Sample records for identifying single nucleotide

  1. Functional analysis of regulatory single-nucleotide polymorphisms.

    PubMed

    Pampín, Sandra; Rodríguez-Rey, José C

    2007-04-01

    The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

  2. Compositions and methods for detecting single nucleotide polymorphisms

    DOEpatents

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  3. High-resolution single-nucleotide polymorphism array-profiling in myeloproliferative neoplasms identifies novel genomic aberrations

    PubMed Central

    Stegelmann, Frank; Bullinger, Lars; Griesshammer, Martin; Holzmann, Karlheinz; Habdank, Marianne; Kuhn, Susanne; Maile, Carmen; Schauer, Stefanie; Döhner, Hartmut; Döhner, Konstanze

    2010-01-01

    Single-nucleotide polymorphism arrays allow for genome-wide profiling of copy-number alterations and copy-neutral runs of homozygosity at high resolution. To identify novel genetic lesions in myeloproliferative neoplasms, a large series of 151 clinically well characterized patients was analyzed in our study. Copy-number alterations were rare in essential thrombocythemia and polycythemia vera. In contrast, approximately one third of myelofibrosis patients exhibited small genomic losses (less than 5 Mb). In 2 secondary myelofibrosis cases the tumor suppressor gene NF1 in 17q11.2 was affected. Sequencing analyses revealed a mutation in the remaining NF1 allele of one patient. In terms of copy-neutral aberrations, no chromosomes other than 9p were recurrently affected. In conclusion, novel genomic aberrations were identified in our study, in particular in patients with myelofibrosis. Further analyses on single-gene level are necessary to uncover the mechanisms that are involved in the pathogenesis of myeloproliferative neoplasms. PMID:20015882

  4. Challenges in the association of human single nucleotide polymorphism mentions with unique database identifiers

    PubMed Central

    2011-01-01

    Background Most information on genomic variations and their associations with phenotypes are covered exclusively in scientific publications rather than in structured databases. These texts commonly describe variations using natural language; database identifiers are seldom mentioned. This complicates the retrieval of variations, associated articles, as well as information extraction, e. g. the search for biological implications. To overcome these challenges, procedures to map textual mentions of variations to database identifiers need to be developed. Results This article describes a workflow for normalization of variation mentions, i.e. the association of them to unique database identifiers. Common pitfalls in the interpretation of single nucleotide polymorphism (SNP) mentions are highlighted and discussed. The developed normalization procedure achieves a precision of 98.1 % and a recall of 67.5% for unambiguous association of variation mentions with dbSNP identifiers on a text corpus based on 296 MEDLINE abstracts containing 527 mentions of SNPs. The annotated corpus is freely available at http://www.scai.fraunhofer.de/snp-normalization-corpus.html. Conclusions Comparable approaches usually focus on variations mentioned on the protein sequence and neglect problems for other SNP mentions. The results presented here indicate that normalizing SNPs described on DNA level is more difficult than the normalization of SNPs described on protein level. The challenges associated with normalization are exemplified with ambiguities and errors, which occur in this corpus. PMID:21992066

  5. Failure of replicating the association between hippocampal volume and 3 single-nucleotide polymorphisms identified from the European genome-wide association study in Asian populations.

    PubMed

    Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing

    2014-12-01

    Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.

    PubMed

    Wood-Bouwens, Christina M; Ji, Hanlee P

    2018-01-01

    Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.

  7. Detecting associated single-nucleotide polymorphisms on the X chromosome in case control genome-wide association studies.

    PubMed

    Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen

    2017-04-01

    In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.

  8. Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

  9. Analysis of single nucleotide polymorphisms in case-control studies.

    PubMed

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  10. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    PubMed

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  11. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  12. Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

  13. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael

    2003-01-01

    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  14. Detection of single-nucleotide polymorphisms using gold nanoparticles and single-strand-specific nucleases.

    PubMed

    Chen, Yen-Ting; Hsu, Chiao-Ling; Hou, Shao-Yi

    2008-04-15

    The current study reports an assay approach that can detect single-nucleotide polymorphisms (SNPs) and identify the position of the point mutation through a single-strand-specific nuclease reaction and a gold nanoparticle assembly. The assay can be implemented via three steps: a single-strand-specific nuclease reaction that allows the enzyme to truncate the mutant DNA; a purification step that uses capture probe-gold nanoparticles and centrifugation; and a hybridization reaction that induces detector probe-gold nanoparticles, capture probe-gold nanoparticles, and the target DNA to form large DNA-linked three-dimensional aggregates of gold nanoparticles. At high temperature (63 degrees C in the current case), the purple color of the perfect match solution would not change to red, whereas a mismatched solution becomes red as the assembled gold nanoparticles separate. Using melting analysis, the position of the point mutation could be identified. This assay provides a convenient colorimetric detection that enables point mutation identification without the need for expensive mass spectrometry. To our knowledge, this is the first report concerning SNP detection based on a single-strand-specific nuclease reaction and a gold nanoparticle assembly.

  15. Relationships among calpastatin single nucleotide polymorphisms, calpastatin expression and tenderness in pork longissimus

    USDA-ARS?s Scientific Manuscript database

    Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...

  16. Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

    USDA-ARS?s Scientific Manuscript database

    Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

  17. Genome-wide association study for rotator cuff tears identifies two significant single-nucleotide polymorphisms.

    PubMed

    Tashjian, Robert Z; Granger, Erin K; Farnham, James M; Cannon-Albright, Lisa A; Teerlink, Craig C

    2016-02-01

    The precise etiology of rotator cuff disease is unknown, but prior evidence suggests a role for genetic factors. Limited data exist identifying specific genes associated with rotator cuff tearing. The purpose of this study was to identify specific genes or genetic variants associated with rotator cuff tearing by a genome-wide association study with an independent set of rotator cuff tear cases. A set of 311 full-thickness rotator cuff tear cases genotyped on the Illumina 5M single-nucleotide polymorphism (SNP) platform were used in a genome-wide association study with 2641 genetically matched white population controls available from the Illumina iControls database. Tests of association were performed with GEMMA software at 257,558 SNPs that compose the intersection of Illumina SNP platforms and that passed general quality control metrics. SNPs were considered significant if P < 1.94 × 10(-7) (Bonferroni correction: 0.05/257,558). Tests of association revealed 2 significantly associated SNPs, one occurring in SAP30BP (rs820218; P = 3.8E-9) on chromosome 17q25 and another occurring in SASH1 (rs12527089; P = 1.9E-7) on chromosome 6q24. This study represents the first attempt to identify genetic factors influencing rotator cuff tearing by a genome-wide association study using a dense/complete set of SNPs. Two SNPs were significantly associated with rotator cuff tearing, residing in SAP30BP on chromosome 17 and SASH1 on chromosome 6. Both genes are associated with the cellular process of apoptosis. Identification of potential genes or genetic variants associated with rotator cuff tearing may help in identifying individuals at risk for the development of rotator cuff tearing. Copyright © 2016 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  18. Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

    PubMed

    Winterhagen, Patrick; Wünsche, Jens-Norbert

    2016-05-01

    Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.

  19. Precise detection of de novo single nucleotide variants in human genomes.

    PubMed

    Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael

    2018-05-22

    The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.

  20. Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

    PubMed Central

    El-Sabrout, Karim; Aggag, Sarah A.

    2017-01-01

    Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

  1. Detecting Single-Nucleotide Substitutions Induced by Genome Editing.

    PubMed

    Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R

    2016-08-01

    The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells. © 2016 Cold Spring Harbor Laboratory Press.

  2. Identifying single bases in a DNA oligomer with electron tunnelling.

    PubMed

    Huang, Shuo; He, Jin; Chang, Shuai; Zhang, Peiming; Liang, Feng; Li, Shengqin; Tuchband, Michael; Fuhrmann, Alexander; Ros, Robert; Lindsay, Stuart

    2010-12-01

    It has been proposed that single molecules of DNA could be sequenced by measuring the physical properties of the bases as they pass through a nanopore. Theoretical calculations suggest that electron tunnelling can identify bases in single-stranded DNA without enzymatic processing, and it was recently experimentally shown that tunnelling can sense individual nucleotides and nucleosides. Here, we report that tunnelling electrodes functionalized with recognition reagents can identify a single base flanked by other bases in short DNA oligomers. The residence time of a single base in a recognition junction is on the order of a second, but pulling the DNA through the junction with a force of tens of piconewtons would yield reading speeds of tens of bases per second.

  3. Single nucleotide variations: Biological impact and theoretical interpretation

    PubMed Central

    Katsonis, Panagiotis; Koire, Amanda; Wilson, Stephen Joseph; Hsu, Teng-Kuei; Lua, Rhonald C; Wilkins, Angela Dawn; Lichtarge, Olivier

    2014-01-01

    Genome-wide association studies (GWAS) and whole-exome sequencing (WES) generate massive amounts of genomic variant information, and a major challenge is to identify which variations drive disease or contribute to phenotypic traits. Because the majority of known disease-causing mutations are exonic non-synonymous single nucleotide variations (nsSNVs), most studies focus on whether these nsSNVs affect protein function. Computational studies show that the impact of nsSNVs on protein function reflects sequence homology and structural information and predict the impact through statistical methods, machine learning techniques, or models of protein evolution. Here, we review impact prediction methods and discuss their underlying principles, their advantages and limitations, and how they compare to and complement one another. Finally, we present current applications and future directions for these methods in biological research and medical genetics. PMID:25234433

  4. Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

    USDA-ARS?s Scientific Manuscript database

    Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

  5. Single Nucleotide Polymorphism Analysis of European Archaeological M. leprae DNA

    PubMed Central

    Watson, Claire L.; Lockwood, Diana N. J.

    2009-01-01

    Background Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA) from medieval bones and single nucleotide polymorphism (SNP) typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. Methods and Findings Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia) and are dated around the medieval period (476 to 1350 A.D.). we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs) in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3). Conclusions These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide. PMID:19847306

  6. A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

    PubMed Central

    Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

    2003-01-01

    A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

  7. Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

    PubMed

    Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

    2012-04-01

    Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

  8. Screening of reproduction-related single-nucleotide variations from MeDIP-seq data in sheep.

    PubMed

    Cao, Jiaxue; Wei, Caihong; Zhang, Shuzhen; Capellini, Terence D; Zhang, Li; Zhao, Fuping; Li, Li; Zhong, Tao; Wang, Linjie; Du, Lixin; Zhang, Hongping

    2016-11-01

    Extensive variation in reproduction has arisen in Chinese Mongolian sheep during recent domestication. Hu and Small-tailed Han sheep, for example, have become non-seasonal breeders and exhibit higher fecundity than Tan and Ujumqin breeds. We therefore scanned reproduction-related single-nucleotide variations from methylated DNA-immunoprecipitation sequencing data generated from each of those four breeds to uncover potential mechanisms underlying this breed variation. We generated a high-quality map of single nucleotide variations (SNVs) in DNA methylation enriched regions, and found that the majority of variants are located within non-coding regions. We identified 359 SNVs within the Sheep Quantitative Trait Locus (QTL) database. Nineteen of these SNVs associated with the Aseasonal Reproduction QTL, and 10 out of the 19 reside close to genes with known reproduction functions. We also identified the well-known FecB mutation in high-fecundity sheep (Hu and Small-tailed Han sheep). When we applied these FecB finding to our breeding system, we improved lambing rate by 175%. In summary, this study provided strong candidate SNVs associated with sheep fecundity that can serve as targets for functional testing and to enhance selective breeding strategies. Mol. Reprod. Dev. 83: 958-967, 2016 © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. Single nucleotide polymorphism analysis using different colored dye dimer probes

    NASA Astrophysics Data System (ADS)

    Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter

    2006-09-01

    Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.

  10. [Identification of single nucleotide polymorphisms related to frailty].

    PubMed

    Inglés, Marta; Gimeno-Mallench, Lucia; Mas-Bargues, Cristina; Dromant, Mar; Cruz-Guerrero, Raquel; García-García, Francisco José; Rodríguez-Mañas, Leocadio; Gambini, Juan; Borrás, Consuelo; Viña, José

    2018-04-07

    The search for biomarkers that can lead to the early diagnosis and thus, early treatment of frailty, has become one of the main challenges facing the geriatric scientific community. The aim of the present study was to identify single nucleotide polymorphisms (SNPs) related to frailty. The study was conducted on 152 subjects from the Toledo Study for Healthy Aging (65 to 95 years of age), and classified as frail (n=78), and non-frail (n=74), according to Fried's criteria. After blood collection, DNA was isolated and amplified for the analysis of SNPs using Axiom TM Genotyping technology (Affymetrix). Statistical analyses were performed using the Plink program and library SNPassoc. The results of the study showed 15 SNPs with a P<.001. Those SNPs involved in processes related to frailty, such as energy metabolism, regulation of biological processes, cell motility and integrity, and cognition are highlighted. These results suggest that the genetic variations identified in frail individuals that are involved in biological processes related to frailty may be considered as biomarkers for the early detection of frailty. Copyright © 2018 SEGG. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    PubMed

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  12. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    PubMed

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    NASA Astrophysics Data System (ADS)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  14. Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

    PubMed Central

    Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

    2016-01-01

    Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

  15. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    PubMed

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  16. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Treesearch

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  17. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    PubMed

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  18. Preselection statistics and Random Forest classification identify population informative single nucleotide polymorphisms in cosmopolitan and autochthonous cattle breeds.

    PubMed

    Bertolini, F; Galimberti, G; Schiavo, G; Mastrangelo, S; Di Gerlando, R; Strillacci, M G; Bagnato, A; Portolano, B; Fontanesi, L

    2018-01-01

    Commercial single nucleotide polymorphism (SNP) arrays have been recently developed for several species and can be used to identify informative markers to differentiate breeds or populations for several downstream applications. To identify the most discriminating genetic markers among thousands of genotyped SNPs, a few statistical approaches have been proposed. In this work, we compared several methods of SNPs preselection (Delta, F st and principal component analyses (PCA)) in addition to Random Forest classifications to analyse SNP data from six dairy cattle breeds, including cosmopolitan (Holstein, Brown and Simmental) and autochthonous Italian breeds raised in two different regions and subjected to limited or no breeding programmes (Cinisara, Modicana, raised only in Sicily and Reggiana, raised only in Emilia Romagna). From these classifications, two panels of 96 and 48 SNPs that contain the most discriminant SNPs were created for each preselection method. These panels were evaluated in terms of the ability to discriminate as a whole and breed-by-breed, as well as linkage disequilibrium within each panel. The obtained results showed that for the 48-SNP panel, the error rate increased mainly for autochthonous breeds, probably as a consequence of their admixed origin lower selection pressure and by ascertaining bias in the construction of the SNP chip. The 96-SNP panels were generally more able to discriminate all breeds. The panel derived by PCA-chrom (obtained by a preselection chromosome by chromosome) could identify informative SNPs that were particularly useful for the assignment of minor breeds that reached the lowest value of Out Of Bag error even in the Cinisara, whose value was quite high in all other panels. Moreover, this panel contained also the lowest number of SNPs in linkage disequilibrium. Several selected SNPs are located nearby genes affecting breed-specific phenotypic traits (coat colour and stature) or associated with production traits. In

  19. [Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].

    PubMed

    Khrustaleva, A M; Gritsenko, O F; Klovach, N V

    2013-11-01

    The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected.

  20. Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

    NASA Astrophysics Data System (ADS)

    Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

    2014-03-01

    DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

  1. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    PubMed

    Stafuzza, Nedenia Bonvino; Zerlotini, Adhemar; Lobo, Francisco Pereira; Yamagishi, Michel Eduardo Beleza; Chud, Tatiane Cristina Seleguim; Caetano, Alexandre Rodrigues; Munari, Danísio Prado; Garrick, Dorian J; Machado, Marco Antonio; Martins, Marta Fonseca; Carvalho, Maria Raquel; Cole, John Bruce; Barbosa da Silva, Marcos Vinicius Gualberto

    2017-01-01

    Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose), Gyr, Girolando and Holstein (dairy production). A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs) and 3,828,041 insertions/deletions (InDels) were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  2. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds

    PubMed Central

    Lobo, Francisco Pereira; Yamagishi, Michel Eduardo Beleza; Chud, Tatiane Cristina Seleguim; Caetano, Alexandre Rodrigues; Munari, Danísio Prado; Garrick, Dorian J.; Machado, Marco Antonio; Martins, Marta Fonseca; Carvalho, Maria Raquel; Cole, John Bruce; Barbosa da Silva, Marcos Vinicius Gualberto

    2017-01-01

    Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose), Gyr, Girolando and Holstein (dairy production). A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs) and 3,828,041 insertions/deletions (InDels) were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs. PMID:28323836

  3. A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.

    PubMed

    Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

    2007-04-17

    The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.

  4. A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice

    PubMed Central

    Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, HongBin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

    2007-01-01

    Background The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia. PMID:17439653

  5. [Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

    PubMed

    Li, Su-Xia

    2004-12-01

    Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

  6. Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

    PubMed Central

    Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

    2016-01-01

    The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

  7. OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities

    NASA Astrophysics Data System (ADS)

    Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.

    2016-09-01

    The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.

  8. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    PubMed

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  9. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    PubMed

    Chen, Sherry Xi; Seelig, Georg

    2016-04-20

    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  10. Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.

    PubMed

    Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S

    2012-11-10

    We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Association of Nitric Oxide Synthase and Matrix Metalloprotease Single Nucleotide Polymorphisms with Preeclampsia and Its Complications

    PubMed Central

    Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura

    2015-01-01

    Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342

  12. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  13. A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

    PubMed

    Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

    2011-06-15

    A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. KBG syndrome involving a single-nucleotide duplication in ANKRD11

    PubMed Central

    Kleyner, Robert; Malcolmson, Janet; Tegay, David; Ward, Kenneth; Maughan, Annette; Maughan, Glenn; Nelson, Lesa; Wang, Kai; Robison, Reid; Lyon, Gholson J.

    2016-01-01

    KBG syndrome is a rare autosomal dominant genetic condition characterized by neurological involvement and distinct facial, hand, and skeletal features. More than 70 cases have been reported; however, it is likely that KBG syndrome is underdiagnosed because of lack of comprehensive characterization of the heterogeneous phenotypic features. We describe the clinical manifestations in a male currently 13 years of age, who exhibited symptoms including epilepsy, severe developmental delay, distinct facial features, and hand anomalies, without a positive genetic diagnosis. Subsequent exome sequencing identified a novel de novo heterozygous single base pair duplication (c.6015dupA) in ANKRD11, which was validated by Sanger sequencing. This single-nucleotide duplication is predicted to lead to a premature stop codon and loss of function in ANKRD11, thereby implicating it as contributing to the proband's symptoms and yielding a molecular diagnosis of KBG syndrome. Before molecular diagnosis, this syndrome was not recognized in the proband, as several key features of the disorder were mild and were not recognized by clinicians, further supporting the concept of variable expressivity in many disorders. Although a diagnosis of cerebral folate deficiency has also been given, its significance for the proband's condition remains uncertain. PMID:27900361

  15. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    ERIC Educational Resources Information Center

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  16. Identifying allelic loss and homozygous deletions in pancreatic cancer without matched normals using high-density single-nucleotide polymorphism arrays.

    PubMed

    Calhoun, Eric S; Hucl, Tomas; Gallmeier, Eike; West, Kristen M; Arking, Dan E; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Chakravarti, Aravinda; Hruban, Ralph H; Kern, Scott E

    2006-08-15

    Recent advances in oligonucleotide arrays and whole-genome complexity reduction data analysis now permit the evaluation of tens of thousands of single-nucleotide polymorphisms simultaneously for a genome-wide analysis of allelic status. Using these arrays, we created high-resolution allelotype maps of 26 pancreatic cancer cell lines. The areas of heterozygosity implicitly served to reveal regions of allelic loss. The array-derived maps were verified by a panel of 317 microsatellite markers used in a subset of seven samples, showing a 97.1% concordance between heterozygous calls. Three matched tumor/normal pairs were used to estimate the false-negative and potential false-positive rates for identifying loss of heterozygosity: 3.6 regions (average minimal region of loss, 720,228 bp) and 2.3 regions (average heterozygous gap distance, 4,434,994 bp) per genome, respectively. Genomic fractional allelic loss calculations showed that cumulative levels of allelic loss ranged widely from 17.1% to 79.9% of the haploid genome length. Regional increases in "NoCall" frequencies combined with copy number loss estimates were used to identify 41 homozygous deletions (19 first reports), implicating an additional 13 regions disrupted in pancreatic cancer. Unexpectedly, 23 of these occurred in just two lines (BxPc3 and MiaPaCa2), suggesting the existence of at least two subclasses of chromosomal instability (CIN) patterns, distinguished here by allelic loss and copy number changes (original CIN) and those also highly enriched in the genomic "holes" of homozygous deletions (holey CIN). This study provides previously unavailable high-resolution allelotype and deletion breakpoint maps in widely shared pancreatic cancer cell lines and effectively eliminates the need for matched normal tissue to define informative loci.

  17. Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

    PubMed

    Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

    2012-05-01

    Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

  18. Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

  19. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

    PubMed

    Silva-Junior, Orzenil B; Grattapaglia, Dario

    2015-11-01

    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  20. Incorporation of causative quantitative trait nucleotides in single-step GBLUP.

    PubMed

    Fragomeni, Breno O; Lourenco, Daniela A L; Masuda, Yutaka; Legarra, Andres; Misztal, Ignacy

    2017-07-26

    Much effort is put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, empowered by the availability of dense single nucleotide polymorphism (SNP) information. Genomic selection using traditional SNP information is easily implemented for any number of genotyped individuals using single-step genomic best linear unbiased predictor (ssGBLUP) with the algorithm for proven and young (APY). Our aim was to investigate whether ssGBLUP is useful for genomic prediction when some or all QTN are known. Simulations included 180,000 animals across 11 generations. Phenotypes were available for all animals in generations 6 to 10. Genotypes for 60,000 SNPs across 10 chromosomes were available for 29,000 individuals. The genetic variance was fully accounted for by 100 or 1000 biallelic QTN. Raw genomic relationship matrices (GRM) were computed from (a) unweighted SNPs, (b) unweighted SNPs and causative QTN, (c) SNPs and causative QTN weighted with results obtained with genome-wide association studies, (d) unweighted SNPs and causative QTN with simulated weights, (e) only unweighted causative QTN, (f-h) as in (b-d) but using only the top 10% causative QTN, and (i) using only causative QTN with simulated weight. Predictions were computed by pedigree-based BLUP (PBLUP) and ssGBLUP. Raw GRM were blended with 1 or 5% of the numerator relationship matrix, or 1% of the identity matrix. Inverses of GRM were obtained directly or with APY. Accuracy of breeding values for 5000 genotyped animals in the last generation with PBLUP was 0.32, and for ssGBLUP it increased to 0.49 with an unweighted GRM, 0.53 after adding unweighted QTN, 0.63 when QTN weights were estimated, and 0.89 when QTN weights were based on true effects known from the simulation. When the GRM was constructed from causative QTN only, accuracy was 0.95 and 0.99 with blending at 5 and 1%, respectively. Accuracies simulating 1000 QTN were generally lower, with a similar trend. Accuracies using the

  1. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  2. Single-Nucleotide Polymorphism-Microarray Ploidy Analysis of Paraffin-Embedded Products of Conception in Recurrent Pregnancy Loss Evaluations.

    PubMed

    Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C

    2015-07-01

    To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal

  3. Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene.

    PubMed

    Multani, Shaleen; Saranath, Dhananjaya

    2016-11-01

    Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.

  4. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    PubMed

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  5. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    PubMed Central

    Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo

    2016-01-01

    Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941

  6. Single nucleotide polymorphism-specific regulation of matrix metalloproteinase-9 by multiple miRNAs targeting the coding exon

    PubMed Central

    Duellman, Tyler; Warren, Christopher; Yang, Jay

    2014-01-01

    Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221

  7. Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

    PubMed

    Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

    2011-12-01

    Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  8. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  9. Identification of Rare, Single-Nucleotide Mutations in NDE1 and Their Contributions to Schizophrenia Susceptibility

    PubMed Central

    Kimura, Hiroki; Tsuboi, Daisuke; Wang, Chenyao; Kushima, Itaru; Koide, Takayoshi; Ikeda, Masashi; Iwayama, Yoshimi; Toyota, Tomoko; Yamamoto, Noriko; Kunimoto, Shohko; Nakamura, Yukako; Yoshimi, Akira; Banno, Masahiro; Xing, Jingrui; Takasaki, Yuto; Yoshida, Mami; Aleksic, Branko; Uno, Yota; Okada, Takashi; Iidaka, Tetsuya; Inada, Toshiya; Suzuki, Michio; Ujike, Hiroshi; Kunugi, Hiroshi; Kato, Tadafumi; Yoshikawa, Takeo; Iwata, Nakao; Kaibuchi, Kozo; Ozaki, Norio

    2015-01-01

    Background: Nuclear distribution E homolog 1 (NDE1), located within chromosome 16p13.11, plays an essential role in microtubule organization, mitosis, and neuronal migration and has been suggested by several studies of rare copy number variants to be a promising schizophrenia (SCZ) candidate gene. Recently, increasing attention has been paid to rare single-nucleotide variants (SNVs) discovered by deep sequencing of candidate genes, because such SNVs may have large effect sizes and their functional analysis may clarify etiopathology. Methods and Results: We conducted mutation screening of NDE1 coding exons using 433 SCZ and 145 pervasive developmental disorders samples in order to identify rare single nucleotide variants with a minor allele frequency ≤5%. We then performed genetic association analysis using a large number of unrelated individuals (3554 SCZ, 1041 bipolar disorder [BD], and 4746 controls). Among the discovered novel rare variants, we detected significant associations between SCZ and S214F (P = .039), and between BD and R234C (P = .032). Furthermore, functional assays showed that S214F affected axonal outgrowth and the interaction between NDE1 and YWHAE (14-3-3 epsilon; a neurodevelopmental regulator). Conclusions: This study strengthens the evidence for association between rare variants within NDE1 and SCZ, and may shed light into the molecular mechanisms underlying this severe psychiatric disorder. PMID:25332407

  10. Genome-scale engineering of Saccharomyces cerevisiae with single-nucleotide precision.

    PubMed

    Bao, Zehua; HamediRad, Mohammad; Xue, Pu; Xiao, Han; Tasan, Ipek; Chao, Ran; Liang, Jing; Zhao, Huimin

    2018-07-01

    We developed a CRISPR-Cas9- and homology-directed-repair-assisted genome-scale engineering method named CHAnGE that can rapidly output tens of thousands of specific genetic variants in yeast. More than 98% of target sequences were efficiently edited with an average frequency of 82%. We validate the single-nucleotide resolution genome-editing capability of this technology by creating a genome-wide gene disruption collection and apply our method to improve tolerance to growth inhibitors.

  11. Genetic diversity and population structure analysis of spinach by single-nucleotide polymorphisms identified through genotyping-by-sequencing.

    PubMed

    Shi, Ainong; Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram

    2017-01-01

    Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs.

  12. Genetic diversity and population structure analysis of spinach by single-nucleotide polymorphisms identified through genotyping-by-sequencing

    PubMed Central

    Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram

    2017-01-01

    Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs. PMID:29190770

  13. SiNoPsis: Single Nucleotide Polymorphisms selection and promoter profiling.

    PubMed

    Boloc, Daniel; Rodríguez, Natalia; Gassó, Patricia; Abril, Josep F; Bernardo, Miquel; Lafuente, Amalia; Mas, Sergi

    2017-09-14

    The selection of a Single Nucleotide Polymorphism (SNP) using bibliographic methods can be a very time-consuming task. Moreover, a SNP selected in this way may not be easily visualized in its genomic context by a standard user hoping to correlate it with other valuable information. Here we propose a web form built on top of Circos that can assist SNP-centred screening, based on their location in the genome and the regulatory modules they can disrupt. Its use may allow researchers to prioritize SNPs in genotyping and disease studies. SiNoPsis is bundled as a web portal. It focuses on the different structures involved in the genomic expression of a gene, especially those found in the core promoter upstream region. These structures include transcription factor binding sites (for promoter and enhancer signals), histones, and promoter flanking regions. Additionally, the tool provides eQTL and linkage disequilibrium (LD) properties for a given SNP query, yielding further clues about other indirectly associated SNPs. Possible disruptions of the aforementioned structures affecting gene transcription are reported using multiple resource databases. SiNoPsis has a simple user-friendly interface, which allows single queries by gene symbol, genomic coordinates, Ensembl gene identifiers, RefSeq transcript identifiers and SNPs. It is the only portal providing useful SNP selection based on regulatory modules and LD with functional variants in both textual and graphic modes (by properly defining the arguments and parameters needed to run Circos). SiNoPsis is freely available at https://compgen.bio.ub.edu/SiNoPsis /. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  14. Single-cell mRNA sequencing identifies subclonal heterogeneity in anti-cancer drug responses of lung adenocarcinoma cells.

    PubMed

    Kim, Kyu-Tae; Lee, Hye Won; Lee, Hae-Ock; Kim, Sang Cheol; Seo, Yun Jee; Chung, Woosung; Eum, Hye Hyeon; Nam, Do-Hyun; Kim, Junhyong; Joo, Kyeung Min; Park, Woong-Yang

    2015-06-19

    Intra-tumoral genetic and functional heterogeneity correlates with cancer clinical prognoses. However, the mechanisms by which intra-tumoral heterogeneity impacts therapeutic outcome remain poorly understood. RNA sequencing (RNA-seq) of single tumor cells can provide comprehensive information about gene expression and single-nucleotide variations in individual tumor cells, which may allow for the translation of heterogeneous tumor cell functional responses into customized anti-cancer treatments. We isolated 34 patient-derived xenograft (PDX) tumor cells from a lung adenocarcinoma patient tumor xenograft. Individual tumor cells were subjected to single cell RNA-seq for gene expression profiling and expressed mutation profiling. Fifty tumor-specific single-nucleotide variations, including KRAS(G12D), were observed to be heterogeneous in individual PDX cells. Semi-supervised clustering, based on KRAS(G12D) mutant expression and a risk score representing expression of 69 lung adenocarcinoma-prognostic genes, classified PDX cells into four groups. PDX cells that survived in vitro anti-cancer drug treatment displayed transcriptome signatures consistent with the group characterized by KRAS(G12D) and low risk score. Single-cell RNA-seq on viable PDX cells identified a candidate tumor cell subgroup associated with anti-cancer drug resistance. Thus, single-cell RNA-seq is a powerful approach for identifying unique tumor cell-specific gene expression profiles which could facilitate the development of optimized clinical anti-cancer strategies.

  15. PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

    PubMed

    Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

    2009-03-01

    The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

  16. Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

    2013-09-23

    Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    PubMed

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  18. Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

    NASA Astrophysics Data System (ADS)

    Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

    2016-05-01

    We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

  19. Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

    PubMed Central

    Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

    2014-01-01

    Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

  20. Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster

    PubMed Central

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

    2001-01-01

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that recently have revolutionized human, mouse, and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila by using a sequence tagged site-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that span the genome. Most of these markers are single nucleotide polymorphisms and sequences for these variants are provided in an accessible format. The average density of the new markers is one per 225 kb on the autosomes and one per megabase on the X chromosome. We include in this survey a set of P-element strains that provide additional use for high-resolution mapping. We show one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community. PMID:11381036

  1. Single nucleotide polymorphism markers for genetic mapping in Drosophila melanogaster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed

    2001-04-16

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that have recently revolutionized human, mouse and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila using an STS-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that the genome. The majority of these markers are single nucleotide polymorphisms (SNPs) and sequences for these variants are provided in an accessible format. The average density of the new markersmore » is 1 marker per 225 kb on the autosomes and 1 marker per 1 Mb on the X chromosome. We include in this survey a set of P-element strains that provide additional utility for high-resolution mapping. We demonstrate one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community.« less

  2. Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics.

    PubMed

    Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu

    2012-04-01

    Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  3. Germline contamination and leakage in whole genome somatic single nucleotide variant detection.

    PubMed

    Sendorek, Dorota H; Caloian, Cristian; Ellrott, Kyle; Bare, J Christopher; Yamaguchi, Takafumi N; Ewing, Adam D; Houlahan, Kathleen E; Norman, Thea C; Margolin, Adam A; Stuart, Joshua M; Boutros, Paul C

    2018-01-31

    The clinical sequencing of cancer genomes to personalize therapy is becoming routine across the world. However, concerns over patient re-identification from these data lead to questions about how tightly access should be controlled. It is not thought to be possible to re-identify patients from somatic variant data. However, somatic variant detection pipelines can mistakenly identify germline variants as somatic ones, a process called "germline leakage". The rate of germline leakage across different somatic variant detection pipelines is not well-understood, and it is uncertain whether or not somatic variant calls should be considered re-identifiable. To fill this gap, we quantified germline leakage across 259 sets of whole-genome somatic single nucleotide variant (SNVs) predictions made by 21 teams as part of the ICGC-TCGA DREAM Somatic Mutation Calling Challenge. The median somatic SNV prediction set contained 4325 somatic SNVs and leaked one germline polymorphism. The level of germline leakage was inversely correlated with somatic SNV prediction accuracy and positively correlated with the amount of infiltrating normal cells. The specific germline variants leaked differed by tumour and algorithm. To aid in quantitation and correction of leakage, we created a tool, called GermlineFilter, for use in public-facing somatic SNV databases. The potential for patient re-identification from leaked germline variants in somatic SNV predictions has led to divergent open data access policies, based on different assessments of the risks. Indeed, a single, well-publicized re-identification event could reshape public perceptions of the values of genomic data sharing. We find that modern somatic SNV prediction pipelines have low germline-leakage rates, which can be further reduced, especially for cloud-sharing, using pre-filtering software.

  4. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    PubMed

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  5. Single nucleotide polymorphism of FSHβ gene associated with reproductive traits in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    He, Feng; Wen, Haishen; Yu, Dahui; Li, Jifang; Shi, Bao; Chen, Caifang; Zhang, Jiaren; Jin, Guoxiong; Chen, Xiaoyan; Shi, Dan; Yang, Yanping

    2010-12-01

    Follicle stimulating hormone β (FSHβ) of Japanese flounder ( Paralichthys olivaceus) plays a key role in the regulation of gonadal development. This study aimed to investigate molecular genetic characteristics of the FSHβ gene and elucidate the effects of single nucleotide polymorphisms (SNPs) of FSHβ on reproductive traits in Japanese flounder. We used polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and sequencing of the FSHβ gene in 60 individuals. We identified only an SNP (T/C) in the coding region of exon3 of FSHβ. The SNP (T/C) did not lead to amino acid changes at the position 340 bp of FSHβ gene. Statistical analysis showed that the SNP was significantly associated with testosterone (T) level and gonadosomatic index (GSI) ( P < 0.05). Individuals with genotype TC of the SNP had significantly higher serum T levels and GSI ( P < 0.05) than that of genotype CC. Therefore, FSHβ gene could be a useful molecular marker in selection for prominent reproductive trait in Japanese Flounder.

  6. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

    NASA Astrophysics Data System (ADS)

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori

  7. Contribution of 20 single nucleotide polymorphisms of 13 genes to dyslipidemia associated with antiretroviral therapy.

    PubMed

    Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E

    2007-09-01

    HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.

  8. Association Between Single Nucleotide Polymorphism +276G > T (rs1501299) in ADIPOQ and Endometrial Cancer.

    PubMed

    Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej

    2016-01-01

    Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes.

  9. Creatine kinase: Essential arginine residues at the nucleotide binding site identified by chemical modification and high-resolution tandem mass spectrometry

    PubMed Central

    Wood, Troy D.; Guan, Ziqiang; Borders, Charles L.; Chen, Lorenzo H.; Kenyon, George L.; McLafferty, Fred W.

