng; Li, Shaohui; Lou, Yonggen
2013-01-01
The brown planthopper (BPH), Nilaparvata lugens (Stål), a destructive rice pest in Asia, can quickly overcome rice resistance by evolving new virulent populations. Herbivore saliva plays an important role in plant-herbivore interactions, including in plant defense and herbivore virulence. However, thus far little is known about BPH saliva at the molecular level, especially its role in virulence and BPH-rice interaction. Using cDNA amplification in combination with Illumina short-read sequencing technology, we sequenced the salivary-gland transcriptomes of two BPH populations with different virulence; the populations were derived from rice variety TN1 (TN1 population) and Mudgo (M population). In total, 37,666 and 38,451 unigenes were generated from the salivary glands of these populations, respectively. When combined, a total of 43,312 unigenes were obtained, about 18 times more than the number of expressed sequence tags previously identified from these glands. Gene ontology annotations and KEGG orthology classifications indicated that genes related to metabolism, binding and transport were significantly active in the salivary glands. A total of 352 genes were predicted to encode secretory proteins, and some might play important roles in BPH feeding and BPH-rice interactions. Comparative analysis of the transcriptomes of the two populations revealed that the genes related to 'metabolism,' 'digestion and absorption,' and 'salivary secretion' might be associated with virulence. Moreover, 67 genes encoding putative secreted proteins were differentially expressed between the two populations, suggesting these genes may contribute to the change in virulence. This study was the first to compare the salivary-gland transcriptomes of two BPH populations having different virulence traits and to find genes that may be related to this difference. Our data provide a rich molecular resource for future functional studies on salivary glands and will be useful for elucidating the
GWAS and admixture mapping identify different asthma-associated loci in Latinos: The GALA II Study
Galanter, Joshua M; Gignoux, Christopher R; Torgerson, Dara G; Roth, Lindsey A; Eng, Celeste; Oh, Sam S; Nguyen, Elizabeth A; Drake, Katherine A; Huntsman, Scott; Hu, Donglei; Sen, Saunak; Davis, Adam; Farber, Harold J.; Avila, Pedro C.; Brigino-Buenaventura, Emerita; LeNoir, Michael A.; Meade, Kelley; Serebrisky, Denise; Borrell, Luisa N; Rodríguez-Cintrón, William; Estrada, Andres Moreno; Mendoza, Karla Sandoval; Winkler, Cheryl A.; Klitz, William; Romieu, Isabelle; London, Stephanie J.; Gilliland, Frank; Martinez, Fernando; Bustamante, Carlos; Williams, L Keoki; Kumar, Rajesh; Rodríguez-Santana, José R.; Burchard, and Esteban G.
2013-01-01
Background Asthma is a complex disease with both genetic and environmental causes. Genome-wide association studies of asthma have mostly involved European populations and replication of positive associations has been inconsistent. Objective To identify asthma-associated genes in a large Latino population with genome-wide association analysis and admixture mapping. Methods Latino children with asthma (n = 1,893) and healthy controls (n = 1,881) were recruited from five sites in the United States: Puerto Rico, New York, Chicago, Houston, and the San Francisco Bay Area. Subjects were genotyped on an Affymetrix World Array IV chip. We performed genome-wide association and admixture mapping to identify asthma-associated loci. Results We identified a significant association between ancestry and asthma at 6p21 (lowest p-value: rs2523924, p < 5 × 10−6). This association replicates in a meta-analysis of the EVE Asthma Consortium (p = 0.01). Fine mapping of the region in this study and the EVE Asthma Consortium suggests an association between PSORS1C1 and asthma. We confirmed the strong allelic association between the 17q21 asthma in Latinos (IKZF3, lowest p-value: rs90792, OR: 0.67, 95% CI 0.61 – 0.75, p = 6 × 10−13) and replicated associations in several genes that had previously been associated with asthma in genome-wide association studies. Conclusions Admixture mapping and genome-wide association are complementary techniques that provide evidence for multiple asthma-associated loci in Latinos. Admixture mapping identifies a novel locus on 6p21 that replicates in a meta-analysis of several Latino populations, while genome-wide association confirms the previously identified locus on 17q21. PMID:24406073
Generators of the brainstem auditory evoked potential in cat. III: Identified cell populations.
Melcher, J R; Kiang, N Y
1996-04-01
This paper examines the relationship between different brainstem cell populations and the brainstem auditory evoked potential (BAEP). First, we present a mathematical model relating the BAEP to underlying cellular activity. Then, we identify specific cellular generators of the click-evoked BAEP in cats by combining model-derived insights with key experimental data. These data include (a) a correspondence between particular brainstem regions and specific extrema in the BAEP waveform, determined from lesion experiments, and (b) values for model parameters derived from published physiological and anatomical information. Ultimately, we conclude (with varying degrees of confidence) that: (1) the earliest extrema in the BAEP are generated by spiral ganglion cells, (2) P2 is mainly generated by cochlear nucleus (CN) globular cells, (3) P3 is partly generated by CN spherical cells and partly by cells receiving inputs from globular cells, (4) P4 is predominantly generated by medial superior olive (MSO) principal cells, which are driven by spherical cells, (5) the generators of P5 are driven by MSO principal cells, and (6) the BAEP, as a whole, is generated mainly by cells with characteristic frequencies above 2 kHz. Thus, the BAEP in cats mainly reflects cellular activity in two parallel pathways, one originating with globular cells and the other with spherical cells. Since the globular cell pathway is poorly represented in humans, we suggest that the human BAEP is largely generated by brainstem cells in the spherical cell pathway. Given our conclusions, it should now be possible to relate activity in specific cell populations to psychophysical performance since the BAEP can be recorded in behaving humans and animals.
Rahmatalla, Siham A; Arends, Danny; Reissmann, Monika; Said Ahmed, Ammar; Wimmers, Klaus; Reyer, Henry; Brockmann, Gudrun A
2017-10-23
Sudan is endowed with a variety of indigenous goat breeds which are used for meat and milk production and which are well adapted to the local environment. The aim of the present study was to determine the genetic diversity and relationship within and between the four main Sudanese breeds of Nubian, Desert, Taggar and Nilotic goats. Using the 50 K SNP chip, 24 animals of each breed were genotyped. More than 96% of high quality SNPs were polymorphic with an average minor allele frequency of 0.3. In all breeds, no significant difference between observed (0.4) and expected (0.4) heterozygosity was found and the inbreeding coefficients (F IS ) did not differ from zero. F st coefficients for the genetic distance between breeds also did not significantly deviate from zero. In addition, the analysis of molecular variance revealed that 93% of the total variance in the examined population can be explained by differences among individuals, while only 7% result from differences between the breeds. These findings provide evidence for high genetic diversity and little inbreeding within breeds on one hand, and low diversity between breeds on the other hand. Further examinations using Nei's genetic distance and STRUCTURE analysis clustered Taggar goats distinct from the other breeds. In a principal component (PC) analysis, PC1 could separate Taggar, Nilotic and a mix of Nubian and Desert goats into three groups. The SNPs that contributed strongly to PC1 showed high F st values in Taggar goat versus the other goat breeds. PCA allowed us to identify target genomic regions which contain genes known to influence growth, development, bone formation and the immune system. The information on the genetic variability and diversity in this study confirmed that Taggar goat is genetically different from the other goat breeds in Sudan. The SNPs identified by the first principal components show high F st values in Taggar goat and allowed to identify candidate genes which can be used in the
Anderson, Karen E; Divino, Victoria; DeKoven, Mitch; Langbehn, Douglas; Warner, John H; Giuliano, Joseph; Lee, Won Chan
2014-01-01
Huntington's disease (HD) is a progressive neurodegenerative disease that spans distinct disease stages over 15-20 years. Various interventions are available which may allow patients to live outside of a nursing home for a longer time. However, little is known about use of these interventions by disease stage and by insurance type. We compared use of interventions among early, middle and late stages of HD in commercial (C) and Medicaid (M) health insurance populations. HD patients (ICD-9-CM 333.4) were identified from Thomson Reuters' MarketScan C and M database (2002-2009) and hierarchically grouped into disease stages based upon the presence of defining clinical markers. A total of 1,272 HD patients (752/520 C/M) were identified. While stage distribution was nearly uniform in the C database - 34.0/35.5/34.0% (early/middle/late stage) - in the M population the majority were late stage (74.0%). Overall mean age was similar between C and M populations. Among late-stage patients, more M patients resided in a nursing home (M:73.8% v. C:40.6%) and received hospice care (M:18.4% v. C:11.3%). Physical therapy (PT) and home assistance were the most frequent interventions used by middle-stage patients, however more C patients received PT (C:64.0% v. M:37.1%) while more M patients received home assistance (M:75.3% v. C:53.2%). Among late-stage patients, PT was also higher in the C population (56.3% v. 48.3%). More M patients had assistive devices at home in both middle (M:25.8% v. C:9.7%) and late stages (M:35.6% v.C:23.4%). Apparent interventional differences emerged which varied by disease stage and insurance type.
McLean, Duncan; John, Sujit; Barrett, Robert; McGrath, John; Loa, Peter; Thara, Rangaswamy; Mowry, Bryan
2012-04-30
We contrasted demographic and clinical characteristics in transethnic schizophrenia populations from Australia (n=821), India (n=520) and Sarawak, Malaysia (n=298) and proposed cultural explanations for identified site differences. From these we aimed to identify candidate variables free from significant cultural confounding that are hence suitable for inclusion in genetic analyses. We observed five phenomena: (1) more individuals were living alone in Australia than India or Sarawak; (2) drug use was lower in India than Australia or Sarawak; (3) duration of untreated psychosis (DUP) was longer in India than Australia or Sarawak; (4) the rate of schizoaffective disorder was lower in India than Australia or Sarawak; and (5) age at psychosis onset (AAO) was older in Sarawak than Australia or India. We suggest that site differences for living arrangements, drug use and DUP are culturally confounded. The schizoaffective site difference likely results from measurement bias. The AAO site difference, however, has no obvious cultural or measurement bias explanation. Therefore, this may be an ideal candidate for use in genetic studies, given that genetic variants affecting AAO have already been proposed. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Reyes-Tovilla, Jorge E; Hernández Yánez, Homero Daniel; Peralta-Jiménez, Yesenia; Ramón-Frías, Teresa; Juárez-Rojop, Isela; Pool-García, Sherezada; Velázquez-Sánchez, Martha Patricia; López-Narvóez, Lilia; Fresán, Ana; Tovilla-Zárate, Carlos Alfonso
2015-01-01
We performed a study to identify differences between patients with impulsive suicide attempt and those with premeditated suicide attempt in a Mexican population. We studied 144 patients who recently attempted suicide. Impulsive and premeditated suicide attempts were evaluated with the Suicide Intent Scale. These data were divided according to the type of attempt. Subsequently, the characteristics between the two groups were compared. The rate of patients that made an impulsive attempt was 61.8% and only 9.7% of the patients carried out a premeditated suicide attempt. More years of schooling/education and less severity of the attempt were observed in patients that carried out an impulsive suicide attempt (p < 0.001). Alcohol consumption (0.003) and use of cannabis (0.002) were present in patients who premeditated a suicide attempt. Our findings demonstrate that there are clinical differences among the individuals who carried out an impulsive suicide attempt from those who premeditated an attempt in a Mexican population. As a result, when planning interventions and prevention efforts it may be helpful to consider these clinical differences and demographic characteristics. © 2015 The Author(s).
Personality Characteristics of Leaders Identifying with Different Student Subcultures.
ERIC Educational Resources Information Center
Brainard, Stephen R.
This study was conducted to discover differences in personality characteristics among student leaders. The personality characteristics of presidents of campus organizations affiliated with one of four distinguishable student subcultures, identified by previous research as vocational, academic, collegiate, and nonconformist, were measured by the…
Roselló Peñaloza, Miguel; Gómez Fuentealba, Pablo; Castillo Gallardo, Patricia
2018-03-01
The epidemiological literature has reported differences by sex in the prevalence of psychiatric diagnoses. However, we know little about how other socio-demographic factors participate in these differences. To identify the socio-demographic factors that correlate with prevalent psychiatric diagnoses in women and men in a Chilean urban psychiatric hospital population. Socio-demographic information (age, educational level, marital status, family group and work status), psychiatric diagnoses and sex of the population were collected for 3,920 patients of a tertiary care hospital during a period of 8 years (2007-2014). The data were subjected to bivariate and multivariate analyses comparing the results by sex. Among the most prevalent psychiatric diagnoses, those significantly correlated with sex were eating disorders and major depression (women) and schizophrenia (men). Socio-demographic factors behave differently in men and women regarding those diagnoses. Among the differences, working and being married correlated directly with the diagnosis of depression only among women. Living alone correlated directly with the diagnosis of schizophrenia among men, but correlated inversely among women. Dissimilar associations between sex, psychiatric diagnosis and socio-demographic factors found in this Latin American sample invite us to reflect on how social conditions crosscut the relation between sex and psychopathology and to include gender perspectives in psychiatric practices.
Development of a model system to identify differences in spring and winter oat.
Chawade, Aakash; Lindén, Pernilla; Bräutigam, Marcus; Jonsson, Rickard; Jonsson, Anders; Moritz, Thomas; Olsson, Olof
2012-01-01
Our long-term goal is to develop a Swedish winter oat (Avena sativa). To identify molecular differences that correlate with winter hardiness, a winter oat model comprising of both non-hardy spring lines and winter hardy lines is needed. To achieve this, we selected 294 oat breeding lines, originating from various Russian, German, and American winter oat breeding programs and tested them in the field in south- and western Sweden. By assaying for winter survival and agricultural properties during four consecutive seasons, we identified 14 breeding lines of different origins that not only survived the winter but also were agronomically better than the rest. Laboratory tests including electrolytic leakage, controlled crown freezing assay, expression analysis of the AsVrn1 gene and monitoring of flowering time suggested that the American lines had the highest freezing tolerance, although the German lines performed better in the field. Finally, six lines constituting the two most freezing tolerant lines, two intermediate lines and two spring cultivars were chosen to build a winter oat model system. Metabolic profiling of non-acclimated and cold acclimated leaf tissue samples isolated from the six selected lines revealed differential expression patterns of 245 metabolites including several sugars, amino acids, organic acids and 181 hitherto unknown metabolites. The expression patterns of 107 metabolites showed significant interactions with either a cultivar or a time-point. Further identification, characterisation and validation of these metabolites will lead to an increased understanding of the cold acclimation process in oats. Furthermore, by using the winter oat model system, differential sequencing of crown mRNA populations would lead to identification of various biomarkers to facilitate winter oat breeding.
Yuan, Ya-Qun; Li, Fan; Meng, Pai; You, Jie; Wu, Min; Li, Shu-Guang; Chen, Bo
2016-07-23
Dietary patterns are linked to obesity, but the gender difference in the association between dietary patterns and obesity remains unclear. We explored this gender difference in a middle-aged and elderly populations in Shanghai. Residents (n = 2046; aged ≥45 years; 968 men and 1078 women) who participated in the Shanghai Food Consumption Survey were studied. Factor analysis of data from four periods of 24-h dietary recalls (across 2012-2014) identified dietary patterns. Height, body weight, and waist circumference were measured to calculate the body mass index. A log binominal model examined the association between dietary patterns and obesity, stratified by gender. Four dietary patterns were identified for both genders: rice staple, wheat staple, snacks, and prudent patterns. The rice staple pattern was associated positively with abdominal obesity in men (prevalence ratio (PR) = 1.358; 95% confidence interval (CI) 1.132-1.639; p = 0.001), but was associated negatively with general obesity in women (PR = 0.745; 95% CI: 0.673-0.807; p = 0.031). Men in the highest quartile of the wheat staple pattern had significantly greater risk of central obesity (PR = 1.331; 95% CI: 1.094-1.627; p = 0.005). There may be gender differences in the association between dietary patterns and obesity in middle-aged and elderly populations in Shanghai, China.
Yuan, Ya-Qun; Li, Fan; Meng, Pai; You, Jie; Wu, Min; Li, Shu-Guang; Chen, Bo
2016-01-01
Dietary patterns are linked to obesity, but the gender difference in the association between dietary patterns and obesity remains unclear. We explored this gender difference in a middle-aged and elderly populations in Shanghai. Residents (n = 2046; aged ≥45 years; 968 men and 1078 women) who participated in the Shanghai Food Consumption Survey were studied. Factor analysis of data from four periods of 24-h dietary recalls (across 2012–2014) identified dietary patterns. Height, body weight, and waist circumference were measured to calculate the body mass index. A log binominal model examined the association between dietary patterns and obesity, stratified by gender. Four dietary patterns were identified for both genders: rice staple, wheat staple, snacks, and prudent patterns. The rice staple pattern was associated positively with abdominal obesity in men (prevalence ratio (PR) = 1.358; 95% confidence interval (CI) 1.132–1.639; p = 0.001), but was associated negatively with general obesity in women (PR = 0.745; 95% CI: 0.673–0.807; p = 0.031). Men in the highest quartile of the wheat staple pattern had significantly greater risk of central obesity (PR = 1.331; 95% CI: 1.094–1.627; p = 0.005). There may be gender differences in the association between dietary patterns and obesity in middle-aged and elderly populations in Shanghai, China. PMID:27455322
Mobegi, Victor A; Duffy, Craig W; Amambua-Ngwa, Alfred; Loua, Kovana M; Laman, Eugene; Nwakanma, Davis C; MacInnis, Bronwyn; Aspeling-Jones, Harvey; Murray, Lee; Clark, Taane G; Kwiatkowski, Dominic P; Conway, David J
2014-06-01
Locally varying selection on pathogens may be due to differences in drug pressure, host immunity, transmission opportunities between hosts, or the intensity of between-genotype competition within hosts. Highly recombining populations of the human malaria parasite Plasmodium falciparum throughout West Africa are closely related, as gene flow is relatively unrestricted in this endemic region, but markedly varying ecology and transmission intensity should cause distinct local selective pressures. Genome-wide analysis of sequence variation was undertaken on a sample of 100 P. falciparum clinical isolates from a highly endemic region of the Republic of Guinea where transmission occurs for most of each year and compared with data from 52 clinical isolates from a previously sampled population from The Gambia, where there is relatively limited seasonal malaria transmission. Paired-end short-read sequences were mapped against the 3D7 P. falciparum reference genome sequence, and data on 136,144 single nucleotide polymorphisms (SNPs) were obtained. Within-population analyses identifying loci showing evidence of recent positive directional selection and balancing selection confirm that antimalarial drugs and host immunity have been major selective agents. Many of the signatures of recent directional selection reflected by standardized integrated haplotype scores were population specific, including differences at drug resistance loci due to historically different antimalarial use between the countries. In contrast, both populations showed a similar set of loci likely to be under balancing selection as indicated by very high Tajima's D values, including a significant overrepresentation of genes expressed at the merozoite stage that invades erythrocytes and several previously validated targets of acquired immunity. Between-population FST analysis identified exceptional differentiation of allele frequencies at a small number of loci, most markedly for five SNPs covering a 15-kb
Hijová, Emília; Gecková, Andrea Madarasová; Babinská, Ingrid
2014-03-01
Living in Roma settlements is associated with worse health in comparison with the majority population; this might be partially explained by socioeconomic disadvantages as well as cultural differences, including lifestyle. Eating habits represent an important part of lifestyle closely related to primary causes of morbidity and mortality, such as cardiovascular diseases, metabolic diseases or cancers. The eating habits of the population living in Roma settlements in comparison with those of the majority population were explored using the cross-sectional epidemiological HepaMeta study conducted in 2011. A representative sample of Roma (n = 452, mean age = 34.7; 35.2% men) and non-Roma (n = 403, mean age = 33.5; 45.9% men) aged 18-55 years living in the Kosice region were asked about breakfasting and recent consumption of fruits, vegetables, dairy products, meat products, meat, farinaceous dishes, and soft drinks. A logistic regression model was used separately for male and female participants. The population living in Roma settlements reported the recent consumption of fruit, vegetables and dairy products significantly less frequently in comparison with the majority population. Moreover, Roma females, in comparison with non-Roma females, reported significantly more frequently the consumption of meat and soft drinks. No differences were found between Roma and non-Roma in the consumption of meat products and farinaceous dishes. The population living in Roma settlements reported more frequently unhealthy eating habits in comparison with the majority population; this might contribute to worse health status of this population. The differences might be attributed to cultural differences between ethnic as well as socioeconomic groups, reduced availability of certain food items due to segregation or poverty and lower health literacy.
Kashtan, Nadav; Roggensack, Sara E; Berta-Thompson, Jessie W; Grinberg, Maor; Stepanauskas, Ramunas; Chisholm, Sallie W
2017-09-01
The Atlantic and Pacific Oceans represent different biogeochemical regimes in which the abundant marine cyanobacterium Prochlorococcus thrives. We have shown that Prochlorococcus populations in the Atlantic are composed of hundreds of genomically, and likely ecologically, distinct coexisting subpopulations with distinct genomic backbones. Here we ask if differences in the ecology and selection pressures between the Atlantic and Pacific are reflected in the diversity and genomic composition of their indigenous Prochlorococcus populations. We applied large-scale single-cell genomics and compared the cell-by-cell genomic composition of wild populations of co-occurring cells from samples from Station ALOHA off Hawaii, and from Bermuda Atlantic Time Series Station off Bermuda. We reveal fundamental differences in diversity and genomic structure of populations between the sites. The Pacific populations are more diverse than those in the Atlantic, composed of significantly more coexisting subpopulations and lacking dominant subpopulations. Prochlorococcus from the two sites seem to be composed of mostly non-overlapping distinct sets of subpopulations with different genomic backbones-likely reflecting different sets of ocean-specific micro-niches. Furthermore, phylogenetically closely related strains carry ocean-associated nutrient acquisition genes likely reflecting differences in major selection pressures between the oceans. This differential selection, along with geographic separation, clearly has a significant role in shaping these populations.
Graf von Stillfried, D; Czihal, T
2014-02-01
Geographic variation in health care is increasingly subject to analysis and health policy aiming at the suitable allocation of resources and the reduction of unwarranted variation for the patient populations concerned. As in the case of area-level indicators, in most cases populations are geographically defined. The concept of geographically defined populations, however, may be self-limiting with respect to identifying the potential for improvement. As an alternative, we explored how a functional definition of populations would support defining the scope for reducing unwarranted geographical variations. Given that patients in Germany have virtually no limits in accessing physicians of their choice, we adapted a method that has been developed in the United States to create virtual networks of physicians based on commonly treated patients. Using the physician claims data under statutory insurance, which covers 90% of the population, we defined 43,006 populations-and networks-in 2010. We found that there is considerable variation between the population in terms of their risk structure and the share of the primary care practice in the total services provided. Moreover, there are marked differences in the size and structure of networks between cities, densely populated regions, and rural regions. We analyzed the variation for two area-level indicators: the proportion of diabetics with at least one HbA1c test per year for diabetics, and the proportion of patients with low back pain undergoing computed tomography and/or magnetic resonance imaging. Variation at the level of functionally defined populations proved to be larger than for geographically defined populations. The pattern of distribution gives evidence on the degree to which consensus targets could be reached and which networks need to be addressed in order to reduce unwarranted regional variation. The concept of functionally defined populations needs to be further developed before implementation.
Antarctic and non-Antarctic meteorites form different populations
NASA Technical Reports Server (NTRS)
Dennison, J. E.; Lingner, D. W.; Lipschutz, M. E.
1986-01-01
The trace element differences between Victoria Land H5 chondrites and non-Antarctic H5 chondrites are studied. The focus on common meteorites was stimulated by Antarctic and non-Antarctic differences in meteorite types and in the trace element contents of congeners of rare type. Thirteen elements were analyzed by neutron activation analysis with radiochemical separation, and eight differed significantly. Eliminating test biasing and the possibility of compositional difference due to Antarctic weathering of the 300,000 year-old (on the average) Victoria Land falls, it is concluded that the two sets of chondrites differ due to extraterrestrial causes. The three possibilities discussed, differences in sample population, physical properties, orbital characteristics, and meteoroid flux with time, are all seen as problematic.
Hallett, S.L.; Lorz, H.V.; Atkinson, S.D.; Rasmussen, C.; Xue, L.; Bartholomew, J.L.
2009-01-01
Tubifex tubifex are obligate invertebrate hosts in the life cycle of Myxobolus cerebralis, the myxozoan parasite that causes whirling disease in salmonid fishes. This exotic parasite is established to varying degrees across Oregon's Columbia River system (Pacific Northwest, USA) and characteristics of local T. tubifex populations likely play a role in the pattern of disease occurrence. To better understand these patterns, we collected T. tubifex from three Oregon river basins (Willamette, Deschutes, and Grande Ronde), determined their genotype (mitochondrial 16S rDNA lineage and RAPD genotype) and exposed 10 different populations to M. cerebralis in the laboratory. Four mt lineages were identified: I, III, V and VI. Lineage III was found in all river basins but dominated both central and eastern sites. The RAPD assay further divided these lineages into geographic sub-populations; no RAPD genotype was common to all basins. There was a significant difference in prevalence of infection and level of parasite production among the populations we exposed to M. cerebralis that was attributed to genotypic composition. Only lineage III worms released actinospores and only populations dominated by this lineage amplified the parasite. These populations had the lowest survival, however, the lineage dominant before exposure remained dominant despite the high prevalence of infection. The distribution and infection dynamics of susceptible T. tubifex throughout Oregon may contribute to the differences in M. cerebralis occurrence; our studies further support the influence of oligochaete genotypes on the manifestation of whirling disease in salmonid populations. ?? 2009 Elsevier Inc. All rights reserved.
A Data Mining Approach to Identify Sexuality Patterns in a Brazilian University Population.
Waleska Simões, Priscyla; Cesconetto, Samuel; Toniazzo de Abreu, Larissa Letieli; Côrtes de Mattos Garcia, Merisandra; Cassettari Junior, José Márcio; Comunello, Eros; Bisognin Ceretta, Luciane; Aparecida Manenti, Sandra
2015-01-01
This paper presents the profile and experience of sexuality generated from a data mining classification task. We used a database about sexuality and gender violence performed on a university population in southern Brazil. The data mining task identified two relationships between the variables, which enabled the distinction of subgroups that better detail the profile and experience of sexuality. The identification of the relationships between the variables define behavioral models and factors of risk that will help define the algorithms being implemented in the data mining classification task.
Using a commercial telephone directory to identify a population-based sample of women of reproductive age
*DT Lobdell, GM Buck, JM Weiner, P Mendola (United States Environmental Protection Agency, Research Triangle Park, NC 27711)
In the United States, sampling women o...
Polynesian genetic affinities with Southeast Asian populations as identified by mtDNA analysis.
Melton, T; Peterson, R; Redd, A J; Saha, N; Sofro, A S; Martinson, J; Stoneking, M
1995-01-01
Polynesian genetic affinities to populations of Asia were studied using mtDNA markers. A total of 1,037 individuals from 12 populations were screened for a 9-bp deletion in the intergenic region between the COII and tRNA(Lys) genes that approaches fixation in Polynesians. Sequence-specific oligonucleotide probes that identify specific mtDNA control region nucleotide substitutions were used to describe variation in individuals with the 9-bp deletion. The 9-bp deletion was not observed in northern Indians, Bangladeshis, or Pakistanis but was seen at low to moderate frequencies in the nine other Southeast Asian populations. Three substitutions in the control region at positions 16217, 16247, and 16261 have previously been observed at high frequency in Polynesian mtDNAs; this "Polynesian motif" was observed in 20% of east Indonesians with the 9-bp deletion but was observed in only one additional individual. mtDNA types related to the Polynesian motif are highest in frequency in the corridor from Taiwan south through the Philippines and east Indonesia, and the highest diversity for these types is in Taiwan. These results are consistent with linguistic evidence of a Taiwanese origin for the proto-Polynesian expansion, which spread throughout Oceania by way of Indonesia. PMID:7668267
Differences in Antipsychotic-Related Adverse Events in Adult, Pediatric, and Geriatric Populations.
Sagreiya, Hersh; Chen, Yi-Ren; Kumarasamy, Narmadan A; Ponnusamy, Karthik; Chen, Doris; Das, Amar K
2017-02-26
In recent years, antipsychotic medications have increasingly been used in pediatric and geriatric populations, despite the fact that many of these drugs were approved based on clinical trials in adult patients only. Preliminary studies have shown that the "off-label" use of these drugs in pediatric and geriatric populations may result in adverse events not found in adults. In this study, we utilized the large-scale U.S. Food and Drug Administration (FDA) Adverse Events Reporting System (AERS) database to look at differences in adverse events from antipsychotics among adult, pediatric, and geriatric populations. We performed a systematic analysis of the FDA AERS database using MySQL by standardizing the database using structured terminologies and ontologies. We compared adverse event profiles of atypical versus typical antipsychotic medications among adult (18-65), pediatric (age < 18), and geriatric (> 65) populations. We found statistically significant differences between the number of adverse events in the pediatric versus adult populations with aripiprazole, clozapine, fluphenazine, haloperidol, olanzapine, quetiapine, risperidone, and thiothixene, and between the geriatric versus adult populations with aripiprazole, chlorpromazine, clozapine, fluphenazine, haloperidol, paliperidone, promazine, risperidone, thiothixene, and ziprasidone (p < 0.05, with adjustment for multiple comparisons). Furthermore, the particular types of adverse events reported also varied significantly between each population for aripiprazole, clozapine, haloperidol, olanzapine, quetiapine, risperidone, and ziprasidone (Chi-square, p < 10 -6 ). Diabetes was the most commonly reported side effect in the adult population, compared to behavioral problems in the pediatric population and neurologic symptoms in the geriatric population. We also found discrepancies between the frequencies of reports in AERS and in the literature. Our analysis of the FDA AERS database shows that there are
Oliva-Moreno, Juan
2018-01-01
Background HIV/AIDS (Human immunodeficiency virus/Acquired immune deficiency syndrome) not only has a strong impact on the health of the worldwide population but also affects the labour status of HIV-positive people. The primary aim of this paper is to compare the labour participation of people living with HIV (PlwHIV) with the labour participation of the general population along the last business cycle in Spain. Method The data used are from the Hospital Survey on HIV-AIDS, with a total sample size of 4,651 PlwHIV and the Labour Force Survey from 2001 to 2010, with a total sample size of 660,674 individuals as general population. Propensity Score Matching method was used to analyse the differences between the labour participation of PlwHIV and the general population. Additionally, several specific models categorised into different subgroups (gender, education, source of infection and level of defences) were also performed. Results We identified a convergence in labour participation across the period in the two populations considered: PlwHIV was 23% less likely to have a job than the general population during 2001–2002 and 14% less likely during 2009–2010. This convergence is mainly explained by two facts: first, the positive evolution of people infected by sex; second, the change in the PlwHIV population composition with a decreasing weight of people infected by drug use throughout the decade. Thereby, at the end of period, there was no statistical difference in the employment rate between PlwHIV infected through sex and the general population but there was strongly difference in PlwHIV infected through drugs. Conclusion Inmunological status, source of infection and level of education play a relevant role among the PlwHIV population when comparing their labour participation with the general population. In spite of this positive result, the likelihood of being employed in HIV-positive people continues to be different from that of non-carriers. Our study shows
Peña Longobardo, Luz María; Oliva-Moreno, Juan
2018-01-01
HIV/AIDS (Human immunodeficiency virus/Acquired immune deficiency syndrome) not only has a strong impact on the health of the worldwide population but also affects the labour status of HIV-positive people. The primary aim of this paper is to compare the labour participation of people living with HIV (PlwHIV) with the labour participation of the general population along the last business cycle in Spain. The data used are from the Hospital Survey on HIV-AIDS, with a total sample size of 4,651 PlwHIV and the Labour Force Survey from 2001 to 2010, with a total sample size of 660,674 individuals as general population. Propensity Score Matching method was used to analyse the differences between the labour participation of PlwHIV and the general population. Additionally, several specific models categorised into different subgroups (gender, education, source of infection and level of defences) were also performed. We identified a convergence in labour participation across the period in the two populations considered: PlwHIV was 23% less likely to have a job than the general population during 2001-2002 and 14% less likely during 2009-2010. This convergence is mainly explained by two facts: first, the positive evolution of people infected by sex; second, the change in the PlwHIV population composition with a decreasing weight of people infected by drug use throughout the decade. Thereby, at the end of period, there was no statistical difference in the employment rate between PlwHIV infected through sex and the general population but there was strongly difference in PlwHIV infected through drugs. Inmunological status, source of infection and level of education play a relevant role among the PlwHIV population when comparing their labour participation with the general population. In spite of this positive result, the likelihood of being employed in HIV-positive people continues to be different from that of non-carriers. Our study shows that institutional features of labour
Pereira, R M; Taylor, A S; Lehnert, M P; Koehler, P G
2013-06-01
Effects of host availability and feeding period on bed bugs, Cimex lectularius (L.) (Hemiptera: Cimicidae), were measured. Population growth and the potential harmful effect of bed bug populations on human hosts were modelled. Bloodmeal sizes were affected by both feeding length and frequency, with >2-fold difference between insects fed daily or weekly. Blood consumption increased >2-fold between bed bugs fed occasionally and often, and 1.5-fold between occasional and daily feeding. Bed bugs fed more often than once a week, potentially every 2-4 days. Egg production was associated with nutrition, being strongly correlated with blood consumption in the previous week. Bed bug populations can grow under different feeding regimes and are hard to control with <80% mortality. Bed bugs can survive and grow even in locations with a limited blood supply, where bed bug persistence may be important for the continual spread of populations. Persistence in non-traditional locations and a potential association with human pathogens increase the health risks of bed bugs. Potential blood loss as a result of a bed bug can have serious consequences because uncontrolled populations can reach harmful levels in 3-8 months. The reproduction potential of bed bug populations suggests serious consequences to human health and the need for efficacious control measures. © 2012 The Royal Entomological Society.
ERIC Educational Resources Information Center
Raz, Raanan; Weisskopf, Marc G.; Davidovitch, Michael; Pinto, Ofir; Levine, Hagai
2015-01-01
We analyzed data from the Israeli National Insurance Institute (NII). Autism Spectrum Disorder (ASD) incidence was calculated for all children born in Israel 1992-2009, and by population groups. Overall, 9,109 ASD cases among 2,431,649 children were identified. ASD cumulative incidence by age 8 years increased 10-fold during 2000-2011, from 0.49 %…
An, Hye Suck; Lee, Jang Wook; Hong, Seong Wan
2012-01-01
The small abalone, Haliotis diversicolor supertexta, of the family Haliotidae, is one of the most important species of marine shellfish in eastern Asia. Over the past few decades, this species has drastically declined in Korea. Thus, hatchery-bred seeds have been released into natural coastal areas to compensate for the reduced fishery resources. However, information on the genetic background of the small abalone is scarce. In this study, 20 polymorphic microsatellite DNA markers were identified using next-generation sequencing techniques and used to compare allelic variation between wild and released abalone populations in Korea. Using high-throughput genomic sequencing, a total of 1516 (2.26%; average length of 385 bp) reads containing simple sequence repeats were obtained from 86,011 raw reads. Among the 99 loci screened, 28 amplified successfully, and 20 were polymorphic. When comparing allelic variation between wild and released abalone populations, a total of 243 different alleles were observed, with 18.7 alleles per locus. High genetic diversity (mean heterozygosity = 0.81; mean allelic number = 15.5) was observed in both populations. A statistical analysis of the fixation index (F(ST)) and analysis of molecular variance (AMOVA) indicated limited genetic differences between the two populations (F(ST) = 0.002, p > 0.05). Although no significant reductions in the genetic diversity were found in the released population compared with the wild population (p > 0.05), the genetic diversity parameters revealed that the seeds released for stock abundance had a different genetic composition. These differences are likely a result of hatchery selection and inbreeding. Additionally, all the primer pair sets were effectively amplified in another congeneric species, H. diversicolor diversicolor, indicating that these primers are useful for both abalone species. These microsatellite loci may be valuable for future aquaculture and population genetic studies aimed at
Saenz-Agudelo, P; Jones, G P; Thorrold, S R; Planes, S
2009-04-01
The application of spatially explicit models of population dynamics to fisheries management and the design marine reserve network systems has been limited due to a lack of empirical estimates of larval dispersal. Here we compared assignment tests and parentage analysis for examining larval retention and connectivity under two different gene flow scenarios using panda clownfish (Amphiprion polymnus) in Papua New Guinea. A metapopulation of panda clownfish in Bootless Bay with little or no genetic differentiation among five spatially discrete locations separated by 2-6 km provided the high gene flow scenario. The low gene flow scenario compared the Bootless Bay metapopulation with a genetically distinct population (F(ST )= 0.1) located at Schumann Island, New Britain, 1500 km to the northeast. We used assignment tests and parentage analysis based on microsatellite DNA data to identify natal origins of 177 juveniles in Bootless Bay and 73 juveniles at Schumann Island. At low rates of gene flow, assignment tests correctly classified juveniles to their source population. On the other hand, parentage analysis led to an overestimate of self-recruitment within the two populations due to the significant deviation from panmixia when both populations were pooled. At high gene flow (within Bootless Bay), assignment tests underestimated self-recruitment and connectivity among subpopulations, and grossly overestimated self-recruitment within the overall metapopulation. However, the assignment tests did identify immigrants from distant (genetically distinct) populations. Parentage analysis clearly provided the most accurate estimates of connectivity in situations of high gene flow.
Zubair, Niha; Luis Ambite, Jose; Bush, William S.; Kichaev, Gleb; Lu, Yingchang; Manichaikul, Ani; Sheu, Wayne H-H.; Absher, Devin; Assimes, Themistocles L.; Bielinski, Suzette J.; Bottinger, Erwin P.; Buzkova, Petra; Chuang, Lee-Ming; Chung, Ren-Hua; Cochran, Barbara; Dumitrescu, Logan; Gottesman, Omri; Haessler, Jeffrey W.; Haiman, Christopher; Heiss, Gerardo; Hsiung, Chao A.; Hung, Yi-Jen; Hwu, Chii-Min; Juang, Jyh-Ming J.; Le Marchand, Loic; Lee, I-Te; Lee, Wen-Jane; Lin, Li-An; Lin, Danyu; Lin, Shih-Yi; Mackey, Rachel H.; Martin, Lisa W.; Pasaniuc, Bogdan; Peters, Ulrike; Predazzi, Irene; Quertermous, Thomas; Reiner, Alex P.; Robinson, Jennifer; Rotter, Jerome I.; Ryckman, Kelli K.; Schreiner, Pamela J.; Stahl, Eli; Tao, Ran; Tsai, Michael Y.; Waite, Lindsay L.; Wang, Tzung-Dau; Buyske, Steven; Ida Chen, Yii-Der; Cheng, Iona; Crawford, Dana C.; Loos, Ruth J.F.; Rich, Stephen S.; Fornage, Myriam; North, Kari E.; Kooperberg, Charles; Carty, Cara L.
2016-01-01
Abstract Genome-wide association studies have identified over 150 loci associated with lipid traits, however, no large-scale studies exist for Hispanics and other minority populations. Additionally, the genetic architecture of lipid-influencing loci remains largely unknown. We performed one of the most racially/ethnically diverse fine-mapping genetic studies of HDL-C, LDL-C, and triglycerides to-date using SNPs on the MetaboChip array on 54,119 individuals: 21,304 African Americans, 19,829 Hispanic Americans, 12,456 Asians, and 530 American Indians. The majority of signals found in these groups generalize to European Americans. While we uncovered signals unique to racial/ethnic populations, we also observed systematically consistent lipid associations across these groups. In African Americans, we identified three novel signals associated with HDL-C (LPL, APOA5, LCAT) and two associated with LDL-C (ABCG8, DHODH). In addition, using this population, we refined the location for 16 out of the 58 known MetaboChip lipid loci. These results can guide tailored screening efforts, reveal population-specific responses to lipid-lowering medications, and aid in the development of new targeted drug therapies. PMID:28426890
Interarm blood pressure difference in a post-stroke population.
Gaynor, Eva; Brewer, Linda; Mellon, Lisa; Hall, Patricia; Horgan, Frances; Shelley, Emer; Dolan, Eamonn; Hickey, Anne; Bennett, Kathleen; Williams, David J
2017-09-01
An increased interarm systolic blood pressure (SBP) difference of ≥10 mm Hg is associated with increased cardiovascular risk and a difference of ≥15 mm Hg with increased cerebrovascular risk. The stroke population presents a high-risk group for future cardiovascular and cerebrovascular events and therefore estimation of interarm SBP difference as a predictive tool may assist with further secondary stroke prevention. The aim of the study was to determine the prevalence of interarm SBP and diastolic blood pressure difference in a post-stroke population. A comprehensive assessment of secondary risk factors along with blood pressure measurements were taken 6-months' post-ischemic stroke from the Action on Secondary Prevention Interventions and Rehabilitation in Stroke cohort. Descriptive and logistic regression analyses were performed. Odds ratios and 95% confidence intervals are presented. Two hundred thirty-eight (M: F,139:99; mean age, 68.4 years) of 256 patients followed up at 6 months post-stroke had suitable blood pressure readings from both arms. Ninety-six patients (40.3%) had an interarm SBP difference of ≥10 mm Hg and 49 (20.6%) had a difference of ≥15 mm Hg. A history of hypertension, diabetes, smoking, and obesity was not significantly associated with an increased risk of interarm SBP difference. After multivariate logistic analysis, a history of alcohol excess was associated with an increased IASBP ≥15 mm Hg (odds ratio 2.32, 95% confidence interval 1.03-5.22). We have demonstrated that interarm SBP difference is commonly seen in a post stroke population. Copyright © 2017 American Society of Hypertension. Published by Elsevier Inc. All rights reserved.
Bertolini, F; Galimberti, G; Schiavo, G; Mastrangelo, S; Di Gerlando, R; Strillacci, M G; Bagnato, A; Portolano, B; Fontanesi, L
2018-01-01
Commercial single nucleotide polymorphism (SNP) arrays have been recently developed for several species and can be used to identify informative markers to differentiate breeds or populations for several downstream applications. To identify the most discriminating genetic markers among thousands of genotyped SNPs, a few statistical approaches have been proposed. In this work, we compared several methods of SNPs preselection (Delta, F st and principal component analyses (PCA)) in addition to Random Forest classifications to analyse SNP data from six dairy cattle breeds, including cosmopolitan (Holstein, Brown and Simmental) and autochthonous Italian breeds raised in two different regions and subjected to limited or no breeding programmes (Cinisara, Modicana, raised only in Sicily and Reggiana, raised only in Emilia Romagna). From these classifications, two panels of 96 and 48 SNPs that contain the most discriminant SNPs were created for each preselection method. These panels were evaluated in terms of the ability to discriminate as a whole and breed-by-breed, as well as linkage disequilibrium within each panel. The obtained results showed that for the 48-SNP panel, the error rate increased mainly for autochthonous breeds, probably as a consequence of their admixed origin lower selection pressure and by ascertaining bias in the construction of the SNP chip. The 96-SNP panels were generally more able to discriminate all breeds. The panel derived by PCA-chrom (obtained by a preselection chromosome by chromosome) could identify informative SNPs that were particularly useful for the assignment of minor breeds that reached the lowest value of Out Of Bag error even in the Cinisara, whose value was quite high in all other panels. Moreover, this panel contained also the lowest number of SNPs in linkage disequilibrium. Several selected SNPs are located nearby genes affecting breed-specific phenotypic traits (coat colour and stature) or associated with production traits. In
Al-Mayhani, M. Talal F.; Grenfell, Richard; Narita, Masashi; Piccirillo, Sara; Kenney-Herbert, Emma; Fawcett, James W.; Collins, V. Peter; Ichimura, Koichi; Watts, Colin
2011-01-01
Glioblastoma multiforme (GBM) is the most common type of primary brain tumor and a highly malignant and heterogeneous cancer. Current conventional therapies fail to eradicate or curb GBM cell growth. Hence, exploring the cellular and molecular basis of GBM cell growth is vital to develop novel therapeutic approaches. Neuroglia (NG)-2 is a transmembrane proteoglycan expressed by NG2+ progenitors and is strongly linked to cell proliferation in the normal brain. By using NG2 as a biomarker we identify a GBM cell population (GBM NG2+ cells) with robust proliferative, clonogenic, and tumorigenic capacity. We show that a significant proportion (mean 83%) of cells proliferating in the tumor mass express NG2 and that over 50% of GBM NG2+ cells are proliferating. Compared with the GBM NG2− cells from the same tumor, the GBM of NG2+ cells overexpress genes associated with aggressive tumorigenicity, including overexpression of Mitosis and Cell Cycling Module genes (e.g., MELK, CDC, MCM, E2F), which have been previously shown to correlate with poor survival in GBM. We also show that the coexpression pattern of NG2 with other glial progenitor markers in GBM does not recapitulate that described in the normal brain. The expression of NG2 by such an aggressive and actively cycling GBM population combined with its location on the cell surface identifies this cell population as a potential therapeutic target in a subset of patients with GBM. PMID:21798846
Dorofeev, S B; Babenko, A I
2017-01-01
The article deals with analysis of national and international publications concerning methodological aspects of elaborating systematic approach to healthy life-style of population. This scope of inquiry plays a key role in development of human capital. The costs related to healthy life-style are to be considered as personal investment into future income due to physical incrementation of human capital. The definitions of healthy life-style, its categories and supportive factors are to be considered in the process of development of strategies and programs of healthy lifestyle. The implementation of particular strategies entails application of comprehensive information and educational programs meant for various categories of population. Therefore, different motivation techniques are to be considered for children, adolescents, able-bodied population, the elderly. This approach is to be resulted in establishing particular responsibility for national government, territorial administrations, health care administrations, employers and population itself. The necessity of complex legislative measures is emphasized. The recent social hygienic studies were focused mostly on particular aspects of development of healthy life-style of population. Hence, the demand for long term exploration of development of organizational and functional models implementing medical preventive measures on the basis of comprehensive information analysis using statistical, sociological and professional expertise.
Chen, Hongdan; Ye, Wenfeng; Li, Shaohui; Lou, Yonggen
2013-01-01
Background The brown planthopper (BPH), Nilaparvata lugens (Stål), a destructive rice pest in Asia, can quickly overcome rice resistance by evolving new virulent populations. Herbivore saliva plays an important role in plant–herbivore interactions, including in plant defense and herbivore virulence. However, thus far little is known about BPH saliva at the molecular level, especially its role in virulence and BPH–rice interaction. Methodology/Principal Findings Using cDNA amplification in combination with Illumina short-read sequencing technology, we sequenced the salivary-gland transcriptomes of two BPH populations with different virulence; the populations were derived from rice variety TN1 (TN1 population) and Mudgo (M population). In total, 37,666 and 38,451 unigenes were generated from the salivary glands of these populations, respectively. When combined, a total of 43,312 unigenes were obtained, about 18 times more than the number of expressed sequence tags previously identified from these glands. Gene ontology annotations and KEGG orthology classifications indicated that genes related to metabolism, binding and transport were significantly active in the salivary glands. A total of 352 genes were predicted to encode secretory proteins, and some might play important roles in BPH feeding and BPH–rice interactions. Comparative analysis of the transcriptomes of the two populations revealed that the genes related to ‘metabolism,’ ‘digestion and absorption,’ and ‘salivary secretion’ might be associated with virulence. Moreover, 67 genes encoding putative secreted proteins were differentially expressed between the two populations, suggesting these genes may contribute to the change in virulence. Conclusions/Significance This study was the first to compare the salivary-gland transcriptomes of two BPH populations having different virulence traits and to find genes that may be related to this difference. Our data provide a rich molecular resource for
The differing magnitude distributions of the two Jupiter Trojan color populations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, Ian; Brown, Michael E.; Emery, Joshua P., E-mail: iwong@caltech.edu
The Jupiter Trojans are a significant population of minor bodies in the middle solar system that have garnered substantial interest in recent years. Several spectroscopic studies of these objects have revealed notable bimodalities with respect to near-infrared spectra, infrared albedo, and color, which suggest the existence of two distinct groups among the Trojan population. In this paper, we analyze the magnitude distributions of these two groups, which we refer to as the red and less red color populations. By compiling spectral and photometric data from several previous works, we show that the observed bimodalities are self-consistent and categorize 221 ofmore » the 842 Trojans with absolute magnitudes in the range H<12.3 into the two color populations. We demonstrate that the magnitude distributions of the two color populations are distinct to a high confidence level (>95%) and fit them individually to a broken power law, with special attention given to evaluating and correcting for incompleteness in the Trojan catalog as well as incompleteness in our categorization of objects. A comparison of the best-fit curves shows that the faint-end power-law slopes are markedly different for the two color populations, which indicates that the red and less red Trojans likely formed in different locations. We propose a few hypotheses for the origin and evolution of the Trojan population based on the analyzed data.« less
Bajard, Agathe; Chabaud, Sylvie; Cornu, Catherine; Castellan, Anne-Charlotte; Malik, Salma; Kurbatova, Polina; Volpert, Vitaly; Eymard, Nathalie; Kassai, Behrouz; Nony, Patrice
2016-01-01
The main objective of our work was to compare different randomized clinical trial (RCT) experimental designs in terms of power, accuracy of the estimation of treatment effect, and number of patients receiving active treatment using in silico simulations. A virtual population of patients was simulated and randomized in potential clinical trials. Treatment effect was modeled using a dose-effect relation for quantitative or qualitative outcomes. Different experimental designs were considered, and performances between designs were compared. One thousand clinical trials were simulated for each design based on an example of modeled disease. According to simulation results, the number of patients needed to reach 80% power was 50 for crossover, 60 for parallel or randomized withdrawal, 65 for drop the loser (DL), and 70 for early escape or play the winner (PW). For a given sample size, each design had its own advantage: low duration (parallel, early escape), high statistical power and precision (crossover), and higher number of patients receiving the active treatment (PW and DL). Our approach can help to identify the best experimental design, population, and outcome for future RCTs. This may be particularly useful for drug development in rare diseases, theragnostic approaches, or personalized medicine. Copyright © 2016 Elsevier Inc. All rights reserved.
Prabhanjan, Manasa; Suresh, Raviraj V; Murthy, Megha N; Ramachandra, Nallur B
2016-03-01
To identify the role of copy number variations (CNVs) on disease risk genes and its effect on disease phenotypes in type 2 diabetes mellitus (T2DM) in 12 random populations using high throughput arrays. CNV analysis was carried out on a total of 1715 individuals from 12 populations, from ArrayExpress Archive of the European Bioinformatics Institute along with our subjects using Affymetrix Genome Wide SNP 6.0 array. CNV effect on T2DM genes were analyzed using several bioinformatics tools and a molecular protein interaction network was constructed to identify the disease mechanism altered by the CNVs. Analysis showed 34.4% of the total population to be under CNV burden for T2DM, with 83 disease causal and associated genes being under CNV influence. Hotspots were identified on chromosomes 22, 12, 6, 19 and 11.Overlap studies with case cohorts revealed significant disease risk genes such as EGFR, E2F1, PPP1R3A, HLA and TSPAN8. CNVs play a significant role in predisposing T2DM in normal cohorts and contribute to the phenotypic effects. Thus, CNVs should be considered as one of the major contributors in predisposition of the disease. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Drosophila Cancer Models Identify Functional Differences between Ret Fusions.
Levinson, Sarah; Cagan, Ross L
2016-09-13
We generated and compared Drosophila models of RET fusions CCDC6-RET and NCOA4-RET. Both RET fusions directed cells to migrate, delaminate, and undergo EMT, and both resulted in lethality when broadly expressed. In all phenotypes examined, NCOA4-RET was more severe than CCDC6-RET, mirroring their effects on patients. A functional screen against the Drosophila kinome and a library of cancer drugs found that CCDC6-RET and NCOA4-RET acted through different signaling networks and displayed distinct drug sensitivities. Combining data from the kinome and drug screens identified the WEE1 inhibitor AZD1775 plus the multi-kinase inhibitor sorafenib as a synergistic drug combination that is specific for NCOA4-RET. Our work emphasizes the importance of identifying and tailoring a patient's treatment to their specific RET fusion isoform and identifies a multi-targeted therapy that may prove effective against tumors containing the NCOA4-RET fusion. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Taqui, Ather M; Shaikh, Mehrine; Gowani, Saqib A; Shahid, Fatima; Khan, Asmatullah; Tayyeb, Syed M; Satti, Minahil; Vaqar, Talha; Shahid, Saman; Shamsi, Afreen; Ganatra, Hammad A; Naqvi, Haider A
2008-01-01
Background Body dysmorphic disorder (BDD) is a psychiatric disorder characterized by a preoccupation with an imagined or slight defect which causes significant distress or impairment in functioning. Few studies have assessed gender differences in BDD in a non clinical population. Also no study assessed BDD in medical students. This study was designed to determine the point prevalence of BDD in Pakistani medical students and the gender differences in prevalence of BDD, body foci of concern and symptoms of BDD. Methods The medical students enrolled in a medical university in Karachi, Pakistan filled out a self-report questionnaire which assessed clinical features of BDD. BDD was diagnosed according to the DSM-IV criteria. Results Out of the 156 students, 57.1% were female. A total of 78.8% of the students reported dissatisfaction with some aspect of their appearance and 5.8% met the DSM-IV criteria for BDD. The male to female ratio for BDD was 1.7. Regarding gender differences in body foci of concern, the top three reported foci of concern in male students were head hair (34.3%), being fat (32.8%), skin (14.9%) and nose(14.9%), whereas in females they were being fat (40.4%), skin (24.7%) and teeth (18%). Females were significantly more concerned about being fat (p = 0.005). Male students were significantly more concerned about being thin (p = 0.01) and about head hair (p = 0.012). Conclusion BDD is fairly common in our medical student population, with a higher prevalence in males. Important gender differences in BDD symptomatology and reported body foci of concern were identified which reflected the influence of media on body image perception. The impact of cultural factors on the prevalence as well as gender differences in BDD symptomatology was also established. PMID:18400091
Goodworth, Adam D.; Wu, Yen-Hsun; Felmlee, Duffy; Dunklebarger, Ellis; Saavedra, Sandra
2016-01-01
Populations with moderate-to-severe motor control impairments often exhibit degraded trunk control and/or lack the ability to sit unassisted. These populations need more research, yet their underdeveloped trunk control complicates identification of neural mechanisms behind their movements. The purpose of this study was to overcome this barrier by developing the first multi-articulated trunk support system to identify visual, vestibular, and proprioception contributions to posture in populations lacking independent sitting. The system provided external stability at a user-specific level on the trunk, so that body segments above the level of support required active posture control. The system included a tilting surface (controlled via servomotor) as a stimulus to investigate sensory contributions to postural responses. Frequency response and coherence functions between the surface tilt and trunk support were used to characterize system dynamics and indicated that surface tilts were accurately transmitted up to 5Hz. Feasibility of collecting kinematic data in participants lacking independent sitting was demonstrated in two populations: two typically developing infants, ~2-8 months, in a longitudinal study (8 sessions each) and four children with moderate-to-severe cerebral palsy (GMFCS III-V). Adaptability in the system was assessed by testing 16 adults (ages 18-63). Kinematic responses to continuous pseudorandom surface tilts were evaluated across 0.046–2Hz and qualitative feedback indicated that the trunk support and stimulus were comfortable for all subjects. Concepts underlying the system enable both research for, and rehabilitation in, populations lacking independent sitting. PMID:27046877
Finch, Caroline F; Stephan, Karen; Shee, Anna Wong; Hill, Keith; Haines, Terry P; Clemson, Lindy; Day, Lesley
2015-01-01
Background There has been limited research investigating the relationship between injurious falls and hospital resource use. The aims of this study were to identify clusters of community-dwelling older people in the general population who are at increased risk of being admitted to hospital following a fall and how those clusters differed in their use of hospital resources. Methods Analysis of routinely collected hospital admissions data relating to 45 374 fall-related admissions in Victorian community-dwelling older adults aged ≥65 years that occurred during 2008/2009 to 2010/2011. Fall-related admission episodes were identified based on being admitted from a private residence to hospital with a principal diagnosis of injury (International Classification of Diseases (ICD)-10-AM codes S00 to T75) and having a first external cause of a fall (ICD-10-AM codes W00 to W19). A cluster analysis was performed to identify homogeneous groups using demographic details of patients and information on the presence of comorbidities. Hospital length of stay (LOS) was compared across clusters using competing risks regression. Results Clusters based on area of residence, demographic factors (age, gender, marital status, country of birth) and the presence of comorbidities were identified. Clusters representing hospitalised fallers with comorbidities were associated with longer LOS compared with other cluster groups. Clusters delineated by demographic factors were also associated with increased LOS. Conclusions All patients with comorbidity, and older women without comorbidities, stay in hospital longer following a fall and hence consume a disproportionate share of hospital resources. These findings have important implications for the targeting of falls prevention interventions for community-dwelling older people. PMID:25618735
Sex differences in jealousy: a population-based twin study in Sweden.
Walum, Hasse; Larsson, Henrik; Westberg, Lars; Lichtenstein, Paul; Magnusson, Patrik K E
2013-10-01
According to the theory of evolved sex differences in jealousy, the challenge for women to ensure paternal investment increased their jealousy response to emotional infidelity, whereas paternal uncertainty exerted selective pressures that shaped men to become more distressed by sexual infidelity. Several studies have investigated whether the effect of these sexually dimorphic selection pressures can be detected in contemporary human populations, with conflicting results. To date, no genetically informed studies of sex differences in jealousy have been conducted. We used data from the Screening Across the Lifespan of Twins Younger (SALTY) sample, containing information concerning self-rated jealousy from 3,197 complete twin pairs collected by the Swedish Twin Registry. Intra-class correlations and structural equation models were used to assess the genetic influence on jealousy and to investigate sex differences at genetic level. We saw a highly significant sex effect on the relationship between infidelity types, indicating that men, relative to women, reported greater jealousy in response to sexual infidelity than in response to emotional infidelity. The twin models revealed significant heritabilities for both sexual (32%) and emotional (26%) jealousy. The heritabilities were of a similar magnitude in both sexes, and no qualitative sex differences could be detected. We show for the first time that variance in jealousy is to some extent explained by genetic factors. Even though our results from the mean value analyses are in line with the theory of evolved sex differences in jealousy, we could not identify any sex differences on a genetic level.
Pfennig, Karin S; Allenby, Ashley; Martin, Ryan A; Monroy, Anaïs; Jones, Corbin D
2012-09-01
Two congeneric species of spadefoot toad, Spea multiplicata and Spea bombifrons, have been the focus of hybridization studies since the 1970s. Because complex hybrids are not readily distinguished phenotypically, genetic markers are needed to identify introgressed individuals. We therefore developed a set of molecular markers (amplified fragment length polymorphism, polymerase chain reaction-restriction fragment length polymorphism and single nucleotide polymorphism) for identifying pure-species, F1 hybrids and more complex introgressed types. To do so, we tested a series of markers across both species and known hybrids using populations in both allopatry and sympatry. We retained those markers that differentiated the two pure-species and also consistently identified known species hybrids. These markers are well suited for identifying hybrids between these species. Moreover, those markers that show variation within each species can be used in conjunction with existing molecular markers in studies of population structure and gene flow. © 2012 Blackwell Publishing Ltd.
Purushotham, Chetana B; Robin, V V
2016-10-01
Various mechanisms of isolation can structure populations and result in cultural and genetic differentiation. Similar to genetic markers, for songbirds, culturally transmitted sexual signals such as breeding song can be used as a measure of differentiation as songs can also be impacted by geographic isolation resulting in population-level differences in song structure. Several studies have found differences in song structure either across ancient geographic barriers or across contemporary habitat barriers owing to deforestation. However, very few studies have examined the effect of both ancient barriers and recent deforestation in the same system. In this study, we examined the geographic variation in song structure across six populations of the White-bellied Shortwing, a threatened and endemic songbird species complex found on isolated mountaintops or "sky islands" of the Western Ghats. While some sky islands in the system are isolated by ancient valleys, others are separated by deforestation. We examined 14 frequency and temporal spectral traits and two syntax traits from 835 songs of 38 individuals across the six populations. We identified three major song clusters based on a discriminant model of spectral traits, degree of similarity of syntax features, as well as responses of birds to opportunistic playback. However, some traits like complex vocal mechanisms (CVM), relating to the use of syrinxes, clearly differentiated both ancient and recently fragmented populations. We suggest that CVMs may have a cultural basis and can be used to identify culturally isolated populations that cannot be differentiated using genetic markers or commonly used frequency-based song traits. Our results demonstrate the use of bird songs to reconstruct phylogenetic groups and impacts of habitat fragmentation even in complex scenarios of historic and contemporary isolation.