    1998-01-01

    Phenylglyoxal is an arginine-specific reagent that inactivates creatine kinase (CK). Previous results suggest that modification of the dimeric enzyme at a single arginine residue per subunit causes complete inactivation accompanied by the loss of nucleotide binding; the actual site of modification was not identified. Here, high-resolution tandem mass spectrometry (MS/MS) was used to identify three phenylglyoxal-modified Arg residues in monomeric rabbit muscle CK. Electrospray ionizaton Fourier-transform MS of the phenylglyoxal-modified CK that had lost ≈80% activity identified three species: unmodified, once-modified (+116 Da), and twice-modified (+232 Da) enzyme in a ratio of approximately 1:4:1. MS/MS restricts the derivatized sites to P122-P212 and P283-V332, whereas MS of Lys-C digestions revealed two modified peptides, A266-K297 and G116-K137. The only Arg in A266-K297 is Arg-291 (invariant), whereas MS/MS of modified G116-K137 shows that two of the three sites Arg-129, Arg-131, or Arg-134 (all invariant) can contain the modification. The recently reported x-ray crystal structure for the octameric chicken mitochondrial CK indicates that its nucleotide triphosphate-binding site indeed contains the equivalent of R291, R129, and R131 reported here to be at the active site of rabbit muscle CK. PMID:9520370

  10. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries)

    PubMed Central

    Li, M-H; Tiirikka, T; Kantanen, J

    2014-01-01

    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10−11 for all the colours; P=2.3 × 10−11 for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding. PMID:24022497

  11. A single nucleotide polymorphism genotyping platform for the authentication of patient derived xenografts.

    PubMed

    El-Hoss, Jad; Jing, Duohui; Evans, Kathryn; Toscan, Cara; Xie, Jinhan; Lee, Hyunjoo; Taylor, Renea A; Lawrence, Mitchell G; Risbridger, Gail P; MacKenzie, Karen L; Sutton, Rosemary; Lock, Richard B

    2016-09-13

    Patient derived xenografts (PDXs) have become a vital, frequently used, component of anti-cancer drug development. PDXs can be serially passaged in vivo for years, and shared across laboratories. As a consequence, the potential for mis-identification and cross-contamination is possible, yet authentication of PDXs appears limited. We present a PDX Authentication System (PAS), by combining a commercially available OpenArray assay of single nucleotide polymorphisms (SNPs) with in-house R studio programs, to validate PDXs established in individual mice from acute lymphoblastic leukemia biopsies. The PAS is sufficiently robust to identify contamination at levels as low as 3%, similar to the gold standard of short tandem repeat (STR) profiling. We have surveyed a panel of PDXs established from 73 individual leukemia patients, and found that the PAS provided sufficient discriminatory power to identify each xenograft. The identified SNP-discrepant PDXs demonstrated distinct gene expression profiles, indicating a risk of contamination for PDXs at high passage number. The PAS also allows for the authentication of tumor cells with complex karyotypes from solid tumors including prostate cancer and Ewing's sarcoma. This study highlights the demands of authenticating PDXs for cancer research, and evaluates a reliable authentication platform that utilizes a commercially available and cost-effective system.

  12. Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

    PubMed Central

    Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

    2007-01-01

    Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

  13. A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  14. Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

    PubMed Central

    Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

    2016-01-01

    Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

  15. Gene-based meta-analysis of genome-wide association study data identifies independent single-nucleotide polymorphisms in ANXA6 as being associated with systemic lupus erythematosus in Asian populations.

    PubMed

    Zhang, Jing; Zhang, Lu; Zhang, Yan; Yang, Jing; Guo, Mengbiao; Sun, Liangdan; Pan, Hai-Feng; Hirankarn, Nattiya; Ying, Dingge; Zeng, Shuai; Lee, Tsz Leung; Lau, Chak Sing; Chan, Tak Mao; Leung, Alexander Moon Ho; Mok, Chi Chiu; Wong, Sik Nin; Lee, Ka Wing; Ho, Marco Hok Kung; Lee, Pamela Pui Wah; Chung, Brian Hon-Yin; Chong, Chun Yin; Wong, Raymond Woon Sing; Mok, Mo Yin; Wong, Wilfred Hing Sang; Tong, Kwok Lung; Tse, Niko Kei Chiu; Li, Xiang-Pei; Avihingsanon, Yingyos; Rianthavorn, Pornpimol; Deekajorndej, Thavatchai; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk; Ying, Shirley King Yee; Fung, Samuel Ka Shun; Lai, Wai Ming; Garcia-Barceló, Maria-Mercè; Cherny, Stacey S; Sham, Pak Chung; Cui, Yong; Yang, Sen; Ye, Dong Qing; Zhang, Xue-Jun; Lau, Yu Lung; Yang, Wanling

    2015-11-01

    Previous genome-wide association studies (GWAS), which were mainly based on single-variant analysis, have identified many systemic lupus erythematosus (SLE) susceptibility loci. However, the genetic architecture of this complex disease is far from being understood. The aim of this study was to investigate whether using a gene-based analysis may help to identify novel loci, by considering global evidence of association from a gene or a genomic region rather than focusing on evidence for individual variants. Based on the results of a meta-analysis of 2 GWAS of SLE conducted in 2 Asian cohorts, we performed an in-depth gene-based analysis followed by replication in a total of 4,626 patients and 7,466 control subjects of Asian ancestry. Differential allelic expression was measured by pyrosequencing. More than one-half of the reported SLE susceptibility loci showed evidence of independent effects, and this finding is important for understanding the mechanisms of association and explaining disease heritability. ANXA6 was detected as a novel SLE susceptibility gene, with several single-nucleotide polymorphisms (SNPs) contributing independently to the association with disease. The risk allele of rs11960458 correlated significantly with increased expression of ANXA6 in peripheral blood mononuclear cells from heterozygous healthy control subjects. Several other associated SNPs may also regulate ANXA6 expression, according to data obtained from public databases. Higher expression of ANXA6 in patients with SLE was also reported previously. Our study demonstrated the merit of using gene-based analysis to identify novel susceptibility loci, especially those with independent effects, and also demonstrated the widespread presence of loci with independent effects in SLE susceptibility genes. © 2015, American College of Rheumatology.

  16. Functional Genomics Analysis of Big Data Identifies Novel Peroxisome Proliferator-Activated Receptor γ Target Single Nucleotide Polymorphisms Showing Association With Cardiometabolic Outcomes.

    PubMed

    Richardson, Kris; Schnitzler, Gavin R; Lai, Chao-Qiang; Ordovas, Jose M

    2015-12-01

    Cardiovascular disease and type 2 diabetes mellitus represent overlapping diseases where a large portion of the variation attributable to genetics remains unexplained. An important player in their pathogenesis is peroxisome proliferator-activated receptor γ (PPARγ) that is involved in lipid and glucose metabolism and maintenance of metabolic homeostasis. We used a functional genomics methodology to interrogate human chromatin immunoprecipitation-sequencing, genome-wide association studies, and expression quantitative trait locus data to inform selection of candidate functional single nucleotide polymorphisms (SNPs) falling in PPARγ motifs. We derived 27 328 chromatin immunoprecipitation-sequencing peaks for PPARγ in human adipocytes through meta-analysis of 3 data sets. The PPARγ consensus motif showed greatest enrichment and mapped to 8637 peaks. We identified 146 SNPs in these motifs. This number was significantly less than would be expected by chance, and Inference of Natural Selection from Interspersed Genomically coHerent elemenTs analysis indicated that these motifs are under weak negative selection. A screen of these SNPs against genome-wide association studies for cardiometabolic traits revealed significant enrichment with 16 SNPs. A screen against the MuTHER expression quantitative trait locus data revealed 8 of these were significantly associated with altered gene expression in human adipose, more than would be expected by chance. Several SNPs fall close, or are linked by expression quantitative trait locus to lipid-metabolism loci including CYP26A1. We demonstrated the use of functional genomics to identify SNPs of potential function. Specifically, that SNPs within PPARγ motifs that bind PPARγ in adipocytes are significantly associated with cardiometabolic disease and with the regulation of transcription in adipose. This method may be used to uncover functional SNPs that do not reach significance thresholds in the agnostic approach of genome

  17. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    PubMed

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  18. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    NASA Astrophysics Data System (ADS)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  19. High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

    PubMed Central

    Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

    2006-01-01

    Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

  20. Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis

    PubMed Central

    Olsen, Randall J.; Sitkiewicz, Izabela; Ayeras, Ara A.; Gonulal, Vedia E.; Cantu, Concepcion; Beres, Stephen B.; Green, Nicole M.; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P.; Montgomery, Charles A.; Cartwright, Joiner; McGeer, Allison; Low, Donald E.; Whitney, Adeline R.; Cagle, Philip T.; Blasdel, Terry L.; DeLeo, Frank R.; Musser, James M.

    2010-01-01

    Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis (“flesh-eating disease”). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the ΔmtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research. PMID:20080771

  1. Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis.

    PubMed

    Olsen, Randall J; Sitkiewicz, Izabela; Ayeras, Ara A; Gonulal, Vedia E; Cantu, Concepcion; Beres, Stephen B; Green, Nicole M; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P; Montgomery, Charles A; Cartwright, Joiner; McGeer, Allison; Low, Donald E; Whitney, Adeline R; Cagle, Philip T; Blasdel, Terry L; DeLeo, Frank R; Musser, James M

    2010-01-12

    Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis ("flesh-eating disease"). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the DeltamtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research.

  2. Genetic analysis of glucosinolate variability in broccoli florets using genome-anchored single nucleotide polymorphisms.

    PubMed

    Brown, Allan F; Yousef, Gad G; Reid, Robert W; Chebrolu, Kranthi K; Thomas, Aswathy; Krueger, Christopher; Jeffery, Elizabeth; Jackson, Eric; Juvik, John A

    2015-07-01

    The identification of genetic factors influencing the accumulation of individual glucosinolates in broccoli florets provides novel insight into the regulation of glucosinolate levels in Brassica vegetables and will accelerate the development of vegetables with glucosinolate profiles tailored to promote human health. Quantitative trait loci analysis of glucosinolate (GSL) variability was conducted with a B. oleracea (broccoli) mapping population, saturated with single nucleotide polymorphism markers from a high-density array designed for rapeseed (Brassica napus). In 4 years of analysis, 14 QTLs were associated with the accumulation of aliphatic, indolic, or aromatic GSLs in floret tissue. The accumulation of 3-carbon aliphatic GSLs (2-propenyl and 3-methylsulfinylpropyl) was primarily associated with a single QTL on C05, but common regulation of 4-carbon aliphatic GSLs was not observed. A single locus on C09, associated with up to 40 % of the phenotypic variability of 2-hydroxy-3-butenyl GSL over multiple years, was not associated with the variability of precursor compounds. Similarly, QTLs on C02, C04, and C09 were associated with 4-methylsulfinylbutyl GSL concentration over multiple years but were not significantly associated with downstream compounds. Genome-specific SNP markers were used to identify candidate genes that co-localized to marker intervals and previously sequenced Brassica oleracea BAC clones containing known GSL genes (GSL-ALK, GSL-PRO, and GSL-ELONG) were aligned to the genomic sequence, providing support that at least three of our 14 QTLs likely correspond to previously identified GSL loci. The results demonstrate that previously identified loci do not fully explain GSL variation in broccoli. The identification of additional genetic factors influencing the accumulation of GSL in broccoli florets provides novel insight into the regulation of GSL levels in Brassicaceae and will accelerate development of vegetables with modified or enhanced GSL

  3. The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit.

    PubMed

    Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun

    2016-10-01

    The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

  4. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome

    PubMed Central

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-01-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield. PMID:25333064

  5. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    PubMed

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  6. Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

  7. Assessment of the Geographic Origins of Pinewood Nematode Isolates via Single Nucleotide Polymorphism in Effector Genes

    PubMed Central

    Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição

    2013-01-01

    The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785

  8. Nucleotide cleaving agents and method

    DOEpatents

    Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

    2000-01-01

    The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

  9. Single nucleotide polymorphisms in the mitochondrial displacement loop and outcome of esophageal squamous cell carcinoma.

    PubMed

    Zhang, Ruixing; Wang, Rui; Zhang, Fengbin; Wu, Chensi; Fan, Haiyan; Li, Yan; Wang, Cuiju; Guo, Zhanjun

    2010-11-26

    Accumulation of single nucleotide polymorphisms (SNPs) in the displacement loop (D-loop) of mitochondrial DNA (mtDNA) has been described for different types of cancers and might be associated with cancer risk and disease outcome. We used a population-based series of esophageal squamous cell carcinoma (ESCC) patients for investigating the prediction power of SNPs in mitochondrial D-loop. The D-loop region of mtDNA was sequenced for 60 ESCC patients recorded in the Fourth Hospital of Hebei Medical University between 2003 and 2004. The 5 year survival curve were calculated with the Kaplan-Meier method and compared by the log-rank test at each SNP site, a multivariate survival analysis was also performed with the Cox proportional hazards method. The SNP sites of nucleotides 16274G/A, 16278C/T and 16399A/G were identified for prediction of post-operational survival by the log-rank test. In an overall multivariate analysis, the 16278 and 16399 alleles were identified as independent predictors of ESCC outcome. The length of survival of patients with the minor allele 16278T genotype was significantly shorter than that of patients with 16278C at the 16278 site (relative risk, 3.001; 95% CI, 1.029 - 8.756; p = 0.044). The length of survival of patients with the minor allele 16399G genotype was significantly shorter than that of patients with the more frequent allele 16399A at the 16399 site in ESCC patients (relative risk, 3.483; 95% CI, 1.068 - 11.359; p = 0.039). Genetic polymorphisms in the D-loop are independent prognostic markers for patients with ESCC. Accordingly, the analysis of genetic polymorphisms in the mitochondrial D-loop can help identify patient subgroups at high risk of a poor disease outcome.

  10. A 2-Stage Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms Associated With Development of Erectile Dysfunction Following Radiation Therapy for Prostate Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerns, Sarah L.; Departments of Pathology and Genetics, Albert Einstein College of Medicine, Bronx, New York; Stock, Richard

    2013-01-01

    Purpose: To identify single nucleotide polymorphisms (SNPs) associated with development of erectile dysfunction (ED) among prostate cancer patients treated with radiation therapy. Methods and Materials: A 2-stage genome-wide association study was performed. Patients were split randomly into a stage I discovery cohort (132 cases, 103 controls) and a stage II replication cohort (128 cases, 102 controls). The discovery cohort was genotyped using Affymetrix 6.0 genome-wide arrays. The 940 top ranking SNPs selected from the discovery cohort were genotyped in the replication cohort using Illumina iSelect custom SNP arrays. Results: Twelve SNPs identified in the discovery cohort and validated in themore » replication cohort were associated with development of ED following radiation therapy (Fisher combined P values 2.1 Multiplication-Sign 10{sup -5} to 6.2 Multiplication-Sign 10{sup -4}). Notably, these 12 SNPs lie in or near genes involved in erectile function or other normal cellular functions (adhesion and signaling) rather than DNA damage repair. In a multivariable model including nongenetic risk factors, the odds ratios for these SNPs ranged from 1.6 to 5.6 in the pooled cohort. There was a striking relationship between the cumulative number of SNP risk alleles an individual possessed and ED status (Sommers' D P value = 1.7 Multiplication-Sign 10{sup -29}). A 1-allele increase in cumulative SNP score increased the odds for developing ED by a factor of 2.2 (P value = 2.1 Multiplication-Sign 10{sup -19}). The cumulative SNP score model had a sensitivity of 84% and specificity of 75% for prediction of developing ED at the radiation therapy planning stage. Conclusions: This genome-wide association study identified a set of SNPs that are associated with development of ED following radiation therapy. These candidate genetic predictors warrant more definitive validation in an independent cohort.« less

  11. ENGINES: exploring single nucleotide variation in entire human genomes.

    PubMed

    Amigo, Jorge; Salas, Antonio; Phillips, Christopher

    2011-04-19

    Next generation ultra-sequencing technologies are starting to produce extensive quantities of data from entire human genome or exome sequences, and therefore new software is needed to present and analyse this vast amount of information. The 1000 Genomes project has recently released raw data for 629 complete genomes representing several human populations through their Phase I interim analysis and, although there are certain public tools available that allow exploration of these genomes, to date there is no tool that permits comprehensive population analysis of the variation catalogued by such data. We have developed a genetic variant site explorer able to retrieve data for Single Nucleotide Variation (SNVs), population by population, from entire genomes without compromising future scalability and agility. ENGINES (ENtire Genome INterface for Exploring SNVs) uses data from the 1000 Genomes Phase I to demonstrate its capacity to handle large amounts of genetic variation (>7.3 billion genotypes and 28 million SNVs), as well as deriving summary statistics of interest for medical and population genetics applications. The whole dataset is pre-processed and summarized into a data mart accessible through a web interface. The query system allows the combination and comparison of each available population sample, while searching by rs-number list, chromosome region, or genes of interest. Frequency and FST filters are available to further refine queries, while results can be visually compared with other large-scale Single Nucleotide Polymorphism (SNP) repositories such as HapMap or Perlegen. ENGINES is capable of accessing large-scale variation data repositories in a fast and comprehensive manner. It allows quick browsing of whole genome variation, while providing statistical information for each variant site such as allele frequency, heterozygosity or FST values for genetic differentiation. Access to the data mart generating scripts and to the web interface is granted from

  12. A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, G K; Hillier, L; Brandstrom, M

    2005-02-20

    We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

  13. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    USDA-ARS?s Scientific Manuscript database

    High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

  14. Single nucleotide polymorphisms and haplotypes associated with feed efficiency in beef cattle

    PubMed Central

    2013-01-01

    Background General, breed- and diet-dependent associations between feed efficiency in beef cattle and single nucleotide polymorphisms (SNPs) or haplotypes were identified on a population of 1321 steers using a 50 K SNP panel. Genomic associations with traditional two-step indicators of feed efficiency – residual feed intake (RFI), residual average daily gain (RADG), and residual intake gain (RIG) – were compared to associations with two complementary one-step indicators of feed efficiency: efficiency of intake (EI) and efficiency of gain (EG). Associations uncovered in a training data set were evaluated on independent validation data set. A multi-SNP model was developed to predict feed efficiency. Functional analysis of genes harboring SNPs significantly associated with feed efficiency and network visualization aided in the interpretation of the results. Results For the five feed efficiency indicators, the numbers of general, breed-dependent, and diet-dependent associations with SNPs (P-value < 0.0001) were 31, 40, and 25, and with haplotypes were six, ten, and nine, respectively. Of these, 20 SNP and six haplotype associations overlapped between RFI and EI, and five SNP and one haplotype associations overlapped between RADG and EG. This result confirms the complementary value of the one and two-step indicators. The multi-SNP models included 89 SNPs and offered a precise prediction of the five feed efficiency indicators. The associations of 17 SNPs and 7 haplotypes with feed efficiency were confirmed on the validation data set. Nine clusters of Gene Ontology and KEGG pathway categories (mean P-value < 0.001) including, 9nucleotide binding; ion transport, phosphorous metabolic process, and the MAPK signaling pathway were overrepresented among the genes harboring the SNPs associated with feed efficiency. Conclusions The general SNP associations suggest that a single panel of genomic variants can be used regardless of breed and diet. The breed- and diet

  15. Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

  16. Annotate-it: a Swiss-knife approach to annotation, analysis and interpretation of single nucleotide variation in human disease

    PubMed Central

    2012-01-01

    The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org. PMID:23013645

  17. Developing single nucleotide polymorphism (SNP) markers from transcriptome sequences for identification of longan (Dimocarpus longan) germplasm

    PubMed Central

    Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng

    2015-01-01

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559

  18. High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform

    USDA-ARS?s Scientific Manuscript database

    Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...

  19. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    PubMed

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  20. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    PubMed

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  1. regSNPs-splicing: a tool for prioritizing synonymous single-nucleotide substitution.

    PubMed

    Zhang, Xinjun; Li, Meng; Lin, Hai; Rao, Xi; Feng, Weixing; Yang, Yuedong; Mort, Matthew; Cooper, David N; Wang, Yue; Wang, Yadong; Wells, Clark; Zhou, Yaoqi; Liu, Yunlong

    2017-09-01

    While synonymous single-nucleotide variants (sSNVs) have largely been unstudied, since they do not alter protein sequence, mounting evidence suggests that they may affect RNA conformation, splicing, and the stability of nascent-mRNAs to promote various diseases. Accurately prioritizing deleterious sSNVs from a pool of neutral ones can significantly improve our ability of selecting functional genetic variants identified from various genome-sequencing projects, and, therefore, advance our understanding of disease etiology. In this study, we develop a computational algorithm to prioritize sSNVs based on their impact on mRNA splicing and protein function. In addition to genomic features that potentially affect splicing regulation, our proposed algorithm also includes dozens structural features that characterize the functions of alternatively spliced exons on protein function. Our systematical evaluation on thousands of sSNVs suggests that several structural features, including intrinsic disorder protein scores, solvent accessible surface areas, protein secondary structures, and known and predicted protein family domains, show significant differences between disease-causing and neutral sSNVs. Our result suggests that the protein structure features offer an added dimension of information while distinguishing disease-causing and neutral synonymous variants. The inclusion of structural features increases the predictive accuracy for functional sSNV prioritization.

  2. Identification of a single nucleotide polymorphism indicative of high risk in acute myocardial infarction

    PubMed Central

    Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.

    2017-01-01

    Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065

  3. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    PubMed Central

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N.; Kumar, Dibyendu

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. Results The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay

  4. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

    PubMed

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu

    2017-01-01

    RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive

  5. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    PubMed

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  6. DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

    PubMed

    Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin

    2017-05-23

    A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

    PubMed Central

    Jannink, Jean-Luc

    2010-01-01

    Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

  8. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.

    PubMed

    Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline

    2012-05-17

    The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. The molecular typing method presented is one tool that could be incorporated into the forensic science tool box after a thorough

  9. Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

    PubMed Central

    Saad, Mohamed N.; Mabrouk, Mai S.; Eldeib, Ayman M.; Shaker, Olfat G.

    2015-01-01

    Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA) is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP) approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field. PMID:26843965

  10. Short communication: Relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle

    USDA-ARS?s Scientific Manuscript database

    Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...

  11. Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

    PubMed

    Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

    2011-05-01

    Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

  12. Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

    PubMed Central

    Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

    2011-01-01

    Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

  13. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    USDA-ARS?s Scientific Manuscript database

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  14. Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

    Treesearch

    Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

    2016-01-01

    Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

  15. Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

    PubMed

    Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

    2018-02-23

    The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

  16. DNAzyme based gap-LCR detection of single-nucleotide polymorphism.

    PubMed

    Zhou, Li; Du, Feng; Zhao, Yongyun; Yameen, Afshan; Chen, Haodong; Tang, Zhuo

    2013-07-15

    Fast and accurate detection of single-nucleotide polymorphism (SNP) is thought more and more important for understanding of human physiology and elucidating the molecular based diseases. A great deal of effort has been devoted to developing accurate, rapid, and cost-effective technologies for SNP analysis. However most of those methods developed to date incorporate complicated probe labeling and depend on advanced equipment. The DNAzyme based Gap-LCR detection method averts any chemical modification on probes and circumvents those problems by incorporating a short functional DNA sequence into one of LCR primers. Two kinds of exonuclease are utilized in our strategy to digest all the unreacted probes and release the DNAzymes embedded in the LCR product. The DNAzyme applied in our method is a versatile tool to report the result of SNP detection in colorimetric or fluorometric ways for different detection purposes. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  18. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    PubMed

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Heat-transfer resistance at solid-liquid interfaces: a tool for the detection of single-nucleotide polymorphisms in DNA.

    PubMed

    van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick

    2012-03-27

    In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society

  20. Colorectal cancer-susceptibility single-nucleotide polymorphisms in Korean population.

    PubMed

    Hong, Sung Noh; Park, Changho; Kim, Jong-Il; Kim, Duk-Hwan; Kim, Hee Cheol; Chang, Dong Kyung; Rhee, Poong-Lyul; Kim, Jae J; Rhee, Jong Chul; Son, Hee Jung; Kim, Young-Ho

    2015-05-01

    Considering the significant racial and ethnic diversity in genetic variation, it is unclear whether the genome-wide association studies-identified colorectal cancer (CRC)-susceptibility single-nucleotide polymorphisms (SNPs) discovered in European populations are also relevant to the Korean population. However, studies on CRC-susceptibility SNPs in Koreans are limited. To investigate the racial and ethnic diversity of CRC-susceptibility genetic variants, we genotyped for the established European CRC-susceptibility SNPs in 198 CRC cases and 329 controls in Korea. To identify novel genetic variants using genome-wide screening in Korea, Illumina HumanHap 370K/610K BeadChips were performed on 105 CRC patients, and candidate CRC-susceptibility SNPs were selected. Subsequently, genotyping for replication was done in 189 CRC cases and 190 controls. Among the European CRC-susceptibility SNPs, rs4939827 in SMAD7 was associated with a significant decreased risk of Korean CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 0.67 [95% CI, 0.47-0.95]; dominant model, 0.59 [95% CI, 0.39-0.91]). rs4779584 and rs10795668 were associated with CRC risk in females and males, respectively. Among candidate CRC-susceptibility SNPs selected from genome-wide screening, novel SNP, rs17051076, was found to be associated with a significantly increased risk of microsatellite instability-high CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 4.25 [95% CI, 1.51-11.98]; dominant model, 3.52 [95% CI, 1.13-10.94]) in the replication study. rs4939827, rs4779584, and rs10795668 may contribute to the risk of CRC in the Korean population as well as in European populations. Novel rs17051076 could be associated with microsatellite instability-high CRC in Koreans. These associations support the ethnic diversity of CRC-susceptibility SNPs and should be taken into account in large-scale studies. © 2013 Journal of Gastroenterology and Hepatology

  1. Single-nucleotide polymorphism genotyping on optical thin-film biosensor chips.

    PubMed

    Zhong, Xiao-Bo; Reynolds, Robert; Kidd, Judith R; Kidd, Kenneth K; Jenison, Robert; Marlar, Richard A; Ward, David C

    2003-09-30

    Single-nucleotide polymorphisms (SNPs) constitute the bulk of human genetic variation and provide excellent markers to identify genetic factors contributing to complex disease susceptibility. A rapid, sensitive, and inexpensive assay is important for large-scale SNP scoring. Here we report the development of a multiplex SNP detection system using silicon chips coated to create a thin-film optical biosensor. Allele-discriminating, aldehyde-labeled oligonucleotides are arrayed and covalently attached to a hydrazinederivatized chip surface. Target sequences (e.g., PCR amplicons) then are hybridized in the presence of a mixture of biotinylated detector probes, one for each SNP, and a thermostable DNA ligase. After a stringent wash (0.01 M NaOH), ligation of biotinylated detector probes to perfectly matched capture oligomers is visualized as a color change on the chip surface (gold to blue/purple) after brief incubations with an anti-biotin IgG-horseradish peroxidase conjugate and a precipitable horseradish peroxidase substrate. Testing of PCR fragments is completed in 30-40 min. Up to several hundred SNPs can be assayed on a 36-mm2 chip, and SNP scoring can be done by eye or with a simple digital-camera system. This assay is extremely robust, exhibits high sensitivity and specificity, and is format-flexible and economical. In studies of mutations associated with risk for venous thrombosis and genotyping/haplotyping of African-American samples, we document high-fidelity analysis with 0 misassignments in 500 assays performed in duplicate.

  2. Generation of DNA single-strand displacement by compromised nucleotide excision repair

    PubMed Central

    Godon, Camille; Mourgues, Sophie; Nonnekens, Julie; Mourcet, Amandine; Coin, Fréderic; Vermeulen, Wim; Mari, Pierre-Olivier; Giglia-Mari, Giuseppina

    2012-01-01

    Nucleotide excision repair (NER) is a precisely coordinated process essential to avoid DNA damage-induced cellular malfunction and mutagenesis. Here, we investigate the mechanistic details and effects of the NER machinery when it is compromised by a pathologically significant mutation in a subunit of the repair/transcription factor TFIIH, namely XPD. In contrast to previous studies, we find that no single- or double-strand DNA breaks are produced at early time points after UV irradiation of cells bearing a specific XPD mutation, despite the presence of a clear histone H2AX phosphorylation (γH2AX) signal in the UV-exposed areas. We show that the observed γH2AX signal can be explained by the presence of longer single-strand gaps possibly generated by strand displacement. Our in vivo measurements also indicate a strongly reduced TFIIH-XPG binding that could promote single-strand displacement at the site of UV lesions. This finding not only highlights the crucial role of XPG's interactions with TFIIH for proper NER, but also sheds new light on how a faulty DNA repair process can induce extreme genomic instability in human patients. PMID:22863773

  3. Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.

    PubMed

    Ermert, Susanne; Marx, Andreas; Hacker, Stephan M

    2017-04-01

    Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.

  4. Genome-Wide Association Study to Identify Single Nucleotide Polymorphisms (SNPs) Associated With the Development of Erectile Dysfunction in African-American Men After Radiotherapy for Prostate Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerns, Sarah L.; Ostrer, Harry; Stock, Richard

    2010-12-01

    Purpose: To identify single nucleotide polymorphisms (SNPs) associated with erectile dysfunction (ED) among African-American prostate cancer patients treated with external beam radiation therapy. Methods and Materials: A cohort of African-American prostate cancer patients treated with external beam radiation therapy was observed for the development of ED by use of the five-item Sexual Health Inventory for Men (SHIM) questionnaire. Final analysis included 27 cases (post-treatment SHIM score {<=}7) and 52 control subjects (post-treatment SHIM score {>=}16). A genome-wide association study was performed using approximately 909,000 SNPs genotyped on Affymetrix 6.0 arrays (Affymetrix, Santa Clara, CA). Results: We identified SNP rs2268363, locatedmore » in the follicle-stimulating hormone receptor (FSHR) gene, as significantly associated with ED after correcting for multiple comparisons (unadjusted p = 5.46 x 10{sup -8}, Bonferroni p = 0.028). We identified four additional SNPs that tended toward a significant association with an unadjusted p value < 10{sup -6}. Inference of population substructure showed that cases had a higher proportion of African ancestry than control subjects (77% vs. 60%, p = 0.005). A multivariate logistic regression model that incorporated estimated ancestry and four of the top-ranked SNPs was a more accurate classifier of ED than a model that included only clinical variables. Conclusions: To our knowledge, this is the first genome-wide association study to identify SNPs associated with adverse effects resulting from radiotherapy. It is important to note that the SNP that proved to be significantly associated with ED is located within a gene whose encoded product plays a role in male gonad development and function. Another key finding of this project is that the four SNPs most strongly associated with ED were specific to persons of African ancestry and would therefore not have been identified had a cohort of European ancestry been screened

  5. Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

    PubMed Central

    Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

    2012-01-01

    Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

  6. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    PubMed Central

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  7. Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

    PubMed

    Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

    2008-01-01

    Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p

  8. A Single Nucleotide Polymorphism in the Phospholipase D1 Gene is Associated with Risk of Non-Small Cell Lung Cancer

    PubMed Central

    Ahn, Myung-Ju; Park, Shin-Young; Kim, Won Kyu; Cho, Ju Hwan; Chang, Brian Junho; Kim, Dong Jo; Ahn, Jin Seok; Park, Keunchil; Han, Joong-Soo

    2012-01-01

    Phospholipase D (PLD) has an important role in various biological functions including vesicular transport, endocytosis, exocytosis, cell migration, and mitosis. These cellular biological processes are deregulated in the development of various human tumors. In order to explore the relationship between the PLD1 gene and risk of non-small cell lung cancer (NSCLC), single nucleotide polymorphisms (SNP) in the PLD1 exon region were surveyed in 211 NSCLC patients and 205 normal controls. In this study, we identified six SNPs at exon 23 in the PLD1 gene. Among the six SNPs, the most notable was a heterozygous A to C transition at nucleotide 2698 (A2698C, p<0.001). In addition, the genotype frequencies of A2744C (AC+CC) and A2756C (AC+CC) were associated with gender (female, A2744C and A2756C: p=0.071) in NSCLC patients. Interestingly, although the SNP A2698C did not cause change in amino acid, correlation between odd ratio of NSCLC patients and the SNP A2698C was observed to be statistically significant. PMID:23675264

  9. A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

    PubMed

    Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

    2006-04-01

    Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

  10. Reconstructing population histories from single nucleotide polymorphism data.

    PubMed

    Sirén, Jukka; Marttinen, Pekka; Corander, Jukka

    2011-01-01

    Population genetics encompasses a strong theoretical and applied research tradition on the multiple demographic processes that shape genetic variation present within a species. When several distinct populations exist in the current generation, it is often natural to consider the pattern of their divergence from a single ancestral population in terms of a binary tree structure. Inference about such population histories based on molecular data has been an intensive research topic in the recent years. The most common approach uses coalescent theory to model genealogies of individuals sampled from the current populations. Such methods are able to compare several different evolutionary scenarios and to estimate demographic parameters. However, their major limitation is the enormous computational complexity associated with the indirect modeling of the demographies, which limits the application to small data sets. Here, we propose a novel Bayesian method for inferring population histories from unlinked single nucleotide polymorphisms, which is applicable also to data sets harboring large numbers of individuals from distinct populations. We use an approximation to the neutral Wright-Fisher diffusion to model random fluctuations in allele frequencies. The population histories are modeled as binary rooted trees that represent the historical order of divergence of the different populations. A combination of analytical, numerical, and Monte Carlo integration techniques are utilized for the inferences. A particularly important feature of our approach is that it provides intuitive measures of statistical uncertainty related with the estimates computed, which may be entirely lacking for the alternative methods in this context. The potential of our approach is illustrated by analyses of both simulated and real data sets.

  11. Single nucleotide editing without DNA cleavage using CRISPR/Cas9-deaminase in the sea urchin embryo.

    PubMed

    Shevidi, Saba; Uchida, Alicia; Schudrowitz, Natalie; Wessel, Gary M; Yajima, Mamiko

    2017-12-01

    A single base pair mutation in the genome can result in many congenital disorders in humans. The recent gene editing approach using CRISPR/Cas9 has rapidly become a powerful tool to replicate or repair such mutations in the genome. These approaches rely on cleaving DNA, while presenting unexpected risks. In this study, we demonstrate a modified CRISPR/Cas9 system fused to cytosine deaminase (Cas9-DA), which induces a single nucleotide conversion in the genome. Cas9-DA was introduced into sea urchin eggs with sgRNAs targeted for SpAlx1, SpDsh, or SpPks, each of which is critical for skeletogenesis, embryonic axis formation, or pigment formation, respectively. We found that both Cas9 and Cas9-DA edit the genome, and cause predicted phenotypic changes at a similar efficiency. Cas9, however, resulted in significant deletions in the genome centered on the gRNA target sequence, whereas Cas9-DA resulted in single or double nucleotide editing of C to T conversions within the gRNA target sequence. These results suggest that the Cas9-DA approach may be useful for manipulating gene activity with decreased risks of genomic aberrations. Developmental Dynamics 246:1036-1046, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  12. Genome-wide association study of fertility traits in dairy cattle using high-density single nucleotide polymorphism marker panels

    USDA-ARS?s Scientific Manuscript database

    Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...

  13. The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

    USDA-ARS?s Scientific Manuscript database

    The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

  14. Labeled nucleotide phosphate (NP) probes

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2009-02-03

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  15. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

    PubMed Central

    2012-01-01

    Background The September 11, 2001 attacks on the World Trade Center and the Pentagon increased the concern about the potential for terrorist attacks on many vulnerable sectors of the US, including agriculture. The concentrated nature of crops, easily obtainable biological agents, and highly detrimental impacts make agroterrorism a potential threat. Although procedures for an effective criminal investigation and attribution following such an attack are available, important enhancements are still needed, one of which is the capability for fine discrimination among pathogen strains. The purpose of this study was to develop a molecular typing assay for use in a forensic investigation, using Wheat streak mosaic virus (WSMV) as a model plant virus. Method This genotyping technique utilizes single base primer extension to generate a genetic fingerprint. Fifteen single nucleotide polymorphisms (SNPs) within the coat protein and helper component-protease genes were selected as the genetic markers for this assay. Assay optimization and sensitivity testing was conducted using synthetic targets. WSMV strains and field isolates were collected from regions around the world and used to evaluate the assay for discrimination. The assay specificity was tested against a panel of near-neighbors consisting of genetic and environmental near-neighbors. Result Each WSMV strain or field isolate tested produced a unique SNP fingerprint, with the exception of three isolates collected within the same geographic location that produced indistinguishable fingerprints. The results were consistent among replicates, demonstrating the reproducibility of the assay. No SNP fingerprints were generated from organisms included in the near-neighbor panel, suggesting the assay is specific for WSMV. Using synthetic targets, a complete profile could be generated from as low as 7.15 fmoles of cDNA. Conclusion The molecular typing method presented is one tool that could be incorporated into the forensic

  16. Imputation of single nucleotide polymorhpism genotypes of Hereford cattle: reference panel size, family relationship and population structure

    USDA-ARS?s Scientific Manuscript database

    The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...

  17. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    PubMed Central

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  18. Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

    PubMed

    Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

    2009-06-01

    The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

  19. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    PubMed

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  20. Automated detection system of single nucleotide polymorphisms using two kinds of functional magnetic nanoparticles

    NASA Astrophysics Data System (ADS)

    Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue

    2008-11-01

    Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.

  1. The association of single-nucleotide polymorphisms in the oxytocin receptor and G protein-coupled receptor kinase 6 (GRK6) genes with oxytocin dosing requirements and labor outcomes.

    PubMed

    Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K

    2017-09-01

    Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in

  2. Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

    USDA-ARS?s Scientific Manuscript database

    Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

  3. VarDetect: a nucleotide sequence variation exploratory tool

    PubMed Central

    Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades

    2008-01-01

    Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032

  4. Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

    PubMed

    Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

    2003-06-01

    In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

  5. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

    PubMed Central

    Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

  6. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

    PubMed

    Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

  7. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    NASA Astrophysics Data System (ADS)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

    2017-02-01

    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  8. Identification and validation of single nucleotide polymorphisms as tools to detect hybridization and population structure in freshwater stingrays.

    PubMed

    Cruz, Vanessa P; Vera, Manuel; Pardo, Belén G; Taggart, John; Martinez, Paulino; Oliveira, Claudio; Foresti, Fausto

    2017-05-01

    Single nucleotide polymorphism (SNP) markers were identified and validated for two stingrays species, Potamotrygon motoro and Potamotrygon falkneri, using double digest restriction-site associated DNA (ddRAD) reads using 454-Roche technology. A total of 226 774 reads (65.5 Mb) were obtained (mean read length 289 ± 183 bp) detecting a total of 5399 contigs (mean contig length: 396 ± 91 bp). Mining this data set, a panel of 143 in silico SNPs was selected. Eighty-two of these SNPs were successfully validated and 61 were polymorphic: 14 in P. falkneri, 21 in P. motoro, 3 in both species and 26 fixed for alternative variants in both species, thus being useful for population analyses and hybrid detection. © 2016 John Wiley & Sons Ltd.

  9. Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease.

    PubMed

    Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan

    2018-01-01

    To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

  10. [The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

    PubMed

    Bai, Peng; Tian, Li; Zhou, Xue-ping

    2005-05-01

    DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

  11. Single nucleotide polymorphism analysis of the enterocin P structural gene of Enterococcus faecium strains isolated from nonfermented animal foods.

    PubMed

    Arlindo, Samuel; Calo, Pilar; Franco, Carlos; Prado, Marta; Cepeda, Alberto; Barros-Velázquez, Jorge

    2006-12-01

    The bacteriocins produced by two lactic acid bacteria isolated from nonfermented fresh meat and fish, respectively, and exhibiting a remarkable antilisterial activity, were characterized. Bacteriocinogenic strains were identified as Enterococcus faecium and the maximum bacteriocin production by both strains was detected in the stationary phase of growth. The activity against Listeria monocytogenes was maintained in pH range of 3-7 and was stable in both strains after heating at 100 or 121 degrees C. The genes coding for enterocin P were detected, isolated, and sequenced in both E. faecium strains. They exhibited DNA/DNA homology in the 87.1-97.2% range with respect to the other four enterocin P genes reported so far. Three single nucleotide polymorphism events, silent at the amino acid level, were detected at nucleotide positions 45 (G/A), 75 (A/G), and 90 (T/C) in E. faecium LHICA 28-4 and may explain the differences reported for those loci in other enterocin P-producing E. faecium strains. This work provides the first description of enterocin P-producing E. faecium strains in nonfermented foodstuffs and, in the case of E. faecium LHICA 51, the first report of an enterocin P-producing strain isolated from fish so far.

  12. The regulated secretory pathway and human disease: insights from gene variants and single nucleotide polymorphisms.

    PubMed

    Lin, Wei-Jye; Salton, Stephen R

    2013-01-01

    The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired.

  13. Human Mitochondrial RNA Polymerase: Evaluation of the Single-Nucleotide-Addition Cycle on Synthetic RNA/DNA Scaffolds

    PubMed Central

    Smidansky, Eric D.; Arnold, Jamie J.; Reynolds, Shelley L.; Cameron, Craig E.

    2013-01-01

    The human mitochondrial RNA polymerase (h-mtRNAP) serves as both the transcriptase for expression and the primase for replication of mitochondrial DNA. As such, the enzyme is of fundamental importance to cellular energy metabolism, and defects in its function may be related to human disease states. Here we describe in vitro analysis of the h-mtRNAP kinetic mechanism for single, correct nucleotide incorporation. This was made possible by the development of efficient methods for expression and purification of h-mtRNAP using a bacterial system and by utilization of assays that rely on simple, synthetic RNA/DNA scaffolds without the need for mitochondrial transcription accessory proteins. We find that h-mtRNAP accomplishes single-nucleotide incorporation by using the same core steps, including conformational change steps before and after chemistry, that are prototypical for most types of nucleic acid polymerases. The polymerase binds to scaffolds via a two-step mechanism consisting of a fast initial-encounter step followed by a much slower isomerization that leads to catalytic competence. A substantial solvent deuterium kinetic isotope effect was observed for the forward reaction, but none was detectable for the reverse reaction, suggesting that chemistry is at least partially rate-limiting in the forward direction but not in the reverse. h-mtRNAP appears to exercise much more stringent surveillance over base than over sugar in determining the correctness of a nucleotide. The utility of developing the robust in vitro assays described here and of establishing a baseline of kinetic performance for the wild-type enzyme is that biological questions concerning h-mtRNAP may now begin to be addressed. PMID:21548588

  14. Single nucleotide polymorphisms of TNF-Α gene in febrile seizures.

    PubMed

    Zare-Shahabadi, Ameneh; Ashrafi, Mahmoud Reza; Shahrokhi, Amin; Soltani, Samaneh; Zoghi, Samaneh; Soleimani, Farin; Vameghi, Roshanak; Badv, Reza Shervin; Rezaei, Nima

    2015-09-15

    Febrile seizures (FS) is the most common seizure disorder during childhood. This study was performed in 78 patients with FS and 137 control subjects to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence specific primers method. The highest positive allelic association that made the patients susceptible to FS was seen for TNF-α -238/G (p<0.0001). The GG genotype at TNF-α -238 was significantly higher in the patients with FS, compared to the controls (p=0.0001). Also, GA genotype at the same position was significantly lower in patients than in controls (P=0.0001). The GG haplotype had a significant positive association at TNF-α (308, 238) while GA haplotype showed a negative association (P<0.001). Our data support the idea that TNF-α single-nucleotide polymorphisms play a role in the pathogenesis of FS. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. In silico prediction of splice-altering single nucleotide variants in the human genome.

    PubMed

    Jian, Xueqiu; Boerwinkle, Eric; Liu, Xiaoming

    2014-12-16

    In silico tools have been developed to predict variants that may have an impact on pre-mRNA splicing. The major limitation of the application of these tools to basic research and clinical practice is the difficulty in interpreting the output. Most tools only predict potential splice sites given a DNA sequence without measuring splicing signal changes caused by a variant. Another limitation is the lack of large-scale evaluation studies of these tools. We compared eight in silico tools on 2959 single nucleotide variants within splicing consensus regions (scSNVs) using receiver operating characteristic analysis. The Position Weight Matrix model and MaxEntScan outperformed other methods. Two ensemble learning methods, adaptive boosting and random forests, were used to construct models that take advantage of individual methods. Both models further improved prediction, with outputs of directly interpretable prediction scores. We applied our ensemble scores to scSNVs from the Catalogue of Somatic Mutations in Cancer database. Analysis showed that predicted splice-altering scSNVs are enriched in recurrent scSNVs and known cancer genes. We pre-computed our ensemble scores for all potential scSNVs across the human genome, providing a whole genome level resource for identifying splice-altering scSNVs discovered from large-scale sequencing studies.

  16. Association of Notch3 single-nucleotide polymorphisms and lacunar infarctions in patients.

    PubMed

    Li, Ying; Liu, Nan; Chen, Hui; Huang, Yonghua; Zhang, Weiwei

    2016-01-01

    Cerebrovascular disease is a leading cause of morbidity and mortality worldwide, which is influenced by genetic and environmental factors. The aim of the present study was to examine the association between single-nucleotide polymorphisms (SNPs) in Notch3 exons 3-6 and lacunar infarction by comparing SNPs between control subjects and those with lacunar infarction. A single-center case-control study was conducted to investigate the association between Notch3 SNPs and risk of stroke. A total of 140 patients were included in the study, 30 of whom had no infarction (control) and 110 had lacunar infarction. Lacunar patients were divided into the 'pure lacunar' and 'lacunar + leukoarasis' groups based on brain imaging. All the patients were of Chinese Han ethnicity, and the male to female ratio was 84:56. Patient clinical histories included hypertension, diabetes mellitus (DM), hyperlipidemia, and heart disease were recorded. The Notch3 sequence was obtained from the National Centser for Biotechnology Information database. Notch3 was amplified by polymerase chain reaction from whole blood samples, and exons 3-6 were sequenced to identify SNPs. The result showed that there was no significant difference in the prevalence of hypertension, DM, hyperlipidemia, and heart disease between the control and lacunar infarction patients. Notabley, the age of the lacunar + leukoarasis patients was significantly higher than that of the control and pure lacunar patients (P<0.05). Eight SNPs were detected at low frequencies, and only rs3815388 and rs1043994 exhibited slightly higher frequencies. A χ 2 test indicated that Notch3 SNPs, particularly rs1043994, were associated with lacunar infarction (P<0.05). In conclusion, the result of the present study have shown that Notch3 SNPs, particularly rs1043994, are associated with lacunar infarction.

  17. A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

    USDA-ARS?s Scientific Manuscript database

    Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

  18. CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

    PubMed Central

    Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

    2004-01-01

    Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

  19. Role of six single nucleotide polymorphisms, risk factors in coronary disease, in OLR1 alternative splicing

    PubMed Central

    Tejedor, J. Ramón; Tilgner, Hagen; Iannone, Camilla; Guigó, Roderic; Valcárcel, Juan

    2015-01-01

    The OLR1 gene encodes the oxidized low-density lipoprotein receptor (LOX-1), which is responsible for the cellular uptake of oxidized LDL (Ox-LDL), foam cell formation in atheroma plaques and atherosclerotic plaque rupture. Alternative splicing (AS) of OLR1 exon 5 generates two protein isoforms with antagonistic functions in Ox-LDL uptake. Previous work identified six single nucleotide polymorphisms (SNPs) in linkage disequilibrium that influence the inclusion levels of OLR1 exon 5 and correlate with the risk of cardiovascular disease. Here we use minigenes to recapitulate the effects of two allelic series (Low- and High-Risk) on OLR1 AS and identify one SNP in intron 4 (rs3736234) as the main contributor to the differences in exon 5 inclusion, while the other SNPs in the allelic series attenuate the drastic effects of this key SNP. Bioinformatic, proteomic, mutational and functional high-throughput analyses allowed us to define regulatory sequence motifs and identify SR protein family members (SRSF1, SRSF2) and HMGA1 as factors involved in the regulation of OLR1 AS. Our results suggest that antagonism between SRSF1 and SRSF2/HMGA1, and differential recognition of their regulatory motifs depending on the identity of the rs3736234 polymorphism, influence OLR1 exon 5 inclusion and the efficiency of Ox-LDL uptake, with potential implications for atherosclerosis and coronary disease. PMID:25904137

  20. A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

    PubMed Central

    Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

    2006-01-01

    Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

  1. A single origin and moderate bottleneck during domestication of soybean (Glycine max): implications from microsatellites and nucleotide sequences

    PubMed Central

    Guo, Juan; Wang, Yunsheng; Song, Chi; Zhou, Jianfeng; Qiu, Lijuan; Huang, Hongwen; Wang, Ying

    2010-01-01

    Background and Aims It is essential to illuminate the evolutionary history of crop domestication in order to understand further the origin and development of modern cultivation and agronomy; however, despite being one of the most important crops, the domestication origin and bottleneck of soybean (Glycine max) are poorly understood. In the present study, microsatellites and nucleotide sequences were employed to elucidate the domestication genetics of soybean. Methods The genomes of 79 landrace soybeans (endemic cultivated soybeans) and 231 wild soybeans (G. soja) that represented the species-wide distribution of wild soybean in East Asia were scanned with 56 microsatellites to identify the genetic structure and domestication origin of soybean. To understand better the domestication bottleneck, four nucleotide sequences were selected to simulate the domestication bottleneck. Key Results Model-based analysis revealed that most of the landrace genotypes were assigned to the inferred wild soybean cluster of south China, South Korea and Japan. Phylogeny for wild and landrace soybeans showed that all landrace soybeans formed a single cluster supporting a monophyletic origin of all the cultivars. The populations of the nearest branches which were basal to the cultivar lineage were wild soybeans from south China. The coalescent simulation detected a bottleneck severity of K′ = 2 during soybean domestication, which could be explained by a foundation population of 6000 individuals if domestication duration lasted 3000 years. Conclusions As a result of integrating geographic distribution with microsatellite genotype assignment and phylogeny between landrace and wild soybeans, a single origin of soybean in south China is proposed. The coalescent simulation revealed a moderate genetic bottleneck with an effective wild soybean population used for domestication estimated to be ≈2 % of the total number of ancestral wild soybeans. Wild soybeans in Asia, especially in south

  2. Association of glutathione S-transferase pi isoform single-nucleotide polymorphisms with exudative age-related macular degeneration in a Chinese population.

    PubMed

    Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu

    2012-10-01

    To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.

  3. Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed.

    PubMed

    Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H

    2012-01-01

    PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.

  4. Single nucleotide polymorphisms related to cystic fibrosis in chronic rhinositus-a pilot study.

    PubMed

    Hull, Benjamin P; Jiramongkolchai, Pawina; Turner, Justin H; Olson, Lana; Chandra, Rakesh K

    2017-05-01

    The clinical association between cystic fibrosis (CF) and chronic rhinosinusitis (CRS) is well known. Studies have identified several non-CF transmembrane conductance regulator single nucleotide polymorphisms (SNPs) associated with disease severity in CF patients. We hypothesized that prevalence of these SNPs would be different between CRS patients and age/gender-matched non-CRS controls. This is a targeted SNP study of 1231 CRS patients identified through a large university hospital database who were compared with 8796 age- and gender-matched controls without a history of rhinitis, sinusitis, allergies, or asthma. Prevalence of 5 relevant SNPs was compared between groups, with p < 0.05 considered significant. Stratification by race and gender was performed among groups when statistically appropriate. CRS patients exhibited a statistically significant (p = 0.036) lower prevalence of rs12883884 (associated with an ion transporter) compared with controls. This association was lost when patients were stratified by race. CRS patients manifested a greater prevalence of rs1403543 (chromosome 23) in both Caucasian and African American subgroups (p = 0.036 and p = 0.026, respectively). Statistical significance disappeared among Caucasians when stratified by gender, but persisted among African American women (p = 0.047). rs12188164 and rs12793173 were both more prevalent in African Americans with CRS than controls (p = 0.042 and p = 0.020, respectively). A trend was also observed for decreased prevalence of rs12883884 in CRS patients compared with controls in the African American subgroup (p = 0.086). The identified SNPs were differentially prevalent in CRS compared with control groups, with some variability as a function of race and gender. Further research is required to confirm these findings and elucidate clinical significance. © 2017 ARS-AAOA, LLC.

  5. Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

    PubMed

    Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

    2006-06-01

    Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.

  6. Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

    PubMed

    Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

    2016-06-01

    Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. ESR1 single nucleotide polymorphisms predict breast cancer susceptibility in the central European Caucasian population.

    PubMed

    Lipphardt, Mark F; Deryal, Mustafa; Ong, Mei Fang; Schmidt, Werner; Mahlknecht, Ulrich

    2013-01-01

    Estrogen and progesterone hormones are key regulators of a wide variety of biological processes. In addition to their influence on reproduction, cell differentiation and apoptosis, they affect inflammatory response, cell metabolism and most importantly, they regulate physiological breast tissue proliferation and differentiation as well as the development and progression of breast cancer. In order to assess whether genetic variants in the steroid hormone receptor gene ESR1 (estrogen receptor alpha) had an effect on sporadic breast cancer susceptibility, we assessed 7 ESR1 single nucleotide polymorphisms (SNPs) for associations with breast cancer susceptibility and clinical parameters in 221 breast cancer patients and 221 controls, respectively. We identified ESR1 intron SNP +2464 C/T (rs3020314) and ESR1 intron SNP -4576 A/C (rs1514348) to correlate with breast cancer susceptibility and progesterone receptor expression status. Patients genotyped CT for ESR1 intron SNP +2464 (rs3020314) (p ≤ 0.045) or genotyped AC for ESR1 intron SNP -4576 (rs1514348) (p ≤ 0.000026) were identified to carry a significant risk as to the development of breast cancer in the Central European Caucasian population (both together: p ≤ 0.000488). Our study could confirm previous associations and revealed new associations of SNP rs1514348 with susceptibility to breast cancer and clinical outcome, which might be used as new additional SNP markers.

  8. Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

    PubMed

    Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C

    2015-03-01

    Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

  9. Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

    PubMed Central

    Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

    2015-01-01

    Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

  10. Antibiotic Resistance and Single-Nucleotide Polymorphism Cluster Grouping Type in a Multinational Sample of Resistant Mycobacterium tuberculosis Isolates▿

    PubMed Central

    Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.

    2007-01-01

    A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140

  11. VCS: Tool for Visualizing Copy Number Variation and Single Nucleotide Polymorphism.

    PubMed

    Kim, HyoYoung; Sung, Samsun; Cho, Seoae; Kim, Tae-Hun; Seo, Kangseok; Kim, Heebal

    2014-12-01

    Copy number variation (CNV) or single nucleotide phlyorphism (SNP) is useful genetic resource to aid in understanding complex phenotypes or deseases susceptibility. Although thousands of CNVs and SNPs are currently avaliable in the public databases, they are somewhat difficult to use for analyses without visualization tools. We developed a web-based tool called the VCS (visualization of CNV or SNP) to visualize the CNV or SNP detected. The VCS tool can assist to easily interpret a biological meaning from the numerical value of CNV and SNP. The VCS provides six visualization tools: i) the enrichment of genome contents in CNV; ii) the physical distribution of CNV or SNP on chromosomes; iii) the distribution of log2 ratio of CNVs with criteria of interested; iv) the number of CNV or SNP per binning unit; v) the distribution of homozygosity of SNP genotype; and vi) cytomap of genes within CNV or SNP region.

  12. Study of seven single-nucleotide polymorphisms identified in East Asians for association with obesity in a Taiwanese population.

    PubMed

    Huang, Wei-Hsin; Hwang, Lee-Ching; Chan, Hsin-Lung; Lin, Hsiang-Yu; Lin, Yung-Hsiang

    2016-08-10

    This study aimed to examine single-nucleotide polymorphisms (SNPs) of seven previously reported obesity genes in East Asians and to analyse their associations and synergistic effects on obesity in the Taiwanese population. Cross-sectional study. One medical centre in northern Taiwan. A total of 323 non-obese and 264 obese participants were recruited. The threshold for obesity in this study was a body mass index of ≥27 kg/m(2), as defined by the Ministry of Health and Welfare in Taiwan. The study was performed with the approval of the institutional review board of MacKay Memorial Hospital, Taipei, Taiwan (application number 12MMHIS106). We analysed the genotype distributions of seven SNPs localising to the PPARγ2, GNB3, SDC3, ADRB2, FTO, PPARγ and ESR1 genes in obese and non-obese groups and then paired obesity-related SNPs to determine if they have synergistic effects on obesity. Analysis of the genotype distributions in obese and non-obese groups revealed only a significant positive correlation between an SNP in rs2282440-syndecan 3 (SDC3) and obesity in the Taiwanese population (p=0.006). In addition, the T/T genotype of SDC3 was significantly associated with a larger waist and hip circumference, higher body fat percentage and lower high-density lipoprotein cholesterol. Moreover, the combination of the rs2282440-SDC3T/T genotype with the rs1801282-peroxisome proliferator-activated receptor-gamma2 gene (PPARγ2) G carrier genotype was strongly associated with obesity (OR=6.77). We found that the rs2282440-SDC3T/T genotype is associated with obesity in the Taiwanese population. Furthermore, there is a synergistic effect of the high-risk alleles of the SDC3 and PPARγ2 genes on the obese phenotype in the Taiwanese population. 12MMHIS106; Results. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  13. Methods to Increase the Sensitivity of High Resolution Melting Single Nucleotide Polymorphism Genotyping in Malaria.

    PubMed

    Daniels, Rachel; Hamilton, Elizabeth J; Durfee, Katelyn; Ndiaye, Daouda; Wirth, Dyann F; Hartl, Daniel L; Volkman, Sarah K

    2015-11-10

    Despite decades of eradication efforts, malaria remains a global burden. Recent renewed interest in regional elimination and global eradication has been accompanied by increased genomic information about Plasmodium parasite species responsible for malaria, including characteristics of geographical populations as well as variations associated with reduced susceptibility to anti-malarial drugs. One common genetic variation, single-nucleotide polymorphisms (SNPs), offers attractive targets for parasite genotyping. These markers are useful not only for tracking drug resistance markers but also for tracking parasite populations using markers not under drug or other selective pressures. SNP genotyping methods offer the ability to track drug resistance as well as to fingerprint individual parasites for population surveillance, particularly in response to malaria control efforts in regions nearing elimination status. While informative SNPs have been identified that are agnostic to specific genotyping technologies, high-resolution melting (HRM) analysis is particularly suited to field-based studies. Compared to standard fluorescent-probe based methods that require individual SNPs in a single labeled probe and offer at best 10% sensitivity to detect SNPs in samples that contain multiple genomes (polygenomic), HRM offers 2-5% sensitivity. Modifications to HRM, such as blocked probes and asymmetric primer concentrations as well as optimization of amplification annealing temperatures to bias PCR towards amplification of the minor allele, further increase the sensitivity of HRM. While the sensitivity improvement depends on the specific assay, we have increased detection sensitivities to less than 1% of the minor allele. In regions approaching malaria eradication, early detection of emerging or imported drug resistance is essential for prompt response. Similarly, the ability to detect polygenomic infections and differentiate imported parasite types from cryptic local reservoirs

  14. A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

    PubMed Central

    Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi

    2013-01-01

    In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

  15. A domesticated transposon mediates the effects of a single-nucleotide polymorphism responsible for enhanced muscle growth.

    PubMed

    Butter, Falk; Kappei, Dennis; Buchholz, Frank; Vermeulen, Michiel; Mann, Matthias

    2010-04-01

    Single-nucleotide polymorphisms (SNPs) in the regulatory regions of the genome can have a profound impact on phenotype. The G3072A polymorphism in intron 3 of insulin-like growth factor 2 (IGF2) is implicated in higher muscle content and reduced fat in European pigs and is bound by a putative repressor. Here, we identify this repressor--which we call muscle growth regulator (MGR)--by using a DNA protein interaction screen based on quantitative mass spectrometry. MGR has a bipartite nuclear localization signal, two BED-type zinc fingers and is highly conserved between placental mammals. Surprisingly, the gene is located in an intron and belongs to the hobo-Ac-Tam3 transposase superfamily, suggesting regulatory use of a formerly parasitic element. In transactivation assays, MGR differentially represses the expression of the two SNP variants. Knockdown of MGR in C2C12 myoblast cells upregulates Igf2 expression and mild overexpression retards growth. Thus, MGR is the repressor responsible for enhanced muscle growth in the IGF2 G3072A polymorphism in commercially bred pigs.

  16. Intracellular nucleotide and nucleotide sugar contents of cultured CHO cells determined by a fast, sensitive, and high-resolution ion-pair RP-HPLC.

    PubMed

    Kochanowski, N; Blanchard, F; Cacan, R; Chirat, F; Guedon, E; Marc, A; Goergen, J-L

    2006-01-15

    Analysis of intracellular nucleotide and nucleotide sugar contents is essential in studying protein glycosylation of mammalian cells. Nucleotides and nucleotide sugars are the donor substrates of glycosyltransferases, and nucleotides are involved in cellular energy metabolism and its regulation. A sensitive and reproducible ion-pair reverse-phase high-performance liquid chromatography (RP-HPLC) method has been developed, allowing the direct and simultaneous detection and quantification of some essential nucleotides and nucleotide sugars. After a perchloric acid extraction, 13 molecules (8 nucleotides and 5 nucleotide sugars) were separated, including activated sugars such as UDP-glucose, UDP-galactose, GDP-mannose, UDP-N-acetylglucosamine, and UDP-N-acetylgalactosamine. To validate the analytical parameters, the reproducibility, linearity of calibration curves, detection limits, and recovery were evaluated for standard mixtures and cell extracts. The developed method is capable of resolving picomolar quantities of nucleotides and nucleotide sugars in a single chromatographic run. The HPLC method was then applied to quantify intracellular levels of nucleotides and nucleotide sugars of Chinese hamster ovary (CHO) cells cultivated in a bioreactor batch process. Evolutions of the titers of nucleotides and nucleotide sugars during the batch process are discussed.

  17. Single-nucleotide polymorphisms studied for associations with urinary toxicity from (125)I prostate brachytherapy implants.

    PubMed

    Usmani, Nawaid; Leong, Nelson; Martell, Kevin; Lan, Lanna; Ghosh, Sunita; Pervez, Nadeem; Pedersen, John; Yee, Don; Murtha, Albert; Amanie, John; Sloboda, Ron; Murray, David; Parliament, Matthew

    2014-01-01

    To identify clinical, dosimetric, and genetic factors that are associated with late urinary toxicity after a (125)I prostate brachytherapy implant. Genomic DNA from 296 men treated with (125)I prostate brachytherapy monotherapy was extracted from saliva samples for this study. A retrospective database was compiled including clinical, dosimetric, and toxicity data for this cohort of patients. Fourteen candidate single-nucleotide polymorphism (SNPs) from 13 genes (TP53, ERCC2, GSTP1, NOS, TGFβ1, MSH6, RAD51, ATM, LIG4, XRCC1, XRCC3, GSTA1, and SOD2) were tested in this cohort for correlations with toxicity. This study identified 217 men with at least 2 years of followup. Of these, 39 patients developed Grade ≥2 late urinary complications with a transurethral resection of prostate, urethral stricture, gross hematuria, or a sustained increase in their International Prostate Symptom Score. The only clinical or dosimetric factor that was associated with late urinary toxicity was age (p = 0.02). None of the 14 SNPs tested in this study were associated with late urinary toxicity in the univariate analysis. This study identified age as the only variable being associated with late urinary toxicity. However, the small sample size and the candidate gene approach used in this study mean that further investigations are essential. Genome-wide association studies are emerging as the preferred approach for future radiogenomic studies to overcome the limitations from a candidate gene approach. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

  18. [Intra- and interpopulation variability of southwestern Kamchatka sockeye salmon Oncorhynchus nerka inferred from the data on single nucleotide polymorphism].

    PubMed

    Khrustaleva, A M; Klovach, N V; Gritsenko, O F; Seeb, J E

    2014-07-01

    The variability of 45 single nucleotide polymorphism (SNP) loci was studied in nine samples of the sockeye salmon Oncorhynchus nerka from the rivers of southwestern Kamchatka. The Wahlund effect, gametic disequilibrium at some loci, and a decrease in interpopulation genetic diversity estimates observed in samples from the Bolshaya River outlet are explained in terms of the samples' heterogeneity. Partitioning of mixed samples using some biological characteristics of the individuals led to a noticeable decrease in the frequency of these phenomena. It was demonstrated that the allelic diversity between the populations within the river Plotnikovs accounted for the larger part of genetic variation, as compared to the differentiation between the basins. The SNP loci responsible for intra- and interpopulation differentiation of sockeye salmon from the rivers of southwestern Kamchatka were identified. Some recommendations for field population genetic studies of Asian sockeye salmon were formulated.

  19. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  20. Single-nucleotide polymorphism-gene intermixed networking reveals co-linkers connected to multiple gene expression phenotypes

    PubMed Central

    Gong, Bin-Sheng; Zhang, Qing-Pu; Zhang, Guang-Mei; Zhang, Shao-Jun; Zhang, Wei; Lv, Hong-Chao; Zhang, Fan; Lv, Sa-Li; Li, Chuan-Xing; Rao, Shao-Qi; Li, Xia

    2007-01-01

    Gene expression profiles and single-nucleotide polymorphism (SNP) profiles are modern data for genetic analysis. It is possible to use the two types of information to analyze the relationships among genes by some genetical genomics approaches. In this study, gene expression profiles were used as expression traits. And relationships among the genes, which were co-linked to a common SNP(s), were identified by integrating the two types of information. Further research on the co-expressions among the co-linked genes was carried out after the gene-SNP relationships were established using the Haseman-Elston sib-pair regression. The results showed that the co-expressions among the co-linked genes were significantly higher if the number of connections between the genes and a SNP(s) was more than six. Then, the genes were interconnected via one or more SNP co-linkers to construct a gene-SNP intermixed network. The genes sharing more SNPs tended to have a stronger correlation. Finally, a gene-gene network was constructed with their intensities of relationships (the number of SNP co-linkers shared) as the weights for the edges. PMID:18466544

  1. The Regulated Secretory Pathway and Human Disease: Insights from Gene Variants and Single Nucleotide Polymorphisms

    PubMed Central

    Lin, Wei-Jye; Salton, Stephen R.

    2013-01-01

    The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired. PMID:23964269

  2. Identification of Functional Single-Nucleotide Polymorphisms Affecting Leaf Hair Number in Brassica rapa.

    PubMed

    Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke

    2018-06-01

    Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.

  3. Wavelet-based identification of DNA focal genomic aberrations from single nucleotide polymorphism arrays

    PubMed Central

    2011-01-01

    Background Copy number aberrations (CNAs) are an important molecular signature in cancer initiation, development, and progression. However, these aberrations span a wide range of chromosomes, making it hard to distinguish cancer related genes from other genes that are not closely related to cancer but are located in broadly aberrant regions. With the current availability of high-resolution data sets such as single nucleotide polymorphism (SNP) microarrays, it has become an important issue to develop a computational method to detect driving genes related to cancer development located in the focal regions of CNAs. Results In this study, we introduce a novel method referred to as the wavelet-based identification of focal genomic aberrations (WIFA). The use of the wavelet analysis, because it is a multi-resolution approach, makes it possible to effectively identify focal genomic aberrations in broadly aberrant regions. The proposed method integrates multiple cancer samples so that it enables the detection of the consistent aberrations across multiple samples. We then apply this method to glioblastoma multiforme and lung cancer data sets from the SNP microarray platform. Through this process, we confirm the ability to detect previously known cancer related genes from both cancer types with high accuracy. Also, the application of this approach to a lung cancer data set identifies focal amplification regions that contain known oncogenes, though these regions are not reported using a recent CNAs detecting algorithm GISTIC: SMAD7 (chr18q21.1) and FGF10 (chr5p12). Conclusions Our results suggest that WIFA can be used to reveal cancer related genes in various cancer data sets. PMID:21569311

  4. Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update.

    PubMed

    Sheikh, Ishfaq A; Ahmad, Ejaz; Jamal, Mohammad S; Rehan, Mohd; Assidi, Mourad; Tayubi, Iftikhar A; AlBasri, Samera F; Bajouh, Osama S; Turki, Rola F; Abuzenadah, Adel M; Damanhouri, Ghazi A; Beg, Mohd A; Al-Qahtani, Mohammed

    2016-10-17

    Preterm birth (PTB), birth at <37 weeks of gestation, is a significant global public health problem. World-wide, about 15 million babies are born preterm each year resulting in more than a million deaths of children. Preterm neonates are more prone to problems and need intensive care hospitalization. Health issues may persist through early adulthood and even be carried on to the next generation. Majority (70 %) of PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs) that are reported to be associated with PTB. A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007-2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.

  5. Scanning the genome for gene single nucleotide polymorphisms involved in adaptive population differentiation in white spruce

    PubMed Central

    Namroud, Marie-Claire; Beaulieu, Jean; Juge, Nicolas; Laroche, Jérôme; Bousquet, Jean

    2008-01-01

    Conifers are characterized by a large genome size and a rapid decay of linkage disequilibrium, most often within gene limits. Genome scans based on noncoding markers are less likely to detect molecular adaptation linked to genes in these species. In this study, we assessed the effectiveness of a genome-wide single nucleotide polymorphism (SNP) scan focused on expressed genes in detecting local adaptation in a conifer species. Samples were collected from six natural populations of white spruce (Picea glauca) moderately differentiated for several quantitative characters. A total of 534 SNPs representing 345 expressed genes were analysed. Genes potentially under natural selection were identified by estimating the differentiation in SNP frequencies among populations (FST) and identifying outliers, and by estimating local differentiation using a Bayesian approach. Both average expected heterozygosity and population differentiation estimates (HE = 0.270 and FST = 0.006) were comparable to those obtained with other genetic markers. Of all genes, 5.5% were identified as outliers with FST at the 95% confidence level, while 14% were identified as candidates for local adaptation with the Bayesian method. There was some overlap between the two gene sets. More than half of the candidate genes for local adaptation were specific to the warmest population, about 20% to the most arid population, and 15% to the coldest and most humid higher altitude population. These adaptive trends were consistent with the genes’ putative functions and the divergence in quantitative traits noted among the populations. The results suggest that an approach separating the locus and population effects is useful to identify genes potentially under selection. These candidates are worth exploring in more details at the physiological and ecological levels. PMID:18662225

  6. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

    ERIC Educational Resources Information Center

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-01-01

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  7. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    PubMed

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  8. Unraveling the complexity of the interactions of DNA nucleotides with gold by single molecule force spectroscopy

    NASA Astrophysics Data System (ADS)

    Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie

    2015-11-01

    Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct

  9. Single nucleotide polymorphism array karyotyping: a diagnostic and prognostic tool in myelodysplastic syndromes with unsuccessful conventional cytogenetic testing.

    PubMed

    Arenillas, Leonor; Mallo, Mar; Ramos, Fernando; Guinta, Kathryn; Barragán, Eva; Lumbreras, Eva; Larráyoz, María-José; De Paz, Raquel; Tormo, Mar; Abáigar, María; Pedro, Carme; Cervera, José; Such, Esperanza; José Calasanz, María; Díez-Campelo, María; Sanz, Guillermo F; Hernández, Jesús María; Luño, Elisa; Saumell, Sílvia; Maciejewski, Jaroslaw; Florensa, Lourdes; Solé, Francesc

    2013-12-01

    Cytogenetic aberrations identified by metaphase cytogenetics (MC) have diagnostic, prognostic, and therapeutic implications in myelodysplastic syndromes (MDS). However, in some MDS patients MC study is unsuccesful. Single nucleotide polymorphism array (SNP-A) based karyotyping could be helpful in these cases. We performed SNP-A in 62 samples from bone marrow or peripheral blood of primary MDS with an unsuccessful MC study. SNP-A analysis enabled the detection of aberrations in 31 (50%) patients. We used the copy number alteration information to apply the International Prognostic Scoring System (IPSS) and we observed differences in survival between the low/intermediate-1 and intermediate-2/high risk patients. We also saw differences in survival between very low/low/intermediate and the high/very high patients when we applied the revised IPSS (IPSS-R). In conclusion, SNP-A can be used successfully in PB samples and the identification of CNA by SNP-A improve the diagnostic and prognostic evaluation of this group of MDS patients. Copyright © 2013 Wiley Periodicals, Inc.

  10. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    PubMed Central

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  11. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    PubMed

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  12. Identifying N6-methyladenosine sites using multi-interval nucleotide pair position specificity and support vector machine

    NASA Astrophysics Data System (ADS)

    Xing, Pengwei; Su, Ran; Guo, Fei; Wei, Leyi

    2017-04-01

    N6-methyladenosine (m6A) refers to methylation of the adenosine nucleotide acid at the nitrogen-6 position. It plays an important role in a series of biological processes, such as splicing events, mRNA exporting, nascent mRNA synthesis, nuclear translocation and translation process. Numerous experiments have been done to successfully characterize m6A sites within sequences since high-resolution mapping of m6A sites was established. However, as the explosive growth of genomic sequences, using experimental methods to identify m6A sites are time-consuming and expensive. Thus, it is highly desirable to develop fast and accurate computational identification methods. In this study, we propose a sequence-based predictor called RAM-NPPS for identifying m6A sites within RNA sequences, in which we present a novel feature representation algorithm based on multi-interval nucleotide pair position specificity, and use support vector machine classifier to construct the prediction model. Comparison results show that our proposed method outperforms the state-of-the-art predictors on three benchmark datasets across the three species, indicating the effectiveness and robustness of our method. Moreover, an online webserver implementing the proposed predictor has been established at http://server.malab.cn/RAM-NPPS/. It is anticipated to be a useful prediction tool to assist biologists to reveal the mechanisms of m6A site functions.