Tedim, Ana P.; Ruiz-Garbajosa, Patricia; Corander, Jukka; Rodríguez, Concepción M.; Cantón, Rafael; Willems, Rob J.; Baquero, Fernando
2014-01-01
The diversity of enterococcal populations from fecal samples from hospitalized (n = 133) and nonhospitalized individuals (n = 173) of different age groups (group I, ages 0 to 19 years; group II, ages 20 to 59 years; group III, ages ≥60 years) was analyzed. Enterococci were recovered at similar rates from hospitalized and nonhospitalized persons (77.44% to 79.77%) of all age groups (75.0% to 82.61%). Enterococcus faecalis and Enterococcus faecium were predominant, although seven other Enterococcus species were identified. E. faecalis and E. faecium (including ampicillin-resistant E. faecium) colonization rates in nonhospitalized persons were age independent. For inpatients, E. faecalis colonization rates were age independent, but E. faecium colonization rates (particularly the rates of ampicillin-resistant E. faecium colonization) significantly increased with age. The population structure of E. faecium and E. faecalis was determined by superimposing goeBURST and Bayesian analysis of the population structure (BAPS). Most E. faecium sequence types (STs; 150 isolates belonging to 75 STs) were linked to BAPS groups 1 (22.0%), 2 (31.3%), and 3 (36.7%). A positive association between hospital isolates and BAPS subgroups 2.1a and 3.3a (which included major ampicillin-resistant E. faecium human lineages) and between community-based ampicillin-resistant E. faecium isolates and BAPS subgroups 1.2 and 3.3b was found. Most E. faecalis isolates (130 isolates belonging to 58 STs) were grouped into 3 BAPS groups, BAPS groups 1 (36.9%), 2 (40.0%), and 3 (23.1%), with each one comprising widespread lineages. No positive associations with age or hospitalization were established. The diversity and dynamics of enterococcal populations in the fecal microbiota of healthy humans are largely unexplored, with the available knowledge being fragmented and contradictory. The study offers a novel and comprehensive analysis of enterococcal population landscapes and suggests that E. faecium
Osada, Masako; Singh, Varan J; Wu, Kenmin; Sant'Angelo, Derek B; Pezzano, Mark
2013-01-01
Thymic microenvironments are essential for the proper development and selection of T cells critical for a functional and self-tolerant adaptive immune response. While significant turnover occurs, it is unclear whether populations of adult stem cells contribute to the maintenance of postnatal thymic epithelial microenvironments. Here, the slow cycling characteristic of stem cells and their property of label-retention were used to identify a K5-expressing thymic stromal cell population capable of generating clonal cell lines that retain the capacity to differentiate into a number of mesenchymal lineages including adipocytes, chondrocytes and osteoblasts suggesting a mesenchymal stem cell-like phenotype. Using cell surface analysis both culture expanded LRCs and clonal thymic mesenchymal cell lines were found to express Sca1, PDGFRα, PDGFRβ,CD29, CD44, CD49F, and CD90 similar to MSCs. Sorted GFP-expressing stroma, that give rise to TMSC lines, contribute to thymic architecture when reaggregated with fetal stroma and transplanted under the kidney capsule of nude mice. Together these results show that the postnatal thymus contains a population of mesenchymal stem cells that can be maintained in culture and suggests they may contribute to the maintenance of functional thymic microenvironments.
Population density and racial differences in the performance of emergency medical services.
David, Guy; Harrington, Scott E
2010-07-01
This paper analyzes the existence and scope of possible racial differences/disparities in the provision of emergency medical services (EMS) response capability (time from dispatch to arrival at the scene and level of training of the responding team) using data on approximately 120,000 cardiac incidents in the state of Mississippi during 1995-2004. The conceptual framework and empirical analysis focus on the likely effects of population density on the efficient production of EMS as a local public good subject to congestion, and on the need to control adequately for population density to avoid bias in testing for racial differences. Models that control for aggregate population density at the county-level indicate "reverse" disparities: faster estimated response times for African-Americans than for whites. When a refined county-level measure of population density is used that incorporates differences in African-American and white population density by Census tract, the reverse disparity in response times disappears. There also is little or no evidence of race-related differences in the certification level of EMS responders. However, there is evidence that, controlling for response time, African-Americans on average were significantly more likely to be deceased than whites upon EMS arrival at the scene. The overall results are germane to the debate over the scope of conditioning variables that should be included when testing for racial disparities in health care.
Sarfati, Diana; Gurney, Jason; Lim, Bee Teng; Bagheri, Nasser; Simpson, Andrew; Koea, Jonathan; Dennett, Elizabeth
2016-03-01
Our study sought to optimize the identification and investigate the impact of comorbidity in cancer patients using routinely collected hospitalization data. We undertook an iterative process of classification of important clinical conditions involving evaluation of relevant literature and consultation with clinicians. Patients diagnosed with colon, rectal, breast, ovarian, uterine, stomach, liver, renal or bladder cancers (n = 14,096) between 2006 and 2008 were identified from the New Zealand Cancer Registry. Conditions were identified using data on diagnoses from hospital admissions for 5 years prior to cancer diagnosis. Patients were followed up until end of 2009 using routine mortality data. Prevalence estimates for each condition by site were calculated. All-cause mortality impact of common conditions was investigated using Cox regression models adjusted for age and stage at diagnosis. Patients with liver and stomach cancers tended to have higher comorbidity and those with breast cancer, lower comorbidity than other cancer patients. Of the 50 conditions, the most common were hypertension (prevalence 8.0-20.9%), cardiac conditions (2.1-13.5%) and diabetes with (2.3-13.3%) and without (2.9-12.9%) complications. Comorbidity was associated with higher all-cause mortality but the impact varied by condition and across cancer site, with impact less for cancers with poor prognoses. Conditions most consistently associated with adverse outcomes across all cancer sites were renal disease, coagulopathies and congestive heart failure. Comorbidity is highly prevalent in cancer populations, but prevalence and impact of conditions differ markedly by cancer type. © 2013 Wiley Publishing Asia Pty Ltd.
Igawa, T; Oumi, S; Katsuren, S; Sumida, M
2013-01-01
Isolation by distance and landscape connectivity are fundamental factors underlying speciation and evolution. To understand how landscapes affect gene flow and shape population structures, island species provide intrinsic study objects. We investigated the effects of landscapes on the population structure of the endangered frog species, Odorrana ishikawae and O. splendida, which each inhabit an island in southwest Japan. This was done by examining population structure, gene flow and demographic history of each species by analyzing 12 microsatellite loci and exploring causal environmental factors through ecological niche modeling (ENM) and the cost-distance approach. Our results revealed that the limited gene flow and multiple-population structure in O. splendida and the single-population structure in O. ishikawae were maintained after divergence of the species through ancient vicariance between islands. We found that genetic distance correlated with geographic distance between populations of both species. Our landscape genetic analysis revealed that the connectivity of suitable habitats influences gene flow and leads to the formation of specific population structures. In particular, different degrees of topographical complexity between islands are the major determining factor for shaping contrasting population structures of two species. In conclusion, our results illustrate the diversification mechanism of organisms through the interaction with space and environment. Our results also present an ENM approach for identifying the key factors affecting demographic history and population structures of target species, especially endangered species. PMID:22990312
Zubair, Niha; Graff, Mariaelisa; Luis Ambite, Jose; Bush, William S; Kichaev, Gleb; Lu, Yingchang; Manichaikul, Ani; Sheu, Wayne H-H; Absher, Devin; Assimes, Themistocles L; Bielinski, Suzette J; Bottinger, Erwin P; Buzkova, Petra; Chuang, Lee-Ming; Chung, Ren-Hua; Cochran, Barbara; Dumitrescu, Logan; Gottesman, Omri; Haessler, Jeffrey W; Haiman, Christopher; Heiss, Gerardo; Hsiung, Chao A; Hung, Yi-Jen; Hwu, Chii-Min; Juang, Jyh-Ming J; Le Marchand, Loic; Lee, I-Te; Lee, Wen-Jane; Lin, Li-An; Lin, Danyu; Lin, Shih-Yi; Mackey, Rachel H; Martin, Lisa W; Pasaniuc, Bogdan; Peters, Ulrike; Predazzi, Irene; Quertermous, Thomas; Reiner, Alex P; Robinson, Jennifer; Rotter, Jerome I; Ryckman, Kelli K; Schreiner, Pamela J; Stahl, Eli; Tao, Ran; Tsai, Michael Y; Waite, Lindsay L; Wang, Tzung-Dau; Buyske, Steven; Ida Chen, Yii-Der; Cheng, Iona; Crawford, Dana C; Loos, Ruth J F; Rich, Stephen S; Fornage, Myriam; North, Kari E; Kooperberg, Charles; Carty, Cara L
2016-12-15
Genome-wide association studies have identified over 150 loci associated with lipid traits, however, no large-scale studies exist for Hispanics and other minority populations. Additionally, the genetic architecture of lipid-influencing loci remains largely unknown. We performed one of the most racially/ethnically diverse fine-mapping genetic studies of HDL-C, LDL-C, and triglycerides to-date using SNPs on the MetaboChip array on 54,119 individuals: 21,304 African Americans, 19,829 Hispanic Americans, 12,456 Asians, and 530 American Indians. The majority of signals found in these groups generalize to European Americans. While we uncovered signals unique to racial/ethnic populations, we also observed systematically consistent lipid associations across these groups. In African Americans, we identified three novel signals associated with HDL-C (LPL, APOA5, LCAT) and two associated with LDL-C (ABCG8, DHODH). In addition, using this population, we refined the location for 16 out of the 58 known MetaboChip lipid loci. These results can guide tailored screening efforts, reveal population-specific responses to lipid-lowering medications, and aid in the development of new targeted drug therapies. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Identifying biologically relevant differences between metagenomic communities.
Parks, Donovan H; Beiko, Robert G
2010-03-15
Metagenomics is the study of genetic material recovered directly from environmental samples. Taxonomic and functional differences between metagenomic samples can highlight the influence of ecological factors on patterns of microbial life in a wide range of habitats. Statistical hypothesis tests can help us distinguish ecological influences from sampling artifacts, but knowledge of only the P-value from a statistical hypothesis test is insufficient to make inferences about biological relevance. Current reporting practices for pairwise comparative metagenomics are inadequate, and better tools are needed for comparative metagenomic analysis. We have developed a new software package, STAMP, for comparative metagenomics that supports best practices in analysis and reporting. Examination of a pair of iron mine metagenomes demonstrates that deeper biological insights can be gained using statistical techniques available in our software. An analysis of the functional potential of 'Candidatus Accumulibacter phosphatis' in two enhanced biological phosphorus removal metagenomes identified several subsystems that differ between the A.phosphatis stains in these related communities, including phosphate metabolism, secretion and metal transport. Python source code and binaries are freely available from our website at http://kiwi.cs.dal.ca/Software/STAMP CONTACT: beiko@cs.dal.ca Supplementary data are available at Bioinformatics online.
Joint source based morphometry identifies linked gray and white matter group differences.
Xu, Lai; Pearlson, Godfrey; Calhoun, Vince D
2009-02-01
We present a multivariate approach called joint source based morphometry (jSBM), to identify linked gray and white matter regions which differ between groups. In jSBM, joint independent component analysis (jICA) is used to decompose preprocessed gray and white matter images into joint sources and statistical analysis is used to determine the significant joint sources showing group differences and their relationship to other variables of interest (e.g. age or sex). The identified joint sources are groupings of linked gray and white matter regions with common covariation among subjects. In this study, we first provide a simulation to validate the jSBM approach. To illustrate our method on real data, jSBM is then applied to structural magnetic resonance imaging (sMRI) data obtained from 120 chronic schizophrenia patients and 120 healthy controls to identify group differences. JSBM identified four joint sources as significantly associated with schizophrenia. Linked gray-white matter regions identified in each of the joint sources included: 1) temporal--corpus callosum, 2) occipital/frontal--inferior fronto-occipital fasciculus, 3) frontal/parietal/occipital/temporal--superior longitudinal fasciculus and 4) parietal/frontal--thalamus. Age effects on all four joint sources were significant, but sex effects were significant only for the third joint source. Our findings demonstrate that jSBM can exploit the natural linkage between gray and white matter by incorporating them into a unified framework. This approach is applicable to a wide variety of problems to study linked gray and white matter group differences.
Joint source based morphometry identifies linked gray and white matter group differences
Xu, Lai; Pearlson, Godfrey; Calhoun, Vince D.
2009-01-01
We present a multivariate approach called joint source based morphometry (jSBM), to identify linked gray and white matter regions which differ between groups. In jSBM, joint independent component analysis (jICA) is used to decompose preprocessed gray and white matter images into joint sources and statistical analysis is used to determine the significant joint sources showing group differences and their relationship to other variables of interest (e.g. age or sex). The identified joint sources are groupings of linked gray and white matter regions with common covariation among subjects. In this study, we first provide a simulation to validate the jSBM approach. To illustrate our method on real data, jSBM is then applied to structural magnetic resonance imaging (sMRI) data obtained from 120 chronic schizophrenia patients and 120 healthy controls to identify group differences. JSBM identified four joint sources as significantly associated with schizophrenia. Linked gray–white matter regions identified in each of the joint sources included: 1) temporal — corpus callosum, 2) occipital/frontal — inferior fronto-occipital fasciculus, 3) frontal/parietal/occipital/temporal —superior longitudinal fasciculus and 4) parietal/frontal — thalamus. Age effects on all four joint sources were significant, but sex effects were significant only for the third joint source. Our findings demonstrate that jSBM can exploit the natural linkage between gray and white matter by incorporating them into a unified framework. This approach is applicable to a wide variety of problems to study linked gray and white matter group differences. PMID:18992825
Mendez, Fernando L
2017-04-01
Difference in male and female effective population sizes has, at times, been attributed to both sexes having unequal variance in their number of offspring. Such difference is paralleled by the relative effective sizes of autosomes, sex chromosomes, and mitochondrial DNA. I develop a simple framework to calculate the inbreeding effective population sizes for loci with different modes of inheritance. In this framework, I separate the effects due to mating strategy and those due to genetic transmission. I then show that, in addition to differences in the variance in offspring number, skew in the male/female effective sizes can also be caused by family composition. This approach can be used to illustrate the effect of induced behaviors on the relative male and female effective population sizes. In particular, I show the impact of the one-child policy formerly implemented in the People's Republic of China on the relative male and female effective population sizes. Furthermore, I argue that, under some strong constraints on family structure, the concepts of male and female effective population sizes are invalid. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.
Age, Sex, and Racial Differences in Neuroimaging Use in Acute Stroke: A Population-Based Study.
Vagal, A; Sanelli, P; Sucharew, H; Alwell, K A; Khoury, J C; Khatri, P; Woo, D; Flaherty, M; Kissela, B M; Adeoye, O; Ferioli, S; De Los Rios La Rosa, F; Martini, S; Mackey, J; Kleindorfer, D
2017-10-01
Limited information is available regarding differences in neuroimaging use for acute stroke work-up. Our objective was to assess whether race, sex, or age differences exist in neuroimaging use and whether these differences depend on the care center type in a population-based study. Patients with stroke (ischemic and hemorrhagic) and transient ischemic attack were identified in a metropolitan, biracial population using the Greater Cincinnati/Northern Kentucky Stroke Study in 2005 and 2010. Multivariable regression was used to determine the odds of advanced imaging use (CT angiography/MR imaging/MR angiography) for race, sex, and age. In 2005 and 2010, there were 3471 and 3431 stroke/TIA events, respectively. If one adjusted for covariates, the odds of advanced imaging were higher for younger (55 years or younger) compared with older patients, blacks compared with whites, and patients presenting to an academic center and those seen by a stroke team or neurologist. The observed association between race and advanced imaging depended on age; in the older age group, blacks had higher odds of advanced imaging compared with whites (odds ratio, 1.34; 95% CI, 1.12-1.61; P < .01), and in the younger group, the association between race and advanced imaging was not statistically significant. Age by race interaction persisted in the academic center subgroup ( P < .01), but not in the nonacademic center subgroup ( P = .58). No significant association was found between sex and advanced imaging. Within a large, biracial stroke/TIA population, there is variation in the use of advanced neuroimaging by age and race, depending on the care center type. © 2017 by American Journal of Neuroradiology.
Gender differences in smoking behaviors in an Asian population.
Tsai, Yi-Wen; Tsai, Tzu-I; Yang, Chung-Lin; Kuo, Ken N
2008-01-01
Gender-sensitive tobacco control policies are being challenged, and new directions are being sought because public health efforts have reduced cigarette consumption more substantially among men than among women. To better target women, it would help to identify the protective cultural factors that promote resiliency in women and discourage them from smoking. Whereas western cultures have generated a great deal of gender-specific research and programs on the prevention of smoking in women, Asian cultures have not. Taking a personal and sociocultural perspective, this study examines the effect of gender on smoking behaviors in Taiwan. In a 2004 cross-sectional random-sampled interview survey, 827 adult men and 90 adult women smokers in Taiwan were queried about the time they began smoking, maintenance of their habits, and their readiness to change. The male/female smoking rate ratio was 9.5 (45.7% vs. 4.8%). Men smoked significantly more cigarettes per day than women (18 vs. 11). We found Taiwanese women started smoking around 20 years old, much later than their western counterparts. We also found that whereas the smoking behavior of the men was very sensitive to social environment and structural factors, that of women revolved around their desire to control their weight and handle their emotions. Differences in the smoking behavior of men and women are a result of a different sociocultural environment and the life trajectories and social circumstances embedded within it. Comprehensive tobacco control policies need to be tailored to not just smoking behavior alone or one population alone but to the determinants of smoking behavior in specific groups, for example, women. Even when targeting women, some effort may be needed on targeting women of different ethnicities, for instance, Asian women in whom the prevalence is increasing at alarming rates.
Gender Differences in Smoking Behaviors in an Asian Population
Tsai, Yi-Wen; Yang, Chung-Lin; Kuo, Ken N.
2008-01-01
Abstract Background Gender-sensitive tobacco control policies are being challenged, and new directions are being sought because public health efforts have reduced cigarette consumption more substantially among men than among women. To better target women, it would help to identify the protective cultural factors that promote resiliency in women and discourage them from smoking. Whereas western cultures have generated a great deal of gender-specific research and programs on the prevention of smoking in women, Asian cultures have not. Taking a personal and sociocultural perspective, this study examines the effect of gender on smoking behaviors in Taiwan. Methods In a 2004 cross-sectional random-sampled interview survey, 827 adult men and 90 adult women smokers in Taiwan were queried about the time they began smoking, maintenance of their habits, and their readiness to change. Results The male/female smoking rate ratio was 9.5 (45.7% vs. 4.8%). Men smoked significantly more cigarettes per day than women (18 vs. 11). We found Taiwanese women started smoking around 20 years old, much later than their western counterparts. We also found that whereas the smoking behavior of the men was very sensitive to social environment and structural factors, that of women revolved around their desire to control their weight and handle their emotions. Conclusions Differences in the smoking behavior of men and women are a result of a different sociocultural environment and the life trajectories and social circumstances embedded within it. Comprehensive tobacco control policies need to be tailored to not just smoking behavior alone or one population alone but to the determinants of smoking behavior in specific groups, for example, women. Even when targeting women, some effort may be needed on targeting women of different ethnicities, for instance, Asian women in whom the prevalence is increasing at alarming rates. PMID:18681817
Nagano, Yasuharu; Yako-Suketomo, Hiroko; Natsui, Hiroaki
2018-01-01
Raising awareness on a disorder is important for its prevention and for promoting public health. However, for sports injuries like the anterior cruciate ligament (ACL) injury no studies have investigated the awareness on risk factors for injury and possible preventative measures in the general population. The sources of information among the population are also unclear. The purpose of the present study was to identify these aspects of public awareness about the ACL injury. A questionnaire was randomly distributed among the general population registered with a web based questionnaire supplier, to recruit 900 participants who were aware about the ACL injury. The questionnaire consisted of two parts: Question 1 asked them about their sources of information regarding the ACL injury; Question 2 asked them about the risk factors for ACL injury. Multivariate logistic regression was used to determine the information sources that provide a good understanding of the risk factors. The leading source of information for ACL injury was television (57.0%). However, the results of logistic regression analysis revealed that television was not an effective medium to create awareness about the risk factors, among the general population. Instead "Lecture by a coach", "Classroom session on Health", and "Newspaper" were significantly more effective in creating a good awareness of the risk factors (p < 0.001).
Hu, Yao; Li, Huaixing; Lu, Ling; Manichaikul, Ani; Zhu, Jingwen; Chen, Yii-Der I; Sun, Liang; Liang, Shuang; Siscovick, David S; Steffen, Lyn M; Tsai, Michael Y; Rich, Stephen S; Lemaitre, Rozenn N; Lin, Xu
2016-03-15
Epidemiological studies suggest that levels of n-3 and n-6 long-chain polyunsaturated fatty acids are associated with risk of cardio-metabolic outcomes across different ethnic groups. Recent genome-wide association studies in populations of European ancestry have identified several loci associated with plasma and/or erythrocyte polyunsaturated fatty acids. To identify additional novel loci, we carried out a genome-wide association study in two population-based cohorts consisting of 3521 Chinese participants, followed by a trans-ethnic meta-analysis with meta-analysis results from 8962 participants of European ancestry. Four novel loci (MYB, AGPAT4, DGAT2 and PPT2) reached genome-wide significance in the trans-ethnic meta-analysis (log10(Bayes Factor) ≥ 6). Of them, associations of MYB and AGPAT4 with docosatetraenoic acid (log10(Bayes Factor) = 11.5 and 8.69, respectively) also reached genome-wide significance in the Chinese-specific genome-wide association analyses (P = 4.15 × 10(-14) and 4.30 × 10(-12), respectively), while associations of DGAT2 with gamma-linolenic acid (log10(Bayes Factor) = 6.16) and of PPT2 with docosapentaenoic acid (log10(Bayes Factor) = 6.24) were nominally significant in both Chinese- and European-specific genome-wide association analyses (P ≤ 0.003). We also confirmed previously reported loci including FADS1, NTAN1, NRBF2, ELOVL2 and GCKR. Different effect sizes in FADS1 and independent association signals in ELOVL2 were observed. These results provide novel insight into the genetic background of polyunsaturated fatty acids and their differences between Chinese and European populations. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Hasunuma, Tomoko; Tohkin, Masahiro; Kaniwa, Nahoko; Jang, In‐Jin; Yimin, Cui; Kaneko, Masaru; Saito, Yoshiro; Takeuchi, Masahiro; Watanabe, Hiroshi; Yamazoe, Yasushi; Uyama, Yoshiaki
2016-01-01
Aim To examine whether strict control of clinical trial conditions could reduce apparent differences of pharmacokinetic (PK) parameters among ethnic groups. Methods Open‐label, single dose PK studies of moxifloxacin, simvastatin and meloxicam were conducted in healthy male subjects from three East Asian populations (Japanese, Chinese and Koreans) and one Caucasian population as a control. These three drugs were selected because differences in PK parameters have been reported, even though the backgrounds of these East Asian populations are similar. Moxifloxacin (400 mg) was administered orally to 20 subjects, and plasma and urine levels of moxifloxacin and its metabolite (M2) were measured. Simvastatin (20 mg) was given to 40 subjects, and plasma levels of simvastatin and simvastatin acid were measured. Meloxicam (7.5 mg) was given to 30 subjects and its plasma concentration was determined. Intrinsic factors (polymorphism of UGT1A1 for moxifloxacin, SLCO1B1 for simvastatin, and CYP2C9 for meloxicam) were also examined. Results AUCinf values for moxifloxacin, simvastatin and meloxicam showed no significant differences among the East Asian groups. Cmax values of moxifloxacin and simvastatin, but not meloxicam, showed significant differences. There were no significant differences of data for M2 or simvastatin acid. Genetic analysis identified significant differences in the frequencies of relevant polymorphisms, but these differences did not affect the PK parameters observed. Conclusions Although there were some differences in PK parameters among the three East Asian groups, the present study performed under strictly controlled conditions did not reproduce the major ethnic differences observed in previous studies. PMID:26774055
van Leeuwen, Elisabeth M.; Karssen, Lennart C.; Deelen, Joris; Isaacs, Aaron; Medina-Gomez, Carolina; Mbarek, Hamdi; Kanterakis, Alexandros; Trompet, Stella; Postmus, Iris; Verweij, Niek; van Enckevort, David J.; Huffman, Jennifer E.; White, Charles C.; Feitosa, Mary F.; Bartz, Traci M.; Manichaikul, Ani; Joshi, Peter K.; Peloso, Gina M.; Deelen, Patrick; van Dijk, Freerk; Willemsen, Gonneke; de Geus, Eco J.; Milaneschi, Yuri; Penninx, Brenda W.J.H.; Francioli, Laurent C.; Menelaou, Androniki; Pulit, Sara L.; Rivadeneira, Fernando; Hofman, Albert; Oostra, Ben A.; Franco, Oscar H.; Leach, Irene Mateo; Beekman, Marian; de Craen, Anton J.M.; Uh, Hae-Won; Trochet, Holly; Hocking, Lynne J.; Porteous, David J.; Sattar, Naveed; Packard, Chris J.; Buckley, Brendan M.; Brody, Jennifer A.; Bis, Joshua C.; Rotter, Jerome I.; Mychaleckyj, Josyf C.; Campbell, Harry; Duan, Qing; Lange, Leslie A.; Wilson, James F.; Hayward, Caroline; Polasek, Ozren; Vitart, Veronique; Rudan, Igor; Wright, Alan F.; Rich, Stephen S.; Psaty, Bruce M.; Borecki, Ingrid B.; Kearney, Patricia M.; Stott, David J.; Adrienne Cupples, L.; Neerincx, Pieter B.T.; Elbers, Clara C.; Francesco Palamara, Pier; Pe'er, Itsik; Abdellaoui, Abdel; Kloosterman, Wigard P.; van Oven, Mannis; Vermaat, Martijn; Li, Mingkun; Laros, Jeroen F.J.; Stoneking, Mark; de Knijff, Peter; Kayser, Manfred; Veldink, Jan H.; van den Berg, Leonard H.; Byelas, Heorhiy; den Dunnen, Johan T.; Dijkstra, Martijn; Amin, Najaf; Joeri van der Velde, K.; van Setten, Jessica; Kattenberg, Mathijs; van Schaik, Barbera D.C.; Bot, Jan; Nijman, Isaäc J.; Mei, Hailiang; Koval, Vyacheslav; Ye, Kai; Lameijer, Eric-Wubbo; Moed, Matthijs H.; Hehir-Kwa, Jayne Y.; Handsaker, Robert E.; Sunyaev, Shamil R.; Sohail, Mashaal; Hormozdiari, Fereydoun; Marschall, Tobias; Schönhuth, Alexander; Guryev, Victor; Suchiman, H. Eka D.; Wolffenbuttel, Bruce H.; Platteel, Mathieu; Pitts, Steven J.; Potluri, Shobha; Cox, David R.; Li, Qibin; Li, Yingrui; Du, Yuanping; Chen, Ruoyan; Cao, Hongzhi; Li, Ning; Cao, Sujie; Wang, Jun; Bovenberg, Jasper A.; Jukema, J. Wouter; van der Harst, Pim; Sijbrands, Eric J.; Hottenga, Jouke-Jan; Uitterlinden, Andre G.; Swertz, Morris A.; van Ommen, Gert-Jan B.; de Bakker, Paul I.W.; Eline Slagboom, P.; Boomsma, Dorret I.; Wijmenga, Cisca; van Duijn, Cornelia M.
2015-01-01
Variants associated with blood lipid levels may be population-specific. To identify low-frequency variants associated with this phenotype, population-specific reference panels may be used. Here we impute nine large Dutch biobanks (~35,000 samples) with the population-specific reference panel created by the Genome of the Netherlands Project and perform association testing with blood lipid levels. We report the discovery of five novel associations at four loci (P value <6.61 × 10−4), including a rare missense variant in ABCA6 (rs77542162, p.Cys1359Arg, frequency 0.034), which is predicted to be deleterious. The frequency of this ABCA6 variant is 3.65-fold increased in the Dutch and its effect (βLDL-C=0.135, βTC=0.140) is estimated to be very similar to those observed for single variants in well-known lipid genes, such as LDLR. PMID:25751400
Greacen, Tim; Kersaudy-Rahib, Delphine; Le Gall, Jean-Marie; Lydié, Nathalie; Ghosn, Jade; Champenois, Karen
2016-01-01
HIV self-tests are currently being introduced in France with the aim of promoting screening both for the general population and for high-risk populations. The current study aimed to identify and compare the information and support needs of the different target population groups. The Delphi process was used to synthesize expert opinions for each population group. Experts were chosen for their experience and expertise in the area of HIV and HIV screening for each population. Each group developed recommendations for a specific population: six high HIV prevalence populations (men who have sex with men; transgender people; substance users; migrants from sub-Saharan Africa; French West Indies; French Guiana) and two low prevalence populations (the general population; people under 25). Each group included expertise from four areas: research, screening and care, policy-making, and community groups. A final total of 263 recommendations were grouped into eight main themes: Communicating at both national and community levels about self-test arrival (24% of all recommendations); Providing information adapted to the different community groups' needs (23%); Providing counselling on self-test use and access to care (15%); Making self-tests available to all in terms of accessibility and cost (13%); Preparing community healthcare and screening systems for the arrival of the self-test (11%); Approving only high quality self-tests (6%); Defending self-test users' legal rights (5%); Evaluating self-test use (3%). Although a large number of recommendations were common to several groups of experts, the study highlighted a certain number of recommendations specific to each different population group, particularly with regard to information content and access both to information and to the self-tests themselves. Results from the current study should make a significant contribution to policy decisions concerning catering for the specific access, information and support needs of different
Aguilar-Velázquez, Daniela Georgina; González-Castro, Thelma Beatriz; Tovilla-Zárate, Carlos Alfonso; Juárez-Rojop, Isela E; López-Narváez, Maria Lilia; Frésan, Ana; Hernández-Díaz, Yazmin; Guzmán-Priego, Crystell Guadalupe
2017-12-01
Suicide is the second cause of death in youth population. The aim of the present study was to analyze demographic characteristics and suicide methods used, as well as to identify gender differences among Mexican children and adolescents (aged 10-17 years) that committed suicide. Between January 2003 and December 2013, 167 suicides of children and adolescents between 10 and 17 years of age were documented by the Secretary of Health of the state of Tabasco, Mexico. All sociodemographic characteristics were compared according to gender. Our sample included 67.7% males and 32.3% females (male to female 2.1:1). The predominant marital status was single (89.6%) and hanging (93.7%) was the principal method of suicide used. Both female and male adolescents were predominantly students (50%); however, female adolescents were more frequently married (17%) and were housewives (26.4%). Our results identified that hanging is the principal suicide method used by children and adolescents in Mexican population; we also detected main gender differences in terms of poisoning/drug toxicity as the method used, occupation and marital status. These results should be taken into consideration when designing suicide prevention programs due to the differences found by gender. Copyright © 2017 Elsevier B.V. All rights reserved.
New Model for Population-Subpopulation Differences
2007-02-01
EDGEWOOD CHEMICAL BIOLOGICAL CENTER U.S. ARMY RESEARCH, DEVELOPMENT AND ENGINEERING COMMAND ECBC-TR-534 NEW MODEL FOR POPULATION-SUBPOPULATION...DATES COVERED (From - To) XX-02-2007 Final Nov 2005 - Nov 2006 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER New Model for Population-Subpopulation...susceptibilities for both the general population and the military subpopulation were modeled by a lognormal distribution. The assumption of a lognormal distribution
Elderd, Bret D.; Dwyer, Greg; Dukic, Vanja
2013-01-01
Estimates of a disease’s basic reproductive rate R0 play a central role in understanding outbreaks and planning intervention strategies. In many calculations of R0, a simplifying assumption is that different host populations have effectively identical transmission rates. This assumption can lead to an underestimate of the overall uncertainty associated with R0, which, due to the non-linearity of epidemic processes, may result in a mis-estimate of epidemic intensity and miscalculated expenditures associated with public-health interventions. In this paper, we utilize a Bayesian method for quantifying the overall uncertainty arising from differences in population-specific basic reproductive rates. Using this method, we fit spatial and non-spatial susceptible-exposed-infected-recovered (SEIR) models to a series of 13 smallpox outbreaks. Five outbreaks occurred in populations that had been previously exposed to smallpox, while the remaining eight occurred in Native-American populations that were naïve to the disease at the time. The Native-American outbreaks were close in a spatial and temporal sense. Using Bayesian Information Criterion (BIC), we show that the best model includes population-specific R0 values. These differences in R0 values may, in part, be due to differences in genetic background, social structure, or food and water availability. As a result of these inter-population differences, the overall uncertainty associated with the “population average” value of smallpox R0 is larger, a finding that can have important consequences for controlling epidemics. In general, Bayesian hierarchical models are able to properly account for the uncertainty associated with multiple epidemics, provide a clearer understanding of variability in epidemic dynamics, and yield a better assessment of the range of potential risks and consequences that decision makers face. PMID:24021521
Suleman, Fatima; Ally, Shabnam; Bayat, Samirah; Essack, Razia; Moodley, Renalda; Mtembu, Thobekile; Ramalingham, Emily
2009-08-01
Personal factors, especially attitude, have been implicated in the utilization of health care services, and in access to medical treatment. There is little information on the attitudes of the general public in South Africa towards medications and whether attitudes differ across population groups or among the different users of the health care system. This study aimed to determine the general attitude of a local population to medications, self-care orientation and health professional contact, and whether differences existed between age groups, gender and race groups. METHODS We carried out a randomized, cross-sectional quantitative study via telephonic questionnaire survey (adapted from a previous study) of a sample of 1132 telephone numbers. The setting was the Durban Metropolitan Area, KwaZulu-Natal, South Africa. KEY FINDINGS A total of 500 (44.2%) people responded. The majority had a positive attitude towards medication. An increase in age resulted in increased medication use. Females were more likely than males to use medication and seek professional health care (P = 0.0406). Most of the respondents (86.0%) were self-care-orientated and displayed moderate medication knowledge (46.2%). Some 295 (59.0%) of the 500 respondents had visited a pharmacy within the last 6 months. Conclusions Health care professionals can adopt an informed approach to address the needs of the population with regard to medication, by targeting groups more likely to use medication (females and the older age group). In addition, gaps in medication knowledge were identified which could be used for health-promotion interventions by health care workers.
Sard, Nicholas M; Jacobson, Dave P; Banks, Michael A
2016-10-01
Diversity in life history tactics contributes to the persistence of a population because it helps to protect against stochastic environments by varying individuals in space and time. However, some life history tactics may not be accounted for when assessing the demographic viability of a population. One important factor in demographic viability assessments is cohort replacement rate (CRR), which is defined as the number of future adults produced by an adult. We assessed if precocial resident males (
Chiossi, G; Pedroza, C; Costantine, M M; Truong, V T T; Gargano, G; Saade, G R
2017-08-01
To compare the effectiveness of customized vs population-based growth charts for the prediction of adverse pregnancy outcomes. MEDLINE, ClinicalTrials.gov and The Cochrane Library were searched up to 31 May 2016 to identify interventional and observational studies comparing adverse outcomes among large- (LGA) and small- (SGA) for-gestational-age neonates, when classified according to customized vs population-based growth charts. Perinatal mortality and admission to the neonatal intensive care unit (NICU) of both SGA and LGA neonates, intrauterine fetal demise (IUFD) and neonatal mortality of SGA neonates, and neonatal shoulder dystocia and hypoglycemia as well as maternal third- and fourth-degree perineal lacerations in LGA pregnancies were evaluated. The electronic search identified 237 records that were examined based on title and abstract, of which 27 full-text articles were examined for eligibility. After excluding seven articles, 20 observational studies were included in a Bayesian meta-analysis. Neonates classified as SGA according to customized growth charts had higher risks of IUFD (odds ratio (OR), 7.8 (95% CI, 4.2-12.3)), neonatal death (OR, 3.5 (95% CI, 1.1-8.0)), perinatal death (OR, 5.8 (95% CI, 3.8-7.8)) and NICU admission (OR, 3.6 (95% CI, 2.0-5.5)) than did non-SGA cases. Neonates classified as SGA according to population-based growth charts also had increased risk for adverse outcomes, albeit the point estimates of the pooled ORs were smaller: IUFD (OR, 3.3 (95% CI, 1.9-5.0)), neonatal death (OR, 2.9 (95% CI, 1.2-4.5)), perinatal death (OR, 4.0 (95% CI, 2.8-5.1)) and NICU admission (OR, 2.4 (95% CI, 1.7-3.2)). For LGA vs non-LGA, there were no differences in pooled ORs for perinatal death, NICU admission, hypoglycemia and maternal third- and fourth-degree perineal lacerations when classified according to either the customized or the population-based approach. In contrast, both approaches indicated that LGA neonates are at increased risk for
Orientation Courses: Meeting the Needs of Different Student Populations.
ERIC Educational Resources Information Center
Higbee, Jeanne L.
A model that includes three distinct syllabi for orientation courses for different subgroups of the college or university freshman population is presented. Among the groups with special needs are underprepared students who may be motivated but need skill development, and underachieving students characterized by untapped potential. One means of…
Raz, Raanan; Weisskopf, Marc G; Davidovitch, Michael; Pinto, Ofir; Levine, Hagai
2014-01-01
We analyzed data from the Israeli National Insurance Institute (NII). Autism Spectrum Disorder (ASD) incidence was calculated for all children born in Israel 1992-2009, and by population groups. Overall, 9,109 ASD cases among 2,431,649 children were identified. ASD cumulative incidence by age 8 years increased 10-fold during 2000-2011, from 0.049% to 0.49%, while other child disabilities in NII increased only 1.65-fold. There was a consistent increase in ASD incidence with advancing birth cohorts born 1992-2004, stabilizing among those born 2005-2009. ASD rates among Israeli Arabs were substantially lower, and increased about 10 years later than the general population. The findings suggest a role for ASD awareness, accessing of the government benefit, or the way the concept of ASD is perceived. PMID:25287899
Campbell, Colin N J; Vives, Núria; Esteve, Anna; Ambrosioni, Juan; Tural, Cristina; Ferrer, Elena; Navarro, Gemma; Force, Lluis; García, Isabel; Masabeu, Àngels; Vilaró, Josep M; García de Olalla, Patricia; Caylà, Joan Artur; Miró, Josep M; Casabona, Jordi
2018-01-01
Objective Undiagnosed HIV continues to be a hindrance to efforts aimed at reducing incidence of HIV. The objective of this study was to provide an estimate of the HIV undiagnosed population in Catalonia and compare the HIV care cascade with this step included between high-risk populations. Methods To estimate HIV incidence, time between infection and diagnosis and the undiagnosed population stratified by CD4 count, we used the ECDC HIV Modelling Tool V.1.2.2. This model uses data on new HIV and AIDS diagnoses from the Catalan HIV/AIDS surveillance system from 2001 to 2013. Data used to estimate the proportion of people enrolled, on ART and virally suppressed in the HIV care cascade were derived from the PISCIS cohort. Results The total number of people living with HIV (PLHIV) in Catalonia in 2013 was 34 729 (32 740 to 36 827), with 12.3% (11.8 to 18.1) of whom were undiagnosed. By 2013, there were 8458 (8101 to 9079) Spanish-born men who have sex with men (MSM) and 2538 (2334 to 2918) migrant MSM living with HIV in Catalonia. A greater proportion of migrant MSM than local MSM was undiagnosed (32% vs 22%). In the subsequent steps of the HIV care cascade, migrants MSM experience greater losses than the Spanish-born MSM: in retention in care (74% vs 55%), in the proportion on combination antiretroviral treatment (70% vs 50%) and virally suppressed (65% vs 46%). Conclusions By the end of 2013, there were an estimated 34 729 PLHIV in Catalonia, of whom 4271 were still undiagnosed. This study shows that the Catalan epidemic of HIV has continued to expand with the key group sustaining HIV transmission being MSM living with undiagnosed HIV. PMID:29490955
Age-Group and Gender Differences in Stroke Knowledge in an Israeli Jewish Adult Population.
Melnikov, Semyon; Itzhaki, Michal; Koton, Silvia
Stroke is a leading cause of long-term disability and the fifth leading cause of death in Israel. Knowledge of stroke warning signs has been linked to early seeking of medical help. Little is known about knowledge of stroke warning signs in Israeli Jewish adults. Stroke knowledge was examined among Jewish Israeli adults. Using a structured questionnaire, registered nurses interviewed a convenience sample of the respondents, 18 years or older, with no stroke history. Stroke knowledge and demographics were examined by 3 age groups (<45, 45-64, and >64 years) in men and women. In total, 1137 Jewish Israelis were interviewed, 457 (40.2%) men and 680 women (59.8%); 493 (43.4%) were younger than 45 years, 541 (47.6%) were aged 45 to 64 years, and 102 (9%) were older than 64 years; 1 (0.1%) did not report age. On average, each interview lasted for 25 to 30 minutes. Participants younger than 45 years showed the lowest knowledge of stroke cause. Women younger than 45 years were less likely to identify at least 2 stroke warning signs. Participants younger than 45 years were less likely to identify at least 2 risk factors, compared with participants aged 45 to 64 years and older than 64 years. Women younger than 45 years were less likely to identify at least 2 stroke prevention strategies. Participants younger than 45 years showed the lowest levels of stroke knowledge. The highest stroke knowledge was found in the 45 to 64 years age group. Stroke knowledge among different age groups was similar in both genders. Educational campaigns aimed at increasing knowledge of stroke among the general population and targeting the younger population are recommended.
Stephan, Carsten; Xu, Chuanliang; Finne, Patrik; Cammann, Henning; Meyer, Hellmuth-Alexander; Lein, Michael; Jung, Klaus; Stenman, Ulf-Hakan
2007-09-01
Different artificial neural networks (ANNs) using total prostate-specific antigen (PSA) and percentage of free PSA (%fPSA) have been introduced to enhance the specificity of prostate cancer detection. The applicability of independently trained ANN and logistic regression (LR) models to different populations regarding the composition (screening versus referred) and different PSA assays has not yet been tested. Two ANN and LR models using PSA (range 4 to 10 ng/mL), %fPSA, prostate volume, digital rectal examination findings, and patient age were tested. A multilayer perceptron network (MLP) was trained on 656 screening participants (Prostatus PSA assay) and another ANN (Immulite-based ANN [iANN]) was constructed on 606 multicentric urologically referred men. These and other assay-adapted ANN models, including one new iANN-based ANN, were used. The areas under the curve for the iANN (0.736) and MLP (0.745) were equal but showed no differences to %fPSA (0.725) in the Finnish group. Only the new iANN-based ANN reached a significant larger area under the curve (0.77). At 95% sensitivity, the specificities of MLP (33%) and the new iANN-based ANN (34%) were significantly better than the iANN (23%) and %fPSA (19%). Reverse methodology using the MLP model on the referred patients revealed, in contrast, a significant improvement in the areas under the curve for iANN and MLP (each 0.83) compared with %fPSA (0.70). At 90% and 95% sensitivity, the specificities of all LR and ANN models were significantly greater than those for %fPSA. The ANNs based on different PSA assays and populations were mostly comparable, but the clearly different patient composition also allowed with assay adaptation no unbiased ANN application to the other cohort. Thus, the use of ANNs in other populations than originally built is possible, but has limitations.
Babinská, Ingrid; Gecková, Andrea Madarasová; Jarcuska, Peter; Pella, Daniel; Mareková, Mária; Stefková, Gabriela; Veselská, Zuzana Dankulincová
2014-03-01
Several studies have revealed a high prevalence of risk factors associated with unhealthy lifestyle among individuals with lower socioeconomic status. In Slovakia, one of the most socially and health-disadvantaged groups is the Roma minority. The aim of this study is to explore differences in physical activity, smoking and alcohol consumption between the population living in Roma settlements and the majority population in Slovakia. Data from the cross-sectional epidemiological HepaMeta study conducted in Slovakia in 2011 were used. The sample consisted of 452 Roma (mean age = 34.7; 35.2% men) and 403 non-Roma (mean age = 33.5; 45.9% men) respondents. The differences in health-related behaviour between the population living in Roma settlements and the majority population were analysed using logistic models separately for males and females. These data show a clear difference between the population living in Roma settlements and the majority population with regard to leisure-time physical activity (only in women) and smoking, although not alcohol consumption. The prevalence of leisure-time physical activities such as walking or some other type of sport was significantly lower among Roma women than among non-Roma women. Men and women living in Roma settlements are more likely to smoke on a daily basis and they are heavier smokers in comparison with the majority population. HepaMeta study did not find differences in alcohol consumption between the Roma and non-Roma men. However, Roma women reported less frequent recent drinking and binge-drinking of 6 or more doses of alcohol on a single occasion. The higher prevalence of unhealthy lifestyle activities among Roma seem to contribute to these inequalities in cardiovascular diseases morbidity and mortality in comparison with the majority population.
Brasso, Rebecka L; Chiaradia, André; Polito, Michael J; Raya Rey, Andrea; Emslie, Steven D
2015-08-15
The wide geographic distribution of penguins (Order Sphenisciformes) throughout the Southern Hemisphere provided a unique opportunity to use a single taxonomic group as biomonitors of mercury among geographically distinct marine ecosystems. Mercury concentrations were compared among ten species of penguins representing 26 geographically distinct breeding populations. Mercury concentrations were relatively low (⩽2.00ppm) in feathers from 18/26 populations considered. Population-level differences in trophic level explained variation in mercury concentrations among Little, King, and Gentoo penguin populations. However, Southern Rockhopper and Magellanic penguins breeding on Staten Island, Tierra del Fuego, had the highest mercury concentrations relative to their conspecifics despite foraging at a lower trophic level. The concurrent use of stable isotope and mercury data allowed us to document penguin populations at the greatest risk of exposure to harmful concentrations of mercury as a result of foraging at a high trophic level or in geographic 'hot spots' of mercury availability. Copyright © 2015 Elsevier Ltd. All rights reserved.
Difference in health inequity between two population groups due to a social determinant of health.
Moonesinghe, Ramal; Bouye, Karen; Penman-Aguilar, Ana
2014-12-01
The World Health Organization defines social determinants of health as "complex, integrated, and overlapping social structures and economic systems" that are responsible for most health inequities. Similar to the individual-level risk factors such as behavioral and biological risk factors that influence disease, we consider social determinants of health such as the distribution of income, wealth, influence and power as risk factors for risk of disease. We operationally define health inequity in a disease within a population due to a risk factor that is unfair and avoidable as the difference between the disease outcome with and without the risk factor in the population. We derive expressions for difference in health inequity between two populations due to a risk factor that is unfair and avoidable for a given disease. The difference in heath inequity between two population groups due to a risk factor increases with increasing difference in relative risks and the difference in prevalence of the risk factor in the two populations. The difference in health inequity could be larger than the difference in health outcomes between the two populations in some situations. Compared to health disparities which are typically measured and monitored using absolute or relative disparities of health outcomes, the methods presented in this manuscript provide a different, yet complementary, picture because they parse out the contributions of unfair and avoidable risk factors.
Difference in Health Inequity between Two Population Groups due to a Social Determinant of Health
Moonesinghe, Ramal; Bouye, Karen; Penman-Aguilar, Ana
2014-01-01
The World Health Organization defines social determinants of health as “complex, integrated, and overlapping social structures and economic systems” that are responsible for most health inequities. Similar to the individual-level risk factors such as behavioral and biological risk factors that influence disease, we consider social determinants of health such as the distribution of income, wealth, influence and power as risk factors for risk of disease. We operationally define health inequity in a disease within a population due to a risk factor that is unfair and avoidable as the difference between the disease outcome with and without the risk factor in the population. We derive expressions for difference in health inequity between two populations due to a risk factor that is unfair and avoidable for a given disease. The difference in heath inequity between two population groups due to a risk factor increases with increasing difference in relative risks and the difference in prevalence of the risk factor in the two populations. The difference in health inequity could be larger than the difference in health outcomes between the two populations in some situations. Compared to health disparities which are typically measured and monitored using absolute or relative disparities of health outcomes, the methods presented in this manuscript provide a different, yet complementary, picture because they parse out the contributions of unfair and avoidable risk factors. PMID:25522048
Dada, Esther O; Anderson, Morgan K; Grier, Tyson; Alemany, Joseph A; Jones, Bruce H
2017-11-01
To determine the age- and sex-specific differences of physical fitness performances and Body Mass Index (BMI) in basic training and the operational Army. Cross-sectional Study. This secondary analysis utilizes retrospective surveys of U.S. Army Soldiers in Basic Combat Training (BCT) and operational units to compare physical performances between men and women as measured by the Army Physical Readiness Test (APFT). An ANOVA was used to compare mean differences in APFT results and BMI within sex-specific populations. A post hoc Tukey test identified specific mean differences. Adjusting for age, an ANCOVA was used to compare sex and occupation (infantry and non-infantry) differences in APFT results. Surveyed populations consisted of 2216 BCT Soldiers (1573 men and 643 women) and 5515 Operational Soldiers (4987 men and 528 women). Male and female operational Soldiers had greater muscular performance (79%-125% higher APFT push-ups, 66%-85% higher APFT sit-ups) and cardiorespiratory performance (22%-24% faster APFT 2-mile run times) than BCT Soldiers. Male BCT and operational Soldiers outperform their female counterparts on tests of muscular and cardiorespiratory endurance. Sex differences in physical performances attenuated among female Soldiers in operational units compared to BCT. Among male operational Soldiers, infantry Soldiers exhibited greater cardiorespiratory and muscular performance than non-infantry Soldiers. Higher BMI was associated with higher age groups, except for female BCT Soldiers. Gaps in cardiorespiratory and muscular performances between men and women should be addressed through targeted physical training programs that aim to minimize physiological differences. Published by Elsevier Ltd.
[The management of asymptomatic bacteriuria in different patient population].
Ivanov, M-L; Malinverni, R
2008-11-12
Who should be screened for asymptomatic bacteriuria (AB) and who should be treated? This review updates some aspects of the management of AB in different patient populations. A systematic screening for AB is recommended for pregnant women because of a significant risk of complications. In these cases as well as before any uro-gynecologic surgical procedure treatment of AB is strongly recommended. The management of AB in immunosuppressed or transplanted patients is more controversial. In other populations treating AB is not recommended and the outcome seems to be worse in case of treatment due to possible side effects and selection of resistant organisms. Recent studies have shown a considerable gap between clinical practice and recommendations.
Kurtuluş-Ulküer, M; Ulküer, U; Kesici, T; Menevşe, S
2002-09-01
In this study, the phenotype and allele frequencies of five enzyme systems were determined in a total of 611 unrelated Turkish individuals and analyzed by using the exact and the chi 2 test. The following five red cell enzymes were identified by cellulose acetate electrophoresis: phosphoglucomutase (PGM), adenosine deaminase (ADA), phosphoglucose isomerase (PGI), adenylate kinase (AK), and 6-phosphogluconate dehydrogenase (6-PGD). The ADA, PGM and AK enzymes were found to be polymorphic in the Turkish population. The results of the statistical analysis showed, that the phenotype frequencies of the five enzyme under study are in Hardy-Weinberg equilibrium. Statistical analysis was performed in order to examine whether there are significant differences in the phenotype frequencies between the Turkish population and four American population groups. This analysis showed, that there are some statistically significant differences between the Turkish and the other groups. Moreover, the observed phenotype and allele frequencies were compared with those obtained in other population groups of Turkey.
Alharbi, Khalid Khalaf; Ali Khan, Imran; Alotaibi, Mohammad Abdullah; Saud Aloyaid, Abdullah; Al-Basheer, Haifa Abdulaziz; Alghamdi, Naelah Abdullah; Al-Baradie, Raid Saleem; Al-Sulaiman, A M
2018-01-01
Stroke is a multifactorial and heterogeneous disorder, correlates with heritability and considered as one of the major diseases. The prior reports performed the variable models such as genome-wide association studies (GWAS), replication, case-control, cross-sectional and meta-analysis studies and still, we lack diagnostic marker in the global world. There are limited studies were carried out in Saudi population, and we aim to investigate the molecular association of single nucleotide polymorphisms (SNPs) identified through GWAS and meta-analysis studies in stroke patients in the Saudi population. In this case-control study, we have opted gender equality of 207 cases and 207 controls from the capital city of Saudi Arabia in King Saud University Hospital. The peripheral blood (5 ml) sample will be collected in two different vacutainers, and three mL of the coagulated blood will be used for lipid analysis (biochemical tests) and two mL will be used for DNA analysis (molecular tests). Genomic DNA will be extracted with the collected blood samples, and specific primers will be designed for the opted SNPs ( SORT1 -rs646218 and OLR1 -rs11053646 polymorphisms) and PCR-RFLP will be performed and randomly DNA sequencing will be carried out to cross check the results. The rs646218 and rs11053646 polymorphisms were significantly associated with allele, genotype and dominant models with and without crude odds ratios (OR's) and Multiple logistic regression analysis (p < 0.05). Correlation between lipid profile and genotypes has confirmed the significant relation between triglycerides and rs646218 and rs1105364 6polymorphisms. However, rs11053646 polymorphism was correlated with HDLC (p = 0.04). Genotypes were examined in both males' vs. males and females' vs. females in cases and control and we concluded that in rs11053646 polymorphisms with male subjects compared between cases and controls found to be associated with dominant model heterozygote genotypes (p < 0.05). The
Hasunuma, Tomoko; Tohkin, Masahiro; Kaniwa, Nahoko; Jang, In-Jin; Yimin, Cui; Kaneko, Masaru; Saito, Yoshiro; Takeuchi, Masahiro; Watanabe, Hiroshi; Yamazoe, Yasushi; Uyama, Yoshiaki; Kawai, Shinichi
2016-06-01
To examine whether strict control of clinical trial conditions could reduce apparent differences of pharmacokinetic (PK) parameters among ethnic groups. Open-label, single dose PK studies of moxifloxacin, simvastatin and meloxicam were conducted in healthy male subjects from three East Asian populations (Japanese, Chinese and Koreans) and one Caucasian population as a control. These three drugs were selected because differences in PK parameters have been reported, even though the backgrounds of these East Asian populations are similar. Moxifloxacin (400 mg) was administered orally to 20 subjects, and plasma and urine levels of moxifloxacin and its metabolite (M2) were measured. Simvastatin (20 mg) was given to 40 subjects, and plasma levels of simvastatin and simvastatin acid were measured. Meloxicam (7.5 mg) was given to 30 subjects and its plasma concentration was determined. Intrinsic factors (polymorphism of UGT1A1 for moxifloxacin, SLCO1B1 for simvastatin, and CYP2C9 for meloxicam) were also examined. AUCinf values for moxifloxacin, simvastatin and meloxicam showed no significant differences among the East Asian groups. Cmax values of moxifloxacin and simvastatin, but not meloxicam, showed significant differences. There were no significant differences of data for M2 or simvastatin acid. Genetic analysis identified significant differences in the frequencies of relevant polymorphisms, but these differences did not affect the PK parameters observed. Although there were some differences in PK parameters among the three East Asian groups, the present study performed under strictly controlled conditions did not reproduce the major ethnic differences observed in previous studies. © 2016 The Authors. British Journal of Clinical Pharmacology published by John Wiley & Sons Ltd on behalf of The British Pharmacological Society.
Population differences in the rate of proliferation of international HapMap cell lines.
Stark, Amy L; Zhang, Wei; Zhou, Tong; O'Donnell, Peter H; Beiswanger, Christine M; Huang, R Stephanie; Cox, Nancy J; Dolan, M Eileen
2010-12-10
The International HapMap Project is a resource for researchers containing genotype, sequencing, and expression information for EBV-transformed lymphoblastoid cell lines derived from populations across the world. The expansion of the HapMap beyond the four initial populations of Phase 2, referred to as Phase 3, has increased the sample number and ethnic diversity available for investigation. However, differences in the rate of cellular proliferation between the populations can serve as confounders in phenotype-genotype studies using these cell lines. Within the Phase 2 populations, the JPT and CHB cell lines grow faster (p < 0.0001) than the CEU or YRI cell lines. Phase 3 YRI cell lines grow significantly slower than Phase 2 YRI lines (p < 0.0001), with no widespread genetic differences based on common SNPs. In addition, we found significant growth differences between the cell lines in the Phase 2 ASN populations and the Han Chinese from the Denver metropolitan area panel in Phase 3 (p < 0.0001). Therefore, studies that separate HapMap panels into discovery and replication sets must take this into consideration. Copyright © 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Replication of newly identified type 2 diabetes susceptible loci in Northwest Indian population.
Sharma, Varun; Sharma, Indu; Sethi, Itty; Mahajan, Ankit; Singh, Gurvinder; Angural, Arshia; Bhanwer, A J S; Dhar, Manoj K; Singh, Vinod; Rai, Ekta; Sharma, Swarkar
2017-04-01
To replicate the association of newly identified variants of TMEM163 (transmembrane protein 163) and COBLL1 (cordon-bleu protein-like 1) with type 2 diabetes (T2D) in Northwest Indian population. We performed a replication study of variants rs998451 and rs6723108 of gene TMEM163 and rs7607980 of gene COBLL1. The variations were genotyped using Taqman allele discrimination assay in 1209 Northwest Indians (651 T2D cases and 558 controls). The association of each SNP with the disease was evaluated using logistic regression. All the three SNPs examined in this study did not show any significant association with T2D. For rs998451 and rs6723108 of TMEM163 the observed odds ratios were 0.71 with a 95% CI of 0.28-1.84 (p=0.484) and 1.80 with a 95% CI of 0.74-4.40 (p=0.196), respectively. For rs7607980 the estimated odds ratio was 1.01 with 95% CI of 0.70-1.44 (p=0.946). We conclude that lack of association could be because of population structure of Indian Population that is conglomeration of various ethnic groups. For a conclusive association study of T2D in India, it is critical that such studies are carried out among endogamous ethnic groups rather than conventional practice of pooling samples based on Geographical/regional or linguist affiliations like Asian Indian, North or South Indian etc. Copyright © 2017 Elsevier B.V. All rights reserved.
Hupalo, Daniel N; Luo, Zunping; Melnikov, Alexandre; Sutton, Patrick L; Rogov, Peter; Escalante, Ananias; Vallejo, Andrés F; Herrera, Sócrates; Arévalo-Herrera, Myriam; Fan, Qi; Wang, Ying; Cui, Liwang; Lucas, Carmen M; Durand, Salomon; Sanchez, Juan F; Baldeviano, G Christian; Lescano, Andres G; Laman, Moses; Barnadas, Celine; Barry, Alyssa; Mueller, Ivo; Kazura, James W; Eapen, Alex; Kanagaraj, Deena; Valecha, Neena; Ferreira, Marcelo U; Roobsoong, Wanlapa; Nguitragool, Wang; Sattabonkot, Jetsumon; Gamboa, Dionicia; Kosek, Margaret; Vinetz, Joseph M; González-Cerón, Lilia; Birren, Bruce W; Neafsey, Daniel E; Carlton, Jane M
2017-01-01
Plasmodium vivax is a major public health burden, responsible for the majority of malaria infections outside Africa. We explored the impact of demographic history and selective pressures on the P. vivax genome by sequencing 182 clinical isolates sampled from 11 countries across the globe, using hybrid selection to overcome human DNA contamination. We confirmed previous reports of high genomic diversity in P. vivax relative to the more virulent Plasmodium falciparum species; regional populations of P. vivax exhibited greater diversity than the global P. falciparum population, indicating a large and/or stable population. Signals of natural selection suggest that P. vivax is evolving in response to antimalarial drugs and is adapting to regional differences in the human host and the mosquito vector. These findings underline the variable epidemiology of this parasite species and highlight the breadth of approaches that may be required to eliminate P. vivax globally. PMID:27348298
Hupalo, Daniel N; Luo, Zunping; Melnikov, Alexandre; Sutton, Patrick L; Rogov, Peter; Escalante, Ananias; Vallejo, Andrés F; Herrera, Sócrates; Arévalo-Herrera, Myriam; Fan, Qi; Wang, Ying; Cui, Liwang; Lucas, Carmen M; Durand, Salomon; Sanchez, Juan F; Baldeviano, G Christian; Lescano, Andres G; Laman, Moses; Barnadas, Celine; Barry, Alyssa; Mueller, Ivo; Kazura, James W; Eapen, Alex; Kanagaraj, Deena; Valecha, Neena; Ferreira, Marcelo U; Roobsoong, Wanlapa; Nguitragool, Wang; Sattabonkot, Jetsumon; Gamboa, Dionicia; Kosek, Margaret; Vinetz, Joseph M; González-Cerón, Lilia; Birren, Bruce W; Neafsey, Daniel E; Carlton, Jane M
2016-08-01
Plasmodium vivax is a major public health burden, responsible for the majority of malaria infections outside Africa. We explored the impact of demographic history and selective pressures on the P. vivax genome by sequencing 182 clinical isolates sampled from 11 countries across the globe, using hybrid selection to overcome human DNA contamination. We confirmed previous reports of high genomic diversity in P. vivax relative to the more virulent Plasmodium falciparum species; regional populations of P. vivax exhibited greater diversity than the global P. falciparum population, indicating a large and/or stable population. Signals of natural selection suggest that P. vivax is evolving in response to antimalarial drugs and is adapting to regional differences in the human host and the mosquito vector. These findings underline the variable epidemiology of this parasite species and highlight the breadth of approaches that may be required to eliminate P. vivax globally.
Cai, Guoshuai; Xiao, Feifei; Cheng, Chao; Li, Yafang; Amos, Christopher I.; Whitfield, Michael L.
2017-01-01
Background We analyzed and integrated transcriptome data from two large studies of lung adenocarcinomas on distinct populations. Our goal was to investigate the variable gene expression alterations between paired tumor-normal tissues and prospectively identify those alterations that can reliably predict lung disease related outcomes across populations. Methods We developed a mixed model that combined the paired tumor-normal RNA-seq from two populations. Alterations in gene expression common to both populations were detected and validated in two independent DNA microarray datasets. A 10-gene prognosis signature was developed through a l1 penalized regression approach and its prognostic value was evaluated in a third independent microarray cohort. Results Deregulation of apoptosis pathways and increased expression of cell cycle pathways were identified in tumors of both Caucasian and Asian lung adenocarcinoma patients. We demonstrate that a 10-gene biomarker panel can predict prognosis of lung adenocarcinoma in both Caucasians and Asians. Compared to low risk groups, high risk groups showed significantly shorter overall survival time (Caucasian patients data: HR = 3.63, p-value = 0.007; Asian patients data: HR = 3.25, p-value = 0.001). Conclusions This study uses a statistical framework to detect DEGs between paired tumor and normal tissues that considers variances among patients and ethnicities, which will aid in understanding the common genes and signalling pathways with the largest effect sizes in ethnically diverse cohorts. We propose multifunctional markers for distinguishing tumor from normal tissue and prognosis for both populations studied. PMID:28426704
Rampelli, Simone; Turroni, Silvia; Schnorr, Stephanie L; Soverini, Matteo; Quercia, Sara; Barone, Monica; Castagnetti, Andrea; Biagi, Elena; Gallinella, Giorgio; Brigidi, Patrizia; Candela, Marco
2017-11-01
It is a matter of fact that the human gut microbiome also includes a non-bacterial fraction represented by eukaryotic cells and viruses. To further explore the gut microbiome variation in human populations, here we characterized the human DNA viral community from publicly available gut metagenome data sets from human populations with different geographical origin and lifestyle. In particular, such data sets encompass microbiome information from two western urban societies (USA and Italy), as well as two traditional hunter-gatherer communities (the Hadza from Tanzania and Matses from Peru) and one pre-agricultural tribe (Tunapuco from Peru). Our results allowed for the first taxonomic reconstruction of the complex viral metacommunities within the human gut. The core virome structure included herpesviruses, papillomaviruses, polyomaviruses, adenoviruses and anelloviruses. Using Random Forests and a co-occurrence analysis approach, we identified the viruses that distinguished populations according to their geographical origin and/or lifestyle. This paves the way for new research aimed at investigating the biological role of the gut virome in human physiology, and the importance of our viral counterpart in the microbiome-host co-evolutionary process. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Network analysis of translocated Takahe populations to identify disease surveillance targets.
Grange, Zoë L; VAN Andel, Mary; French, Nigel P; Gartrell, Brett D
2014-04-01
network in 2011. Likewise, the wild Murchison Mountains population was consistently the sink of the network. Other nodes, such as the offshore islands and the wildlife hospital, varied in importance over time. Common network descriptors and measures of centrality identified key locations for targeting disease surveillance. The visual representation of movements of animals in a population that this technique provides can aid decision makers when they evaluate translocation proposals or attempt to control a disease outbreak. © 2014 Society for Conservation Biology.
Harter, David E V; Thiv, Mike; Weig, Alfons; Jentsch, Anke; Beierkuhnlein, Carl
2015-10-01
The Crassulacean genus Aeonium is a well-known example for plant species radiation on oceanic archipelagos. However, while allopatric speciation among islands is documented for this genus, the role of intra-island speciation due to population divergence by topographical isolation or ecological heterogeneity has not yet been addressed. The aim of this study was to investigate intraspecific genetic structures and to identify spatial and ecological drivers of genetic population differentiation on the island scale. We analyzed inter simple sequence repeat variation within two island-endemic Aeonium species of La Palma: one widespread generalist that covers a large variety of different habitat types (Ae. davidbramwellii) and one narrow ecological specialist (Ae. nobile), in order to assess evolutionary potentials on this island. Gene pool differentiation and genetic diversity patterns were associated with major landscape structures in both species, with phylogeographic implications. However, overall levels of genetic differentiation were low. For the generalist species, outlier loci detection and loci-environment correlation approaches indicated moderate signatures of divergent selection pressures linked to temperature and precipitation variables, while the specialist species missed such patterns. Our data point to incipient differentiation among populations, emphasizing that ecological heterogeneity and topographical structuring within the small scales of an island can foster evolutionary processes. Very likely, such processes have contributed to the radiation of Aeonium on the Canary Islands. There is also support for different evolutionary mechanisms between generalist and specialist species.
Chaplinska, Mariia; Gerritsma, Sylvia; Dini-Andreote, Francisco; Falcao Salles, Joana; Wertheim, Bregje
2016-01-01
In Drosophila, diet is considered a prominent factor shaping the associated bacterial community. However, the host population background (e.g. genotype, geographical origin and founder effects) is a factor that may also exert a significant influence and is often overlooked. To test for population background effects, we characterized the bacterial communities in larvae of six genetically differentiated and geographically distant D. melanogaster lines collected from natural populations across Europe. The diet for these six lines had been identical for ca. 50 generations, thus any differences in the composition of the microbiome originates from the host populations. We also investigated whether induced shifts in the microbiome-in this case by controlled antibiotic administration-alters the hosts' resistance to parasitism. Our data revealed a clear signature of population background on the diversity and composition of D. melanogaster microbiome that differed across lines, even after hosts had been maintained at the same diet and laboratory conditions for over 4 years. In particular, the number of bacterial OTUs per line ranged from 8 to 39 OTUs. Each line harboured 2 to 28 unique OTUs, and OTUs that were highly abundant in some lines were entirely missing in others. Moreover, we found that the response to antibiotic treatment differed among the lines and significantly altered the host resistance to the parasitoid Asobara tabida in one of the six lines. Wolbachia, a widespread intracellular endosymbiont associated with parasitoid resistance, was lacking in this line, suggesting that other components of the Drosophila microbiome caused a change in host resistance. Collectively, our results revealed that lines that originate from different population backgrounds show significant differences in the established Drosophila microbiome, outpacing the long-term effect of diet. Perturbations on these naturally assembled microbiomes to some degree influenced the hosts' resistance
A PCR survey of vector-borne pathogens in different dog populations from Turkey.
Guo, Huanping; Sevinc, Ferda; Ceylan, Onur; Sevinc, Mutlu; Ince, Ege; Gao, Yang; Moumouni, Paul Franck Adjou; Liu, Mingming; Efstratiou, Artemis; Wang, Guanbo; Cao, Shinuo; Zhou, Mo; Jirapattharasate, Charoonluk; Ringo, Aaron Edmond; Zheng, Weiqing; Xuan, Xuenan
2017-09-26
In the present study, a total of 192 blood samples were collected from pet dogs, kennel dogs and shepherd dogs in Konya district, Turkey, and tested by specific PCR for the presence of vector-borne pathogens. Several pathogens were identified, most of which can cause substantial morbidity in dogs. PCR results revealed that 54 (28.1%) dogs were infected with one or more pathogens. Positive results were obtained for Babesia spp. in 4 dogs (2.1%), Hepatozoon spp. in 8 dogs (4.2%) and Mycoplasma spp. in 46 dogs (24%). Three dogs (1.6%) were infected with two or three pathogens. The sequence analysis of the positive DNA samples revealed the presence of Babesia canis vogeli, Hepatozoon canis, Hepatozoon sp. MF, Mycoplasma haemocanis and Candidatus Mycoplasma haematoparvum. Ehrlichia canis and Anaplasma platys were not detected. Regardless of ownership status, vector-borne diseases were common in these dog populations. There was significant difference of pathogen prevalence among the different dog populations. Mycoplasma spp. was more frequent in the kennel dogs (31.9%) than in the pet (21.4%) and shepherd dogs (13.8%). Additionally, the frequency of Babesia spp. and Hepatozoon spp. was higher in the shepherd dogs which account for three quarters and half of the total number of Babesia spp. and Hepatozoon spp., respectively. To our knowledge, this is the first report of Mycoplasma infection in dogs in Turkey. The results of the present study provide a foundation for understanding the epidemiology of canine vector-borne diseases (CVBDs), and for strategies to control these diseases in Turkey.
Reyes-Urueña, Juliana Maria; Campbell, Colin N J; Vives, Núria; Esteve, Anna; Ambrosioni, Juan; Tural, Cristina; Ferrer, Elena; Navarro, Gemma; Force, Lluis; García, Isabel; Masabeu, Àngels; Vilaró, Josep M; García de Olalla, Patricia; Caylà, Joan Artur; Miró, Josep M; Casabona, Jordi
2018-02-28
Undiagnosed HIV continues to be a hindrance to efforts aimed at reducing incidence of HIV. The objective of this study was to provide an estimate of the HIV undiagnosed population in Catalonia and compare the HIV care cascade with this step included between high-risk populations. To estimate HIV incidence, time between infection and diagnosis and the undiagnosed population stratified by CD4 count, we used the ECDC HIV Modelling Tool V.1.2.2. This model uses data on new HIV and AIDS diagnoses from the Catalan HIV/AIDS surveillance system from 2001 to 2013. Data used to estimate the proportion of people enrolled, on ART and virally suppressed in the HIV care cascade were derived from the PISCIS cohort. The total number of people living with HIV (PLHIV) in Catalonia in 2013 was 34 729 (32 740 to 36 827), with 12.3% (11.8 to 18.1) of whom were undiagnosed. By 2013, there were 8458 (8101 to 9079) Spanish-born men who have sex with men (MSM) and 2538 (2334 to 2918) migrant MSM living with HIV in Catalonia. A greater proportion of migrant MSM than local MSM was undiagnosed (32% vs 22%). In the subsequent steps of the HIV care cascade, migrants MSM experience greater losses than the Spanish-born MSM: in retention in care (74% vs 55%), in the proportion on combination antiretroviral treatment (70% vs 50%) and virally suppressed (65% vs 46%). By the end of 2013, there were an estimated 34 729 PLHIV in Catalonia, of whom 4271 were still undiagnosed. This study shows that the Catalan epidemic of HIV has continued to expand with the key group sustaining HIV transmission being MSM living with undiagnosed HIV. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
ORF phage display to identify cellular proteins with different functions.
Li, Wei
2012-09-01
Open reading frame (ORF) phage display is a new branch of phage display aimed at improving its efficiency to identify cellular proteins with specific binding or functional activities. Despite the success of phage display with antibody libraries and random peptide libraries, phage display with cDNA libraries of cellular proteins identifies a high percentage of non-ORF clones encoding unnatural short peptides with minimal biological implications. This is mainly because of the uncontrollable reading frames of cellular proteins in conventional cDNA libraries. ORF phage display solves this problem by eliminating non-ORF clones to generate ORF cDNA libraries. Here I summarize the procedures of ORF phage display, discuss the factors influencing its efficiency, present examples of its versatile applications, and highlight evidence of its capability of identifying biologically relevant cellular proteins. ORF phage display coupled with different selection strategies is capable of delineating diverse functions of cellular proteins with unique advantages. Copyright © 2012 Elsevier Inc. All rights reserved.
Ling, Zhi-Qiang; Wang, Yi; Mukaisho, Kenichi; Hattori, Takanori; Tatsuta, Takeshi; Ge, Ming-Hua; Jin, Li; Mao, Wei-Min; Sugihara, Hiroyuki
2010-06-01
Tests of differentially expressed genes (DEGs) from microarray experiments are based on the null hypothesis that genes that are irrelevant to the phenotype/stimulus are expressed equally in the target and control samples. However, this strict hypothesis is not always true, as there can be several transcriptomic background differences between target and control samples, including different cell/tissue types, different cell cycle stages and different biological donors. These differences lead to increased false positives, which have little biological/medical significance. In this article, we propose a statistical framework to identify DEGs between target and control samples from expression microarray data allowing transcriptomic background differences between these samples by introducing a modified null hypothesis that the gene expression background difference is normally distributed. We use an iterative procedure to perform robust estimation of the null hypothesis and identify DEGs as outliers. We evaluated our method using our own triplicate microarray experiment, followed by validations with reverse transcription-polymerase chain reaction (RT-PCR) and on the MicroArray Quality Control dataset. The evaluations suggest that our technique (i) results in less false positive and false negative results, as measured by the degree of agreement with RT-PCR of the same samples, (ii) can be applied to different microarray platforms and results in better reproducibility as measured by the degree of DEG identification concordance both intra- and inter-platforms and (iii) can be applied efficiently with only a few microarray replicates. Based on these evaluations, we propose that this method not only identifies more reliable and biologically/medically significant DEG, but also reduces the power-cost tradeoff problem in the microarray field. Source code and binaries freely available for download at http://comonca.org.cn/fdca/resources/softwares/deg.zip.
Spore populations among bulk tank raw milk and dairy powders are significantly different.
Miller, Rachel A; Kent, David J; Watterson, Matthew J; Boor, Kathryn J; Martin, Nicole H; Wiedmann, Martin
2015-12-01
To accommodate stringent spore limits mandated for the export of dairy powders, a more thorough understanding of the spore species present will be necessary to develop prospective strategies to identify and reduce sources (i.e., raw materials or in-plant) of contamination. We characterized 1,523 spore isolates obtained from bulk tank raw milk (n=33 farms) and samples collected from 4 different dairy powder-processing plants producing acid whey, nonfat dry milk, sweet whey, or whey protein concentrate 80. The spores isolated comprised 12 genera, at least 44 species, and 216 rpoB allelic types. Bacillus and Geobacillus represented the most commonly isolated spore genera (approximately 68.9 and 12.1%, respectively, of all spore isolates). Whereas Bacillus licheniformis was isolated from samples collected from all plants and farms, Geobacillus spp. were isolated from samples from 3 out of 4 plants and just 1 out of 33 farms. We found significant differences between the spore population isolated from bulk tank raw milk and those isolated from dairy powder plant samples, except samples from the plant producing acid whey. A comparison of spore species isolated from raw materials and finished powders showed that although certain species, such as B. licheniformis, were found in both raw and finished product samples, other species, such as Geobacillus spp. and Anoxybacillus spp., were more frequently isolated from finished powders. Importantly, we found that 8 out of 12 genera were isolated from at least 2 different spore count methods, suggesting that some spore count methods may provide redundant information if used in parallel. Together, our results suggest that (1) Bacillus and Geobacillus are the predominant spore contaminants in a variety of dairy powders, implying that future research efforts targeted at elucidating approaches to reduce levels of spores in dairy powders should focus on controlling levels of spore isolates from these genera; and (2) the spore
Population-based differences in treatment outcome following anticancer drug therapies.
Ma, Brigette By; Hui, Edwin P; Mok, Tony Sk
2010-01-01
Population-based differences in toxicity and clinical outcome following treatment with anticancer drugs have an important effect on oncology practice and drug development. These differences arise from complex interactions between biological and environmental factors, which include genetic diversity affecting drug metabolism and the expression of drug targets, variations in tumour biology and host physiology, socioeconomic disparities, and regional preferences in treatment standards. Some well-known examples include the high prevalence of activating epidermal growth factor receptor (EGFR) mutations in pulmonary adenocarcinoma among northeast (China, Japan, Korea) and parts of southeast Asia (excluding India) non-smokers, which predict sensitivity to EGFR kinase inhibitors, and the sharp contrast between Japan and the west in the management and survival outcome of gastric cancer. This review is a critical overview of population-based differences in the four most prevalent cancers in the world: lung, breast, colorectal, and stomach cancer. Particular attention is given to the clinical relevance of such knowledge in terms of the individualisation of drug therapy and in the design of clinical trials. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Mack, Philip C; Gandara, David R; Lara, Primo N
2012-12-01
neutropenia and anemia. The underlying basis for these divergent outcomes is discussed. The common arm methodology provides a template for identifying and interpreting patient outcome differences across populations, and is an instructive lesson in the burgeoning era of clinical trials globalization.
Rosas, Antonio; Bastir, Markus; Alarcón, Jose Antonio; Kuroe, Kazuto
2008-09-01
To test the hypothesis that midline basicranial orientation and posterior cranial base length are discriminating factors between adults of different populations and its potential maxillo/mandibular disharmonies. Twenty-nine 2D landmarks of the midline cranial base, the face and the mandible of dry skull X-rays from three major populations (45 Asians, 34 Africans, 64 Europeans) were digitized and analysed by geometric morphometrics. We used, first, MANOVA to test for mean shape differences between populations; then, principal components analysis (PCA) to assess the overall variation in the sample and finally, canonical variate analysis (CVA) with jack-knife validations (N=1000) to analyse the anatomical features that best distinguished among populations. Significant mean shapes differences were shown between populations (P<0.001). CVA revealed two significant axes of discrimination (P<0.001). Jack-knife validation correctly identified 92% of 15,000 unknowns. In Africans the whole cranial base is rotated into a forward-downward position, while in Asians it is rotated in the opposite way. The Europeans occupied an intermediate position. African and Asian samples showed a maxillo/mandibular prognathism. African prognathism was produced by an anterior positioned maxilla, Asian prognathism by retruded anterior cranial base and increase of the posterior cranial base length. Europeans showed a trend towards retracted mandibles with relatively shorter posterior cranial bases. The results supported the hypothesis that basicranial orientation and posterior cranial base length are valid factors to distinguish between geographic groups. The whole craniofacial configuration underlying a particular maxillo-facial disharmony must be considered in diagnosis, growth predictions and resulting treatment planning.
Identifying water price and population criteria for meeting future urban water demand targets
NASA Astrophysics Data System (ADS)
Ashoori, Negin; Dzombak, David A.; Small, Mitchell J.
2017-12-01
Predictive models for urban water demand can help identify the set of factors that must be satisfied in order to meet future targets for water demand. Some of the explanatory variables used in such models, such as service area population and changing temperature and rainfall rates, are outside the immediate control of water planners and managers. Others, such as water pricing and the intensity of voluntary water conservation efforts, are subject to decisions and programs implemented by the water utility. In order to understand this relationship, a multiple regression model fit to 44 years of monthly demand data (1970-2014) for Los Angeles, California was applied to predict possible future demand through 2050 under alternative scenarios for the explanatory variables: population, price, voluntary conservation efforts, and temperature and precipitation outcomes predicted by four global climate models with two CO2 emission scenarios. Future residential water demand in Los Angeles is projected to be largely driven by price and population rather than climate change and conservation. A median projection for the year 2050 indicates that residential water demand in Los Angeles will increase by approximately 36 percent, to a level of 620 million m3 per year. The Monte Carlo simulations of the fitted model for water demand were then used to find the set of conditions in the future for which water demand is predicted to be above or below the Los Angeles Department of Water and Power 2035 goal to reduce residential water demand by 25%. Results indicate that increases in price can not ensure that the 2035 water demand target can be met when population increases. Los Angeles must rely on furthering their conservation initiatives and increasing their use of stormwater capture, recycled water, and expanding their groundwater storage. The forecasting approach developed in this study can be utilized by other cities to understand the future of water demand in water-stressed areas
Richardson, A K; Clarke, G; Sabel, C E; Pearson, J F; Mason, D F; Taylor, B V
2012-11-01
Identifying eligible individuals for a prevalence survey is difficult in the absence of a disease register or a national population register. To develop a method to identify and invite eligible individuals to participate in a national prevalence survey while maintaining confidentiality and complying with privacy legislation. A unique identifier (based on date of birth, sex and initials) was developed so that database holders could identify eligible individuals, notify us and invite them on our behalf to participate in a national multiple sclerosis prevalence survey while maintaining confidentiality and complying with privacy legislation. Several organisations (including central government, health and non-governmental organisations) used the method described to assign unique identifiers to individuals listed on their databases and to forward invitations and consent forms to them. The use of a unique identifier allowed us to recognise and record all the sources of identification for each individual. This prevented double counting or approaching the same individual more than once and facilitated the use of capture-recapture methods to improve the prevalence estimate. Capture-recapture analysis estimated that the method identified over 96% of eligible individuals in this prevalence survey. This method was developed and used successfully in a national prevalence survey of multiple sclerosis in New Zealand. The method may be useful for prevalence surveys of other diseases in New Zealand and for prevalence surveys in other countries with similar privacy legislation and lack of disease registers and population registers. © 2012 The Authors; Internal Medicine Journal © 2012 Royal Australasian College of Physicians.
Greacen, Tim; Kersaudy-Rahib, Delphine; Le Gall, Jean-Marie; Lydié, Nathalie; Ghosn, Jade; Champenois, Karen
2016-01-01
Context HIV self-tests are currently being introduced in France with the aim of promoting screening both for the general population and for high-risk populations. Objective The current study aimed to identify and compare the information and support needs of the different target population groups. Methods The Delphi process was used to synthesize expert opinions for each population group. Experts were chosen for their experience and expertise in the area of HIV and HIV screening for each population. Each group developed recommendations for a specific population: six high HIV prevalence populations (men who have sex with men; transgender people; substance users; migrants from sub-Saharan Africa; French West Indies; French Guiana) and two low prevalence populations (the general population; people under 25). Each group included expertise from four areas: research, screening and care, policy-making, and community groups. Results A final total of 263 recommendations were grouped into eight main themes: Communicating at both national and community levels about self-test arrival (24% of all recommendations); Providing information adapted to the different community groups’ needs (23%); Providing counselling on self-test use and access to care (15%); Making self-tests available to all in terms of accessibility and cost (13%); Preparing community healthcare and screening systems for the arrival of the self-test (11%); Approving only high quality self-tests (6%); Defending self-test users’ legal rights (5%); Evaluating self-test use (3%). Although a large number of recommendations were common to several groups of experts, the study highlighted a certain number of recommendations specific to each different population group, particularly with regard to information content and access both to information and to the self-tests themselves. Conclusion Results from the current study should make a significant contribution to policy decisions concerning catering for the specific
Hansson, Erik; Sasa, Mahmood; Mattisson, Kristoffer; Robles, Arodys; Gutiérrez, José María
2013-01-01
Introduction Snakebite accidents are an important health problem in rural areas of tropical countries worldwide, including Costa Rica, where most bites are caused by the pit-viper Bothrops asper. The treatment of these potentially fatal accidents is based on the timely administration of specific antivenom. In many regions of the world, insufficient health care systems and lack of antivenom in remote and poor areas where snakebites are common, means that efficient treatment is unavailable for many snakebite victims, leading to unnecessary mortality and morbidity. In this study, geographical information systems (GIS) were used to identify populations in Costa Rica with a need of improved access to antivenom treatment: those living in areas with a high risk of snakebites and long time to reach antivenom treatment. Method/Principal Findings Populations living in areas with high risk of snakebites were identified using two approaches: one based on the district-level reported incidence, and another based on mapping environmental factors favoring B. asper presence. Time to reach treatment using ambulance was estimated using cost surface analysis, thereby enabling adjustment of transportation speed by road availability and quality, topography and land use. By mapping populations in high risk of snakebites and the estimated time to treatment, populations with need of improved treatment access were identified. Conclusion/Significance This study demonstrates the usefulness of GIS for improving treatment of snakebites. By mapping reported incidence, risk factors, location of existing treatment resources, and the time estimated to reach these for at-risk populations, rational allocation of treatment resources is facilitated. PMID:23383352
Hansson, Erik; Sasa, Mahmood; Mattisson, Kristoffer; Robles, Arodys; Gutiérrez, José María
2013-01-01
Snakebite accidents are an important health problem in rural areas of tropical countries worldwide, including Costa Rica, where most bites are caused by the pit-viper Bothrops asper. The treatment of these potentially fatal accidents is based on the timely administration of specific antivenom. In many regions of the world, insufficient health care systems and lack of antivenom in remote and poor areas where snakebites are common, means that efficient treatment is unavailable for many snakebite victims, leading to unnecessary mortality and morbidity. In this study, geographical information systems (GIS) were used to identify populations in Costa Rica with a need of improved access to antivenom treatment: those living in areas with a high risk of snakebites and long time to reach antivenom treatment. Populations living in areas with high risk of snakebites were identified using two approaches: one based on the district-level reported incidence, and another based on mapping environmental factors favoring B. asper presence. Time to reach treatment using ambulance was estimated using cost surface analysis, thereby enabling adjustment of transportation speed by road availability and quality, topography and land use. By mapping populations in high risk of snakebites and the estimated time to treatment, populations with need of improved treatment access were identified. This study demonstrates the usefulness of GIS for improving treatment of snakebites. By mapping reported incidence, risk factors, location of existing treatment resources, and the time estimated to reach these for at-risk populations, rational allocation of treatment resources is facilitated.
Hiring appropriate providers for different populations: acute care nurse practitioners.
Haut, Cathy; Madden, Maureen
2015-06-01
Acute care nurse practitioners, prepared as providers for a variety of populations of patients, continue to make substantial contributions to health care. Evidence indicates shorter stays, higher satisfaction among patients, increased work efficiency, and higher quality outcomes when acute care nurse practitioners are part of unit- or service-based provider teams. The Consensus Model for APRN Regulation: Licensure, Accreditation, Certification, and Education outlines detailed guidelines for matching nurse practitioners' education with certification and practice by using a population-focused algorithm. Despite national support for the model, nurse practitioners and employers continue to struggle with finding the right fit. Nurse practitioners often use their interest and previous nursing experience to apply for an available position, and hospitals may not understand preparation or regulations related to matching the appropriate provider to the work environment. Evidence and regulatory guidelines indicate appropriate providers for population-focused positions. This article presents history and recommendations for hiring acute care nurse practitioners as providers for different populations of patients. ©2015 American Association of Critical-Care Nurses.
Leifso, A; MacDougall, A S; Husband, B; Hierro, J L; Köchy, M; Pärtel, M; Peltzer, D A
2012-12-01
The global expansion of species beyond their ancestral ranges can derive from mechanisms that are trait-based (e.g., post-establishment evolved differences compared to home populations) or circumstantial (e.g., propagule pressure, with no trait-based differences). These mechanisms can be difficult to distinguish following establishment, but each makes unique predictions regarding trait similarity between ancestral ('home') and introduced ('away') populations. Here, we tested for trait-based population differences across four continents for the globally distributed grass Dactylis glomerata, to assess the possible role of trait evolution in its worldwide expansion. We used a common-environment glasshouse experiment to quantify trait differences among home and away populations, and the potential relevance of these differences for competitive interactions. Few significant trait differences were found among continents, suggesting minimal change during global expansion. All populations were polyploids, with similar foliar carbon:nitrogen ratios (a proxy for defense), chlorophyll content, and biomass. Emergence time and growth rate favored home populations, resulting in their competitive superiority over away populations. Small but significant trait differences among away populations suggest different introductory histories or local adaptive responses following establishment. In summary, the worldwide distribution of this species appears to have arisen from its pre-adapted traits promoting growth, and its repeated introduction with cultivation and intense propagule pressure. Global expansion can thus occur without substantial shifts in growth, reproduction, or defense. Rather than focusing strictly on the invader, invasion success may also derive from the traits found (or lacking) in the recipient community and from environmental context including human disturbance.
Individual differences, density dependence and offspring birth traits in a population of red deer
Stopher, Katie V; Pemberton, Josephine M; Clutton-Brock, Tim H; Coulson, Tim
2008-01-01
Variation between individuals is an essential component of natural selection and evolutionary change, but it is only recently that the consequences of persistent differences between individuals on population dynamics have been considered. In particular, few authors have addressed whether interactions exist between individual quality and environmental variation. In part, this is due to the difficulties of collecting sufficient data, but also the challenge of defining individual quality. Using a long-established study population of red deer, Cervus elaphus, inhabiting the North Block of the Isle of Rum, and three quality measures, this paper investigates how differences in maternal quality affect variation in birth body mass and date, as population density varies, and how this differs depending on the sex of the offspring and the maternal quality measure used. Significant interactions between maternal quality, measured as a hind's total contribution to population growth, and population density are reported for birth mass, but only for male calves. Analyses using dominance or age at primiparity to define maternal quality showed no significant interactions with population density, highlighting the difficulties of defining a consistent measure of individual quality. PMID:18522909
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tyler, Ludmila; Lee, Scott J.; Young, Nelson D.
The small, annual grass Brachypodium distachyon (L.) Beauv., a close relative of wheat ( Triticum aestivum L.) and barley ( Hordeum vulgare L.), is a powerful model system for cereals and bioenergy grasses. Genome-wide association studies (GWAS) of natural variation can elucidate the genetic basis of complex traits but have been so far limited in B. distachyon by the lack of large numbers of well-characterized and sufficiently diverse accessions. Here, we report on genotyping-by-sequencing (GBS) of 84 B. distachyon, seven B. hybridum, and three B. stacei accessions with diverse geographic origins including Albania, Armenia, Georgia, Italy, Spain, and Turkey. Overmore » 90,000 high-quality single-nucleotide polymorphisms (SNPs) distributed across the Bd21 reference genome were identified. Our results confirm the hybrid nature of the B. hybridum genome, which appears as a mosaic of B. distachyon-like and B. stacei-like sequences. Analysis of more than 50,000 SNPs for the B. distachyon accessions revealed three distinct, genetically defined populations. Surprisingly, these genomic profiles are associated with differences in flowering time rather than with broad geographic origin. High levels of differentiation in loci associated with floral development support the differences in flowering phenology between B. distachyon populations. Genome-wide association studies combining genotypic and phenotypic data also suggest the presence of one or more photoperiodism, circadian clock, and vernalization genes in loci associated with flowering time variation within B. distachyon populations. As a result, our characterization elucidates genes underlying population differences, expands the germplasm resources available for Brachypodium, and illustrates the feasibility and limitations of GWAS in this model grass.« less
Tyler, Ludmila; Lee, Scott J.; Young, Nelson D.; ...
2016-04-29
The small, annual grass Brachypodium distachyon (L.) Beauv., a close relative of wheat ( Triticum aestivum L.) and barley ( Hordeum vulgare L.), is a powerful model system for cereals and bioenergy grasses. Genome-wide association studies (GWAS) of natural variation can elucidate the genetic basis of complex traits but have been so far limited in B. distachyon by the lack of large numbers of well-characterized and sufficiently diverse accessions. Here, we report on genotyping-by-sequencing (GBS) of 84 B. distachyon, seven B. hybridum, and three B. stacei accessions with diverse geographic origins including Albania, Armenia, Georgia, Italy, Spain, and Turkey. Overmore » 90,000 high-quality single-nucleotide polymorphisms (SNPs) distributed across the Bd21 reference genome were identified. Our results confirm the hybrid nature of the B. hybridum genome, which appears as a mosaic of B. distachyon-like and B. stacei-like sequences. Analysis of more than 50,000 SNPs for the B. distachyon accessions revealed three distinct, genetically defined populations. Surprisingly, these genomic profiles are associated with differences in flowering time rather than with broad geographic origin. High levels of differentiation in loci associated with floral development support the differences in flowering phenology between B. distachyon populations. Genome-wide association studies combining genotypic and phenotypic data also suggest the presence of one or more photoperiodism, circadian clock, and vernalization genes in loci associated with flowering time variation within B. distachyon populations. As a result, our characterization elucidates genes underlying population differences, expands the germplasm resources available for Brachypodium, and illustrates the feasibility and limitations of GWAS in this model grass.« less
Urmersbach, Sara; Alter, Thomas; Koralage, Madura Sanjeevani Gonsal; Sperling, Lisa; Gerdts, Gunnar; Messelhäusser, Ute; Huehn, Stephan
2014-03-08
Vibrio parahaemolyticus is frequently isolated from environmental and seafood samples and associated with gastroenteritis outbreakes in American, European, Asian and African countries. To distinguish between different lineages of V. parahaemolyticus various genotyping techniques have been used, incl. multilocus sequence typing (MLST). Even though some studies have already applied MLST analysis to characterize V. parahaemolyticus strain sets, these studies have been restricted to specific geographical areas (e.g. U.S. coast, Thailand and Peru), have focused exclusively on pandemic or non-pandemic pathogenic isolates or have been based on a limited strain number. To generate a global picture of V. parahaemolyticus genotype distribution, a collection of 130 environmental and seafood related V. parahaemolyticus isolates of different geographical origins (Sri Lanka, Ecuador, North Sea and Baltic Sea as well as German retail) was subjected to MLST analysis after modification of gyrB and recA PCRs. The V. parahaemolyticus population was composed of 82 unique Sequence Types (STs), of which 68 (82.9%) were new to the pubMLST database. After translating the in-frame nucleotide sequences into amino acid sequences, less diversity was detectable: a total of 31 different peptide Sequence Types (pSTs) with 19 (61.3%) new pSTs were generated from the analyzed isolates. Most STs did not show a global dissemination, but some were supra-regionally distributed and clusters of STs were dependent on geographical origin. On peptide level no general clustering of strains from specific geographical regions was observed, thereby the most common pSTs were found on all continents (Asia, South America and Europe) and rare pSTs were restricted to distinct countries or even geographical regions. One lineage of pSTs associated only with strains from North and Baltic Sea strains was identified. Our study reveals a high genetic diversity in the analyzed V. parahaemolyticus strain set as well as for
Genetic differences in human circadian clock genes among worldwide populations.
Ciarleglio, Christopher M; Ryckman, Kelli K; Servick, Stein V; Hida, Akiko; Robbins, Sam; Wells, Nancy; Hicks, Jennifer; Larson, Sydney A; Wiedermann, Joshua P; Carver, Krista; Hamilton, Nalo; Kidd, Kenneth K; Kidd, Judith R; Smith, Jeffrey R; Friedlaender, Jonathan; McMahon, Douglas G; Williams, Scott M; Summar, Marshall L; Johnson, Carl Hirschie
2008-08-01
The daily biological clock regulates the timing of sleep and physiological processes that are of fundamental importance to human health, performance, and well-being. Environmental parameters of relevance to biological clocks include (1) daily fluctuations in light intensity and temperature, and (2) seasonal changes in photoperiod (day length) and temperature; these parameters vary dramatically as a function of latitude and locale. In wide-ranging species other than humans, natural selection has genetically optimized adaptiveness along latitudinal clines. Is there evidence for selection of clock gene alleles along latitudinal/photoperiod clines in humans? A number of polymorphisms in the human clock genes Per2, Per3, Clock, and AANAT have been reported as alleles that could be subject to selection. In addition, this investigation discovered several novel polymorphisms in the human Arntl and Arntl2 genes that may have functional impact upon the expression of these clock transcriptional factors. The frequency distribution of these clock gene polymorphisms is reported for diverse populations of African Americans, European Americans, Ghanaians, Han Chinese, and Papua New Guineans (including 5 subpopulations within Papua New Guinea). There are significant differences in the frequency distribution of clock gene alleles among these populations. Population genetic analyses indicate that these differences are likely to arise from genetic drift rather than from natural selection.
Differences between blood donors and a population sample: implications for case-control studies.
Golding, Jean; Northstone, Kate; Miller, Laura L; Davey Smith, George; Pembrey, Marcus
2013-08-01
Selecting appropriate controls for studies of genetic variation in case series is important. The two major candidates involve the use of blood donors or a random sample of the population. We compare and contrast the two different populations of controls for studies of genetic variation using data from parents enrolled in the Avon Longitudinal Study of Parents and Children (ALSPAC). In addition we compute different biases using a series of hypothetical assumptions. The study subjects who had been blood donors differed markedly from the general population in social, health-related, anthropometric, and personality-related variables. Using theoretical examples, we show that blood donors are a poor control group for non-genetic studies of diseases related to environmentally, behaviourally, or socially patterned exposures. However, we show that if blood donors are used as controls in genetic studies, these factors are unlikely to make a major difference in detecting true associations with relatively rare disorders (cumulative incidence through life of <10%). Nevertheless, for more common disorders, the reduction in accuracy resulting from the inclusion in any control population of individuals who have or will develop the disease in question can create a greater bias than can socially patterned factors. Information about the medical history of a control and the parents of the control (as a proxy for whether the control will develop the disease) is more important with regard to the choice of controls than whether the controls are a random population sample or blood donors.
Monarch butterfly population decline in North America: identifying the threatening processes
Thogmartin, Wayne E.; Wiederholt, Ruscena; Oberhauser, Karen; Drum, Ryan G.; Diffendorfer, Jay E.; Altizer, Sonia; Taylor, Orley R.; Pleasants, John M.; Semmens, Darius J.; Semmens, Brice X.; Erickson, Richard A.; Libby, Kaitlin; Lopez-Hoffman, Laura
2017-01-01
The monarch butterfly (Danaus plexippus) population in North America has sharply declined over the last two decades. Despite rising concern over the monarch butterfly's status, no comprehensive study of the factors driving this decline has been conducted. Using partial least-squares regressions and time-series analysis, we investigated climatic and habitat-related factors influencing monarch population size from 1993 to 2014. Potential threats included climatic factors, habitat loss (milkweed and overwinter forest), disease and agricultural insecticide use (neonicotinoids). While climatic factors, principally breeding season temperature, were important determinants of annual variation in abundance, our results indicated strong negative relationships between population size and habitat loss variables, principally glyphosate use, but also weaker negative effects from the loss of overwinter forest and breeding season use of neonicotinoids. Further declines in population size because of glyphosate application are not expected. Thus, if remaining threats to habitat are mitigated we expect climate-induced stochastic variation of the eastern migratory population of monarch butterfly around a relatively stationary population size.
Improving the time efficiency of identifying dairy herds with poorer welfare in a population.
de Vries, M; Bokkers, E A M; van Schaik, G; Engel, B; Dijkstra, T; de Boer, I J M
2016-10-01
Animal-based welfare assessment is time consuming and expensive. A promising strategy for improving the efficiency of identifying dairy herds with poorer welfare is to first estimate levels of welfare in herds based on data that are more easily obtained. Our aims were to evaluate the potential of herd housing and management data for estimating the level of welfare in dairy herds, and to estimate the associated reduction in the number of farm visits required for identification of herds with poorer welfare in a population. Seven trained observers collected data on 6 animal-based welfare indicators in a selected sample of 181 loose-housed Dutch dairy herds (herd size: 22 to 211 cows). Severely lame cows, cows with lesions or swellings, cows with a dirty hindquarter, and very lean cows were counted, and avoidance distance was assessed for a sample of cows. Occurrence of displacements (social behavior) was recorded in the whole barn during 120 min of observation. For the same herds, data regarding cattle housing and management were collected on farms, and data relating to demography, management, milk production and composition, and fertility were extracted from national databases. A herd was classified as having poorer welfare when it belonged to the 25% worst-scoring herds. We used variables of herd housing and management data as potential predictors for individual animal-based welfare indicators in logistic regressions at the herd level. Prediction was less accurate for the avoidance distance index [area under the curve (AUC)=0.69], and moderately accurate for prevalence of severely lame cows (AUC=0.83), prevalence of cows with lesions or swellings (AUC=0.81), prevalence of cows with a dirty hindquarter (AUC=0.74), prevalence of very lean cows (AUC=0.83), and frequency of displacements (AUC=0.72). We compared the number of farm visits required for identifying herds with poorer welfare in a population for a risk-based screening with predictions based on herd housing
Developmental timing differences underlie armor loss across threespine stickleback populations.
Currey, Mark C; Bassham, Susan; Perry, Stephen; Cresko, William A
2017-11-01
Comparing ontogenetic patterns within a well-described evolutionary context aids in inferring mechanisms of change, including heterochronies or deletion of developmental pathways. Because selection acts on phenotypes throughout ontogeny, any within-taxon developmental variation has implications for evolvability. We compare ontogenetic order and timing of locomotion and defensive traits in three populations of threespine stickleback that have evolutionarily divergent adult forms. This analysis adds to the growing understanding of developmental genetic mechanisms of adaptive change in this evolutionary model species by delineating when chondrogenesis and osteogenesis in two derived populations begin to deviate from the developmental pattern in their immediate ancestors. We found that differences in adult defensive morphologies arise through abolished or delayed initiation of these traits rather than via an overall heterochronic shift, that intra-population ontogenetic variation is increased for some derived traits, and that altered armor developmental timing differentiates the derived populations from each other despite parallels in adult lateral plate armor phenotypes. We found that changes in ossified elements of the pelvic armor are linked to delayed and incomplete development of an early-forming pelvic cartilage, and that this disruption likely presages the variable pelvic vestiges documented in many derived populations. © 2017 Wiley Periodicals, Inc.
Luo, Huajie; Wu, Hao; Shen, Hailian; Chen, Haifeng; Yang, Tao; Huang, Zhiwu; Jin, Xiaojie; Pang, Xiuhong; Li, Lei; Hu, Xianting; Jiang, Xuemei; Fan, Zhuping; Li, Jiping
2016-07-01
This study aimed to test the association between the European GWAS-identified risk IQGAP2 SNP rs457717 (A>G) and age-related hearing impairment (ARHI) in a Han male Chinese (HMC) population. A total of 2420 HMC subjects were divided into two groups [group 70+: >70 years (n = 1306), and group 70-: ≤70 years (n = 1114)]. The participants were categorised into case and control groups according to Z high scores for group 70- and the severity of hearing loss and different audiogram shapes identified by K-means cluster analysis for group 70+. The IQGAP2 tagSNP rs457717 was genotyped in accordance with the different ARHI phenotypes. The genotype distributions of IQGAP2 (AA/AG/GG) were not significantly different between the case and control groups (P = 0.613 for group 70-; P = 0.602 for group 70+). Compared with genotype AA, the ORs of genotypes AG and GG for ARHI were not significantly different following adjustment for other environmental risk factors. We demonstrated that the IQGAP2 TagSNP rs457717 (A/G) was not associated with ARHI in HMC individuals.
A Need for Better Studies to Identify Those Populations at ...
This invited editorial on a paper accepted for publication in the Journal of Pediatrics details scientific advances needed to improve the identification of those populations at greatest risk of a pollutant-related health effect with a primary focus on air pollution. Invited editorial on a paper dealing with at-risk populations.
Hoebel, Jens; Finger, Jonas D; Kuntz, Benjamin; Lampert, Thomas
2016-02-01
Regular physical activity has positive effects on health at all ages. This study aims to investigate how far physical activity and regular sports engagement, as a more specific type of physical activity, are associated with socioeconomic factors in the middle-aged working population. Data were obtained from 21,699 working men and women aged between 30 and 64 years who participated in the 2009 and 2010 population-based national German Health Update (GEDA) surveys conducted by the Robert Koch Institute. Besides a multi-dimensional index of socioeconomic status (SES), three single dimensions of SES (education, occupation, and income) were used to analyse socioeconomic differences in total physical activity and regular sports engagement. While the prevalence of total physical activity increased with lower SES, the proportion of people with regular sports engagement decreased with lower SES. These associations remained after adjusting for age in men and women. After mutual adjustment of the three single socioeconomic dimensions, physical activity was independently associated with lower education and lower occupational status. Regular sports engagement was observed to be independently associated with higher education, higher occupational status, as well as higher income after mutual adjustment. This study demonstrates significant socioeconomic differences in physical and sports activity in the middle-aged working population. Education, occupation, and income show varying independent associations with physical activity behaviour. Such differences need to be considered when identifying target groups for health-enhancing physical activity interventions.
Molinaro, Alyssa M; Pearson, Bret J
2016-04-27
The planarian Schmidtea mediterranea is a master regenerator with a large adult stem cell compartment. The lack of transgenic labeling techniques in this animal has hindered the study of lineage progression and has made understanding the mechanisms of tissue regeneration a challenge. However, recent advances in single-cell transcriptomics and analysis methods allow for the discovery of novel cell lineages as differentiation progresses from stem cell to terminally differentiated cell. Here we apply pseudotime analysis and single-cell transcriptomics to identify adult stem cells belonging to specific cellular lineages and identify novel candidate genes for future in vivo lineage studies. We purify 168 single stem and progeny cells from the planarian head, which were subjected to single-cell RNA sequencing (scRNAseq). Pseudotime analysis with Waterfall and gene set enrichment analysis predicts a molecularly distinct neoblast sub-population with neural character (νNeoblasts) as well as a novel alternative lineage. Using the predicted νNeoblast markers, we demonstrate that a novel proliferative stem cell population exists adjacent to the brain. scRNAseq coupled with in silico lineage analysis offers a new approach for studying lineage progression in planarians. The lineages identified here are extracted from a highly heterogeneous dataset with minimal prior knowledge of planarian lineages, demonstrating that lineage purification by transgenic labeling is not a prerequisite for this approach. The identification of the νNeoblast lineage demonstrates the usefulness of the planarian system for computationally predicting cellular lineages in an adult context coupled with in vivo verification.
Sexual reproduction and population dynamics: the role of polygyny and demographic sex differences.
Lindström, J; Kokko, H
1998-01-01
Most models of population dynamics do not take sexual reproduction into account (i.e., they do not consider the role of males). However, assumptions behind this practice--that no demographic sex differences exist and males are always abundant enough to fertilize all the females--are usually not justified in natural populations. On the contrary, demographic sex differences are common, especially in polygynous species. Previous models that consider sexual reproduction report a stabilizing effect through mixing of different genotypes, thus suggesting a decrease in the propensity for complex of dynamics in sexually reproducing populations. Here we show that considering the direct role of males in reproduction and density dependence leads to the conclusion that a two-sex model is not necessarily more stable compared with the corresponding one-sex model. Although solutions exist where sexual reproduction has a stabilizing effect even when no genotypic variability is included (primarily when associated with monogamy), factors like polygyny, sex differences in survival or density dependence, and possible alterations of the primary sex ratio (the Trivers-Willard mechanism), may enlarge the parametric region of complex dynamics. Sexual reproduction therefore does not necessarily increase the stability of population dynamics and can have destabilizing effects, at least in species with complicated mating systems and sexual dimorphism. PMID:9606132
Evolutionary Origins of the Differences in Osteoporosis Risk in US Populations.
Nelson, Dorothy A
2018-03-23
Over the past 50 years, it has been increasingly evident that there are population differences in bone mass and the risk of osteoporosis. In the United States, many studies have reported a lower prevalence of osteoporosis in African Americans compared with people of European descent. If we trace the trajectory of changes in lifeways from the earliest migrations of early Homo out of Africa over the past two million years or so, to include lower vitamin D levels in higher latitudes; more meat in the diet; increasing sedentism; and a longer lifespan/longer postmenopausal period, it is not surprising that osteoporosis occurs more frequently in populations of European descent. While many scholars have explored the apparent "paradox" of higher bone mass, lower vitamin D levels, and higher parathyroid hormone levels among African Americans, this brief review of evolutionary shifts that affected our species may change the approach to understanding the current population differences in the United States. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.
Breen, Courtney; Shakeshaft, Anthony; Sanson-Fisher, Rob; D'Este, Catherine; Mattick, Richard P; Gilmour, Stuart
2014-02-01
To examine the extent to which individual- and community- level characteristics account for differences in risky alcohol consumption. A cross-sectional postal survey of 2,977 randomly selected individuals from 20 regional communities in NSW, Australia. Individuals drinking at harmful levels on the AUDIT and for risk of harm in the short term and long-term were identified. Multi-level modelling of the correlates of risky alcohol consumption at the individual and community level was conducted. There were differences between communities in alcohol consumption patterns. Being male, unmarried and reporting worse health were significant individual-level correlates for drinking at levels for risk of harm in the long term. The number of GPs (+) and police (-) were significant community characteristics. Being younger (≤25), unmarried, Australian born and with a larger income was associated with drinking at levels for risk of harm in the short term and harmful drinking on the AUDIT. The number of hotels and clubs was positively associated with drinking at levels for risk of harm in the short term. Rates of risky drinking vary significantly between communities and both individual and community characteristics are significantly associated with risky alcohol consumption. A combination of individual- and population-level interventions, tailored to the risk profile of individual communities, is most likely to be optimally effective. © 2014 The Authors. ANZJPH © 2014 Public Health Association of Australia.
Mooney, H A
1980-01-01
Plants of the widely distributed species Heliotropium curassavicum L. have a large photosynthetic acclimation potential to temperature. There are, however, some differences among the acclimation potentials of populations occupying dissimilar thermal regimes. Plants of populations originating from a cool maritime climate have a greater acclimation potential than plants of populations originating from a desert habitat, which is characterized by large seasonal changes in temperature.
Enzweiler, Kevin A; Bosso, John A; White, Roger L
2003-07-01
Formulary decisions regarding a given drug class are often made in the absence of patient outcome and/or sophisticated pharmacoeconomic data. Analyses that consider factors beyond simple acquisition costs may be useful in such situations. For example, the cost implications of using manufacturers' recommendations for dosing in patients with renal dysfunction may be important, depending on the distribution of various levels of renal function within a patient population. Using four 1000-patient populations representing different renal function distributions and a fifth population of our medical center's distribution, we determined the costs of therapy for intravenous and oral levofloxacin, gatifloxacin, and moxifloxacin for a 10-day course of therapy for community-acquired pneumonia. Costs considered were average wholesale prices (AWPs), 50% of AWP, or same daily price, plus intravenous dose preparation and administration costs when applicable. Costs for each renal function distribution were examined for significant differences with an analysis-of-variance test. Also, costs of failing to adjust dosing regimens for decreased renal function were determined. Differences in fluoroquinolone costs (AWP, 50% AWP, or when matched as the same daily price) among the populations were found. When considering same daily prices, differences among populations ranged from about 35,000 dollars with intravenous gatifloxacin to more than 51,000 dollars for intravenous levofloxacin (all fluoroquinolones, p>0.05). Within a population, differences in costs among the intravenous fluoroquinolones ranged from 47,000-99,000 dollars. Rank orders of the drugs and population costs of therapy were affected by the pricing structure used and varied by the specific population and drug. Differences among the fluoroquinolones or populations were much smaller (<2100 dollars) when considering oral regimens. Costs potentially incurred by failing to adjust dosing for renal function were substantial
Interarm blood pressure difference and target organ damage in the general population.
Johansson, Jouni K; Puukka, Pauli J; Jula, Antti M
2014-02-01
The objective of the study was to investigate interarm differences of blood pressure (BP) and its determinants, and to clarify whether both arms are equally good in assessing BP and target organ damage in the general population. We studied a representative sample of Finnish adult population with 484 study participants, ages 25-74 years. BP was measured twice by an oscillometric monitor simultaneously on both arms. Study participants underwent a clinical examination including measurements of serum lipids, glucose and indicators of target organ damage. BP was 2.3/0.2 mmHg higher on right than on left arm (P < 0.001/P = 0.15 for SBP/DBP differences). SBP and DBP measured on right and left arms correlated equally with left ventricular mass index (LVMI), interventricular septal thickness (IVST), posterior wall thickness (PWT), pulse wave velocity (PWV) and albuminuria. Higher SBP level was an independent determinant of both greater systolic and diastolic interarm BP difference. Exaggerated absolute diastolic interarm BP difference (>5 mmHg) was associated with higher BMI, arm circumference, LVMI, IVST and PWT, whereas exaggerated absolute systolic interarm BP difference (>10 mmHg) was not associated with any clinical variables. There was only a small difference in BP between arms in a healthy general population. Both arms are equally good determinants of target organ damage. BP should be measured at least once on both arms and prefer the arm with higher BP readings in the future BP measurements.
Andrews, Tessa M.; Shepard, Bradley B.; Litt, Andrea R.; Kruse, Carter G.; Zale, Alexander V.; Kalinowski, Steven T.
2013-01-01
Translocations are frequently used to increase the abundance and range of endangered fishes. One factor likely to affect the outcome of translocations is fish movement. We introduced embryos from five Westslope Cutthroat Trout Oncorhynchus clarkii lewisi populations (both hatchery and wild) at five different locations within a fishless watershed. We then examined the movement of age-1 and age-2 fish and looked for differences in movement distance among source populations and among introduction sites; we also examined the interactions among age, population, and introduction site. At age 1, most individuals (90.9%) remained within 1,000 m their introduction sites. By age 2, the majority of individuals (58.3%) still remained within 1,000 m of their introduction site, but considerably more individuals had moved downstream, some more than 6,000 m from their introduction site. We observed a significant interaction between age and source population (F 4, 1077 = 15.45, P 4, 1077 = 11.39, P < 0.0008), so we presented results in the context of these interactions. Within age-groups, we observed differences in movement behavior among source populations and among donor populations of Westslope Cutthroat Trout. We discuss these findings in light of previous research on juvenile salmonid movement.
Richards, Stephanie L; Agada, Nwanne; Balanay, Jo Anne G; White, Avian V
2018-02-01
Minimizing arthropod exposure (e.g. mosquito and tick bites) is vital to protect health of outdoor workers. Personal protective measures can help protect against exposure. Here, the quantity of permethrin was evaluated for different fabric types after washing. Cone and petri dish exposure assays were used to investigate the knockdown/mortality of permethrin-susceptible and permethrin-resistant populations of mosquitoes. Permethrin-treated clothing was effective against the tested mosquito population that was susceptible to permethrin but not a permethrin-resistant population. Permethrin quantity was significantly highest in the 100% cotton fabric and for the 0 wash group. Permethrin quantity in fabrics decreased with washing. No significant differences (p > 0.05) were observed in knockdown/mortality rates for either exposure method. The protective effect of permethrin-treated clothing against mosquitoes is impacted by many factors, e.g. wash frequency, fabric type, and the susceptibility/resistance status of local mosquito populations.
Cao, Jinjun; Li, Jie; Niu, Jianqun; Liu, Xiaoxia; Zhang, Qingwen
2012-04-01
The spiraea aphid (Aphis spiraecola Patch) is a primary pest of fruit trees, particularly pear trees in China. Despite the economic importance of this pest, little is known about its genetic structure or its patterns of dispersal at local and regional scales; however, knowledge of these characteristics is important for establishing effective control strategies for this pest. The genetic variability of 431 individuals from 21 populations on pear trees in China was investigated using eight polymorphic microsatellite loci. The high polymorphism of these markers was evident from the expected heterozygosity value (He = 0.824) and the Polymorphism Information Content (PIC = 0.805), indicating that the spiraea aphid maintains a high level of genetic diversity. The analysis of molecular variance revealed a middle level of population differentiation (F(ST) = 0.1478) among A. spiraecola populations. This result is consistent with the results of the STRUCTURE analysis (K = 3), the unweighted pair-group method with arithmetic average tree and the Mantel test (r = 0.6392; P < 0.05). Our results indicate high levels of genetic exchange in the spiraea aphid, possibly facilitated by geography and climate. Our findings emphasize the importance of considering regional differences in studies of population structure, even when strong isolation-by-distance influences the genetic population structure of species.
Kuo, Jane Z; Sheu, Wayne Huey-Herng; Assimes, Themistocles L; Hung, Yi-Jen; Absher, Devin; Chiu, Yen-Feng; Mak, Jordan; Wang, Jun-Sing; Kwon, Soonil; Hsu, Chih-Cheng; Goodarzi, Mark O; Lee, I-Te; Knowles, Joshua W; Miller, Brittany E; Lee, Wen-Jane; Juang, Jyh-Ming J; Wang, Tzung-Dau; Guo, Xiuqing; Taylor, Kent D; Chuang, Lee-Ming; Hsiung, Chao A; Quertermous, Thomas; Rotter, Jerome I; Chen, Yii-Der I
2013-12-01
Candidate gene and genome-wide association studies have identified ∼60 susceptibility loci for type 2 diabetes. A majority of these loci have been discovered and tested only in European populations. The aim of this study was to assess the presence and extent of trans-ethnic effects of these loci in an East Asian population. A total of 9,335 unrelated Chinese Han individuals, including 4,535 with type 2 diabetes and 4,800 non-diabetic ethnically matched controls, were genotyped using the Illumina 200K Metabochip. We tested 50 established loci for type 2 diabetes and related traits (fasting glucose, fasting insulin, 2 h glucose). Disease association with the additive model of inheritance was analysed with logistic regression. We found that 14 loci significantly transferred to the Chinese population, with two loci (p = 5.7 × 10(-12) for KCNQ1; p = 5.0 × 10(-8) for CDKN2A/B-CDKN2BAS) reaching independent genome-wide statistical significance. Five of these 14 loci had similar lead single-nucleotide polymorphisms (SNPs) as were found in the European studies while the other nine were different. Further stepwise conditional analysis identified a total of seven secondary signals and an independent novel locus at the 3' end of CDKAL1. These results suggest that many loci associated with type 2 diabetes are commonly shared between European and Chinese populations. Identification of population-specific SNPs may increase our understanding of the genetic architecture underlying type 2 diabetes in different ethnic populations.
Revilla, Pedro; Fernández, Victoria; Álvarez-Iglesias, Lorena; Medina, Eva T; Cavero, José
2016-10-01
In this study we evaluated the leaf surface properties of maize populations native to different water availability environments. Leaf surface topography, wettability and gas exchange performance of five maize populations from the Sahara desert, dry (south) and humid (north-western) areas of Spain were analysed. Differences in wettability, stomatal and trichome densities, surface free energy and solubility parameter values were recorded between populations and leaf sides. Leaves from the humid Spanish population with special regard to the abaxial side, were less wettable and less susceptible to polar interactions. The higher wettability and hydrophilicity of Sahara populations with emphasis on the abaxial leaf surfaces, may favour dew deposition and foliar water absorption, hence improving water use efficiency under extremely dry conditions. Compared to the other Saharan populations, the dwarf one had a higher photosynthesis rate suggesting that dwarfism may be a strategy for improving plant tolerance to arid conditions. The results obtained for different maize populations suggest that leaf surfaces may vary in response to drought, but further studies will be required to examine the potential relationship between leaf surface properties and plant stress tolerance. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Liang, Jingjing; Le, Thu H.; Edwards, Digna R. Velez; Tayo, Bamidele O.; Gaulton, Kyle J.; Lu, Yingchang; Jensen, Richard A.; Chen, Guanjie; Schwander, Karen; McKenzie, Colin A.; Fox, Ervin; Nalls, Michael A.; Young, J. Hunter; Lane, Jacqueline M.; Zhou, Jie; Tang, Hua; Fornage, Myriam; Musani, Solomon K.; Wang, Heming; Forrester, Terrence; Chu, Pei-Lun; Evans, Michele K.; Morrison, Alanna C.; Martin, Lisa W.; Wiggins, Kerri L.; Hui, Qin; Zhao, Wei; Jackson, Rebecca D.; Faul, Jessica D.; Reiner, Alex P.; Bray, Michael; Denny, Joshua C.; Mosley, Thomas H.; Palmas, Walter; Guo, Xiuqing; Polak, Joseph F.; Taylor, Ken D.; Boerwinkle, Eric; Bottinger, Erwin P.; Liu, Kiang; Risch, Neil; Hunt, Steven C.; Kooperberg, Charles; Zonderman, Alan B.; Becker, Diane M.; Cai, Jianwen; Loos, Ruth J. F.; Psaty, Bruce M.; Weir, David R.; Kardia, Sharon L. R.; Arnett, Donna K.; Won, Sungho; Edwards, Todd L.; Redline, Susan; Cooper, Richard S.; Rao, D. C.; Rotimi, Charles; Levy, Daniel; Chakravarti, Aravinda
2017-01-01
Hypertension is a leading cause of global disease, mortality, and disability. While individuals of African descent suffer a disproportionate burden of hypertension and its complications, they have been underrepresented in genetic studies. To identify novel susceptibility loci for blood pressure and hypertension in people of African ancestry, we performed both single and multiple-trait genome-wide association analyses. We analyzed 21 genome-wide association studies comprised of 31,968 individuals of African ancestry, and validated our results with additional 54,395 individuals from multi-ethnic studies. These analyses identified nine loci with eleven independent variants which reached genome-wide significance (P < 1.25×10−8) for either systolic and diastolic blood pressure, hypertension, or for combined traits. Single-trait analyses identified two loci (TARID/TCF21 and LLPH/TMBIM4) and multiple-trait analyses identified one novel locus (FRMD3) for blood pressure. At these three loci, as well as at GRP20/CDH17, associated variants had alleles common only in African-ancestry populations. Functional annotation showed enrichment for genes expressed in immune and kidney cells, as well as in heart and vascular cells/tissues. Experiments driven by these findings and using angiotensin-II induced hypertension in mice showed altered kidney mRNA expression of six genes, suggesting their potential role in hypertension. Our study provides new evidence for genes related to hypertension susceptibility, and the need to study African-ancestry populations in order to identify biologic factors contributing to hypertension. PMID:28498854
Drageset, Jorunn; Natvig, Gerd Karin; Eide, Geir Egil; Clipp, Elizabeth C; Bondevik, Margareth; Nortvedt, Monica W; Nygaard, Harald A
2008-05-01
To advance the understanding of health-related quality of life among older nursing home residents by assessing their health-related quality of life and comparing this with norms from the general population. The study used a two-group cross-sectional comparative design. The samples comprised 227 nursing home residents aged 65-102 years with at least six months' residence and a representative population sample of 1137 Norwegian citizens aged 65-102 years. All nursing home residents had a Clinical Dementia Rating Scale score > or =0.5 and were capable of conversing. The respondents provided demographic information and were surveyed using the SF-36 Health Survey. We used univariate and multivariate linear models to identify possible differences in health-related quality of life between the nursing home residents and the general population, controlled for age, sex, marital status and education. After adjustment for age, group, sex, marital status and education, the nursing home residents scored significantly higher on bodily pain and on physical and emotional role limitation and significantly lower on the other SF-36 subscales, except social functioning, with the largest differences for physical functioning (mean nursing home 23.2 and mean general population 62.9). The general population scores on all subscales generally increased with increasing education but not among the nursing home residents. The mean SF-36 scale scores differed markedly between the nursing home residents and the general population, with the nursing home residents generally scoring lower. The association with background variables known to be related to health-related quality of life differed between the groups. Healthcare professionals should increase attention to health-related quality of life among nursing home residents, periodically assess health-related quality of life and consider interventions that may improve health-related quality of life in older institutionalised populations. This study
Gupta, Sumit; Nathan, Paul C; Baxter, Nancy N; Lau, Cindy; Daly, Corinne; Pole, Jason D
2018-06-01
Despite the importance of estimating population level cancer outcomes, most registries do not collect critical events such as relapse. Attempts to use health administrative data to identify these events have focused on older adults and have been mostly unsuccessful. We developed and tested administrative data-based algorithms in a population-based cohort of adolescents and young adults with cancer. We identified all Ontario adolescents and young adults 15-21 years old diagnosed with leukemia, lymphoma, sarcoma, or testicular cancer between 1992-2012. Chart abstraction determined the end of initial treatment (EOIT) date and subsequent cancer-related events (progression, relapse, second cancer). Linkage to population-based administrative databases identified fee and procedure codes indicating cancer treatment or palliative care. Algorithms determining EOIT based on a time interval free of treatment-associated codes, and new cancer-related events based on billing codes, were compared with chart-abstracted data. The cohort comprised 1404 patients. Time periods free of treatment-associated codes did not validly identify EOIT dates; using subsequent codes to identify new cancer events was thus associated with low sensitivity (56.2%). However, using administrative data codes that occurred after the EOIT date based on chart abstraction, the first cancer-related event was identified with excellent validity (sensitivity, 87.0%; specificity, 93.3%; positive predictive value, 81.5%; negative predictive value, 95.5%). Although administrative data alone did not validly identify cancer-related events, administrative data in combination with chart collected EOIT dates was associated with excellent validity. The collection of EOIT dates by cancer registries would significantly expand the potential of administrative data linkage to assess cancer outcomes.
Wang, Hui; Liu, Tao; Qiu, Quan; Ding, Peng; He, Yan-Hui; Chen, Wei-Qing
2015-01-23
This study aimed to develop and validate a simple risk score for detecting individuals with impaired fasting glucose (IFG) among the Southern Chinese population. A sample of participants aged ≥20 years and without known diabetes from the 2006-2007 Guangzhou diabetes cross-sectional survey was used to develop separate risk scores for men and women. The participants completed a self-administered structured questionnaire and underwent simple clinical measurements. The risk scores were developed by multiple logistic regression analysis. External validation was performed based on three other studies: the 2007 Zhuhai rural population-based study, the 2008-2010 Guangzhou diabetes cross-sectional study and the 2007 Tibet population-based study. Performance of the scores was measured with the Hosmer-Lemeshow goodness-of-fit test and ROC c-statistic. Age, waist circumference, body mass index and family history of diabetes were included in the risk score for both men and women, with the additional factor of hypertension for men. The ROC c-statistic was 0.70 for both men and women in the derivation samples. Risk scores of ≥28 for men and ≥18 for women showed respective sensitivity, specificity, positive predictive value and negative predictive value of 56.6%, 71.7%, 13.0% and 96.0% for men and 68.7%, 60.2%, 11% and 96.0% for women in the derivation population. The scores performed comparably with the Zhuhai rural sample and the 2008-2010 Guangzhou urban samples but poorly in the Tibet sample. The performance of pre-existing USA, Shanghai, and Chengdu risk scores was poorer in our population than in their original study populations. The results suggest that the developed simple IFG risk scores can be generalized in Guangzhou city and nearby rural regions and may help primary health care workers to identify individuals with IFG in their practice.