  13. Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

    USDA-ARS?s Scientific Manuscript database

    Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

  14. The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

    PubMed

    Yates, Christopher M; Sternberg, Michael J E

    2013-11-01

    Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

  15. Single nucleotide polymorphism and haplotype effects associated with somatic cell score in German Holstein cattle

    PubMed Central

    2014-01-01

    Background To better understand the genetic determination of udder health, we performed a genome-wide association study (GWAS) on a population of 2354 German Holstein bulls for which daughter yield deviations (DYD) for somatic cell score (SCS) were available. For this study, we used genetic information of 44 576 informative single nucleotide polymorphisms (SNPs) and 11 725 inferred haplotype blocks. Results When accounting for the sub-structure of the analyzed population, 16 SNPs and 10 haplotypes in six genomic regions were significant at the Bonferroni threshold of P ≤ 1.14 × 10-6. The size of the identified regions ranged from 0.05 to 5.62 Mb. Genomic regions on chromosomes 5, 6, 18 and 19 coincided with known QTL affecting SCS, while additional genomic regions were found on chromosomes 13 and X. Of particular interest is the region on chromosome 6 between 85 and 88 Mb, where QTL for mastitis traits and significant SNPs for SCS in different Holstein populations coincide with our results. In all identified regions, except for the region on chromosome X, significant SNPs were present in significant haplotypes. The minor alleles of identified SNPs on chromosomes 18 and 19, and the major alleles of SNPs on chromosomes 6 and X were favorable for a lower SCS. Differences in somatic cell count (SCC) between alternative SNP alleles reached 14 000 cells/mL. Conclusions The results support the polygenic nature of the genetic determination of SCS, confirm the importance of previously reported QTL, and provide evidence for the segregation of additional QTL for SCS in Holstein cattle. The small size of the regions identified here will facilitate the search for causal genetic variations that affect gene functions. PMID:24898131

  16. Novel Single Nucleotide Polymorphism-Based Assay for Genotyping Mycobacterium avium subsp. paratuberculosis

    PubMed Central

    Goldstone, Robert J.; McLuckie, Joyce; Smith, David G. E.

    2015-01-01

    Typing of Mycobacterium avium subspecies paratuberculosis strains presents a challenge, since they are genetically monomorphic and traditional molecular techniques have limited discriminatory power. The recent advances and availability of whole-genome sequencing have extended possibilities for the characterization of Mycobacterium avium subspecies paratuberculosis, and whole-genome sequencing can provide a phylogenetic context to facilitate global epidemiology studies. In this study, we developed a single nucleotide polymorphism (SNP) assay based on PCR and restriction enzyme digestion or sequencing of the amplified product. The SNP analysis was performed using genome sequence data from 133 Mycobacterium avium subspecies paratuberculosis isolates with different genotypes from 8 different host species and 17 distinct geographic regions around the world. A total of 28,402 SNPs were identified among all of the isolates. The minimum number of SNPs required to distinguish between all of the 133 genomes was 93 and between only the type C isolates was 41. To reduce the number of SNPs and PCRs required, we adopted an approach based on sequential detection of SNPs and a decision tree. By the analysis of 14 SNPs Mycobacterium avium subspecies paratuberculosis isolates can be characterized within 14 phylogenetic groups with a higher discriminatory power than mycobacterial interspersed repetitive unit–variable number tandem repeat assay and other typing methods. Continuous updating of genome sequences is needed in order to better characterize new phylogenetic groups and SNP profiles. The novel SNP assay is a discriminative, simple, reproducible method and requires only basic laboratory equipment for the large-scale global typing of Mycobacterium avium subspecies paratuberculosis isolates. PMID:26677250

  17. Single-Nucleotide Polymorphisms Associated with Skin Naphthyl–Keratin Adduct Levels in Workers Exposed to Naphthalene

    PubMed Central

    Jiang, Rong; French, John E.; Stober, Vandy P.; Kang-Sickel, Juei-Chuan C.; Zou, Fei

    2012-01-01

    Background: Individual genetic variation that results in differences in systemic response to xenobiotic exposure is not accounted for as a predictor of outcome in current exposure assessment models. Objective: We developed a strategy to investigate individual differences in single-nucleotide polymorphisms (SNPs) as genetic markers associated with naphthyl–keratin adduct (NKA) levels measured in the skin of workers exposed to naphthalene. Methods: The SNP-association analysis was conducted in PLINK using candidate-gene analysis and genome-wide analysis. We identified significant SNP–NKA associations and investigated the potential impact of these SNPs along with personal and workplace factors on NKA levels using a multiple linear regression model and the Pratt index. Results: In candidate-gene analysis, a SNP (rs4852279) located near the CYP26B1 gene contributed to the 2-naphthyl–keratin adduct (2NKA) level. In the multiple linear regression model, the SNP rs4852279, dermal exposure, exposure time, task replacing foam, age, and ethnicity all were significant predictors of 2NKA level. In genome-wide analysis, no single SNP reached genome-wide significance for NKA levels (all p ≥ 1.05 × 10–5). Pathway and network analyses of SNPs associated with NKA levels were predicted to be involved in the regulation of cellular processes and homeostasis. Conclusions: These results provide evidence that a quantitative biomarker can be used as an intermediate phenotype when investigating the association between genetic markers and exposure–dose relationship in a small, well-characterized exposed worker population. PMID:22391508

  18. Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.

    PubMed

    Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala

    2006-06-01

    Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.

  19. Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

    PubMed Central

    Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala

    2006-01-01

    Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

  20. Association between Single Nucleotide Polymorphism of Vitamin D Receptor Gene FokI Polymorphism and Clinical Progress of Benign Prostatic Hyperplasia

    PubMed Central

    Ruan, Li; Zhu, Jian-guo; Pan, Cong; Hua, Xing; Yuan, Dong-bo; Li, Zheng-ming; Zhong, Wei-de

    2015-01-01

    Background. The aim of the study was to investigate the association between single nucleotide polymorphism (SNP) of vitamin D receptor (VDR) gene and clinical progress of benign prostatic hyperplasia (BPH) in Chinese men. Methods. The DNA was extracted from blood of 200 BPH patients with operation (progression group) and 200 patients without operation (control group), respectively. The genotypes of VDR gene FokI SNP represented by “F/f” were identified by PCR-restriction fragment length polymorphism. The odds ratio (OR) of having progression of BPH for having the genotype were calculated. Results. Our date indicated that the f alleles of the VDR gene FokI SNP associated with the progression of BPH (P = 0.009). Conclusion. For the first time, our study demonstrated that VDR gene FokI SNP may be associated with the risk of BPH progress. PMID:25685834

  1. Identification of Novel Single Nucleotide Polymorphisms Associated with Acute Respiratory Distress Syndrome by Exome-Seq

    PubMed Central

    Shortt, Katherine; Chaudhary, Suman; Grigoryev, Dmitry; Heruth, Daniel P.; Venkitachalam, Lakshmi; Zhang, Li Q.; Ye, Shui Q.

    2014-01-01

    Acute respiratory distress syndrome (ARDS) is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP) which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719) in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T) occurs within a histone mark (intron 6) of the Arylsulfatase D gene. rs9605146 (G>A) causes a deleterious coding change (proline to leucine) in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A) is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted. PMID:25372662

  2. Single Nucleotide Variants Associated With Polygenic Hypercholesterolemia in Families Diagnosed Clinically With Familial Hypercholesterolemia.

    PubMed

    Lamiquiz-Moneo, Itziar; Pérez-Ruiz, María Rosario; Jarauta, Estíbaliz; Tejedor, María Teresa; Bea, Ana M; Mateo-Gallego, Rocío; Pérez-Calahorra, Sofía; Baila-Rueda, Lucía; Marco-Benedí, Victoria; de Castro-Orós, Isabel; Cenarro, Ana; Civeira, Fernando

    2018-05-01

    Approximately 20% to 40% of clinically defined familial hypercholesterolemia cases do not show a causative mutation in candidate genes, and some of them may have a polygenic origin. A cholesterol gene risk score for the diagnosis of polygenic hypercholesterolemia has been demonstrated to be valuable to differentiate polygenic and monogenic hypercholesterolemia. The aim of this study was to determine the contribution to low-density lipoprotein cholesterol (LDL-C) of the single nucleotide variants associated with polygenic hypercholesterolemia in probands with genetic hypercholesterolemia without mutations in candidate genes (nonfamilial hypercholesterolemia genetic hypercholesterolemia) and the genetic score in cascade screening in their family members. We recruited 49 nonfamilial hypercholesterolemia genetic hypercholesterolemia families (294 participants) and calculated cholesterol gene scores, derived from single nucleotide variants in SORT1, APOB, ABCG8, APOE and LDLR and lipoprotein(a) plasma concentration. Risk alleles in SORT1, ABCG8, APOE, and LDLR showed a statistically significantly higher frequency in blood relatives than in the 1000 Genomes Project. However, there were no differences between affected and nonaffected members. The contribution of the cholesterol gene score to LDL-C was significantly higher in affected than in nonaffected participants (P = .048). The percentage of the LDL-C variation explained by the score was 3.1%, and this percentage increased to 6.9% in those families with the highest genetic score in the proband. Nonfamilial hypercholesterolemia genetic hypercholesterolemia families concentrate risk alleles for high LDL-C. Their contribution varies greatly among families, indicating the complexity and heterogeneity of these forms of hypercholesterolemias. The gene score explains a small percentage of LDL-C, which limits its use in diagnosis. Copyright © 2017 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All

  3. Identification of a New Single-nucleotide Polymorphism within the Apolipoprotein A5 Gene, Which is Associated with Metabolic Syndrome.

    PubMed

    Salehi, Samaneh; Emadi-Baygi, Modjtaba; Rezaei, Majdaddin; Kelishadi, Roya; Nikpour, Parvaneh

    2017-01-01

    Metabolic syndrome (MetS) is a common disorder which is a constellation of clinical features including abdominal obesity, increased level of serum triglycerides (TGs) and decrease of serum high-density lipoprotein-cholesterol (HDL-C), elevated blood pressure, and glucose intolerance. The apolipoprotein A5 (APOA5) is involved in lipid metabolism, influencing the level of plasma TG and HDL-C. In the present study, we aimed to investigate the associations between four INDEL variants of APOA5 gene and the MetS risk. In this case-control study, we genotyped 116 Iranian children and adolescents with/without MetS by using Sanger sequencing method for these INDELs. Then, we explored the association of INDELs with MetS risk and their clinical components by logistic regression and one-way analysis of variance analyses. We identified a novel insertion polymorphism, c. *282-283 insAG/c. *282-283 insG variant, which appears among case and control groups. rs72525532 showed a significant difference for TG levels between various genotype groups. In addition, there were significant associations between newly identified single-nucleotide polymorphism (SNP) and rs72525532 with MetS risk. These results show that rs72525532 and the newly identified SNP may influence the susceptibility of the individuals to MetS.

  4. Nucleic acid analysis using terminal-phosphate-labeled nucleotides

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2008-04-22

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  5. Detection of clonal evolution in hematopoietic malignancies by combining comparative genomic hybridization and single nucleotide polymorphism arrays.

    PubMed

    Hartmann, Luise; Stephenson, Christine F; Verkamp, Stephanie R; Johnson, Krystal R; Burnworth, Bettina; Hammock, Kelle; Brodersen, Lisa Eidenschink; de Baca, Monica E; Wells, Denise A; Loken, Michael R; Zehentner, Barbara K

    2014-12-01

    Array comparative genomic hybridization (aCGH) has become a powerful tool for analyzing hematopoietic neoplasms and identifying genome-wide copy number changes in a single assay. aCGH also has superior resolution compared with fluorescence in situ hybridization (FISH) or conventional cytogenetics. Integration of single nucleotide polymorphism (SNP) probes with microarray analysis allows additional identification of acquired uniparental disomy, a copy neutral aberration with known potential to contribute to tumor pathogenesis. However, a limitation of microarray analysis has been the inability to detect clonal heterogeneity in a sample. This study comprised 16 samples (acute myeloid leukemia, myelodysplastic syndrome, chronic lymphocytic leukemia, plasma cell neoplasm) with complex cytogenetic features and evidence of clonal evolution. We used an integrated manual peak reassignment approach combining analysis of aCGH and SNP microarray data for characterization of subclonal abnormalities. We compared array findings with results obtained from conventional cytogenetic and FISH studies. Clonal heterogeneity was detected in 13 of 16 samples by microarray on the basis of log2 values. Use of the manual peak reassignment analysis approach improved resolution of the sample's clonal composition and genetic heterogeneity in 10 of 13 (77%) patients. Moreover, in 3 patients, clonal disease progression was revealed by array analysis that was not evident by cytogenetic or FISH studies. Genetic abnormalities originating from separate clonal subpopulations can be identified and further characterized by combining aCGH and SNP hybridization results from 1 integrated microarray chip by use of the manual peak reassignment technique. Its clinical utility in comparison to conventional cytogenetic or FISH studies is demonstrated. © 2014 American Association for Clinical Chemistry.

  6. Effect of increasing the number of single-nucleotide polymorphisms from 60,000 to 85,000 in genomic evaluation of Holsteins

    USDA-ARS?s Scientific Manuscript database

    The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...

  7. Pre-Steady-State Kinetic Analysis of Single-Nucleotide Incorporation by DNA Polymerases

    PubMed Central

    Su, Yan; Guengerich, F. Peter

    2016-01-01

    Pre-steady-state kinetic analysis is a powerful and widely used method to obtain multiple kinetic parameters. This protocol provides a step-by-step procedure for pre-steady-state kinetic analysis of single-nucleotide incorporation by a DNA polymerase. It describes the experimental details of DNA substrate annealing, reaction mixture preparation, handling of the RQF-3 rapid quench-flow instrument, denaturing polyacrylamide DNA gel preparation, electrophoresis, quantitation, and data analysis. The core and unique part of this protocol is the rationale for preparation of the reaction mixture (the ratio of the polymerase to the DNA substrate) and methods for conducting pre-steady-state assays on an RQF-3 rapid quench-flow instrument, as well as data interpretation after analysis. In addition, the methods for the DNA substrate annealing and DNA polyacrylamide gel preparation, electrophoresis, quantitation and analysis are suitable for use in other studies. PMID:27248785

  8. Real-Time PCR Typing of Escherichia coli Based on Multiple Single Nucleotide Polymorphisms--a Convenient and Rapid Method.

    PubMed

    Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan

    2016-01-01

    Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.

  9. Noncoding somatic and inherited single-nucleotide variants converge to promote ESR1 expression in breast cancer.

    PubMed

    Bailey, Swneke D; Desai, Kinjal; Kron, Ken J; Mazrooei, Parisa; Sinnott-Armstrong, Nicholas A; Treloar, Aislinn E; Dowar, Mark; Thu, Kelsie L; Cescon, David W; Silvester, Jennifer; Yang, S Y Cindy; Wu, Xue; Pezo, Rossanna C; Haibe-Kains, Benjamin; Mak, Tak W; Bedard, Philippe L; Pugh, Trevor J; Sallari, Richard C; Lupien, Mathieu

    2016-10-01

    Sustained expression of the estrogen receptor-α (ESR1) drives two-thirds of breast cancer and defines the ESR1-positive subtype. ESR1 engages enhancers upon estrogen stimulation to establish an oncogenic expression program. Somatic copy number alterations involving the ESR1 gene occur in approximately 1% of ESR1-positive breast cancers, suggesting that other mechanisms underlie the persistent expression of ESR1. We report significant enrichment of somatic mutations within the set of regulatory elements (SRE) regulating ESR1 in 7% of ESR1-positive breast cancers. These mutations regulate ESR1 expression by modulating transcription factor binding to the DNA. The SRE includes a recurrently mutated enhancer whose activity is also affected by rs9383590, a functional inherited single-nucleotide variant (SNV) that accounts for several breast cancer risk-associated loci. Our work highlights the importance of considering the combinatorial activity of regulatory elements as a single unit to delineate the impact of noncoding genetic alterations on single genes in cancer.

  10. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  11. A genotyping system capable of simultaneously analyzing >1000 single nucleotide polymorphisms in a haploid genome.

    PubMed

    Wang, Hui-Yun; Luo, Minjie; Tereshchenko, Irina V; Frikker, Danielle M; Cui, Xiangfeng; Li, James Y; Hu, Guohong; Chu, Yi; Azaro, Marco A; Lin, Yong; Shen, Li; Yang, Qifeng; Kambouris, Manousos E; Gao, Richeng; Shih, Weichung; Li, Honghua

    2005-02-01

    A high-throughput genotyping system for scoring single nucleotide polymorphisms (SNPs) has been developed. With this system, >1000 SNPs can be analyzed in a single assay, with a sensitivity that allows the use of single haploid cells as starting material. In the multiplex polymorphic sequence amplification step, instead of attaching universal sequences to the amplicons, primers that are unlikely to have nonspecific and productive interactions are used. Genotypes of SNPs are then determined by using the widely accessible microarray technology and the simple single-base extension assay. Three SNP panels, each consisting of >1000 SNPs, were incorporated into this system. The system was used to analyze 24 human genomic DNA samples. With 5 ng of human genomic DNA, the average detection rate was 98.22% when single probes were used, and 96.71% could be detected by dual probes in different directions. When single sperm cells were used, 91.88% of the SNPs were detectable, which is comparable to the level that was reached when very few genetic markers were used. By using a dual-probe assay, the average genotyping accuracy was 99.96% for 5 ng of human genomic DNA and 99.95% for single sperm. This system may be used to significantly facilitate large-scale genetic analysis even if the amount of DNA template is very limited or even highly degraded as that obtained from paraffin-embedded cancer specimens, and to make many unpractical research projects highly realistic and affordable.

  12. A Single Nucleotide Deletion in Gibberellin20-oxidase1 Causes Alpine Dwarfism in Arabidopsis.

    PubMed

    Luo, Yonghai; Dong, Xinwei; Yu, Tianying; Shi, Xuan; Li, Zongyun; Yang, Weicai; Widmer, Alex; Karrenberg, Sophie

    2015-07-01

    Alpine dwarfism is widely observed in alpine plant populations and often considered a high-altitude adaptation, yet its molecular basis and ecological relevance remain unclear. In this study, we used map-based cloning and field transplant experiments to investigate dwarfism in natural Arabidopsis (Arabidopsis thaliana) accessions collected from the Swiss Alps. A loss-of-function mutation due to a single nucleotide deletion in gibberellin20-oxidase1 (GA5) was identified as the cause of dwarfism in an alpine accession. The mutated allele, ga5-184, was found in two natural Arabidopsis populations collected from one geographic region at high altitude, but was different from all other reported ga5 null alleles, suggesting that this allele has evolved locally. In field transplant experiments, the dwarf accession with ga5-184 exhibited a fitness pattern consistent with adaptation to high altitude. Across a wider array of accessions from the Swiss Alps, plant height decreased with altitude of origin, but fitness patterns in the transplant experiments were variable and general altitudinal adaptation was not evident. In general, our study provides new insights into molecular basis and possible ecological roles of alpine dwarfism, and demonstrates the importance of the GA-signaling pathway for the generation of ecologically relevant variation in higher plants. © 2015 American Society of Plant Biologists. All Rights Reserved.

  13. Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

    PubMed

    Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

    2017-01-01

    Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

  14. Larva-mediated chalkbrood resistance-associated single nucleotide polymorphism markers in the honey bee Apis mellifera.

    PubMed

    Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S

    2016-06-01

    Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.

  15. A Bayesian hierarchical model to detect differentially methylated loci from single nucleotide resolution sequencing data

    PubMed Central

    Feng, Hao; Conneely, Karen N.; Wu, Hao

    2014-01-01

    DNA methylation is an important epigenetic modification that has essential roles in cellular processes including gene regulation, development and disease and is widely dysregulated in most types of cancer. Recent advances in sequencing technology have enabled the measurement of DNA methylation at single nucleotide resolution through methods such as whole-genome bisulfite sequencing and reduced representation bisulfite sequencing. In DNA methylation studies, a key task is to identify differences under distinct biological contexts, for example, between tumor and normal tissue. A challenge in sequencing studies is that the number of biological replicates is often limited by the costs of sequencing. The small number of replicates leads to unstable variance estimation, which can reduce accuracy to detect differentially methylated loci (DML). Here we propose a novel statistical method to detect DML when comparing two treatment groups. The sequencing counts are described by a lognormal-beta-binomial hierarchical model, which provides a basis for information sharing across different CpG sites. A Wald test is developed for hypothesis testing at each CpG site. Simulation results show that the proposed method yields improved DML detection compared to existing methods, particularly when the number of replicates is low. The proposed method is implemented in the Bioconductor package DSS. PMID:24561809

  16. Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

    PubMed

    Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

    2015-11-14

    Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and

  17. Using Single-Nucleotide Polymorphisms To Discriminate Disease-Associated from Carried Genomes of Neisseria meningitidis▿†

    PubMed Central

    Katz, Lee S.; Sharma, Nitya V.; Harcourt, Brian H.; Thomas, Jennifer Dolan; Wang, Xin; Mayer, Leonard W.; Jordan, I. King

    2011-01-01

    Neisseria meningitidis is one of the main agents of bacterial meningitis, causing substantial morbidity and mortality worldwide. However, most of the time N. meningitidis is carried as a commensal not associated with invasive disease. The genomic basis of the difference between disease-associated and carried isolates of N. meningitidis may provide critical insight into mechanisms of virulence, yet it has remained elusive. Here, we have taken a comparative genomics approach to interrogate the difference between disease-associated and carried isolates of N. meningitidis at the level of individual nucleotide variations (i.e., single nucleotide polymorphisms [SNPs]). We aligned complete genome sequences of 8 disease-associated and 4 carried isolates of N. meningitidis to search for SNPs that show mutually exclusive patterns of variation between the two groups. We found 63 SNPs that distinguish the 8 disease-associated genomes from the 4 carried genomes of N. meningitidis, which is far more than can be expected by chance alone given the level of nucleotide variation among the genomes. The putative list of SNPs that discriminate between disease-associated and carriage genomes may be expected to change with increased sampling or changes in the identities of the isolates being compared. Nevertheless, we show that these discriminating SNPs are more likely to reflect phenotypic differences than shared evolutionary history. Discriminating SNPs were mapped to genes, and the functions of the genes were evaluated for possible connections to virulence mechanisms. A number of overrepresented functional categories related to virulence were uncovered among SNP-associated genes, including genes related to the category “symbiosis, encompassing mutualism through parasitism.” PMID:21622743

  18. Using PCR-RFLP technology to teach single nucleotide polymorphism for undergraduates.

    PubMed

    Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

    2013-01-01

    Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a serial experiment in molecular biology laboratory course to teach single nucleotide polymorphism (SNP) to undergraduate students majoring in molecular biology or genetics. The flanking sequence of rs4382766 was located in Prdx6 gene, which contained a restriction site of SspI, and was used as a target in this lab course. The students could mimic real research by integrating different techniques, such as database retrieving, genomic DNA isolation, PCR, and restriction enzyme assay. This serial experiment of PCR-RFLP helps students set up intact idea of molecular biology and understand the relation among individual experiments. Students were found to be more enthusiastic during the laboratory classes than those in the former curriculum. Copyright © 2013 Wiley Periodicals, Inc.

  19. Single nucleotide polymorphisms of DNA repair genes as predictors of radioresponse.

    PubMed

    Parliament, Matthew B; Murray, David

    2010-10-01

    Radiation therapy is a key modality in the treatment of cancer. Substantial progress has been made in unraveling the molecular events which underpin the responses of malignant and surrounding normal tissues to ionizing radiation. An understanding of the genes involved in processes such as DNA double-strand break repair, DNA damage response, cell-cycle control, apoptosis, cellular antioxidant defenses, and cytokine production, has evolved toward examination of how genetic variants, most often, single nucleotide polymorphisms (SNPs), may influence interindividual radioresponse. Experimental approaches, such as candidate SNP-association studies, genome-wide association studies, and massively parallel sequencing are being proposed to address these questions. We present a focused review of the evidence supporting an association between SNPs in DNA repair genes and radioresponse in normal tissues and tumors. Although preliminary results indicate possible associations, there are methodological weaknesses in many of the studies, and independent validation of SNPs as biomarkers of radioresponse in much larger cohorts will likely require research cooperation through international consortia. Copyright © 2010 Elsevier Inc. All rights reserved.

  20. Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.

    PubMed

    Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A

    2006-08-01

    Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.

  1. An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

    USDA-ARS?s Scientific Manuscript database

    Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

  2. Exploring single nucleotide polymorphism (SNP), microsatellite (SSR) and differentially expressed genes in the jellyfish (Rhopilema esculentum) by transcriptome sequencing.

    PubMed

    Li, Yunfeng; Zhou, Zunchun; Tian, Meilin; Tian, Yi; Dong, Ying; Li, Shilei; Liu, Weidong; He, Chongbo

    2017-08-01

    In this study, single nucleotide polymorphism (SNP), microsatellite (SSR) and differentially expressed genes (DEGs) in the oral parts, gonads, and umbrella parts of the jellyfish Rhopilema esculentum were analyzed by RNA-Seq technology. A total of 76.4 million raw reads and 72.1 million clean reads were generated from deep sequencing. Approximately 119,874 tentative unigenes and 149,239 transcripts were obtained. A total of 1,034,708 SNP markers were detected in the three tissues. For microsatellite mining, 5088 SSRs were identified from the unigene sequences. The most frequent repeat motifs were mononucleotide repeats, which accounted for 61.93%. Transcriptome comparison of the three tissues yielded a total of 8841 DEGs, of which 3560 were up-regulated and 5281 were down-regulated. This study represents the greatest sequencing effort carried out for a jellyfish and provides the first high-throughput transcriptomic resource for jellyfish. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.

    PubMed

    Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris

    2004-07-14

    With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  4. Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

    PubMed Central

    2013-01-01

    Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different

  5. Gene-Based Single Nucleotide Polymorphism Markers for Genetic and Association Mapping in Common Bean

    PubMed Central

    2012-01-01

    Background In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. Results In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. Conclusions In short, this study illustrates the power of intron

  6. Makeup of the genetic correlation between milk production traits using genome-wide single nucleotide polymorphism information.

    PubMed

    van Binsbergen, R; Veerkamp, R F; Calus, M P L

    2012-04-01

    The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.

    PubMed

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

  8. Could single nucleotide polymorphisms influence on the efficacy of platelet-rich plasma in the treatment of sport injuries?

    PubMed Central

    Pruna, Ricard; Til, Lluis; Artells, Rosa

    2014-01-01

    Summary Platelet-rich plasma (PRP) is a new powerful biological tool in sports medicine, when used to treat tendon, ligament and muscle injuries. PRP is a fraction of autologous whole blood containing an increased number of platelets and a wide variety of cytokines that can improve and accelerate the healing of various tissues. An analysis of the literature shows promising pre-clinical results for PRP treatment, but there is a lack of solid clinical proof to support its use in sports medicine, and in fact, clinical findings on individual responses to PRP treatment are contradictory. These contradictions may be due to interindividual differences in the presence of single nucleotide polymorphisms (SNPs) in genes related to PRPs and/or their receptors. These SNPs can determine a greater or lesser response to this treatment and consequently a shorter or longer recovery time. We have focused our attention in the study of genes related to PRP with the aim to develope a genetic profile that will identify the individuals and injuries most likely to benefit from PRP treatment. PMID:24932449

  9. A survey of genome-wide single nucleotide polymorphisms through genome resequencing in the Périgord black truffle (Tuber melanosporum Vittad.).

    PubMed

    Payen, Thibaut; Murat, Claude; Gigant, Anaïs; Morin, Emmanuelle; De Mita, Stéphane; Martin, Francis

    2015-09-01

    The Périgord black truffle (Tuber melanosporum Vittad.), considered a gastronomic delicacy worldwide, is an ectomycorrhizal filamentous fungus that is ecologically important in Mediterranean French, Italian and Spanish woodlands. In this study, we developed a novel resource of single nucleotide polymorphisms (SNPs) for T. melanosporum using Illumina high-throughput resequencing. The genome from six T. melanosporum geographical accessions was sequenced to a depth of approximately 20×. These geographical accessions were selected from different populations within the northern and southern regions of the geographical species distribution. Approximately 80% of the reads for each of the six resequenced geographical accessions mapped against the reference T. melanosporum genome assembly, estimating the core genome size of this organism to be approximately 110 Mbp. A total of 442 326 SNPs corresponding to 3540 SNPs/Mbps were identified as being included in all seven genomes. The SNPs occurred more frequently in repeated sequences (85%), although 4501 SNPs were also identified in the coding regions of 2587 genes. Using the ratio of nonsynonymous mutations per nonsynonymous site (pN) to synonymous mutations per synonymous site (pS) and Tajima's D index scanning the whole genome, we were able to identify genomic regions and genes potentially subjected to positive or purifying selection. The SNPs identified represent a valuable resource for future population genetics and genomics studies. © 2015 John Wiley & Sons Ltd.

  10. Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

    PubMed Central

    Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

    2014-01-01

    Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

  11. GDF5 single-nucleotide polymorphism rs143383 is associated with lumbar disc degeneration in Northern European women

    PubMed Central

    Williams, F M K; Popham, M; Hart, D J; de Schepper, E; Bierma-Zeinstra, S; Hofman, A; Uitterlinden, A G; Arden, N K; Cooper, C; Spector, T D; Valdes, A M; van Meurs, J

    2011-01-01

    Objective Lumbar disc degeneration (LDD) is a serious social and medical problem which has been shown to be highly heritable. It has similarities with peripheral joint osteoarthritis (OA) in terms of both epidemiology and pathologic processes. A few known genetic variants have been identified using a candidate gene approach, but many more are thought to exist. GDF5 is a gene whose variants have been shown to play a role in skeletal height as well as predisposing to peripheral joint OA. In vitro, the gene product growth differentiation factor 5 has been shown to promote growth and repair of animal disc. This study was undertaken to investigate whether the GDF5 gene plays a role in LDD. Methods We investigated whether the 5′ upstream single-nucleotide polymorphism (SNP) variant rs143383 was associated with LDD, using plain radiography and magnetic resonance imaging to identify disc space narrowing and osteophytes, in 5 population cohorts from Northern Europe. Results An association between LDD and the SNP rs143383 was identified in women, with the same risk allele as in knee and hip OA (odds ratio 1.72 [95% confidence interval 1.15–2.57], P = 0.008). Conclusion Our findings in 5 population cohorts from Northern Europe indicate that a variant in the GDF5 gene is a risk factor for LDD in women. Many more such variants are predicted to exist, but this result highlights the growth and differentiation cellular pathway as a possible route to a better understanding of the process behind lumbar disc degeneration. PMID:21360499

  12. Increased frequency of de novo copy number variants in congenital heart disease by integrative analysis of single nucleotide polymorphism array and exome sequence data.

    PubMed

    Glessner, Joseph T; Bick, Alexander G; Ito, Kaoru; Homsy, Jason; Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R; Golhar, Ryan; Sanders, Stephan J; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A Jeremy; State, Matthew W; Kaltman, Jonathan R; White, Peter S; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K

    2014-10-24

    Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown pathogenesis. To determine the contribution of de novo copy number variants (CNVs) in the pathogenesis of sporadic CHD. We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism arrays and whole exome sequencing. Results were experimentally validated using digital droplet polymerase chain reaction. We compared validated CNVs in CHD cases with CNVs in 1301 healthy control trios. The 2 complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either single nucleotide polymorphism array (P=7×10(-5); odds ratio, 4.6) or whole exome sequencing data (P=6×10(-4); odds ratio, 3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (P=0.02; odds ratio, 2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in whole exome sequencing and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q subtelomeric deletions. We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. © 2014 American Heart Association, Inc.

  13. Noncoding somatic and inherited single-nucleotide variants converge to promote ESR1 expression in breast cancer

    PubMed Central

    Bailey, Swneke D.; Desai, Kinjal; Kron, Ken J.; Mazrooei, Parisa; Sinnott-Armstrong, Nicholas A.; Treloar, Aislinn E.; Dowar, Mark; Thu, Kelsie L.; Cescon, David W.; Silvester, Jennifer; Yang, S. Y. Cindy; Wu, Xue; Pezo, Rossanna C.; Haibe-Kains, Benjamin; Mak, Tak W.; Bedard, Philippe L.; Pugh, Trevor J.; Sallari, Richard C.; Lupien, Mathieu

    2016-01-01

    Sustained expression of the oestrogen receptor alpha (ESR1) drives two-thirds of breast cancer and defines the ESR1-positive subtype. ESR1 engages enhancers upon oestrogen stimulation to establish an oncogenic expression program1. Somatic copy number alterations involving the ESR1 gene occur in approximately 1% of ESR1-positive breast cancers2–5, implying that other mechanisms underlie the persistent expression of ESR1. We report the significant enrichment of somatic mutations within the set of regulatory elements (SRE) regulating ESR1 in 7% of ESR1-positive breast cancers. These mutations regulate ESR1 expression by modulating transcription factor binding to the DNA. The SRE includes a recurrently mutated enhancer whose activity is also affected by a functional inherited single nucleotide variant (SNV) rs9383590 that accounts for several breast cancer risk-loci. Our work highlights the importance of considering the combinatorial activity of regulatory elements as a single unit to delineate the impact of noncoding genetic alterations on single genes in cancer. PMID:27571262

  14. A Transcriptome Map of Actinobacillus pleuropneumoniae at Single-Nucleotide Resolution Using Deep RNA-Seq

    PubMed Central

    Su, Zhipeng; Zhu, Jiawen; Xu, Zhuofei; Xiao, Ran; Zhou, Rui; Li, Lu; Chen, Huanchun

    2016-01-01

    Actinobacillus pleuropneumoniae is the pathogen of porcine contagious pleuropneumoniae, a highly contagious respiratory disease of swine. Although the genome of A. pleuropneumoniae was sequenced several years ago, limited information is available on the genome-wide transcriptional analysis to accurately annotate the gene structures and regulatory elements. High-throughput RNA sequencing (RNA-seq) has been applied to study the transcriptional landscape of bacteria, which can efficiently and accurately identify gene expression regions and unknown transcriptional units, especially small non-coding RNAs (sRNAs), UTRs and regulatory regions. The aim of this study is to comprehensively analyze the transcriptome of A. pleuropneumoniae by RNA-seq in order to improve the existing genome annotation and promote our understanding of A. pleuropneumoniae gene structures and RNA-based regulation. In this study, we utilized RNA-seq to construct a single nucleotide resolution transcriptome map of A. pleuropneumoniae. More than 3.8 million high-quality reads (average length ~90 bp) from a cDNA library were generated and aligned to the reference genome. We identified 32 open reading frames encoding novel proteins that were mis-annotated in the previous genome annotations. The start sites for 35 genes based on the current genome annotation were corrected. Furthermore, 51 sRNAs in the A. pleuropneumoniae genome were discovered, of which 40 sRNAs were never reported in previous studies. The transcriptome map also enabled visualization of 5'- and 3'-UTR regions, in which contained 11 sRNAs. In addition, 351 operons covering 1230 genes throughout the whole genome were identified. The RNA-Seq based transcriptome map validated annotated genes and corrected annotations of open reading frames in the genome, and led to the identification of many functional elements (e.g. regions encoding novel proteins, non-coding sRNAs and operon structures). The transcriptional units described in this study

  15. A Lactotransferrin Single Nucleotide Polymorphism Demonstrates Biological Activity That Can Reduce Susceptibility to Caries

    PubMed Central

    Toruner, Gokce A.; Velliyagounder, Kabilan; Sampathkumar, Vandana; Godboley, Dipti; Furgang, David

    2013-01-01

    Streptococcus mutans is prominently linked to dental caries. Saliva's influence on caries is incompletely understood. Our goal was to identify a salivary protein with anti-S. mutans activity, characterize its genotype, and determine genotypic variants associated with S. mutans activity and reduced caries. An S. mutans affinity column was used to isolate active moieties from saliva obtained from a subject with minimal caries. The bound and eluted protein was identified as lactotransferrin (LTF) by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) analysis and confirmed by Western blotting with LTF antibody. A single nucleotide polymorphism (SNP) that produced a shift from arginine (R) to lysine (K) at amino acid position 47 in the LTF antimicrobial region (rs: 1126478) killed S. mutans in vitro. Saliva from a subject with moderate caries and with the LTF “wild-type” R form at position 47 had no such activity. A pilot genetic study (n = 30) showed that KK subjects were more likely to have anti-S. mutans activity than RR subjects (P = 0.001; relative risk = 3.6; 95% confidence interval [95% CI] = 1.5 to 11.13). Pretreatment of KK saliva with antibody to LTF reduced S. mutans killing in a dose-dependent manner (P = 0.02). KK subjects were less likely to have caries (P = 0.02). A synthetic 11-mer LTF/K peptide killed S. mutans and other caries-related bacteria, while the LTF/R peptide had no effect (P = 0.01). Our results provide functional evidence that the LTF/K variant results in both anti-S. mutans activity and reduced decay. We suggest that the LTF/K variant can influence oral microbial ecology in general and caries-provoking microbes specifically. PMID:23460521

  16. Single nucleotide polymorphism markers for low-dose aspirin-associated peptic ulcer and ulcer bleeding.

    PubMed

    Shiotani, Akiko; Murao, Takahisa; Fujita, Yoshihiko; Fujimura, Yoshinori; Sakakibara, Takashi; Nishio, Kazuto; Haruma, Ken

    2014-12-01

    In our previous study, the SLCO1B1 521TT genotype and the SLCO1B1*1b haplotype were significantly associated with the risk of peptic ulcer in patients taking low-dose aspirin (LDA). The aim of the present study was to investigate pharmacogenomic profile of LDA-induced peptic ulcer and ulcer bleeding. Patients taking 100 mg of enteric-coated aspirin for cardiovascular diseases and with a peptic ulcer or ulcer bleeding and patients who also participated in endoscopic surveillance were studied. Genome-wide analysis of single nucleotide polymorphisms (SNPs) was performed using the Affymetrix DME Plus Premier Pack. SLCO1B1*1b haplotype and candidate genotypes of genes associated with ulcer bleeding or small bowel bleeding identified by genome-wide analysis were determined using TaqMan SNP Genotyping Assay kits, polymerase chain reaction-restriction fragment length polymorphism, and direct sequencing. Of 593 patients enrolled, 111 patients had a peptic ulcer and 45 had ulcer bleeding. The frequencies of the SLCO1B1*1b haplotype and CHST2 2082 T allele were significantly greater in patients with peptic ulcer and ulcer bleeding compared to the controls. After adjustment for significant factors, the SLCO1B1*1b haplotype was associated with peptic ulcer (OR 2.20, 95% CI 1.24-3.89) and CHST2 2082 T allele with ulcer bleeding (2.57, 1.07-6.17). The CHST2 2082 T allele as well as SLCO1B1*1b haplotype may identify patients at increased risk for aspirin-induced peptic ulcer or ulcer bleeding. © 2014 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  17. dbWGFP: a database and web server of human whole-genome single nucleotide variants and their functional predictions.

    PubMed

    Wu, Jiaxin; Wu, Mengmeng; Li, Lianshuo; Liu, Zhuo; Zeng, Wanwen; Jiang, Rui

    2016-01-01

    The recent advancement of the next generation sequencing technology has enabled the fast and low-cost detection of all genetic variants spreading across the entire human genome, making the application of whole-genome sequencing a tendency in the study of disease-causing genetic variants. Nevertheless, there still lacks a repository that collects predictions of functionally damaging effects of human genetic variants, though it has been well recognized that such predictions play a central role in the analysis of whole-genome sequencing data. To fill this gap, we developed a database named dbWGFP (a database and web server of human whole-genome single nucleotide variants and their functional predictions) that contains functional predictions and annotations of nearly 8.58 billion possible human whole-genome single nucleotide variants. Specifically, this database integrates 48 functional predictions calculated by 17 popular computational methods and 44 valuable annotations obtained from various data sources. Standalone software, user-friendly query services and free downloads of this database are available at http://bioinfo.au.tsinghua.edu.cn/dbwgfp. dbWGFP provides a valuable resource for the analysis of whole-genome sequencing, exome sequencing and SNP array data, thereby complementing existing data sources and computational resources in deciphering genetic bases of human inherited diseases. © The Author(s) 2016. Published by Oxford University Press.

  18. Amplification of unscheduled DNA synthesis signal enables fluorescence-based single cell quantification of transcription-coupled nucleotide excision repair

    PubMed Central

    Wienholz, Franziska; Vermeulen, Wim

    2017-01-01

    Abstract Nucleotide excision repair (NER) comprises two damage recognition pathways: global genome NER (GG-NER) and transcription-coupled NER (TC-NER), which remove a wide variety of helix-distorting lesions including UV-induced damage. During NER, a short stretch of single-stranded DNA containing damage is excised and the resulting gap is filled by DNA synthesis in a process called unscheduled DNA synthesis (UDS). UDS is measured by quantifying the incorporation of nucleotide analogues into repair patches to provide a measure of NER activity. However, this assay is unable to quantitatively determine TC-NER activity due to the low contribution of TC-NER to the overall NER activity. Therefore, we developed a user-friendly, fluorescence-based single-cell assay to measure TC-NER activity. We combined the UDS assay with tyramide-based signal amplification to greatly increase the UDS signal, thereby allowing UDS to be quantified at low UV doses, as well as DNA-repair synthesis of other excision-based repair mechanisms such as base excision repair and mismatch repair. Importantly, we demonstrated that the amplified UDS is sufficiently sensitive to quantify TC-NER-derived repair synthesis in GG-NER-deficient cells. This assay is important as a diagnostic tool for NER-related disorders and as a research tool for obtaining new insights into the mechanism and regulation of excision repair. PMID:28088761

  19. Development of a single nucleotide polymorphism DNA microarray for the detection and genotyping of the SARS coronavirus.

    PubMed

    Guo, Xi; Geng, Peng; Wang, Quan; Cao, Boyang; Liu, Bin

    2014-10-01

    Severe acute respiratory syndrome (SARS), a disease that spread widely in the world during late 2002 to 2004, severely threatened public health. Although there have been no reported infections since 2004, the extremely pathogenic SARS coronavirus (SARS-CoV), as the causative agent of SARS, has recently been identified in animals, showing the potential for the re-emergence of this disease. Previous studies showed that 27 single nucleotide polymorphism (SNP) mutations among the spike (S) gene of this virus are correlated closely with the SARS pathogenicity and epidemicity. We have developed a SNP DNA microarray in order to detect and genotype these SNPs, and to obtain related information on the pathogenicity and epidemicity of a given strain. The microarray was hybridized with PCR products amplified from cDNAs obtained from different SARS-CoV strains. We were able to detect 24 SNPs and determine the type of a given strain. The hybridization profile showed that 19 samples were detected and genotyped correctly by using our microarray, with 100% accuracy. Our microarray provides a novel method for the detection and epidemiological surveillance of SARS-CoV.

  20. Impact of IL-10 (-1082) promoter-single nucleotide polymorphism on the outcome of hepatitis C virus genotype 4 infection.

    PubMed

    Helal, Soheir F; Gomaa, Howayda E; Thabet, Eman H; Younan, Mariam A; Helmy, Neveen A

    2014-01-01

    Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (-1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (-1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (-1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects.

  1. Characterization of frequencies and distribution of single nucleotide insertions/deletions in the human genome.

    PubMed

    Tan, Ene-Choo; Li, Haixia

    2006-07-19

    Most of the studies on single nucleotide variations are on substitutions rather than insertions/deletions. In this study, we examined the distribution and characteristics of single nucleotide insertions/deletions (SNindels), using data available from dbSNP for all the human chromosomes. There are almost 300,000 SNindels in the database, of which only 0.8% are validated. They occur at the frequency of 0.887 per 10 kb on average for the whole genome, or approximately 1 for every 11,274 bp. More than half occur in regions with mononucleotide repeats the longest of which is 47 bases. Overall the mononucleotide repeats involving C and G are much shorter than those for A and T. About 12% are surrounded by palindromes. There is general correlation between chromosome size and total number for each chromosome. Inter-chromosomal variation in density ranges from 0.6 to 21.7 per kilobase. The overall spectrum shows very high proportion of SNindel of types -/A and -/T at over 81%. The proportion of -/A and -/T SNindels for each chromosome is correlated to its AT content. Less than half of the SNindels are within or near known genes and even fewer (<0.183%) in coding regions, and more than 1.4% of -/C and -/G are in coding compared to 0.2% for -/A and -/T types. SNindels of -/A and -/T types make up 80% of those found within untranslated regions but less than 40% of those within coding regions. A separate analysis using the subset of 2324 validated SNindels showed slightly less AT bias of 74%, SNindels not within mononucleotide repeats showed even less AT bias at 58%. Density of validated SNindels is 0.007/10 kb overall and 90% are found within or near genes. Among all chromosomes, Y has the lowest numbers and densities for all SNindels, validated SNindels, and SNindels not within repeats.

  2. Structure of a eukaryotic cyclic nucleotide-gated channel

    PubMed Central

    Li, Minghui; Zhou, Xiaoyuan; Wang, Shu; Michailidis, Ioannis; Gong, Ye; Su, Deyuan; Li, Huan; Li, Xueming; Yang, Jian

    2018-01-01

    Summary Cyclic nucleotide-gated (CNG) channels are essential for vision and olfaction. They belong to the voltage-gated ion channel superfamily but their activities are controlled by intracellular cyclic nucleotides instead of transmembrane voltage. Here we report a 3.5 Å-resolution single-particle electron cryomicroscopy structure of a CNG channel from C. elegans in the cGMP-bound open state. The channel has an unusual voltage-sensor-like domain (VSLD), accounting for its deficient voltage dependence. A C-terminal linker connecting S6 and the cyclic nucleotide-binding domain interacts directly with both the VSLD and pore domain, forming a gating ring that couples conformational changes triggered by cyclic nucleotide binding to the gate. The selectivity filter is lined by the carboxylate side chains of a functionally important glutamate and three rings of backbone carbonyls. This structure provides a new framework for understanding mechanisms of ion permeation, gating and channelopathy of CNG channels and cyclic nucleotide modulation of related channels. PMID:28099415

  3. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

    PubMed

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2015-07-01

    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

  4. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

    PubMed Central

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2015-01-01

    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

  5. Mapping Argonaute and conventional RNA-binding protein interactions with RNA at single-nucleotide resolution using HITS-CLIP and CIMS analysis

    PubMed Central

    Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.

    2014-01-01

    Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355

  6. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    PubMed

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  7. Scanning confocal fluorescence microscopy for single molecule analysis of nucleotide excision repair complexes.

    PubMed

    Segers-Nolten, G M J; Wyman, C; Wijgers, N; Vermeulen, W; Lenferink, A T M; Hoeijmakers, J H J; Greve, J; Otto, C

    2002-11-01

    We used scanning confocal fluorescence microscopy to observe and analyze individual DNA- protein complexes formed between human nucleotide excision repair (NER) proteins and model DNA substrates. For this purpose human XPA protein was fused to EGFP, purified and shown to be functional. Binding of EGFP-labeled XPA protein to a Cy3.5-labeled DNA substrate, in the presence and absence of RPA, was assessed quantitatively by simultaneous excitation and emission detection of both fluorophores. Co-localization of Cy3.5 and EGFP signals within one diffraction limited spot indicated complexes of XPA with DNA. Measurements were performed on samples in a 1% agarose matrix in conditions that are compatible with protein activity and where reactions can be studied under equilibrium conditions. In these samples DNA alone was freely diffusing and protein-bound DNA was immobile, whereby they could be discriminated resulting in quantitative data on DNA binding. On the single molecule level approximately 10% of XPA co-localized with DNA; this increased to 32% in the presence of RPA. These results, especially the enhanced binding of XPA in the presence of RPA, are similar to those obtained in bulk experiments, validating the utility of scanning confocal fluorescence microscopy for investigating functional interactions at the single molecule level.

  8. CHASM and SNVBox: toolkit for detecting biologically important single nucleotide mutations in cancer.

    PubMed

    Wong, Wing Chung; Kim, Dewey; Carter, Hannah; Diekhans, Mark; Ryan, Michael C; Karchin, Rachel

    2011-08-01

    Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. MySQL database, source code and binaries freely available for academic/government use at http://wiki.chasmsoftware.org, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python <3.0*, MySQL server >5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM.

  9. Sub-micro-liter Electrochemical Single-Nucleotide-Polymorphism Detector for Lab-on-a-Chip System

    NASA Astrophysics Data System (ADS)

    Tanaka, Hiroyuki; Fiorini, Paolo; Peeters, Sara; Majeed, Bivragh; Sterken, Tom; de Beeck, Maaike Op; Hayashi, Miho; Yaku, Hidenobu; Yamashita, Ichiro

    2012-04-01

    A sub-micro-liter single-nucleotide-polymorphism (SNP) detector for lab-on-a-chip applications is developed. This detector enables a fast, sensitive, and selective SNP detection directly from human blood. The detector is fabricated on a Si substrate by a standard complementary metal oxide semiconductor/micro electro mechanical systems (CMOS/MEMS) process and Polydimethylsiloxane (PDMS) molding. Stable and reproducible measurements are obtained by implementing an on-chip Ag/AgCl electrode and encapsulating the detector. The detector senses the presence of SNPs by measuring the concentration of pyrophosphoric acid generated during selective DNA amplification. A 0.5-µL-volume detector enabled the successful performance of the typing of a SNP within the ABO gene using human blood. The measured sensitivity is 566 pA/µM.

  10. IL10 single nucleotide polymorphisms are related to upregulation of constitutive IL-10 production and susceptibility to Helicobacter pylori infection.

    PubMed

    Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina

    2014-06-01

    Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.

  11. SNPing Away at Complex Diseases: Analysis of Single-Nucleotide Polymorphisms around APOE in Alzheimer Disease

    PubMed Central

    Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.

    2000-01-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235

  12. SNPing away at complex diseases: analysis of single-nucleotide polymorphisms around APOE in Alzheimer disease.

    PubMed

    Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M

    2000-08-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (Pidentified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes.

  13. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm

    PubMed Central

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. ‘Cayenne’, ‘Spanish’, ‘Queen’) was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697

  14. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms.

    PubMed

    Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

    2008-08-19

    Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  15. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

    PubMed Central

    Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

    2008-01-01

    Background Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required. PMID:18710585

  16. The AVPR1A Gene and Its Single Nucleotide Polymorphism rs10877969: A Literature Review of Associations with Health Conditions and Pain.

    PubMed

    Roach, Keesha L; Hershberger, Patricia E; Rutherford, Julienne N; Molokie, Robert E; Wang, Zaijie Jim; Wilkie, Diana J

    2018-03-01

    Pain is the quintessential symptom for individuals suffering from sickle cell disease (SCD). Although the degree of suffering and the cost of treatment are staggering, SCD continues to be grossly understudied, including a lack of data for pain-related genes and prevalence of polymorphisms in this population. This lack of data adds to the inadequacy of pain therapy in this population. Pain genetics investigators have recently examined allele frequencies of single-nucleotide polymorphisms from candidate genes in people who have SCD. One of the genes identified was the arginine vasopressin receptor 1A gene (AVPR1A) and its associated single-nucleotide polymorphism (SNP) rs10877969. Progress in explaining pain-related polymorphisms associated with SCD can be facilitated by understanding the literature. The purpose of this literature review was to describe mechanisms of the polymorphic gene AVPR1A and the phenotypic variations associated with its SNPs relative to health conditions and pain. Published studies were included if the research addressed AVPR1A and was a full article in a peer-reviewed journal, in the English language, a human or animal study, and published 2009 to present. Abstracts were included if they were in English and provided information not found in a full article. The results of this review revealed that AVPR1A is associated with behavioral phenotypes, which include pair bonding, autism spectrum disorder, musical aptitude, infidelity, altruism, monogamy, mating, substance abuse, and alcohol preference. In addition, there were associations with pain, stress pain by sex, and sickle cell pain. Summary of this literature could provide insights into future pain research of this SNP in people with SCD. Copyright © 2018 American Society for Pain Management Nursing. Published by Elsevier Inc. All rights reserved.

  17. Single Nucleotide Polymorphism (SNP)-Strings: An Alternative Method for Assessing Genetic Associations

    PubMed Central

    Goodin, Douglas S.; Khankhanian, Pouya

    2014-01-01

    Background Genome-wide association studies (GWAS) identify disease-associations for single-nucleotide-polymorphisms (SNPs) from scattered genomic-locations. However, SNPs frequently reside on several different SNP-haplotypes, only some of which may be disease-associated. This circumstance lowers the observed odds-ratio for disease-association. Methodology/Principal Findings Here we develop a method to identify the two SNP-haplotypes, which combine to produce each person’s SNP-genotype over specified chromosomal segments. Two multiple sclerosis (MS)-associated genetic regions were modeled; DRB1 (a Class II molecule of the major histocompatibility complex) and MMEL1 (an endopeptidase that degrades both neuropeptides and β-amyloid). For each locus, we considered sets of eleven adjacent SNPs, surrounding the putative disease-associated gene and spanning ∼200 kb of DNA. The SNP-information was converted into an ordered-set of eleven-numbers (subject-vectors) based on whether a person had zero, one, or two copies of particular SNP-variant at each sequential SNP-location. SNP-strings were defined as those ordered-combinations of eleven-numbers (0 or 1), representing a haplotype, two of which combined to form the observed subject-vector. Subject-vectors were resolved using probabilistic methods. In both regions, only a small number of SNP-strings were present. We compared our method to the SHAPEIT-2 phasing-algorithm. When the SNP-information spanning 200 kb was used, SHAPEIT-2 was inaccurate. When the SHAPEIT-2 window was increased to 2,000 kb, the concordance between the two methods, in both of these eleven-SNP regions, was over 99%, suggesting that, in these regions, both methods were quite accurate. Nevertheless, correspondence was not uniformly high over the entire DNA-span but, rather, was characterized by alternating peaks and valleys of concordance. Moreover, in the valleys of poor-correspondence, SHAPEIT-2 was also inconsistent with itself, suggesting that

  18. Optimization of the Divergent method for genotyping single nucleotide variations using SYBR Green-based single-tube real-time PCR.

    PubMed

    Gentilini, Fabio; Turba, Maria E

    2014-01-01

    A novel technique, called Divergent, for single-tube real-time PCR genotyping of point mutations without the use of fluorescently labeled probes has recently been reported. This novel PCR technique utilizes a set of four primers and a particular denaturation temperature for simultaneously amplifying two different amplicons which extend in opposite directions from the point mutation. The two amplicons can readily be detected using the melt curve analysis downstream to a closed-tube real-time PCR. In the present study, some critical aspects of the original method were specifically addressed to further implement the technique for genotyping the DNM1 c.G767T mutation responsible for exercise-induced collapse in Labrador retriever dogs. The improved Divergent assay was easily set up using a standard two-step real-time PCR protocol. The melting temperature difference between the mutated and the wild-type amplicons was approximately 5°C which could be promptly detected by all the thermal cyclers. The upgraded assay yielded accurate results with 157pg of genomic DNA per reaction. This optimized technique represents a flexible and inexpensive alternative to the minor grove binder fluorescently labeled method and to high resolution melt analysis for high-throughput, robust and cheap genotyping of single nucleotide variations. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

    PubMed

    Lee, L; Anderson, E J

    1998-01-01

    SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

  20. Common single nucleotide variants underlying drug addiction: more than a decade of research.

    PubMed

    Bühler, Kora-Mareen; Giné, Elena; Echeverry-Alzate, Victor; Calleja-Conde, Javier; de Fonseca, Fernando Rodriguez; López-Moreno, Jose Antonio

    2015-09-01

    Drug-related phenotypes are common complex and highly heritable traits. In the last few years, candidate gene (CGAS) and genome-wide association studies (GWAS) have identified a huge number of single nucleotide polymorphisms (SNPs) associated with drug use, abuse or dependence, mainly related to alcohol or nicotine. Nevertheless, few of these associations have been replicated in independent studies. The aim of this study was to provide a review of the SNPs that have been most significantly associated with alcohol-, nicotine-, cannabis- and cocaine-related phenotypes in humans between the years of 2000 and 2012. To this end, we selected CGAS, GWAS, family-based association and case-only studies published in peer-reviewed international scientific journals (using the PubMed/MEDLINE and Addiction GWAS Resource databases) in which a significant association was reported. A total of 371 studies fit the search criteria. We then filtered SNPs with at least one replication study and performed meta-analysis of the significance of the associations. SNPs in the alcohol metabolizing genes, in the cholinergic gene cluster CHRNA5-CHRNA3-CHRNB4, and in the DRD2 and ANNK1 genes, are, to date, the most replicated and significant gene variants associated with alcohol- and nicotine-related phenotypes. In the case of cannabis and cocaine, a far fewer number of studies and replications have been reported, indicating either a need for further investigation or that the genetics of cannabis/cocaine addiction are more elusive. This review brings a global state-of-the-art vision of the behavioral genetics of addiction and collaborates on formulation of new hypothesis to guide future work. © 2015 Society for the Study of Addiction.

  1. Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

    PubMed

    El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

    2017-04-03

    Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

  2. CHASM and SNVBox: toolkit for detecting biologically important single nucleotide mutations in cancer

    PubMed Central

    Carter, Hannah; Diekhans, Mark; Ryan, Michael C.; Karchin, Rachel

    2011-01-01

    Summary: Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. Availability and Implementation: MySQL database, source code and binaries freely available for academic/government use at http://wiki.chasmsoftware.org, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python <3.0*, MySQL server >5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM. Contact: karchin@jhu.edu Supplementary Information: Supplementary data are available at Bioinformatics online. PMID:21685053

  3. [Association between single-nucleotide polymorphisms in the IRAK-4 gene and allergic rhinitis].

    PubMed

    Zhang, Yuan; Xi, Lin; Zhao, Yan-ming; Zhao, Li-ping; Zhang, Luo

    2012-06-01

    To investigate the genetic association pattern between single-nucleotide polymorphisms (SNP) in the interleukin-1 receptor-associated kinase 4 (IRAK-4) gene and allergic rhinitis (AR). A population of 379 patients with the diagnosis of AR and 333 healthy controls who lived in Beijing region was recruited. A total of 8 reprehensive marker SNP which were in IRAK-4 gene region were selected according to the Beijing people database from Hapmap website. The individual genotyping was performed by MassARRAY platform. SPSS 13.0 software was used for statistic analysis. Subgroup analysis for the presence of different allergen sensitivities displayed associations only in the house dust mite-allergic cohorts (rs3794262: P = 0.0034, OR = 1.7388; rs4251481: P = 0.0023, OR = 2.6593), but not in subjects who were allergic to pollens as well as mix allergens. The potential genetic contribution of the IRAK-4 gene to AR demonstrated an allergen-dependant association pattern in Chinese population.

  4. Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

    PubMed Central

    van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

    2012-01-01

    Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

  5. Non-synonymous single nucleotide polymorphisms in the watermelon eIF4E gene are closely associated with resistance to zucchini yellow mosaic virus.

    PubMed

    Ling, Kai-Shu; Harris, Karen R; Meyer, Jenelle D F; Levi, Amnon; Guner, Nihat; Wehner, Todd C; Bendahmane, Abdelhafid; Havey, Michael J

    2009-12-01

    Zucchini yellow mosaic virus (ZYMV) is one of the most economically important potyviruses infecting cucurbit crops worldwide. Using a candidate gene approach, we cloned and sequenced eIF4E and eIF(iso)4E gene segments in watermelon. Analysis of the nucleotide sequences between the ZYMV-resistant watermelon plant introduction PI 595203 (Citrullus lanatus var. lanatus) and the ZYMV-susceptible watermelon cultivar 'New Hampshire Midget' ('NHM') showed the presence of single nucleotide polymorphisms (SNPs). Initial analysis of the identified SNPs in association studies indicated that SNPs in the eIF4E, but not eIF(iso)4E, were closely associated to the phenotype of ZYMV-resistance in 70 F(2) and 114 BC(1R) progenies. Subsequently, we focused our efforts in obtaining the entire genomic sequence of watermelon eIF4E. Three SNPs were identified between PI 595203 and NHM. One of the SNPs (A241C) was in exon 1 and the other two SNPs (C309A and T554G) were in the first intron of the gene. SNP241 which resulted in an amino acid substitution (proline to threonine) was shown to be located in the critical cap recognition and binding area, similar to that of several plant species resistance to potyviruses. Analysis of a cleaved amplified polymorphism sequence (CAPS) marker derived from this SNP in F(2) and BC(1R) populations demonstrated a cosegregation between the CAPS-2 marker and their ZYMV resistance or susceptibility phenotype. When we investigated whether such SNP mutation in the eIF4E was also conserved in several other PIs of C. lanatus var. citroides, we identified a different SNP (A171G) resulting in another amino acid substitution (D71G) from four ZYMV-resistant C. lanatus var. citroides (PI 244018, PI 482261, PI 482299, and PI 482322). Additional CAPS markers were also identified. Availability of all these CAPS markers will enable marker-aided breeding of watermelon for ZYMV resistance.

  6. Impact of IL-10 (−1082) Promoter–Single Nucleotide Polymorphism on the Outcome of Hepatitis C Virus Genotype 4 Infection

    PubMed Central

    Helal, Soheir F.; Gomaa, Howayda E.; Thabet, Eman H.; Younan, Mariam A.; Helmy, Neveen A.

    2014-01-01

    Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (−1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (−1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (−1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). CONCLUSION No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects. PMID:24833945

  7. Highlights from the functional single nucleotide polymorphisms associated with human muscle size and strength or FAMuSS study.

    PubMed

    Pescatello, Linda S; Devaney, Joseph M; Hubal, Monica J; Thompson, Paul D; Hoffman, Eric P

    2013-01-01

    The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity.

  8. Highlights from the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength or FAMuSS Study

    PubMed Central

    Pescatello, Linda S.; Devaney, Joseph M.; Hubal, Monica J.; Thompson, Paul D.; Hoffman, Eric P.

    2013-01-01

    The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity. PMID:24455711

  9. The common single-nucleotide polymorphism rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women.

    PubMed

    Wan, Ji-Peng; Wang, Hong; Li, Chang-Zhong; Zhao, Han; You, Li; Shi, Dong-Hong; Sun, Xiu-Hua; Lv, Hong; Wang, Fei; Wen, Ze-Qing; Wang, Xie-Tong; Chen, Zi-Jiang

    2014-11-01

    Preeclampsia, characterized by hypertension and proteinuria, remains a leading cause of maternal morbidity and mortality. Recently, a genome-wide association study (GWAS) identified the single-nucleotide polymorphism, rs2681472, as a new hypertension susceptibility genetic variant. The purpose of this study was to evaluate the association between preeclampsia and rs268172 in a Northern Han Chinese population. We genotyped 1218 unrelated Northern Han Chinese women, including 515 patients with preeclampsia and 703 healthy controls. No significant differences were detected in the allele frequencies between patients and controls (P = .23). When patients were divided into early-onset and late-onset preeclampsia according to gestational age of disease onset, the allele frequencies significantly differed between controls and patients with early-onset preeclampsia (P = .02). Genotype frequencies also were significantly different between controls and patients early-onset preeclampsia when data were analyzed under additive (P = .03) and dominant (P = .009) models. We replicated this association in an independent Northern Han Chinese population and observed a significant difference in the allele frequencies between patients with early-onset preeclampsia and controls (P = .011). We report that rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women. © The Author(s) 2014.

  10. Identification of a psoriasis susceptibility candidate gene by linkage disequilibrium mapping with a localized single nucleotide polymorphism map.

    PubMed

    Hewett, Duncan; Samuelsson, Lena; Polding, Joanne; Enlund, Fredrik; Smart, Devi; Cantone, Kathryn; See, Chee Gee; Chadha, Sapna; Inerot, Annica; Enerback, Charlotta; Montgomery, Doug; Christodolou, Chris; Robinson, Phil; Matthews, Paul; Plumpton, Mary; Wahlstrom, Jan; Swanbeck, Gunnar; Martinsson, Tommy; Roses, Allen; Riley, John; Purvis, Ian

    2002-03-01

    Psoriasis is a chronic inflammatory disease of the skin with both genetic and environmental risk factors. Here we describe the creation of a single-nucleotide polymorphism (SNP) map spanning 900-1200 kb of chromosome 3q21, which had been previously recognized as containing a psoriasis susceptibility locus, PSORS5. We genotyped 644 individuals, from 195 Swedish psoriatic families, for 19 polymorphisms. Linkage disequilibrium (LD) between marker and disease was assessed using the transmission/disequilibrium test (TDT). In the TDT analysis, alleles of three of these SNPs showed significant association with disease (P<0.05). A 160-kb interval encompassing these three SNPs was sequenced, and a coding sequence consisting of 13 exons was identified. The predicted protein shares 30-40% homology with the family of cation/chloride cotransporters. A five-marker haplotype spanning the 3' half of this gene is associated with psoriasis to a P value of 3.8<10(-5). We have called this gene SLC12A8, coding for a member of the solute carrier family 12 proteins. It belongs to a class of genes that were previously unrecognized as playing a role in psoriasis pathogenesis.

  11. Functional and Structural Consequence of Rare Exonic Single Nucleotide Polymorphisms: One Story, Two Tales

    PubMed Central

    Gu, Wanjun; Gurguis, Christopher I.; Zhou, Jin J.; Zhu, Yihua; Ko, Eun-A.; Ko, Jae-Hong; Wang, Ting; Zhou, Tong

    2015-01-01

    Genetic variation arising from single nucleotide polymorphisms (SNPs) is ubiquitously found among human populations. While disease-causing variants are known in some cases, identifying functional or causative variants for most human diseases remains a challenging task. Rare SNPs, rather than common ones, are thought to be more important in the pathology of most human diseases. We propose that rare SNPs should be divided into two categories dependent on whether the minor alleles are derived or ancestral. Derived alleles are less likely to have been purified by evolutionary processes and may be more likely to induce deleterious effects. We therefore hypothesized that the rare SNPs with derived minor alleles would be more important for human diseases and predicted that these variants would have larger functional or structural consequences relative to the rare variants for which the minor alleles are ancestral. We systematically investigated the consequences of the exonic SNPs on protein function, mRNA structure, and translation. We found that the functional and structural consequences are more significant for the rare exonic variants for which the minor alleles are derived. However, this pattern is reversed when the minor alleles are ancestral. Thus, the rare exonic SNPs with derived minor alleles are more likely to be deleterious. Age estimation of rare SNPs confirms that these potentially deleterious SNPs are recently evolved in the human population. These results have important implications for understanding the function of genetic variations in human exonic regions and for prioritizing functional SNPs in genome-wide association studies of human diseases. PMID:26454016

  12. Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

    PubMed

    Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

    2009-07-14

    In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

  13. Genetic homogeneity of the invasive lionfish across the Northwestern Atlantic and the Gulf of Mexico based on Single Nucleotide Polymorphisms.

    PubMed

    Pérez-Portela, R; Bumford, A; Coffman, B; Wedelich, S; Davenport, M; Fogg, A; Swenarton, M K; Coleman, F; Johnston, M A; Crawford, D L; Oleksiak, M F

    2018-03-22

    Despite the devastating impact of the lionfish (Pterois volitans) invasion on NW Atlantic ecosystems, little genetic information about the invasion process is available. We applied Genotyping by Sequencing techniques to identify 1,220 single nucleotide polymorphic sites (SNPs) from 162 lionfish samples collected between 2013 and 2015 from two areas chronologically identified as the first and last invaded areas in US waters: the east coast of Florida and the Gulf of Mexico. We used population genomic analyses, including phylogenetic reconstruction, Bayesian clustering, genetic distances, Discriminant Analyses of Principal Components, and coalescence simulations for detection of outlier SNPs, to understand genetic trends relevant to the lionfish's long-term persistence. We found no significant differences in genetic structure or diversity between the two areas (F ST p-values > 0.01, and t-test p-values > 0.05). In fact, our genomic analyses showed genetic homogeneity, with enough gene flow between the east coast of Florida and Gulf of Mexico to erase previous signals of genetic divergence detected between these areas, secondary spreading, and bottlenecks in the Gulf of Mexico. These findings suggest rapid genetic changes over space and time during the invasion, resulting in one panmictic population with no signs of divergence between areas due to local adaptation.

  14. Association of the IL4R single-nucleotide polymorphism I50V with recurrent spontaneous abortion (RSA).

    PubMed

    Tavasolian, Fataneh; Abdollahi, Elham; Samadi, Morteza

    2014-07-01

    Recurrent spontaneous abortion (RSA) is defined as three or more consecutive abortions before the 20th week of gestation. There is increasing evidence to support an immunological mechanism for the occurrence of RSA. The purpose of our study was to examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, recurrent spontaneous abortion. This is a case-control study. We recruited 200 patients with RSA (case group) using established diagnostic criteria and 200, normal individuals (control group) at the fertility and infertility center in Yazd city and Isfahan city during 2012 to 2013. We screened the I50V variant in IL-4R in patients and controls by PCR-RFLF method, and we performed an association analysis between I50V variant and RSA.the data was analyzed by spss 16 software using Chi-square test. No differences in the genotype and allele frequencies of the I50V SNPs were identified between patients with RSA and healthy controls. The frequency of SNP in IL-4 receptor (I50V) in patients with recurrent spontaneous abortion did not differ significantly compared with the control group. Analysis of IL4R SNP haplotypes or complex alleles suggested no dominant protection in patients with RSA.

  15. Single Nucleotide Polymorphism Array Analysis of Bone Marrow Failure Patients Reveals Characteristic Patterns of Genetic Changes

    PubMed Central

    Babushok, Daria V.; Xie, Hongbo M.; Roth, Jacquelyn J.; Perdigones, Nieves; Olson, Timothy S.; Cockroft, Joshua D.; Gai, Xiaowu; Perin, Juan C.; Li, Yimei; Paessler, Michele E.; Hakonarson, Hakon; Podsakoff, Gregory M.; Mason, Philip J.; Biegel, Jaclyn A.; Bessler, Monica

    2013-01-01

    Summary The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12.2, p<0.01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. PMID:24116929

  16. Single nucleotide polymorphism array analysis of bone marrow failure patients reveals characteristic patterns of genetic changes.

    PubMed

    Babushok, Daria V; Xie, Hongbo M; Roth, Jacquelyn J; Perdigones, Nieves; Olson, Timothy S; Cockroft, Joshua D; Gai, Xiaowu; Perin, Juan C; Li, Yimei; Paessler, Michele E; Hakonarson, Hakon; Podsakoff, Gregory M; Mason, Philip J; Biegel, Jaclyn A; Bessler, Monica

    2014-01-01

    The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12·2, P < 0·01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. © 2013 John Wiley & Sons Ltd.

  17. ToNER: A tool for identifying nucleotide enrichment signals in feature-enriched RNA-seq data.

    PubMed

    Promworn, Yuttachon; Kaewprommal, Pavita; Shaw, Philip J; Intarapanich, Apichart; Tongsima, Sissades; Piriyapongsa, Jittima

    2017-01-01

    Biochemical methods are available for enriching 5' ends of RNAs in prokaryotes, which are employed in the differential RNA-seq (dRNA-seq) and the more recent Cappable-seq protocols. Computational methods are needed to locate RNA 5' ends from these data by statistical analysis of the enrichment. Although statistical-based analysis methods have been developed for dRNA-seq, they may not be suitable for Cappable-seq data. The more efficient enrichment method employed in Cappable-seq compared with dRNA-seq could affect data distribution and thus algorithm performance. We present Transformation of Nucleotide Enrichment Ratios (ToNER), a tool for statistical modeling of enrichment from RNA-seq data obtained from enriched and unenriched libraries. The tool calculates nucleotide enrichment scores and determines the global transformation for fitting to the normal distribution using the Box-Cox procedure. From the transformed distribution, sites of significant enrichment are identified. To increase power of detection, meta-analysis across experimental replicates is offered. We tested the tool on Cappable-seq and dRNA-seq data for identifying Escherichia coli transcript 5' ends and compared the results with those from the TSSAR tool, which is designed for analyzing dRNA-seq data. When combining results across Cappable-seq replicates, ToNER detects more known transcript 5' ends than TSSAR. In general, the transcript 5' ends detected by ToNER but not TSSAR occur in regions which cannot be locally modeled by TSSAR. ToNER uses a simple yet robust statistical modeling approach, which can be used for detecting RNA 5'ends from Cappable-seq data, in particular when combining information from experimental replicates. The ToNER tool could potentially be applied for analyzing other RNA-seq datasets in which enrichment for other structural features of RNA is employed. The program is freely available for download at ToNER webpage (http://www4a.biotec.or.th/GI/tools/toner) and Git

  18. ToNER: A tool for identifying nucleotide enrichment signals in feature-enriched RNA-seq data

    PubMed Central

    Promworn, Yuttachon; Kaewprommal, Pavita; Shaw, Philip J.; Intarapanich, Apichart; Tongsima, Sissades

    2017-01-01

    Background Biochemical methods are available for enriching 5′ ends of RNAs in prokaryotes, which are employed in the differential RNA-seq (dRNA-seq) and the more recent Cappable-seq protocols. Computational methods are needed to locate RNA 5′ ends from these data by statistical analysis of the enrichment. Although statistical-based analysis methods have been developed for dRNA-seq, they may not be suitable for Cappable-seq data. The more efficient enrichment method employed in Cappable-seq compared with dRNA-seq could affect data distribution and thus algorithm performance. Results We present Transformation of Nucleotide Enrichment Ratios (ToNER), a tool for statistical modeling of enrichment from RNA-seq data obtained from enriched and unenriched libraries. The tool calculates nucleotide enrichment scores and determines the global transformation for fitting to the normal distribution using the Box-Cox procedure. From the transformed distribution, sites of significant enrichment are identified. To increase power of detection, meta-analysis across experimental replicates is offered. We tested the tool on Cappable-seq and dRNA-seq data for identifying Escherichia coli transcript 5′ ends and compared the results with those from the TSSAR tool, which is designed for analyzing dRNA-seq data. When combining results across Cappable-seq replicates, ToNER detects more known transcript 5′ ends than TSSAR. In general, the transcript 5′ ends detected by ToNER but not TSSAR occur in regions which cannot be locally modeled by TSSAR. Conclusion ToNER uses a simple yet robust statistical modeling approach, which can be used for detecting RNA 5′ends from Cappable-seq data, in particular when combining information from experimental replicates. The ToNER tool could potentially be applied for analyzing other RNA-seq datasets in which enrichment for other structural features of RNA is employed. The program is freely available for download at ToNER webpage (http://www4a

  19. Association of PTPN22 Single Nucleotide Polymorphisms with Celiac Disease.

    PubMed

    Aflatounian, Majid; Rezaei, Arezou; Sadr, Maryam; Saghazadeh, Amene; Elhamian, Nazanin; Sadeghi, Hengameh; Motevasselian, Fatemeh; Farahmand, Fatemeh; Fallahi, Gholamhossein; Motamed, Farzaneh; Najafi, Mehri; Rezaei, Nima

    2017-06-01

    Celiac disease is a chronic autoimmune disease in which gene-environment interactions cause the immune system to unfavorably react to naturally gluten-containing foods. PTPN22 plays a crucial role in regulating the function of various cells of the immune system, particularly T cells. Polymorphisms of the PTPN22 gene have been associated with many autoimmune diseases. The present genetic association study was conducted to investigate the possible associations between PTPNTT single nucleotide polymorphisms (SNPs) and celiac disease in an Iranian population. The study population consisted of 45 patients with celiac disease and 93 healthy controls. The study genotyped five SNPs of the PTPN22 gene: rs12760457, rs1310182, rs1217414, rs33996649, and rs2476601. Control and patient groups did not differ on the genotype distribution of four of five investigated SNPs in the PTPN22 gene, for example, rs12760457, rs2476601, rs1217414, and rs33996649. The only investigated PTPN22 variant, which could be associated with CD, was rs1310182. A significant increase in the carriage of the T allele of rs1310182 in CD patients was observed (OR (95% CI) = 11.42 (5.41, 24.1), p value < 0.0001). The TT genotype of this SNP was significantly associated with celiac disease. Our study suggests that the rs1310182 SNP of PTPN22 gene may be a predisposing factor of celiac disease in the Iranian population. Further studies are required to investigate the issue in other racial and ethnic subgroups.