Wang, Hui; Liu, Tao; Qiu, Quan; Ding, Peng; He, Yan-Hui; Chen, Wei-Qing
2015-01-01
This study aimed to develop and validate a simple risk score for detecting individuals with impaired fasting glucose (IFG) among the Southern Chinese population. A sample of participants aged ≥20 years and without known diabetes from the 2006–2007 Guangzhou diabetes cross-sectional survey was used to develop separate risk scores for men and women. The participants completed a self-administered structured questionnaire and underwent simple clinical measurements. The risk scores were developed by multiple logistic regression analysis. External validation was performed based on three other studies: the 2007 Zhuhai rural population-based study, the 2008–2010 Guangzhou diabetes cross-sectional study and the 2007 Tibet population-based study. Performance of the scores was measured with the Hosmer-Lemeshow goodness-of-fit test and ROC c-statistic. Age, waist circumference, body mass index and family history of diabetes were included in the risk score for both men and women, with the additional factor of hypertension for men. The ROC c-statistic was 0.70 for both men and women in the derivation samples. Risk scores of ≥28 for men and ≥18 for women showed respective sensitivity, specificity, positive predictive value and negative predictive value of 56.6%, 71.7%, 13.0% and 96.0% for men and 68.7%, 60.2%, 11% and 96.0% for women in the derivation population. The scores performed comparably with the Zhuhai rural sample and the 2008–2010 Guangzhou urban samples but poorly in the Tibet sample. The performance of pre-existing USA, Shanghai, and Chengdu risk scores was poorer in our population than in their original study populations. The results suggest that the developed simple IFG risk scores can be generalized in Guangzhou city and nearby rural regions and may help primary health care workers to identify individuals with IFG in their practice. PMID:25625405
Ali, Mohammad; Liu, Xuanyao; Pillai, Esakimuthu Nisha; Chen, Peng; Khor, Chiea-Chuen; Ong, Rick Twee-Hee; Teo, Yik-Ying
2014-07-22
India is home to many ethnically and linguistically diverse populations. It is hypothesized that history of invasions by people from Persia and Central Asia, who are referred as Aryans in Hindu Holy Scriptures, had a defining role in shaping the Indian population canvas. A shift in spoken languages from Dravidian languages to Indo-European languages around 1500 B.C. is central to the Aryan Invasion Theory. Here we investigate the genetic differences between two sub-populations of India consisting of: (1) The Indo-European language speaking Gujarati Indians with genome-wide data from the International HapMap Project; and (2) the Dravidian language speaking Tamil Indians with genome-wide data from the Singapore Genome Variation Project. We implemented three population genetics measures to identify genomic regions that are significantly differentiated between the two Indian populations originating from the north and south of India. These measures singled out genomic regions with: (i) SNPs exhibiting significant variation in allele frequencies in the two Indian populations; and (ii) differential signals of positive natural selection as quantified by the integrated haplotype score (iHS) and cross-population extended haplotype homozygosity (XP-EHH). One of the regions that emerged spans the SLC24A5 gene that has been functionally shown to affect skin pigmentation, with a higher degree of genetic sharing between Gujarati Indians and Europeans. Our finding points to a gene-flow from Europe to north India that provides an explanation for the lighter skin tones present in North Indians in comparison to South Indians.
Strength Training and Detraining in Different Populations: Case Studies
Marques, Mário C.; Zajac, Adam; Pereira, Ana; Costa, Aldo M.
2011-01-01
Many researchers have demonstrated that a specific strength training program can improve maximal strength and, the rate of force production, reduce the incidence of muscle-skeletal injury, and contribute to faster injury recovery times, thereby minimizing the number of missed practice sessions or competitions. Yet, to our best knowledge, there is no apparent consensus on the appropriate method of muscle strength and power training to enhance performance in distinct populations groups. Interruptions in training process because of illness, injury, holidays, post-season break or other factors are normal situations in any kind of sport. However, the detraining period and its consequences are not well reported in sports literature, and namely during puberty. Therefore, the aim of this paper was to discuss several case studies concerning different populations such us physical students, age-swimming competitors and elite power athletes. PMID:23487418
Polymorphic Alu Insertion/Deletion in Different Caste and Tribal Populations from South India.
Chinniah, Rathika; Vijayan, Murali; Thirunavukkarasu, Manikandan; Mani, Dhivakar; Raju, Kamaraj; Ravi, Padma Malini; Sivanadham, Ramgopal; C, Kandeepan; N, Mahalakshmi; Karuppiah, Balakrishnan
2016-01-01
Seven human-specific Alu markers were studied in 574 unrelated individuals from 10 endogamous groups and 2 hill tribes of Tamil Nadu and Kerala states. DNA was isolated, amplified by PCR-SSP, and subjected to agarose gel electrophoresis, and genotypes were assigned for various Alu loci. Average heterozygosity among caste populations was in the range of 0.292-0.468. Among tribes, the average heterozygosity was higher for Paliyan (0.3759) than for Kani (0.2915). Frequency differences were prominent in all loci studied except Alu CD4. For Alu CD4, the frequency was 0.0363 in Yadavas, a traditional pastoral and herd maintaining population, and 0.2439 in Narikuravars, a nomadic gypsy population. The overall genetic difference (Gst) of 12 populations (castes and tribes) studied was 3.6%, which corresponds to the Gst values of 3.6% recorded earlier for Western Asian populations. Thus, our study confirms the genetic similarities between West Asian populations and South Indian castes and tribes and supported the large scale coastal migrations from Africa into India through West Asia. However, the average genetic difference (Gst) of Kani and Paliyan tribes with other South Indian tribes studied earlier was 8.3%. The average Gst of combined South and North Indian Tribes (CSNIT) was 9.5%. Neighbor joining tree constructed showed close proximity of Kani and Paliyan tribal groups to the other two South Indian tribes, Toda and Irula of Nilgiri hills studied earlier. Further, the analysis revealed the affinities among populations and confirmed the presence of North and South India specific lineages. Our findings have documented the highly diverse (micro differentiated) nature of South Indian tribes, predominantly due to isolation, than the endogamous population groups of South India. Thus, our study firmly established the genetic relationship of South Indian castes and tribes and supported the proposed large scale ancestral migrations from Africa, particularly into South India
Polymorphic Alu Insertion/Deletion in Different Caste and Tribal Populations from South India
Chinniah, Rathika; Vijayan, Murali; Thirunavukkarasu, Manikandan; Mani, Dhivakar; Raju, Kamaraj; Ravi, Padma Malini; Sivanadham, Ramgopal; C, Kandeepan; N, Mahalakshmi; Karuppiah, Balakrishnan
2016-01-01
Seven human-specific Alu markers were studied in 574 unrelated individuals from 10 endogamous groups and 2 hill tribes of Tamil Nadu and Kerala states. DNA was isolated, amplified by PCR-SSP, and subjected to agarose gel electrophoresis, and genotypes were assigned for various Alu loci. Average heterozygosity among caste populations was in the range of 0.292–0.468. Among tribes, the average heterozygosity was higher for Paliyan (0.3759) than for Kani (0.2915). Frequency differences were prominent in all loci studied except Alu CD4. For Alu CD4, the frequency was 0.0363 in Yadavas, a traditional pastoral and herd maintaining population, and 0.2439 in Narikuravars, a nomadic gypsy population. The overall genetic difference (Gst) of 12 populations (castes and tribes) studied was 3.6%, which corresponds to the Gst values of 3.6% recorded earlier for Western Asian populations. Thus, our study confirms the genetic similarities between West Asian populations and South Indian castes and tribes and supported the large scale coastal migrations from Africa into India through West Asia. However, the average genetic difference (Gst) of Kani and Paliyan tribes with other South Indian tribes studied earlier was 8.3%. The average Gst of combined South and North Indian Tribes (CSNIT) was 9.5%. Neighbor joining tree constructed showed close proximity of Kani and Paliyan tribal groups to the other two South Indian tribes, Toda and Irula of Nilgiri hills studied earlier. Further, the analysis revealed the affinities among populations and confirmed the presence of North and South India specific lineages. Our findings have documented the highly diverse (micro differentiated) nature of South Indian tribes, predominantly due to isolation, than the endogamous population groups of South India. Thus, our study firmly established the genetic relationship of South Indian castes and tribes and supported the proposed large scale ancestral migrations from Africa, particularly into South India
Identifying Student Cultural Awareness and Perceptions of Different Cultures
ERIC Educational Resources Information Center
Rodriguez, Mary T.; Lamm, Alexa J.
2016-01-01
The population of the United States is growing and increasing in cultural diversity. Of the total U.S. population in 2010, 50.48 million were of Hispanic or Latino origin. Colleges and universities must prepare students to be successful in this diverse work place. Agricultural college students must know how to navigate diversity in order to adapt…
Bókony, Veronika; Kulcsár, Anna; Tóth, Zoltán; Liker, András
2012-01-01
Urbanization creates novel environments for wild animals where selection pressures may differ drastically from those in natural habitats. Adaptation to urban life involves changes in various traits, including behavior. Behavioral traits often vary consistently among individuals, and these so-called personality traits can be correlated with each other, forming behavioral syndromes. Despite their adaptive significance and potential to act as constraints, little is known about the role of animal personality and behavioral syndromes in animals' adaptation to urban habitats. In this study we tested whether differently urbanized habitats select for different personalities and behavioral syndromes by altering the population mean, inter-individual variability, and correlations of personality traits. We captured house sparrows (Passer domesticus) from four different populations along the gradient of urbanization and assessed their behavior in standardized test situations. We found individual consistency in neophobia, risk taking, and activity, constituting three personality axes. On the one hand, urbanization did not consistently affect the mean and variance of these traits, although there were significant differences between some of the populations in food neophobia and risk taking (both in means and variances). On the other hand, both urban and rural birds exhibited a behavioral syndrome including object neophobia, risk taking and activity, whereas food neophobia was part of the syndrome only in rural birds. These results indicate that there are population differences in certain aspects of personality in house sparrows, some of which may be related to habitat urbanization. Our findings suggest that urbanization and/or other population-level habitat differences may not only influence the expression of personality traits but also alter their inter-individual variability and the relationships among them, changing the structure of behavioral syndromes. PMID:22574204
Age accounts for racial differences in ischemic stroke volume in a population-based study.
Zakaria, Tarek; Lindsell, Christopher J; Kleindorfer, Dawn; Alwell, Kathleen; Moomaw, Charles J; Woo, Daniel; Szaflarski, Jerzy P; Khoury, Jane; Miller, Rosie; Broderick, Joseph P; Kissela, Brett
2008-01-01
The stroke volume among black ischemic stroke patients in phase I of the population-based Greater Cincinnati/Northern Kentucky Stroke Study (GCNKSS) was smaller than reported among acute stroke studies, with a median stroke volume of 2.5 cm. However, it is not known if stroke volume was similar between black and white patients within the same study population. Phase II of the GCNKSS identified all ischemic strokes between July 1993 and June 1994. The stroke volume was estimated by study physicians using the modified ellipsoid method. Analysis of stroke volume by race, sex and age was performed for strokes with a measurable lesion of >or=0.5 cm(3). Among verified cases of ischemic stroke, 334 patients were eligible for this analysis. There were 191 whites (57%) and 143 blacks (43%). The mean age was 69.4 years. The median stroke volume for all patients was 8.8 cm(3) (range 0.5-540), with a mean of 36.4 cm(3). Stroke volume was not different between men and women, and it tended to increase with age. Although stroke volume was significantly higher among whites, age was a confounding factor. Subsequent analysis of stroke volume stratified by age showed no difference between blacks and whites in any age group. Our data show that most ischemic stroke lesions, regardless of the race, are of small size, and this may be an important reason for the low percentage of strokes treated currently with tissue-type plasminogen activator. The association of age with stroke volume requires further study. Copyright 2008 S. Karger AG, Basel.
Malaquias, José B; Ramalho, Francisco S; Dos S Dias, Carlos T; Brugger, Bruno P; S Lira, Aline Cristina; Wilcken, Carlos F; Pachú, Jéssica K S; Zanuncio, José C
2017-02-09
The relationship between pests and natural enemies using multivariate analysis on cotton in different spacing has not been documented yet. Using multivariate approaches is possible to optimize strategies to control Aphis gossypii at different crop spacings because the possibility of a better use of the aphid sampling strategies as well as the conservation and release of its natural enemies. The aims of the study were (i) to characterize the temporal abundance data of aphids and its natural enemies using principal components, (ii) to analyze the degree of correlation between the insects and between groups of variables (pests and natural enemies), (iii) to identify the main natural enemies responsible for regulating A. gossypii populations, and (iv) to investigate the similarities in arthropod occurrence patterns at different spacings of cotton crops over two seasons. High correlations in the occurrence of Scymnus rubicundus with aphids are shown through principal component analysis and through the important role the species plays in canonical correlation analysis. Clustering the presence of apterous aphids matches the pattern verified for Chrysoperla externa at the three different spacings between rows. Our results indicate that S. rubicundus is the main candidate to regulate the aphid populations in all spacings studied.
NASA Astrophysics Data System (ADS)
Malaquias, José B.; Ramalho, Francisco S.; Dos S. Dias, Carlos T.; Brugger, Bruno P.; S. Lira, Aline Cristina; Wilcken, Carlos F.; Pachú, Jéssica K. S.; Zanuncio, José C.
2017-02-01
The relationship between pests and natural enemies using multivariate analysis on cotton in different spacing has not been documented yet. Using multivariate approaches is possible to optimize strategies to control Aphis gossypii at different crop spacings because the possibility of a better use of the aphid sampling strategies as well as the conservation and release of its natural enemies. The aims of the study were (i) to characterize the temporal abundance data of aphids and its natural enemies using principal components, (ii) to analyze the degree of correlation between the insects and between groups of variables (pests and natural enemies), (iii) to identify the main natural enemies responsible for regulating A. gossypii populations, and (iv) to investigate the similarities in arthropod occurrence patterns at different spacings of cotton crops over two seasons. High correlations in the occurrence of Scymnus rubicundus with aphids are shown through principal component analysis and through the important role the species plays in canonical correlation analysis. Clustering the presence of apterous aphids matches the pattern verified for Chrysoperla externa at the three different spacings between rows. Our results indicate that S. rubicundus is the main candidate to regulate the aphid populations in all spacings studied.
Gibbon, Sahra
2016-01-01
ABSTRACT In the past ten years, there has been an expansion of scientific interest in population genetics linked to both understanding histories of human migration and the way that population difference and diversity may account for and/or be implicated in health and disease. In this article, I examine how particular aspects of a globalizing research agenda related to population differences and genetic ancestry are taken up in locally variant ways in the nascent field of Brazilian cancer genetics. Drawing on a broad range of ethnographic data from clinical and nonclinical contexts in the south of Brazil, I examine the ambiguities that attention to genetic ancestry generates, so revealing the disjunctured and diverse ways a global research agenda increasingly orientated to questions of population difference and genetic ancestry is being used and reused. PMID:26452039
Identifying the ideal profile of French yogurts for different clusters of consumers.
Masson, M; Saint-Eve, A; Delarue, J; Blumenthal, D
2016-05-01
Identifying the sensory properties that affect consumer preferences for food products is an important feature of product development. Different methods, such as external preference mapping or partial least squares regression, are used to establish relationships between sensory data and consumer preferences and to identify sensory attributes that drive consumer preferences, by highlighting optimum products. Plain French yogurts were evaluated by a sensory profiling method performed by 12 trained judges. In parallel, 180 consumers were asked to score their overall liking and complete a cognitive restraint questionnaire. After hierarchical cluster analysis on the liking scores, preference mapping using a quadratic regression model was performed. Five clusters of consumers were identified as a function of different preference patterns. Contrary to our expectations, fat levels were not discriminating. For each cluster, the results of preference mapping enabled the identification of optimum products. A comparison of the 5 sensory profiles revealed numerous differences between key sensory attributes. For example, one consumer cluster had a strong preference for products perceived as very thick, grainy, but with a less flowing texture, less sticky, whey presence and color, in contrast to other clusters. In addition, each segment of consumers was characterized according to the results of the cognitive restraint questionnaire. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
De Kort, H; Vandepitte, K; Mergeay, J; Mijnsbrugge, K V; Honnay, O
2015-01-01
The evaluation of the molecular signatures of selection in species lacking an available closely related reference genome remains challenging, yet it may provide valuable fundamental insights into the capacity of populations to respond to environmental cues. We screened 25 native populations of the tree species Frangula alnus subsp. alnus (Rhamnaceae), covering three different geographical scales, for 183 annotated single-nucleotide polymorphisms (SNPs). Standard population genomic outlier screens were combined with individual-based and multivariate landscape genomic approaches to examine the strength of selection relative to neutral processes in shaping genomic variation, and to identify the main environmental agents driving selection. Our results demonstrate a more distinct signature of selection with increasing geographical distance, as indicated by the proportion of SNPs (i) showing exceptional patterns of genetic diversity and differentiation (outliers) and (ii) associated with climate. Both temperature and precipitation have an important role as selective agents in shaping adaptive genomic differentiation in F. alnus subsp. alnus, although their relative importance differed among spatial scales. At the ‘intermediate' and ‘regional' scales, where limited genetic clustering and high population diversity were observed, some indications of natural selection may suggest a major role for gene flow in safeguarding adaptability. High genetic diversity at loci under selection in particular, indicated considerable adaptive potential, which may nevertheless be compromised by the combined effects of climate change and habitat fragmentation. PMID:25944466
Mental health differences between German gay and bisexual men and population-based controls.
Sattler, Frank A; Franke, Gabriele H; Christiansen, Hanna
2017-07-21
International studies have revealed that gay and bisexual men present more mental health problems than the general male population. Furthermore, there is evidence that minority stress predicts mental health problems in gay and bisexual men. The aim of the present study is to provide initial data on mental health differences in Germany and to analyze the effect of minority stress. Mental health data on n = 1903 German gay and bisexual men and n = 958 men from a population-based sample were assessed using a shortened version of the SCL-90-S. The mental health of the two samples was compared. Furthermore, a linear regression was conducted for the gay and bisexual sample: mental health was used as the criterion and minority stressors as predictors. As compared to our population sample, gay and bisexual men demonstrated more mental health problems with a moderate effect size. In the regression, minority stress predicted mental health problems in the gay and bisexual sample. We observed pronounced mental health differences between gay and bisexual men versus the population sample. These differences could be at least partly due to the minority stress gay and bisexual men face. Research should focus on how to reduce and cope with minority stress.
Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.
Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav
2007-08-01
Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.
Specker, Bonny; Binkley, Teresa; Fahrenwald, Nancy
2004-12-01
Despite reports of lower fracture risk among rural versus urban populations, few studies have investigated rural versus urban differences in bone mineral content (BMC) and bone mineral density (BMD). Population differences in cross-sectional bone geometry and understanding lifestyle factors responsible for these differences may reveal insights into the reason for differences in fracture risk. We hypothesized that if lifestyle differences in bone mass, size, and geometry are a result of muscle strength, activity, or dietary differences, Hutterite and rural populations should have greater bone mass compared to nonrural populations. The study population consisted of 1189 individuals: 504 rural Hutterites (188 men), 349 rural individuals (>75% life farming, 184 men), and 336 nonrural individuals (never lived on farm, 134 men) aged 20 to 66 years. BMC, bone area, and areal BMD (aBMD) of the total body (TB), hip, femoral neck (FN), and spine by DXA; volumetric BMD (vBMD) and bone geometry at the 4% and 20% radius; polar stress strain index (pSSI), a measure of bone strength, at the 20% pQCT site; and strength, 7-day activity recall, and 24-h diet recall were collected and compared among groups. Hutterite women and men had greater grip strength compared to rural and nonrural populations (both, P <0.001). Rural women had greater activity versus Hutterite and nonrural (P <0.001), while both Hutterite and rural men had greater activity than nonrural (P <0.001). Hutterite and rural populations tended to have greater BMC and areal size than the nonrural population, while Hutterites had greater BMC and areal size than rural population at some (TB, FN for females only), but not all (proximal hip), sites. Cortical vBMD was inversely associated with periosteal circumference at the 20% radius in women (r=-0.25, P <0.001) and men (r=-0.28, P <0.001) and was higher in nonrural versus Hutterite and rural men. Hutterite and rural women and men had greater pSSI at the 20% radius
Al-Atiyat, R M; Aljumaah, R S
2014-08-27
This study aimed to estimate evolutionary distances and to reconstruct phylogeny trees between different Awassi sheep populations. Thirty-two sheep individuals from three different geographical areas of Jordan and the Kingdom of Saudi Arabia (KSA) were randomly sampled. DNA was extracted from the tissue samples and sequenced using the T7 promoter universal primer. Different phylogenetic trees were reconstructed from 0.64-kb DNA sequences using the MEGA software with the best general time reverse distance model. Three methods of distance estimation were then used. The maximum composite likelihood test was considered for reconstructing maximum likelihood, neighbor-joining and UPGMA trees. The maximum likelihood tree indicated three major clusters separated by cytosine (C) and thymine (T). The greatest distance was shown between the South sheep and North sheep. On the other hand, the KSA sheep as an outgroup showed shorter evolutionary distance to the North sheep population than to the others. The neighbor-joining and UPGMA trees showed quite reliable clusters of evolutionary differentiation of Jordan sheep populations from the Saudi population. The overall results support geographical information and ecological types of the sheep populations studied. Summing up, the resulting phylogeny trees may contribute to the limited information about the genetic relatedness and phylogeny of Awassi sheep in nearby Arab countries.
Unravelling the hidden ancestry of American admixed populations.
Montinaro, Francesco; Busby, George B J; Pascali, Vincenzo L; Myers, Simon; Hellenthal, Garrett; Capelli, Cristian
2015-03-24
The movement of people into the Americas has brought different populations into contact, and contemporary American genomes are the product of a range of complex admixture events. Here we apply a haplotype-based ancestry identification approach to a large set of genome-wide SNP data from a variety of American, European and African populations to determine the contributions of different ancestral populations to the Americas. Our results provide a fine-scale characterization of the source populations, identify a series of novel, previously unreported contributions from Africa and Europe and highlight geohistorical structure in the ancestry of American admixed populations.
Ivors, K; Garbelotto, M; Vries, I D E; Ruyter-Spira, C; Te Hekkert, B; Rosenzweig, N; Bonants, P
2006-05-01
Analysis of 12 polymorphic simple sequence repeats identified in the genome sequence of Phytophthora ramorum, causal agent of 'sudden oak death', revealed genotypic diversity to be significantly higher in nurseries (91% of total) than in forests (18% of total). Our analysis identified only two closely related genotypes in US forests, while the genetic structure of populations from European nurseries was of intermediate complexity, including multiple, closely related genotypes. Multilocus analysis determined populations in US forests reproduce clonally and are likely descendants of a single introduced individual. The 151 isolates analysed clustered in three clades. US forest and European nursery isolates clustered into two distinct clades, while one isolate from a US nursery belonged to a third novel clade. The combined microsatellite, sequencing and morphological analyses suggest the three clades represent distinct evolutionary lineages. All three clades were identified in some US nurseries, emphasizing the role of commercial plant trade in the movement of this pathogen.
Effect of registration on corpus callosum population differences found with DBM analysis
NASA Astrophysics Data System (ADS)
Han, Zhaoying; Thornton-Wells, Tricia A.; Gore, John C.; Dawant, Benoit M.
2011-03-01
Deformation Based Morphometry (DBM) is a relatively new method used for characterizing anatomical differences among populations. DBM is based on the analysis of the deformation fields generated by non-rigid registration algorithms, which warp the individual volumes to one standard coordinate system. Although several studies have compared non-rigid registration algorithms for segmentation tasks, few studies have compared the effect of the registration algorithm on population differences that may be uncovered through DBM. In this study, we compared DBM results obtained with five well established non-rigid registration algorithms on the corpus callosum (CC) in thirteen subjects with Williams Syndrome (WS) and thirteen Normal Control (NC) subjects. The five non-rigid registration algorithms include: (1) The Adaptive Basis Algorithm (ABA); (2) Image Registration Toolkit (IRTK); (3) FSL Nonlinear Image Registration Tool (FSL); (4) Automatic Registration Tools (ART); and (5) the normalization algorithm available in SPM8. For each algorithm, the 3D deformation fields from all subjects to the atlas were obtained and used to calculate the Jacobian determinant (JAC) at each voxel in the mid-sagittal slice of the CC. The mean JAC maps for each group were compared quantitatively across different nonrigid registration algorithms. An ANOVA test performed on the means of the JAC over the Genu and the Splenium ROIs shows the JAC differences between nonrigid registration algorithms are statistically significant over the Genu for both groups and over the Splenium for the NC group. These results suggest that it is important to consider the effect of registration when using DBM to compute morphological differences in populations.
The Study of Geographic Differences in the Prevalence of Disability among Taiwanese Population
ERIC Educational Resources Information Center
Lin, Jin-Ding; Li, Chien-De; Lin, Lan-Ping; Hsu, Shang-Wei
2012-01-01
The present study analyzes data of the governmental reported general population and population of persons with disabilities from 2002 to 2009, to describe the disability prevalence and to test the overtime change with particular focused on the geographic differences in Taiwan. In average, the disability prevalence was 42.06% (range = 31.06%-80.04%…
Cai, Lei; Chen, Tianlu; Yang, Jinglei; Zhou, Kejun; Yan, Xiaomei; Chen, Wenzhong; Sun, Liya; Li, Linlin; Qin, Shengying; Wang, Peng; Yang, Ping; Cui, Donghong; Burmeister, Margit; He, Lin; Jia, Wei; Wan, Chunling
2015-10-12
Little is known about the trace element profile differences between Schizophrenia patients and healthy controls; previous studies about the association of certain elements with Schizophrenia have obtained conflicting results. To identify these differences in the Han Chinese population, inductively coupled plasma-mass spectrometry was used to quantify the levels of 35 elements in the sera of 111 Schizophrenia patients and 110 healthy participants, which consisted of a training (61/61 for cases/controls included) and a test group including remaining participants. An orthogonal projection to latent structures model was constructed from the training group (R(2)Y = 0.465, Q(2)cum = 0.343) had a sensitivity of 76.0% and a specificity of 71.4% in the test group. Single element analysis indicated that the concentrations of cesium, zinc, and selenium were significantly reduced in patients with Schizophrenia in both the training and test groups. The meta-analysis including 522 cases and 360 controls supported that Zinc was significantly associated with Schizophrenia (standardized mean difference [SMD], -0.81; 95% confidence intervals [CI], -1.46 to -0.16, P = 0.01) in the random-effect model. Information theory analysis indicated that Zinc could play roles independently in Schizophrenia. These results suggest clear element profile differences between patients with Schizophrenia and healthy controls, and reduced Zn level is confirmed in the Schizophrenia patients.
McNamara, K B; Simmons, L W
2017-09-01
Group living can select for increased immunity, given the heightened risk of parasite transmission. Yet, it also may select for increased male reproductive investment, given the elevated risk of female multiple mating. Trade-offs between immunity and reproduction are well documented. Phenotypically, population density mediates both reproductive investment and immune function in the Indian meal moth, Plodia interpunctella. However, the evolutionary response of populations to these traits is unknown. We created two replicated populations of P. interpunctella, reared and mated for 14 generations under high or low population densities. These population densities cause plastic responses in immunity and reproduction: at higher numbers, both sexes invest more in one index of immunity [phenoloxidase (PO) activity] and males invest more in sperm. Interestingly, our data revealed divergence in PO and reproduction in a different direction to previously reported phenotypic responses. Males evolving at low population densities transferred more sperm, and both males and females displayed higher PO than individuals at high population densities. These positively correlated responses to selection suggest no apparent evolutionary trade-off between immunity and reproduction. We speculate that the reduced PO activity and sperm investment when evolving under high population density may be due to the reduced population fitness predicted under increased sexual conflict and/or to trade-offs between pre- and post-copulatory traits. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.
Nemat-Gorgani, Neda; Hilton, Hugo G; Henn, Brenna M; Lin, Meng; Gignoux, Christopher R; Myrick, Justin W; Werely, Cedric J; Granka, Julie M; Möller, Marlo; Hoal, Eileen G; Yawata, Makoto; Yawata, Nobuyo; Boelen, Lies; Asquith, Becca; Parham, Peter; Norman, Paul J
2018-04-15
The functions of human NK cells in defense against pathogens and placental development during reproduction are modulated by interactions of killer cell Ig-like receptors (KIRs) with HLA-A, -B and -C class I ligands. Both receptors and ligands are highly polymorphic and exhibit extensive differences between human populations. Indigenous to southern Africa are the KhoeSan, the most ancient group of modern human populations, who have highest genomic diversity worldwide. We studied two KhoeSan populations, the Nama pastoralists and the ≠Khomani San hunter-gatherers. Comprehensive next-generation sequence analysis of HLA-A , -B , and -C and all KIR genes identified 248 different KIR and 137 HLA class I , which assort into ∼200 haplotypes for each gene family. All 74 Nama and 78 ≠Khomani San studied have different genotypes. Numerous novel KIR alleles were identified, including three arising by intergenic recombination. On average, KhoeSan individuals have seven to eight pairs of interacting KIR and HLA class I ligands, the highest diversity and divergence of polymorphic NK cell receptors and ligands observed to date. In this context of high genetic diversity, both the Nama and the ≠Khomani San have an unusually conserved, centromeric KIR haplotype that has arisen to high frequency and is different in the two KhoeSan populations. Distinguishing these haplotypes are independent mutations in KIR2DL1 , which both prevent KIR2DL1 from functioning as an inhibitory receptor for C2 + HLA-C. The relatively high frequency of C2 + HLA-C in the Nama and the ≠Khomani San appears to have led to natural selection against strong inhibitory C2-specific KIR. Copyright © 2018 by The American Association of Immunologists, Inc.
Ross, Colleen M.; Pleydell, Eve J.; Muirhead, Richard W.
2012-01-01
Dairy cows have been identified as common carriers of Campylobacter jejuni, which causes many of the human gastroenteritis cases reported worldwide. To design on-farm management practices that control the human infection sourced from dairy cows, the first step is to acquire an understanding of the excretion patterns of the cow reservoir. We monitored the same 35 cows from two dairy farms for C. jejuni excretion fortnightly for up to 12 months. The objective was to examine the concentration of C. jejuni and assess the genetic relationship of the C. jejuni populations excreted by individual cows. Significant differences (P < 0.01) in C. jejuni fecal concentration were observed among the 35 cows, with median concentrations that varied by up to 3.6 log10 · g−1 feces. A total of 36 different genotypes were identified from the 514 positive samples by using enterobacterial repetitive intergenic consensus (ERIC)-PCR. Although 22 of these genotypes were excreted by more than one cow, the analysis of frequencies and distribution of the genotypes by model-based statistics revealed a high degree of individuality in the C. jejuni population in each cow. The observed variation in the frequency of excretion of a genotype among cows and the analysis by multilocus sequence typing (MLST) of these genotypes suggest that excretion of C. jejuni in high numbers is due to a successful adaptation of a particular genotype to a particular cow's gut environment, but that animal-related factors render some individual cows resistant to colonization by particular genotypes. The reasons for differences in C. jejuni colonization of animals warrant further investigation. PMID:22904055
Muttis, Evangelina; Balsalobre, Agustin; Chuchuy, Ailen; Mangudo, Carolina; Ciota, Alexander T; Kramer, Laura D; Micieli, María Victoria
2018-04-11
Aedes aegypti (L.) (Diptera: Culicidae) is a vector of many medically significant viruses in the Americas, including dengue virus, chikungunya virus, and Zika virus. Traits such as longevity, fecundity, and feeding behavior contribute to the ability of Ae. aegypti to serve as a vector of these pathogens. Both local environmental factors and population genetics could contribute to variability in these traits. We performed a comparative study of Ae. aegypti populations from four geographically and environmentally distinct collection sites in Argentina in which the cohorts from each population were held at temperature values simulating a daily cycle, with an average of 25°C in order to identify the influence of population on life-history traits. In addition, we performed the study of the same populations held at a daily temperature cycle similar to that of the surveyed areas. According to the results, Aguaray is the most outstanding population, showing features that are important to achieve high fitness. Whereas La Plata gathers features consistent with low fitness. Iguazu was outstanding in blood-feeding rate while Posadas's population showed intermediate values. Our results also demonstrate that climate change could differentially affect unique populations, and that these differences have implications for the capacity for Ae. aegypti to act as vectors for medically important arboviruses.
Waller, Lauren P; Hahn, Philip G; Maron, John L; Lekberg, Ylva
2018-02-01
Arbuscular mycorrhizal (AM) fungi can promote plant growth and reproduction, but other plant physiological traits or traits that provide defense against herbivores can also be affected by AM fungi. However, whether responses of different traits to AM fungi are correlated and whether these relationships vary among plants from different populations are unresolved. In a common garden experiment, we grew Asclepias speciosa plants from seed collected from populations found along an environmental gradient with and without AM fungi to assess whether the responses of six growth and defense traits to AM fungi are correlated. Although there was strong genetic differentiation in mean trait values among populations, AM fungi consistently increased expression of most growth and defense traits across all populations. Responses of biomass and root to shoot ratio to AM fungi were positively correlated, suggesting that plants that are more responsive to AM fungi allocated more biomass belowground. Responses of biomass and trichome density to AM fungi were negatively correlated, indicating a trade-off in responsiveness between a growth and defensive trait. Our results suggest that while there is substantial population differentiation in many traits of A. speciosa, populations respond similarly to AM fungi, and both positive and negative correlations among trait responses occur. © 2018 Botanical Society of America.
Sung, Ki-Chul; Reaven, Gerald; Kim, Sun
2014-07-01
The plasma concentration ratio of triglyceride (TG)/high-density lipoprotein cholesterol (HDL-C) has identified increased cardio-metabolic risk and outcome in European populations. The goal of this study was to see if this ratio would also have clinical utility in identifying cardio-metabolic risk in an East Asian population. Measurements of various cardio-metabolic risk factors, including coronary calcium scores, were available on 12,166 apparently healthy Korean adults. Approximately 25% of men and women with the highest TG/HDL-C ratios were classified as being at high cardio-metabolic risk, and their risk factor profiles compared to the remainder of the population, as well as to individuals with the metabolic syndrome (MetS). High cardio-metabolic risk (upper 25%) was defined as a TG/HDL-C ratio ≥3.5 (men) or ≥2.0 (women), and all cardio-metabolic risk factors measured, including coronary calcium scores, were significantly more adverse when compared to individuals beneath these cut-points. Although cardio-metabolic risk profiles appeared reasonably comparable in subjects identified by either a high TG/HDL-C or a diagnosis of MetS, use of the TG/HDL-C increased the numbers at high risk. Evidence that determination of the plasma TG/HDL-C concentration ratio provides a simple way to identify individual at increased cardio-metabolic risk has been extended to an East Asian population. The ability of an elevated TG/HDL-C ratio to accomplish this goal is comparable to that achieved using the more complicated MetS criteria. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Jackson, Bianca D; Walker, Neff; Heidkamp, Rebecca
2017-11-01
Background: The Lives Saved Tool (LiST) uses the poverty head-count ratio at $1.90/d as a proxy for food security to identify the percentage of the population with the potential to benefit from balanced energy supplementation and complementary feeding (CF) interventions, following the approach used for the Lancet 's 2008 series on Maternal and Child Undernutrition. Because much work has been done in the development of food security indicators, a re-evaluation of the use of this indicator was warranted. Objective: The aim was to re-evaluate the use of the poverty head-count ratio at $1.90/d as the food security proxy indicator in LiST. Methods: We carried out a desk review to identify available indicators of food security. We identified 3 indicators and compared them by using scatterplots, Spearman's correlations, and Bland-Altman plot analysis. We generated LiST projections to compare the modeled impact results with the use of the different indicators. Results: There are many food security indicators available, but only 3 additional indicators were identified with the data availability requirements to be used as the food security indicator in LiST. As expected, analyzed food security indicators were significantly positively correlated ( P < 0.001), but there was generally poor agreement between them. The disparity between the indicators also increases as the values of the indicators increase. Consequently, the choice of indicator can have a considerable effect on the impact of interventions modeled in LiST, especially in food-insecure contexts. Conclusions: There was no single indicator identified that is ideal for measuring the percentage of the population who is food insecure for LiST. Thus, LiST will use the food security indicators that were used in the meta-analyses that produced the effect estimates. These are the poverty head-count ratio at $1.90/d for CF interventions and the prevalence of a low body mass index in women of reproductive age for balanced
C.A. Eyre; M. Kozanitas; M. Garbelotto
2013-01-01
Limited information is available on how soil and leaf populations of the sudden oak death pathogen, Phytophthora ramorum, may differ in their response to changing weather conditions, and their corresponding role in initiating the next disease cycle after unfavorable weather conditions. We sampled and cultured from 425 trees in six sites, three...
Boldness in two perch populations - long-term differences and the effect of predation pressure.
Magnhagen, Carin; Hellström, Gustav; Borcherding, Jost; Heynen, Martina
2012-11-01
1. Populations of the same species often display different behaviours, for example, in their response to predators. The question is whether this difference is developed as part of a divergent selection caused by differences in predation pressure, or as a result of phenotypic responses to current environmental conditions. 2. Two populations of Eurasian perch were investigated over a time span of 6 years to see whether risk-taking behaviour in young-of-the-year perch were consistent across cohorts, or if behaviour varied over time with changes in predation regime. 3. Boldness was estimated in aquarium studies by looking at how the fish made trade-offs between foraging in a risky area and staying in shelter. Predation risk of each year and lake was estimated from fishing surveys, using an individual-based model calculating attack rates for cannibalistic perch. 4. The average boldness scores were consistently lower in perch from Fisksjön compared with those in Ängersjön, although the magnitude of the difference varied among years. Variance component analyses showed that differences between lakes in boldness scores only explained 12 per cent of the total variation. Differences between years were contributing at least similarly or more to the total variance, and the variation was higher in Fisksjön than in Ängersjön. 5. The observed risk-taking behaviour of young-of-the-year perch, compared across cohorts, was significantly correlated with the year-specific estimates of cannibalistic attack rates, with lower boldness scores in years with higher predation pressure. In Fisksjön, with significant changes over the years in population structure, the range of both predation risk and boldness scores was wider than in Ängersjön. 6. By following the two perch populations over several years, we have been able to show that the differences in risk-taking behaviour mainly are due to direct phenotypic responses to recent experience of predation risk. Long-term differences in
Chen, Qiuhong; Takada, Ritsuko; Noda, Chiyo; Kobayashi, Satoru; Takada, Shinji
2016-01-01
Accumulating evidence suggests that exosomes are heterogeneous in molecular composition and physical properties. Here we examined whether epithelial cells secrete a heterogeneous population of exosomes, and if that is the case, whether epithelial cell polarity affects release of different populations of exosomes, especially that of those carrying Wnt. Sucrose-density ultracentrifugation and molecular marker analysis revealed that different populations of exosomes or exosome-like vesicles were released from MDCK cells depending on the cell polarity. Wnt3a associated with these vesicles were detectable in culture media collected from both apical and basolateral sides of the cells. Basolaterally secreted Wnt3a were co-fractionated with a typical exosomal protein TSG101 in fractions having typical exosome densities. In contrast, most of apically secreted Wnt3a, as well as Wnt11, were co-fractionated with CD63 and Hsp70, which are also common to the most exosomes, but recovered in higher density fractions. Wnt3a exhibiting similar floatation behavior to the apically secreted ones were also detectable in the culture media of Wnt3a-expressing L and HEK293 cells. The lipidation of Wnt3a was required for its basolateral secretion in exosomes but was dispensable for the apical one. Thus, epithelial cells release Wnt via distinct populations of vesicles differing in secretion polarity and lipidation dependency. PMID:27765945
Ward, M.H.; Nuckols, J.R.; Weigel, S. J.; Cantor, K.P.; Miller, Roger S.
2000-01-01
Pesticides used in agriculture may cause adverse health effects among the population living near agricultural areas. However, identifying the populations most likely to be exposed is difficult. We conducted a feasibility study to determine whether satellite imagery could be used to reconstruct historical crop patterns. We used historical Farm Service Agency records as a source of ground reference data to classify a late summer 1984 satellite image into crop species in a three-county area in south central Nebraska. Residences from a population-based epidemiologic study of non-Hodgkin lymphoma were located on the crop maps using a geographic information system (GIS). Corn, soybeans, sorghum, and alfalfa were the major crops grown in the study area. Eighty-five percent of residences could be located, and of these 22% had one of the four major crops within 500 m of the residence, an intermediate distance for the range of drift effects from pesticides applied in agriculture. We determined the proximity of residences to specific crop species and calculated crop-specific probabilities of pesticide use based on available data. This feasibility study demonstrated that remote sensing data and historical records on crop location can be used to create historical crop maps. The crop pesticides that were likely to have been applied can be estimated when information about crop-specific pesticide use is available. Using a GIS, zones of potential exposure to agricultural pesticides and proximity measures can be determined for residences in a study.
A quantitative telomeric chromatin isolation protocol identifies different telomeric states
NASA Astrophysics Data System (ADS)
Grolimund, Larissa; Aeby, Eric; Hamelin, Romain; Armand, Florence; Chiappe, Diego; Moniatte, Marc; Lingner, Joachim
2013-11-01
Telomere composition changes during tumourigenesis, aging and in telomere syndromes in a poorly defined manner. Here we develop a quantitative telomeric chromatin isolation protocol (QTIP) for human cells, in which chromatin is cross-linked, immunopurified and analysed by mass spectrometry. QTIP involves stable isotope labelling by amino acids in cell culture (SILAC) to compare and identify quantitative differences in telomere protein composition of cells from various states. With QTIP, we specifically enrich telomeric DNA and all shelterin components. We validate the method characterizing changes at dysfunctional telomeres, and identify and validate known, as well as novel telomere-associated polypeptides including all THO subunits, SMCHD1 and LRIF1. We apply QTIP to long and short telomeres and detect increased density of SMCHD1 and LRIF1 and increased association of the shelterins TRF1, TIN2, TPP1 and POT1 with long telomeres. Our results validate QTIP to study telomeric states during normal development and in disease.
Hudson, Melissa M; Mulrooney, Daniel A; Bowers, Daniel C; Sklar, Charles A; Green, Daniel M; Donaldson, Sarah S; Oeffinger, Kevin C; Neglia, Joseph P; Meadows, Anna T; Robison, Leslie L
2009-05-10
Childhood cancer survivors often experience complications related to cancer and its treatment that may adversely affect quality of life and increase the risk of premature death. The purpose of this manuscript is to review how data derived from Childhood Cancer Survivor Study (CCSS) investigations have facilitated identification of childhood cancer survivor populations at high risk for specific organ toxicity and secondary carcinogenesis and how this has informed clinical screening practices. Articles previously published that used the resource of the CCSS to identify risk factors for specific organ toxicity and subsequent cancers were reviewed and results summarized. CCSS investigations have characterized specific groups to be at highest risk of morbidity related to endocrine and reproductive dysfunction, pulmonary toxicity, cerebrovascular injury, neurologic and neurosensory sequelae, and subsequent neoplasms. Factors influencing risk for specific outcomes related to the individual survivor (eg, sex, race/ethnicity, age at diagnosis, attained age), sociodemographic status (eg, education, household income, health insurance) and cancer history (eg, diagnosis, treatment, time from diagnosis) have been consistently identified. These CCSS investigations that clarify risk for treatment complications related to specific treatment modalities, cumulative dose exposures, and sociodemographic factors identify profiles of survivors at high risk for cancer-related morbidity who deserve heightened surveillance to optimize outcomes after treatment for childhood cancer.
Haptoglobin gene subtypes in three Brazilian population groups of different ethnicities
2009-01-01
Haptoglobin is a plasma hemoglobin-binding protein that limits iron loss during normal erythrocyte turnover and hemolysis, thereby preventing oxidative damage mediated by iron excess in the circulation. Haptoglobin polymorphism in humans, characterized by the Hp*1 and Hp *2 alleles, results in distinct phenotypes known as Hp1-1, Hp2-1 and Hp2-2, whose frequencies vary according to the ethnic origin of the population. The Hp*1 allele has two subtypes, Hp *1F and Hp *1S , that also vary in their frequencies among populations worldwide. In this work, we examined the distribution frequencies of haptoglobin subtypes in three Brazilian population groups of different ethnicities. The haptoglobin genotypes of Kayabi Amerindians (n = 56), Kalunga Afro-descendants (n = 70) and an urban population (n = 132) were determined by allele-specific PCR. The Hp*1F allele frequency was highest in Kalunga (29.3%) and lowest in Kayabi (2.6%). The Hp*1F/Hp*1S allele frequency ratios were 0.6, 1.0 and 0.26 for the Kayabi, Kalunga and urban populations, respectively. This variation was attributable largely to the Hp*1F allele. However, despite the large variation in Hp*1F frequencies, results of F ST (0.0291) indicated slight genetic differentiation among subpopulations of the general Brazilian population studied here. This is the first Brazilian report of variations in the Hp*1F and Hp*1S frequencies among non-Amerindian Brazilians. PMID:21637505
Haptoglobin gene subtypes in three Brazilian population groups of different ethnicities.
Miranda-Vilela, Ana L; Akimoto, Arthur K; Alves, Penha C Z; Hiragi, Cássia O; Penalva, Guilherme C; Oliveira, Silviene F; Grisolia, Cesar K; Klautau-Guimarães, Maria N
2009-07-01
Haptoglobin is a plasma hemoglobin-binding protein that limits iron loss during normal erythrocyte turnover and hemolysis, thereby preventing oxidative damage mediated by iron excess in the circulation. Haptoglobin polymorphism in humans, characterized by the Hp(*1) and Hp (*2) alleles, results in distinct phenotypes known as Hp1-1, Hp2-1 and Hp2-2, whose frequencies vary according to the ethnic origin of the population. The Hp(*1) allele has two subtypes, Hp (*1F) and Hp (*1S) , that also vary in their frequencies among populations worldwide. In this work, we examined the distribution frequencies of haptoglobin subtypes in three Brazilian population groups of different ethnicities. The haptoglobin genotypes of Kayabi Amerindians (n = 56), Kalunga Afro-descendants (n = 70) and an urban population (n = 132) were determined by allele-specific PCR. The Hp(*1F) allele frequency was highest in Kalunga (29.3%) and lowest in Kayabi (2.6%). The Hp(*1F)/Hp(*1S) allele frequency ratios were 0.6, 1.0 and 0.26 for the Kayabi, Kalunga and urban populations, respectively. This variation was attributable largely to the Hp(*1F) allele. However, despite the large variation in Hp(*1F) frequencies, results of F (ST) (0.0291) indicated slight genetic differentiation among subpopulations of the general Brazilian population studied here. This is the first Brazilian report of variations in the Hp(*1F) and Hp(*1S) frequencies among non-Amerindian Brazilians.
Regional differences, socio-demographics, and hidden population of HIV/AIDS in India.
Kumar, Rajeev; Suar, Damodar; Singh, Sanjay Kumar
2017-02-01
This study examines the prevalence of HIV/AIDS in different regions of India, their socio-demographic indicators, and the presence of hidden population infected with HIV. Secondary data analyzed were obtained from national and international agencies. Considering the prevalence of HIV/AIDS in India, the low-prevalence regions in the last decade have shown a steady increase in recent years. Productive age, urbanization, male gender, lower level of education, minority religions, low income, and mobile occupations are associated with HIV pandemic. The hidden population vulnerable to HIV/AIDS are: street children, homeless population, and refugees. These observations can help map the high-risk behavior groups and formulate targeted strategies to curb the HIV menace.
Andrews, Tessa M.; Shepard, Bradley B.; Litt, Andrea R.; Kruse, Carter G.; Zale, Alexander V.; Kalinowski, Steven T.
2013-01-01
Translocations are frequently used to increase the abundance and range of endangered fishes. One factor likely to affect the outcome of translocations is fish movement. We introduced embryos from five Westslope Cutthroat Trout Oncorhynchus clarkii lewisipopulations (both hatchery and wild) at five different locations within a fishless watershed. We then examined the movement of age-1 and age-2 fish and looked for differences in movement distance among source populations and among introduction sites; we also examined the interactions among age, population, and introduction site. At age 1, most individuals (90.9%) remained within 1,000 m their introduction sites. By age 2, the majority of individuals (58.3%) still remained within 1,000 m of their introduction site, but considerably more individuals had moved downstream, some more than 6,000 m from their introduction site. We observed a significant interaction between age and source population (F 4, 1077 = 15.45, P < 0.0001) as well as between age and introduction site (F 41, 1077 = 11.39, P < 0.0008), so we presented results in the context of these interactions. Within age-groups, we observed differences in movement behavior among source populations and among donor populations of Westslope Cutthroat Trout. We discuss these findings in light of previous research on juvenile salmonid movement.
Martínez-Ibarra, José A; Nogueda-Torres, Benjamin; Salazar-Schettino, Paz M; Vences-Blanco, Mauro O; de la Torre-Álvarez, Felipe J; Montañez-Valdez, Oziel D
2014-03-01
Meccus pallidipennis is one of the most epidemiologically important vectors of Trypanosoma cruzi to reservoir hosts in nine states of Mexico. Triatomines occurring in distinct locations normally adapt to local conditions. The aim of this study was to examine the biological attributes of three populations of M. pallidipennis from areas with different environmental characteristics as a factor influencing the triatomine capacity for T. cruzi transmission. The values of biological parameters related to the life cycle, the number of blood meals to molt to next instar, fecundity and percentage of females after a biological cycle of three populations of M. pallidipennis were evaluated. A cohort of each of the three studied populations from different geographical areas of Mexico was maintained under similar laboratory conditions and then compared with each other. The life cycle was less than six months in all the studied cohorts, with differences among them. The number of blood meals to molt was lower for the cohort from Izϊcar de Matamoros. Laid eggs per day per female was lower for the cohort from Luvianos. In contrast, no important differences were recorded on the percentage of mortality, egg eclosion rate or percentages of obtained females. It was found that an important level of heterogeneity exist between the three studied populations of M. pallidipennis, apparently influenced by the remarkable differences on environmental conditions on the localities where the founders were initially collected, that emphasizes the necessity of studies on local populations of triatomines.
Silva, M H; Nascimento, M D S B; Leonardo, F S; Rebêlo, J M M; Pereira, S R F
2011-01-01
Entomological surveys in the state of Maranhão have recorded morphologically distinct populations of Lutzomyia longipalpis (Lutz & Neiva). Some populations have one pair of spots (1S) on the fourth tergite, while others have two pairs (2S) on the third and fourth tergites of males. In the present study we investigated the degree of genetic polymorphism among four populations in the municipalities of Caxias, Codó and Raposa, in the state of Maranhão, Brazil, by using RAPD (Random Amplified Polymorphic DNA) markers. A total of 35 loci were identified, of which 30 were polymorphic. The highest polymorphism was observed with primer OPA 4, which produced 11 different profiles. Genetic diversity was assessed using grouping methods that produced a dendrogram in which the genotypes could be clearly separated into two main clades according to the number of spots on the male abdominal tergites. One cluster contained the populations from Caxias and Codó, and the other was formed by the populations from Raposa and Codó. The results of our RAPD analysis showed a clear separation between the populations with one and two pairs of spots. The epidemiologic significance of this genetic differentiation should be investigated in future studies.
Aragam, Nagesh; Wang, Ke-Sheng; Pan, Yue
2011-10-01
Major depressive disorder (MDD) is a universally prevalent, genetic, and environment dependent mental condition that disables people of every culture, race, gender, and age. While the gender differences for MDD have been widely reported in literature, few genome-wide analyses of gender differences have been reported to date. We conducted a genome-wide association analysis of gender differences for MDD using the Netherlands NESDA and NTR population-based samples (1726 cases and 1630 controls). PLINK software was used to analyze the genome-wide association data of Perlegen 600 K SNP Chips. We identified 40 male-specific and 56 female-specific MDD associated SNPs with P-values less than 10(-4). The best male-specific SNP was rs9352774 (P=2.26 × 10(-6)) within LGSN gene while the best female-specific SNP was rs2715148 (P=5.64 × 10(-7)) within PCLO gene. We also found 38 SNPs showing gene × gender interactions in influencing MDD (P<10(-4)). The best SNP was rs12692709 (P=5.75 × 10(-6)) near FIGN gene at 2q24.3 while the next best SNP was rs11039588 (P=1.16 × 10(-5)) within OR4B1 gene. The findings from this study need be replicated in other populations. These results provide genetic basis for gender differences in MDD and will serve as a resource for replication in other populations to elucidate the potential role of these genetic variants in MDD. Copyright © 2011 Elsevier B.V. All rights reserved.
Population trends in Vermivora warblers are linked to strong migratory connectivity
Kramer, Gunnar R.; Andersen, David; Buehler, David A.; Wood, Petra B.; Peterson, Sean M.; Lehman, Justin A.; Aldinger, Kyle R.; Bulluck, Lesley P.; Harding, Sergio R.; Jones, John A.; Loegering, John P.; Smalling, Curtis G.; Vallender, Rachel; Streby, Henry M.
2018-01-01
Migratory species can experience limiting factors at different locations and during different periods of their annual cycle. In migratory birds, these factors may even occur in different hemispheres. Therefore, identifying the distribution of populations throughout their annual cycle (i.e., migratory connectivity) can reveal the complex ecological and evolutionary relationships that link species and ecosystems across the globe and illuminate where and how limiting factors influence population trends. A growing body of literature continues to identify species that exhibit weak connectivity wherein individuals from distinct breeding areas co-occur during the nonbreeding period. A detailed account of a broadly distributed species exhibiting strong migratory connectivity in which nonbreeding isolation of populations is associated with differential population trends remains undescribed. Here, we present a range-wide assessment of the nonbreeding distribution and migratory connectivity of two broadly dispersed Nearctic-Neotropical migratory songbirds. We used geolocators to track the movements of 70 Vermivora warblers from sites spanning their breeding distribution in eastern North America and identified links between breeding populations and nonbreeding areas. Unlike blue-winged warblers (Vermivora cyanoptera), breeding populations of golden-winged warblers (Vermivora chrysoptera) exhibited strong migratory connectivity, which was associated with historical trends in breeding populations: stable for populations that winter in Central America and declining for those that winter in northern South America.
Malaquias, José B.; Ramalho, Francisco S.; dos S. Dias, Carlos T.; Brugger, Bruno P.; S. Lira, Aline Cristina; Wilcken, Carlos F.; Pachú, Jéssica K. S.; Zanuncio, José C.
2017-01-01
The relationship between pests and natural enemies using multivariate analysis on cotton in different spacing has not been documented yet. Using multivariate approaches is possible to optimize strategies to control Aphis gossypii at different crop spacings because the possibility of a better use of the aphid sampling strategies as well as the conservation and release of its natural enemies. The aims of the study were (i) to characterize the temporal abundance data of aphids and its natural enemies using principal components, (ii) to analyze the degree of correlation between the insects and between groups of variables (pests and natural enemies), (iii) to identify the main natural enemies responsible for regulating A. gossypii populations, and (iv) to investigate the similarities in arthropod occurrence patterns at different spacings of cotton crops over two seasons. High correlations in the occurrence of Scymnus rubicundus with aphids are shown through principal component analysis and through the important role the species plays in canonical correlation analysis. Clustering the presence of apterous aphids matches the pattern verified for Chrysoperla externa at the three different spacings between rows. Our results indicate that S. rubicundus is the main candidate to regulate the aphid populations in all spacings studied. PMID:28181503
Differences in Acute Alcohol-Induced Behavioral Responses Among Zebrafish Populations
Gerlai, Robert; Ahmad, Fahad; Prajapati, Sonal
2009-01-01
Background With the arsenal of genetic tools available for zebrafish, this species has been successfully used to investigate the genetic aspects of human diseases from developmental disorders to cancer. Interest in the behavior and brain function of zebrafish is also increasing as CNS disorders may be modeled and studied with this species. Alcoholism and alcohol abuse are among the most devastating and costliest diseases. However, the mechanisms of these diseases are not fully understood. Zebrafish has been proposed as a model organism to study such mechanisms. Characterization of alcohol’s effects on zebrafish is a necessary step in this research. Methods Here, we compare the effects of acute alcohol (EtOH) administration on the behavior of zebrafish from 4 distinct laboratory-bred populations using automated as well as observation based behavioral quantification methods. Results Alcohol treatment resulted in significant dose-dependent behavioral changes but the dose–response trajectories differed among zebrafish populations. Conclusions The results demonstrate for the first time a genetic component in alcohol responses in adult zebrafish and also show the feasibility of high throughput behavioral screening. We discuss the exploration and exploitation of the genetic differences found. PMID:18652595
Automatic Conceptual Encoding of Printed Verbal Material: Assessment of Population Differences.
ERIC Educational Resources Information Center
Kee, Daniel W.; And Others
1984-01-01
The release from proactive interference task as used to investigate categorical encoding of items. Low socioeconomic status Black and middle socioeconomic status White children were compared. Conceptual encoding differences between these populations were not detected in automatic conceptual encoding but were detected when the free recall method…
Wen, Wanqing; Zheng, Wei; Okada, Yukinori; Takeuchi, Fumihiko; Tabara, Yasuharu; Hwang, Joo-Yeon; Dorajoo, Rajkumar; Li, Huaixing; Tsai, Fuu-Jen; Yang, Xiaobo; He, Jiang; Wu, Ying; He, Meian; Zhang, Yi; Liang, Jun; Guo, Xiuqing; Sheu, Wayne Huey-Herng; Delahanty, Ryan; Guo, Xingyi; Kubo, Michiaki; Yamamoto, Ken; Ohkubo, Takayoshi; Go, Min Jin; Liu, Jian Jun; Gan, Wei; Chen, Ching-Chu; Gao, Yong; Li, Shengxu; Lee, Nanette R.; Wu, Chen; Zhou, Xueya; Song, Huaidong; Yao, Jie; Lee, I-Te; Long, Jirong; Tsunoda, Tatsuhiko; Akiyama, Koichi; Takashima, Naoyuki; Cho, Yoon Shin; Ong, Rick TH; Lu, Ling; Chen, Chien-Hsiun; Tan, Aihua; Rice, Treva K; Adair, Linda S.; Gui, Lixuan; Allison, Matthew; Lee, Wen-Jane; Cai, Qiuyin; Isomura, Minoru; Umemura, Satoshi; Kim, Young Jin; Seielstad, Mark; Hixson, James; Xiang, Yong-Bing; Isono, Masato; Kim, Bong-Jo; Sim, Xueling; Lu, Wei; Nabika, Toru; Lee, Juyoung; Lim, Wei-Yen; Gao, Yu-Tang; Takayanagi, Ryoichi; Kang, Dae-Hee; Wong, Tien Yin; Hsiung, Chao Agnes; Wu, I-Chien; Juang, Jyh-Ming Jimmy; Shi, Jiajun; Choi, Bo Youl; Aung, Tin; Hu, Frank; Kim, Mi Kyung; Lim, Wei Yen; Wang, Tzung-Dao; Shin, Min-Ho; Lee, Jeannette; Ji, Bu-Tian; Lee, Young-Hoon; Young, Terri L.; Shin, Dong Hoon; Chun, Byung-Yeol; Cho, Myeong-Chan; Han, Bok-Ghee; Hwu, Chii-Min; Assimes, Themistocles L.; Absher, Devin; Yan, Xiaofei; Kim, Eric; Kuo, Jane Z.; Kwon, Soonil; Taylor, Kent D.; Chen, Yii-Der I.; Rotter, Jerome I.; Qi, Lu; Zhu, Dingliang; Wu, Tangchun; Mohlke, Karen L.; Gu, Dongfeng; Mo, Zengnan; Wu, Jer-Yuarn; Lin, Xu; Miki, Tetsuro; Tai, E. Shyong; Lee, Jong-Young; Kato, Norihiro; Shu, Xiao-Ou; Tanaka, Toshihiro
2014-01-01
Recent genetic association studies have identified 55 genetic loci associated with obesity or body mass index (BMI). The vast majority, 51 loci, however, were identified in European-ancestry populations. We conducted a meta-analysis of associations between BMI and ∼2.5 million genotyped or imputed single nucleotide polymorphisms among 86 757 individuals of Asian ancestry, followed by in silico and de novo replication among 7488–47 352 additional Asian-ancestry individuals. We identified four novel BMI-associated loci near the KCNQ1 (rs2237892, P = 9.29 × 10−13), ALDH2/MYL2 (rs671, P = 3.40 × 10−11; rs12229654, P = 4.56 × 10−9), ITIH4 (rs2535633, P = 1.77 × 10−10) and NT5C2 (rs11191580, P = 3.83 × 10−8) genes. The association of BMI with rs2237892, rs671 and rs12229654 was significantly stronger among men than among women. Of the 51 BMI-associated loci initially identified in European-ancestry populations, we confirmed eight loci at the genome-wide significance level (P < 5.0 × 10−8) and an additional 14 at P < 1.0 × 10−3 with the same direction of effect as reported previously. Findings from this analysis expand our knowledge of the genetic basis of obesity. PMID:24861553
NASA Astrophysics Data System (ADS)
Bi, R.; Liu, H.
2016-02-01
Understanding how biological components respond to environmental changes could be insightful to predict ecosystem trajectories under different climate scenarios. Zooplankton are key components of marine ecosystems and changes in their dynamics could have major impact on ecosystem structure. We developed an individual-based model of a common coastal calanoid copepod Acartia tonsa to examine how environmental factors affect zooplankton population dynamics and explore the role of individual variability in sustaining population under various environmental conditions consisting of temperature, food concentration and salinity. Total abundance, egg production and proportion of survival were used to measure population success. Results suggested population benefits from high level of individual variability under extreme environmental conditions including unfavorable temperature, salinity, as well as low food concentration, and selection on fast-growers becomes stronger with increasing individual variability and increasing environmental stress. Multiple regression analysis showed that temperature, food concentration, salinity and individual variability have significant effects on survival of A. tonsa population. These results suggest that environmental factors have great influence on zooplankton population, and individual variability has important implications for population survivability under unfavorable conditions. Given that marine ecosystems are at risk from drastic environmental changes, understanding how individual variability sustains populations could increase our capability to predict population dynamics in a changing environment.
Identifying the Culturally Different Gifted Student.
ERIC Educational Resources Information Center
Chambers, Jack A.; Barron, Frank
The study was designed to provide a relatively simple method of identifying gifted Mexican-American elementary school children, using as Ss approximately 298 Mexican-Americans (in grades 3-6) from both urban and rural schools. Ss were rated by present and former teachers on traits found to be characteristic of highly creative and talented…
Zhang, Qinbin; Wang, Long; Zhang, Xiaoxiang; Song, Guiliang; Fu, Zhiyuan; Ding, Dong; Liu, Zonghua; Tang, Jihua
2014-01-01
To investigate the genetic mechanism of mercury accumulation in maize (Zea mays L.), a population of 194 recombinant inbred lines derived from an elite hybrid Yuyu 22, was used to identify quantitative trait loci (QTLs) for mercury accumulation at two locations. The results showed that the average Hg concentration in the different tissues of maize followed the order: leaves > bracts > stems > axis > kernels. Twenty-three QTLs for mercury accumulation in five tissues were detected on chromosomes 1, 4, 7, 8, 9 and 10, which explained 6.44% to 26.60% of the phenotype variance. The QTLs included five QTLs for Hg concentration in kernels, three QTLs for Hg concentration in the axis, six QTLs for Hg concentration in stems, four QTLs for Hg concentration in bracts and five QTLs for Hg concentration in leaves. Interestingly, three QTLs, qKHC9a, qKHC9b, and qBHC9 were in linkage with two QTLs for drought tolerance. In addition, qLHC1 was in linkage with two QTLs for arsenic accumulation. The study demonstrated the concentration of Hg in Hg-contaminated paddy soil could be reduced, and maize production maintained simultaneously by selecting and breeding maize Hg pollution-safe cultivars (PSCs). PMID:25210737
Identifying the metabolic differences of a fast-growth phenotype in Synechococcus UTEX 2973
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mueller, Thomas J.; Ungerer, Justin L.; Pakrasi, Himadri B.
The photosynthetic capabilities of cyanobacteria make them interesting candidates for industrial bioproduction. One obstacle to large-scale implementation of cyanobacteria is their limited growth rates as compared to industrial mainstays. Synechococcus UTEX 2973, a strain closely related to Synechococcus PCC 7942, was recently identified as having the fastest measured growth rate among cyanobacteria. To facilitate the development of 2973 as a model organism we developed in this study the genome-scale metabolic model iSyu683. Experimental data were used to define CO 2 uptake rates as well as the biomass compositions for each strain. The inclusion of constraints based on experimental measurements ofmore » CO 2 uptake resulted in a ratio of the growth rates of Synechococcus 2973 to Synechococcus 7942 of 2.03, which nearly recapitulates the in vivo growth rate ratio of 2.13. This identified the difference in carbon uptake rate as the main factor contributing to the divergent growth rates. Additionally four SNPs were identified as possible contributors to modified kinetic parameters of metabolic enzymes and candidates for further study. As a result, comparisons against more established cyanobacterial strains identified a number of differences between the strains along with a correlation between the number of cytochrome c oxidase operons and heterotrophic or diazotrophic capabilities.« less
Identifying the metabolic differences of a fast-growth phenotype in Synechococcus UTEX 2973
Mueller, Thomas J.; Ungerer, Justin L.; Pakrasi, Himadri B.; ...
2017-01-31
The photosynthetic capabilities of cyanobacteria make them interesting candidates for industrial bioproduction. One obstacle to large-scale implementation of cyanobacteria is their limited growth rates as compared to industrial mainstays. Synechococcus UTEX 2973, a strain closely related to Synechococcus PCC 7942, was recently identified as having the fastest measured growth rate among cyanobacteria. To facilitate the development of 2973 as a model organism we developed in this study the genome-scale metabolic model iSyu683. Experimental data were used to define CO 2 uptake rates as well as the biomass compositions for each strain. The inclusion of constraints based on experimental measurements ofmore » CO 2 uptake resulted in a ratio of the growth rates of Synechococcus 2973 to Synechococcus 7942 of 2.03, which nearly recapitulates the in vivo growth rate ratio of 2.13. This identified the difference in carbon uptake rate as the main factor contributing to the divergent growth rates. Additionally four SNPs were identified as possible contributors to modified kinetic parameters of metabolic enzymes and candidates for further study. As a result, comparisons against more established cyanobacterial strains identified a number of differences between the strains along with a correlation between the number of cytochrome c oxidase operons and heterotrophic or diazotrophic capabilities.« less
Baeta, Miriam; Núñez, Carolina; Cardoso, Sergio; Palencia-Madrid, Leire; Piñeiro-Hermida, Sergio; Arriba-Barredo, Miren; Villanueva-Millán, María Jesús; M de Pancorbo, Marian
2015-01-01
The Basque Diaspora in Western USA and Argentina represents two populations which have maintained strong Basque cultural and social roots in a completely different geographic context. Hence, they provide an exceptional opportunity to study the maternal genetic legacy from the ancestral Basque population and assess the degree of genetic introgression from the host populations in two of the largest Basque communities outside the Basque Country. For this purpose, we analyzed the complete mitochondrial DNA control region of Basque descendants living in Western USA (n = 175) and in Argentina (n = 194). The Diaspora populations studied here displayed a genetic diversity in their European maternal input which was similar to that of the Basque source populations, indicating that not important founder effects would have occurred. Actually, the genetic legacy of the Basque population still prevailed in their present-day maternal pools, by means of a haplogroup distribution similar to the source population characterized by the presence of autochthonous Basque lineages, such as U5b1f1a and J1c5c1. However, introgression of non-Basque lineages, mostly Native American, has been observed in the Diaspora populations, particularly in Argentina, where the quick assimilation of the newcomers would have favored a wider admixture with host populations. In contrast, a longer isolation of the Diaspora groups in USA, because of language and cultural differences, would have limited the introgression of local lineages. This study reveals important differences in the maternal evolutionary histories of these Basque Diaspora populations, which have to be taken into consideration in forensic and medical genetic studies.
De Winter, Gunnar; Martins, Henrique Ramalho; Trovo, Rafael Arnoni; Chapman, Ben B
2016-01-01
Behavioural variation among individuals has received a lot of attention by behavioural ecologists in the past few years. Its causes and consequences are becoming vast areas of research. The origin and maintenance of individual variation in behaviour within and among populations is affected by many facets of the biotic and abiotic environment. Here, two populations of lab-reared juvenile three-spined sticklebacks (Gasterosteus aculeatus) are tested for three behaviours (boldness, exploration, and sociability). Given the identical rearing conditions, the only difference between these populations is the parental habitat. In both populations, correlations between behaviour and body length are found. Interestingly, these differ between the populations. In one population body length was negatively correlated with exploratory behaviour, while in the other one body length correlated negatively with sociability. Considering the identical environment these juvenile fish were exposed to, these findings suggest a potential (epi)genetic foundation for these correlations and shows that, in three-spined sticklebacks, the proximate basis for correlations between body length and behaviour appears quite malleable. Copyright © 2015 Elsevier B.V. All rights reserved.
McCullumsmith, Cheryl B; Clark, C Brendan; Perkins, Adam; Fife, Jessaka; Cropsey, Karen L
2013-01-01
Community corrections populations are a high-risk group who carry multiple suicide risk factors. To identify factors correlated with historical suicide attempts and ideation among African-American men, African-American women, White men, and White women in a community corrections population. Self-report data from 18,753 enrollees in community corrections were analyzed. Multinomial logistic regression analyses were conducted to determine associations between historical suicidal ideation and attempts among the four demographic groups. Participants with historical suicide attempts tended to be younger, White, female, be taking psychotropic medication, have a history of physical or sexual abuse, and meet criteria for dependence on alcohol, amphetamines, cocaine, opioids, or sedatives. Five variables were commonly associated with suicide attempts for all four race/gender groups: younger age, being on disability or retirement, taking psychotropic medication, history of sexual or physical abuse, and cocaine dependence. Other demographic variables had race or gender specificities as risk factors for suicide attempts. Participants had high rates of historical suicide attempts with unique correlates differentiating attempters from ideators among different racial and gender groups. Cocaine dependence was universal predictor of suicide attempts, while other substance dependencies show specific racial and gender profiles associated with suicide attempts.
Raelson, John V; Little, Randall D; Ruether, Andreas; Fournier, Hélène; Paquin, Bruno; Van Eerdewegh, Paul; Bradley, W E C; Croteau, Pascal; Nguyen-Huu, Quynh; Segal, Jonathan; Debrus, Sophie; Allard, René; Rosenstiel, Philip; Franke, Andre; Jacobs, Gunnar; Nikolaus, Susanna; Vidal, Jean-Michel; Szego, Peter; Laplante, Nathalie; Clark, Hilary F; Paulussen, René J; Hooper, John W; Keith, Tim P; Belouchi, Abdelmajid; Schreiber, Stefan
2007-09-11
Genome-wide association (GWA) studies offer a powerful unbiased method for the identification of multiple susceptibility genes for complex diseases. Here we report the results of a GWA study for Crohn's disease (CD) using family trios from the Quebec Founder Population (QFP). Haplotype-based association analyses identified multiple regions associated with the disease that met the criteria for genome-wide significance, with many containing a gene whose function appears relevant to CD. A proportion of these were replicated in two independent German Caucasian samples, including the established CD loci NOD2 and IBD5. The recently described IL23R locus was also identified and replicated. For this region, multiple individuals with all major haplotypes in the QFP were sequenced and extensive fine mapping performed to identify risk and protective alleles. Several additional loci, including a region on 3p21 containing several plausible candidate genes, a region near JAKMIP1 on 4p16.1, and two larger regions on chromosome 17 were replicated. Together with previously published loci, the spectrum of CD genes identified to date involves biochemical networks that affect epithelial defense mechanisms, innate and adaptive immune response, and the repair or remodeling of tissue.
Different Evolutionary Paths to Complexity for Small and Large Populations of Digital Organisms
2016-01-01
A major aim of evolutionary biology is to explain the respective roles of adaptive versus non-adaptive changes in the evolution of complexity. While selection is certainly responsible for the spread and maintenance of complex phenotypes, this does not automatically imply that strong selection enhances the chance for the emergence of novel traits, that is, the origination of complexity. Population size is one parameter that alters the relative importance of adaptive and non-adaptive processes: as population size decreases, selection weakens and genetic drift grows in importance. Because of this relationship, many theories invoke a role for population size in the evolution of complexity. Such theories are difficult to test empirically because of the time required for the evolution of complexity in biological populations. Here, we used digital experimental evolution to test whether large or small asexual populations tend to evolve greater complexity. We find that both small and large—but not intermediate-sized—populations are favored to evolve larger genomes, which provides the opportunity for subsequent increases in phenotypic complexity. However, small and large populations followed different evolutionary paths towards these novel traits. Small populations evolved larger genomes by fixing slightly deleterious insertions, while large populations fixed rare beneficial insertions that increased genome size. These results demonstrate that genetic drift can lead to the evolution of complexity in small populations and that purifying selection is not powerful enough to prevent the evolution of complexity in large populations. PMID:27923053
1999-04-01
realm of gender and race /ethnic background. Finally, analysis is accomplished on these differences and conclusions drawn to ascertain any consequences... Race /Ethnic Comparison ............................................................................................ 31 Hispanic Population...Population............................................................................ 36 Race /Ethnic by Gender Comparison
Chen, Jing; Zhou, Chunshan; Wang, Shaojian; Hu, Jincan
2018-06-04
Air pollution contributes significantly to premature death in China. However, only a limited number of studies have identified the potential determinants of population exposure to PM 2.5 from a socioeconomic perspective. This paper analyses the socioeconomic determinants of population exposure at the city level in China. We first estimated population exposure to PM 2.5 by integrating high resolution spatial distribution maps of PM 2.5 concentrations and population density, using data for 2013. Then, geographically weighted regression (GWR) modeling was undertaken to explore the strength and direction of relationships between the selected socioeconomic factors and population exposure. The results indicate that approximately 75% of the population of China lived in an area where PM 2.5 concentrations were over 35 μg/m 3 in 2013. From the GWR models, we found that the percentages for cities that showed a statistically significant relationship (p < 0.05) between population exposure and each of the six factors were: urbanization, 91.92%; industry share, 91.58%; construction level, 88.55%; urban expansion, 73.40%; income disparity, 64.98%; and private vehicles, 27.27%. The R-squared value for the six factors in the multivariable GWR model was 0.88, and all cities demonstrated a statistically significant relationship. More importantly, the association between the six factors and population exposure was found to be spatially heterogeneous at the local geographic level. Consideration of these six drivers of population exposure can help policy makers and epidemiologists to evaluate and reduce population exposure risks. Copyright © 2018 Elsevier Ltd. All rights reserved.
Differing Mechanisms Underlie Sexual Size-Dimorphism in Two Populations of a Sex-Changing Fish
McCormick, Mark I.; Ryen, Christopher A.; Munday, Philip L.; Walker, Stefan P. W.
2010-01-01
Variability in the density of groups within a patchy environment lead to differences in interaction rates, growth dynamics and social organization. In protogynous hermaphrodites there are hypothesised trade-offs among sex-specific growth, reproductive output and mortality. When differences in density lead to changes to social organization the link between growth and the timing of sex-change is predicted to change. The present study explores this prediction by comparing the social organisation and sex-specific growth of two populations of a protogynous tropical wrasse, Halichoeres miniatus, which differ in density. At a low density population a strict harem structure was found, where males maintained a tight monopoly of access and spawning rights to females. In contrast, at a high density population a loosely organised system prevailed, where females could move throughout multiple male territories. Otolith microstructure revealed the species to be annual and deposit an otolith check associated with sex-change. Growth trajectories suggested that individuals that later became males in both populations underwent a growth acceleration at sex-change. Moreover, in the high density population, individuals that later became males were those individuals that had the largest otolith size at hatching and consistently deposited larger increments throughout early larval, juvenile and female life. This study demonstrates that previous growth history and growth rate changes associated with sex change can be responsible for the sexual dimorphism typically found in sex-changing species, and that the relative importance of these may be socially constrained. PMID:20485547
Jay, Z. J.; Rusch, D. B.; Tringe, S. G.; Bailey, C.; Jennings, R. M.
2014-01-01
High-temperature (>70°C) ecosystems in Yellowstone National Park (YNP) provide an unparalleled opportunity to study chemotrophic archaea and their role in microbial community structure and function under highly constrained geochemical conditions. Acidilobus spp. (order Desulfurococcales) comprise one of the dominant phylotypes in hypoxic geothermal sulfur sediment and Fe(III)-oxide environments along with members of the Thermoproteales and Sulfolobales. Consequently, the primary goals of the current study were to analyze and compare replicate de novo sequence assemblies of Acidilobus-like populations from four different mildly acidic (pH 3.3 to 6.1) high-temperature (72°C to 82°C) environments and to identify metabolic pathways and/or protein-encoding genes that provide a detailed foundation of the potential functional role of these populations in situ. De novo assemblies of the highly similar Acidilobus-like populations (>99% 16S rRNA gene identity) represent near-complete consensus genomes based on an inventory of single-copy genes, deduced metabolic potential, and assembly statistics generated across sites. Functional analysis of coding sequences and confirmation of gene transcription by Acidilobus-like populations provide evidence that they are primarily chemoorganoheterotrophs, generating acetyl coenzyme A (acetyl-CoA) via the degradation of carbohydrates, lipids, and proteins, and auxotrophic with respect to several external vitamins, cofactors, and metabolites. No obvious pathways or protein-encoding genes responsible for the dissimilatory reduction of sulfur were identified. The presence of a formate dehydrogenase (Fdh) and other protein-encoding genes involved in mixed-acid fermentation supports the hypothesis that Acidilobus spp. function as degraders of complex organic constituents in high-temperature, mildly acidic, hypoxic geothermal systems. PMID:24162572
ERIC Educational Resources Information Center
Glasnapp, Douglas R.; Poggio, John P.
This study used computer simulation to provide information on the percentage of students with learning disabilities expected to be identified under different aptitude-achievement discrepancy eligibility models and criteria and to demonstrate the consequential effects in terms of the extent to which the different models identify students of…
Jacobs, Matthieu; Grégoire, Nicolas; Couet, William; Bulitta, Jurgen B.
2016-01-01
Semi-mechanistic pharmacokinetic-pharmacodynamic (PK-PD) modeling is increasingly used for antimicrobial drug development and optimization of dosage regimens, but systematic simulation-estimation studies to distinguish between competing PD models are lacking. This study compared the ability of static and dynamic in vitro infection models to distinguish between models with different resistance mechanisms and support accurate and precise parameter estimation. Monte Carlo simulations (MCS) were performed for models with one susceptible bacterial population without (M1) or with a resting stage (M2), a one population model with adaptive resistance (M5), models with pre-existing susceptible and resistant populations without (M3) or with (M4) inter-conversion, and a model with two pre-existing populations with adaptive resistance (M6). For each model, 200 datasets of the total bacterial population were simulated over 24h using static antibiotic concentrations (256-fold concentration range) or over 48h under dynamic conditions (dosing every 12h; elimination half-life: 1h). Twelve-hundred random datasets (each containing 20 curves for static or four curves for dynamic conditions) were generated by bootstrapping. Each dataset was estimated by all six models via population PD modeling to compare bias and precision. For M1 and M3, most parameter estimates were unbiased (<10%) and had good imprecision (<30%). However, parameters for adaptive resistance and inter-conversion for M2, M4, M5 and M6 had poor bias and large imprecision under static and dynamic conditions. For datasets that only contained viable counts of the total population, common statistical criteria and diagnostic plots did not support sound identification of the true resistance mechanism. Therefore, it seems advisable to quantify resistant bacteria and characterize their MICs and resistance mechanisms to support extended simulations and translate from in vitro experiments to animal infection models and
McKeigue, P M
1997-01-01
Where recent admixture has occurred between two populations that have different disease rates for genetic reasons, family-based association studies can be used to map the genes underlying these differences, if the ancestry of the alleles at each locus examined can be assigned to one of the two founding populations. This article explores the statistical power and design requirements of this approach. Markers suitable for assigning the ancestry of genomic regions could be defined by grouping alleles at closely spaced microsatellite loci into haplotypes, or generated by representational difference analysis. For a given relative risk between populations, the sample size required to detect a disease locus that accounts for this relative risk by linkage-disequilibrium mapping in an admixed population is not critically dependent on assumptions about genotype penetrances or allele frequencies. Using the transmission-disequilibrium test to search the genome for a locus that accounts for a relative risk of between 2 and 3 in a high-risk population, compared with a low-risk population, generally requires between 150 and 800 case-parent pairs of mixed descent. The optimal strategy is to conduct an initial study using markers spaced at < or = 10 cM with cases from the second and third generations of mixed descent, and then to map the disease loci more accurately in a subsequent study of a population with a longer history of admixture. This approach has greater statistical power than allele-sharing designs and has obvious applications to the genetics of hypertension, non-insulin-dependent diabetes, and obesity. PMID:8981962
Purcell, Amanda; Fleming, Jennifer; Bennett, Sally; Burmeister, Bryan; Haines, Terry
2010-03-01
The Multidimensional Fatigue Inventory (MFI) is a commonly used cancer-related fatigue assessment tool. Unlike other fatigue assessments, there are no published minimal clinically important difference (MCID) criteria for the MFI in cancer populations. MCID criteria determine the smallest change in scores that can be regarded as important, allowing clinicians and researchers to interpret the meaning of changes in patient's fatigue scores. This research aims to improve the clinical utility of the MFI by establishing MCID criteria for the MFI sub-scales in a radiotherapy population. Two hundred ten patients undergoing radiotherapy were recruited to a single-centre prospective cohort study. Patients were assessed at three time points, at the start of radiotherapy, the end of radiotherapy and 6 weeks after radiotherapy completion. Assessment consisted of four clinically relevant constructs: (1) treatment impact on fatigue, (2) health-related quality of life, (3) performance status and (4) occupational productivity. These constructs were used as external or anchor-based measures to determine MCIDs for each sub-scale of the MFI. Multiple MCIDs were identified, each from a different perspective based on the constructs cited. Researchers seeking to use a generic MCID may wish to use a two-point reference for each MFI sub-scale as it was consistent across the pre- and post-radiotherapy comparison and occupational productivity anchors. MCIDs validated in this study allow better interpretation of changes in MFI sub-scale scores and allow effect size calculations for determining sample size in future studies.
Chilelli, Nino Cristiano; Cosma, Chiara; Ragazzi, Eugenio; Burlina, Silvia; Zaninotto, Martina; Plebani, Mario; Lapolla, Annunziata
2014-10-01
Discordance between HbA1c and OGTT in screening pre-diabetes may occur because of lack of laboratory standardization, distinct underlying pathophysiological processes or different ethnicity. We evaluated HbA1c efficacy for screening OGTT-defined IFG and IGT conditions in a large Caucasian population using the newly revised IFCC protocol. A total of 501 consecutive subjects were screened for pre-diabetic conditions with OGTT with 75 g of glucose. Testing for HbA1c, lipid profile and fasting insulin levels was also performed. For detecting differences between continuous variables, ANOVA followed by Tukey's honestly significant difference (HSD) post hoc test was used. Logistic regression and ROC curve analysis were also performed for assessing HbA1c screening efficacy. ROC curve analysis showed that optimal HbA1c cut-off for detecting IFG was 5.6 % (sensitivity of 78 % and specificity of 63 %), while for IGT, the optimal cut-off was 5.9 % (sensitivity of 46 % and specificity of 84 %), with AUCs < 0.8. Screening with HbA1c identified 53.4 % of the 193 patients with IFG and/or IGT diagnosed at OGTT. As regards surrogate markers of insulin resistance, we observed a trend towards higher values of HOMA-IR and lower QUICKI values in subjects with IFG than in those with IGT. Patients with pre-diabetes at both tests had similar values of HOMA and QUICKI, compared with those with altered OGTT only. IFCC-aligned HbA1c assay proved scarcely effective in detecting IFG and/or IGT in a large Caucasian population, identifying only half of the patients with abnormal OGTT. Moreover, adding HbA1c screening to OGTT may be of little benefit in identifying subjects with a worse metabolic profile.
Manier, Mollie K; Arnold, Stevan J
2006-12-07
Identifying ecological factors associated with population genetic differentiation is important for understanding microevolutionary processes and guiding the management of threatened populations. We identified ecological correlates of several population genetic parameters for three interacting species (two garter snakes and an anuran) that occupy a common landscape. Using multiple regression analysis, we found that species interactions were more important in explaining variation in population genetic parameters than habitat and nearest-neighbour characteristics. Effective population size was best explained by census size, while migration was associated with differences in species abundance. In contrast, genetic distance was poorly explained by the ecological correlates that we tested, but geographical distance was prominent in models for all species. We found substantially different population dynamics for the prey species relative to the two predators, characterized by larger effective sizes, lower gene flow and a state of migration-drift equilibrium. We also identified an escarpment formed by a series of block faults that serves as a barrier to dispersal for the predators. Our results suggest that successful landscape-level management should incorporate genetic and ecological data for all relevant species, because even closely associated species can exhibit very different population genetic dynamics on the same landscape.
Bonjoch, X; Blanch, A R
2009-04-01
The composition of the most abundant facultative anaerobic bacteria populations [faecal coliforms (FC) and enterococci (ENT)] in sludge can be modified after different treatments. These involve the disposal or reuse of sludge and include: anaerobic digesters, incineration, composting, pasteurization and lime treatments. In this study, three treatment types (mesophilic anaerobic digestion, composting and pasteurization) were compared in terms of their ability to reduce both bacterial populations. The diversity and any changes in composition of main phenotypic groups for both populations were also analyzed. Mesophilic anaerobic digestion (MAD) was carried out at 35 degrees C for 20 days. Digested sludge was then dehydrated by centrifugation at 2,500 rpm. Composting (COM) was performed at 55 degrees C with windrow phases. Pasteurization was assayed at 60 degrees C for 90 min (P60), at 80 degrees C for 60 min (P80). A 1-1.5 log unit reduction was observed for FC, and 1 log unit reduction was noted for ENT by MAD treatment. In composting, this reduction proved higher for FC than for ENT (6 log and 3-4 log units, respectively). Optimal pasteurization was obtained at 80 degrees C for 60 min, resulting in a 5 log unit reduction for FC and a 2 log unit reduction for ENT. High diversity indices (Di) for both bacterial populations were detected both before and after implementation of the different treatments. Analyses of the population's similarity provided that FC were diverse both before and after COM, P60 and P80 treatments. However, no differences were observed on the composition of ENT populations after the different treatments assayed.
SNPs and Haplotypes in Native American Populations
Kidd, Judith R.; Friedlaender, Françoise; Pakstis, Andrew J.; Furtado, Manohar; Fang, Rixun; Wang, Xudong; Nievergelt, Caroline M.; Kidd, Kenneth K.
2013-01-01
Autosomal DNA polymorphisms can provide new information and understanding of both the origins of and relationships among modern Native American populations. At the same time that autosomal markers can be highly informative, they are also susceptible to ascertainment biases in the selection of the markers to use. Identifying markers that can be used for ancestry inference among Native American populations can be considered separate from identifying markers to further the quest for history. In the current study we are using data on nine Native American populations to compare the results based on a large haplotype-based dataset with relatively small independent sets of SNPs. We are interested in what types of limited datasets an individual laboratory might be able to collect are best for addressing two different questions of interest. First, how well can we differentiate the Native American populations and/or infer ancestry by assigning an individual to her population(s) of origin? Second, how well can we infer the historical/evolutionary relationships among Native American populations and their Eurasian origins. We conclude that only a large comprehensive dataset involving multiple autosomal markers on multiple populations will be able to answer both questions; different small sets of markers are able to answer only one or the other of these questions. Using our largest dataset we see a general increasing distance from Old World populations from North to South in the New World except for an unexplained close relationship between our Maya and Quechua samples. PMID:21913176
Ethnic and Gender Differences in Identifying Gifted Students: A Multi-Cultural Analysis
ERIC Educational Resources Information Center
Sarouphim, Ketty M.; Maker, C. June
2010-01-01
The purpose of this study was to examine ethnic and gender differences in using DISCOVER, a performance-based assessment, for identifying gifted students. The sample consisted of 941 students from grades K-5 belonging to six ethnicities: White Americans, African-Americans, Hispanics, Native-Americans, South Pacific/Pacific Islanders, and Arabs.…
NASA Technical Reports Server (NTRS)
Delano, John W.
1988-01-01
Apollo 14 regolith breccias (14313, 14307, 14301, 14049, 14047) have been found to have different populations of nonagglutinitic, mare-derived glasses. These variations appear to not only reflect different source regoliths but also different closure ages for these breccias. Based upon these different glass populations, 14301 is inferred to have a closure age sometime during the epoch of mare volcanism. All of the other four breccias were formed after the termination of mare volcanism with a possible age sequence from old to young of the following: 14307, 14313, 14049, 14047. Due to the relative simplicity of acquiring high-quality chemical data on large numbers of glasses by electron microprobe, mare glass populations allow: (1) classification of regolith breccias with respect to provenance and (2) estimation of their relative and absolute closure ages. The determination of (Ar-40)-(Ar-39) ages on individual glass spherules within breccias using the laser probe should in the future prove to be a promising extension of the present study.
Gatti, Daniel M.; Morgan, Daniel L.; Kissling, Grace E.; Shockley, Keith R.; Knudsen, Gabriel A.; Shepard, Kim G.; Price, Herman C.; King, Deborah; Witt, Kristine L.; Pedersen, Lars C.; Munger, Steven C.; Svenson, Karen L.; Churchill, Gary A.
2014-01-01
Background Inhalation of benzene at levels below the current exposure limit values leads to hematotoxicity in occupationally exposed workers. Objective We sought to evaluate Diversity Outbred (DO) mice as a tool for exposure threshold assessment and to identify genetic factors that influence benzene-induced genotoxicity. Methods We exposed male DO mice to benzene (0, 1, 10, or 100 ppm; 75 mice/exposure group) via inhalation for 28 days (6 hr/day for 5 days/week). The study was repeated using two independent cohorts of 300 animals each. We measured micronuclei frequency in reticulocytes from peripheral blood and bone marrow and applied benchmark concentration modeling to estimate exposure thresholds. We genotyped the mice and performed linkage analysis. Results We observed a dose-dependent increase in benzene-induced chromosomal damage and estimated a benchmark concentration limit of 0.205 ppm benzene using DO mice. This estimate is an order of magnitude below the value estimated using B6C3F1 mice. We identified a locus on Chr 10 (31.87 Mb) that contained a pair of overexpressed sulfotransferases that were inversely correlated with genotoxicity. Conclusions The genetically diverse DO mice provided a reproducible response to benzene exposure. The DO mice display interindividual variation in toxicity response and, as such, may more accurately reflect the range of response that is observed in human populations. Studies using DO mice can localize genetic associations with high precision. The identification of sulfotransferases as candidate genes suggests that DO mice may provide additional insight into benzene-induced genotoxicity. Citation French JE, Gatti DM, Morgan DL, Kissling GE, Shockley KR, Knudsen GA, Shepard KG, Price HC, King D, Witt KL, Pedersen LC, Munger SC, Svenson KL, Churchill GA. 2015. Diversity Outbred mice identify population-based exposure thresholds and genetic factors that influence benzene-induced genotoxicity. Environ Health Perspect 123:237
Lakhan, Ram; Mawson, Anthony R
2016-05-01
Low-and middle-income countries (LAMI) lack an integrated and systematic approach to identify people with intellectual disabilities. Screening surveys are considered resource-intensive; therefore, alternative approaches are needed. This study attempted to identify children up to age 18 years with intellectual disabilities through a mixed-method approach involving focus group interviews (FGIs) and door-to-door surveys. Focus groups were conducted with the assistance and involvement of local leaders in four villages of Barwani district of Madhya Pradesh with a 99% tribal population in all four villages. A formal survey of the community was then conducted to determine the prevalence of intellectual disabilities based on a standardized screening instrument (NIMH-DDS). Thirty focus group interviews were conducted involving 387 participants (males 284, females 103) over a period of 13 days. The entire adult population (N = 8797) was then surveyed for intellectual disabilities using a standardized screening instrument. The data revealed a close similarity in the prevalence rates of intellectual disabilities, as determined by the two approaches (Focus Group Interviews, 5.22/1000 versus Survey, 5.57/1000). A qualitative method using FGIs successfully identified people with intellectual disabilities in an economically deprived tribal area, showing that a community-based approach provides a close estimate of intellectual disabilities based on a formal survey using standard diagnostic criteria. These data suggest that FGI, along with other qualitative data, could be helpful in designing and in serving as an entree for community-based interventions. © 2015 John Wiley & Sons Ltd.
Racial differences in tumor stage and survival for colorectal cancer in an insured population.
Doubeni, Chyke A; Field, Terry S; Buist, Diana S M; Korner, Eli J; Bigelow, Carol; Lamerato, Lois; Herrinton, Lisa; Quinn, Virginia P; Hart, Gene; Hornbrook, Mark C; Gurwitz, Jerry H; Wagner, Edward H
2007-02-01
Despite declining death rates from colorectal cancer (CRC), racial disparities have continued to increase. In this study, the authors examined disparities in a racially diverse group of insured patients. This study was conducted among patients who were diagnosed with CRC from 1993 to 1998, when they were enrolled in integrated healthcare systems. Patients were identified from tumor registries and were linked to information in administrative databases. The sample was restricted to non-Hispanic whites (n = 10,585), non-Hispanic blacks (n = 1479), Hispanics (n = 985), and Asians/Pacific Islanders (n = 909). Differences in tumor stage and survival were analyzed by using polytomous and Cox regression models, respectively. In multivariable regression analyses, blacks were more likely than whites to have distant or unstaged tumors. In Cox models that were adjusted for nonmutable factors, blacks had a higher risk of death from CRC (hazard ratio [HR], 1.17; 95% confidence interval [95% CI], 1.06-1.30). Hispanics had a risk of death similar to whites (HR, 1.04; 95% CI, 0.92-1.18), whereas Asians/Pacific Islanders had a lower risk of death from CRC (HR, 0.89; 95% CI, 0.78-1.02). Adjustment for tumor stage decreased the HR to 1.11 for blacks, and the addition of receipt of surgical therapy to the model decreased the HR further to 1.06. The HR among Hispanics and Asians/Pacific Islanders was stable to adjustment for tumor stage and surgical therapy. The relation between race and survival from CRC was complex and appeared to be related to differences in tumor stage and therapy received, even in insured populations. Targeted interventions to improve the use of effective screening and treatment among vulnerable populations may be needed to eliminate disparities in CRC. (c) 2007 American Cancer Society.
Kanthimathi, Sekar; Chidambaram, Manickam; Bodhini, Dhanasekaran; Liju, Samuel; Bhavatharini, Aruyerchelvan; Uma, Ram; Anjana, Ranjit Mohan; Mohan, Viswanathan; Radha, Venkatesan
2017-06-01
Earlier studies have provided evidence that the gestational diabetes mellitus (GDM) and Type 2 diabetes mellitus (T2DM) share common genetic background. A recent genome wide association study (GWAS) showed a strong association of six novel gene variants with T2DM among south Asians but not with Europeans. The aim of this study was to investigate whether these variants that confer susceptibility to T2DM in Asian Indian population also correlate with GDM in Asian Indian population. In addition to these novel variants, three T2DM associated SNPs that were previously identified by GWAS in Caucasian populations, which also showed association with T2DM in south Indian population in our previous study were also evaluated for their susceptibility to GDM in our population. The study groups comprised unrelated pregnant women with GDM (n = 518) and pregnant women with normal glucose tolerance (NGT) (n = 1220). A total of nine SNPs in or near nine loci, namely AP3S2 (rs2028299), BAZ1B (rs12056034), CDKN2A/B (rs7020996), GRB14 (rs3923113), HHEX (rs7923837), HMG20A (rs7178572), HNF4A (rs4812829), ST6GAL1 (rs16861329) and VPS26A (rs1802295) were genotyped using the MassARRAY system. Among these nine SNPs that previously showed an association with T2DM in Asian Indians, HMG20A (rs7178572) and HNF4A (rs4812829) gene variants showed a significant association with GDM. The risk alleles of rs7178572 in HMG20A and rs4812829 in HNF4A gene conferred 1.24 and 1.28 times higher risk independently and about 1.44 and 1.97 times increased susceptibility to GDM for one and two risk genotypes, respectively. We report that the HMG20A (rs7178572) and HNF4A (rs4812829) variants that have previously shown a strong association with T2DM in Asian Indians also contributes significant risk to GDM in this population. This is the first report of the association of HMG20A (rs7178572) and HNF4A (rs4812829) variants with GDM.
Denova-Gutiérrez, Edgar; Tucker, Katherine L; Salmerón, Jorge; Flores, Mario; Barquera, Simón
2016-01-01
To examine the validity of a semi-quantitative food frequency questionnaire (SFFQ) to identify dietary patterns in an adult Mexican population. A 140-item SFFQ and two 24-hour dietary recalls (24DRs) were administered. Foods were categorized into 29 food groups used to derive dietary patterns via factor analysis. Pearson and intraclass correlations coefficients between dietary pattern scores identified from the SFFQ and 24DRs were assessed. Pattern 1 was high in snacks, fast food, soft drinks, processed meats and refined grains; pattern 2 was high in fresh vegetables, fresh fruits, and dairy products; and pattern 3 was high in legumes, eggs, sweetened foods and sugars. Pearson correlation coefficients between the SFFQ and the 24DRs for these patterns were 0.66 (P<0.001), 0.41 (P<0.001) and 0.29 (P=0.193) respectively. Our data indicate reasonable validity of the SFFQ, using factor analysis, to derive major dietary patterns in comparison with two 24DR.
Rand, Kristin A.; Song, Chi; Dean, Eric; Serie, Daniel J.; Curtin, Karen; Sheng, Xin; Hu, Donglei; Huff, Carol Ann; Bernal-Mizrachi, Leon; Tomasson, Michael H.; Ailawadhi, Sikander; Singhal, Seema; Pawlish, Karen; Peters, Edward S.; Bock, Cathryn H.; Stram, Alex; Van Den Berg, David J; Edlund, Christopher K.; V.Conti, David; Zimmerman, Todd; Hwang, Amie E.; Huntsman, Scott; Graff, John; Nooka, Ajay; Kong, Yinfei; Pregja, Silvana L.; Berndt, Sonja I.; Blot, William J.; Carpten, John; Casey, Graham; Chu, Lisa; Diver, W. Ryan; Stevens, Victoria L.; Lieber, Michael R.; Goodman, Phyllis J.; Hennis, Anselm J.M.; Hsing, Ann W.; Mehta, Jayesh; Kittles, Rick A.; Kolb, Suzanne; Klein, Eric A.; Leske, Cristina; Murphy, Adam B.; Nemesure, Barbara; Neslund-Dudas, Christine; Strom, Sara S.; Vij, Ravi; Rybicki, Benjamin A.; Stanford, Janet L.; Signorello, Lisa B.; Witte, John S.; Ambrosone, Christine B.; Bhatti, Parveen; John, Esther M.; Bernstein, Leslie; Zheng, Wei; Olshan, Andrew F.; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah J.; Bandera, Elisa V.; Birmann, Brenda M.; Ingles, Sue A.; Press, Michael F.; Atanackovic, Djordje; Glenn, Martha J.; Cannon-Albright, Lisa A.; Jones, Brandt; Tricot, Guido; Martin, Thomas G.; Kumar, Shaji K.; Wolf, Jeffrey L.; Deming, Sandra L.; Rothman, Nathaniel; Brooks-Wilson, Angela R.; Rajkumar, S. Vincent; Kolonel, Laurence N.; Chanock, Stephen J.; Slager, Susan L.; Severson, Richard K.; Janakiraman, Nalini; Terebelo, Howard R.; Brown, Elizabeth E.; De Roos, Anneclaire J.; Mohrbacher, Ann F.; Colditz, Graham A.; Giles, Graham G.; Spinelli, John J.; Chiu, Brian C.; Munshi, Nikhil C.; Anderson, Kenneth C.; Levy, Joan; Zonder, Jeffrey A.; Orlowski, Robert Z.; Lonial, Sagar; Camp, Nicola J.; Vachon, Celine M.; Ziv, Elad; Stram, Daniel O.; Hazelett, Dennis J.; Haiman, Christopher A.; Cozen, Wendy
2017-01-01
Background Genome-wide association studies (GWAS) in European populations have identified genetic risk variants associated with multiple myeloma (MM). Methods We performed association testing of common variation in eight regions in 1,264 MM patients and 1,479 controls of European ancestry (EA) and 1,305 MM patients and 7,078 controls of African ancestry (AA) and conducted a meta-analysis to localize the signals, with epigenetic annotation used to predict functionality. Results We found that variants in 7p15.3, 17p11.2, 22q13.1 were statistically significantly (p<0.05) associated with MM risk in AAs and EAs and the variant in 3p22.1 was associated in EAs only. In a combined AA-EA meta-analysis, variation in five regions (2p23.3, 3p22.1, 7p15.3, 17p11.2, 22q13.1) was statistically signficantly associated with MM risk. In 3p22.1, the correlated variants clustered within the gene body of ULK4. Correlated variants in 7p15.3 clustered around an enhancer at the 3′ end of the CDCA7L transcription termination site. A missense variant at 17p11.2 (rs34562254, Pro251Leu, OR=1.32, p=2.93×10−7) in TNFRSF13B, encodes a lymphocyte-specific protein in the tumor necrosis factor receptor family that interacts with the NF-κB pathway. SNPs correlated with the index signal in 22q13.1 cluster around the promoter and enhancer regions of CBX7. Conclusions We found that reported MM susceptibility regions contain risk variants important across populations supporting the use of multiple racial/ethnic groups with different underlying genetic architecture to enhance the localization and identification of putatively functional alleles. Impact A subset of reported risk loci for multiple myeloma have consistent affects across populations and are likely to be functional. PMID:27587788
Scofield, Holly; Roth, Thomas; Drake, Christopher
2008-01-01
Study Objective: There is growing interest in the study of periodic limb movements during sleep and their potential clinical correlates. The aim of the present analysis is to address the lack of population-based studies using polysomnographic (PSG) measures to determine the prevalence of period limb movements during sleep in specific racial groups as well as the general population. Settings and participants: A community-based sample of 592 participants drawn from the general population of tricounty Detroit (mean age = 41.9 ± 12.6 years; 52.9% F; 31.5% African American). All individuals were assessed using objective and subjective measures in the sleep laboratory. Measurements: Participants were evaluated during a 24-h laboratory assessment, including a polysomnogram and multiple sleep latency test. Periodic leg movements were scored using standard criteria. Reports of sleep disturbance and daytime sleepiness were also assessed using standardized measures including the Global Sleep Assessment Questionnaire (GSAQ) and the Epworth Sleepiness Scale (ESS). Results: The overall prevalence of periodic limb movements during sleep (PLMSI >15) was 7.6%. African Americans had a lower prevalence of PLMSI >15 than Caucasians (4.3% vs. 9.3%; Χ2 = 4.5, P < 0.05). Regardless of race, symptoms of insomnia were significantly higher in individuals with PLMSI >15 than in those with PLMSI ≤15 (45% vs. 25%; Χ2 = 6.84, P < 0.01). Conclusion: This is the first study to determine the prevalence of PLMS in a population-based sample using standardized objective criteria. A key finding of the present study is that racial differences in this PSG parameter do exist, with African Americans being less likely to have elevated PLMS. Citation: Scofield H; Roth T; Drake C. Periodic limb movements during sleep: population prevalence, clinical correlates, and racial differences. SLEEP 2008;31(9):1221-1227. PMID:18788647
Wen, Wanqing; Zheng, Wei; Okada, Yukinori; Takeuchi, Fumihiko; Tabara, Yasuharu; Hwang, Joo-Yeon; Dorajoo, Rajkumar; Li, Huaixing; Tsai, Fuu-Jen; Yang, Xiaobo; He, Jiang; Wu, Ying; He, Meian; Zhang, Yi; Liang, Jun; Guo, Xiuqing; Sheu, Wayne Huey-Herng; Delahanty, Ryan; Guo, Xingyi; Kubo, Michiaki; Yamamoto, Ken; Ohkubo, Takayoshi; Go, Min Jin; Liu, Jian Jun; Gan, Wei; Chen, Ching-Chu; Gao, Yong; Li, Shengxu; Lee, Nanette R; Wu, Chen; Zhou, Xueya; Song, Huaidong; Yao, Jie; Lee, I-Te; Long, Jirong; Tsunoda, Tatsuhiko; Akiyama, Koichi; Takashima, Naoyuki; Cho, Yoon Shin; Ong, Rick Th; Lu, Ling; Chen, Chien-Hsiun; Tan, Aihua; Rice, Treva K; Adair, Linda S; Gui, Lixuan; Allison, Matthew; Lee, Wen-Jane; Cai, Qiuyin; Isomura, Minoru; Umemura, Satoshi; Kim, Young Jin; Seielstad, Mark; Hixson, James; Xiang, Yong-Bing; Isono, Masato; Kim, Bong-Jo; Sim, Xueling; Lu, Wei; Nabika, Toru; Lee, Juyoung; Lim, Wei-Yen; Gao, Yu-Tang; Takayanagi, Ryoichi; Kang, Dae-Hee; Wong, Tien Yin; Hsiung, Chao Agnes; Wu, I-Chien; Juang, Jyh-Ming Jimmy; Shi, Jiajun; Choi, Bo Youl; Aung, Tin; Hu, Frank; Kim, Mi Kyung; Lim, Wei Yen; Wang, Tzung-Dao; Shin, Min-Ho; Lee, Jeannette; Ji, Bu-Tian; Lee, Young-Hoon; Young, Terri L; Shin, Dong Hoon; Chun, Byung-Yeol; Cho, Myeong-Chan; Han, Bok-Ghee; Hwu, Chii-Min; Assimes, Themistocles L; Absher, Devin; Yan, Xiaofei; Kim, Eric; Kuo, Jane Z; Kwon, Soonil; Taylor, Kent D; Chen, Yii-Der I; Rotter, Jerome I; Qi, Lu; Zhu, Dingliang; Wu, Tangchun; Mohlke, Karen L; Gu, Dongfeng; Mo, Zengnan; Wu, Jer-Yuarn; Lin, Xu; Miki, Tetsuro; Tai, E Shyong; Lee, Jong-Young; Kato, Norihiro; Shu, Xiao-Ou; Tanaka, Toshihiro
2014-10-15
Recent genetic association studies have identified 55 genetic loci associated with obesity or body mass index (BMI). The vast majority, 51 loci, however, were identified in European-ancestry populations. We conducted a meta-analysis of associations between BMI and ∼2.5 million genotyped or imputed single nucleotide polymorphisms among 86 757 individuals of Asian ancestry, followed by in silico and de novo replication among 7488-47 352 additional Asian-ancestry individuals. We identified four novel BMI-associated loci near the KCNQ1 (rs2237892, P = 9.29 × 10(-13)), ALDH2/MYL2 (rs671, P = 3.40 × 10(-11); rs12229654, P = 4.56 × 10(-9)), ITIH4 (rs2535633, P = 1.77 × 10(-10)) and NT5C2 (rs11191580, P = 3.83 × 10(-8)) genes. The association of BMI with rs2237892, rs671 and rs12229654 was significantly stronger among men than among women. Of the 51 BMI-associated loci initially identified in European-ancestry populations, we confirmed eight loci at the genome-wide significance level (P < 5.0 × 10(-8)) and an additional 14 at P < 1.0 × 10(-3) with the same direction of effect as reported previously. Findings from this analysis expand our knowledge of the genetic basis of obesity. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Ethnic differences in the ability of triglyceride levels to identify insulin resistance.
Sumner, Anne E; Cowie, Catherine C
2008-02-01
The Metabolic Syndrome is used to predict the onset of coronary artery disease and Type 2 diabetes. As the predictive value of the Metabolic Syndrome has been challenged, alternative syndromes have been developed. All of these syndromes were developed in populations that were predominantly non-Hispanic white (NHW). They include the Enlarged Waist Elevated Triglyceride Syndrome, the Overweight-Lipid Syndrome and the Hypertriglyceridemic Waist Syndrome. The first applies to postmenopausal women, the second to overweight individuals (BMI> or =25 kg/m(2)), and the third to men. Each syndrome uses hypertriglyceridemia as a criterion. However, the definition of hypertriglyceridemia varies by syndrome i.e. TG> or =128 mg/dL for the Enlarged Waist Elevated Triglyceride Syndrome, TG> or =130 mg/dL for the Overweight-Lipid Syndrome, > or =150 mg/dL for the Metabolic Syndrome, and TG> or =176 mg/dL for the Hypertriglyceridemic Waist Syndrome. Insulin resistance and hypertriglyceridemia are highly correlated. But as insulin resistant non-Hispanic blacks (NHB) often have triglyceride (TG) levels below the thresholds set by these syndromes, the ability of either TG or these syndromes to identify high risk NHB is unknown. Using the National Health and Nutrition Examination Survey (NHANES) 1999-2002, our goals were to determine by ethnicity: (1) the prevalence of each of these syndromes; (2) the ability of fasting TG concentrations to identify insulin resistance at cut-off levels established by these syndromes, specifically 130, 150 and 176 mg/dL. Participants were 2804 adults from NHANES 1999-2002. The cohort was divided into tertiles of homeostasis model assessment. Insulin resistance was defined as the upper tertile (> or =2.73). The prevalence of each syndrome was lower in NHB than NHW or Mexican Americans (MA) (all P<0.05). Mean TG levels in NHB, non-Hispanic Whites (NHW) and Mexican Americans (MA) were: 99, 140 and 144mg/dL, respectively. The mean percents of insulin
Spanakis, Marios; Marias, Kostas
2014-12-01
Gadofosveset is a Gd-based contrast agent used for magnetic resonance imaging (MRI). Gadolinium kinetic distribution models are implemented in T1-weighted dynamic contrast-enhanced perfusion MRI for characterization of lesion sites in the body. Physiology changes in a disease state potentially can influence the pharmacokinetics of drugs and to this respect modify the distribution properties of contrast agents. This work focuses on the in silico modelling of pharmacokinetic properties of gadofosveset in different population groups through the application of physiologically-based pharmacokinetic models (PBPK) embedded in Simcyp® population pharmacokinetics platform. Physicochemical and pharmacokinetic properties of gadofosveset were introduced into Simcyp® simulator platform and a min-PBPK model was applied. In silico clinical trials were generated simulating the administration of the recommended dose for the contrast agent (i.v., 30 mg/kg) in population cohorts of healthy volunteers, obese, renal and liver impairment, and in a generated virtual oncology population. Results were evaluated regarding basic pharmacokinetic parameters of Cmax, AUC and systemic CL and differences were assessed through ANOVA and estimation of ratio of geometric mean between healthy volunteers and the other population groups. Simcyp® predicted a mean Cmax = 551.60 mg/l, a mean AUC = 4079.12 mg/L*h and a mean systemic CL = 0.56 L/h for the virtual population of healthy volunteers. Obese population showed a modulation in Cmax and CL, attributed to increased administered dose. In renal and liver impairment cohorts a significant modulation in Cmax, AUC and CL of gadofosveset is predicted. Oncology population exhibited statistical significant differences regarding AUC when compared with healthy volunteers. This work employed Simcyp® population pharmacokinetics platform in order to compute gadofosveset's pharmacokinetic profiles through PBPK models and in silico clinical
Windhausen, Vanessa S.; Atlin, Gary N.; Hickey, John M.; Crossa, Jose; Jannink, Jean-Luc; Sorrells, Mark E.; Raman, Babu; Cairns, Jill E.; Tarekegne, Amsal; Semagn, Kassa; Beyene, Yoseph; Grudloyma, Pichet; Technow, Frank; Riedelsheimer, Christian; Melchinger, Albrecht E.
2012-01-01
Genomic prediction is expected to considerably increase genetic gains by increasing selection intensity and accelerating the breeding cycle. In this study, marker effects estimated in 255 diverse maize (Zea mays L.) hybrids were used to predict grain yield, anthesis date, and anthesis-silking interval within the diversity panel and testcross progenies of 30 F2-derived lines from each of five populations. Although up to 25% of the genetic variance could be explained by cross validation within the diversity panel, the prediction of testcross performance of F2-derived lines using marker effects estimated in the diversity panel was on average zero. Hybrids in the diversity panel could be grouped into eight breeding populations differing in mean performance. When performance was predicted separately for each breeding population on the basis of marker effects estimated in the other populations, predictive ability was low (i.e., 0.12 for grain yield). These results suggest that prediction resulted mostly from differences in mean performance of the breeding populations and less from the relationship between the training and validation sets or linkage disequilibrium with causal variants underlying the predicted traits. Potential uses for genomic prediction in maize hybrid breeding are discussed emphasizing the need of (1) a clear definition of the breeding scenario in which genomic prediction should be applied (i.e., prediction among or within populations), (2) a detailed analysis of the population structure before performing cross validation, and (3) larger training sets with strong genetic relationship to the validation set. PMID:23173094
Windhausen, Vanessa S; Atlin, Gary N; Hickey, John M; Crossa, Jose; Jannink, Jean-Luc; Sorrells, Mark E; Raman, Babu; Cairns, Jill E; Tarekegne, Amsal; Semagn, Kassa; Beyene, Yoseph; Grudloyma, Pichet; Technow, Frank; Riedelsheimer, Christian; Melchinger, Albrecht E
2012-11-01
Genomic prediction is expected to considerably increase genetic gains by increasing selection intensity and accelerating the breeding cycle. In this study, marker effects estimated in 255 diverse maize (Zea mays L.) hybrids were used to predict grain yield, anthesis date, and anthesis-silking interval within the diversity panel and testcross progenies of 30 F(2)-derived lines from each of five populations. Although up to 25% of the genetic variance could be explained by cross validation within the diversity panel, the prediction of testcross performance of F(2)-derived lines using marker effects estimated in the diversity panel was on average zero. Hybrids in the diversity panel could be grouped into eight breeding populations differing in mean performance. When performance was predicted separately for each breeding population on the basis of marker effects estimated in the other populations, predictive ability was low (i.e., 0.12 for grain yield). These results suggest that prediction resulted mostly from differences in mean performance of the breeding populations and less from the relationship between the training and validation sets or linkage disequilibrium with causal variants underlying the predicted traits. Potential uses for genomic prediction in maize hybrid breeding are discussed emphasizing the need of (1) a clear definition of the breeding scenario in which genomic prediction should be applied (i.e., prediction among or within populations), (2) a detailed analysis of the population structure before performing cross validation, and (3) larger training sets with strong genetic relationship to the validation set.
Population-specific life histories contribute to metapopulation viability
Halsey, Samniqueka J.; Bell, Timothy J.; McEachern, A. Kathryn; Pavlovic, Noel B.
2016-01-01
Restoration efforts can be improved by understanding how variations in life-history traits occur within populations of the same species living in different environments. This can be done by first understanding the demographic responses of natural occurring populations. Population viability analysis continues to be useful to species management and conservation with sensitivity analysis aiding in the understanding of population dynamics. In this study, using life-table response experiments and elasticity analyses, we investigated how population-specific life-history demographic responses contributed to the metapopulation viability of the Federally threatened Pitcher's thistle (Cirsium pitcheri). Specifically, we tested the following hypotheses: (1) Subpopulations occupying different environments within a metapopulation have independent demographic responses and (2) advancing succession results in a shift from a demographic response focused on growth and fecundity to one dominated by stasis. Our results showed that reintroductions had a positive contribution to the metapopulation growth rate as compared to native populations which had a negative contribution. We found no difference in succession on the contribution to metapopulation viability. In addition, we identified distinct population-specific contributions to metapopulation viability and were able to associate specific life-history demographic responses. For example, the positive impact of Miller High Dunes population on the metapopulation growth rate resulted from high growth contributions, whereas increased time of plant in stasis for the State Park Big Blowout population resulted in negative contributions. A greater understanding of how separate populations respond in their corresponding environment may ultimately lead to more effective management strategies aimed at reducing extinction risk. We propose the continued use of sensitivity analyses to evaluate population-specific demographic influences on
Veturi, Yogasudha; Ritchie, Marylyn D
2018-01-01
Transcriptome-wide association studies (TWAS) have recently been employed as an approach that can draw upon the advantages of genome-wide association studies (GWAS) and gene expression studies to identify genes associated with complex traits. Unlike standard GWAS, summary level data suffices for TWAS and offers improved statistical power. Two popular TWAS methods include either (a) imputing the cis genetic component of gene expression from smaller sized studies (using multi-SNP prediction or MP) into much larger effective sample sizes afforded by GWAS - TWAS-MP or (b) using summary-based Mendelian randomization - TWAS-SMR. Although these methods have been effective at detecting functional variants, it remains unclear how extensive variability in the genetic architecture of complex traits and diseases impacts TWAS results. Our goal was to investigate the different scenarios under which these methods yielded enough power to detect significant expression-trait associations. In this study, we conducted extensive simulations based on 6000 randomly chosen, unrelated Caucasian males from Geisinger's MyCode population to compare the power to detect cis expression-trait associations (within 500 kb of a gene) using the above-described approaches. To test TWAS across varying genetic backgrounds we simulated gene expression and phenotype using different quantitative trait loci per gene and cis-expression /trait heritability under genetic models that differentiate the effect of causality from that of pleiotropy. For each gene, on a training set ranging from 100 to 1000 individuals, we either (a) estimated regression coefficients with gene expression as the response using five different methods: LASSO, elastic net, Bayesian LASSO, Bayesian spike-slab, and Bayesian ridge regression or (b) performed eQTL analysis. We then sampled with replacement 50,000, 150,000, and 300,000 individuals respectively from the testing set of the remaining 5000 individuals and conducted GWAS on each
USDA-ARS?s Scientific Manuscript database
Two hundred thirty-one isolates of P. nicotianae representing 14 populations from different host genera, including agricultural crops (Citrus, Nicotiana, and Lycopersicon), potted ornamental species in nurseries (Lavandula, Convolvulus, Myrtus, Correa and Ruta) and other plant genera of lesser econo...
Li, Zhihua; Fan, Jingyi; Li, Ni; Zhu, Meng; Zhang, Jiahui; Wang, Yuzhuo; Geng, Liguo; Cheng, Yang; Ma, Hongxia; Jin, Guangfu; Dai, Juncheng; Hu, Zhibin; Shen, Hongbing
2018-05-29
Genome-wide association studies (GWAS) and fine mapping studies have identified multiple lung cancer susceptibility variants in TERT-CLPTM1L region. However, it is still unclear about the relationship between these risk variants and the independent lung cancer risk signals in this region. Therefore, we evaluated the independent susceptibility signals for lung cancer and explored the potential functional variants in this region. Sequential conditional analysis was used to detect the independent susceptibility loci based on four lung cancer GWAS datasets with 12,843 lung cases and 12,639 controls. Comprehensively functional annotations were performed for each independent signal. Three independent susceptibility signals were identified in multi-ethnic population. For the first signal, rs2736100 showed the most significant association with lung cancer risk (C > A, OR = 0.82, 95%CI: 0.79-0.85, P = 1.98 × 10 -25 ). Rs36019446 was the top-ranked site (A > G, OR = 0.88, 95%CI: 0.84-0.92, P = 1.74 × 10 -9 ) in the second signal. For the third signal, rs326048 was the leading SNP (A > G, OR = 0.91, 95%CI: 0.87-0.95, P = 1.38 × 10 -5 ). The following subgroup analysis found the same three loci among Asian population. Further, we compared the difference between various subgroup populations. Functional annotations revealed that rs2736100, rs27996 (r 2 = 0.85 with rs36019446) and rs326049 (r 2 = 0.73 with rs326048) could be potential functional variants in these three risk signals, respectively. In conclusion, although multiple variants have been found associated with lung cancer risk in TERT-CLPTM1L region, our findings indicated that there are three independent lung cancer susceptibility signals in this region. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Stefler, Denes; Bobak, Martin
2015-01-01
Difference in fruit and vegetable consumption has been suggested as a possible reason for the large gap in cardiovascular disease (CVD) mortality rates between Eastern and Western European populations. However, individual-level dietary data which allow direct comparison across the two regions are rare. In this systematic review we aimed to answer the question whether cross-national studies with comparable individual-level dietary data reveal any systematic differences in fruit and vegetable consumption between populations in Central and Eastern Europe (CEE) and the Former Soviet Union (FSU) compared to Western Europe (WE). Studies were identified by electronic search of MEDLINE, EMBASE and Web of Science databases from inception to September 2014, and hand search. Studies which reported data on fruit, vegetable consumption or carotene and vitamin C intake or tissue concentrations of adult participants from both CEE/FSU and WE countries were considered for inclusion. Quality of the included studies was assessed by a modified STROBE statement. Power calculation was performed to determine the statistical significance of the comparison results. Twenty-two studies fulfilled the inclusion criteria. Fruit consumption was found to be consistently lower in CEE/FSU participants compared to Western Europeans. Results on vegetable intake were less unambiguous. Antioxidant studies indicated lower concentration of beta-carotene in CEE/FSU subjects, but the results for vitamin C were not consistent. This systematic review suggests that populations in CEE and FSU consume less fruit than Western Europeans. The difference in the consumption of fruit may contribute to the CVD gap between the two regions.
Kenney, M. Cristina; Chwa, Marilyn; Atilano, Shari R.; Falatoonzadeh, Payam; Ramirez, Claudio; Malik, Deepika; Tarek, Mohamed; Cáceres del Carpio, Javier; Nesburn, Anthony B.; Boyer, David S.; Kuppermann, Baruch D.; Vawter, Marquis P.; Jazwinski, S. Michal; Miceli, Michael V.; Wallace, Douglas C.; Udar, Nitin
2015-01-01
The geographic origins of populations can be identified by their maternally inherited mitochondrial DNA (mtDNA) haplogroups. This study compared human cybrids (cytoplasmic hybrids), which are cell lines with identical nuclei but mitochondria from different individuals with mtDNA from either the H haplogroup or L haplogroup backgrounds. The most common European haplogroup is H while individuals of maternal African origin are of the L haplogroup. Despite lower mtDNA copy numbers, L cybrids had higher expression levels for nine mtDNA-encoded respiratory complex genes, decreased ATP turnover rates and lower levels of ROS production, parameters which are consistent with more efficient oxidative phosphorylation. Surprisingly, GeneChip arrays showed that the L and H cybrids had major differences in expression of genes of the canonical complement system (5 genes), dermatan/chondroitin sulfate biosynthesis (5 genes) and CCR3 signaling (9 genes). Quantitative nuclear gene expression studies confirmed that L cybrids had (a) lower expression levels of complement pathway and innate immunity genes and (b) increased levels of inflammation-related signaling genes, which are critical in human diseases. Our data support the hypothesis that mtDNA haplogroups representing populations from different geographic origins may play a role in differential susceptibilities to diseases. PMID:24200652
Cavallari, Marcelo Mattos; Gimenes, Marcos Aparecido; Billot, Claire; Torres, Roseli Buzanelli; Zucchi, Maria Imaculada; Cavalheiro, Alberto Jose; Bouvet, Jean-Marc
2010-10-01
Species delimitation can be problematic, and recently diverged taxa are sometimes viewed as the extremes of a species' continuum in response to environmental conditions. Using population genetic approaches, this study assessed the relationship between two Casearia sylvestris (Salicaceae) varieties, which occur sympatrically and allopatrically in the landscape of south-east Brazil, where intermediate types are also found. In total, 376 individuals from nine populations in four different ecosystems were sampled, and nine microsatellite markers were used to assess the relative effects of the ecosystems and varieties on the distribution of genetic diversity among populations of this species. As a by-product of this study, several PCR products with more than two alleles were observed. The possibility that extra bands represent non-specific amplification or PCR artefacts was discarded by sequencing a sample of these bands. We suggest that (partial) genome duplication in C. sylvestris most probably explains this phenomenon, which may be a key factor in the differentiation of the two taxa, as it was markedly more frequent in one of the varieties. AMOVA indicated that approx. 22 % of the total genetic diversity was found between the two varieties. Bayesian analysis identified varieties and ecosystems as evolutionary units, rather than the individual populations sampled. The results are in agreement with field observations and support the recognition of two varieties, as well as documenting the occurrence of hybridization between them.