  20. QQ-SNV: single nucleotide variant detection at low frequency by comparing the quality quantiles.

    PubMed

    Van der Borght, Koen; Thys, Kim; Wetzels, Yves; Clement, Lieven; Verbist, Bie; Reumers, Joke; van Vlijmen, Herman; Aerssens, Jeroen

    2015-11-10

    Next generation sequencing enables studying heterogeneous populations of viral infections. When the sequencing is done at high coverage depth ("deep sequencing"), low frequency variants can be detected. Here we present QQ-SNV (http://sourceforge.net/projects/qqsnv), a logistic regression classifier model developed for the Illumina sequencing platforms that uses the quantiles of the quality scores, to distinguish true single nucleotide variants from sequencing errors based on the estimated SNV probability. To train the model, we created a dataset of an in silico mixture of five HIV-1 plasmids. Testing of our method in comparison to the existing methods LoFreq, ShoRAH, and V-Phaser 2 was performed on two HIV and four HCV plasmid mixture datasets and one influenza H1N1 clinical dataset. For default application of QQ-SNV, variants were called using a SNV probability cutoff of 0.5 (QQ-SNV(D)). To improve the sensitivity we used a SNV probability cutoff of 0.0001 (QQ-SNV(HS)). To also increase specificity, SNVs called were overruled when their frequency was below the 80(th) percentile calculated on the distribution of error frequencies (QQ-SNV(HS-P80)). When comparing QQ-SNV versus the other methods on the plasmid mixture test sets, QQ-SNV(D) performed similarly to the existing approaches. QQ-SNV(HS) was more sensitive on all test sets but with more false positives. QQ-SNV(HS-P80) was found to be the most accurate method over all test sets by balancing sensitivity and specificity. When applied to a paired-end HCV sequencing study, with lowest spiked-in true frequency of 0.5%, QQ-SNV(HS-P80) revealed a sensitivity of 100% (vs. 40-60% for the existing methods) and a specificity of 100% (vs. 98.0-99.7% for the existing methods). In addition, QQ-SNV required the least overall computation time to process the test sets. Finally, when testing on a clinical sample, four putative true variants with frequency below 0.5% were consistently detected by QQ-SNV(HS-P80) from different

  1. Single nucleotide polymorphisms associated with thermoregulation in lactating dairy cows exposed to heat stress.

    PubMed

    Dikmen, S; Wang, X-z; Ortega, M S; Cole, J B; Null, D J; Hansen, P J

    2015-12-01

    Dairy cows with increased rectal temperature experience lower milk yield and fertility. Rectal temperature during heat stress is heritable, so genetic selection for body temperature regulation could reduce effects of heat stress on production. One aim of the study was to validate the relationship between genotype and heat tolerance for single nucleotide polymorphisms (SNPs) previously associated with resistance to heat stress. A second aim was to identify new SNPs associated with heat stress resistance. Thermotolerance was assessed in lactating Holsteins during the summer by measuring rectal temperature (a direct measurement of body temperature regulation; n = 435), respiration rate (an indirect measurement of body temperature regulation, n = 450) and sweating rate (the major evaporative cooling mechanism in cattle, n = 455). The association between genotype and thermotolerance was evaluated for 19 SNPs previously associated with rectal temperature from a genomewide analysis study (GWAS), four SNPs previously associated with change in milk yield during heat stress from GWAS, 2 candidate gene SNPs previously associated with rectal temperature and respiration rate during heat stress (ATPA1A and HSP70A) and 66 SNPs in genes previously shown to be associated with reproduction, production or health traits in Holsteins. For SNPs previously associated with heat tolerance, regions of BTA4, BTA6 and BTA24 were associated with rectal temperature; regions of BTA6 and BTA24 were associated with respiration rate; and regions of BTA5, BTA26 and BTA29 were associated with sweating rate. New SNPs were identified for rectal temperature (n = 12), respiration rate (n = 8) and sweating rate (n = 3) from among those previously associated with production, reproduction or health traits. The SNP that explained the most variation were PGR and ASL for rectal temperature, ACAT2 and HSD17B7 for respiration rate, and ARL6IP1 and SERPINE2 for sweating rate. ARL6IP1 was associated with all three

  2. Integrating multiple genomic data to predict disease-causing nonsynonymous single nucleotide variants in exome sequencing studies.

    PubMed

    Wu, Jiaxin; Li, Yanda; Jiang, Rui

    2014-03-01

    Exome sequencing has been widely used in detecting pathogenic nonsynonymous single nucleotide variants (SNVs) for human inherited diseases. However, traditional statistical genetics methods are ineffective in analyzing exome sequencing data, due to such facts as the large number of sequenced variants, the presence of non-negligible fraction of pathogenic rare variants or de novo mutations, and the limited size of affected and normal populations. Indeed, prevalent applications of exome sequencing have been appealing for an effective computational method for identifying causative nonsynonymous SNVs from a large number of sequenced variants. Here, we propose a bioinformatics approach called SPRING (Snv PRioritization via the INtegration of Genomic data) for identifying pathogenic nonsynonymous SNVs for a given query disease. Based on six functional effect scores calculated by existing methods (SIFT, PolyPhen2, LRT, MutationTaster, GERP and PhyloP) and five association scores derived from a variety of genomic data sources (gene ontology, protein-protein interactions, protein sequences, protein domain annotations and gene pathway annotations), SPRING calculates the statistical significance that an SNV is causative for a query disease and hence provides a means of prioritizing candidate SNVs. With a series of comprehensive validation experiments, we demonstrate that SPRING is valid for diseases whose genetic bases are either partly known or completely unknown and effective for diseases with a variety of inheritance styles. In applications of our method to real exome sequencing data sets, we show the capability of SPRING in detecting causative de novo mutations for autism, epileptic encephalopathies and intellectual disability. We further provide an online service, the standalone software and genome-wide predictions of causative SNVs for 5,080 diseases at http://bioinfo.au.tsinghua.edu.cn/spring.

  3. Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

    PubMed

    Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

    2017-02-01

    The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

  4. Prenatal Diagnosis of DNA Copy Number Variations by Genomic Single-Nucleotide Polymorphism Array in Fetuses with Congenital Heart Defects.

    PubMed

    Tang, Shaohua; Lv, Jiaojiao; Chen, Xiangnan; Bai, Lili; Li, Huanzheng; Chen, Chong; Wang, Ping; Xu, Xueqin; Lu, Jianxin

    2016-01-01

    To evaluate the usefulness of single-nucleotide polymorphism (SNP) array for prenatal genetic diagnosis of congenital heart defect (CHD), we used this approach to detect clinically significant copy number variants (CNVs) in fetuses with CHDs. A HumanCytoSNP-12 array was used to detect genomic samples obtained from 39 fetuses that exhibited cardiovascular abnormalities on ultrasound and had a normal karyotype. The relationship between CNVs and CHDs was identified by using genotype-phenotype comparisons and searching of chromosomal databases. All clinically significant CNVs were confirmed by real-time PCR. CNVs were detected in 38/39 (97.4%) fetuses: variants of unknown significance were detected in 2/39 (5.1%), and clinically significant CNVs were identified in 7/39 (17.9%). In 3 of the 7 fetuses with clinically significant CNVs, 3 rare and previously undescribed CNVs were detected, and these CNVs encompassed the CHD candidate genes FLNA (Xq28 dup), BCOR (Xp11.4 dup), and RBL2 (16q12.2 del). Compared with conventional cytogenetic genomics, SNP array analysis provides significantly improved detection of submicroscopic genomic aberrations in pregnancies with CHDs. Based on these results, we propose that genomic SNP array is an effective method which could be used in the prenatal diagnostic test to assist genetic counseling for pregnancies with CHDs. © 2015 S. Karger AG, Basel.

  5. Direct activation of the olfactory cyclic nucleotide-gated channel through modification of sulfhydryl groups by NO compounds.

    PubMed

    Broillet, M C; Firestein, S

    1996-02-01

    The activation of a cyclic nucleotide-gated channel is the final step in sensory transduction in olfaction. Normally, this channel is opened by the intracellular cyclic nucleotide second messenger cAMP or cGMP. However, in single channel recordings we found that donors of nitric oxide, a putative intercellular messenger, could directly activate the native olfactory neuron channel. Its action was independent of the presence of the normal ligand and did not involve the cyclic nucleotide binding site, suggesting an alternate site on the molecule that is critical in channel gating. The biochemical pathway appears to utilize nitric oxide in one of its alternate redox states, the nitrosonium ion, transnitrosylating a free sulfhydryl group belonging to a cysteine residue tentatively identified as being in the region linking the S6 transmembrane domain to the ligand binding domain.

  6. N-acetyltransferase single nucleotide polymorphisms: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine

    PubMed Central

    Hein, David W.

    2009-01-01

    Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125

  7. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  8. SNPHunter: a bioinformatic software for single nucleotide polymorphism data acquisition and management.

    PubMed

    Wang, Lin; Liu, Simin; Niu, Tianhua; Xu, Xin

    2005-03-18

    Single nucleotide polymorphisms (SNPs) provide an important tool in pinpointing susceptibility genes for complex diseases and in unveiling human molecular evolution. Selection and retrieval of an optimal SNP set from publicly available databases have emerged as the foremost bottlenecks in designing large-scale linkage disequilibrium studies, particularly in case-control settings. We describe the architectural structure and implementations of a novel software program, SNPHunter, which allows for both ad hoc-mode and batch-mode SNP search, automatic SNP filtering, and retrieval of SNP data, including physical position, function class, flanking sequences at user-defined lengths, and heterozygosity from NCBI dbSNP. The SNP data extracted from dbSNP via SNPHunter can be exported and saved in plain text format for further down-stream analyses. As an illustration, we applied SNPHunter for selecting SNPs for 10 major candidate genes for type 2 diabetes, including CAPN10, FABP4, IL6, NOS3, PPARG, TNF, UCP2, CRP, ESR1, and AR. SNPHunter constitutes an efficient and user-friendly tool for SNP screening, selection, and acquisition. The executable and user's manual are available at http://www.hsph.harvard.edu/ppg/software.htm

  9. Measurement of nucleotide exchange rate constants in single rabbit soleus myofibrils during shortening and lengthening using a fluorescent ATP analog.

    PubMed Central

    Shirakawa, I; Chaen, S; Bagshaw, C R; Sugi, H

    2000-01-01

    The kinetics of displacement of a fluorescent nucleotide, 2'(3')-O-[N[2-[[Cy3]amido]ethyl]carbamoyl]-adenosine 5'-triphosphate (Cy3-EDA-ATP), bound to rabbit soleus muscle myofibrils were studied using flash photolysis of caged ATP. Use of myofibrils from this slow twitch muscle allowed better resolution of the kinetics of nucleotide exchange than previous studies with psoas muscle myofibrils (, Biophys. J. 73:2033-2042). Soleus myofibrils in the presence of Cy3-EDA-nucleotides (Cy3-EDA-ATP or Cy3-EDA-ADP) showed selective fluorescence staining of the A-band. The K(m) for Cy3-EDA-ATP and the K(d) for Cy3-EDA-ADP binding to the myofibril A-band were 1.9 microM and 3.8 microM, respectively, indicating stronger binding of nucleotide to soleus cross-bridges compared to psoas cross-bridges (2.6 microM and 50 microM, respectively). After flash photolysis of caged ATP, the A-band fluorescence of the myofibril in the Cy3-EDA-ATP solution under isometric conditions decayed exponentially with a rate constant of 0.045 +/- 0.007 s(-1) (n = 32) at 10 degrees C, which was about seven times slower than that for psoas myofibrils. When a myofibril was allowed to shorten with a constant velocity, the nucleotide displacement rate constant increased from 0.066 s(-1) (isometric) to 0.14 s(-1) at 20 degrees C with increasing shortening velocity up to 0.1 myofibril length/s (V(max), the shortening velocity under no load was approximately 0. 2 myofibril lengths/s). The rate constant was not significantly affected by an isovelocity stretch of up to 0.1 myofibril lengths/s. These results suggest that the cross-bridge kinetics are not significantly affected at higher strain during lengthening but depend on the lower strain during shortening. These data also indicate that the interaction distance between a cross-bridge and the actin filament is at least 16 nm for a single cycle of the ATPase. PMID:10653804

  10. Integrated analyses using RNA-Seq data reveal viral genomes, single nucleotide variations, the phylogenetic relationship, and recombination for Apple stem grooving virus.

    PubMed

    Jo, Yeonhwa; Choi, Hoseong; Kim, Sang-Min; Kim, Sun-Lim; Lee, Bong Choon; Cho, Won Kyong

    2016-08-09

    Next-generation sequencing (NGS) provides many possibilities for plant virology research. In this study, we performed integrated analyses using plant transcriptome data for plant virus identification using Apple stem grooving virus (ASGV) as an exemplar virus. We used 15 publicly available transcriptome libraries from three different studies, two mRNA-Seq studies and a small RNA-Seq study. We de novo assembled nearly complete genomes of ASGV isolates Fuji and Cuiguan from apple and pear transcriptomes, respectively, and identified single nucleotide variations (SNVs) of ASGV within the transcriptomes. We demonstrated the application of NGS raw data to confirm viral infections in the plant transcriptomes. In addition, we compared the usability of two de novo assemblers, Trinity and Velvet, for virus identification and genome assembly. A phylogenetic tree revealed that ASGV and Citrus tatter leaf virus (CTLV) are the same virus, which was divided into two clades. Recombination analyses identified six recombination events from 21 viral genomes. Taken together, our in silico analyses using NGS data provide a successful application of plant transcriptomes to reveal extensive information associated with viral genome assembly, SNVs, phylogenetic relationships, and genetic recombination.

  11. Electrochemical primer extension based on polyoxometalate electroactive labels for multiplexed detection of single nucleotide polymorphisms.

    PubMed

    Chahin, Nassif; Uribe, Laura A; Debela, Ahmed M; Thorimbert, Serge; Hasenknopf, Bernold; Ortiz, Mayreli; Katakis, Ioannis; O'Sullivan, Ciara K

    2018-06-07

    Polyoxymetalates (POMs) ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ) were used to modify dideoxynucleotides (ddNTPs) through amide bond formation, and applied to the multiplexed detection of single nucleotide polymorphisms (SNPs) in an electrochemical primer extension reaction. Each gold electrode of an array was functionalised with a short single stranded thiolated DNA probe, specifically designed to extend with the POM-ddNTP at the SNP site to be interrogated. The system was applied to the simultaneous detection of 4 SNPs within a single stranded 103-mer model target generated using asymmetric PCR, highlighting the potential of POM-ddNTPs for targeted, multiplexed SNP detection. The four DNA bases were successfully labelled with both ([SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- and [P 2 W 17 O 61 {Sn(CH 2 ) 2 CO)}] 6- ), and [SiW 11 O 39 {Sn(CH 2 ) 2 CO)}] 4- demonstrated to be the more suitable due to its single oxidation peak, which provides an unequivocal signal. The POM-ddNTP enzymatically incorporated to the DNA anchored to the surface was visualised by AFM using gold coated mica. The developed assay has been demonstrated to be highly reproducible, simple to carry out and with very low non-specific background signals. Future work will focus on applying the developed platform to the detection of SNPs associated with rifampicin resistance in real samples from patients suffering from tuberculosis. Copyright © 2018. Published by Elsevier B.V.

  12. Rhabdomyolysis After Out-of-Water Exercise in an Elite Adolescent Water Polo Player Carrying the IL-6 174C Allele Single-Nucleotide Polymorphism.

    PubMed

    Eliakim, Alon; Ben Zaken, Sigal; Meckel, Yoav; Yamin, Chen; Dror, Nitzan; Nemet, Dan

    2015-12-01

    We present an adolescent elite water polo player who despite a genetic predisposition to develop exercise-induced severe muscle damage due to carrying the IL-6 174C allele single-nucleotide polymorphism, developed acute rhabdomyolysis only after a vigorous out-of-water training, suggesting that water polo training may be more suitable for genetically predisposed athletes.

  13. Detection of mandarin in orange juice by single-nucleotide polymorphism qPCR assay.

    PubMed

    Aldeguer, Miriam; López-Andreo, María; Gabaldón, José A; Puyet, Antonio

    2014-02-15

    A dual-probe real time PCR (qPCR) DNA-based analysis was devised for the identification of mandarin in orange juice. A single nucleotide polymorphism at the trnL-trnF intergenic region of the chloroplast chromosome was confirmed in nine orange (Citrus sinensis) and thirteen commercial varieties of mandarin, including Citrus reticulata and Citrus unshiu species and a mandarin × tangelo hybrid. Two short minor-groove binding fluorescent probes targeting the polymorphic sequence were used in the dual-probe qPCR, which allowed the detection of both species in single-tube reactions. The similarity of PCR efficiencies allowed a simple estimation of the ratio mandarin/orange in the juice samples, which correlated to the measured difference of threshold cycle values for both probes. The limit of detection of the assay was 5% of mandarin in orange juice, both when the juice was freshly prepared (not from concentrate) or reconstituted from concentrate, which would allow the detection of fraudulently added mandarin juice. The possible use of the dual-probe system for quantitative measurements was also tested on fruit juice mixtures. qPCR data obtained from samples containing equal amounts of mandarin and orange juice revealed that the mandarin target copy number was approximately 2.6-fold higher than in orange juice. The use of a matrix-adapted control as calibrator to compensate the resulting C(T) bias allowed accurate quantitative measurements to be obtained. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Pan-genome multilocus sequence typing and outbreak-specific reference-based single nucleotide polymorphism analysis to resolve two concurrent Staphylococcus aureus outbreaks in neonatal services.

    PubMed

    Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P

    2016-06-01

    We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  15. First High-Density Linkage Map and Single Nucleotide Polymorphisms Significantly Associated With Traits of Economic Importance in Yellowtail Kingfish Seriola lalandi.

    PubMed

    Nguyen, Nguyen H; Rastas, Pasi M A; Premachandra, H K A; Knibb, Wayne

    2018-01-01

    The genetic resources available for the commercially important fish species Yellowtail kingfish (YTK) ( Seriola lalandi) are relative sparse. To overcome this, we aimed (1) to develop a linkage map for this species, and (2) to identify markers/variants associated with economically important traits in kingfish (with an emphasis on body weight). Genetic and genomic analyses were conducted using 13,898 single nucleotide polymorphisms (SNPs) generated from a new high-throughput genotyping by sequencing platform, Diversity Arrays Technology (DArTseq TM ) in a pedigreed population comprising 752 animals. The linkage analysis enabled to map about 4,000 markers to 24 linkage groups (LGs), with an average density of 3.4 SNPs per cM. The linkage map was integrated into a genome-wide association study (GWAS) and identified six variants/SNPs associated with body weight ( P < 5e -8 ) when a multi-locus mixed model was used. Two out of the six significant markers were mapped to LGs 17 and 23, and collectively they explained 5.8% of the total genetic variance. It is concluded that the newly developed linkage map and the significantly associated markers with body weight provide fundamental information to characterize genetic architecture of growth-related traits in this population of YTK S. lalandi .

  16. The low single nucleotide polymorphism heritability of plasma and saliva cortisol levels.

    PubMed

    Neumann, Alexander; Direk, Nese; Crawford, Andrew A; Mirza, Saira; Adams, Hieab; Bolton, Jennifer; Hayward, Caroline; Strachan, David P; Payne, Erin K; Smith, Jennifer A; Milaneschi, Yuri; Penninx, Brenda; Hottenga, Jouke J; de Geus, Eco; Oldehinkel, Albertine J; van der Most, Peter J; de Rijke, Yolanda; Walker, Brian R; Tiemeier, Henning

    2017-11-01

    Cortisol is an important stress hormone affected by a variety of biological and environmental factors, such as the circadian rhythm, exercise and psychological stress. Cortisol is mostly measured using blood or saliva samples. A number of genetic variants have been found to contribute to cortisol levels with these methods. While the effects of several specific single genetic variants is known, the joint genome-wide contribution to cortisol levels is unclear. Our aim was to estimate the amount of cortisol variance explained by common single nucleotide polymorphisms, i.e. the SNP heritability, using a variety of cortisol measures, cohorts and analysis approaches. We analyzed morning plasma (n=5705) and saliva levels (n=1717), as well as diurnal saliva levels (n=1541), in the Rotterdam Study using genomic restricted maximum likelihood estimation. Additionally, linkage disequilibrium score regression was fitted on the results of genome-wide association studies (GWAS) performed by the CORNET consortium on morning plasma cortisol (n=12,597) and saliva cortisol (n=7703). No significant SNP heritability was detected for any cortisol measure, sample or analysis approach. Point estimates ranged from 0% to 9%. Morning plasma cortisol in the CORNET cohorts, the sample with the most power, had a 6% [95%CI: 0-13%] SNP heritability. The results consistently suggest a low SNP heritability of these acute and short-term measures of cortisol. The low SNP heritability may reflect the substantial environmental and, in particular, situational component of these cortisol measures. Future GWAS will require very large sample sizes. Alternatively, more long-term cortisol measures such as hair cortisol samples are needed to discover further genetic pathways regulating cortisol concentrations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Simultaneous determination of nucleotide sugars with ion-pair reversed-phase HPLC.

    PubMed

    Nakajima, Kazuki; Kitazume, Shinobu; Angata, Takashi; Fujinawa, Reiko; Ohtsubo, Kazuaki; Miyoshi, Eiji; Taniguchi, Naoyuki

    2010-07-01

    Nucleotide sugars are important in determining cell surface glycoprotein glycosylation, which can modulate cellular properties such as growth and arrest. We have developed a conventional HPLC method for simultaneous determination of nucleotide sugars. A mixture of nucleotide sugars (CMP-NeuAc, UDP-Gal, UDP-Glc, UDP-GalNAc, UDP-GlcNAc, GDP-Man, GDP-Fuc and UDP-GlcUA) and relevant nucleotides were perfectly separated in an optimized ion-pair reversed-phase mode using Inertsil ODS-4 and ODS-3 columns. The newly developed method enabled us to determine the nucleotide sugars in cellular extracts from 1 x 10(6) cells in a single run. We applied this method to characterize nucleotide sugar levels in breast and pancreatic cancer cell lines and revealed that the abundance of UDP-GlcNAc, UDP-GalNAc, UDP-GlcUA and GDP-Fuc were a cell-type-specific feature. To determine the physiological significance of changes in nucleotide sugar levels, we analyzed their changes by glucose deprivation and found that the determination of nucleotide sugar levels provided us with valuable information with respect to studying the overview of cellular glycosylation status.

  18. Kaposi's Sarcoma-Associated Herpesvirus MicroRNA Single-Nucleotide Polymorphisms Identified in Clinical Samples Can Affect MicroRNA Processing, Level of Expression, and Silencing Activity

    PubMed Central

    Han, Soo-Jin; Marshall, Vickie; Barsov, Eugene; Quiñones, Octavio; Ray, Alex; Labo, Nazzarena; Trivett, Matthew; Ott, David; Renne, Rolf

    2013-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) encodes 12 pre-microRNAs that can produce 25 KSHV mature microRNAs. We previously reported single-nucleotide polymorphisms (SNPs) in KSHV-encoded pre-microRNA and mature microRNA sequences from clinical samples (V. Marshall et al., J. Infect. Dis., 195:645–659, 2007). To determine whether microRNA SNPs affect pre-microRNA processing and, ultimately, mature microRNA expression levels, we performed a detailed comparative analysis of (i) mature microRNA expression levels, (ii) in vitro Drosha/Dicer processing, and (iii) RNA-induced silencing complex-dependent targeting of wild-type (wt) and variant microRNA genes. Expression of pairs of wt and variant pre-microRNAs from retroviral vectors and measurement of KSHV mature microRNA expression by real-time reverse transcription-PCR (RT-PCR) revealed differential expression levels that correlated with the presence of specific sequence polymorphisms. Measurement of KSHV mature microRNA expression in a panel of primary effusion lymphoma cell lines by real-time RT-PCR recapitulated some observed expression differences but suggested a more complex relationship between sequence differences and expression of mature microRNA. Furthermore, in vitro maturation assays demonstrated significant SNP-associated changes in Drosha/DGCR8 and/or Dicer processing. These data demonstrate that SNPs within KSHV-encoded pre-microRNAs are associated with differential microRNA expression levels. Given the multiple reports on the involvement of microRNAs in cancer, the biological significance of these phenotypic and genotypic variants merits further studies in patients with KSHV-associated malignancies. PMID:24006441

  19. Replication of endometriosis-associated single-nucleotide polymorphisms from genome-wide association studies in a Caucasian population.

    PubMed

    Sundqvist, J; Xu, H; Vodolazkaia, A; Fassbender, A; Kyama, C; Bokor, A; Gemzell-Danielsson, K; D'Hooghe, T M; Falconer, H

    2013-03-01

    Is it possible to replicate the previously identified genetic association of four single-nucleotide polymorphisms (SNPs), rs12700667, rs7798431, rs1250248 and rs7521902, with endometriosis in a Caucasian population? A borderline association was observed for rs1250248 and endometriosis (P = 0.049). However, we could not replicate the other previously identified endometriosis-associated SNPs (rs12700667, rs7798431 and rs7521902) in the same population. Endometriosis is considered a complex disease, influenced by several genetic and environmental factors, as well as interactions between them. Previous studies have found genetic associations with endometriosis for SNPs at the 7p15 and 2q35 loci in a Caucasian population. Allele frequencies of SNPs were investigated in patients with endometriosis and controls. Blood samples and peritoneal biopsies were taken from a Caucasian female population consisting of 1129 patients with endometriosis and 831 controls. DNA was extracted for genotyping. The study was performed at a University hospital and research laboratories. A weak association with endometriosis (all stages) was observed for rs1250248 (P = 0.049). No significant associations were observed for the SNPs rs12700667, rs7798431 and rs7521902. A non-significant trend towards the association of rs1250248 with moderate/severe endometriosis was observed (odds ratio 1.18, 95% confidence interval 0.97-1.44). The inability to confirm all previous findings may result from differences between populations and type II errors. Our result demonstrates the difficulty of identifying common genetic variants in complex diseases. This study was supported by grants from the Karolinska Institutet and Stockholm City County/Karolinska Institutet (ALF), Stockholm, Sweden, Swedish Medical Research Council (K2007-54X-14212-06-3, K2010-54X-14212-09-3), Stockholm, Sweden, Leuven University Research Council (Onderzoeksraad KU Leuven), the Leuven University Hospitals Clinical Research Foundation

  20. Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

    PubMed

    Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

    2017-03-01

    Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

  1. Gut metagenomes of type 2 diabetic patients have characteristic single-nucleotide polymorphism distribution in Bacteroides coprocola.

    PubMed

    Chen, Yaowen; Li, Zongcheng; Hu, Shuofeng; Zhang, Jian; Wu, Jiaqi; Shao, Ningsheng; Bo, Xiaochen; Ni, Ming; Ying, Xiaomin

    2017-02-01

    Gut microbes play a critical role in human health and disease, and researchers have begun to characterize their genomes, the so-called gut metagenome. Thus far, metagenomics studies have focused on genus- or species-level composition and microbial gene sets, while strain-level composition and single-nucleotide polymorphism (SNP) have been overlooked. The gut metagenomes of type 2 diabetes (T2D) patients have been found to be enriched with butyrate-producing bacteria and sulfate reduction functions. However, it is not known whether the gut metagenomes of T2D patients have characteristic strain patterns or SNP distributions. We downloaded public gut metagenome datasets from 170 T2D patients and 174 healthy controls and performed a systematic comparative analysis of their metagenome SNPs. We found that Bacteroides coprocola, whose relative abundance did not differ between the groups, had a characteristic distribution of SNPs in the T2D patient group. We identified 65 genes, all in B. coprocola, that had remarkably different enrichment of SNPs. The first and sixth ranked genes encode glycosyl hydrolases (GenBank accession EDU99824.1 and EDV02301.1). Interestingly, alpha-glucosidase, which is also a glycosyl hydrolase located in the intestine, is an important drug target of T2D. These results suggest that different strains of B. coprocola may have different roles in human gut and a specific set of B. coprocola strains are correlated with T2D.

  2. Single nucleotide polymorphism in IL1B is associated with infection risk in paediatric acute myeloid leukaemia.

    PubMed

    Sung, L; Dix, D; Cellot, S; Gillmeister, B; Ethier, M C; Roslin, N M; Johnston, D L; Feusner, J; Mitchell, D; Lewis, V; Aplenc, R; Yanofsky, R; Portwine, C; Price, V; Zelcer, S; Silva, M; Bowes, L; Michon, B; Stobart, K; Traubici, J; Allen, U; Beyene, J; den Hollander, N; Paterson, A D

    2016-06-01

    We evaluated single nucleotide polymorphisms (SNPs) associated with infection risk in children with newly diagnosed acute myeloid leukaemia (AML). We conducted a multicentre, prospective cohort study that included children aged ≤18 years with de novo AML. DNA was isolated from blood lymphocytes or buccal swabs, and candidate gene SNP analysis was conducted. Primary outcome was the occurrence of microbiologically documented sterile site infection during chemotherapy. Secondary outcomes were Gram-positive and -negative infections, viridans group streptococcal infection and proven/probable invasive fungal infection. Interpretation was guided by consistency in risk alleles and microbiologic agent with previous literature. Over the study period 254 children and adolescents with AML were enrolled. Overall, 190 (74.8%) had at least one sterile site microbiologically documented infection. Among the 172 with inferred European ancestry and DNA available, nine significant associations were observed; two were consistent with previous literature. Allele A at IL1B (rs16944) was associated with decreased microbiologically documented infection, and allele G at IL10 (rs1800896) was associated with increased risk of Gram-positive infection. We identified SNPs associated with infection risk in paediatric AML. Genotype may provide insight into mechanisms of infection risk that could be used for supportive-care novel treatments. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  3. Chosen single nucleotide polymorphisms (SNPs) of enamel formation genes and dental caries in a population of Polish children.

    PubMed

    Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał

    2017-09-01

    It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p < 0.0001), rs34538475 in AMBN (p < 0.0001), rs2337360 in TUFT1 (p < 0.0001), and rs2235091 (p = 0.0085) and rs198969 (p = 0.0069) in KLK4. Genotype and allele frequencies indicated both risk and protective variants for these markers. Single nucleotide polymorphisms in AMELX, AMBN, TUFT1, KLK4 genes may be considered as a risk factor for dental caries occurrence in Polish children.

  4. Single-nucleotide polymorphism in the human mu opioid receptor gene alters beta-endorphin binding and activity: possible implications for opiate addiction.

    PubMed

    Bond, C; LaForge, K S; Tian, M; Melia, D; Zhang, S; Borg, L; Gong, J; Schluger, J; Strong, J A; Leal, S M; Tischfield, J A; Kreek, M J; Yu, L

    1998-08-04

    Opioid drugs play important roles in the clinical management of pain, as well as in the development and treatment of drug abuse. The mu opioid receptor is the primary site of action for the most commonly used opioids, including morphine, heroin, fentanyl, and methadone. By sequencing DNA from 113 former heroin addicts in methadone maintenance and 39 individuals with no history of drug or alcohol abuse or dependence, we have identified five different single-nucleotide polymorphisms (SNPs) in the coding region of the mu opioid receptor gene. The most prevalent SNP is a nucleotide substitution at position 118 (A118G), predicting an amino acid change at a putative N-glycosylation site. This SNP displays an allelic frequency of approximately 10% in our study population. Significant differences in allele distribution were observed among ethnic groups studied. The variant receptor resulting from the A118G SNP did not show altered binding affinities for most opioid peptides and alkaloids tested. However, the A118G variant receptor binds beta-endorphin, an endogenous opioid that activates the mu opioid receptor, approximately three times more tightly than the most common allelic form of the receptor. Furthermore, beta-endorphin is approximately three times more potent at the A118G variant receptor than at the most common allelic form in agonist-induced activation of G protein-coupled potassium channels. These results show that SNPs in the mu opioid receptor gene can alter binding and signal transduction in the resulting receptor and may have implications for normal physiology, therapeutics, and vulnerability to develop or protection from diverse diseases including the addictive diseases.

  5. Discriminating a Single Nucleotide Difference for Enhanced miRNA Detection Using Tunable Graphene and Oligonucleotide Nanodevices.

    PubMed

    Robertson, Neil M; Hizir, Mustafa Salih; Balcioglu, Mustafa; Wang, Rui; Yavuz, Mustafa Selman; Yumak, Hasan; Ozturk, Birol; Sheng, Jia; Yigit, Mehmet V

    2015-09-15

    In this study we have reported our efforts to address some of the challenges in the detection of miRNAs using water-soluble graphene oxide and DNA nanoassemblies. Purposefully inserting mismatches at specific positions in our DNA (probe) strands shows increasing specificity against our target miRNA, miR-10b, over miR-10a which varies by only a single nucleotide. This increased specificity came at a loss of signal intensity within the system, but we demonstrated that this could be addressed with the use of DNase I, an endonuclease capable of cleaving the DNA strands of the RNA/DNA heteroduplex and recycling the RNA target to hybridize to another probe strand. As we previously demonstrated, this enzymatic signal also comes with an inherent activity of the enzyme on the surface-adsorbed probe strands. To remove this activity of DNase I and the steady nonspecific increase in the fluorescence signal without compromising the recovered signal, we attached a thermoresponsive PEGMA polymer (poly(ethylene glycol) methyl ether methacrylate) to nGO. This smart polymer is able to shield the probes adsorbed on the nGO surface from the DNase I activity and is capable of tuning the detection capacity of the nGO nanoassembly with a thermoswitch at 39 °C. By utilizing probes with multiple mismatches, DNase I cleavage of the DNA probe strands, and the attachment of PEGMA polymers to graphene oxide to block undesired DNase I activity, we were able to detect miR-10b from liquid biopsy mimics and breast cancer cell lines. Overall we have reported our efforts to improve the specificity, increase the sensitivity, and eliminate the undesired enzymatic activity of DNase I on surface-adsorbed probes for miR-10b detection using water-soluble graphene nanodevices. Even though we have demonstrated only the discrimination of miR-10b from miR-10a, our approach can be extended to other short RNA molecules which differ by a single nucleotide.

  6. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  7. Best practices for evaluating single nucleotide variant calling methods for microbial genomics

    PubMed Central

    Olson, Nathan D.; Lund, Steven P.; Colman, Rebecca E.; Foster, Jeffrey T.; Sahl, Jason W.; Schupp, James M.; Keim, Paul; Morrow, Jayne B.; Salit, Marc L.; Zook, Justin M.