Identifying currents in the gene pool for bacterial populations using an integrative approach.
Tang, Jing; Hanage, William P; Fraser, Christophe; Corander, Jukka
2009-08-01
The evolution of bacterial populations has recently become considerably better understood due to large-scale sequencing of population samples. It has become clear that DNA sequences from a multitude of genes, as well as a broad sample coverage of a target population, are needed to obtain a relatively unbiased view of its genetic structure and the patterns of ancestry connected to the strains. However, the traditional statistical methods for evolutionary inference, such as phylogenetic analysis, are associated with several difficulties under such an extensive sampling scenario, in particular when a considerable amount of recombination is anticipated to have taken place. To meet the needs of large-scale analyses of population structure for bacteria, we introduce here several statistical tools for the detection and representation of recombination between populations. Also, we introduce a model-based description of the shape of a population in sequence space, in terms of its molecular variability and affinity towards other populations. Extensive real data from the genus Neisseria are utilized to demonstrate the potential of an approach where these population genetic tools are combined with an phylogenetic analysis. The statistical tools introduced here are freely available in BAPS 5.2 software, which can be downloaded from http://web.abo.fi/fak/mnf/mate/jc/software/baps.html.
Population Structure of Barley Landrace Populations and Gene-Flow with Modern Varieties
Bellucci, Elisa; Bitocchi, Elena; Rau, Domenico; Nanni, Laura; Ferradini, Nicoletta; Giardini, Alessandro; Rodriguez, Monica; Attene, Giovanna; Papa, Roberto
2013-01-01
Landraces are heterogeneous plant varieties that are reproduced by farmers as populations that are subject to both artificial and natural selection. Landraces are distinguished by farmers due to their specific traits, and different farmers often grow different populations of the same landrace. We used simple sequence repeats (SSRs) to analyse 12 barley landrace populations from Sardinia from two collections spanning 10 years. We analysed the population structure, and compared the population diversity of the landraces that were collected at field level (population). We used a representative pool of barley varieties for diversity comparisons and to analyse the effects of gene flow from modern varieties. We found that the Sardinian landraces are a distinct gene pool from those of both two-row and six-row barley varieties. There is also a low, but significant, mean level and population-dependent level of introgression from the modern varieties into the Sardinian landraces. Moreover, we show that the Sardinian landraces have the same level of gene diversity as the representative sample of modern commercial varieties grown in Italy in the last decades, even within population level. Thus, these populations represent crucial sources of germplasm that will be useful for crop improvement and for population genomics studies and association mapping, to identify genes, loci and genome regions responsible for adaptive variations. Our data also suggest that landraces are a source of valuable germplasm for sustainable agriculture in the context of future climate change, and that in-situ conservation strategies based on farmer use can preserve the genetic identity of landraces while allowing adaptation to local environments. PMID:24386303
Scantlebury, Michael; Shanas, Uri; Or-Chen, Keren; Haim, Abraham
2009-12-01
One mechanism for physiological adjustment of small mammals to different habitats and different seasons is by seasonal acclimatization of their osmoregulatory system. We examined the abilities of broad-toothed field mice (Apodemus mystacinus) from different ecosystems ('sub-alpine' and 'Mediterranean') to cope with salinity stress under short day (SD) and long day (LD) photoperiod regimes. We compared urine volume, osmolarity, urea and electrolyte (sodium, potassium and chloride) concentrations. Significant differences were noted in the abilities of mice from the two ecosystems to deal with salinity load; in particular sub-alpine mice produced less concentrated urine than Mediterranean mice with SD- sub-alpine mice seeming to produce particularly dilute urine. Urea concentration generally decreased with increasing salinity, whereas sodium and potassium levels increased, however SD- sub-alpine mice behaved differently and appeared not to be able to excrete electrolytes as effectively as the other groups of mice. Differences observed provide an insight into the kinds of variability that are present within populations inhabiting different ecosystems, thus how populations may be able to respond to potential changes in their environment. Physiological data pertaining to adaptation to increased xeric conditions, as modelled by A. mystacinus, provides valuable information as to how other species may cope with potential climatic challenges.
[Lead intakes by different age-sex population groups from Chinese total diet study in 2000].
Zhang, Lei; Gao, Junquan; Li, Xiaowei
2007-07-01
To estimate the dietary lead intakes by different age-sex population groups in China. The lead concentrations of food sample from 3rd Chinese total diet study were determined, and then were combined with the food consumption by population of ten age-sex groups, The lead intakes, and its distribution and dietary sources were obtained. It was found that the mean and median concentrations of lead in all food samples were 0.118 and 0.052mg/kg, respectively. The highest concentration of individual sample and mean concentrations of lead in preserved egg were 8.964mg/kg and 2.577mg/kg, respectively. The vegetable samples in Hubei Province were heavily contaminated. The lead intakes by different age-sex groups were estimated to be 54.9-112.7microg/day. The average dietary lead intakes by 2-7 years old group could reach 86.1% of PTWI, and individual lead intakes by about 30% children in this group exceed PTWI. But the average dietary lead intakes of other age-sex population groups ranged from 42.8% to 86.1% of PTWI. The main sources of dietary lead were cereals and vegetables in ten age-sex population groups, and could reach 72%-80% of total lead intakes. Although the dietary lead intakes by different age-sex population groups are all lower than PTWI, it should be decreased to a lower level. Moreover, the dietary exposures to lead are higher enough for 2-7 years old children and population in some provinces to be considered seriously.
Bierie, Brian; Pierce, Sarah E.; Kroeger, Cornelia; Stover, Daniel G.; Pattabiraman, Diwakar R.; Thiru, Prathapan; Liu Donaher, Joana; Reinhardt, Ferenc; Chaffer, Christine L.; Keckesova, Zuzana; Weinberg, Robert A.
2017-01-01
Neoplastic cells within individual carcinomas often exhibit considerable phenotypic heterogeneity in their epithelial versus mesenchymal-like cell states. Because carcinoma cells with mesenchymal features are often more resistant to therapy and may serve as a source of relapse, we sought to determine whether such cells could be further stratified into functionally distinct subtypes. Indeed, we find that a basal epithelial marker, integrin-β4 (ITGB4), can be used to enable stratification of mesenchymal-like triple-negative breast cancer (TNBC) cells that differ from one another in their relative tumorigenic abilities. Notably, we demonstrate that ITGB4+ cancer stem cell (CSC)-enriched mesenchymal cells reside in an intermediate epithelial/mesenchymal phenotypic state. Among patients with TNBC who received chemotherapy, elevated ITGB4 expression was associated with a worse 5-year probability of relapse-free survival. Mechanistically, we find that the ZEB1 (zinc finger E-box binding homeobox 1) transcription factor activity in highly mesenchymal SUM159 TNBC cells can repress expression of the epithelial transcription factor TAp63α (tumor protein 63 isoform 1), a protein that promotes ITGB4 expression. In addition, we demonstrate that ZEB1 and ITGB4 are important in modulating the histopathological phenotypes of tumors derived from mesenchymal TNBC cells. Hence, mesenchymal carcinoma cell populations are internally heterogeneous, and ITGB4 is a mechanistically driven prognostic biomarker that can be used to identify the more aggressive subtypes of mesenchymal carcinoma cells in TNBC. The ability to rapidly isolate and mechanistically interrogate the CSC-enriched, partially mesenchymal carcinoma cells should further enable identification of novel therapeutic opportunities to improve the prognosis for high-risk patients with TNBC. PMID:28270621
Bademci, Guney; Lasisi, Akeem; Yariz, Kemal O; Montenegro, Paola; Menendez, Ibis; Vinueza, Rodrigo; Paredes, Rosario; Moreta, Germania; Subasioglu, Asli; Blanton, Susan; Fitoz, Suat; Incesulu, Armagan; Sennaroglu, Levent; Tekin, Mustafa
2015-02-25
Mutations in the POU3F4 gene cause X-linked deafness type 3 (DFN3), which is characterized by inner ear anomalies. Three Turkish, one Ecuadorian, and one Nigerian families were included based on either inner ear anomalies detected in probands or X-linked family histories. Exome sequencing and/or Sanger sequencing were performed in order to identify the causative DNA variants in these families. Four novel, c.707A>C (p.(Glu236Ala)), c.772delG (p.(Glu258ArgfsX30)), c.902C>T (p.(Pro301Leu)), c.987T>C (p.(Ile308Thr)), and one previously reported mutation c.346delG (p.(Ala116ProfsX26)) in POU3F4, were identified. All mutations identified are predicted to affect the POU-specific or POU homeo domains of the protein and co-segregated with deafness in all families. Expanding the spectrum of POU3F4 mutations in different populations along with their associated phenotypes provides better understanding of their clinical importance and will be helpful in clinical evaluation and counseling of the affected individuals.
Singh, Anju; Lester, Chantel; Drapp, Rebecca; Hu, Dorothy Z; Glimcher, Laurie H; Jones, Dallas
2015-02-01
Cell-based bone regeneration strategies offer promise for traumatic bone injuries, congenital defects, non-union fractures and other skeletal pathologies. Postnatal bone remodeling and fracture healing provide evidence that an osteochondroprogenitor cell is present in adult life that can differentiate to remodel or repair the fractured bone. However, cell-based skeletal repair in the clinic is still in its infancy, mostly due to poor characterization of progenitor cells and lack of knowledge about their in vivo behavior. Here, we took a combined approach of high-throughput screening, flow-based cell sorting and in vivo transplantation to isolate markers that identify osteochondroprogenitor cells. We show that the presence of tetraspanin CD9 enriches for osteochondroprogenitors within CD105(+) mesenchymal cells and that these cells readily form bone upon transplantation. In addition, we have used Thy1.2 and the ectonucleotidase CD73 to identify subsets within the CD9(+) population that lead to endochondral or intramembranous-like bone formation. Utilization of this unique cell surface phenotype to enrich for osteochondroprogenitor cells will allow for further characterization of the molecular mechanisms that regulate their osteogenic properties. © 2015. Published by The Company of Biologists Ltd.
Explaining educational differences in sickness absence: a population-based follow-up study.
Kaikkonen, Risto; Härkänen, Tommi; Rahkonen, Ossi; Gould, Raija; Koskinen, Seppo
2015-07-01
There is a marked socioeconomic gradient in sickness absences, but the causes of this gradient are poorly understood. This study examined the role of health and work-related factors as determinants of educational differences in long-term sickness absence in an 8-year follow-up. The study comprised a population-based sample of 5835 Finns aged 30-64 years (participation 89%, N=3946) in a register-based 8-year follow-up. This is a novel method to predict the population average of sickness absence days per working year (DWY) based on the expected outcome values using Poisson and gamma regression models. The difference in the DWY between the lowest and highest educational level was clear among both men (3.2 days/year versus 8.0 days/year) and women (women 4.4 days/year versus 10.1 days/year). Adjusting for physical working conditions, health status and health behavior, and obesity attenuated the differences. Psychosocial working conditions had only a minor effect on the association. After adjusting for health and work-related factors, the difference attenuated by 1.8 days and 2.6 days among men and women, respectively. Our results suggest that improvements in physical working conditions and reducing smoking, particularly among employees with a low level of education, may markedly reduce educational differences in sickness absence.
Identifying Reservoirs of Infection: A Conceptual and Practical Challenge
2002-01-01
Many infectious agents, especially those that cause emerging diseases, infect more than one host species. Managing reservoirs of multihost pathogens often plays a crucial role in effective disease control. However, reservoirs remain variously and loosely defined. We propose that reservoirs can only be understood with reference to defined target populations. Therefore, we define a reservoir as one or more epidemiologically connected populations or environments in which the pathogen can be permanently maintained and from which infection is transmitted to the defined target population. Existence of a reservoir is confirmed when infection within the target population cannot be sustained after all transmission between target and nontarget populations has been eliminated. When disease can be controlled solely by interventions within target populations, little knowledge of potentially complex reservoir infection dynamics is necessary for effective control. We discuss the practical value of different approaches that may be used to identify reservoirs in the field. PMID:12498665
Bruno, Denise M.; Wilson, Tracey E.; Gany, Francesca; Aragones, Abraham
2014-01-01
Objective Minority populations in the United States are disproportionally affected by Human Papillomavirus (HPV) infection and HPV-related cancer. We sought to understand physician practices, knowledge and beliefs that affect utilization of the HPV vaccine in primary care settings serving large minority populations in areas with increased rates of HPV-related cancer. Study Design Cross-sectional survey of randomly selected primary care providers, including pediatricians, family practice physicians and internists, serving large minority populations in Brooklyn, N.Y. and in areas with higher than average cervical cancer rates. Results Of 156 physicians randomly selected, 121 eligible providers responded to the survey; 64% were pediatricians, 19% were internists and 17% were family practitioners. Thirty-four percent of respondents reported that they routinely offered HPV vaccine to their eligible patients. Seventy percent of physicians reported that the lack of preventive care visits for patients in the eligible age group limited their ability to recommend the HPV vaccine and 70% of those who reported this barrier do not routinely recommend HPV vaccine. The lack of time to educate parents about the HPV vaccine and cost of the vaccine to their patients were two commonly reported barriers that affected whether providers offered the vaccine. Conclusions Our study found that the majority of providers serving the highest risk populations for HPV infection and HPV-related cancers are not routinely recommending the HPV vaccine to their patients. Reasons for providers' failure to recommend the HPV vaccine routinely are identified and possible areas for targeted interventions to increase HPV vaccination rates are discussed. PMID:24886959
Honma, Hajime; Suyama, Yoshihisa; Watanabe, Yuki; Matsumoto, Fumio; Nakai, Yutaka
2011-11-01
Eimeria gruis and E. reichenowi cause coccidiosis, a major parasitic disease of cranes. By non-invasive molecular approaches, we investigated the prevalence and genetic characterization of pathogens in two Japanese crane habitats; one is Hokkaido inhabited by the endangered red-crowned crane, and the other is Izumi in Kyushu where populations that consist mainly of vulnerable hooded and white-naped cranes migrate in winter. The non-invasively collected faecal samples from each wintering population were first subjected to host genomic DNA-targeted analyses to determine the sample origin and avoid sample redundancy. Extremely high prevalence was observed in the Izumi populations (> 90%) compared with the Hokkaido population (18-30%) by examining 470 specimens by microscopy and PCR-based capillary electrophoresis (PCR-CE), using genetic markers in the second internal transcribed spacer (ITS2). Correspondence analysis of PCR-CE data revealed differences in community composition of coccidia between hooded and white-naped cranes. 18S rRNA and ITS2 sequences were determined from single oocysts excreted by red-crowned and hooded cranes. Phylogenetic analysis of 18S rRNA suggested that E. reichenowi was polyphyletic while E. gruis was monophyletic. Together with PCR-CE data, these results indicate different host specificity among the E. reichenowi type. Our data suggest that E. reichenowi comprises multiple species. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
Avitan, Ofir; Bahouth, Zaher; Halachmi, Sarel; Shprits, Sagi; Masarwa, Ismail; Sabo, Edmond; Moskovitz, Boaz; Nativ, Ofer
2017-01-01
Pathology of urothelial carcinoma may vary in different populations at diagnosis. Our aim was to evaluate the histopathologic differences between Jewish and Arab patients in Israel at first diagnosis of urothelial cancer. We retrospectively collected data of all patients with confirmed urothelial cancer, treated at our department between January 2010 and January 2015. We examined the distribution of the histopathologic data among the studied populations. To compare the categorical variables we used the Chi-Square Pearson test. Comparison of independent variables was made by Student's t -test. P value below 0.05 was considered significant. The study group included 413 patients, 345 Jews and 68 Arabs. The major differences were that Arab patients were younger (62.61 versus 68.55 years, P = 0.001), had more aggressive tumors that were detected at a more advanced stage, and had also a higher rate of metastatic disease (7.4% versus 3.2%, P = 0.05). Nonurothelial cell tumors were 2.3 times more prevalent in Arab population. Unlike Jewish population, Arab women had higher rate of invasive/metastatic disease compared with Arab men (40% versus 22.4%). At time of diagnosis the tumors were more aggressive in Arab patients, especially in Arab women. The reasons for those differences constitute a target for a separate research. These results should have an impact on prevention medicine and education of physicians treating mixed populations.
McLean, Duncan; Thara, Rangaswamy; John, Sujit; Barrett, Robert; Loa, Peter; McGrath, John; Mowry, Bryan
2014-09-01
There is significant variation in the expression of schizophrenia across ethnically different populations, and the optimal structural and diagnostic representation of schizophrenia are contested. We contrasted both lifetime frequencies of DSM-IV criterion A (the core symptom criterion of the internationally recognized DSM classification system) symptoms and types/content of delusions and hallucinations in transethnic schizophrenia populations from Australia (n = 776), India (n = 504) and Sarawak, Malaysia (n = 259), to elucidate clinical heterogeneity. Differences in both criterion A symptom composition and symptom content were apparent. Indian individuals with schizophrenia reported negative symptoms more frequently than other sites, whereas individuals from Sarawak reported disorganized symptoms more frequently. Delusions of control and thought broadcast, insertion, or withdrawal were less frequent in Sarawak than Australia. Curiously, a subgroup of 20 Indian individuals with schizophrenia reported no lifetime delusions or hallucinations. These findings potentially challenge the long-held view in psychiatry that schizophrenia is fundamentally similar across cultural groups, with differences in only the content of psychotic symptoms, but equivalence in structural form.
García-Fernández, Alfredo; Iriondo, Jose M; Bartels, Dorothea; Escudero, Adrián
2013-01-01
Climate change is imposing warmer and more arid conditions on high-mountain Mediterranean pastures. The severity of these conditions is more intense in lower elevation populations and may be critical for their survival. In this context, we asked whether local adaptation plays an important role in the response of these populations to climate change, and if so, what mechanisms are involved. Previous works, involving reciprocal sowings suggested the existence of local adaptation in lower elevation populations of Silene ciliata, a perennial representative of high-mountain Mediterranean pastures. To determine if this local advantage is due to better adaptation to more intense water stress conditions, an experiment was conducted in which S. ciliata plants from three populations located at different elevations (Low, Intermediate and High) were subjected to severe artificial water stress. Results showed that plants from the Low population had greater tolerance to water stress than plants from the High population in the earliest stages of water shortage. Furthermore, responses of proteins to specific antibodies related to drought were evaluated. Two representative late-embryogenesis abundant (LEA) proteins known to play a role in water stress tolerance were expressed throughout the drought treatment in plants from the three populations, with some pattern differences among individuals within populations. This study detected slight evidence of local adaptation to water stress in populations from different elevations. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.
Locomotor performance of cane toads differs between native-range and invasive populations.
Kosmala, Georgia; Christian, Keith; Brown, Gregory; Shine, Richard
2017-07-01
Invasive species provide a robust opportunity to evaluate how animals deal with novel environmental challenges. Shifts in locomotor performance-and thus the ability to disperse-(and especially, the degree to which it is constrained by thermal and hydric extremes) are of special importance, because they might affect the rate that an invader can spread. We studied cane toads ( Rhinella marina ) across a broad geographical range: two populations within the species' native range in Brazil, two invasive populations on the island of Hawai'i and eight invasive populations encompassing the eastern, western and southern limits of the toad invasion in Australia. A toad's locomotor performance on a circular raceway was strongly affected by both its temperature and its hydration state, but the nature and magnitude of those constraints differed across populations. In their native range, cane toads exhibited relatively low performance (even under optimal test conditions) and a rapid decrease in performance at lower temperatures and hydration levels. At the other extreme, performance was high in toads from southern Australia, and virtually unaffected by desiccation. Hawai'ian toads broadly resembled their Brazilian conspecifics, plausibly reflecting similar climatic conditions. The invasion of Australia has been accompanied by a dramatic enhancement in the toads' locomotor abilities, and (in some populations) by an ability to maintain locomotor performance even when the animal is cold and/or dehydrated. The geographical divergences in performance among cane toad populations graphically attest to the adaptability of invasive species in the face of novel abiotic challenges.
Dawes, Molly; Chen, Chin-Chih; Farmer, Thomas W; Hamm, Jill V
2017-11-01
Patterns of adjustment for youth victimized by peers vary depending on whether youth are identified as victims through self-reports, peer-reports, or both. In order to provide more targeted strategies that may help mitigate negative consequences associated with specific victimization groups, more information is needed about how these youth perceive their school ecology (bullying and academic ecology), their feelings of school belonging, and their valuing of school. Based on the convergence of self- and peer-reports of victimization, we identified four victim groups from a sample of students in 5th grade classrooms (N = 1360; 52.8% girls, 53.1% White, 34.6% Black or Hispanic, 12.2% Native American, Asian, or other) using Latent Profile Analysis (LPA): convergent victims (high self- and peer-reports), self-identified victims (high self-, low peer-reports), peer-identified victims (low self-, high peer-reports), and nonvictims (low self- and peer-reports). Convergent victims' perceptions were similar to nonvictims with key differences being convergent victims' greater willingness to protect peers being bullied but lower feelings of school belonging compared to nonvictims. Peer-identified and self-identified victims perceived differences in the bullying and academic ecology including peer-identified victims' greater willingness to protect peers and expectations for more peers to encourage bulling against them compared to self-identified victims. However, both peer- and self-identified victims perceived greater emotional risk of participating in class and had lower feelings of school belonging compared to nonvictims. Implications for supporting youth with divergent self- and peer-reported victimization status as they transition to middle school are discussed.
Bergroth, T; Ekici, H; Gisslén, M; Hagberg, L; Sönnerborg, A
2009-02-01
The aim of the study was to determine to what extent unique drug resistance patterns appear in minor and major HIV-1 quasispecies in cerebrospinal fluid (CSF) as compared with blood. Forty-four plasma and CSF samples from 13 multi-treatment-experienced patients, seven of whom provided longitudinal samples, were included in the study. The subjects had failed antiretroviral therapy including lamivudine. The reverse transcriptase (RT) gene was examined by selective real-time polymerase chain reaction (SPCR), which can detect M184I/V mutants down to 0.2% of the viral population. SPCR revealed differences at amino acid position 184 in the plasma/CSF populations in 12 paired samples from eight patients. One plasma sample was positive by SPCR where direct sequencing showed wild-type M184. The other 11 paired samples showed quantitative differences in the mixed populations of the mutant or wild-type M184 quasispecies. Differences in other resistance-associated mutations between plasma and CSF viruses were also found by direct sequencing. In multi-treatment-experienced patients with therapy failure, differences in drug resistance patterns were found frequently between plasma and CSF in both minor and major viral populations. To what extent this was a true biological phenomenon remains to be established, and the clinical relevance of these findings is yet to be determined.
Two founding events identified in Asian citrus psyllid populations collected in the Americas
USDA-ARS?s Scientific Manuscript database
A phylogeographic analysis inferred from the partial mitochondrial cytochrome oxidase subunit I gene (COI) (433-bp) was performed with 22 populations (n=121) of Diaphorina citri collected in the Americas. Eight populations (n=46) from four countries in South America and 14 populations (n=75) from f...
Chlamydia prevalence in the general population: is there a sex difference? a systematic review
2013-01-01
Background The focus of Chlamydia trachomatis screening and testing lies more on women than on men. The study aim was to establish by systematic review the prevalence of urogenital Chlamydia trachomatis infection in men and women in the general population. Methods Electronic databases and reference lists were searched from 2000 to 2013 using the key words “Chlamydia trachomatis”, “population-based study” and “disease prevalence”. Reference lists were checked. Studies were included in the analysis if Chlamydia trachomatis prevalence was reported for both men and women in a population-based study. Prevalence rates for men and women were described as well as highest prevalence rate by age and sex. The difference in prevalence between the sexes in each study was calculated. Results Twenty-five studies met the inclusion criteria and quality assessment for the review. In nine of the twenty-five studies there was a statistically significant sex difference in the chlamydia prevalence. In all nine studies the prevalence of chlamydia was higher in women than in men. The prevalence for women varied from 1.1% to 10.6% and for men from 0.1% to 12.1%. The average chlamydia prevalence is highly variable between countries. The highest prevalence of chlamydia occurred predominantly in younger age groups (< 25 years). The absence of symptoms in population-based urogenital chlamydia infection is common in men and women (mean 88.5% versus 68.3%). Conclusions The urogenital chlamydia trachomatis prevalence in the general population is more similar than dissimilar for men and women. A modest sex difference is apparent. The prevalence rates can be used to inform chlamydia screening strategies in general practice. PMID:24215287
Liebenberg, Leandi; L'Abbé, Ericka N; Stull, Kyra E
2015-12-01
The cranium is widely recognized as the most important skeletal element to use when evaluating population differences and estimating ancestry. However, the cranium is not always intact or available for analysis, which emphasizes the need for postcranial alternatives. The purpose of this study was to quantify postcraniometric differences among South Africans that can be used to estimate ancestry. Thirty-nine standard measurements from 11 postcranial bones were collected from 360 modern black, white and coloured South Africans; the sex and ancestry distribution were equal. Group differences were explored with analysis of variance (ANOVA) and Tukey's honestly significant difference (HSD) test. Linear and flexible discriminant analysis (LDA and FDA, respectively) were conducted with bone models as well as numerous multivariate subsets to identify the model and method that yielded the highest correct classifications. Leave-one-out (LDA) and k-fold (k=10; FDA) cross-validation with equal priors were used for all models. ANOVA and Tukey's HSD results reveal statistically significant differences between at least two of the three groups for the majority of the variables, with varying degrees of group overlap. Bone models, which consisted of all measurements per bone, resulted in low accuracies that ranged from 46% to 63% (LDA) and 41% to 66% (FDA). In contrast, the multivariate subsets, which consisted of different variable combinations from all elements, achieved accuracies as high as 85% (LDA) and 87% (FDA). Thus, when using a multivariate approach, the postcranial skeleton can distinguish among three modern South African groups with high accuracy. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Roriz, Mariana; Santos, Carla; Vasconcelos, Marta W
2011-08-01
For a long time it was thought that Bursaphelenchus xylophilus was the only agent of the pine wilt disease. Recently, it was discovered that there are bacteria associated with the nematodes that contribute to the pathogenesis of this disease, mainly through the release of toxins that promote the death of the pines. Among the species most commonly found, are bacteria belonging to the Bacillus, Pantoea, Pseudomonas and Xanthomonas genera. The main objective of this work was to study the effect of inoculation of maritime pine (Pinus pinaster) with four different nematode isolates, in the bacterial population of nematodes and trees, at different stages of disease progression. The monitoring of progression of disease symptoms was also recorded. Also, the identification of bacteria isolated from the xylem of trees and the surface of nematodes was performed by classical identification methods, by the API20E identification system and by sequencing of bacterial DNA. The results showed that for the symptoms progression, the most striking difference was observed for the pines inoculated with the avirulent isolate, C14-5, which led to a slower and less severe aggravation of symptoms than in pines inoculated with the virulent isolates. In general, it was found that bacterial population, inside the tree, increased with disease progression. A superior bacterial quantity was isolated from pines inoculated with the nematode isolates HF and 20, and, comparatively, few bacteria were isolated from pines inoculated with the avirulent isolate. The identification system API20E was insufficient in the identification of bacterial species; Enterobacter cloacae species was identified in 79% of the isolated bacterial colonies and seven of these colonies could not be identified by this method. Molecular identification methods, through bacterial DNA sequencing, allowed a more reliable identification: eleven different bacterial species within the Bacillus, Citrobacter, Enterobacter, Escherichia
Dybala, Kristen E.; Eadie, John M.; Gardali, Thomas; Seavy, Nathaniel E.; Herzog, Mark P.
2013-01-01
Few studies have quantitatively projected changes in demography in response to climate change, yet doing so can provide important insights into the processes that may lead to population declines and changes in species distributions. Using a long-term mark-recapture data set, we examined the influence of multiple direct and indirect effects of weather on adult and juvenile survival for a population of Song Sparrows (Melospiza melodia) in California. We found evidence for a positive, direct effect of winter temperature on adult survival, and a positive, indirect effect of prior rainy season precipitation on juvenile survival, which was consistent with an effect of precipitation on food availability during the breeding season. We used these relationships, and climate projections of significantly warmer and slightly drier winter weather by the year 2100, to project a significant increase in mean adult survival (12-17%) and a slight decrease in mean juvenile survival (4-6%) under the B1 and A2 climate change scenarios. Together with results from previous studies on seasonal fecundity and postfledging survival in this population, we integrated these results in a population model and projected increases in the population growth rate under both climate change scenarios. Our results underscore the importance of considering multiple, direct, and indirect effects of weather throughout the annual cycle, as well as differences in the responses of each life stage to climate change. Projecting demographic responses to climate change can identify not only how populations will be affected by climate change but also indicate the demographic process(es) and specific mechanisms that may be responsible. This information can, in turn, inform climate change adaptation plans, help prioritize future research, and identify where limited conservation resources will be most effectively and efficiently spent.
Pośpiech, Ewelina; Karłowska-Pik, Joanna; Ziemkiewicz, Bartosz; Kukla, Magdalena; Skowron, Małgorzata; Wojas-Pelc, Anna; Branicki, Wojciech
2016-07-01
The genetics of eye colour has been extensively studied over the past few years, and the identified polymorphisms have been applied with marked success in the field of Forensic DNA Phenotyping. A picture that arises from evaluation of the currently available eye colour prediction markers shows that only the analysis of HERC2-OCA2 complex has similar effectiveness in different populations, while the predictive potential of other loci may vary significantly. Moreover, the role of gender in the explanation of human eye colour variation should not be neglected in some populations. In the present study, we re-investigated the data for 1020 Polish individuals and using neural networks and logistic regression methods explored predictive capacity of IrisPlex SNPs and gender in this population sample. In general, neural networks provided higher prediction accuracy comparing to logistic regression (AUC increase by 0.02-0.06). Four out of six IrisPlex SNPs were associated with eye colour in the studied population. HERC2 rs12913832, OCA2 rs1800407 and SLC24A4 rs12896399 were found to be the most important eye colour predictors (p < 0.007) while the effect of rs16891982 in SLC45A2 was less significant. Gender was found to be significantly associated with eye colour with males having ~1.5 higher odds for blue eye colour comparing to females (p = 0.002) and was ranked as the third most important factor in blue/non-blue eye colour determination. However, the implementation of gender into the developed prediction models had marginal and ambiguous impact on the overall accuracy of prediction confirming that the effect of gender on eye colour in this population is small. Our study indicated the advantage of neural networks in prediction modeling in forensics and provided additional evidence for population specific differences in the predictive importance of the IrisPlex SNPs and gender.
Corcuera, Leyre; Gil-Pelegrín, Eustaquio; Notivol, Eduardo
2012-12-01
We studied the intraspecific variability of maritime pine in a set of morphological and physiological traits: soil-to-leaf hydraulic conductance, intrinsic water-use efficiency (WUE, estimated by carbon isotope composition, δ(13)C), root morphology, xylem anatomy, growth and carbon allocation patterns. The data were collected from Pinus pinaster Aiton seedlings (25 half-sib families from five populations) grown in a greenhouse and subjected to water and water-stress treatments. The aims were to relate this variability to differences in water availability at the geographic location of the populations, and to study the potential trade-offs among traits. The drought-stressed seedlings demonstrated a decrease in hydraulic conductance and root surface area and increased WUE and root tip number. The relationships among the growth, morphological, anatomical and physiological traits changed with the scale of study: within the species, among/within populations. The populations showed a highly significant relationship between the percentage reduction in whole-plant hydraulic conductance and WUE. The differences among the populations in root morphology, whole-plant conductance, carbon allocation, plant growth and WUE were significant and consistent with dryness of the site of seed origin. The xeric populations exhibited lower growth and a conservative water use, as opposed to the fast-growing, less water-use-efficient populations from mesic habitats. The xeric and mesic populations, Tamrabta and San Cipriano, respectively, showed the most contrasting traits and were clustered in opposite directions along the main axis in the canonical discriminant analysis under both the control and drought treatments. The results suggest the possibility of selecting the Arenas population, which presents a combination of traits that confer increased growth and drought resistance.
Chi, Guangqing; Ho, Hung Chak
2018-01-01
The past century has witnessed rapidly increasing population-land conflicts due to exponential population growth and its many consequences. Although the measures of population-land conflicts are many, there lacks a model that appropriately considers both the social and physical contexts of population-land conflicts. In this study we introduce the concept of population stress , which identifies areas with populations growing faster than the lands available for sustainable development. Specifically, population stress areas are identified by comparing population growth and land development as measured by land developability in the contiguous United States from 2001 to 2011. Our approach is based on a combination of spatial multicriteria analysis, zonal statistics, and spatiotemporal modeling. We found that the population growth of a county is associated with the decrease of land developability, along with the spatial influences of surrounding counties. The Midwest and the traditional "Deep South" counties would have less population stress with future land development, whereas the Southeast Coast, Washington State, Northern Texas, and the Southwest would face more stress due to population growth that is faster than the loss of suitable lands for development. The factors contributing to population stress may differ from place to place. Our population stress concept is useful and innovative for understanding population stress due to land development and can be applied to other regions as well as global research. It can act as a basis towards developing coherent sustainable land use policies. Coordination among local governments and across different levels of governments in the twenty-first century is a must for effective land use planning.
Cell population data in neonates: differences by age group and associations with perinatal factors.
Lee, J; Kim, S Y; Lee, W; Han, K; Sung, I K
2015-10-01
Cell population data (CPD) describe physical parameters of white blood cell subpopulations and are reported to be of some value in the diagnosis of sepsis in neonates. Before using the CPD for diagnosing sepsis, the baseline features of the CPD distribution in healthy neonates should be clarified. The aim of this study was to compare the CPD distributions of healthy neonates and other age groups and to identify perinatal factors that are associated with changes in the CPD distribution of healthy neonates. The CPD distribution of 69 samples from term neonates was compared with adolescents and adults. The CPD distribution of 163 samples from healthy neonates was analyzed in association with perinatal factors, including gestational age, chronologic age, birthweight, delivery mode, premature rupture of membranes, diabetes, and pregnancy-induced hypertension. The CPD distribution for term neonates was significantly different from those in adolescents and adults. The mean lymphocyte volume showed a negative correlation with gestational age at birth (r = -0.305; P < 0.01). The mean neutrophil volume was smaller in the cesarean section group than in the normal delivery group. The small for gestational age (SGA) group had smaller mean neutrophil volume and mean monocyte volume than the appropriate for gestational age group. The CPD distribution of healthy neonates differed from those of adolescents or adults, and the differences were associated with gestational age, delivery mode, and being SGA. © 2015 John Wiley & Sons Ltd.
Busingye, Doreen; Arabshahi, Simin; Subasinghe, Asvini K; Evans, Roger G; Riddell, Michaela A; Thrift, Amanda G
2014-10-01
Of the 1 billion people with hypertension globally, two-thirds reside in low- and middle-income countries (LMICs). The risk of hypertension in LMICs is thought to be positively associated with socioeconomic status (SES). However, recent studies have provided data inconsistent with this concept. Thus, we assessed the association between SES and hypertension in rural populations of LMICs. Further, we explored whether this association differs according to geographical region. Through a search of databases we identified population-based studies that presented risk estimates for the association between SES, or any of its proxies, and hypertension. Meta-analyses were conducted using a random effects model. Overall, no association was detected between educational status and hypertension, whereas a positive association was observed with income. Interestingly, educational status was inversely associated with hypertension in East Asia {effect size [ES] 0.82 [95% confidence interval (CI) 0.78, 0.87]} but positively associated in South Asia [ES 1.28 (95% CI 1.14, 1.43)]. Higher income, household assets or social class were positively associated with hypertension in South Asia whereas no association was detected in East Asia and Africa. Compared with other occupations, farmers or manual labourers were associated with a lower risk for hypertension. Further, in regions such as Latin America, few studies were identified that fulfilled our inclusion criteria. We provide evidence that the association between hypertension and SES in rural populations of LMICs in Asia varies according to geographical region. This has important implications for targeting intervention strategies aimed at high-risk populations in different geographical regions. © The Author 2014; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association.
Prevalence of contact allergy in the general population in different European regions.
Diepgen, T L; Ofenloch, R F; Bruze, M; Bertuccio, P; Cazzaniga, S; Coenraads, P-J; Elsner, P; Goncalo, M; Svensson, Å; Naldi, L
2016-02-01
Population-based studies about contact allergy are scarce. To obtain reliable estimates of the prevalence of contact allergy in the general population in Europe. A cross-sectional study of a random sample from the general population, aged 18-74 years, in five different European countries (Sweden, the Netherlands, Germany, Italy and Portugal). In total, 12 377 subjects were interviewed and a random sample (n = 3119) patch tested to TRUE Test panels 1-3 and Fragrance Mix (FM) II, hydroxyisohexyl 3-cyclohexene carboxaldehyde (HICC) and sesquiterpene lactone mix. A positive patch test reaction is considered as contact allergy. In total, 27·0% [95% confidence interval (CI) 25·5-28·5] had at least one positive reaction to an allergen of the European baseline series, with a significantly higher prevalence in women than in men. The highest age-standardized prevalences (≥ 1%) were found for nickel (14·5%, 95% CI 13·2-15·8), thiomersal (5·0%, 95% CI 4·2-5·8), cobalt (2·2%, 95% CI 1·7-2·7), FM II (1·9%, 95% CI 1·5-2·5), FM I (1·8%, 95% CI 1·4-2·3), HICC (1·4%, 95% CI 1·0-1·9), p-tert-butylphenol formaldehyde resin (1·3%, 95% CI 0·9-1·7) and para-phenylenediamine (1·0%, 95% CI 0·6-1·3). Only nickel and thiomersal showed a statistically significantly different prevalence for contact allergy among the different European populations. Subjects reporting contact dermatitis in their lifetime (age-standardized prevalence 15·1%, 95% CI 13·8-16·3) had an increased risk for contact allergy (odds ratio 1·9, 95% CI 1·5-2·5). The risk of having a contact allergy was not increased in those with atopic dermatitis (prevalence 7·6%, 95% CI 6·7-8·6; odds ratio 1·0, 95% CI 0·7-1·4). Contact allergy to at least one allergen of the European baseline series was diagnosed in more than one-quarter of the general European population. Therefore measures to improve the primary prevention of contact allergy have to be enforced. © 2015 British Association of
Code of Federal Regulations, 2014 CFR
2014-07-01
... and for what different populations may an eligible application be submitted? 646.10 Section 646.10....10 How many applications may an eligible applicant submit and for what different populations may an... population. (b) For each grant competition, the Secretary designates, in the Federal Register notice inviting...
Code of Federal Regulations, 2012 CFR
2012-07-01
... and for what different populations may an eligible application be submitted? 646.10 Section 646.10....10 How many applications may an eligible applicant submit and for what different populations may an... population. (b) For each grant competition, the Secretary designates, in the Federal Register notice inviting...
Code of Federal Regulations, 2013 CFR
2013-07-01
... and for what different populations may an eligible application be submitted? 646.10 Section 646.10....10 How many applications may an eligible applicant submit and for what different populations may an... population. (b) For each grant competition, the Secretary designates, in the Federal Register notice inviting...
Code of Federal Regulations, 2011 CFR
2011-07-01
... and for what different populations may an eligible application be submitted? 646.10 Section 646.10....10 How many applications may an eligible applicant submit and for what different populations may an... population. (b) For each grant competition, the Secretary designates, in the Federal Register notice inviting...
Carrillo, Juli; McDermott, Daniel; Siemann, Evan
2014-03-01
During introduction, invasive plants can be released from specialist herbivores, but may retain generalist herbivores and encounter novel enemies. For fast-growing invasive plants, tolerance of herbivory via compensatory regrowth may be an important defense against generalist herbivory, but it is unclear whether tolerance responses are specifically induced by different herbivores and whether specificity differs among native and invasive plant populations. We conducted a greenhouse experiment to examine the variation among native and invasive populations of Chinese tallow tree, Triadica sebifera, in their specificity of tolerance responses to herbivores by exposing plants to herbivory from either one of two generalist caterpillars occurring in the introduced range of Triadica. Simultaneously, we measured the specificity of another defensive trait, extrafloral nectar (EFN) production, to detect potential tradeoffs between resistance and tolerance of herbivores. Invasive populations had higher aboveground biomass tolerance than native populations, and responded non-specifically to either herbivore, while native populations had significantly different and specific aboveground biomass responses to the two herbivores. Both caterpillar species similarly induced EFN in native and invasive populations. Plant tolerance and EFN were positively correlated or had no relationship and biomass in control and herbivore-damaged plants was positively correlated, suggesting little costs of tolerance. Relationships among these vegetative traits depended on herbivore type, suggesting that some defense traits may have positive associations with growth-related processes that are differently induced by herbivores. Importantly, loss of specificity in invasive populations indicates subtle evolutionary changes in defenses in invasive plants that may relate to and enhance their invasive success.
Halimaa, Pauliina; Lin, Ya-Fen; Ahonen, Viivi H; Blande, Daniel; Clemens, Stephan; Gyenesei, Attila; Häikiö, Elina; Kärenlampi, Sirpa O; Laiho, Asta; Aarts, Mark G M; Pursiheimo, Juha-Pekka; Schat, Henk; Schmidt, Holger; Tuomainen, Marjo H; Tervahauta, Arja I
2014-03-18
Populations of Noccaea caerulescens show tremendous differences in their capacity to hyperaccumulate and hypertolerate metals. To explore the differences that could contribute to these traits, we undertook SOLiD high-throughput sequencing of the root transcriptomes of three phenotypically well-characterized N. caerulescens accessions, i.e., Ganges, La Calamine, and Monte Prinzera. Genes with possible contribution to zinc, cadmium, and nickel hyperaccumulation and hypertolerance were predicted. The most significant differences between the accessions were related to metal ion (di-, trivalent inorganic cation) transmembrane transporter activity, iron and calcium ion binding, (inorganic) anion transmembrane transporter activity, and antioxidant activity. Analysis of correlation between the expression profile of each gene and the metal-related characteristics of the accessions disclosed both previously characterized (HMA4, HMA3) and new candidate genes (e.g., for nickel IRT1, ZIP10, and PDF2.3) as possible contributors to the hyperaccumulation/tolerance phenotype. A number of unknown Noccaea-specific transcripts also showed correlation with Zn(2+), Cd(2+), or Ni(2+) hyperaccumulation/tolerance. This study shows that N. caerulescens populations have evolved great diversity in the expression of metal-related genes, facilitating adaptation to various metalliferous soils. The information will be helpful in the development of improved plants for metal phytoremediation.
Ortiz, M.; Torres, M.; Muñoz, L.; Fernández-García, E.; Canals, J.; Cabornero, A. I.; Aguilar, E.; Ballesteros, J.; del Amo, J.; García-Sáiz, A.
2006-01-01
The aim of this study is to determine oncogenic human papillomavirus (HPV) types and HPV type 16 (HPV16) variant distribution in two Spanish population groups, commercial sex workers and imprisoned women (CSW/IPW) and the general population. A multicenter cross-sectional study of 1,889 women from five clinical settings in two Spanish cities was conducted from May to November 2004. Oncogenic HPV infection was tested by an Hybrid Capture II (HC2) test, and positive samples were genotyped by direct sequencing using three different primer sets in L1 (MY09/11 and GP5+/GP6+) and E6/E7. HPV16 variants were identified by sequencing the E6, E2, and L1 regions. Four hundred twenty-five samples were positive for the HC2 test, 31.5% from CSW/IPW and 10.7% from the general population. HPV16 was the most frequent type. Distinct profiles of oncogenic HPV type prevalence were observed across the two populations. In order of decreasing frequency, HPV types 16, 31, 58, 66, 56, and 18 were most frequent in CSW/IPW women, and types 16, 31, 52, 68, 51, and 53 were most frequent in the general population. We analyzed HPV16 intratype variants, and a large majority (78.7%) belonged to the European lineage. AA variants were detected in 16.0% of cases. African variants belonging to classes Af1 (4.0%) and Af2 (1.3%) were detected. Different HPV types and HPV16 intratype variants are involved in oncogenic HPV infections in our population. These results suggest that HPV type distribution differs in CSW/IPW women and in the general population, although further analysis is necessary. PMID:16597872
Ortiz, M; Torres, M; Muñoz, L; Fernández-García, E; Canals, J; Cabornero, A I; Aguilar, E; Ballesteros, J; Del Amo, J; García-Sáiz, A
2006-04-01
The aim of this study is to determine oncogenic human papillomavirus (HPV) types and HPV type 16 (HPV16) variant distribution in two Spanish population groups, commercial sex workers and imprisoned women (CSW/IPW) and the general population. A multicenter cross-sectional study of 1,889 women from five clinical settings in two Spanish cities was conducted from May to November 2004. Oncogenic HPV infection was tested by an Hybrid Capture II (HC2) test, and positive samples were genotyped by direct sequencing using three different primer sets in L1 (MY09/11 and GP5+/GP6+) and E6/E7. HPV16 variants were identified by sequencing the E6, E2, and L1 regions. Four hundred twenty-five samples were positive for the HC2 test, 31.5% from CSW/IPW and 10.7% from the general population. HPV16 was the most frequent type. Distinct profiles of oncogenic HPV type prevalence were observed across the two populations. In order of decreasing frequency, HPV types 16, 31, 58, 66, 56, and 18 were most frequent in CSW/IPW women, and types 16, 31, 52, 68, 51, and 53 were most frequent in the general population. We analyzed HPV16 intratype variants, and a large majority (78.7%) belonged to the European lineage. AA variants were detected in 16.0% of cases. African variants belonging to classes Af1 (4.0%) and Af2 (1.3%) were detected. Different HPV types and HPV16 intratype variants are involved in oncogenic HPV infections in our population. These results suggest that HPV type distribution differs in CSW/IPW women and in the general population, although further analysis is necessary.
Halachmi, Sarel; Shprits, Sagi; Masarwa, Ismail; Sabo, Edmond; Moskovitz, Boaz; Nativ, Ofer
2017-01-01
Background Pathology of urothelial carcinoma may vary in different populations at diagnosis. Our aim was to evaluate the histopathologic differences between Jewish and Arab patients in Israel at first diagnosis of urothelial cancer. Patients and Methods We retrospectively collected data of all patients with confirmed urothelial cancer, treated at our department between January 2010 and January 2015. We examined the distribution of the histopathologic data among the studied populations. To compare the categorical variables we used the Chi-Square Pearson test. Comparison of independent variables was made by Student's t-test. P value below 0.05 was considered significant. Results The study group included 413 patients, 345 Jews and 68 Arabs. The major differences were that Arab patients were younger (62.61 versus 68.55 years, P = 0.001), had more aggressive tumors that were detected at a more advanced stage, and had also a higher rate of metastatic disease (7.4% versus 3.2%, P = 0.05). Nonurothelial cell tumors were 2.3 times more prevalent in Arab population. Unlike Jewish population, Arab women had higher rate of invasive/metastatic disease compared with Arab men (40% versus 22.4%). Conclusion At time of diagnosis the tumors were more aggressive in Arab patients, especially in Arab women. The reasons for those differences constitute a target for a separate research. These results should have an impact on prevention medicine and education of physicians treating mixed populations. PMID:28812022
Friedrich, Deise C.; Santos, Sidney E. B.; Ribeiro-dos-Santos, Ândrea K. C.; Hutz, Mara H.
2012-01-01
Adult-type hypolactasia is a common phenotype caused by the lactase enzyme deficiency. The −13910 C>T polymorphism, located 14 Kb upstream of the lactase gene (LCT) in the MCM6 gene was associated with lactase persistence (LP) in Europeans. This polymorphism is rare in Africa but several other variants associated with lactase persistence were observed in Africans. The aims of this study were to identify polymorphisms in the MCM6 region associated with the lactase persistence phenotype and to determine the distribution of LCT gene haplotypes in 981 individuals from North, Northeast and South Brazil. These polymorphisms were genotyped by PCR based methods and sequencing. The −13779*C,−13910*T, −13937*A, −14010*C, −14011*T LP alleles previously described in the MCM6 gene region that acts as an enhancer for the LCT gene were identified in Brazilians. The most common LP allele was −13910*T. Its frequency was highly correlated with European ancestry in the Brazilian populations investigated. The −13910*T was higher (0.295) in southern Brazilians of European ancestry and lower (0.175) in the Northern admixed population. LCT haplotypes were derived from the 10 LCT SNPs genotyped. Overall twenty six haplotypes previously described were identified in the four Brazilian populations studied. The Multidimensional Scaling analysis showed that Belém, in the north, was closer to Amerindians. Northeastern and southern Afro-descendants were more related with Bantu-speaking South Africans whereas the Southern population with European ancestry grouped with Southern and Northern Europeans. This study shows a high variability considering the number of LCT haplotypes observed. Due to the highly admixed nature of the Brazilian populations, the diagnosis of hypolactasia in Brazil, based only in the investigation of the −13910*T allele is an oversimplification. PMID:23029545
Genetically distinct genogroup IV norovirus strains identified in wastewater.
Kitajima, Masaaki; Rachmadi, Andri T; Iker, Brandon C; Haramoto, Eiji; Gerba, Charles P
2016-12-01
We investigated the prevalence and genetic diversity of genogroup IV norovirus (GIV NoV) strains in wastewater in Arizona, United States, over a 13-month period. Among 50 wastewater samples tested, GIV NoVs were identified in 13 (26 %) of the samples. A total of 47 different GIV NoV strains were identified, which were classified into two genetically distinct clusters: the GIV.1 human cluster and a unique genetic cluster closely related to strains previously identified in Japanese wastewater. The results provide additional evidence of the considerable genetic diversity among GIV NoV strains through the analysis of wastewater containing virus strains shed from all populations.
Lee, Sewon; Lee, Kiyoung
2017-06-22
Time location patterns are a significant factor for exposure assessment models of air pollutants. Factors associated with time location patterns in urban populations are typically due to high air pollution levels in urban areas. The objective of this study was to determine the seasonal differences in time location patterns in two urban cities. A Time Use Survey of Korean Statistics (KOSTAT) was conducted in the summer, fall, and winter of 2014. Time location data from Seoul and Busan were collected, together with demographic information obtained by diaries and questionnaires. Determinants of the time spent at each location were analyzed by multiple linear regression and the stepwise method. Seoul and Busan participants had similar time location profiles over the three seasons. The time spent at own home, other locations, workplace/school and during walk were similar over the three seasons in both the Seoul and Busan participants. The most significant time location pattern factors were employment status, age, gender, monthly income, and spouse. Season affected the time spent at the workplace/school and other locations in the Seoul participants, but not in the Busan participants. The seasons affected each time location pattern of the urban population slightly differently, but overall there were few differences.
Delaney, Jessica T; Jeff, Janina M; Brown, Nancy J; Pretorius, Mias; Okafor, Henry E; Darbar, Dawood; Roden, Dan M; Crawford, Dana C
2012-01-01
Despite a greater burden of risk factors, atrial fibrillation (AF) is less common among African Americans than European-descent populations. Genome-wide association studies (GWAS) for AF in European-descent populations have identified three predominant genomic regions associated with increased risk (1q21, 4q25, and 16q22). The contribution of these loci to AF risk in African American is unknown. We studied 73 African Americans with AF from the Vanderbilt-Meharry AF registry and 71 African American controls, with no history of AF including after cardiac surgery. Tests of association were performed for 148 SNPs across the three regions associated with AF, and 22 SNPs were significantly associated with AF (P<0.05). The SNPs with the strongest associations in African Americans were both different from the index SNPs identified in European-descent populations and independent from the index European-descent population SNPs (r(2)<0.40 in HapMap CEU): 1q21 rs4845396 (odds ratio [OR] 0.30, 95% confidence interval [CI] 0.13-0.67, P = 0.003), 4q25 rs4631108 (OR 3.43, 95% CI 1.59-7.42, P = 0.002), and 16q22 rs16971547 (OR 8.1, 95% CI 1.46-45.4, P = 0.016). Estimates of European ancestry were similar among cases (23.6%) and controls (23.8%). Accordingly, the probability of having two copies of the European derived chromosomes at each region did not differ between cases and controls. Variable European admixture at known AF loci does not explain decreased AF susceptibility in African Americans. These data support the role of 1q21, 4q25, and 16q22 variants in AF risk for African Americans, although the index SNPs differ from those identified in European-descent populations.
Nikolić, Biljana; Ristić, Mihailo; Bojović, Srdjan; Marin, Petar D
2008-07-01
The essential-oil composition of Pinus peuce Griseb. is reported at the population level. Macedonian pine is endemic high-mountain Balkan pine relict of an anthropogenically reduced area, with large morphological diversity and insufficiently clear taxonomic position. In the pine-needle terpene profile of two populations from Montenegro and one from Serbia, 78 compounds were detected, 56 of which are identified (Table 3). The dominant constituents were alpha-pinene (36.5%) and germacrene D (11.4%). The following 20 additional components were found to be present in medium-to-high amounts (0.5-10%): camphene (8.5%), bornyl acetate (6.8%), beta-pinene (6.8%), beta-caryophyllene (5.2%), beta-phellandrene (4.7%), terpinen-4-ol acetate (1.6%), (E)-hex-2-enal (1.5%), alpha-muurolene (1.2%), beta-gurjunene (1.1%), beta-myrcene (1.0%), alpha-terpinyl acetate (0.9%), alpha-phellandrene (0.8%), delta-cadinene (0.8%), alpha-humulene (0.8%), sabinene (0.7%), aromadendrene (0.6%), alpha-thujene (0.6%), gamma-muurolene (0.6%), gamma-cadinene (0.6%), alpha-terpinolene (0.5%), and one unknown component (0.5%). The similarity of the populations and the within-population variability were visualized by principle-component analysis (PCA) and genetic analysis of selected terpenes in 90 tree samples. Our study suggests a closer connection between populations II and III compared to population I. Based on the profile of the main terpene components, the studied populations are more similar to populations from Kosovo and Greece than to the population from Mt. Mokra (Montenegro) and the population in France.
Predazzi, Irene M; Martínez-Labarga, Cristina; Vecchione, Lucia; Mango, Ruggiero; Ciccacci, Cinzia; Amati, Francesca; Ottoni, Claudio; Crawford, Michael H; Rickards, Olga; Romeo, Francesco; Novelli, Giuseppe
2010-04-01
Several studies have demonstrated a link between cardiovascular disease (CVD) susceptibility and the genetic background of populations. Endothelial activation and dysfunction induced by oxidized low-density lipoprotein (ox-LDL) is one of the key steps in the initiation of atherosclerosis. The oxidized low density lipoprotein (lectin-like) receptor 1 (OLR1) gene is the main receptor of ox-LDL. We have previously characterized two polymorphisms (rs3736235 and rs11053646) associated with the risk for coronary artery disease (CAD) and acute myocardial infarction (AMI). Given their clinical significance, it is of interest to know the distribution of these variants in populations from different continents. A total of 1229 individuals from 17 different African, Asian and European populations was genotyped for the two considered markers. The high frequencies of ancestral alleles in South-Saharan populations is concordant with the African origin of our species. The results highlight that African populations are closer to Asians, and clearly separated from the Europeans. The results confirm significant genetic structuring among populations and suggest a possible basis for varying susceptibility to CVD among groups correlated with the geographical location of populations linked with the migrations out of Africa, or with different lifestyle.
Metabolic indicators of habitat differences in four Minnesota deer populations
Seal, U.S.; Nelson, M.E.; Mech, L.D.; Hoskinson, R.L.
1978-01-01
Blood samples were collected from 40 white-tailed deer (Odocoileus virginianus) from 4 winter yards in northeastern Minnesota from 17 March 1974 through 23 April 1975. The results of 26 blood assays were examined for the effects of age, sex, capture date, capture method, disease and location. Age-related effects were found for serum chloride, calcium, gamma globulin, creatine phosphokinase (CPK), lactic dehydrogenase (LDH), and alkaline phosphatase. The only sex difference was lower CPK in males. Date of collection effects were found for erythrocyte count, mean corpuscular volume (MCV), serum glucose, and nonesterified fatty acids (NEF A). Capture method affected serum glucose, acid base balance, and serum enzymes. Effects related primarily to capture location or habitat differences were found for erythrocyte count, MCV, mean corpuscular hemoglobin concentration (MCHC), serum urea, cholesterol, LDH, thyroxine, and NEF A. Animals whose assays indicated the poorest nutritional status inhabited wintering areas with the oldest vegetation. Habitat differences can be detected by measuring the physiological status of the local animal populations.
Estrada-Gómez, Sebastian; Vargas-Muñoz, Leidy Johana; Saldarriaga-Córdoba, Mónica; Cifuentes, Yeimy; Perafan, Carlos
2017-04-01
Theraphosidae spider venoms are well known for possess a complex mixture of protein and non-protein compounds in their venom. The objective of this study was to report and identify different proteins translated from the venom gland DNA information of the recently described Theraphosidae spider Pamphobeteus verdolaga. Using a venom gland transcriptomic analysis, we reported a set of the first complete sequences of seven different proteins of the recenlty described Theraphosidae spider P. verdolaga. Protein analysis indicates the presence of different proteins on the venom composition of this new spider, some of them uncommon in the Theraphosidae family. MS/MS analysis of P. verdolaga showed different fragments matching sphingomyelinases (sicaritoxin), barytoxins, hexatoxins, latroinsectotoxins, and linear (zadotoxins) peptides. Only four of the MS/MS fragments showed 100% sequence similarity with one of the transcribed proteins. Transcriptomic analysis showed the presence of different groups of proteins like phospholipases, hyaluronidases, inhibitory cysteine knots (ICK) peptides among others. The three database of protein domains used in this study (Pfam, SMART and CDD) showed congruency in the search of unique conserved protein domain for only four of the translated proteins. Those proteins matched with EF-hand proteins, cysteine rich secretory proteins, jingzhaotoxins, theraphotoxins and hexatoxins, from different Mygalomorphae spiders belonging to the families Theraphosidae, Barychelidae and Hexathelidae. None of the analyzed sequences showed a complete 100% similarity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Rand, Kristin A; Song, Chi; Dean, Eric; Serie, Daniel J; Curtin, Karen; Sheng, Xin; Hu, Donglei; Huff, Carol Ann; Bernal-Mizrachi, Leon; Tomasson, Michael H; Ailawadhi, Sikander; Singhal, Seema; Pawlish, Karen; Peters, Edward S; Bock, Cathryn H; Stram, Alex; Van Den Berg, David J; Edlund, Christopher K; Conti, David V; Zimmerman, Todd; Hwang, Amie E; Huntsman, Scott; Graff, John; Nooka, Ajay; Kong, Yinfei; Pregja, Silvana L; Berndt, Sonja I; Blot, William J; Carpten, John; Casey, Graham; Chu, Lisa; Diver, W Ryan; Stevens, Victoria L; Lieber, Michael R; Goodman, Phyllis J; Hennis, Anselm J M; Hsing, Ann W; Mehta, Jayesh; Kittles, Rick A; Kolb, Suzanne; Klein, Eric A; Leske, Cristina; Murphy, Adam B; Nemesure, Barbara; Neslund-Dudas, Christine; Strom, Sara S; Vij, Ravi; Rybicki, Benjamin A; Stanford, Janet L; Signorello, Lisa B; Witte, John S; Ambrosone, Christine B; Bhatti, Parveen; John, Esther M; Bernstein, Leslie; Zheng, Wei; Olshan, Andrew F; Hu, Jennifer J; Ziegler, Regina G; Nyante, Sarah J; Bandera, Elisa V; Birmann, Brenda M; Ingles, Sue A; Press, Michael F; Atanackovic, Djordje; Glenn, Martha J; Cannon-Albright, Lisa A; Jones, Brandt; Tricot, Guido; Martin, Thomas G; Kumar, Shaji K; Wolf, Jeffrey L; Deming Halverson, Sandra L; Rothman, Nathaniel; Brooks-Wilson, Angela R; Rajkumar, S Vincent; Kolonel, Laurence N; Chanock, Stephen J; Slager, Susan L; Severson, Richard K; Janakiraman, Nalini; Terebelo, Howard R; Brown, Elizabeth E; De Roos, Anneclaire J; Mohrbacher, Ann F; Colditz, Graham A; Giles, Graham G; Spinelli, John J; Chiu, Brian C; Munshi, Nikhil C; Anderson, Kenneth C; Levy, Joan; Zonder, Jeffrey A; Orlowski, Robert Z; Lonial, Sagar; Camp, Nicola J; Vachon, Celine M; Ziv, Elad; Stram, Daniel O; Hazelett, Dennis J; Haiman, Christopher A; Cozen, Wendy
2016-12-01
Genome-wide association studies (GWAS) in European populations have identified genetic risk variants associated with multiple myeloma. We performed association testing of common variation in eight regions in 1,318 patients with multiple myeloma and 1,480 controls of European ancestry and 1,305 patients with multiple myeloma and 7,078 controls of African ancestry and conducted a meta-analysis to localize the signals, with epigenetic annotation used to predict functionality. We found that variants in 7p15.3, 17p11.2, 22q13.1 were statistically significantly (P < 0.05) associated with multiple myeloma risk in persons of African ancestry and persons of European ancestry, and the variant in 3p22.1 was associated in European ancestry only. In a combined African ancestry-European ancestry meta-analysis, variation in five regions (2p23.3, 3p22.1, 7p15.3, 17p11.2, 22q13.1) was statistically significantly associated with multiple myeloma risk. In 3p22.1, the correlated variants clustered within the gene body of ULK4 Correlated variants in 7p15.3 clustered around an enhancer at the 3' end of the CDCA7L transcription termination site. A missense variant at 17p11.2 (rs34562254, Pro251Leu, OR, 1.32; P = 2.93 × 10 -7 ) in TNFRSF13B encodes a lymphocyte-specific protein in the TNF receptor family that interacts with the NF-κB pathway. SNPs correlated with the index signal in 22q13.1 cluster around the promoter and enhancer regions of CBX7 CONCLUSIONS: We found that reported multiple myeloma susceptibility regions contain risk variants important across populations, supporting the use of multiple racial/ethnic groups with different underlying genetic architecture to enhance the localization and identification of putatively functional alleles. A subset of reported risk loci for multiple myeloma has consistent effects across populations and is likely to be functional. Cancer Epidemiol Biomarkers Prev; 25(12); 1609-18. ©2016 AACR. ©2016 American Association for Cancer Research.
Global diversity, population stratification, and selection of human copy number variation
Sudmant, Peter H.; Mallick, Swapan; Nelson, Bradley J.; Hormozdiari, Fereydoun; Krumm, Niklas; Huddleston, John; Coe, Bradley P.; Baker, Carl; Nordenfelt, Susanne; Bamshad, Michael; Jorde, Lynn B.; Posukh, Olga L.; Sahakyan, Hovhannes; Watkins, W. Scott; Yepiskoposyan, Levon; Abdullah, M. Syafiq; Bravi, Claudio M.; Capelli, Cristian; Hervig, Tor; Wee, Joseph T. S.; Tyler-Smith, Chris; van Driem, George; Romero, Irene Gallego; Jha, Aashish R.; Karachanak-Yankova, Sena; Toncheva, Draga; Comas, David; Henn, Brenna; Kivisild, Toomas; Ruiz-Linares, Andres; Sajantila, Antti; Metspalu, Ene; Parik, Jüri; Villems, Richard; Starikovskaya, Elena B.; Ayodo, George; Beall, Cynthia M.; Di Rienzo, Anna; Hammer, Michael; Khusainova, Rita; Khusnutdinova, Elza; Klitz, William; Winkler, Cheryl; Labuda, Damian; Metspalu, Mait; Tishkoff, Sarah A.; Dryomov, Stanislav; Sukernik, Rem; Patterson, Nick; Reich, David; Eichler, Evan E.
2015-01-01
In order to explore the diversity and selective signatures of duplication and deletion human copy number variants (CNVs), we sequenced 236 individuals from 125 distinct human populations. We observed that duplications exhibit fundamentally different population genetic and selective signatures than deletions and are more likely to be stratified between human populations. Through reconstruction of the ancestral human genome, we identify megabases of DNA lost in different human lineages and pinpoint large duplications that introgressed from the extinct Denisova lineage now found at high frequency exclusively in Oceanic populations. We find that the proportion of CNV base pairs to single nucleotide variant base pairs is greater among non-Africans than it is among African populations, but we conclude that this difference is likely due to unique aspects of non-African population history as opposed to differences in CNV load. PMID:26249230
Population Genomics of the Euryhaline Teleost Poecilia latipinna
Hoover, D.; Travis, J.; Oleksiak, M. F.; Crawford, D. L.
2015-01-01
Global climate change and increases in sea levels will affect coastal marine communities. The conservation of these ecologically important areas will be a challenge because of their wide geographic distribution, ecological diversity and species richness. To address this problem, we need to better understand how the genetic variation of the species in these communities is distributed within local populations, among populations and between distant regions. In this study we apply genotyping by sequencing (GBS) and examine 955 SNPs to determine Sailfin molly (Poecilia latipinna) genetic diversity among three geographically close mangrove salt marsh flats in the Florida Keys compared to populations in southern and northern Florida. The questions we are asking are whether there is sufficient genetic variation among isolated estuarine fish within populations and whether there are significant divergences among populations. Additionally, we want to know if GBS approaches agree with previous studies using more traditional molecular approaches. We are able to identify large genetic diversity within each saltmarsh community (π ≈ 36%). Additionally, among the Florida Key populations and the mainland or between southern and northern Florida regions, there are significant differences in allele frequencies seen in population structure and evolutionary relationships among individuals. Surprisingly, even though the cumulative FST value using all 955 SNPs within the three Florida Key populations is small, there are 29 loci with significant FST values, and 11 of these were outliers suggestive of adaptive divergence. These data suggest that among the salt marsh flats surveyed here, there is significant genetic diversity within each population and small but significant differences among populations. Much of the genetic variation within and among populations found here with GBS is very similar to previous studies using allozymes and microsatellites. However, the meaningful difference
Population Genomics of the Euryhaline Teleost Poecilia latipinna.
Nunez, J C B; Seale, T P; Fraser, M A; Burton, T L; Fortson, T N; Hoover, D; Travis, J; Oleksiak, M F; Crawford, D L
2015-01-01
Global climate change and increases in sea levels will affect coastal marine communities. The conservation of these ecologically important areas will be a challenge because of their wide geographic distribution, ecological diversity and species richness. To address this problem, we need to better understand how the genetic variation of the species in these communities is distributed within local populations, among populations and between distant regions. In this study we apply genotyping by sequencing (GBS) and examine 955 SNPs to determine Sailfin molly (Poecilia latipinna) genetic diversity among three geographically close mangrove salt marsh flats in the Florida Keys compared to populations in southern and northern Florida. The questions we are asking are whether there is sufficient genetic variation among isolated estuarine fish within populations and whether there are significant divergences among populations. Additionally, we want to know if GBS approaches agree with previous studies using more traditional molecular approaches. We are able to identify large genetic diversity within each saltmarsh community (π ≈ 36%). Additionally, among the Florida Key populations and the mainland or between southern and northern Florida regions, there are significant differences in allele frequencies seen in population structure and evolutionary relationships among individuals. Surprisingly, even though the cumulative FST value using all 955 SNPs within the three Florida Key populations is small, there are 29 loci with significant FST values, and 11 of these were outliers suggestive of adaptive divergence. These data suggest that among the salt marsh flats surveyed here, there is significant genetic diversity within each population and small but significant differences among populations. Much of the genetic variation within and among populations found here with GBS is very similar to previous studies using allozymes and microsatellites. However, the meaningful difference
Kikuchi, Hiroyuki; Takamiya, Tomoko; Odagiri, Yuko; Ohya, Yumiko; Shimomitsu, Teruichi; Inoue, Shigeru
2013-12-01
Examining the sociodemographic determinants of psychological distress is important in identifying specific subgroups in need of further intervention. However, there are few studies focusing on older populations and on the role of gender or location of residence. To try to clarify characteristics of a population at high risk for mental illness, we examined the sociodemographic determinants of psychological distress in older adults living in three different locations. A mail survey was used to collect data on levels of psychological distress and sociodemographic characteristics from a population-based sample of 1894 older adults who lived in Bunkyo (urban setting), Fuchu (suburban setting) and Oyama (rural setting) in Japan (aged 65-74 years, 51.3% men). Psychological distress level was measured based on Kessler's six-item psychological distress scale (K6) and dichotomized into two groups with a cut-off score of 5 (0-4 or 5-24). Multiple logistic regression analyses were used to examine the associations between sociodemographic factors, specifically gender and location of residence, and psychological distress levels. The variables of older age, living in Bunkyo, living in Oyama and living alone were significantly associated with high psychological distress. Although these associations were observed in men, no associations were observed in women. Location-specific analyses showed significant associations between sociodemographic and psychological distress among men living in Oyama, but not among those in Bunkyo or Fuchu. Sociodemographic factors were significantly correlated with psychological distress, particularly among older men in rural areas. Characteristics of a population at high risk for mental illness may vary based on gender and location of residence. Health promotion initiatives for older adults may be more effective if they take these demographic factors into account. © 2013 The Authors. Psychogeriatrics © 2013 Japanese Psychogeriatric Society.
Sex differences in knee joint loading: Cross-sectional study in geriatric population.
Ro, Du Hyun; Lee, Dong Yeon; Moon, Giho; Lee, Sahnghoon; Seo, Sang Gyo; Kim, Seong Hwan; Park, In Woong; Lee, Myung Chul
2017-06-01
This study investigated sex differences in knee biomechanics and investigated determinants for difference in a geriatric population. Age-matched healthy volunteers (42 males and 42 females, average age 65 years) without knee OA were included in the study. Subjects underwent physical examination on their knee and standing full-limb radiography for anthropometric measurements. Linear, kinetic, and kinematic parameters were compared using a three-dimensional, 12-camera motion capture system. Gait parameters were evaluated and determinants for sex difference were evaluated with multiple regression analysis. Females had a higher peak knee adduction moment (KAM) during gait (p = 0.004). Females had relatively wider pelvis and narrower step width (both p < 0.001). However, coronal knee alignment was not significantly different between the sexes. Multiple regression analysis revealed that coronal alignment (b = 0.014, p < 0.001), step width (b = -0.010, p = 0.011), and pelvic width/height ratio (b = 1.703, p = 0.046) were significant determinants of peak KAM. Because coronal alignment was not different between the sexes, narrow step width and high pelvic width/height ratio of female were the main contributors to higher peak KAM in females. Sex differences in knee biomechanics were present in the geriatric population. Increased mechanical loading on the female knee, which was associated with narrow step width and wide pelvis, may play an important role in future development and progression of OA. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1283-1289, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Identifying environmental correlates of intraspecific genetic variation.
Harrisson, K A; Yen, J D L; Pavlova, A; Rourke, M L; Gilligan, D; Ingram, B A; Lyon, J; Tonkin, Z; Sunnucks, P
2016-09-01
Genetic variation is critical to the persistence of populations and their capacity to adapt to environmental change. The distribution of genetic variation across a species' range can reveal critical information that is not necessarily represented in species occurrence or abundance patterns. We identified environmental factors associated with the amount of intraspecific, individual-based genetic variation across the range of a widespread freshwater fish species, the Murray cod Maccullochella peelii. We used two different approaches to statistically quantify the relative importance of predictor variables, allowing for nonlinear relationships: a random forest model and a Bayesian approach. The latter also accounted for population history. Both approaches identified associations between homozygosity by locus and both disturbance to the natural flow regime and mean annual flow. Homozygosity by locus was negatively associated with disturbance to the natural flow regime, suggesting that river reaches with more disturbed flow regimes may support larger, more genetically diverse populations. Our findings are consistent with the hypothesis that artificially induced perennial flows in regulated channels may provide greater and more consistent habitat and reduce the frequency of population bottlenecks that can occur frequently under the highly variable and unpredictable natural flow regime of the system. Although extensive river regulation across eastern Australia has not had an overall positive effect on Murray cod numbers over the past century, regulation may not represent the primary threat to Murray cod survival. Instead, pressures other than flow regulation may be more critical to the persistence of Murray cod (for example, reduced frequency of large floods, overfishing and chemical pollution).
Genome-wide evidence for divergent selection between populations of a major agricultural pathogen.
Hartmann, Fanny E; McDonald, Bruce A; Croll, Daniel
2018-06-01
The genetic and environmental homogeneity in agricultural ecosystems is thought to impose strong and uniform selection pressures. However, the impact of this selection on plant pathogen genomes remains largely unknown. We aimed to identify the proportion of the genome and the specific gene functions under positive selection in populations of the fungal wheat pathogen Zymoseptoria tritici. First, we performed genome scans in four field populations that were sampled from different continents and on distinct wheat cultivars to test which genomic regions are under recent selection. Based on extended haplotype homozygosity and composite likelihood ratio tests, we identified 384 and 81 selective sweeps affecting 4% and 0.5% of the 35 Mb core genome, respectively. We found differences both in the number and the position of selective sweeps across the genome between populations. Using a XtX-based outlier detection approach, we identified 51 extremely divergent genomic regions between the allopatric populations, suggesting that divergent selection led to locally adapted pathogen populations. We performed an outlier detection analysis between two sympatric populations infecting two different wheat cultivars to identify evidence for host-driven selection. Selective sweep regions harboured genes that are likely to play a role in successfully establishing host infections. We also identified secondary metabolite gene clusters and an enrichment in genes encoding transporter and protein localization functions. The latter gene functions mediate responses to environmental stress, including interactions with the host. The distinct gene functions under selection indicate that both local host genotypes and abiotic factors contributed to local adaptation. © 2018 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.
2012-01-01
Background Health economics is increasingly used to inform resource allocation decision-making, however, there is comparatively little evidence relevant to minority groups. In part, this is due to lack of cost and effectiveness data specific to these groups upon which economic evaluations can be based. Consequently, resource allocation decisions often rely on mainstream evidence which may not be representative, resulting in inequitable funding decisions. This paper describes a method to overcome this deficiency for Australia’s Indigenous population. A template has been developed which can adapt mainstream health intervention data to the Indigenous setting. Methods The ‘Indigenous Health Service Delivery Template’ has been constructed using mixed methods, which include literature review, stakeholder discussions and key informant interviews. The template quantifies the differences in intervention delivery between best practice primary health care for the Indigenous population via Aboriginal Community Controlled Health Services (ACCHSs), and mainstream general practitioner (GP) practices. Differences in costs and outcomes have been identified, measured and valued. This template can then be used to adapt mainstream health intervention data to allow its economic evaluation as if delivered from an ACCHS. Results The template indicates that more resources are required in the delivery of health interventions via ACCHSs, due to their comprehensive nature. As a result, the costs of such interventions are greater, however this is accompanied by greater benefits due to improved health service access. In the example case of the polypill intervention, 58% more costs were involved in delivery via ACCHSs, with 50% more benefits. Cost-effectiveness ratios were also altered accordingly. Conclusions The Indigenous Health Service Delivery Template reveals significant differences in the way health interventions are delivered from ACCHSs compared to mainstream GP practices. It is
Mäkinen, H S; Cano, J M; Merilä, J
2008-08-01
Natural selection is expected to leave an imprint on the neutral polymorphisms at the adjacent genomic regions of a selected gene. While directional selection tends to reduce within-population genetic diversity and increase among-population differentiation, the reverse is expected under balancing selection. To identify targets of natural selection in the three-spined stickleback (Gasterosteus aculeatus) genome, 103 microsatellite and two indel markers including expressed sequence tags (EST) and quantitative trait loci (QTL)-associated loci, were genotyped in four freshwater and three marine populations. The results indicated that a high proportion of loci (14.7%) might be affected by balancing selection and a lower proportion (2.8%) by directional selection. The strongest signatures of directional selection were detected in a microsatellite locus and two indel markers located in the intronic regions of the Eda-gene coding for the number of lateral plates. Yet, other microsatellite loci previously found to be informative in QTL-mapping studies revealed no signatures of selection. Two novel microsatellite loci (Stn12 and Stn90) located in chromosomes I and VIII, respectively, showed signals of directional selection and might be linked to genomic regions containing gene(s) important for adaptive divergence. Although the coverage of the total genomic content was relatively low, the predominance of balancing selection signals is in agreement with the contention that balancing, rather than directional selection is the predominant mode of selection in the wild.
Identifying differences in biased affective information processing in major depression.
Gollan, Jackie K; Pane, Heather T; McCloskey, Michael S; Coccaro, Emil F
2008-05-30
This study investigates the extent to which participants with major depression differ from healthy comparison participants in the irregularities in affective information processing, characterized by deficits in facial expression recognition, intensity categorization, and reaction time to identifying emotionally salient and neutral information. Data on diagnoses, symptom severity, and affective information processing using a facial recognition task were collected from 66 participants, male and female between ages 18 and 54 years, grouped by major depressive disorder (N=37) or healthy non-psychiatric (N=29) status. Findings from MANCOVAs revealed that major depression was associated with a significantly longer reaction time to sad facial expressions compared with healthy status. Also, depressed participants demonstrated a negative bias towards interpreting neutral facial expressions as sad significantly more often than healthy participants. In turn, healthy participants interpreted neutral faces as happy significantly more often than depressed participants. No group differences were observed for facial expression recognition and intensity categorization. The observed effects suggest that depression has significant effects on the perception of the intensity of negative affective stimuli, delayed speed of processing sad affective information, and biases towards interpreting neutral faces as sad.
Phansak, Piyaporn; Soonsuwon, Watcharin; Hyten, David L; Song, Qijian; Cregan, Perry B; Graef, George L; Specht, James E
2016-06-01
Plant breeders continually generate ever-higher yielding cultivars, but also want to improve seed constituent value, which is mainly protein and oil, in soybean [Glycine max (L.) Merr.]. Identification of genetic loci governing those two traits would facilitate that effort. Though genome-wide association offers one such approach, selective genotyping of multiple biparental populations offers a complementary alternative, and was evaluated here, using 48 F2:3 populations (n = ∼224 plants) created by mating 48 high protein germplasm accessions to cultivars of similar maturity, but with normal seed protein content. All F2:3 progeny were phenotyped for seed protein and oil, but only 22 high and 22 low extreme progeny in each F2:3 phenotypic distribution were genotyped with a 1536-SNP chip (ca 450 bimorphic SNPs detected per mating). A significant quantitative trait locus (QTL) on one or more chromosomes was detected for protein in 35 (73%), and for oil in 25 (52%), of the 48 matings, and these QTL exhibited additive effects of ≥ 4 g kg(-1) and R(2) values of 0.07 or more. These results demonstrated that a multiple-population selective genotyping strategy, when focused on matings between parental phenotype extremes, can be used successfully to identify germplasm accessions possessing large-effect QTL alleles. Such accessions would be of interest to breeders to serve as parental donors of those alleles in cultivar development programs, though 17 of the 48 accessions were not unique in terms of SNP genotype, indicating that diversity among high protein accessions in the germplasm collection is less than what might ordinarily be assumed. Copyright © 2016 Phansak et al.
Phansak, Piyaporn; Soonsuwon, Watcharin; Hyten, David L.; Song, Qijian; Cregan, Perry B.; Graef, George L.; Specht, James E.
2016-01-01
Plant breeders continually generate ever-higher yielding cultivars, but also want to improve seed constituent value, which is mainly protein and oil, in soybean [Glycine max (L.) Merr.]. Identification of genetic loci governing those two traits would facilitate that effort. Though genome-wide association offers one such approach, selective genotyping of multiple biparental populations offers a complementary alternative, and was evaluated here, using 48 F2:3 populations (n = ∼224 plants) created by mating 48 high protein germplasm accessions to cultivars of similar maturity, but with normal seed protein content. All F2:3 progeny were phenotyped for seed protein and oil, but only 22 high and 22 low extreme progeny in each F2:3 phenotypic distribution were genotyped with a 1536-SNP chip (ca. 450 bimorphic SNPs detected per mating). A significant quantitative trait locus (QTL) on one or more chromosomes was detected for protein in 35 (73%), and for oil in 25 (52%), of the 48 matings, and these QTL exhibited additive effects of ≥ 4 g kg–1 and R2 values of 0.07 or more. These results demonstrated that a multiple-population selective genotyping strategy, when focused on matings between parental phenotype extremes, can be used successfully to identify germplasm accessions possessing large-effect QTL alleles. Such accessions would be of interest to breeders to serve as parental donors of those alleles in cultivar development programs, though 17 of the 48 accessions were not unique in terms of SNP genotype, indicating that diversity among high protein accessions in the germplasm collection is less than what might ordinarily be assumed. PMID:27172185
Khan, Farhan R; Irving, Jennifer R; Bury, Nicolas R; Hogstrand, Christer
2011-03-01
The River Hayle, Cornwall, UK exhibits pronounced Cu and Zn concentration gradients which were used to compare the metal handling abilities of two populations of Gammarus pulex (Crustacea: Amphipoda). One population was native to the Hayle region (Drym) and presumably has been historically impacted by elevated Cu and Zn levels, whilst naïve gammarids were collected from the River Cray, Kent, UK. Both populations were subject to a 32 day in situ exposure at four R. Hayle sites (Drym, Godolphin, Relubbus and St. Erth). Mortality (LT50), Cu and Zn accumulation and sub-cellular distribution, and oxidative stress (malondialdehyde production) increased with the expected Cu and Zn bioavailabilities at the four sites (i.e. Godolphin>Relubbus>St. Erth>Drym). The naïve population experienced greater metal induced effects in terms of Cu and Zn accumulation, oxidative stress responses and lower LT50s. Analysis of Cu and Zn sub-cellular distribution, however, revealed no significant differences in metal handling. In both populations each metal was localised predominantly to the sub-cellular fraction containing metal bound to metallothionein-like proteins (MTLP) or that holding both metal-rich granules (MRG) and exoskeleton, MTLP and MRG binding being indicative of metal detoxification. However, a greater capacity for detoxified metal storage is not a mechanism implicated in the perceived tolerance of the historically impacted gammarids. Instead our results suggest that the historically impacted population was adapted for lower uptake of Cu and Zn leading to lower bioaccumulation, stress response and ultimately mortality. These results demonstrate not only the usefulness of the in situ methodology, but also that differences in population exposure history can cause significant differences in metal responses during exposure at higher concentrations. Copyright © 2011 Elsevier B.V. All rights reserved.
Impact of different study populations on reader behavior and performance metrics: initial results
NASA Astrophysics Data System (ADS)
Gallas, Brandon D.; Pisano, Etta; Cole, Elodia; Myers, Kyle
2017-03-01
The FDA recently completed a study on design methodologies surrounding the Validation of Imaging Premarket Evaluation and Regulation called VIPER. VIPER consisted of five large reader sub-studies to compare the impact of different study populations on reader behavior as seen by sensitivity, specificity, and AUC, the area under the ROC curve (receiver operating characteristic curve). The study investigated different prevalence levels and two kinds of sampling of non-cancer patients: a screening population and a challenge population. The VIPER study compared full-field digital mammography (FFDM) to screenfilm mammography (SFM) for women with heterogeneously dense or extremely dense breasts. All cases and corresponding images were sampled from Digital Mammographic Imaging Screening Trial (DMIST) archives. There were 20 readers (American Board Certified radiologists) for each sub-study, and instead of every reader reading every case (fully-crossed study), readers and cases were split into groups to reduce reader workload and the total number of observations (split-plot study). For data collection, readers first decided whether or not they would recall a patient. Following that decision, they provided an ROC score for how close or far that patient was from the recall decision threshold. Performance results for FFDM show that as prevalence increases to 50%, there is a moderate increase in sensitivity and decrease in specificity, whereas AUC is mainly flat. Regarding precision, the statistical efficiency (ratio of variances) of sensitivity and specificity relative to AUC are 0.66 at best and decrease with prevalence. Analyses comparing modalities and the study populations (screening vs. challenge) are still ongoing.
Impact of Different Study Populations on Reader Behavior and Performance Metrics: Initial Results
Gallas, Brandon D.; Pisano, Etta; Cole, Elodia; Myers, Kyle
2017-01-01
The FDA recently completed a study on design methodologies surrounding the Validation of Imaging Premarket Evaluation and Regulation called VIPER. VIPER consisted of five large reader sub-studies to compare the impact of different study populations on reader behavior as seen by sensitivity, specificity, and AUC, the area under the ROC curve (receiver operating characteristic curve). The study investigated different prevalence levels and two kinds of sampling of non-cancer patients: a screening population and a challenge population. The VIPER study compared full-field digital mammography (FFDM) to screen-film mammography (SFM) for women with heterogeneously dense or extremely dense breasts. All cases and corresponding images were sampled from Digital Mammographic Imaging Screening Trial (DMIST) archives. There were 20 readers (American Board Certified radiologists) for each sub-study, and instead of every reader reading every case (fully-crossed study), readers and cases were split into groups to reduce reader workload and the total number of observations (split-plot study). For data collection, readers first decided whether or not they would recall a patient. Following that decision, they provided an ROC score for how close or far that patient was from the recall decision threshold. Performance results for FFDM show that as prevalence increases to 50%, there is a moderate increase in sensitivity and decrease in specificity, whereas AUC is mainly flat. Regarding precision, the statistical efficiency (ratio of variances) of sensitivity and specificity relative to AUC are 0.66 at best and decrease with prevalence. Analyses comparing modalities and the study populations (screening vs. challenge) are still ongoing. PMID:28845078
Zhang, Bei; Sun, Yuping; Li, Yuanyuan; Yu, Jiahui; Wang, Tingting; Xia, He; Li, Changgui; Liu, Shiguo; Yao, Hua
2015-01-01
To investigate whether functional variants of five interleukin genes (IL-1β, IL-10, IL-8, IL-18 and IL-18RAP) are associated with susceptibility to hyperuricemia among different nationalities (including Uygur, Kazak and Han populations) in the Xinjiang Autonomous Region of China. A total of 884 hyperuricemia patients and 1316 matched controls were recruited from the First Affiliated Hospital of Xinjiang Medical University in Urumqi. After genotyping of rs4073 in IL-8, rs16944 in IL-1, rs187238 in IL-18, rs1800871 in IL-10 and rs13015714 in IL-18RAP by TaqMan allele discrimination assays, an association analysis was performed using the χ2 test as well as a genotype-phenotype analysis. For the Uygur population, IL-8 rs4073, IL-18 rs187238 and IL-18RAP rs130154 polymorphisms were all associated with hyperuricemia (P<0.001 by genotype and P=0.008, OR 0.802 by allele for IL-8; P=0.01 by genotype and P=0.006, OR 1.332 by allele for IL-18 rs187238; P=0.007 by genotype and P=0.005, OR 1.27 by allele for IL-18RAP rs130154). For the Kazak population, only IL-18 rs187238 showed statistical significance with hyperuricemia (P=0.002 by genotype and P=0.007, OR 1.823 by allele). However, no differences were found between the five SNPs and hyperuricemia among the Han population. This study demonstrated genetic polymorphisms of different interleukin genes related to hyperuricemia vary in different nationalities in the Xinjiang Autonomous Region because of different geographical environments. IL-8, IL-1RL1 and IL-18 might be involved in the development of hyperuricemia in the Uygur population, whereas only IL-18 might be involved in the Kazak population. PMID:26722554
An overview of confounding. Part 2: how to identify it and special situations.
Howards, Penelope P
2018-04-01
Confounding biases study results when the effect of the exposure on the outcome mixes with the effects of other risk and protective factors for the outcome that are present differentially by exposure status. However, not all differences between the exposed and unexposed group cause confounding. Thus, sources of confounding must be identified before they can be addressed. Confounding is absent in an ideal study where all of the population of interest is exposed in one universe and is unexposed in a parallel universe. In an actual study, an observed unexposed population represents the unobserved parallel universe. Thinking about differences between this substitute population and the unexposed parallel universe helps identify sources of confounding. These differences can then be represented in a diagram that shows how risk and protective factors for the outcome are related to the exposure. Sources of confounding identified in the diagram should be addressed analytically and through study design. However, treating all factors that differ by exposure status as confounders without considering the structure of their relation to the exposure can introduce bias. For example, conditions affected by the exposure are not confounders. There are also special types of confounding, such as time-varying confounding and unfixable confounding. It is important to evaluate carefully whether factors of interest contribute to confounding because bias can be introduced both by ignoring potential confounders and by adjusting for factors that are not confounders. The resulting bias can result in misleading conclusions about the effect of the exposure of interest on the outcome. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.
Host-Specific Adaptation of HIV-1 Subtype B in the Japanese Population
Chikata, Takayuki; Carlson, Jonathan M.; Tamura, Yoshiko; Borghan, Mohamed Ali; Naruto, Takuya; Hashimoto, Masao; Murakoshi, Hayato; Le, Anh Q.; Mallal, Simon; John, Mina; Gatanaga, Hiroyuki; Oka, Shinichi; Brumme, Zabrina L.
2014-01-01
ABSTRACT The extent to which HIV-1 clade B strains exhibit population-specific adaptations to host HLA alleles remains incompletely known, in part due to incomplete characterization of HLA-associated HIV-1 polymorphisms (HLA-APs) in different global populations. Moreover, it remains unknown to what extent the same HLA alleles may drive significantly different escape pathways across populations. As the Japanese population exhibits distinctive HLA class I allele distributions, comparative analysis of HLA-APs between HIV-1 clade B-infected Japanese and non-Asian cohorts could shed light on these questions. However, HLA-APs remain incompletely mapped in Japan. In a cohort of 430 treatment-naive Japanese with chronic HIV-1 clade B infection, we identified 284 HLA-APs in Gag, Pol, and Nef using phylogenetically corrected methods. The number of HLA-associated substitutions in Pol, notably those restricted by HLA-B*52:01, was weakly inversely correlated with the plasma viral load (pVL), suggesting that the transmission and persistence of B*52:01-driven Pol mutations could modulate the pVL. Differential selection of HLA-APs between HLA subtype members, including those differing only with respect to substitutions outside the peptide-binding groove, was observed, meriting further investigation as to their mechanisms of selection. Notably, two-thirds of HLA-APs identified in Japan had not been reported in previous studies of predominantly Caucasian cohorts and were attributable to HLA alleles unique to, or enriched in, Japan. We also identified 71 cases where the same HLA allele drove significantly different escape pathways in Japan versus predominantly Caucasian cohorts. Our results underscore the distinct global evolution of HIV-1 clade B as a result of host population-specific cellular immune pressures. IMPORTANCE Cytotoxic T lymphocyte (CTL) escape mutations in HIV-1 are broadly predictable based on the HLA class I alleles expressed by the host. Because HLA allele
Host-specific adaptation of HIV-1 subtype B in the Japanese population.
Chikata, Takayuki; Carlson, Jonathan M; Tamura, Yoshiko; Borghan, Mohamed Ali; Naruto, Takuya; Hashimoto, Masao; Murakoshi, Hayato; Le, Anh Q; Mallal, Simon; John, Mina; Gatanaga, Hiroyuki; Oka, Shinichi; Brumme, Zabrina L; Takiguchi, Masafumi
2014-05-01
The extent to which HIV-1 clade B strains exhibit population-specific adaptations to host HLA alleles remains incompletely known, in part due to incomplete characterization of HLA-associated HIV-1 polymorphisms (HLA-APs) in different global populations. Moreover, it remains unknown to what extent the same HLA alleles may drive significantly different escape pathways across populations. As the Japanese population exhibits distinctive HLA class I allele distributions, comparative analysis of HLA-APs between HIV-1 clade B-infected Japanese and non-Asian cohorts could shed light on these questions. However, HLA-APs remain incompletely mapped in Japan. In a cohort of 430 treatment-naive Japanese with chronic HIV-1 clade B infection, we identified 284 HLA-APs in Gag, Pol, and Nef using phylogenetically corrected methods. The number of HLA-associated substitutions in Pol, notably those restricted by HLA-B*52:01, was weakly inversely correlated with the plasma viral load (pVL), suggesting that the transmission and persistence of B*52:01-driven Pol mutations could modulate the pVL. Differential selection of HLA-APs between HLA subtype members, including those differing only with respect to substitutions outside the peptide-binding groove, was observed, meriting further investigation as to their mechanisms of selection. Notably, two-thirds of HLA-APs identified in Japan had not been reported in previous studies of predominantly Caucasian cohorts and were attributable to HLA alleles unique to, or enriched in, Japan. We also identified 71 cases where the same HLA allele drove significantly different escape pathways in Japan versus predominantly Caucasian cohorts. Our results underscore the distinct global evolution of HIV-1 clade B as a result of host population-specific cellular immune pressures. Cytotoxic T lymphocyte (CTL) escape mutations in HIV-1 are broadly predictable based on the HLA class I alleles expressed by the host. Because HLA allele distributions differ among
Halder, Indrani; Yang, Bao-Zhu; Kranzler, Henry R.; Stein, Murray B.; Shriver, Mark D.; Gelernter, Joel
2010-01-01
Variation in individual admixture proportions leads to heterogeneity within populations. Though novel methods and marker panels have been developed to quantify individual admixture, empirical data describing individual admixture distributions are limited. We investigated variation in individual admixture in four US populations [European American (EA), African American (AA) and Hispanics from Connecticut (EC) and California (WC)] assuming three-way intermixture among Europeans, Africans and Indigenous Americans. Admixture estimates were inferred using a panel of 36 microsatellites and 1 SNP, which have significant allele frequency differences between ancestral populations, and by using both a maximum likelihood (ML) based method and a Bayesian method implemented in the program STRUCTURE. Simulation studies showed that estimates obtained with this marker panel are within 96% of expected values. EAs had the lowest non-European admixture with both methods, but showed greater homogeneity with STRUCTURE than with ML. All other samples showed a high degree of variation in admixture estimates with both methods, were highly concordant and showed evidence of admixture stratification. With both methods, AA subjects had 16% European and <10% Indigenous American admixture on average. EC Hispanics had higher mean African admixture and the WC Hispanics higher mean Indigenous American admixture, possibly reflecting their different continental origins. PMID:19572378
Murat, Claude; Zampieri, Elisa; Vallino, Marta; Daghino, Stefania; Perotto, Silvia; Bonfante, Paola
2011-05-01
Characterization of genomic variation among different microbial species, or different strains of the same species, is a field of significant interest with a wide range of potential applications. We have investigated the genomic variation in mycorrhizal fungal genomes through genomic suppressive subtractive hybridization. The comparison was between phylogenetically distant and close truffle species (Tuber spp.), and between isolates of the ericoid mycorrhizal fungus Oidiodendron maius featuring different degrees of metal tolerance. In the interspecies experiment, almost all the sequences that were identified in the Tuber melanosporum genome and absent in Tuber borchii and Tuber indicum corresponded to transposable elements. In the intraspecies comparison, some specific sequences corresponded to regions coding for enzymes, among them a glutathione synthetase known to be involved in metal tolerance. This approach is a quick and rather inexpensive tool to develop molecular markers for mycorrhizal fungi tracking and barcoding, to identify functional genes and to investigate the genome plasticity, adaptation and evolution. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Microbial diversity--insights from population genetics.
Mes, Ted H M
2008-01-01
Although many environmental microbial populations are large and genetically diverse, both the level of diversity and the extent to which it is ecologically relevant remain enigmatic. Because the effective (or long-term) population size, N(e), is one of the parameters that determines population genetic diversity, tests and simulations that assume selectively neutral mutations may help to identify the processes that have shaped microbial diversity. Using ecologically important genes, tests of selective neutrality suggest that adaptive as well as non-adaptive types of selection act and that departure from neutrality may be widespread or restricted to small groups of genotypes. Population genetic simulations using population sizes between 10(3) and 10(7) suggest extremely high levels of microbial diversity in environments that sustain large populations. However, census and effective population sizes may differ considerably, and because we know nothing of the evolutionary history of environmental microbial populations, we also have no idea what N(e) of environmental populations is. On the one hand, this reflects our ignorance of the microbial world. On the other hand, the tests and simulations illustrate interactions between microbial diversity and microbial population genetics that should inform our thinking in microbial ecology. Because of the different views on microbial diversity across these disciplines, such interactions are crucial if we are to understand the role of genes in microbial communities.
No smile like another: adult age differences in identifying emotions that accompany smiles.
Riediger, Michaela; Studtmann, Markus; Westphal, Andrea; Rauers, Antje; Weber, Hannelore
2014-01-01
People smile in various emotional contexts, for example, when they are amused or angry or simply being polite. We investigated whether younger and older adults differ in how well they are able to identify the emotional experiences accompanying smile expressions, and whether the age of the smiling person plays a role in this respect. With this aim, we produced 80 video episodes of three types of smile expressions: positive-affect smiles had been spontaneously displayed by target persons as they were watching amusing film clips and cartoons. Negative-affect smiles had been displayed spontaneously by target persons during an interaction in which they were being unfairly accused. Affectively neutral smiles were posed upon request. Differences in the accompanying emotional experiences were validated by target persons' self-reports. These smile videos served as experimental stimuli in two studies with younger and older adult participants. In Study 1, older participants were less likely to attribute positive emotions to smiles, and more likely to assume that a smile was posed. Furthermore, younger participants were more accurate than older adults at identifying emotional experiences accompanying smiles. In Study 2, both younger and older participants attributed positive emotions more frequently to smiles shown by older as compared to younger target persons, but older participants did so less frequently than younger participants. Again, younger participants were more accurate than older participants in identifying emotional experiences accompanying smiles, but this effect was attenuated for older target persons. Older participants could better identify the emotional state accompanying smiles shown by older than by younger target persons. Taken together, these findings indicate that there is an age-related decline in the ability to decipher the emotional meaning of smiles presented without context, which, however, is attenuated when the smiling person is also an older adult.
No smile like another: adult age differences in identifying emotions that accompany smiles
Riediger, Michaela; Studtmann, Markus; Westphal, Andrea; Rauers, Antje; Weber, Hannelore
2014-01-01
People smile in various emotional contexts, for example, when they are amused or angry or simply being polite. We investigated whether younger and older adults differ in how well they are able to identify the emotional experiences accompanying smile expressions, and whether the age of the smiling person plays a role in this respect. With this aim, we produced 80 video episodes of three types of smile expressions: positive-affect smiles had been spontaneously displayed by target persons as they were watching amusing film clips and cartoons. Negative-affect smiles had been displayed spontaneously by target persons during an interaction in which they were being unfairly accused. Affectively neutral smiles were posed upon request. Differences in the accompanying emotional experiences were validated by target persons' self-reports. These smile videos served as experimental stimuli in two studies with younger and older adult participants. In Study 1, older participants were less likely to attribute positive emotions to smiles, and more likely to assume that a smile was posed. Furthermore, younger participants were more accurate than older adults at identifying emotional experiences accompanying smiles. In Study 2, both younger and older participants attributed positive emotions more frequently to smiles shown by older as compared to younger target persons, but older participants did so less frequently than younger participants. Again, younger participants were more accurate than older participants in identifying emotional experiences accompanying smiles, but this effect was attenuated for older target persons. Older participants could better identify the emotional state accompanying smiles shown by older than by younger target persons. Taken together, these findings indicate that there is an age-related decline in the ability to decipher the emotional meaning of smiles presented without context, which, however, is attenuated when the smiling person is also an older adult
Microbial quality of food available to populations of differing socioeconomic status.
Koro, Marlen E; Anandan, Shivanthi; Quinlan, Jennifer J
2010-05-01
Low SES has been shown to be linked to poorer-quality diets, decreased consumption of fresh produce, and an increased reliance on small retail stores. The objective of this research was to determine if there is a difference in the microbial quality and potential safety of food available to low-SES versus high-SES populations at the retail level. Aerobic plate count (APC); yeast and mold counts (Y & M); and total coliforms were determined in ready-to-eat (RTE) greens, pre-cut watermelon, broccoli, strawberries, cucumbers, milk, and orange juice and compared among products purchased in stores in low- versus those purchased in high-SES neighborhoods between June 2005 and September 2006. APC, fecal coliforms, and E. coli in ground beef and the presence of Salmonella and Campylobacter in chicken were also compared. Results showed higher microbial loads on produce from markets in low-SES areas. Significant differences observed included (1) APC and Y&M in RTE greens, (2) APC and Y&M in strawberries, and (3) YMCs in cucumbers. No difference was detected in the level of pathogens in raw meat and poultry; however, the APC in ground beef available in high-SES markets was significantly higher compared with that found in low-SES markets. The results presented here indicate that populations of low SES may be more likely to experience produce of poorer microbial quality, which may have an impact on both the appeal and potential safety of the produce. 2010 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.
Population responses in V1 encode different figures by response amplitude.
Gilad, Ariel; Slovin, Hamutal
2015-04-22
The visual system simultaneously segregates between several objects presented in a visual scene. The neural code for encoding different objects or figures is not well understood. To study this question, we trained two monkeys to discriminate whether two elongated bars are either separate, thus generating two different figures, or connected, thus generating a single figure. Using voltage-sensitive dyes, we imaged at high spatial and temporal resolution V1 population responses evoked by the two bars, while keeping their local attributes similar among the two conditions. In the separate condition, unlike the connected condition, the population response to one bar is enhanced, whereas the response to the other is simultaneously suppressed. The response to the background remained unchanged between the two conditions. This divergent pattern developed ∼200 ms poststimulus onset and could discriminate well between the separate and connected single trials. The stimulus separation saliency and behavioral report were highly correlated with the differential response to the bars. In addition, the proximity and/or the specific location of the connectors seemed to have only a weak effect on this late activity pattern, further supporting the involvement of top-down influences. Additional neural codes were less informative about the separate and connected conditions, with much less consistency and discriminability compared with a response amplitude code. We suggest that V1 is involved in the encoding of each figure by different neuronal response amplitude, which can mediate their segregation and perception. Copyright © 2015 the authors 0270-6474/15/356335-15$15.00/0.
Wu, Ying; Waite, Lindsay L.; Jackson, Anne U.; Sheu, Wayne H-H.; Buyske, Steven; Absher, Devin; Arnett, Donna K.; Boerwinkle, Eric; Bonnycastle, Lori L.; Carty, Cara L.; Cheng, Iona; Cochran, Barbara; Croteau-Chonka, Damien C.; Dumitrescu, Logan; Eaton, Charles B.; Franceschini, Nora; Guo, Xiuqing; Henderson, Brian E.; Hindorff, Lucia A.; Kim, Eric; Kinnunen, Leena; Komulainen, Pirjo; Lee, Wen-Jane; Le Marchand, Loic; Lin, Yi; Lindström, Jaana; Lingaas-Holmen, Oddgeir; Mitchell, Sabrina L.; Narisu, Narisu; Robinson, Jennifer G.; Schumacher, Fred; Stančáková, Alena; Sundvall, Jouko; Sung, Yun-Ju; Swift, Amy J.; Wang, Wen-Chang; Wilkens, Lynne; Wilsgaard, Tom; Young, Alicia M.; Adair, Linda S.; Ballantyne, Christie M.; Bůžková, Petra; Chakravarti, Aravinda; Collins, Francis S.; Duggan, David; Feranil, Alan B.; Ho, Low-Tone; Hung, Yi-Jen; Hunt, Steven C.; Hveem, Kristian; Juang, Jyh-Ming J.; Kesäniemi, Antero Y.; Kuusisto, Johanna; Laakso, Markku; Lakka, Timo A.; Lee, I-Te; Leppert, Mark F.; Matise, Tara C.; Moilanen, Leena; Njølstad, Inger; Peters, Ulrike; Quertermous, Thomas; Rauramaa, Rainer; Rotter, Jerome I.; Saramies, Jouko; Tuomilehto, Jaakko; Uusitupa, Matti; Wang, Tzung-Dau; Mohlke, Karen L.
2013-01-01
Genome-wide association studies (GWAS) have identified ∼100 loci associated with blood lipid levels, but much of the trait heritability remains unexplained, and at most loci the identities of the trait-influencing variants remain unknown. We conducted a trans-ethnic fine-mapping study at 18, 22, and 18 GWAS loci on the Metabochip for their association with triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C), respectively, in individuals of African American (n = 6,832), East Asian (n = 9,449), and European (n = 10,829) ancestry. We aimed to identify the variants with strongest association at each locus, identify additional and population-specific signals, refine association signals, and assess the relative significance of previously described functional variants. Among the 58 loci, 33 exhibited evidence of association at P<1×10−4 in at least one ancestry group. Sequential conditional analyses revealed that ten, nine, and four loci in African Americans, Europeans, and East Asians, respectively, exhibited two or more signals. At these loci, accounting for all signals led to a 1.3- to 1.8-fold increase in the explained phenotypic variance compared to the strongest signals. Distinct signals across ancestry groups were identified at PCSK9 and APOA5. Trans-ethnic analyses narrowed the signals to smaller sets of variants at GCKR, PPP1R3B, ABO, LCAT, and ABCA1. Of 27 variants reported previously to have functional effects, 74% exhibited the strongest association at the respective signal. In conclusion, trans-ethnic high-density genotyping and analysis confirm the presence of allelic heterogeneity, allow the identification of population-specific variants, and limit the number of candidate SNPs for functional studies. PMID:23555291
Genetic and morphological differences among populations of the Bonin Islands White-eye in Japan.
Kawakami, Kazuto; Harada, Sachiko; Suzuki, Tadashi; Higuchi, Hiroyoshi
2008-09-01
The Bonin Islands White-eye, Apalopteron familiare , is the sole endemic avian species surviving on the Bonin Islands. The current distribution of this species is limited to only three islands of the Hahajima Island group: Hahajima, Imotojima, and Mukohjima. Imotojima and Mukohjima, which are small satellite islands of Hahajima, are about 3.6 km and 5.5 km, respectively, from the larger island. To investigate genetic and morphological differences among A. familiare populations on these islands, we assayed 634 bp of mitochondrial control region sequence for 132 birds from five locations among the three islands. We detected five haplotypes: two endemic haplotypes each on Hahajima and Imotojima and one on Mukohjima. Principal component analysis based on eight morphological characters of 162 birds from the three island populations revealed that birds from the small satellite islands had significantly different beak morphological characters. Our findings indicate that over-sea dispersal is rare in A. familiare , even when islands are separated by only a few kilometers, and suggest that little movement occurs on Hahajima. Thus, each population on each island should be conserved as an evolutionarily significant unit. The low dispersal ability of this species suggests that it is vulnerable to habitat fragmentation. Although the populations are currently stable and do not require rapid countermeasures, they should be monitored, especially those on the smaller islands.
Haplotypes in SLC24A5 Gene as Ancestry Informative Markers in Different Populations
Giardina, Emiliano; Pietrangeli, Ilenia; Martínez-Labarga, Cristina; Martone, Claudia; de Angelis, Flavio; Spinella, Aldo; De Stefano, Gianfranco; Rickards, Olga; Novelli, Giuseppe
2008-01-01
Ancestry informative markers (AIMs) are human polymorphisms that exhibit substantially allele frequency differences among populations. These markers can be useful to provide information about ancestry of samples which may be useful in predicting a perpetrator’s ethnic origin to aid criminal investigations. Variations in human pigmentation are the most obvious phenotypes to distinguish individuals. It has been recently shown that the variation of a G in an A allele of the coding single-nucleotide polymorphism (SNP) rs1426654 within SLC24A5 gene varies in frequency among several population samples according to skin pigmentation. Because of these observations, the SLC24A5 locus has been evaluated as Ancestry Informative Region (AIR) by typing rs1426654 together with two additional intragenic markers (rs2555364 and rs16960620) in 471 unrelated individuals originating from three different continents (Africa, Asia and Europe). This study further supports the role of human SLC24A5 gene in skin pigmentation suggesting that variations in SLC24A5 haplotypes can correlate with human migration and ancestry. Furthermore, our data do reveal the utility of haplotype and combined unphased genotype analysis of SLC24A5 in predicting ancestry and provide a good example of usefulness of genetic characterization of larger regions, in addition to single polymorphisms, as candidates for population-specific sweeps in the ancestral population. PMID:19440451
Verhille, Christine E.; Dabruzzi, Theresa F.; Cocherell, Dennis E.; Mahardja, Brian; Feyrer, Frederick V.; Foin, Theodore C.; Baerwald, Melinda R.; Fangue, Nann A.
2016-01-01
The Sacramento splittail (Pogonichthys macrolepidotus) is a minnow endemic to the highly modified San Francisco Estuary of California, USA and its associated rivers and tributaries. This species is composed of two genetically distinct populations, which, according to field observations and otolith strontium signatures, show largely allopatric distribution patterns as recently hatched juveniles. Juvenile Central Valley splittail are found primarily in the nearly fresh waters of the Sacramento and San Joaquin rivers and their tributaries, whereas San Pablo juveniles are found in the typically higher-salinity waters (i.e. up to 10‰) of the Napa and Petaluma Rivers. As the large salinity differences between young-of-year habitats may indicate population-specific differences in salinity tolerance, we hypothesized that juvenile San Pablo and Central Valley splittail populations differ in their response to salinity. In hatchery-born and wild-caught juvenile San Pablo splittail, we found upper salinity tolerances, where mortalities occurred within 336 h of exposure to 16‰ or higher, which was higher than the upper salinity tolerance of 14‰ for wild-caught juvenile Central Valley splittail. This, in conjunction with slower recovery of plasma osmolality, but not ion levels, muscle moisture or gill Na+,K+-ATPase activity, in Central Valley relative to San Pablo splittail during osmoregulatory disturbance provides some support for our hypothesis of inter-population variation in salinity tolerance and osmoregulation. The modestly improved salinity tolerance of San Pablo splittail is consistent with its use of higher-salinity habitats. Although confirmation of the putative adaptive difference through further studies is recommended, this may highlight the need for population-specific management considerations.
Verhille, Christine E; Dabruzzi, Theresa F; Cocherell, Dennis E; Mahardja, Brian; Feyrer, Frederick; Foin, Theodore C; Baerwald, Melinda R; Fangue, Nann A
2016-01-01
Abstract The Sacramento splittail (Pogonichthys macrolepidotus) is a minnow endemic to the highly modified San Francisco Estuary of California, USA and its associated rivers and tributaries. This species is composed of two genetically distinct populations, which, according to field observations and otolith strontium signatures, show largely allopatric distribution patterns as recently hatched juveniles. Juvenile Central Valley splittail are found primarily in the nearly fresh waters of the Sacramento and San Joaquin rivers and their tributaries, whereas San Pablo juveniles are found in the typically higher-salinity waters (i.e. up to 10‰) of the Napa and Petaluma Rivers. As the large salinity differences between young-of-year habitats may indicate population-specific differences in salinity tolerance, we hypothesized that juvenile San Pablo and Central Valley splittail populations differ in their response to salinity. In hatchery-born and wild-caught juvenile San Pablo splittail, we found upper salinity tolerances, where mortalities occurred within 336 h of exposure to 16‰ or higher, which was higher than the upper salinity tolerance of 14‰ for wild-caught juvenile Central Valley splittail. This, in conjunction with slower recovery of plasma osmolality, but not ion levels, muscle moisture or gill Na+,K+-ATPase activity, in Central Valley relative to San Pablo splittail during osmoregulatory disturbance provides some support for our hypothesis of inter-population variation in salinity tolerance and osmoregulation. The modestly improved salinity tolerance of San Pablo splittail is consistent with its use of higher-salinity habitats. Although confirmation of the putative adaptive difference through further studies is recommended, this may highlight the need for population-specific management considerations. PMID:27293743
Rauhamäki, Virve; Wolfram, Joy; Jokitalo, Eija; Hanski, Ilkka; Dahlhoff, Elizabeth P.
2014-01-01
Habitat loss and climate change are rapidly converting natural habitats and thereby increasing the significance of dispersal capacity for vulnerable species. Flight is necessary for dispersal in many insects, and differences in dispersal capacity may reflect dissimilarities in flight muscle aerobic capacity. In a large metapopulation of the Glanville fritillary butterfly in the Åland Islands in Finland, adults disperse frequently between small local populations. Individuals found in newly established populations have higher flight metabolic rates and field-measured dispersal distances than butterflies in old populations. To assess possible differences in flight muscle aerobic capacity among Glanville fritillary populations, enzyme activities and tissue concentrations of the mitochondrial protein Cytochrome-c Oxidase (CytOx) were measured and compared with four other species of Nymphalid butterflies. Flight muscle structure and mitochondrial density were also examined in the Glanville fritillary and a long-distance migrant, the red admiral. Glanville fritillaries from new populations had significantly higher aerobic capacities than individuals from old populations. Comparing the different species, strong-flying butterfly species had higher flight muscle CytOx content and enzymatic activity than short-distance fliers, and mitochondria were larger and more numerous in the flight muscle of the red admiral than the Glanville fritillary. These results suggest that superior dispersal capacity of butterflies in new populations of the Glanville fritillary is due in part to greater aerobic capacity, though this species has a low aerobic capacity in general when compared with known strong fliers. Low aerobic capacity may limit dispersal ability of the Glanville fritillary. PMID:24416122
NASA Astrophysics Data System (ADS)
Bennett, B.
2016-02-01
Many fisheries are threatened due to overfishing, changing climate, and anthropogenic activities. Benthic marine organisms can be especially vulnerable to these pressures because of their inability to flee, and some of these organisms comprise the most threatened fisheries. Providing predictive tools to managers is key to reestablishing populations and sustainability in threatened or crashed fisheries. Here we examine the demographics of Cellana spp., culturally and culinarily important intertidal shellfishes in Hawai'i, in populations that are naturally recruitment limited and those that are recruitment saturated. We focus on variation in two demographic parameters: population density and size class frequency. From 2009 to 2015, yearly transect surveys were conducted on four isolated and uninhabited islands within the Papahānaumokuākea Marine National Monument (PMNM), a massive marine protected area. Two islands exhibit classic signs of recruitment limitation with several absent intertidal species and low population densities while two larger islands have a relative abundance of species and high population densities. The population density of C. exarata in the recruitment-saturated populations exhibit much higher variability, than in the recruitment-limited populations, that is driven by a massive recruitment peak in May-June. An inverted age pyramid characterized the recruitment-limited populations, which display a more stable adult-dominated population. The recruitment-saturated populations were characterized by a traditional age pyramid, which exhibit a less stable juvenile-dominated population. These results are being used to model and predict population dynamics in the intensely harvested populations of the main Hawaiian Islands for the purposes of management decision-making.
Fresán, Ana; González-Castro, Thelma Beatriz; Peralta-Jiménez, Yesenia; Juárez-Rojop, Isela; Pool-García, Sherezada; Velázquez-Sánchez, Martha Patricia; López-Narváez, Lilia; Tovilla-Zárate, Carlos Alfonso
2015-06-01
The aim of the present study was to analyse demographic and clinical characteristics, as well as psychiatric diagnoses to identify gender differences in patients with attempted suicide in a Mexican population. Between September 2010 and September 2012, 140 suicide attempts were documented in the Department of Psychiatry at the General Hospital of Comalcalco (Hospital General de Comalcalco in Spanish) in Tabasco, Mexico. Diagnoses were established using the DSM-IV questionnaire in which Axis I and II were considered. The Suicide Intent Scale was also applied. In our sample, 63.6% were females and 36.4% males. With regard to socio-demographic characteristics, the predominant marital status in males was single, and in females married (χ2=5.93, df=2, p=0.05). In occupation the male group was mainly unemployed and housewife in females (χ2=55.51, df=4, p<0.001). Male subjects were more likely to consume alcohol (χ2=20.40, df=1, p≤0.001), cannabis (χ2=16.62, df=1, p≤0.001) or tobacco. The prevalence of psychiatric diagnosis was significantly different because, the male group was mainly diagnosed with substance-related disorders, whereas female participants showed a prevalence of stress-related disorders (χ2=34.17, gl=4, p=0.0001). Our results provide evidence that the characteristics of suicide attempt are different by gender in the Mexican population. Interventions are necessary for the development of prevention strategies that may lead to a reduction in suicidal behaviour. These preventive activities should consider the occupation for the female group and consumption of alcohol, cannabis or tobacco in the male group.
Baird, Andrew J; Haslam, Roger A
2013-12-01
Beliefs, cognitions, and behaviors relating to pain can be associated with a range of negative outcomes. In patients, certain beliefs are associated with increased levels of pain and related disability. There are few data, however, showing the extent to which beliefs of patients differ from those of the general population. This study explored pain beliefs in a large nonclinical population and a chronic low back pain (CLBP) sample using the Pain Beliefs Questionnaire (PBQ) to identify differences in scores and factor structures between and within the samples. This was a cross-sectional study. The samples comprised patients attending a rehabilitation program and respondents to a workplace survey. Pain beliefs were assessed using the PBQ, which incorporates 2 scales: organic and psychological. Exploratory factor analysis was used to explore variations in factor structure within and between samples. The relationship between the 2 scales also was examined. Patients reported higher organic scores and lower psychological scores than the nonclinical sample. Within the nonclinical sample, those who reported frequent pain scored higher on the organic scale than those who did not. Factor analysis showed variations in relation to the presence of pain. The relationship between scales was stronger in those not reporting frequent pain. This was a cross-sectional study; therefore, no causal inferences can be made. Patients experiencing CLBP adopt a more biomedical perspective on pain than nonpatients. The presence of pain is also associated with increased biomedical thinking in a nonclinical sample. However, the impact is not only on the strength of beliefs, but also on the relationship between elements of belief and the underlying belief structure.
Nikolić, Biljana; Ristić, Mihailo; Bojović, Srdjan; Marin, Petar D
2007-05-01
The essential-oil compositions of Pinus heldreichii Christ. from Montenegro and Serbia are reported at the population level. Whitebark pine is a sub-endemic high-mountain Balkan pine relict of an anthropogenically reduced area, with large morphological diversity and insufficiently clear taxonomic position. In the pine-needle terpene profile from three populations from Montenegro, and one from Serbia, 101 compounds were detected, 72 of which could be identified (Table 3). The dominant constituents are limonene (26.3%), alpha-pinene (17.5%), germacrene D (13.5%), and beta-caryophyllene (10.4%), comprising ca. 67.7% of the essential oil. Medium-to-high contents (0.5-10%) of the following 16 additional components were found: beta-pinene, beta-myrcene, alpha-humulene, delta-cadinene, alpha-muurolene, (E)-hex-2-enal, beta-gurjunene, gamma-muurolene, isopimarol, camphene, gamma-cadinene, aromadendrene, beta-bisabolene, trans-beta-farnesene, alpha-cadinene, and (Z)-hex-3-en-1-ol. The similarity of the populations and the within-population variability was visualized by principle-component analysis (PCA) of eleven selected terpenes in 97 tree samples. Cluster and genetic analyses suggest closest connection between the two spatially most-distant populations I (Montenegro) and IV (Serbia). Based on the profile of the main sesquiterpene components, the studied populations from Montenegro and Serbia are more similar to the populations from Greece and the Central Balkan peninsula (Bosnia and Serbia-Kosovo) than to those on the furthest eastern margin of their natural range (Bulgaria).
Zha, Ling-Feng; Nie, Shao-Fang; Chen, Qian-Wen; Liao, Yu-Hua; Zhang, Hong-Song; Dong, Jiang-Tao; Xie, Tian; Wang, Fan; Tang, Ting-Ting; Xia, Ni; Xu, Cheng-Qi; Zhou, Ying-Chao; Zeng, Zhi-Peng; Jiao, Jiao; Wang, Peng-Yun; Wang, Qing K; Tu, Xin; Cheng, Xiang
2018-04-18
Interleukin-13 (IL-13) has important functions in atherosclerosis, but its role in coronary artery disease (CAD) is unclear. Here, we studied the genetic role of IL-13 in CAD in a Chinese Han population using tag SNPs covering the whole IL13 gene (i.e., rs1881457, rs2069744 and rs20541) and a two-stage cohort containing 1863 CAD cases and 1841 controls. Traditional risk factors for CAD, such as age, BMI, and other factors, were used as covariates in logistic regression analysis. In the total population, we found that two haplotypes of IL13 (ATG and ATA, ordered rs1881457 C -rs2069744 T -rs20541 A ) significantly contributed to the risk of CAD with adjusted p values less than 0.05 (p adj = 0.019 and p adj = 0.042, respectively). In subgroup population analyses, the variant rs1881457 C was found to significantly contribute to a nearly two fold increase in the risk of CAD in men (p adj = 0.023, OR = 1.91, 95% CI: 1.09-3.33). The variant rs1881457 C also significantly contributed to a nearly twofold risk of late-onset CAD (p adj = 0.024, OR = 1.93, 95% CI: 1.09-3.42). In conclusion, IL13 might be involved in CAD via different mechanisms under different conditions in the Chinese Han population.
Sviatova, G S; Abil'dinova, G Z; Berezina, G M
2002-03-01
A cytogenetic study was conducted for the first time on human populations neighboring the Semipalatinsk nuclear test site (STS) and exposed to ionizing radiation for a long period of time. In populations with the extreme and maximum radiation risks, high frequencies of radiation-induced chromosomal markers, including acentric fragments (1.99 +/- 0.10 per 100 cells), dicentrics (0.23 +/- 0.01), ring chromosomes (0.38 +/- 0.14), and stable chromosomal aberrations (1.17 +/- 0.02), were found. These frequencies significantly exceeded those in control populations. The spectrum of chromosomal aberrations and the frequencies of the aberrations of different types in persons living in the areas with the highest radionuclide contamination confirmed the mutagenic effect of radiation on chromosomes in the human populations studied.
Identifying Children at Risk of High Myopia Using Population Centile Curves of Refraction.
Chen, Yanxian; Zhang, Jian; Morgan, Ian G; He, Mingguang
2016-01-01
To construct reference centile curves of refraction based on population-based data as an age-specific severity scale to evaluate their efficacy as a tool for identifying children at risk of developing high myopia in a longitudinal study. Data of 4218 children aged 5-15 years from the Guangzhou Refractive Error Study in Children (RESC) study, and 354 first-born twins from the Guangzhou Twin Eye Study (GTES) with annual visit were included in the analysis. Reference centile curves for refraction were constructed using a quantile regression model based on the cycloplegic refraction data from the RESC. The risk of developing high myopia (spherical equivalent ≤ -6 diopters [D]) was evaluated as a diagnostic test using the twin follow-up data. The centile curves suggested that the 3rd, 5th, and 10th percentile decreased from -0.25 D, 0.00 D and 0.25 D in 5 year-olds to -6.00 D, -5.65D and -4.63 D in 15 year-olds in the population-based data from RESC. In the GTES cohort, the 5th centile showed the most effective diagnostic value with a sensitivity of 92.9%, a specificity of 97.9% and a positive predictive value (PPV) of 65.0% in predicting high myopia onset (≤-6.00D) before the age of 15 years. The PPV was highest (87.5%) in 3rd centile but with only 50.0% sensitivity. The Mathew's correlation coefficient of 5th centile in predicting myopia of -6.0D/-5.0D/-4.0D by age of 15 was 0.77/0.51/0.30 respectively. Reference centile curves provide an age-specific estimation on a severity scale of refractive error in school-aged children. Children located under lower percentiles at young age were more likely to have high myopia at 15 years or probably in adulthood.
Drygala, Frank; Korablev, Nikolay; Ansorge, Hermann; Fickel, Joerns; Isomursu, Marja; Elmeros, Morten; Kowalczyk, Rafał; Baltrunaite, Laima; Balciauskas, Linas; Saarma, Urmas; Schulze, Christoph; Borkenhagen, Peter; Frantz, Alain C.