    2015-01-01

    Innovations in sequencing technologies have allowed biologists to make incredible advances in understanding biological systems. As experience grows, researchers increasingly recognize that analyzing the wealth of data provided by these new sequencing platforms requires careful attention to detail for robust results. Thus far, much of the scientific Communit’s focus for use in bacterial genomics has been on evaluating genome assembly algorithms and rigorously validating assembly program performance. Missing, however, is a focus on critical evaluation of variant callers for these genomes. Variant calling is essential for comparative genomics as it yields insights into nucleotide-level organismal differences. Variant calling is a multistep process with a host of potential error sources that may lead to incorrect variant calls. Identifying and resolving these incorrect calls is critical for bacterial genomics to advance. The goal of this review is to provide guidance on validating algorithms and pipelines used in variant calling for bacterial genomics. First, we will provide an overview of the variant calling procedures and the potential sources of error associated with the methods. We will then identify appropriate datasets for use in evaluating algorithms and describe statistical methods for evaluating algorithm performance. As variant calling moves from basic research to the applied setting, standardized methods for performance evaluation and reporting are required; it is our hope that this review provides the groundwork for the development of these standards. PMID:26217378

  8. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  9. Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2010-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

  10. Hamiltonian identifiability assisted by single-probe measurement

    NASA Astrophysics Data System (ADS)

    Sone, Akira; Cappellaro, Paola; Quantum Engineering Group Team

    2017-04-01

    We study the Hamiltonian identifiability of a many-body spin- 1 / 2 system assisted by the measurement on a single quantum probe based on the eigensystem realization algorithm (ERA) approach employed in. We demonstrate a potential application of Gröbner basis to the identifiability test of the Hamiltonian, and provide the necessary experimental resources, such as the lower bound in the number of the required sampling points, the upper bound in total required evolution time, and thus the total measurement time. Focusing on the examples of the identifiability in the spin chain model with nearest-neighbor interaction, we classify the spin-chain Hamiltonian based on its identifiability, and provide the control protocols to engineer the non-identifiable Hamiltonian to be an identifiable Hamiltonian.

  11. Lack of replication of thirteen single-nucleotide polymorphisms implicated in Parkinson’s disease: a large-scale international study

    PubMed Central

    Elbaz, Alexis; Nelson, Lorene M; Payami, Haydeh; Ioannidis, John P A; Fiske, Brian K; Annesi, Grazia; Belin, Andrea Carmine; Factor, Stewart A; Ferrarese, Carlo; Hadjigeorgiou, Georgios M; Higgins, Donald S; Kawakami, Hideshi; Krüger, Rejko; Marder, Karen S; Mayeux, Richard P; Mellick, George D; Nutt, John G; Ritz, Beate; Samii, Ali; Tanner, Caroline M; Van Broeckhoven, Christine; Van Den Eeden, Stephen K; Wirdefeldt, Karin; Zabetian, Cyrus P; Dehem, Marie; Montimurro, Jennifer S; Southwick, Audrey; Myers, Richard M; Trikalinos, Thomas A

    2013-01-01

    Summary Background A genome-wide association study identified 13 single-nucleotide polymorphisms (SNPs) significantly associated with Parkinson’s disease. Small-scale replication studies were largely non-confirmatory, but a meta-analysis that included data from the original study could not exclude all SNP associations, leaving relevance of several markers uncertain. Methods Investigators from three Michael J Fox Foundation for Parkinson’s Research-funded genetics consortia—comprising 14 teams—contributed DNA samples from 5526 patients with Parkinson’s disease and 6682 controls, which were genotyped for the 13 SNPs. Most (88%) participants were of white, non-Hispanic descent. We assessed log-additive genetic effects using fixed and random effects models stratified by team and ethnic origin, and tested for heterogeneity across strata. A meta-analysis was undertaken that incorporated data from the original genome-wide study as well as subsequent replication studies. Findings In fixed and random-effects models no associations with any of the 13 SNPs were identified (odds ratios 0·89 to 1·09). Heterogeneity between studies and between ethnic groups was low for all SNPs. Subgroup analyses by age at study entry, ethnic origin, sex, and family history did not show any consistent associations. In our meta-analysis, no SNP showed significant association (summary odds ratios 0·95 to 1.08); there was little heterogeneity except for SNP rs7520966. Interpretation Our results do not lend support to the finding that the 13 SNPs reported in the original genome-wide association study are genetic susceptibility factors for Parkinson’s disease. PMID:17052658

  12. Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

    PubMed Central

    2015-01-01

    Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

  13. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale.

    PubMed

    Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun

    2015-01-01

    Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.

  14. Single nucleotide polymorphism discovery in cutthroat trout subspecies using genome reduction, barcoding, and 454 pyro-sequencing

    PubMed Central

    2012-01-01

    Background Salmonids are popular sport fishes, and as such have been subjected to widespread stocking throughout western North America. Historically, stocking was done with little regard for genetic variation among populations and has resulted in genetic mixing among species and subspecies in many areas, thus putting the genetic integrity of native salmonid populations at risk and creating a need to assess the genetic constitution of native salmonid populations. Cutthroat trout is a salmonid species with pronounced geographic structure (there are 10 extant subspecies) and a recent history of hybridization with introduced rainbow trout in many populations. Genetic admixture has also occurred among cutthroat trout subspecies in areas where introductions have brought two or more subspecies into contact. Consequently, management agencies have increased their efforts to evaluate the genetic composition of cutthroat trout populations to identify populations that remain uncompromised and manage them accordingly, but additional genetic markers are needed to do so effectively. Here we used genome reduction, MID-barcoding, and 454-pyrosequencing to discover single nucleotide polymorphisms that differentiate cutthroat trout subspecies and can be used as a rapid, cost-effective method to characterize the genetic composition of cutthroat trout populations. Results Thirty cutthroat and six rainbow trout individuals were subjected to genome reduction and next-generation sequencing. A total of 1,499,670 reads averaging 379 base pairs in length were generated by 454-pyrosequencing, resulting in 569,060,077 total base pairs sequenced. A total of 43,558 putative SNPs were identified, and of those, 125 SNP primers were developed that successfully amplified 96 cutthroat trout and rainbow trout individuals. These SNP loci were able to differentiate most cutthroat trout subspecies using distance methods and Structure analyses. Conclusions Genomic and bioinformatic protocols were

  15. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    PubMed

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  16. MAL73, a novel regulator of maltose fermentation, is functionally impaired by single nucleotide polymorphism in sake brewing yeast.

    PubMed

    Ohdate, Takumi; Omura, Fumihiko; Hatanaka, Haruyo; Zhou, Yan; Takagi, Masami; Goshima, Tetsuya; Akao, Takeshi; Ono, Eiichiro

    2018-01-01

    For maltose fermentation, budding yeast Saccharomyces cerevisiae operates a mechanism that involves transporters (MALT), maltases (MALS) and regulators (MALR) collectively known as MAL genes. However, functional relevance of MAL genes during sake brewing process remains largely elusive, since sake yeast is cultured under glucose-rich condition achieved by the co-culture partner Aspergillus spp.. Here we isolated an ethyl methane sulfonate (EMS)-mutagenized sake yeast strain exhibiting enhanced maltose fermentation compared to the parental strain. The mutant carried a single nucleotide insertion that leads to the extension of the C-terminal region of a previously uncharacterized MALR gene YPR196W-2, which was renamed as MAL73. Introduction of the mutant allele MAL73L with extended C-terminal region into the parental or other sake yeast strains enhanced the growth rate when fed with maltose as the sole carbon source. In contrast, disruption of endogenous MAL73 in the sake yeasts decreased the maltose fermentation ability of sake yeast, confirming that the original MAL73 functions as a MALR. Importantly, the MAL73L-expressing strain fermented more maltose in practical condition compared to the parental strain during sake brewing process. Our data show that MAL73(L) is a novel MALR gene that regulates maltose fermentation, and has been functionally attenuated in sake yeast by single nucleotide deletion during breeding history. Since the MAL73L-expressing strain showed enhanced ability of maltose fermentation, MAL73L might also be a valuable tool for enhancing maltose fermentation in yeast in general.

  17. Genome wide analysis reveals single nucleotide polymorphisms associated with fatness and putative novel copy number variants in three pig breeds

    PubMed Central

    2013-01-01

    Background Obesity, excess fat tissue in the body, can underlie a variety of medical complaints including heart disease, stroke and cancer. The pig is an excellent model organism for the study of various human disorders, including obesity, as well as being the foremost agricultural species. In order to identify genetic variants associated with fatness, we used a selective genomic approach sampling DNA from animals at the extreme ends of the fat and lean spectrum using estimated breeding values derived from a total population size of over 70,000 animals. DNA from 3 breeds (Sire Line Large White, Duroc and a white Pietrain composite line (Titan)) was used to interrogate the Illumina Porcine SNP60 Genotyping Beadchip in order to identify significant associations in terms of single nucleotide polymorphisms (SNPs) and copy number variants (CNVs). Results By sampling animals at each end of the fat/lean EBV (estimate breeding value) spectrum the whole population could be assessed using less than 300 animals, without losing statistical power. Indeed, several significant SNPs (at the 5% genome wide significance level) were discovered, 4 of these linked to genes with ontologies that had previously been correlated with fatness (NTS, FABP6, SST and NR3C2). Quantitative analysis of the data identified putative CNV regions containing genes whose ontology suggested fatness related functions (MCHR1, PPARα, SLC5A1 and SLC5A4). Conclusions Selective genotyping of EBVs at either end of the phenotypic spectrum proved to be a cost effective means of identifying SNPs and CNVs associated with fatness and with estimated major effects in a large population of animals. PMID:24225222

  18. HomSI: a homozygous stretch identifier from next-generation sequencing data.

    PubMed

    Görmez, Zeliha; Bakir-Gungor, Burcu; Sagiroglu, Mahmut Samil

    2014-02-01

    In consanguineous families, as a result of inheriting the same genomic segments through both parents, the individuals have stretches of their genomes that are homozygous. This situation leads to the prevalence of recessive diseases among the members of these families. Homozygosity mapping is based on this observation, and in consanguineous families, several recessive disease genes have been discovered with the help of this technique. The researchers typically use single nucleotide polymorphism arrays to determine the homozygous regions and then search for the disease gene by sequencing the genes within this candidate disease loci. Recently, the advent of next-generation sequencing enables the concurrent identification of homozygous regions and the detection of mutations relevant for diagnosis, using data from a single sequencing experiment. In this respect, we have developed a novel tool that identifies homozygous regions using deep sequence data. Using *.vcf (variant call format) files as an input file, our program identifies the majority of homozygous regions found by microarray single nucleotide polymorphism genotype data. HomSI software is freely available at www.igbam.bilgem.tubitak.gov.tr/softwares/HomSI, with an online manual.

  19. A novel canine model for Duchenne muscular dystrophy (DMD): single nucleotide deletion in DMD gene exon 20.

    PubMed

    Mata López, Sara; Hammond, James J; Rigsby, Madison B; Balog-Alvarez, Cynthia J; Kornegay, Joe N; Nghiem, Peter P

    2018-05-29

    Boys with Duchenne muscular dystrophy (DMD) have DMD gene mutations, with associated loss of the dystrophin protein and progressive muscle degeneration and weakness. Corticosteroids and palliative support are currently the best treatment options. The long-term benefits of recently approved compounds such as eteplirsen and ataluren remain to be seen. Dogs with naturally occurring dystrophinopathies show progressive disease akin to that of DMD. Accordingly, canine DMD models are useful for studies of pathogenesis and preclinical therapy development. A dystrophin-deficient, male border collie dog was evaluated at the age of 5 months for progressive muscle weakness and dysphagia. Dramatically increased serum creatine kinase levels (41,520 U/L; normal range 59-895 U/L) were seen on a biochemistry panel. Histopathologic changes characteristic of dystrophinopathy were seen. Dystrophin was absent in the skeletal muscle on immunofluorescence microscopy and western blot. Whole genome sequencing, polymerase chain reaction, and Sanger sequencing revealed a frameshift, single nucleotide deletion in canine DMD exon 20, position 27,626,466 (c.2841delT mRNA), resulting in a stop codon six nucleotides downstream. Semen was archived for future line perpetuation. This spontaneous canine dystrophinopathy occurred due to a novel mutation in the minor DMD mutation hotspot (between exons 2 through 20). Perpetuating this line could allow for preclinical testing of genetic therapies targeted to this area of the DMD gene.

  20. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    PubMed

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

    PubMed

    McAllister, Christine A; Miller, Allison J

    2016-07-01

    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

  2. Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

    PubMed

    Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

    2018-03-01

    Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

  3. Single nucleotide polymorphisms in the CXCR1 gene and its association with clinical mastitis incidence in Polish Holstein-Friesian cows.

    PubMed

    Pokorska, J; Dusza, M; Kułaj, D; Żukowski, K; Makulska, J

    2016-04-28

    The aim of this study was to identify the association between single nucleotide polymorphisms (SNPs) in the bovine chemokine receptor (CXCR1) gene and the resistance or susceptibility of cows to mastitis. The analysis of the CXCR1 polymorphism was carried out using polymerase chain reaction restriction fragment length polymorphism analysis for six SNP mutations (c.+291C>T, c.+365T>C, c.+816C>A, c.+819G>A, +1093C>T, and +1373C>A), of which four were located within the coding region and two in the 3'UTR region of the CXCR1 gene. Genetic material from 146 Polish Holstein-Friesian cows was analyzed after dividing into two groups depending on the incidence of clinical mastitis. Identified polymorphisms were in linkage disequilibrium and formed two linkage groups. Three haplotypes (CCCATA, TTAGCC, CTCGCC), forming six haplotype combinations, were detected. The logistic regression showed a significant association between the CC genotype at c.+365T>C and susceptibility of cows to clinical mastitis (P = 0.047). The frequency of haplotype combination 1/1 (CCCATA/CCCATA) was not significantly higher in cows susceptible to mastitis (P = 0.062). Of the identified SNP mutations, only c.+365T>C is a nonsynonymous mutation that induces a change in the coded protein [GCC (Ala) to GTC (Val) at the 122nd amino acid]. This amino acid change can result in changes in receptor function, which may be a reason for the increased mastitis incidence observed in cows with polymorphism at this site.

  4. The nucleotide sequence and genome organization of Plasmopara halstedii virus.

    PubMed

    Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

    2011-03-17

    Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates

  5. Concholepas concholepas Ferritin H-like subunit (CcFer): Molecular characterization and single nucleotide polymorphism associated to innate immune response.

    PubMed

    Chávez-Mardones, Jacqueline; Valenzuela-Muñoz, Valentina; Núñez-Acuña, Gustavo; Maldonado-Aguayo, Waleska; Gallardo-Escárate, Cristian

    2013-09-01

    Ferritin has been identified as the principal protein of iron storage and iron detoxification, playing a pivotal role for the cellular homeostasis in living organisms. However, recent studies in marine invertebrates have suggested its association with innate immune system. In the present study, one Ferritin subunit was identified from the gastropod Concholepas concholepas (CcFer), which was fully characterized by Rapid Amplification of cDNA Ends technique. Simultaneously, a challenge test was performed to evaluate the immune response against Vibrio anguillarum. The full length of cDNA Ccfer was 1030 bp, containing 513 bp of open reading frame that encodes to 170 amino acid peptide, which was similar to the Ferritin H subunit described in vertebrates. Untranslated Regions (UTRs) were identified with a 5'UTR of 244 bp that contains iron responsive element (IRE), and a 3'UTR of 273 bp. The predicted molecular mass of deduced amino acid of CcFer was 19.66 kDa and isoelectric point of 4.92. Gene transcription analysis revealed that CcFer increases against infections with V. anguillarum, showing a peak expression at 6 h post-infection. Moreover, a single nucleotide polymorphism was detected at -64 downstream 5'UTR sequence (SNP-64). Quantitative real time analysis showed that homozygous mutant allele (TT) was significantly associated with higher expression levels of the challenged group compared to wild (CC) and heterozygous (CT) variants. Our findings suggest that CcFer is associated to innate immune response in C. concholepas and that the presence of SNPs may involve differential transcriptional expression of CcFer. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    PubMed

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  7. Relationship Between Some Single-nucleotide Polymorphism and Response to Hydroxyurea Therapy in Iranian Patients With β-Thalassemia Intermedia.

    PubMed

    Karimi, Mehran; Zarei, Tahereh; Haghpanah, Sezaneh; Moghadam, Mohamad; Ebrahimi, Ahmad; Rezaei, Narges; Heidari, Ghazaleh; Vazin, Afsaneh; Khavari, Maryam; Miri, Hamid R

    2017-05-01

    To evaluate the possible relationship between hydroxyurea (HU) response and some single-nucleotide polymorphism (SNP) in patients affected by β-thalassemia intermedia. In this cross-sectional study, 100 β-thalassemia intermedia patients who were taking HU with a dose of 8 to 15 mg/kg body weight per day for a period of at least 6 months were randomly selected between February 2013 and October 2014 in southern Iran. HU response was defined based on decrease or cessation of the blood transfusion need and evaluation of Hb level. In univariate analysis, from all evaluated SNPs, only rs10837814 SNP of olfactory receptors (ORs) OR51B2 showed a significant association with HU response (P=0.038) and from laboratory characteristics, only nucleated red blood cells showed significant associations (116%±183%) in good responders versus (264%±286%) in poor responders (P=0.045). In multiple logistic regression, neither laboratory variables nor different SNPs, showed significant association with HU response. Three novel nucleotide variations (-665 [A→C], -1301 [T→G],-1199 delA) in OR51B2 gene were found in good responders. None of the evaluated SNPs in our study showed significant association with HU response. Further larger studies and evaluation of other genes are suggested.

  8. Identification of single nucleotide polymorphism in ginger using expressed sequence tags

    PubMed Central

    Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

    2009-01-01

    Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

  9. Single-nucleotide polymorphisms of TNFA and IL1 in allergic rhinitis.

    PubMed

    Nasiri, R; Amirzargar, A Akbar; Movahedi, M; Hirbod-Mobarakeh, A; Farhadi, E; Behniafard, N; Tavakkol, M; Ansaripour, B; Moradi, B; Zare, A; Rezaei, N

    2013-01-01

    Allergic rhinitis is a complex polygenic disorder of the upper respiratory tract. Given that proinflammatory cytokines such as tumor necrosis factor (TNF) and interleukin (IL) 1 seem to play a role in the development of allergic rhinitis, we evaluated the associations between various single-nucleotide polymorphisms (SNPs) of the TNF and IL1 genes in a case-control study. The study population comprised 98 patients with allergic rhinitis. Genotyping was performed using polymerase chain reaction with sequence-specific primers for 2 TNFA promoter variants (rs1800629 and rs361525), 1 variant in the promoter region of IL1A (rs1800587), 2 SNPs in the IL1B gene (rs16944 and rs1 143634), 1 variant in the IL1 receptor (rs2234650), and 1 in IL1RA (rs315952). Patients who were homozygous for the T allele of rs16944 in IL1B had an 8.1-fold greater risk of allergic rhinitis than those with the C allele. In TNFA, a significant relationship was also detected between rs1800629 and rs361525 and allergic rhinitis. Except for rs1800587 in IL1A and rs315952 in IL1RA, significant differences were found between the patient and control groups for all other SNPs. We found that allelic variants in the TNFA and IL1 genes were not only associated with the risk of developing allergic rhinitis, but also affected disease course and severity.

  10. Single nucleotide polymorphisms in the bovine MHC region of Japanese Black cattle are associated with bovine leukemia virus proviral load.

    PubMed

    Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko

    2017-04-04

    Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.

  11. Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

    PubMed

    Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

    2018-05-03

    Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

  12. Reinvestigations of six unusual paternity cases by typing of autosomal single-nucleotide polymorphisms.

    PubMed

    Børsting, Claus; Morling, Niels

    2012-02-01

    In some relationship cases, the initial investigations of autosomal short tandem repeats (STRs) lead to an ambiguous conclusion and supplementary investigations become necessary. Six unusual paternity cases were previously investigated by other researchers and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. Three cases were solved by the SNP investigation without the need for any additional testing. In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. The case work examples underline the importance of performing supplementary investigations, and they advocate for the implementation of several panels that may be used in the highly unusual cases. Panels with SNPs or other markers with low mutation probabilities are preferable as supplementary markers, because the risk of detecting (additional) mutations is very low. © 2012 American Association of Blood Banks.

  13. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    NASA Astrophysics Data System (ADS)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P < 0.01), from which we constructed four main haplotypes due to linkage disequilibrium. Furthermore, the most effective haplotype H2 (GAGGAT) had extremely significant relationship with high glycogen content ( P < 0.0001). These findings revealed the potential influence of Cg-GYS polymorphism on the glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  14. Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology

    PubMed Central

    Pareek, Chandra Shekhar; Smoczyński, Rafał; Kadarmideen, Haja N.; Dziuba, Piotr; Błaszczyk, Paweł; Sikora, Marcin; Walendzik, Paulina; Grzybowski, Tomasz; Pierzchała, Mariusz; Horbańczuk, Jarosław; Szostak, Agnieszka; Ogluszka, Magdalena; Zwierzchowski, Lech; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Wąsowicz, Krzysztof; Gelfand, Brian; Feng, Yaping; Kumar, Dibyendu

    2016-01-01

    Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs) within potential candidate genes (CGs) or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF), Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis of 76 QTLs

  15. Single Nucleotide Polymorphism Discovery in Bovine Pituitary Gland Using RNA-Seq Technology.

    PubMed

    Pareek, Chandra Shekhar; Smoczyński, Rafał; Kadarmideen, Haja N; Dziuba, Piotr; Błaszczyk, Paweł; Sikora, Marcin; Walendzik, Paulina; Grzybowski, Tomasz; Pierzchała, Mariusz; Horbańczuk, Jarosław; Szostak, Agnieszka; Ogluszka, Magdalena; Zwierzchowski, Lech; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Wąsowicz, Krzysztof; Gelfand, Brian; Feng, Yaping; Kumar, Dibyendu

    2016-01-01

    Examination of bovine pituitary gland transcriptome by strand-specific RNA-seq allows detection of putative single nucleotide polymorphisms (SNPs) within potential candidate genes (CGs) or QTLs regions as well as to understand the genomics variations that contribute to economic trait. Here we report a breed-specific model to successfully perform the detection of SNPs in the pituitary gland of young growing bulls representing Polish Holstein-Friesian (HF), Polish Red, and Hereford breeds at three developmental ages viz., six months, nine months, and twelve months. A total of 18 bovine pituitary gland polyA transcriptome libraries were prepared and sequenced using the Illumina NextSeq 500 platform. Sequenced FastQ databases of all 18 young bulls were submitted to NCBI-SRA database with NCBI-SRA accession numbers SRS1296732. For the investigated young bulls, a total of 113,882,3098 raw paired-end reads with a length of 156 bases were obtained, resulting in an approximately 63 million paired-end reads per library. Breed-wise, a total of 515.38, 215.39, and 408.04 million paired-end reads were obtained for Polish HF, Polish Red, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed 93.04%, 94.39%, and 83.46% of the mapped sequencing reads were properly paired to the Polish HF, Polish Red, and Hereford breeds, respectively. Constructed breed-specific SNP-db of three cattle breeds yielded at 13,775,885 SNPs. On an average 765,326 breed-specific SNPs per young bull were identified. Using two stringent filtering parameters, i.e., a minimum 10 SNP reads per base with an accuracy ≥ 90% and a minimum 10 SNP reads per base with an accuracy = 100%, SNP-db records were trimmed to construct a highly reliable SNP-db. This resulted in a reduction of 95,7% and 96,4% cut-off mark of constructed raw SNP-db. Finally, SNP discoveries using RNA-Seq data were validated by KASP™ SNP genotyping assay. The comprehensive QTLs/CGs analysis of 76 QTLs

  16. Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

    PubMed

    Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

    2013-02-01

    Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

  17. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    PubMed

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  18. Sequence-Based Prioritization of Nonsynonymous Single-Nucleotide Polymorphisms for the Study of Disease Mutations

    PubMed Central

    Jiang, Rui ; Yang, Hua ; Zhou, Linqi ; Kuo, C.-C. Jay ; Sun, Fengzhu ; Chen, Ting 

    2007-01-01

    The increasing demand for the identification of genetic variation responsible for common diseases has translated into a need for sophisticated methods for effectively prioritizing mutations occurring in disease-associated genetic regions. In this article, we prioritize candidate nonsynonymous single-nucleotide polymorphisms (nsSNPs) through a bioinformatics approach that takes advantages of a set of improved numeric features derived from protein-sequence information and a new statistical learning model called “multiple selection rule voting” (MSRV). The sequence-based features can maximize the scope of applications of our approach, and the MSRV model can capture subtle characteristics of individual mutations. Systematic validation of the approach demonstrates that this approach is capable of prioritizing causal mutations for both simple monogenic diseases and complex polygenic diseases. Further studies of familial Alzheimer diseases and diabetes show that the approach can enrich mutations underlying these polygenic diseases among the top of candidate mutations. Application of this approach to unclassified mutations suggests that there are 10 suspicious mutations likely to cause diseases, and there is strong support for this in the literature. PMID:17668383

  19. Single-molecule diffusometry reveals the nucleotide-dependent oligomerization pathways of Nicotiana tabacum Rubisco activase

    NASA Astrophysics Data System (ADS)

    Wang, Quan; Serban, Andrew J.; Wachter, Rebekka M.; Moerner, W. E.

    2018-03-01

    Oligomerization plays an important role in the function of many proteins, but a quantitative picture of the oligomer distribution has been difficult to obtain using existing techniques. Here we describe a method that combines sub-stoichiometric labeling and recently developed single-molecule diffusometry to measure the size distribution of oligomers under equilibrium conditions in solution, one molecule at a time. We use this technique to characterize the oligomerization behavior of Nicotiana tabacum (Nt) Rubisco activase (Nt-Rca), a chaperone-like AAA-plus ATPase essential in regulating carbon fixation during photosynthesis. We directly observed monomers, dimers, and a tetramer/hexamer mixture and extracted their fractional abundance as a function of protein concentration. We show that the oligomerization pathway of Nt-Rca is nucleotide dependent: ATPγS binding strongly promotes tetramer/hexamer formation from dimers and results in a preferred tetramer/hexamer population for concentrations in the 1-10 μM range. Furthermore, we directly observed dynamic assembly and disassembly processes of single complexes in real time and from there estimated the rate of subunit exchange to be ˜0.1 s-1 with ATPγS. On the other hand, ADP binding destabilizes Rca complexes by enhancing the rate of subunit exchange by >2 fold. These observations provide a quantitative starting point to elucidate the structure-function relations of Nt-Rca complexes. We envision the method to fill a critical gap in defining and quantifying protein assembly pathways in the small-oligomer regime.

  20. Single-molecule diffusometry reveals the nucleotide-dependent oligomerization pathways of Nicotiana tabacum Rubisco activase.

    PubMed

    Wang, Quan; Serban, Andrew J; Wachter, Rebekka M; Moerner, W E

    2018-03-28

    Oligomerization plays an important role in the function of many proteins, but a quantitative picture of the oligomer distribution has been difficult to obtain using existing techniques. Here we describe a method that combines sub-stoichiometric labeling and recently developed single-molecule diffusometry to measure the size distribution of oligomers under equilibrium conditions in solution, one molecule at a time. We use this technique to characterize the oligomerization behavior of Nicotiana tabacum (Nt) Rubisco activase (Nt-Rca), a chaperone-like AAA-plus ATPase essential in regulating carbon fixation during photosynthesis. We directly observed monomers, dimers, and a tetramer/hexamer mixture and extracted their fractional abundance as a function of protein concentration. We show that the oligomerization pathway of Nt-Rca is nucleotide dependent: ATPγS binding strongly promotes tetramer/hexamer formation from dimers and results in a preferred tetramer/hexamer population for concentrations in the 1-10 μM range. Furthermore, we directly observed dynamic assembly and disassembly processes of single complexes in real time and from there estimated the rate of subunit exchange to be ∼0.1 s -1 with ATPγS. On the other hand, ADP binding destabilizes Rca complexes by enhancing the rate of subunit exchange by >2 fold. These observations provide a quantitative starting point to elucidate the structure-function relations of Nt-Rca complexes. We envision the method to fill a critical gap in defining and quantifying protein assembly pathways in the small-oligomer regime.

  1. Recognition Tunneling of Canonical and Modified RNA Nucleotides for Their Identification with the Aid of Machine Learning.

    PubMed

    Im, JongOne; Sen, Suman; Lindsay, Stuart; Zhang, Peiming

    2018-06-28

    In the present study, we demonstrate a tunneling nanogap technique to identify individual RNA nucleotides, which can be used as a mechanism to read the nucleobases for direct sequencing of RNA in a solid-state nanopore. The tunneling nanogap is composed of two electrodes separated by a distance of <3 nm and functionalized with a recognition molecule. When a chemical entity is captured in the gap, it generates electron tunneling currents, a process we call recognition tunneling (RT). Using RT nanogaps created in a scanning tunneling microscope (STM), we acquired the electron tunneling signals for the canonical and two modified RNA nucleotides. To call the individual RNA nucleotides from the RT data, we adopted a machine learning algorithm, support vector machine (SVM), for the data analysis. Through the SVM, we were able to identify the individual RNA nucleotides and distinguish them from their DNA counterparts with reasonably high accuracy. Since each RNA nucleoside contains a hydroxyl group at the 2'-position of its sugar ring in an RNA strand, it allows for the formation of a tunneling junction at a larger nanogap compared to the DNA nucleoside in a DNA strand, which lacks the 2' hydroxyl group. It also proves advantageous for the manufacture of RT devices. This study is a proof-of-principle demonstration for the development of an RT nanopore device for directly sequencing single RNA molecules, including those bearing modifications.

  2. Identification of single nucleotide polymorphisms in the ASB15 gene and their associations with chicken growth and carcass traits.

    PubMed

    Wang, Y C; Jiang, R R; Kang, X T; Li, Z J; Han, R L; Geng, J; Fu, J X; Wang, J F; Wu, J P

    2015-09-25

    ASB15 is a member of the ankyrin repeat and suppressor of cytokine signaling box family, and is predominantly expressed in skeletal muscle. In the present study, an F2 resource population of Gushi chickens crossed with Anka broilers was used to investigate the genetic effects of the chicken ASB15 gene. Two single nucleotide polymorphisms (SNPs) (rs315759231 A>G and rs312619270 T>C) were identified in exon 7 of the ASB15 gene using forced chain reaction-restriction fragment length polymorphism and DNA sequencing. One was a missense SNP (rs315759231 A>G) and the other was a synonymous SNP (rs312619270 T>C). The rs315759231 A>G polymorphism was significantly associated with body weight at birth, 12-week body slanting length, semi-evisceration weight, evisceration weight, leg muscle weight, and carcass weight (P < 0.05). The rs312619270 T>C polymorphism was significantly associated with body weight at birth, 4, 8, and 12-week body weight, 8-week shank length, 12-week breast bone length, 8 and 12-week body slanting length, breast muscle weight, and carcass weight (P < 0.05). Our results suggest that the ASB15 gene profoundly affects chicken growth and carcass traits.

  3. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat

    PubMed Central

    Chao, Shiaoman; Singh, Ravi P.; Sorrells, Mark E.

    2017-01-01

    Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race-specific genes or complex adult plant resistance is necessary to achieve durability. In the present study, we applied genome-wide association studies (GWAS) for identifying loci associated with the Ug99 stem rust resistance (SR) in a panel of wheat lines developed at the International Maize and Wheat Improvement Center (CIMMYT). Genotyping was carried out using the wheat 9K iSelect single nucleotide polymorphism (SNP) chip. Phenotyping was done in the field in Kenya by infection of Puccinia graminis f. sp. tritici race TTKST, the Sr24-virulent variant of Ug99. Marker-trait association identified 12 SNP markers significantly associated with resistance. Among them, 7 were mapped on five chromosomes. Markers located on chromosomes 4A and 4B overlapped with the location of the Ug99 resistance genes SrND643 and Sr37, respectively. Markers identified on 7DL were collocated with Sr25. Additional significant markers were located in the regions where no Sr gene has been reported. The chromosome location for five of the SNP markers was unknown. A BLASTN search of the NCBI database using the flanking sequences of the SNPs associated with Ug99 resistance revealed that several markers were linked to plant disease resistance analogues, while others were linked to regulatory factors or metabolic enzymes. A KASP (Kompetitive Allele Specific PCR) assay was used for validating six marker loci linked to genes with resistance to Ug99. Of those, four co-segregated with the Sr25-pathotypes while the rest identified unknown resistance genes. With further investigation, these markers can be used for marker-assisted selection in breeding for Ug99 stem rust resistance in wheat. PMID:28241006

  4. A molecular beacon microarray based on a quantum dot label for detecting single nucleotide polymorphisms.

    PubMed

    Guo, Qingsheng; Bai, Zhixiong; Liu, Yuqian; Sun, Qingjiang

    2016-03-15

    In this work, we report the application of streptavidin-coated quantum dot (strAV-QD) in molecular beacon (MB) microarray assays by using the strAV-QD to label the immobilized MB, avoiding target labeling and meanwhile obviating the use of amplification. The MBs are stem-loop structured oligodeoxynucleotides, modified with a thiol and a biotin at two terminals of the stem. With the strAV-QD labeling an "opened" MB rather than a "closed" MB via streptavidin-biotin reaction, a sensitive and specific detection of label-free target DNA sequence is demonstrated by the MB microarray, with a signal-to-background ratio of 8. The immobilized MBs can be perfectly regenerated, allowing the reuse of the microarray. The MB microarray also is able to detect single nucleotide polymorphisms, exhibiting genotype-dependent fluorescence signals. It is demonstrated that the MB microarray can perform as a 4-to-2 encoder, compressing the genotype information into two outputs. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Can Non-HLA Single Nucleotide Polymorphisms Help Stratify Risk in TrialNet Relatives at Risk for Type 1 Diabetes?

    PubMed

    Steck, Andrea K; Xu, Ping; Geyer, Susan; Redondo, Maria J; Antinozzi, Peter; Wentworth, John M; Sosenko, Jay; Onengut-Gumuscu, Suna; Chen, Wei-Min; Rich, Stephen S; Pugliese, Alberto

    2017-08-01

    Genome-wide association studies identified >50 type 1 diabetes (T1D) associated non-human leukocyte antigens (non-HLA) loci. The purpose of this study was to assess the contribution of non-HLA single nucleotide polymorphisms (SNPs) to risk of disease progression. The TrialNet Pathway to Prevention Study follows relatives of T1D patients for development of autoantibodies (Abs) and T1D. Using the Immunochip, we analyzed 53 diabetes-associated, non-HLA SNPs in 1016 Ab-positive, at-risk non-Hispanic white relatives. Effect of SNPs on the development of multiple Abs and T1D. Cox proportional analyses included all substantial non-HLA SNPs, HLA genotypes, relationship to proband, sex, age at initial screening, initial Ab type, and number. Factors involved in progression from single to multiple Abs included age at screening, relationship to proband, HLA genotypes, and rs3087243 (cytotoxic T lymphocyte antigen-4). Significant factors for diabetes progression included age at screening, Ab number, HLA genotypes, rs6476839 [GLIS family zinc finger 3 (GLIS3)], and rs3184504 [SH2B adaptor protein 3 (SH2B3)]. When glucose area under the curve (AUC) was included, factors involved in disease progression included glucose AUC, age at screening, Ab number, relationship to proband, HLA genotypes, rs6476839 (GLIS3), and rs7221109 (CCR7). In stratified analyses by age, glucose AUC, age at screening, sibling, HLA genotypes, rs6476839 (GLIS3), and rs4900384 (C14orf64) were significantly associated with progression to diabetes in participants <12 years old, whereas glucose AUC, sibling, rs3184504 (SH2B3), and rs4900384 (C14orf64) were significant in those ≥12. In conclusion, we identified five non-HLA SNPs associated with increased risk of progression from Ab positivity to disease that may improve risk stratification for prevention trials. Copyright © 2017 by the Endocrine Society

  6. Identification of single nucleotide polymorphism in protein phosphatase 1 regulatory subunit 11 gene in Murrah bulls

    PubMed Central

    Jain, Varsha; Patel, Brijesh; Umar, Farhat Paul; Ajithakumar, H. M.; Gurjar, Suraj K.; Gupta, I. D.; Verma, Archana

    2017-01-01

    Aim: This study was conducted with the objective to identify single nucleotide polymorphism (SNP) in protein phosphatase 1 regulatory subunit 11 (PPP1R11) gene in Murrah bulls. Materials and Methods: Genomic DNA was isolated by phenol–chloroform extraction method from the frozen semen samples of 65 Murrah bulls maintained at Artificial Breeding Research Centre, ICAR-National Dairy Research Institute, Karnal. The quality and concentration of DNA was checked by spectrophotometer reading and agarose gel electrophoresis. The target region of PPP1R11 gene was amplified using four sets of primer designed based on Bos taurus reference sequence. The amplified products were sequenced and aligned using Clustal Omega for identification of SNPs. Animals were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using EcoNI restriction enzyme. Results: The sequences in the NCBI accession number NW_005785016.1 for Bubalus bubalis were compared and aligned with the edited sequences of Murrah bulls with Clustal Omega software. A total of 10 SNPs were found, out of which 1 at 5’UTR, 3 at intron 1, and 6 at intron 2 region. PCR-RFLP using restriction enzyme EcoNI revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study. Conclusion: A total of 10 SNPs were found. PCR-RFLP revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study, due to which association analysis with conception rate was not feasible. PMID:28344410

  7. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome

    PubMed Central

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

    2015-01-01

    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions. PMID:26544948

  8. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    PubMed

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

    2015-01-01

    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  9. Single nucleotide polymorphism (SNP) discovery in duplicated genomes: intron-primed exon-crossing (IPEC) as a strategy for avoiding amplification of duplicated loci in Atlantic salmon (Salmo salar) and other salmonid fishes

    PubMed Central

    Ryynänen, Heikki J; Primmer, Craig R

    2006-01-01

    Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523

  10. Decision Tree Algorithm-Generated Single-Nucleotide Polymorphism Barcodes of rbcL Genes for 38 Brassicaceae Species Tagging.