2016-01-01
The extent of gene flow during the range expansion of non-native species influences the amount of genetic diversity retained in expanding populations. Here, we analyse the population genetic structure of the raccoon dog (Nyctereutes procyonoides) in north-eastern and central Europe. This invasive species is of management concern because it is highly susceptible to fox rabies and an important secondary host of the virus. We hypothesized that the large number of introduced animals and the species’ dispersal capabilities led to high population connectivity and maintenance of genetic diversity throughout the invaded range. We genotyped 332 tissue samples from seven European countries using 16 microsatellite loci. Different algorithms identified three genetic clusters corresponding to Finland, Denmark and a large ‘central’ population that reached from introduction areas in western Russia to northern Germany. Cluster assignments provided evidence of long-distance dispersal. The results of an Approximate Bayesian Computation analysis supported a scenario of equal effective population sizes among different pre-defined populations in the large central cluster. Our results are in line with strong gene flow and secondary admixture between neighbouring demes leading to reduced genetic structuring, probably a result of its fairly rapid population expansion after introduction. The results presented here are remarkable in the sense that we identified a homogenous genetic cluster inhabiting an area stretching over more than 1500km. They are also relevant for disease management, as in the event of a significant rabies outbreak, there is a great risk of a rapid virus spread among raccoon dog populations. PMID:27064784
Shrestha, Ram K; Sansom, Stephanie L; Kimbrough, Lisa; Hutchinson, Angela B; Daltry, Daniel; Maldonado, Waleska; Simpson-May, Georgia M; Illemszky, Sean
2010-01-01
In 2003, the Centers for Disease Control and Prevention launched the Advancing HIV Prevention project to implement new strategies for diagnosing human immunodeficiency virus (HIV) infections outside medical settings and prevent new infections by working with HIV-infected persons and their partners. : To assess the cost and effectiveness of a social network strategy to identify new HIV diagnoses among minority populations. Four community-based organizations (CBOs) in Boston, Philadelphia, and Washington, District of Columbia, implemented a social network strategy for HIV counseling and testing from October 2003 to December 2005. We used standardized cost collection forms to collect program costs attributable to staff time, travel, incentives, test kits, testing supplies, office space, equipment, and utilities. The CBOs used the networks of high-risk and HIV-infected persons (recruiters) who referred their partners and associates for HIV counseling and testing. We obtained HIV-testing outcomes from project databases. Number of HIV tests, number of new HIV-diagnoses notified, total program cost, cost per person tested, cost per person notified of new HIV diagnosis. Two CBOs, both based in Philadelphia, identified 25 and 17 recruiters on average annually and tested 136 and 330 network associates, respectively. Among those tested, 12 and 13 associates were notified of new HIV diagnoses (seropositivity: 9.8%, 4.4%). CBOs in Boston, Massachusetts, and Washington, District of Columbia, identified 26 and 24 recruiters per year on average and tested 228 and 123 network associates. Among those tested, 12 and 11 associates were notified of new HIV diagnoses (seropositivity: 5.1%, 8.7%). The cost per associate notified of a new HIV diagnosis was $11 578 and $12 135 in Philadelphia, and $16 437 and $16 101 in Boston, Massachusetts, and Washington, District of Columbia. The cost of notifying someone with a new HIV diagnosis using social networks varied across sites. Our analysis
Comuzzie, Anthony G.; Cole, Shelley A.; Laston, Sandra L.; Voruganti, V. Saroja; Haack, Karin; Gibbs, Richard A.; Butte, Nancy F.
2012-01-01
Genetic variants responsible for susceptibility to obesity and its comorbidities among Hispanic children have not been identified. The VIVA LA FAMILIA Study was designed to genetically map childhood obesity and associated biological processes in the Hispanic population. A genome-wide association study (GWAS) entailed genotyping 1.1 million single nucleotide polymorphisms (SNPs) using the Illumina Infinium technology in 815 children. Measured genotype analysis was performed between genetic markers and obesity-related traits i.e., anthropometry, body composition, growth, metabolites, hormones, inflammation, diet, energy expenditure, substrate utilization and physical activity. Identified genome-wide significant loci: 1) corroborated genes implicated in other studies (MTNR1B, ZNF259/APOA5, XPA/FOXE1 (TTF-2), DARC, CCR3, ABO); 2) localized novel genes in plausible biological pathways (PCSK2, ARHGAP11A, CHRNA3); and 3) revealed novel genes with unknown function in obesity pathogenesis (MATK, COL4A1). Salient findings include a nonsynonymous SNP (rs1056513) in INADL (p = 1.2E-07) for weight; an intronic variant in MTNR1B associated with fasting glucose (p = 3.7E-08); variants in the APOA5-ZNF259 region associated with triglycerides (p = 2.5-4.8E-08); an intronic variant in PCSK2 associated with total antioxidants (p = 7.6E-08); a block of 23 SNPs in XPA/FOXE1 (TTF-2) associated with serum TSH (p = 5.5E-08 to 1.0E-09); a nonsynonymous SNP (p = 1.3E-21), an intronic SNP (p = 3.6E-13) in DARC identified for MCP-1; an intronic variant in ARHGAP11A associated with sleep duration (p = 5.0E-08); and, after adjusting for body weight, variants in MATK for total energy expenditure (p = 2.7E-08) and in CHRNA3 for sleeping energy expenditure (p = 6.0E-08). Unprecedented phenotyping and high-density SNP genotyping enabled localization of novel genetic loci associated with the pathophysiology of childhood obesity. PMID:23251661
Pacitto, A; Stabile, L; Moreno, T; Kumar, P; Wierzbicka, A; Morawska, L; Buonanno, G
2018-01-01
In the present study, the daily dose in terms of particle surface area received by citizens living in five cities in Western countries, characterized by different lifestyle, culture, climate and built-up environment, was evaluated and compared. For this purpose, the exposure to sub-micron particle concentration levels of the population living in Barcelona (Spain), Cassino (Italy), Guilford (United Kingdom), Lund (Sweden), and Brisbane (Australia) was measured through a direct exposure assessment approach. In particular, measurements of the exposure at a personal scale were performed by volunteers (15 per each population) that used a personal particle counter for different days in order to obtain exposure data in microenvironments/activities they resided/performed. Non-smoking volunteers performing non-industrial jobs were considered in the study. Particle concentration data allowed obtaining the exposure of the population living in each city. Such data were combined in a Monte Carlo method with the time activity pattern data characteristics of each population and inhalation rate to obtain the most probable daily dose in term of particle surface area as a function of the population gender, age, and nationality. The highest daily dose was estimated for citizens living in Cassino and Guilford (>1000 mm 2 ), whereas the lowest value was recognized for Lund citizens (around 100 mm 2 ). Indoor air quality, and in particular cooking and eating activities, was recognized as the main influencing factor in terms of exposure (and thus dose) of the population: then confirming that lifestyle (e.g. time spent in cooking activities) strongly affect the daily dose of the population. On the contrary, a minor or negligible contribution of the outdoor microenvironments was documented. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhuang, Ke; Zhang, Wencai; Zhang, Xiaobo; Wu, Fangqin; Cheng, Longxian
2011-08-01
Associations between "lipid-related" candidate genes, blood lipid concentrations and coronary artery disease (CHD) risk are not clear. We aimed to investigate the effect of three newly identified lipids loci from genome-wide association studies on CHD and blood lipid levels in Chinese Han population. The genotypes of SNPs at three newly identified lipid loci and blood lipids concentrations were examined in 1360 CHD patients and 1360 age- and sex-frequency matched controls from an unrelated Chinese Han population. Allele T of rs16996148 occurred less frequently in CHD patients with the odds ratio (OR) being 0.64 (95% CI 0.50 to 0.81), after adjusting for conventional risk factors and was associated with a 33% decreased CHD risk (P<0.01) comparing with the major allele G. Individuals with GT genotype had the lowest CHD risk. No associations were found between the polymorphisms of other two loci with CHD risk and all three SNPs had no effect on lipid profile in this population. SNP rs16996148 on chromosome 19p13 is significantly associated with lower risk for CHD in Chinese Han population. However, it remains unresolved why these lipid-related loci had significantly less effects than the correspondingly expected effects on blood lipids levels in this population.
Individual heterogeneity and identifiability in capture-recapture models
Link, W.A.
2004-01-01
Individual heterogeneity in detection probabilities is a far more serious problem for capture-recapture modeling than has previously been recognized. In this note, I illustrate that population size is not an identifiable parameter under the general closed population mark-recapture model Mh. The problem of identifiability is obvious if the population includes individuals with pi = 0, but persists even when it is assumed that individual detection probabilities are bounded away from zero. Identifiability may be attained within parametric families of distributions for pi, but not among parametric families of distributions. Consequently, in the presence of individual heterogeneity in detection probability, capture-recapture analysis is strongly model dependent.
Atrioventricular depolarization differences identify coronary artery anomalies in Kawasaki disease.
Cortez, Daniel; Sharma, Nandita; Jone, Pei-Ni
2017-03-01
Kawasaki disease (KD) is the leading cause of acquired heart disease in children. Signal average electrocardiogram changes in patients during the acute phase of KD with coronary artery anomalies (CAA) include depolarization changes. We set out to determine if 12-lead-derived atrioventricular depolarization differences can identify CAA in patients with KD. A blinded, retrospective case-control study of patients with KD was performed. Deep Q waves, corrected QT-intervals (QTc), spatial QRS-T angles, T-wave vector magnitudes (RMS-T), and a novel parameter for assessment of atrioventricular depolarization difference (the spatial PR angle) and a two dimensional PR angle were assessed. Comparisons between groups were performed to test for significant differences. One hundred one patients with KD were evaluated, with 68 having CAA (67.3%, mean age 3.6 ± 3.0 years, 82.6% male), and 32 without CAA (31.7%, mean age 2.7 ± 3.2 years, 70.4% male). The spatial PR angle significantly discriminated KD patients with CAA from those without, 59.7° ± 31.1° versus 41.6° ± 11.5° (p < .001). A spatial PR angle cutoff value of 56.9° gave positive/negative predictive values and odds ratios of 93.8%, 43.5%, and 11.5% (95% confidence interval (CI) 2.6-52.2). The two dimensional PR angle either below 7° or above 92° gave positive/negative predictive values and odds ratios of 100.0%, 38.8%, and 21.1% (95% CI 1.2-362.8). No other parameters significantly differentiated the groups. Atrioventricular depolarization differences, measured by the spatial or two dimensional PR angle differentiate KD patients with CAA versus those without. © 2016 Wiley Periodicals, Inc.
van Erkelens, A; Sie, A S; Manders, P; Visser, A; Duijm, L E; Mann, R M; Ten Voorde, M; Kroeze, H; Prins, J B; Hoogerbrugge, N
2017-06-01
Identifying high familial breast cancer (FBC) risk improves detection of yet unknown BRCA1/2-mutation carriers, for whom BC risk is both highly likely and potentially preventable. We assessed whether a new online self-test could identify women at high FBC risk in population-based BC screening without inducing anxiety or distress. After their visit for screening mammography, women were invited by email to take an online self-test for identifying highly increased FBC risk-based on Dutch guidelines. Exclusion criteria were previously diagnosed as increased FBC risk or a personal history of BC. Anxiety (State-Trait Anxiety Inventory Dutch Version), distress (Hospital Anxiety Depression Scale) and BC risk perception were assessed using questionnaires, which were completed immediately before and after taking the online self-test and 2 weeks later. Of the 562 women invited by email, 406 (72%) completed the online self-test while 304 also completed questionnaires (response rate 54%). After exclusion criteria, 287 (51%) were included for data analysis. Median age was 56 years (range 50-74). A high or moderate FBC risk was identified in 12 (4%) and three (1%) women, respectively. After completion of the online self-test, anxiety and BC risk perception were decreased while distress scores remained unchanged. Levels were below clinical relevance. Most women (85%) would recommend the self-test; few (3%) would not. The online self-test identified previously unknown women at high FBC risk (4%), who may carry a BRCA1/2-mutation, without inducing anxiety or distress. We therefore recommend offering this self-test to women who attend population-based screening mammography for the first time. Copyright © 2017 Elsevier Ltd. All rights reserved.
Pereira, R; Alves, C; Aler, M; Amorim, A; Arévalo, C; Betancor, E; Braganholi, D; Bravo, M L; Brito, P; Builes, J J; Burgos, G; Carvalho, E F; Castillo, A; Catanesi, C I; Cicarelli, R M B; Coufalova, P; Dario, P; D'Amato, M E; Davison, S; Ferragut, J; Fondevila, M; Furfuro, S; García, O; Gaviria, A; Gomes, I; González, E; Gonzalez-Liñan, A; Gross, T E; Hernández, A; Huang, Q; Jiménez, S; Jobim, L F; López-Parra, A M; Marino, M; Marques, S; Martínez-Cortés, G; Masciovecchio, V; Parra, D; Penacino, G; Pinheiro, M F; Porto, M J; Posada, Y; Restrepo, C; Ribeiro, T; Rubio, L; Sala, A; Santurtún, A; Solís, L S; Souto, L; Streitemberger, E; Torres, A; Vilela-Lamego, C; Yunis, J J; Yurrebaso, I; Gusmão, L
2018-01-01
A collaborative effort was carried out by the Spanish and Portuguese Speaking Working Group of the International Society for Forensic Genetics (GHEP-ISFG) to promote knowledge exchange between associate laboratories interested in the implementation of indel-based methodologies and build allele frequency databases of 38 indels for forensic applications. These databases include populations from different countries that are relevant for identification and kinship investigations undertaken by the participating laboratories. Before compiling population data, participants were asked to type the 38 indels in blind samples from annual GHEP-ISFG proficiency tests, using an amplification protocol previously described. Only laboratories that reported correct results contributed with population data to this study. A total of 5839 samples were genotyped from 45 different populations from Africa, America, East Asia, Europe and Middle East. Population differentiation analysis showed significant differences between most populations studied from Africa and America, as well as between two Asian populations from China and East Timor. Low F ST values were detected among most European populations. Overall diversities and parameters of forensic efficiency were high in populations from all continents. Copyright © 2017 Elsevier B.V. All rights reserved.
Ellis, Justine A; Scurrah, Katrina J; Duncan, Anna E; Lamantia, Angela; Byrnes, Graham B; Harrap, Stephen B
2007-04-01
There have been a number of genome-wide linkage studies for adult height in recent years. These studies have yielded few well-replicated loci, and none have been further confirmed by the identification of associated gene variants. The inconsistent results may be attributable to the fact that few studies have combined accurate phenotype measures with informative statistical modelling in healthy populations. We have performed a multi-stage genome-wide linkage analysis for height in 275 adult sibling pairs drawn randomly from the Victorian Family Heart Study (VFHS), a healthy population-based Caucasian cohort. Height was carefully measured in a standardised fashion on regularly calibrated equipment. Following genome-wide identification of a peak Z-score of 3.14 on chromosome 3 at 69 cM, we performed a fine-mapping analysis of this region in an extended sample of 392 two-generation families. We used a number of variance components models that incorporated assortative mating and shared environment effects, and we observed a peak LOD score of approximately 3.5 at 78 cM in four of the five models tested. We also demonstrated that the most prevalent model in the literature gave the worst fit, and the lowest LOD score (2.9) demonstrating the importance of appropriate modelling. The region identified in this study replicates the results of other genome-wide scans of height and bone-related phenotypes, strongly suggesting the presence of a gene important in bone growth on chromosome 3p. Association analyses of relevant candidate genes should identify the genetic variants responsible for the chromosome 3p linkage signal in our population.
Barter, Zoe E; Tucker, Geoffrey T; Rowland-Yeo, Karen
2013-12-01
International Conference on Harmonization of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH) guidelines emphasize the need for better understanding of the influence of ethnicity on drug response to minimize duplication of clinical studies, thereby expediting drug approval. We have developed a Chinese database for the prediction of differences in the population kinetics of drugs mainly metabolized by cytochromes P450 (CYPs) relative to Caucasian populations. Such predictions should help to inform the need for duplication of in vivo pharmacokinetic studies in the two ethnic groups and the design of such studies. Demographic and physiological data for Chinese, along with information on CYP abundances and the frequencies of associated genetic polymorphisms in Chinese, were collated from literature sources and incorporated within the Simcyp Population-based Simulator(®) (v11.1). Default Simcyp parameter values for a virtual Caucasian population and for model compounds metabolized principally by specific CYPs were used as the point of reference. The drugs and the main CYPs involved in their metabolism were phenacetin (CYP1A2), desipramine (CYP2D6), tolbutamide (CYP2C9), omeprazole (CYP2C19), and alprazolam and midazolam (CYP3A). Hydroxy bupropion formation was used as a more sensitive marker of CYP2B6 activity than bupropion kinetics. Observed plasma drug concentration-time profiles and pharmacokinetic parameters after oral and, where possible, intravenous dosing were obtained from published in vivo studies in both Chinese and Caucasian subjects. Virtual subjects generated within Simcyp were matched to the subjects used in the in vivo studies with respect to age, sex, dosage and, where possible, CYP phenotype frequency. Predicted and observed plasma drug concentrations and weight-normalized clearances were compared between the ethnic groups. Significant differences were identified between Chinese and Caucasian populations in the frequency
Classification of stellar populations in globular clusters
NASA Astrophysics Data System (ADS)
Wang, Yue; Zhao, Gang; Li, Hai-Ning
2017-04-01
Possessing multiple stellar populations has been accepted as a common feature of globular clusters (GCs). Different stellar populations manifest themselves with different chemical features, e.g. the well-known O-Na anti-correlation. Generally, the first (primordial) population has O and Na abundances consistent with those of field stars with similar metallicity; while the second (polluted) population is identified by their Na overabundance and O deficiency. The fraction of the populations is an important constraint on the GC formation scenario. Several methods have been proposed for the classification of GC populations. Here we examine a criterion derived based on the distribution of Galactic field stars, which relies on Na abundance as a function of [Fe/H], to distinguish first and second stellar populations in GCs. By comparing the first population fractions of 17 GCs estimated by the field star criterion with those in the literature derived by methods related to individual GCs, we find that the field star criterion tends to overestimate the first population fractions. The population separation methods, which are related to an individual GC sample, are recommended because the diversity of GCs can be taken into consideration. Currently, more caution should be exercised if one wants to regard field stars as a reference for the identification of a GC population. However, further study on the connection between field stars and GCs populations is still needed.
Identifying Water Insecurity Hotspots in the Lake Victoria Basin of Eastern Africa
NASA Astrophysics Data System (ADS)
Pricope, N. G.; Shukla, S.; Linard, C.; Gaughan, A.
2014-12-01
The Lake Victoria Basin (LVB), one of Africa's most populated transboundary watersheds and home to more than 30 million inhabitants, is increasingly challenged by both water quality problems and water quantity shortages against a backdrop of climate variability and change; and other environmental challenges. As a result of pollution, droughts, more erratic rainfall, heightened demand for water for both consumption and agricultural needs as well as differences in water allocation among the riverine countries of Uganda, Tanzania, Kenya, Rwanda and Burundi, many parts of this region are already experiencing water scarcity on a recurrent basis. Furthermore, given projected annual population growth rates of 2.5 to 3.5% for the next 20 years, water shortages are likely to be exacerbated in the future. Analyzing historical changes in the water resources of this region is hence important to identify "hot spots" that might be most sensitive to future changes in climate and demography. In this presentation, we report the findings of a comprehensive analysis performed to (i) examine changes in water resources of LVB in recent decades and (ii) identify overlap between regions of significant changes in water resources with land cover changes and high population centers that are also projected to grow the fastest over the coming decades. We first utilize several satellite, stations and model(s) based climatic and hydrologic datasets to assess changes in water resources in this region. We then use a quality-controlled Moderate Resolution Imaging Spectroradiometer (MODIS) land cover product to identify areas of significant land cover changes. Simultaneously we use projections of gridded population density based on differential growth rates for rural and urban population to estimate fastest projected human population growth for 2030 and 2050 relative to 2010 data. Using the outcomes of these change analysis we identify water insecurity hotspots in the LVB.
Individualized head-related transfer functions based on population grouping.
Xu, Song; Li, Zhizhong; Salvendy, Gavriel
2008-11-01
A method is proposed to divide a population into different groups for partial individualization of head-related transfer functions (HRTFs). Borrowing the basic idea in sizing system design, factor analysis is used to identify the most representative measurements which are then in a case study used to group the population. The comparison between the group mean HRTFs and the population mean HRTFs shows that the group mean HRTFs could greatly reduce spectral distortion at most sampled positions.
Population structure of giraffes is affected by management in the Great Rift Valley, Kenya
2018-01-01
Giraffe populations in East Africa have declined in the past thirty years yet there has been limited research on this species. This study had four objectives: i) to provide a baseline population assessment for the two largest populations of Rothschild’s giraffes in Kenya, ii) to assess whether there are differences in population structure between the two enclosed populations, iii) to assess the potential and possible implications of different management practices on enclosed giraffe populations to inform future decision-making, and iv) to add to the availability of information available about giraffes in the wild. I used individual identification to assess the size and structure of the two populations; in Soysambu Conservancy between May 2010 and January 2011, I identified 77 giraffes; in Lake Nakuru National Park between May 2011 and January 2012, I identified 89. Population structure differed significantly between the two sites; Soysambu Conservancy contained a high percentage of juveniles (34%) and subadults (29%) compared to Lake Nakuru NP, which contained fewer juveniles (5%) and subadults (15%). During the time of this study Soysambu Conservancy contained no lions while Lake Nakuru NP contained a high density of lions (30 lions per 100km2). Lions are the main predator of giraffes, and preferential predation on juvenile giraffes has previously been identified in Lake Nakuru NP. My results suggest that high lion density in Lake Nakuru NP may have influenced the structure of the giraffe population by removing juveniles and, consequently, may affect future population growth. I suggest that wildlife managers consider lion densities alongside breeding plans for Endangered species, since the presence of lions appears to influence the population structure of giraffes in enclosed habitats. PMID:29298338
Population structure of giraffes is affected by management in the Great Rift Valley, Kenya.
Muller, Zoe
2018-01-01
Giraffe populations in East Africa have declined in the past thirty years yet there has been limited research on this species. This study had four objectives: i) to provide a baseline population assessment for the two largest populations of Rothschild's giraffes in Kenya, ii) to assess whether there are differences in population structure between the two enclosed populations, iii) to assess the potential and possible implications of different management practices on enclosed giraffe populations to inform future decision-making, and iv) to add to the availability of information available about giraffes in the wild. I used individual identification to assess the size and structure of the two populations; in Soysambu Conservancy between May 2010 and January 2011, I identified 77 giraffes; in Lake Nakuru National Park between May 2011 and January 2012, I identified 89. Population structure differed significantly between the two sites; Soysambu Conservancy contained a high percentage of juveniles (34%) and subadults (29%) compared to Lake Nakuru NP, which contained fewer juveniles (5%) and subadults (15%). During the time of this study Soysambu Conservancy contained no lions while Lake Nakuru NP contained a high density of lions (30 lions per 100km2). Lions are the main predator of giraffes, and preferential predation on juvenile giraffes has previously been identified in Lake Nakuru NP. My results suggest that high lion density in Lake Nakuru NP may have influenced the structure of the giraffe population by removing juveniles and, consequently, may affect future population growth. I suggest that wildlife managers consider lion densities alongside breeding plans for Endangered species, since the presence of lions appears to influence the population structure of giraffes in enclosed habitats.
Krause, Jane; Van Lieshout, Jan; Klomp, Rien; Huntink, Elke; Aakhus, Eivind; Flottorp, Signe; Jaeger, Cornelia; Steinhaeuser, Jost; Godycki-Cwirko, Maciek; Kowalczyk, Anna; Agarwal, Shona; Wensing, Michel; Baker, Richard
2014-08-12
The tailoring of implementation interventions includes the identification of the determinants of, or barriers to, healthcare practice. Different methods for identifying determinants have been used in implementation projects, but which methods are most appropriate to use is unknown. The study was undertaken in five European countries, recommendations for a different chronic condition being addressed in each country: Germany (polypharmacy in multimorbid patients); the Netherlands (cardiovascular risk management); Norway (depression in the elderly); Poland (chronic obstructive pulmonary disease--COPD); and the United Kingdom (UK) (obesity). Using samples of professionals and patients in each country, three methods were compared directly: brainstorming amongst health professionals, interviews of health professionals, and interviews of patients. The additional value of discussion structured through reference to a checklist of determinants in addition to brainstorming, and determinants identified by open questions in a questionnaire survey, were investigated separately. The questionnaire, which included closed questions derived from a checklist of determinants, was administered to samples of health professionals in each country. Determinants were classified according to whether it was likely that they would inform the design of an implementation intervention (defined as plausibly important determinants). A total of 601 determinants judged to be plausibly important were identified. An additional 609 determinants were judged to be unlikely to inform an implementation intervention, and were classified as not plausibly important. Brainstorming identified 194 of the plausibly important determinants, health professional interviews 152, patient interviews 63, and open questions 48. Structured group discussion identified 144 plausibly important determinants in addition to those already identified by brainstorming. Systematic methods can lead to the identification of large
ERIC Educational Resources Information Center
Hu, Wei; Lee, Hwee Ling; Zhang, Qiang; Liu, Tao; Geng, Li Bo; Seghier, Mohamed L.; Shakeshaft, Clare; Twomey, Tae; Green, David W.; Yang, Yi Ming; Price, Cathy J.
2010-01-01
Previous neuroimaging studies have suggested that developmental dyslexia has a different neural basis in Chinese and English populations because of known differences in the processing demands of the Chinese and English writing systems. Here, using functional magnetic resonance imaging, we provide the first direct statistically based investigation…
Hsu, Jeremy Ming; Hitos, Kerry; Fletcher, John P
2013-09-01
Military and civilian data would suggest that hemostatic resuscitation results in improved outcomes for exsanguinating patients. However, identification of those patients who are at risk of significant hemorrhage is not clearly defined. We attempted to identify factors that would predict the need for massive transfusion (MT) in an Australasian trauma population, by comparing those trauma patients who did receive massive transfusion with those who did not. Between 1985 and 2010, 1,686 trauma patients receiving at least 1 U of packed red blood cells were identified from our prospectively maintained trauma registry. Demographic, physiologic, laboratory, injury, and outcome variables were reviewed. Univariate analysis determined significant factors between those who received MT and those who did not. A predictive multivariate logistic regression model with backward conditional stepwise elimination was used for MT risk. Statistical analysis was performed using SPSS PASW. MT patients had a higher pulse rate, lower Glasgow Coma Scale (GCS) score, lower systolic blood pressure, lower hemoglobin level, higher Injury Severity Score (ISS), higher international normalized ratio (INR), and longer stay. Initial logistic regression identified base deficit (BD), INR, and hemoperitoneum at laparotomy as independent predictive variables. After assigning cutoff points of BD being greater than 5 and an INR of 1.5 or greater, a further model was created. A BD greater than 5 and either INR of 1.5 or greater or hemoperitoneum was associated with 51 times increase in MT risk (odds ratio, 51.6; 95% confidence interval, 24.9-95.8). The area under the receiver operating characteristic curve for the model was 0.859. From this study, a combination of BD, INR, and hemoperitoneum has demonstrated good predictability for MT. This tool may assist in the determination of those patients who might benefit from hemostatic resuscitation. Prognostic study, level III.
Quijada, Narciso M; De Filippis, Francesca; Sanz, José Javier; García-Fernández, María Del Camino; Rodríguez-Lázaro, David; Ercolini, Danilo; Hernández, Marta
2018-04-01
"Chorizo de Léon" is a high-value Spanish dry fermented sausage traditionally manufactured without the use of starter cultures, owing to the activity of a house-specific autochthonous microbiota that naturally contaminates the meat from the environment, the equipment and the raw materials. Lactic acid bacteria (particularly Lactobacillus) and coagulase-negative cocci (mainly Staphylococcus) have been reported as the most important bacterial groups regarding the organoleptic and safety properties of the dry fermented sausages. In this study, samples from raw minced meat to final products were taken from five different producers and the microbial diversity was investigated by high-throughput sequencing of 16S rRNA gene amplicons. The diverse microbial composition observed during the first stages of "Chorizo de Léon" evolved during ripening to a microbiota mainly composed by Lactobacillus in the final product. Oligotyping performed on 16S rRNA gene sequences of Lactobacillus and Staphylococcus populations revealed sub-genus level diversity within the different manufacturers, likely responsible of the characteristic organoleptic properties of the products from different companies. Copyright © 2017 Elsevier Ltd. All rights reserved.
Differences in lipid profiles in two Hispanic ischemic stroke populations.
Arauz, A; Romano, J G; Ruiz-Franco, A; Shang, T; Dong, C; Rundek, T; Koch, S; Hernández-Curiel, B; Pacheco, J; Rojas, P; Ruiz-Navarro, F; Katsnelson, M; Sacco, R L
2014-06-01
The study aims to compare lipid profiles among ischemic stroke patients in a predominantly Caribbean-Hispanic population in Miami and a Mestizo Hispanic population in Mexico City. We analyzed ischemic stroke Hispanic patients with complete baseline fasting lipid profile enrolled contemporaneously in the prospective registries of two tertiary care teaching hospitals in Mexico City and Miami. Demographic characteristics, risk factors, medications, ischemic stroke subtype, and first fasting lipid profile were compared. Vascular risk factor definitions were standardized. Multiple linear regression analysis was performed to compare lipid fractions. A total of 324 patients from Mexico and 236 from Miami were analyzed. Mexicans were significantly younger (58 · 1 vs. 67 · 4 years), had a lower frequency of hypertension (53 · 4% vs. 79 · 7%), and lower body mass index (27 vs. 28 · 5). There was a trend toward greater prevalence of diabetes in Mexicans (31 · 5 vs. 24 · 6%, P = 0 · 07). Statin use at the time of ischemic stroke was more common in Miami Hispanics (18 · 6 vs. 9 · 4%). Mexicans had lower total cholesterol levels (169 · 9 ± 46 · 1 vs. 179 · 9 ± 48 · 4 mg/dl), lower low-density lipoprotein (92 · 3 ± 37 · 1 vs. 108 · 2 ± 40 · 8 mg/dl), and higher triglyceride levels (166 · 9 ± 123 · 9 vs. 149 · 2 ± 115 · 2 mg/dl). These differences remained significant after adjusting for age, gender, hypertension, diabetes, body mass index, smoking, ischemic stroke subtype, and statin use. We found significant differences in lipid fractions in Hispanic ischemic stroke patients, with lower total cholesterol and low-density lipoprotein, and higher triglyceride levels in Mexicans. These findings highlight the heterogeneity of dyslipidemia among the Hispanic race-ethnic group and may lead to different secondary prevention strategies. © 2013 The Authors. International Journal of Stroke © 2013 World Stroke Organization.
Genomic copy number variations in three Southeast Asian populations.
Ku, Chee-Seng; Pawitan, Yudi; Sim, Xueling; Ong, Rick T H; Seielstad, Mark; Lee, Edmund J D; Teo, Yik-Ying; Chia, Kee-Seng; Salim, Agus
2010-07-01
Research on the role of copy number variations (CNVs) in the genetic risk of diseases in Asian populations has been hampered by a relative lack of reference CNV maps for Asian populations outside the East Asians. In this article, we report the population characteristics of CNVs in Chinese, Malay, and Asian Indian populations in Singapore. Using the Illumina Human 1M Beadchip array, we identify 1,174 CNV loci in these populations that corroborated with findings when the same samples were typed on the Affymetrix 6.0 platform. We identify 441 novel loci not previously reported in the Database of Genomic Variations (DGV). We observe a considerable number of loci that span all three populations and were previously unreported, as well as population-specific loci that are quite common in the respective populations. From this we observe the distribution of CNVs in the Asian Indian population to be considerably different from the Chinese and Malay populations. About half of the deletion loci and three-quarters of duplication loci overlap UCSC genes. Tens of loci show population differentiation and overlap with genes previously known to be associated with genetic risk of diseases. One of these loci is the CYP2A6 deletion, previously linked to reduced susceptibility to lung cancer. (c) 2010 Wiley-Liss, Inc.
2016-01-01
The recovery of Bald Eagles (Haliaeetus leucophalus), after DDT and other organochlorine insecticides were banned in the United States, can be regarded as one of the most iconic success stories resulting from the Endangered Species Act. Interest remains high in the recovery and growth of the Bald Eagle population. Common to evaluating growth and recovery rates are counts at nesting sites and analyses of individuals fledged per season. But this is merely one snapshot that ignores survival rates as eagles grow to maturity. By analyzing indices from migration counts, we get a different snapshot better reflecting the survival of young birds. Different populations of Bald Eagles breed at different sites at different times of the year. Typical migration count analyses do not separate the populations. A separation of two distinct populations can be achieved at spring count sites by taking advantage of the tendency for northern summer breeding birds to migrate north in spring earlier than southern winter breeding birds who disperse north later in spring. In this paper I analyze migratory indices at a spring site along Lake Ontario. The analysis shows that eagles considered to be primarily of the northern summer breeding population showed an estimated growth rate of 5.3 ± 0.85% (SE) per year with 49% of eagles tallied in adult plumage, whereas the migrants considered to be primarily of the southern breeding population had an estimated growth rate of 14.0 ± 1.79% with only 22% in adult plumage. Together these results argue that the populations of southern breeding Bald Eagles are growing at a substantially higher rate than northern breeding eagles. These findings suggest that aggregate population indices for a species at migration counting sites can sometimes obscure important differences among separate populations at any given site and that separating counts by time period can be a useful way to check for differences among sub-populations. PMID:27231647
Medina, R F; Nachappa, P; Tamborindeguy, C
2011-04-01
Host-associated differentiation (HAD) is the presence of genetically divergent, host-associated populations. It has been suggested that microbial symbionts of insect herbivores may play a role in HAD by allowing their insect hosts to use different plant species. The objective of this study was to document if host-associated populations of Phylloxera notabilis Pergande (Hemiptera: Phylloxeridae) in pecan and water hickory corresponded with differences in the composition of their associated bacteria. To test this hypothesis, we characterized the symbionts present in P. notabilis associated with these two tree species through metagenomic analyses using 454 sequencing. Differences in bacterial diversity were found between P. notabilis populations associated with pecan and water hickory. The bacteria, Pantoea agglomerans and Serratia marcescens, were absent in the P. notabilis water hickory population, whereas both species accounted for more than 69.72% of bacterial abundance in the pecan population. © 2011 The Authors. Journal of Evolutionary Biology © 2011 European Society For Evolutionary Biology.
ERIC Educational Resources Information Center
Haerens, L.; Vansteenkiste, M.; De Meester, A.; Delrue, J.; Tallir, I.; Vande Broek, G.; Goris, W.; Aelterman, N.
2018-01-01
Background: According to Self-Determination Theory, teachers and sport coaches can differ in the motivating style they rely upon to motivate young people. When endorsing an autonomy-supportive motivating style, instructors try to identify, vitalize, and nurture youngsters' inner motivational resources. In contrast, instructors with a dominant…
Project Objective: To identify at-risk populations, particularly women of child bearing years and young children, for consumption of contaminated fish and seafood via the use of geographically and demographically defined seafood consumption patterns and fish/seafood contaminatio...
Delaney, Jessica T.; Jeff, Janina M.; Brown, Nancy J.; Pretorius, Mias; Okafor, Henry E.; Darbar, Dawood; Roden, Dan M.; Crawford, Dana C.
2012-01-01
Background Despite a greater burden of risk factors, atrial fibrillation (AF) is less common among African Americans than European-descent populations. Genome-wide association studies (GWAS) for AF in European-descent populations have identified three predominant genomic regions associated with increased risk (1q21, 4q25, and 16q22). The contribution of these loci to AF risk in African American is unknown. Methodology/Principal Findings We studied 73 African Americans with AF from the Vanderbilt-Meharry AF registry and 71 African American controls, with no history of AF including after cardiac surgery. Tests of association were performed for 148 SNPs across the three regions associated with AF, and 22 SNPs were significantly associated with AF (P<0.05). The SNPs with the strongest associations in African Americans were both different from the index SNPs identified in European-descent populations and independent from the index European-descent population SNPs (r2<0.40 in HapMap CEU): 1q21 rs4845396 (odds ratio [OR] 0.30, 95% confidence interval [CI] 0.13–0.67, P = 0.003), 4q25 rs4631108 (OR 3.43, 95% CI 1.59–7.42, P = 0.002), and 16q22 rs16971547 (OR 8.1, 95% CI 1.46–45.4, P = 0.016). Estimates of European ancestry were similar among cases (23.6%) and controls (23.8%). Accordingly, the probability of having two copies of the European derived chromosomes at each region did not differ between cases and controls. Conclusions/Significance Variable European admixture at known AF loci does not explain decreased AF susceptibility in African Americans. These data support the role of 1q21, 4q25, and 16q22 variants in AF risk for African Americans, although the index SNPs differ from those identified in European-descent populations. PMID:22384221
Xu, Shaochun; Wang, Pengmei; Zhou, Yi; Zhang, Xiaomei; Gu, Ruiting; Liu, Xujia; Liu, Bingjian; Song, Xiaoyue; Xu, Shuai; Yue, Shidong
2018-01-01
in HQB were significantly larger and heavier than those in SLL (size: P = 0.004; weight: P < 0.001). The recruitment from seedlings accounted for as low as 2.53% of the Z. marina population recruitment in HQB. Our laboratory seed germination experiment, which was conducted in autumn, showed that the seed germination percent in HQB was significantly greater than in SLL at optimal germination temperatures (10 and 15°C; P < 0.001). A laboratory seed germination test at suitable temperature may be a potential novel approach to identify the ecological differences among different geographic populations. It is suggested that the Z. marina population recruitment may have different strategies and adapt to specific local conditions, such as in SLL and HQB, and the temperature regime may control morphological and phonological variations. PMID:29483922
Xu, Shaochun; Wang, Pengmei; Zhou, Yi; Zhang, Xiaomei; Gu, Ruiting; Liu, Xujia; Liu, Bingjian; Song, Xiaoyue; Xu, Shuai; Yue, Shidong
2018-01-01
were significantly larger and heavier than those in SLL (size: P = 0.004; weight: P < 0.001). The recruitment from seedlings accounted for as low as 2.53% of the Z. marina population recruitment in HQB. Our laboratory seed germination experiment, which was conducted in autumn, showed that the seed germination percent in HQB was significantly greater than in SLL at optimal germination temperatures (10 and 15°C; P < 0.001). A laboratory seed germination test at suitable temperature may be a potential novel approach to identify the ecological differences among different geographic populations. It is suggested that the Z. marina population recruitment may have different strategies and adapt to specific local conditions, such as in SLL and HQB, and the temperature regime may control morphological and phonological variations.
Liu, Shenglin; Hansen, Michael M; Jacobsen, Magnus W
2016-10-01
We analysed 81 whole genome sequences of threespine sticklebacks from Pacific North America, Greenland and Northern Europe, representing 16 populations. Principal component analysis of nuclear SNPs grouped populations according to geographical location, with Pacific populations being more divergent from each other relative to European and Greenlandic populations. Analysis of mitogenome sequences showed Northern European populations to represent a single phylogeographical lineage, whereas Greenlandic and particularly Pacific populations showed admixture between lineages. We estimated demographic history using a genomewide coalescence with recombination approach. The Pacific populations showed gradual population expansion starting >100 Kya, possibly reflecting persistence in cryptic refuges near the present distributional range, although we do not rule out possible influence of ancient admixture. Sharp population declines ca. 14-15 Kya were suggested to reflect founding of freshwater populations by marine ancestors. In Greenland and Northern Europe, demographic expansion started ca. 20-25 Kya coinciding with the end of the Last Glacial Maximum. In both regions, marine and freshwater populations started to show different demographic trajectories ca. 8-9 Kya, suggesting that this was the time of recolonization. In Northern Europe, this estimate was surprisingly late, but found support in subfossil evidence for presence of several freshwater fish species but not sticklebacks 12 Kya. The results demonstrate distinctly different demographic histories across geographical regions with potential consequences for adaptive processes. They also provide empirical support for previous assumptions about freshwater populations being founded independently from large, coherent marine populations, a key element in the Transporter Hypothesis invoked to explain the widespread occurrence of parallel evolution across freshwater stickleback populations. © 2016 John Wiley & Sons Ltd.
Differences in delta13C and diameter growth among remnant Scots pine populations in Scotland.
Brendel, Oliver; Handley, Linda; Griffiths, Howard
2002-10-01
Published data suggest that differences in wood cellulose carbon isotope composition (delta13C) and xylem ring width among natural populations of Scots pine in Scotland (Pinus sylvestris L.) are attributable to the persistence of palaeotypes of various post-glacial migratory origins. We assessed differences in wood cellulose delta13C and ring width among Scottish Scots pine populations grown in a clone bank and in natural stands at various locations in northern and central Scotland. Ring width and wood cellulose delta13C varied significantly among natural stands. Potential water deficit was positively correlated with wood cellulose delta13C and xylem ring width in the natural stands. Neither wood cellulose delta13C nor xylem ring width of clone bank trees correlated with any climate variables at the sites from which the trees originated, indicating little adaptation to climate for these traits. Xylem ring width showed a site x population interaction for the growth sites (i.e., natural stands versus clone bank), but wood cellulose delta13C did not. These results suggest that climate variation in Scotland has not resulted in significant genetic variation in wood cellulose delta13C or xylem ring width in post-glacial populations.
The ZJU index is a powerful index for identifying NAFLD in the general Chinese population.
Li, Linman; You, Wenyi; Ren, Wei
2017-10-01
The ZJU index is a novel model for detecting non-alcoholic fatty liver disease (NAFLD) that it is calculated based on combination of the body mass index, fasting plasma glucose, triglycerides, and the serum alanine aminotransferase-to-aspartate transaminase ratio. We aimed to evaluate the diagnostic accuracy of the ZJU index in detecting NAFLD in the Chinese population. This was a cross-sectional study. Anthropometric measurements, laboratory data, and ultrasonography features were collected through a standard protocol. The ZJU index, fatty liver index, hepatic steatosis index, lipid accumulation product, and visceral adiposity index were calculated. Then the predictive values of the five indices were compared according to the area under receiver-operating characteristic curve (AUROC) values. A total of 19,804 participants were recruited, of whom 7324 participants were diagnosed with NFALD and 12,480 subjects were regarded as controls. The AUROC value for NAFLD identification by the ZJU index was 0.925 (95% confidence interval [CI]: 0.919-0.931), which was significantly higher than the values for the other four models (P < 0.001). Furthermore, from age 31 years to >60 years, the AUROC for the ZJU increased from 87.1 to 95.4%, values which were also greater than those for the other four indices. Analysis by sex also showed that the performance of the ZJU index in males and females was better than that of the other four indices. The ZJU index is an accurate and easy to employ tool for identifying NAFLD in the general Chinese population.
Buj, Ivana; Ćaleta, Marko; Marčić, Zoran; Šanda, Radek; Vukić, Jasna; Mrakovčić, Milorad
2015-01-01
The region of Balkans is often considered as an ichthyologic "hot spot", with a great number of species and high portion of endemics living in fresh waters in a relatively small area. The Adriatic watershed in Croatia and Herzegovina is inhabited by six spined loach species (genus Cobitis) whose extinction risk estimations were based solely on their extent of occurrence (and/or area of occupancy) and its fragmentation, and conservation proposals do not consider diversity below species level. In this investigation we employed molecular genetic methods to describe present genetic structure of the Adriatic spined loaches and reveal their demographic history. The divergence of the Adriatic lineages inside the genus Cobitis started in Miocene and lasted until Pleistocene epoch. Geological events responsible for shaping recent diversity of spined loaches in the Adriatic basin are: the Dinarid Mountains upwelling, the evolution of Dinaric Lake system, local tectonic activity, river connections during glaciations and differences in sea level. Even though all the investigated species inhabit karstic rivers located in the same geographic area and that were subject of similar geological events, the results obtained reveal great differences in their genetic diversity and structure and point out the necessity of different conservation measures to ensure their future viability. High level of genetic polymorphism is characteristic for species located more to the south. Two species comprised of more than one population have completely different intraspecific structure; populations of C. illyrica are genetically distinct and represent separate evolutionary significant units, whereas intraspecific structure of C. narentana corresponds to metapopulational pattern. Without population genetic data, evolutionary significant units could be easily misidentified. Furthermore, the obtained results affirm that population genetic measurements are able to detect differences among closely
Shi, Ainong; Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram
2017-01-01
Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs.
Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram
2017-01-01
Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs. PMID:29190770
Pou, Sonia Alejandra; Del Pilar Díaz, María; De La Quintana, Ana Gabriela; Forte, Carla Antonella; Aballay, Laura Rosana
2016-12-01
In Argentina, obesity prevalence rose from 14.6% in 2005 to 20.8% in 2013. Although the number of studies on noncommunicable diseases and dietary patterns as a unique dietary exposure measure has increased, information on this topic remains scarce in developing countries. This is the first population-based study investigating the association between diet and obesity using a dietary pattern approach in Argentina. We aimed (a) to identify current dietary patterns of the population of Córdoba city, (b) to investigate its association with obesity prevalence, and (c) to identify and describe dietary patterns from the subgroup of people with obesity. The Córdoba Obesity and Diet Study (CODIES) was conducted in Córdoba city by using a random sample of n = 4,327 subjects between 2005 and 2012. Empirically derived dietary patterns were identified through principal component factor analysis. A multiple logistic regression analysis was used to investigate the association of dietary patterns with obesity. Four dietary patterns were identified, called " Starchy-Sugar ", " Prudent ", " Western ", and " Sugary drinks ". High scores for the " Western " pattern (with strongest factor loading on meats/eggs, processed meats, and alcohol) showed a positive association with obesity (OR: 1.33, 95% CI: 1.06-1.67, for third versus first tertile of factor score). " Meats/Cheeses " and " Snacks/Alcohol " patterns emerged in people with obesity. The findings suggest that high adherence to the " Western " pattern promoted obesity in this urban population. In addition, people with obesity showed characteristic dietary patterns that differ from those identified in the overall population.
Characterizing the galaxy populations within different environments in the RCS2319 supercluster
NASA Astrophysics Data System (ADS)
Delahaye, Anna; Webb, Tracy
We present the results of a multi-wavelength photometric study of the high redshift supercluster RCS2319+00. RCS2319+00 is a high-redshift (z ~ 0.9) supercluster comprising three spectroscopically confrmed cluster cores discovered in the Red Sequence Cluster Survey (RCS) (Gladders & Yee 2005). Core proximities and merger rates estimate coalescence into a 1015 M ⊙ cluster by z ~ 0.5 (Gilbank et al. 2008). Spectroscopic studies of the system have revealed over 300 supercluster members located in the cores and several infalling groups (Faloon et al. 2013). RCS2319 presents a diverse range of dynamical systems and densities making it an ideal laboratory in which to study the effects of environment on galaxy properties. Imaging in optical and near infrared (griz' from MegaCam, JK s from WIRCam, both at CFHT), as well as 3.6 μm and 4.5μm from IRAC have enabled the assembly of a large photometric catalogue. Coupled with an extensive spectroscopic survey (Faloon et al. 2013) providing nearly 2400 redshifts across the field, photometric redshifts were determined using the template fitting code EAZY (Brammer et al. 2008). Nearly 80 000 photometric redshifts were measured providing a sample of nearly 3000 cluster members. To investigate effects of global environment, analysis was done utilizing a friend-of-friends group finding algorithm identifying several large and small infalling groups along with the three cluster cores. The cores are found to be dominated by massive, red galaxies and the field galaxies are populated by low mass, blue galaxies, as is the case in the local universe. Interestingly, the large groups exhibit intermediate properties between field and core populations, suggesting possible pre-processing as they are being accreted into the core halos. Relative fifth-nearest neighbour overdensity, log(1+δ5), is used as a proxy for local environment to investigate environmental dependence on galaxy colour. While there is an overall dependence of colour on
Prevalence of chronic atrophic gastritis in different parts of the world.
Weck, Melanie Nicole; Brenner, Hermann
2006-06-01
Chronic atrophic gastritis (CAG) is a well-established precursor of intestinal gastric cancer, but epidemiologic data about its occurrence are sparse. We provide an overview on studies that examined the prevalence of CAG in different parts of the world. Articles containing data about the prevalence of chronic atrophic gastritis in unselected population samples and published until November 2005 were identified by searching the MEDLINE database. Furthermore, the references in the identified publications were screened for additional suitable studies. Studies comprising at least 50 subjects were included. Forty-one studies providing data on the prevalence of CAG in unselected population samples could be identified. CAG was determined by gastroscopy in 15 studies and by pepsinogen serum levels in 26 studies. Although results are difficult to compare due to the various definitions of CAG used, a strong increase with age, the lack of major gender differences, and strong variations between populations and population groups (in particular, relatively high rates in certain Asian populations) could be observed quite consistently. We conclude that CAG is relatively common among older adults in different parts of the world, but large variations exist. Large-scale international comparative studies with standardized methodology to determine CAG are needed to provide a coherent picture of the epidemiology of CAG in various populations. Noninvasive measurements of CAG by pepsinogen levels may be particularly suited for that purpose.
Evacuation of institutionalized and specialized populations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vogt, B.M.
The purpose of this research was to assess the needs of organizations caring for institutional and specialized populations when faced with a threat or hazard requiring an evacuation. Individuals within specialized populations are unlike other victims of disaster because of their inherent dependency on organizational care givers and require different management strategies on the part of organizations and agencies in an evacuation. The research sought to identify those aspects of coping strategies that have been used successfully to manage an emergency evacuation. To identify special populations that have evacuated from institutions and similar facilities over a four-year period, a computerizedmore » search was conducted of media accounts describing such events. The search yielded a total of 1024 accounts from which four major subgroups were identified: nursing homes and related care facilities, hospitals, educational institutions, and correctional facilities. A miscellaneous group including housing for the elderly, apartments and other building complexes, workplaces and factories, public facilities, and places occupied by transient populations, such as transportation units and recreational facilities, could be used for future study. Among the factors found to affect evacuations were the extent of organizational resources (such as the number of staff or other individuals available at the time of the event), the type and number of clientele, and such community characteristics as population density. The study focuses on selected organizational characteristics of health care facilities (nursing homes and related care facilities and hospitals) which have recently experienced either a partial or complete evacuation of their facilities. 165 refs., 13 tabs.« less
Cocozza, Claudia; de Miguel, Marina; Pšidová, Eva; Ditmarová, L'ubica; Marino, Stefano; Maiuro, Lucia; Alvino, Arturo; Czajkowski, Tomasz; Bolte, Andreas; Tognetti, Roberto
2016-01-01
Frequency and intensity of heat waves and drought events are expected to increase in Europe due to climate change. European beech (Fagus sylvatica L.) is one of the most important native tree species in Europe. Beech populations originating throughout its native range were selected for common-garden experiments with the aim to determine whether there are functional variations in drought stress responses among different populations. One-year old seedlings from four to seven beech populations were grown and drought-treated in a greenhouse, replicating the experiment at two contrasting sites, in Italy (Mediterranean mountains) and Germany (Central Europe). Experimental findings indicated that: (1) drought (water stress) mainly affected gas exchange describing a critical threshold of drought response between 30 and 26% SWA for photosynthetic rate and Ci/Ca, respectively; (2) the Ci to Ca ratio increased substantially with severe water stress suggesting a stable instantaneous water use efficiency and an efficient regulation capacity of water balance achieved by a tight stomatal control; (3) there was a different response to water stress among the considered beech populations, differently combining traits, although there was not a well-defined variability in drought tolerance. A combined analysis of functional and structural traits for detecting stress signals in beech seedlings is suggested to assess plant performance under limiting moisture conditions and, consequently, to estimate evolutionary potential of beech under a changing environmental scenario. PMID:27446118
A whole-plant screening test to identify genotypes with superior freezing tolerance.
Bertrand, Annick; Castonguay, Yves; Bourassa, Josée
2014-01-01
Freezing tolerance is a determinant factor of persistence of perennials grown in northern climate. Selection for winterhardiness in field nurseries is difficult because of the unpredictability of occurrence of test winters allowing the identification of hardy genotypes. Here we describe a whole-plant assay entirely performed indoor in growth chambers and walk-in freezers to identify genotypes with superior tolerance to freezing within populations of open pollinated species. Three successive freezing stresses are applied to progressively eliminate 90 % of the population and to retain only the 10 % best performing genotypes. This approach can be used to generate recurrently selected populations more tolerant to freezing in different species.
Genetic structure among continental and island populations of gyrfalcons.
Johnson, Jeff A; Burnham, Kurt K; Burnham, William A; Mindell, David P
2007-08-01
Little is known about the possible influence that past glacial events have had on the phylogeography and population structure of avian predators in the Arctic and sub-Arctic. In this study, we use microsatellite and mitochondrial control region DNA variation to investigate the population genetic structure of gyrfalcons (Falco rusticolus) throughout a large portion of their circumpolar distribution. In most locations sampled, the mtDNA data revealed little geographic structure; however, five out of eight mtDNA haplotypes were unique to a particular geographic area (Greenland, Iceland, or Alaska) and the Iceland population differed from others based on haplotype frequency differences (F(ST)). With the microsatellite results, significant population structure (F(ST), principal components analysis, and cluster analysis) was observed identifying Greenland and Iceland as separate populations, while Norway, Alaska and Canada were identified as a single population consistent with contemporary gene flow across Russia. Within Greenland, differing levels of gene flow between western and eastern sampling locations was indicated with apparent asymmetric dispersal in western Greenland from north to south. This dispersal bias is in agreement with the distribution of plumage colour variants with white gyrfalcons in much higher proportion in northern Greenland. Lastly, because the mtDNA control region sequence differed by only one to four nucleotides from a common haplotype among all gyrfalcons, we infer that the observed microsatellite population genetic structure has developed since the last glacial maximum. This conclusion is further supported by our finding that a closely related species, the saker falcon (Falco cherrug), has greater genetic heterogeneity, including mtDNA haplotypes differing by 1-16 nucleotide substitutions from a common gyrfalcon haplotype. This is consistent with gyrfalcons having expanded rapidly from a single glacial-age refugium to their current
Woo, Jean; Zheng, Zheng; Leung, Jason; Chan, Piu
2015-12-09
Frailty predicts dependence and mortality, and is an important health indicator for aging populations. Comparing frailty prevalence between populations of the same ethnicity but different socioeconomic, lifestyle, health and social care systems, and environmental characteristics would address the role of these factors in contributing to frailty. We compare frailty prevalence and contributory factors across three Chinese populations: Beijing rural, Beijing urban, and Hong Kong (urban). Older people aged 65 years and above living in the community were invited to respond to a general health questionnaire covering demographic, socioeconomic, medical and drug histories, geriatric syndromes, assessment of physical and cognitive functioning, psychological wellbeing and nutritional status. Frailty is defined as an index calculated from multiple deficits > = 0.25 (FI). The ratio of FI/life expectancy at birth was used as an indicator of compression of morbidity. Risk factors and attributable fraction for frailty were compared across the three cohorts. The prevalence of frailty increases with age in all three cohorts, and was lower among rural compared with urban (Beijing and Hong Kong) populations. The highest FI/LE ratio was observed in the Beijing urban population, followed by Hong Kong, with the Beijing rural population having the lowest ratio. Risk factors for frailty were similar in all three populations. Those having the highest ORs were multi-morbidity (number of diseases > = 3), polypharmacy (number of drugs > = 4), age 85+, female gender, followed by low education level, and physical inactivity. For all three cohorts, age and multi-morbidity constitute the highest attributable fraction, and were highest in the Beijing rural cohort. A major difference between the Beijing and Hong Kong cohorts is the high AF from polypharmacy in Beijing and the 'protective' contribution of being married; and the effect of being a teetotaler in the Hong Kong cohort. This
Population data for 15 Y-chromosome STRs in a population sample from Quito (Ecuador).
Baeza, Carlos; Guzmán, Rodrigo; Tirado, Miriam; López-Parra, Ana María; Rodríguez, Tatiana; Mesa, María Soledad; Fernández, Eva; Arroyo-Pardo, Eduardo
2007-12-20
Population frequencies for the 9 Y-STR loci included in the "minimal haplotype" from Y-STR Haplotype Reference Database (YHRD), plus other 6 Y-STRs (DYS437, DYS438, DYS439, GATA A7.2, GATA H4 and GATA A10) were obtained for a sample of 120 males from Quito (Ecuador). One hundred and sixteen unique haplotypes were identified within the sample. Haplotype diversity (0.9994) was among the highest in comparison to other populations from Iberia and South-America. Genetic distances were calculated and our sample presented significative differences with all other samples, the lowest values being with a Guinean sample.
McNulty, E.W.; Dwyer, F.J.; Ellersieck, Mark R.; Greer, E.I.; Ingersoll, C.G.; Rabeni, C.F.
1999-01-01
Standard methods for conducting toxicity tests imply that the condition of test organisms can be established using reference toxicity tests. However, only a limited number of studies have evaluated whether reference toxicity tests can actually be used to determine if organisms are in good condition at the start of a test. We evaluated the ability of reference toxicants to identify stress associated with starvation in laboratory populations of the amphipod Hyalella azteca using acute toxicity tests and four reference toxicants: KCl, CdCl2, sodium pentachlorophenate (NaPCP), and carbaryl. Stress associated with severe starvation was observed with exposure of amphipods to carbaryl or NaPCP but not with exposure to KCl or CdCl2 (i.e., lower LC50 with severe starvation). Although the LC50s for NaPCP and carbaryl were statistically different between starved and fed amphipods, this difference may not be biologically significant given the variability expected in acute lethality tests. Stress associated with sieving, heat shock, or cold shock of amphipods before the start of a test was not evident with exposure to carbaryl or KCl as reference toxicants. The chemicals evaluated in this study provided minimal information about the condition of the organisms used to start a toxicity test. Laboratories should periodically perform reference toxicity tests to assess the sensitivity of life stages or strains of test organisms. However, use of other test acceptability criteria required in standard methods such as minimum survival, growth, or reproduction of organisms in the control treatment at the end of a test, provides more useful information about the condition of organisms used to start a test compared to data generated from reference toxicity tests.
Genome skimming identifies polymorphism in tern populations and species
2012-01-01
Background Terns (Charadriiformes: Sterninae) are a lineage of cosmopolitan shorebirds with a disputed evolutionary history that comprises several species of conservation concern. As a non-model system in genetics, previous study has left most of the nuclear genome unexplored, and population-level studies are limited to only 15% of the world's species of terns and noddies. Screening of polymorphic nuclear sequence markers is needed to enhance genetic resolution because of supposed low mitochondrial mutation rate, documentation of nuclear insertion of hypervariable mitochondrial regions, and limited success of microsatellite enrichment in terns. Here, we investigated the phylogenetic and population genetic utility for terns and relatives of a variety of nuclear markers previously developed for other birds and spanning the nuclear genome. Markers displaying a variety of mutation rates from both the nuclear and mitochondrial genome were tested and prioritized according to optimal cross-species amplification and extent of genetic polymorphism between (1) the main tern clades and (2) individual Royal Terns (Thalasseus maxima) breeding on the US East Coast. Results Results from this genome skimming effort yielded four new nuclear sequence-based markers for tern phylogenetics and 11 intra-specific polymorphic markers. Further, comparison between the two genomes indicated a phylogenetic conflict at the base of terns, involving the inclusion (mitochondrial) or exclusion (nuclear) of the Angel Tern (Gygis alba). Although limited mitochondrial variation was confirmed, both nuclear markers and a short tandem repeat in the mitochondrial control region indicated the presence of considerable genetic variation in Royal Terns at a regional scale. Conclusions These data document the value of intronic markers to the study of terns and allies. We expect that these and additional markers attained through next-generation sequencing methods will accurately map the genetic origin and
Bolte, Andreas; Czajkowski, Tomasz; Cocozza, Claudia; Tognetti, Roberto; de Miguel, Marina; Pšidová, Eva; Ditmarová, Ĺubica; Dinca, Lucian; Delzon, Sylvain; Cochard, Hervè; Ræbild, Anders; de Luis, Martin; Cvjetkovic, Branislav; Heiri, Caroline; Müller, Jürgen
2016-01-01
European beech (Fagus sylvatica L., hereafter beech), one of the major native tree species in Europe, is known to be drought sensitive. Thus, the identification of critical thresholds of drought impact intensity and duration are of high interest for assessing the adaptive potential of European beech to climate change in its native range. In a common garden experiment with one-year-old seedlings originating from central and marginal origins in six European countries (Denmark, Germany, France, Romania, Bosnia-Herzegovina, and Spain), we applied extreme drought stress and observed desiccation and mortality processes among the different populations and related them to plant water status (predawn water potential, ΨPD) and soil hydraulic traits. For the lethal drought assessment, we used a critical threshold of soil water availability that is reached when 50% mortality in seedling populations occurs (LD50SWA). We found significant population differences in LD50SWA (10.5-17.8%), and mortality dynamics that suggest a genetic difference in drought resistance between populations. The LD50SWA values correlate significantly with the mean growing season precipitation at population origins, but not with the geographic margins of beech range. Thus, beech range marginality may be more due to climatic conditions than to geographic range. The outcome of this study suggests the genetic variation has a major influence on the varying adaptive potential of the investigated populations.
Bolte, Andreas; Czajkowski, Tomasz; Cocozza, Claudia; Tognetti, Roberto; de Miguel, Marina; Pšidová, Eva; Ditmarová, Ĺubica; Dinca, Lucian; Delzon, Sylvain; Cochard, Hervè; Ræbild, Anders; de Luis, Martin; Cvjetkovic, Branislav; Heiri, Caroline; Müller, Jürgen
2016-01-01
European beech (Fagus sylvatica L., hereafter beech), one of the major native tree species in Europe, is known to be drought sensitive. Thus, the identification of critical thresholds of drought impact intensity and duration are of high interest for assessing the adaptive potential of European beech to climate change in its native range. In a common garden experiment with one-year-old seedlings originating from central and marginal origins in six European countries (Denmark, Germany, France, Romania, Bosnia-Herzegovina, and Spain), we applied extreme drought stress and observed desiccation and mortality processes among the different populations and related them to plant water status (predawn water potential, ΨPD) and soil hydraulic traits. For the lethal drought assessment, we used a critical threshold of soil water availability that is reached when 50% mortality in seedling populations occurs (LD50SWA). We found significant population differences in LD50SWA (10.5–17.8%), and mortality dynamics that suggest a genetic difference in drought resistance between populations. The LD50SWA values correlate significantly with the mean growing season precipitation at population origins, but not with the geographic margins of beech range. Thus, beech range marginality may be more due to climatic conditions than to geographic range. The outcome of this study suggests the genetic variation has a major influence on the varying adaptive potential of the investigated populations. PMID:27379105