    PubMed

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2018-01-01

    DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.

  11. Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women.

    PubMed

    Oliveira, Jéssica de; Tureck, Luciane Viater; Santos, Willian Dos; Saliba, Louise Farah; Schenknecht, Caroline Schovanz; Scaraboto, Débora; Souza, Ricardo Lehtonen R; Furtado-Alle, Lupe

    2017-01-01

    Butyrylcholinesterase (BChE) activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs) in the BCHE gene: -116G > A (rs1126680), 1615GA (rs1803274), 1914A < G (rs3495), with obesity and lipid metabolism markers, body mass index (BMI), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG) levels, and BChE enzymatic activity in obese (BMI≥30/n = 226) and non-obese women (BMI < 25/n = 81). BCHE SNPs genotyping was obtained by TaqMan allelic discrimination assay and by RFLP-PCR. Plasmatic BChE activity was measured using propionylthiocholine as substrate. Similar allele frequencies were found in obese and non-obese women for the three studied SNPs (p > 0.05). The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p < 0.001, respectively). The 1914A > G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

  12. High-resolution genetic map for understanding the effect of genome-wide recombination rate, selection sweep and linkage disequilibrium on nucleotide diversity in watermelon

    USDA-ARS?s Scientific Manuscript database

    Genotyping by sequencing (GBS) technology was used to identify a set of 9,933 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1,087 cM for watermelon. The genome-wide variation of recombination rate (GWRR) across the map was evaluated and a positive co...

  13. Melting analysis on microbeads in rapid temperature-gradient inside microchannels for single nucleotide polymorphisms detectiona)

    PubMed Central

    Li, Kan-Chien; Ding, Shih-Torng; Lin, En-Chung; Wang, Lon (Alex); Lu, Yen-Wen

    2014-01-01

    A continuous-flow microchip with a temperature gradient in microchannels was utilized to demonstrate spatial melting analysis on microbeads for clinical Single Nucleotide Polymorphisms (SNPs) genotyping on animal genomic DNA. The chip had embedded heaters and thermometers, which created a rapid and yet stable temperature gradient between 60 °C and 85 °C in a short distance as the detection region. The microbeads, which served as mobile supports carrying the target DNA and fluorescent dye, were transported across the temperature gradient. As the surrounding temperature increased, the fluorescence signals of the microbeads decayed with this relationship being acquired as the melting curve. Fast DNA denaturation, as a result of the improved heat transfer and thermal stability due to scaling, was also confirmed. Further, each individual microbead could potentially bear different sequences and pass through the detection region, one by one, for a series of melting analysis, with multiplex, high-throughput capability being possible. A prototype was tested with target DNA samples in different genotypes (i.e., wild and mutant types) with a SNP location from Landrace sows. The melting temperatures were obtained and compared to the ones using a traditional tube-based approach. The results showed similar levels of SNP discrimination, validating our proposed technique for scanning homozygotes and heterozygotes to distinguish single base changes for disease research, drug development, medical diagnostics, agriculture, and animal production. PMID:25553186

  14. Prediction of peripheral neuropathy in multiple myeloma patients receiving bortezomib and thalidomide: a genetic study based on a single nucleotide polymorphism array.

    PubMed

    García-Sanz, Ramón; Corchete, Luis Antonio; Alcoceba, Miguel; Chillon, María Carmen; Jiménez, Cristina; Prieto, Isabel; García-Álvarez, María; Puig, Noemi; Rapado, Immaculada; Barrio, Santiago; Oriol, Albert; Blanchard, María Jesús; de la Rubia, Javier; Martínez, Rafael; Lahuerta, Juan José; González Díaz, Marcos; Mateos, María Victoria; San Miguel, Jesús Fernando; Martínez-López, Joaquín; Sarasquete, María Eugenia

    2017-12-01

    Bortezomib- and thalidomide-based therapies have significantly contributed to improved survival of multiple myeloma (MM) patients. However, treatment-induced peripheral neuropathy (TiPN) is a common adverse event associated with them. Risk factors for TiPN in MM patients include advanced age, prior neuropathy, and other drugs, but there are conflicting results about the role of genetics in predicting the risk of TiPN. Thus, we carried out a genome-wide association study based on more than 300 000 exome single nucleotide polymorphisms in 172 MM patients receiving therapy involving bortezomib and thalidomide. We compared patients developing and not developing TiPN under similar treatment conditions (GEM05MAS65, NCT00443235). The highest-ranking single nucleotide polymorphism was rs45443101, located in the PLCG2 gene, but no significant differences were found after multiple comparison correction (adjusted P = .1708). Prediction analyses, cytoband enrichment, and pathway analyses were also performed, but none yielded any significant findings. A copy number approach was also explored, but this gave no significant results either. In summary, our study did not find a consistent genetic component associated with TiPN under bortezomib and thalidomide therapies that could be used for prediction, which makes clinical judgment essential in the practical management of MM treatment. Copyright © 2016 John Wiley & Sons, Ltd.

  15. Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

    PubMed Central

    Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

    2007-01-01

    Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic

  16. Estimation of linkage disequilibrium and interspecific gene flow in Ficedula flycatchers by a newly developed 50k single-nucleotide polymorphism array

    PubMed Central

    Kawakami, Takeshi; Backström, Niclas; Burri, Reto; Husby, Arild; Olason, Pall; Rice, Amber M; Ålund, Murielle; Qvarnström, Anna; Ellegren, Hans

    2014-01-01

    With the access to draft genome sequence assemblies and whole-genome resequencing data from population samples, molecular ecology studies will be able to take truly genome-wide approaches. This now applies to an avian model system in ecological and evolutionary research: Old World flycatchers of the genus Ficedula, for which we recently obtained a 1.1 Gb collared flycatcher genome assembly and identified 13 million single-nucleotide polymorphism (SNP)s in population resequencing of this species and its sister species, pied flycatcher. Here, we developed a custom 50K Illumina iSelect flycatcher SNP array with markers covering 30 autosomes and the Z chromosome. Using a number of selection criteria for inclusion in the array, both genotyping success rate and polymorphism information content (mean marker heterozygosity = 0.41) were high. We used the array to assess linkage disequilibrium (LD) and hybridization in flycatchers. Linkage disequilibrium declined quickly to the background level at an average distance of 17 kb, but the extent of LD varied markedly within the genome and was more than 10-fold higher in ‘genomic islands’ of differentiation than in the rest of the genome. Genetic ancestry analysis identified 33 F1 hybrids but no later-generation hybrids from sympatric populations of collared flycatchers and pied flycatchers, contradicting earlier reports of backcrosses identified from much fewer number of markers. With an estimated divergence time as recently as <1 Ma, this suggests strong selection against F1 hybrids and unusually rapid evolution of reproductive incompatibility in an avian system. PMID:24784959

  17. Neutralizing antibodies against West Nile virus identified directly from human B cells by single-cell analysis and next generation sequencing

    PubMed Central

    Tsioris, Konstantinos; Gupta, Namita T.; Ogunniyi, Adebola O.; Zimnisky, Ross M.; Qian, Feng; Yao, Yi; Wang, Xiaomei; Stern, Joel N. H.; Chari, Raj; Briggs, Adrian W.; Clouser, Christopher R.; Vigneault, Francois; Church, George M.; Garcia, Melissa N.; Murray, Kristy O.; Montgomery, Ruth R.; Kleinstein, Steven H.; Love, J. Christopher

    2015-01-01

    West Nile virus infection (WNV) is an emerging mosquito-borne disease that can lead to severe neurological illness and currently has no available treatment or vaccine. Using microengraving, an integrated single-cell analysis method, we analyzed a cohort of subjects infected with WNV - recently infected and post-convalescent subjects - and efficiently identified four novel WNV neutralizing antibodies. We also assessed the humoral response to WNV on a single-cell and repertoire level by integrating next generation sequencing (NGS) into our analysis. The results from single-cell analysis indicate persistence of WNV-specific memory B cells and antibody-secreting cells in post-convalescent subjects. These cells exhibited class-switched antibody isotypes. Furthermore, the results suggest that the antibody response itself does not predict the clinical severity of the disease (asymptomatic or symptomatic). Using the nucleotide coding sequences for WNV-specific antibodies derived from single cells, we revealed the ontogeny of expanded WNV-specific clones in the repertoires of recently infected subjects through NGS and bioinformatic analysis. This analysis also indicated that the humoral response to WNV did not depend on an anamnestic response, due to an unlikely previous exposure to the virus. The innovative and integrative approach presented here to analyze the evolution of neutralizing antibodies from natural infection on a single-cell and repertoire level can also be applied to vaccine studies, and could potentially aid the development of therapeutic antibodies and our basic understanding of other infectious diseases. PMID:26481611

  18. Neutralizing antibodies against West Nile virus identified directly from human B cells by single-cell analysis and next generation sequencing.

    PubMed

    Tsioris, Konstantinos; Gupta, Namita T; Ogunniyi, Adebola O; Zimnisky, Ross M; Qian, Feng; Yao, Yi; Wang, Xiaomei; Stern, Joel N H; Chari, Raj; Briggs, Adrian W; Clouser, Christopher R; Vigneault, Francois; Church, George M; Garcia, Melissa N; Murray, Kristy O; Montgomery, Ruth R; Kleinstein, Steven H; Love, J Christopher

    2015-12-01

    West Nile virus (WNV) infection is an emerging mosquito-borne disease that can lead to severe neurological illness and currently has no available treatment or vaccine. Using microengraving, an integrated single-cell analysis method, we analyzed a cohort of subjects infected with WNV - recently infected and post-convalescent subjects - and efficiently identified four novel WNV neutralizing antibodies. We also assessed the humoral response to WNV on a single-cell and repertoire level by integrating next generation sequencing (NGS) into our analysis. The results from single-cell analysis indicate persistence of WNV-specific memory B cells and antibody-secreting cells in post-convalescent subjects. These cells exhibited class-switched antibody isotypes. Furthermore, the results suggest that the antibody response itself does not predict the clinical severity of the disease (asymptomatic or symptomatic). Using the nucleotide coding sequences for WNV-specific antibodies derived from single cells, we revealed the ontogeny of expanded WNV-specific clones in the repertoires of recently infected subjects through NGS and bioinformatic analysis. This analysis also indicated that the humoral response to WNV did not depend on an anamnestic response, due to an unlikely previous exposure to the virus. The innovative and integrative approach presented here to analyze the evolution of neutralizing antibodies from natural infection on a single-cell and repertoire level can also be applied to vaccine studies, and could potentially aid the development of therapeutic antibodies and our basic understanding of other infectious diseases.

  19. Allelic variation of the Waxy gene in foxtail millet [Setaria italica (L.) P. Beauv.] by single nucleotide polymorphisms.

    PubMed

    Van, K; Onoda, S; Kim, M Y; Kim, K D; Lee, S-H

    2008-03-01

    The Waxy (Wx) gene product controls the formation of a straight chain polymer of amylose in the starch pathway. Dominance/recessiveness of the Wx allele is associated with amylose content, leading to non-waxy/waxy phenotypes. For a total of 113 foxtail millet accessions, agronomic traits and the molecular differences of the Wx gene were surveyed to evaluate genetic diversities. Molecular types were associated with phenotypes determined by four specific primer sets (non-waxy, Type I; low amylose, Type VI; waxy, Type IV or V). Additionally, the insertion of transposable element in waxy was confirmed by ex1/TSI2R, TSI2F/ex2, ex2int2/TSI7R and TSI7F/ex4r. Seventeen single nucleotide polymorphims (SNPs) were observed from non-coding regions, while three SNPs from coding regions were non-synonymous. Interestingly, the phenotype of No. 88 was still non-waxy, although seven nucleotides (AATTGGT) insertion at 2,993 bp led to 78 amino acids shorter. The rapid decline of r (2) in the sequenced region (exon 1-intron 1-exon 2) suggested a low level of linkage disequilibrium and limited haplotype structure. K (s) values and estimation of evolutionary events indicate early divergence of S. italica among cereal crops. This study suggested the Wx gene was one of the targets in the selection process during domestication.

  20. High-Throughput Genotyping of Single Nucleotide Polymorphisms in the Plasmodium falciparum dhfr Gene by Asymmetric PCR and Melt-Curve Analysis▿

    PubMed Central

    Cruz, Rochelle E.; Shokoples, Sandra E.; Manage, Dammika P.; Yanow, Stephanie K.

    2010-01-01

    Mutations within the Plasmodium falciparum dihydrofolate reductase gene (Pfdhfr) contribute to resistance to antimalarials such as sulfadoxine-pyrimethamine (SP). Of particular importance are the single nucleotide polymorphisms (SNPs) within codons 51, 59, 108, and 164 in the Pfdhfr gene that are associated with SP treatment failure. Given that traditional genotyping methods are time-consuming and laborious, we developed an assay that provides the rapid, high-throughput analysis of parasite DNA isolated from clinical samples. This assay is based on asymmetric real-time PCR and melt-curve analysis (MCA) performed on the LightCycler platform. Unlabeled probes specific to each SNP are included in the reaction mixture and hybridize differentially to the mutant and wild-type sequences within the amplicon, generating distinct melting curves. Since the probe is present throughout PCR and MCA, the assay proceeds seamlessly with no further addition of reagents. This assay was validated for analytical sensitivity and specificity using plasmids, purified genomic DNA from reference strains, and parasite cultures. For all four SNPs, correct genotypes were identified with 100 copies of the template. The performance of the assay was evaluated with a blind panel of clinical isolates from travelers with low-level parasitemia. The concordance between our assay and DNA sequencing ranged from 84 to 100% depending on the SNP. We also directly compared our MCA assay to a published TaqMan real-time PCR assay and identified major issues with the specificity of the TaqMan probes. Our assay provides a number of technical improvements that facilitate the high-throughput screening of patient samples to identify SP-resistant malaria. PMID:20631115

  1. Genome-wide single nucleotide polymorphism scan suggests adaptation to urbanization in an important pollinator, the red-tailed bumblebee (Bombus lapidarius L.).

    PubMed

    Theodorou, Panagiotis; Radzevičiūtė, Rita; Kahnt, Belinda; Soro, Antonella; Grosse, Ivo; Paxton, Robert J

    2018-04-25

    Urbanization is considered a global threat to biodiversity; the growth of cities results in an increase in impervious surfaces, soil and air pollution, fragmentation of natural vegetation and invasion of non-native species, along with numerous environmental changes, including the heat island phenomenon. The combination of these effects constitutes a challenge for both the survival and persistence of many native species, while also imposing altered selective regimes. Here, using 110 314 single nucleotide polymorphisms generated by restriction-site-associated DNA sequencing, we investigated the genome-wide effects of urbanization on putative neutral and adaptive genomic diversity in a major insect pollinator, Bombus lapidarius , collected from nine German cities and nine paired rural sites. Overall, genetic differentiation among sites was low and there was no obvious genome-wide genetic structuring, suggesting the absence of strong effects of urbanization on gene flow. We nevertheless identified several loci under directional selection, a subset of which was associated with urban land use, including the percentage of impervious surface surrounding each sampling site. Overall, our results provide evidence of local adaptation to urbanization in the face of gene flow in a highly mobile insect pollinator. © 2018 The Author(s).

  2. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.

    1991-02-15

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less

  3. L-RCA (ligation-rolling circle amplification): a general method for genotyping of single nucleotide polymorphisms (SNPs)

    PubMed Central

    Qi, Xiaoquan; Bakht, Saleha; Devos, Katrien M.; Gale, Mike D.; Osbourn, Anne

    2001-01-01

    A flexible, non-gel-based single nucleotide polymorphism (SNP) detection method is described. The method adopts thermostable ligation for allele discrimination and rolling circle amplification (RCA) for signal enhancement. Clear allelic discrimination was achieved after staining of the final reaction mixtures with Cybr-Gold and visualisation by UV illumination. The use of a compatible buffer system for all enzymes allows the reaction to be initiated and detected in the same tube or microplate well, so that the experiment can be scaled up easily for high-throughput detection. Only a small amount of DNA (i.e. 50 ng) is required per assay, and use of carefully designed short padlock probes coupled with generic primers and probes make the SNP detection cost effective. Biallelic assay by hybridisation of the RCA products with fluorescence dye-labelled probes is demonstrated, indicating that ligation-RCA (L-RCA) has potential for multiplexed assays. PMID:11713336

  4. Single-nucleotide polymorphisms associated with symptomatic infection and differential human gene expression in healthy seropositive persons each implicate the cytoskeleton, integrin signaling, and oncosuppression in the pathogenesis of human parvovirus B19 infection.

    PubMed

    Kerr, Jonathan R; Kaushik, Narendra; Fear, David; Baldwin, Don A; Nuwaysir, Emile F; Adcock, Ian M

    2005-07-15

    This study was undertaken to further examine the role of the host response to parvovirus B19 in the development of symptoms and consequences of viral persistence. Genomic DNA from 42 patients with symptomatic B19 infection was analyzed using the HuSNP assay (Affymetrix), and the results were compared with those from analysis of 53 healthy control individuals. Fifty-seven single-nucleotide polymorphisms were identified that were significantly associated with symptomatic infection. Total RNA from peripheral blood mononuclear cells from 57 B19-seropositive and 13 B19-seronegative donors was analyzed by hybridization to a single-color microarray representing 9522 human genes. Ninety-two genes were shown to be differentially expressed. Differential expression was confirmed in 6 of 38 genes (SKIP, MACF1, SPAG7, FLOT1, c6orf48, and RASSF5) tested using real-time quantitative polymerase chain reaction in a different group of healthy subjects. Genes identified in both studies play a functional role in the cytoskeleton, integrin signaling, and oncosuppression, themes that have been shown to be important in parvovirus infections.

  5. Robust and Comprehensive Analysis of 20 Osteoporosis Candidate Genes by Very High-Density Single-Nucleotide Polymorphism Screen Among 405 White Nuclear Families Identified Significant Association and Gene–Gene Interaction

    PubMed Central

    Xiong, Dong-Hai; Shen, Hui; Zhao, Lan-Juan; Xiao, Peng; Yang, Tie-Lin; Guo, Yan; Wang, Wei; Guo, Yan-Fang; Liu, Yong-Jun; Recker, Robert R; Deng, Hong-Wen

    2007-01-01

    Many “novel” osteoporosis candidate genes have been proposed in recent years. To advance our knowledge of their roles in osteoporosis, we screened 20 such genes using a set of high-density SNPs in a large family-based study. Our efforts led to the prioritization of those osteoporosis genes and the detection of gene–gene interactions. Introduction We performed large-scale family-based association analyses of 20 novel osteoporosis candidate genes using 277 single nucleotide polymorphisms (SNPs) for the quantitative trait BMD variation and the qualitative trait osteoporosis (OP) at three clinically important skeletal sites: spine, hip, and ultradistal radius (UD). Materials and Methods One thousand eight hundred seventy-three subjects from 405 white nuclear families were genotyped and analyzed with an average density of one SNP per 4 kb across the 20 genes. We conducted association analyses by SNP- and haplotype-based family-based association test (FBAT) and performed gene–gene interaction analyses using multianalytic approaches such as multifactor-dimensionality reduction (MDR) and conditional logistic regression. Results and Conclusions We detected four genes (DBP, LRP5, CYP17, and RANK) that showed highly suggestive associations (10,000-permutation derived empirical global p ≤ 0.01) with spine BMD/OP; four genes (CYP19, RANK, RANKL, and CYP17) highly suggestive for hip BMD/OP; and four genes (CYP19, BMP2, RANK, and TNFR2) highly suggestive for UD BMD/OP. The associations between BMP2 with UD BMD and those between RANK with OP at the spine, hip, and UD also met the experiment-wide stringent criterion (empirical global p ≤ 0.0007). Sex-stratified analyses further showed that some of the significant associations in the total sample were driven by either male or female subjects. In addition, we identified and validated a two-locus gene–gene interaction model involving GCR and ESR2, for which prior biological evidence exists. Our results suggested the

  6. Identifying Molecular Targets for PTSD Treatment Using Single Prolonged Stress

    DTIC Science & Technology

    2015-10-01

    1 AWARD NUMBER: W81XWH-13-1-0377 TITLE: Identifying Molecular Targets For PTSD Treatment Using Single Prolonged Stress PRINCIPAL...TITLE AND SUBTITLE 5a. CONTRACT NUMBER W81XWH-13-1-0377 Identifying Molecular Targets For PTSD Treatment Using Single Prolonged Stress 5b. GRANT...brain GR and β-AR expression alters glutamatergic and GABAergic function in neural circuits that mediate SPS-induced deficits in extinction retention

  7. Differentiation of Erwinia amylovora and Erwinia pyrifoliae strains with single nucleotide polymorphisms and by synthesis of dihydrophenylalanine.

    PubMed

    Gehring, I; Geider, K

    2012-07-01

    Fire blight has spread from North America to New Zealand, Europe, and the Mediterranean region. We were able to differentiate strains from various origins with a novel PCR method. Three Single Nucleotide Polymorphisms (SNPs) in the Erwinia amylovora genome were characteristic of isolates from North America and could distinguish them from isolates from other parts of the world. They were derived from the galE, acrB, and hrpA genes of strains Ea273 and Ea1/79. These genes were analyzed by conventional PCR (cPCR) and quantitative PCR (qPCR) with differential primer annealing temperatures. North-American E. amylovora strains were further differentiated according to their production of L: -2,5-dihydrophenylalanine (DHP) as tested by growth inhibition of the yeast Rhodotorula glutinis. E. amylovora fruit tree (Maloideae) and raspberry (rubus) strains were also differentiated by Single Strand Conformational Polymorphism analysis. Strains from the related species Erwinia pyrifoliae isolated in Korea and Japan were all DHP positive, but were differentiated from each other by SNPs in the galE gene. Differential PCR is a rapid and simple method to distinguish E. amylovora as well as E. pyrifoliae strains according to their geographical origin.

  8. A novel single-nucleotide polymorphism of the visfatin gene and its associations with performance traits in the chicken.

    PubMed

    Han, R-L; Lan, X-Y; Zhang, L-Z; Ren, G; Jing, Y-J; Li, M-J; Zhang, B; Zhao, M; Guo, Y-K; Kang, X-T; Chen, H

    2010-01-01

    Visfatin is a peptide that is predominantly expressed in visceral adipose tissue and is hypothesized to be related to obesity and insulin resistance. In this study, a novel silent single-nucleotide polymorphism (SNP) was found in exon 7 of the chicken visfatin gene (also known as PBEF1) by single-stranded conformation polymorphism (SSCP) and DNA sequencing. In total, 836 chickens forming an F2 resource population of Gushi chicken crossed with Anka broiler were genotyped by XbaI forced RFLP, and the associations of this polymorphism with chicken growth, carcass characteristics, and meat quality were analyzed. Significant associations were found between the polymorphism and 4-week body weight (BW4), 6-week body weight (BW6), 4-week body slanting length (BSL4), fat bandwidth (FBW), breast muscle water loss rate (BWLR) and breast muscle fiber density (BFD) (P < 0.05), as well as 4-week breastbone length (BBL4) (P < 0.01). These observations suggested that the polymorphism in exon7 of the visfatin gene had significant effects on the early growth traits of chicken.

  9. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

    NASA Astrophysics Data System (ADS)

    Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo

    2016-04-01

    We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

  10. Multianalyte, dipstick-type, nanoparticle-based DNA biosensor for visual genotyping of single-nucleotide polymorphisms.

    PubMed

    Litos, Ioannis K; Ioannou, Penelope C; Christopoulos, Theodore K; Traeger-Synodinos, Jan; Kanavakis, Emmanuel

    2009-06-15

    DNA biosensors involve molecular recognition of the target sequence by hybridization with specific probes and detection by electrochemical, optical or gravimetric transduction. Disposable, dipstick-type biosensors have been developed recently, which enable visual detection of DNA without using instruments. In this context, we report a multianalyte DNA biosensor for visual genotyping of two single-nucleotide polymorphisms (SNPs). As a model, the biosensor was applied to the simultaneous genotyping of two SNPs, entailing the detection of four alleles. A PCR product that flanks both polymorphic sites is subjected to a single primer extension (PEXT) reaction employing four allele-specific primers, each containing a region complementary to an allele and a characteristic segment that enables subsequent capture on a test zone of the biosensor. The primers are extended with dNTPs and biotin-dUTP only if there is perfect complementarity with the interrogated sequence. The PEXT mixture is applied to the biosensor. As the developing buffer migrates along the strip, all the allele-specific primers are captured by immobilized oligonucleotides at the four test zones of the biosensor and detected by antibiotin-functionalized gold nanoparticles. As a result, the test zones are colored red if extension has occurred denoting the presence of the corresponding allele in the original sample. The excess nanoparticles are captured by immobilized biotinylated albumin at the control zone of the sensor forming another red zone that indicates the proper performance of the system. The assay was applied successfully to the genotyping of twenty clinical samples for two common SNPs of MBL2 gene.

  11. Single-feature polymorphism discovery in the barley transcriptome

    PubMed Central

    Rostoks, Nils; Borevitz, Justin O; Hedley, Peter E; Russell, Joanne; Mudie, Sharon; Morris, Jenny; Cardle, Linda; Marshall, David F; Waugh, Robbie

    2005-01-01

    A probe-level model for analysis of GeneChip gene-expression data is presented which identified more than 10,000 single-feature polymorphisms (SFP) between two barley genotypes. The method has good sensitivity, as 67% of known single-nucleotide polymorphisms (SNP) were called as SFPs. This method is applicable to all oligonucleotide microarray data, accounts for SNP effects in gene-expression data and represents an efficient and versatile approach for highly parallel marker identification in large genomes. PMID:15960806

  12. Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

    DOEpatents

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

    2009-02-24

    Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  13. A Single Nucleotide Polymorphism in 3′-Untranslated Region Contributes to the Regulation of Toll-like Receptor 4 Translation*

    PubMed Central

    Sato, Kayo; Yoshimura, Atsutoshi; Kaneko, Takashi; Ukai, Takashi; Ozaki, Yukio; Nakamura, Hirotaka; Li, Xinyue; Matsumura, Hiroyoshi; Hara, Yoshitaka; Ogata, Yorimasa

    2012-01-01

    We have previously shown that a single nucleotide polymorphism rs11536889 in the 3′-untranslated region (UTR) of TLR4 was associated with periodontitis. In this study the effects of this single nucleotide polymorphism on Toll-like receptor (TLR) 4 expression were investigated. Monocytes from subjects with the C/C genotype expressed higher levels of TLR4 on their surfaces than those from subjects with the other genotypes. Peripheral blood mononuclear cells (PBMCs) from the C/C and G/C subjects secreted higher levels of IL-8 in response to lipopolysaccharide (LPS), a TLR4 ligand, than the cells from the G/G subjects. However, there was no significant difference in TLR4 mRNA levels in PBMCs from the subjects with each genotype. After stimulation with tripalmitoylated CSK4 (Pam3CSK4), TLR4 mRNA levels increased in PBMCs from both the C/C and G/G subjects, whereas TLR4 protein levels increased in PBMCs from the C/C but not G/G subjects. Transient transfection of a series of chimeric luciferase constructs revealed that a fragment of 3′-UTR containing rs11536889 G allele, but not C allele, suppressed luciferase activity induced by LPS or IL-6. Two microRNAs, hsa-miR-1236 and hsa-miR-642a, were predicted to bind to rs11536889 G allele. Inhibition of these microRNAs reversed the suppressed luciferase activity. These microRNA inhibitors also up-regulated endogenous TLR4 protein on THP-1 cells (the G/G genotype) after LPS stimulation. Furthermore, mutant microRNAs that bind to the C allele inhibited the luciferase activity of the construct containing the C allele. These results indicate that genetic variation of rs11536889 contributes to translational regulation of TLR4, possibly by binding to microRNAs. PMID:22661708

  14. Development of a New Molecular Subtyping Tool for Salmonella enterica Serovar Enteritidis Based on Single Nucleotide Polymorphism Genotyping Using PCR

    PubMed Central

    Kelly, Hilary; Dupras, Andrée Ann; Belanger, Sebastien; Devenish, John

    2014-01-01

    The lack of a sufficiently discriminatory molecular subtyping tool for Salmonella enterica serovar Enteritidis has hindered source attribution efforts and impeded regulatory actions required to disrupt its food-borne transmission. The underlying biological reason for the ineffectiveness of current molecular subtyping tools such as pulsed-field gel electrophoresis (PFGE) and phage typing appears to be related to the high degree of clonality of S. Enteritidis. By interrogating the organism's genome, we previously identified single nucleotide polymorphisms (SNP) distributed throughout the chromosome and have designed a highly discriminatory PCR-based SNP typing test based on 60 polymorphic loci. The application of the SNP-PCR method to DNA samples from S. Enteritidis strains (n = 55) obtained from a variety of sources has led to the differentiation and clustering of the S. Enteritidis isolates into 12 clades made up of 2 to 9 isolates per clade. Significantly, the SNP-PCR assay was able to further differentiate predominant PFGE types (e.g., XAI.0003) and phage types (e.g., phage type 8) into smaller subsets. The SNP-PCR subtyping test proved to be an accurate, precise, and quantitative tool for evaluating the relationships among the S. Enteritidis isolates tested in this study and should prove useful for clustering related S. Enteritidis isolates involved in outbreaks. PMID:25297333

  15. From Single Nucleotide Polymorphisms to Constant Immunosuppression: Mesenchymal Stem Cell Therapy for Autoimmune Diseases

    PubMed Central

    Galipeau, Jacques; Nooka, Ajay K.

    2013-01-01

    The regenerative abilities and the immunosuppressive properties of mesenchymal stromal cells (MSCs) make them potentially the ideal cellular product of choice for treatment of autoimmune and other immune mediated disorders. Although the usefulness of MSCs for therapeutic applications is in early phases, their potential clinical use remains of great interest. Current clinical evidence of use of MSCs from both autologous and allogeneic sources to treat autoimmune disorders confers conflicting clinical benefit outcomes. These varied results may possibly be due to MSC use across wide range of autoimmune disorders with clinical heterogeneity or due to variability of the cellular product. In the light of recent genome wide association studies (GWAS), linking predisposition of autoimmune diseases to single nucleotide polymorphisms (SNPs) in the susceptible genetic loci, the clinical relevance of MSCs possessing SNPs in the critical effector molecules of immunosuppression is largely undiscussed. It is of further interest in the allogeneic setting, where SNPs in the target pathway of MSC's intervention may also modulate clinical outcome. In the present review, we have discussed the known critical SNPs predisposing to disease susceptibility in various autoimmune diseases and their significance in the immunomodulatory properties of MSCs. PMID:24350294

  16. [Association of single nucleotide polymorphism at interleukin-10 gene 1082 nt with the risk of gastric cancer in Chinese population].

    PubMed

    Zhou, Shao-zhang; Zhu, Wei-liang; Li, Ming-ying; Li, Hong-yi; Zhang, Ji-ren

    2008-08-01

    To study the association of single nucleotide polymorphism at interleukin-10 gene 1082 locus with Helicobacter pylori (Hp) infection and the risk of gastric cancer in high prevalent region (Shaanxi Province)aand low prevalence region (Guangdong Province) in China. The genomic DNA was extracted from the peripheral blood of 104 healthy individuals, 104 gastric cancer patients from Guangdong Province, and from 102 healthy volunteers and 102 gastric cancer patients in Shaanxi Province, China. The single nucleotide polymorphism at IL-10 gene 1082 locus was analyzed by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The serum levels of anit-Hp IgG was measured by enzyme-linked immunosorbent assay. The frequencies of IL-10-1082 A/A, A/G and G/G genotypes in the 412 subjects were 86.7%, 10.7% and 2.4%, respectively. In the low prevalence region, the number of carriers of IL-10-1082 G* was much greater in the cancer patients than in the healthy controls (14.4% vs 7.7%, Chi2=4.02, P<0.05, OR=1.01, 95% CI=1.08-3.10). The presence of IL-10-1082 G* was associated with significantly increased risk of gastric cancer following Hp infection (Chi(2)=5.36, P<0.05, OR=6.0, 95% CI=1.23-17.52). In the high prevalence region, the frequency of IL-10-1082 G* was slightly higher among the cancer patients than in the healthy controls, but this difference was not statistically significant (12.7% vs 16.6%, P>0.05). The G* genotype of IL-10 gene 1082 locus may be associated with increased risk of gastric cancer in China.

  17. [Relationship between single nucleotide polymorphisms in thiopurine methyltransferase gene and tolerance to thiopurines in acute leukemia].

    PubMed

    Ma, Xiao-li; Zhu, Ping; Wu, Min-yuan; Li, Zhi-gang; Hu, Ya-mei

    2003-12-01

    For the purpose of clarifying the influence of thiopurine methyltransferase (TPMT) gene single nucleotide polymorphisms (SNPs) on the efficacy of thiopurines and risk for its toxicity and therefore improving the safety and efficacy of thiopurines, the authors investigated TPMT genotype in acute leukemia in children who were intolerant to the treatment with 6-mercap topurine (6-MP). TPMT genotype was determined in an unrelated population of 250 Chinese healthy blood donors and 280 children with acute leukemia. TPMT genotyping assay was based on polymerase chain reaction (PCR), restriction digestion of PCR products, denaturing high-performance liquid chromatography (DHPLC) and direct DNA sequencing in the TPMT * 2 (G238C), TPMT * 3A (G460A, A719G) and TPMT * 3C (A719G). There were 10 TPMT * 1/TPMT * 3C heterozygotes in 280 children. The frequency of the polymorphism was 3.6%. All the involved alleles were TPMT * 3C. Of the 160 children acute leukemia evaluated, 45 (26%) were intolerant to 6-MP. Presentations included hepatotoxicity and hematological toxicity. Six out of 45 children were heterozygous, while the other 39 were wild type homozygous. Before dosage adjustments for thiopurine, the hematologic toxicity and hepatotoxicity in TPMT heterozygous individuals occurred more frequently than in homozygous. Therefore, cases of TPMT heterozygotes experienced more missed doses of 6-MP. TPMT genotype is associated with tolerance in acute leukemia in children. The heterozygote individuals have low TPMT activity. Therefore the frequencies of hemtopoietic toxicity and hepatoxicity are high after using 6-MP. Detection of SNPs in the TPMT genes is useful in identifying children before administration of 6-MP.

  18. Gender and single nucleotide polymorphisms in MTHFR, BHMT, SPTLC1, CRBP2R, and SCARB1 are significant predictors of plasma homocysteine normalized by RBC folate in healthy adults.

    USDA-ARS?s Scientific Manuscript database

    Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...

  19. Genomewide single nucleotide polymorphism discovery in Atlantic salmon (Salmo salar): validation in wild and farmed American and European populations.

    PubMed

    Yáñez, J M; Naswa, S; López, M E; Bassini, L; Correa, K; Gilbey, J; Bernatchez, L; Norris, A; Neira, R; Lhorente, J P; Schnable, P S; Newman, S; Mileham, A; Deeb, N; Di Genova, A; Maass, A

    2016-07-01

    A considerable number of single nucleotide polymorphisms (SNPs) are required to elucidate genotype-phenotype associations and determine the molecular basis of important traits. In this work, we carried out de novo SNP discovery accounting for both genome duplication and genetic variation from American and European salmon populations. A total of 9 736 473 nonredundant SNPs were identified across a set of 20 fish by whole-genome sequencing. After applying six bioinformatic filtering steps, 200 K SNPs were selected to develop an Affymetrix Axiom(®) myDesign Custom Array. This array was used to genotype 480 fish representing wild and farmed salmon from Europe, North America and Chile. A total of 159 099 (79.6%) SNPs were validated as high quality based on clustering properties. A total of 151 509 validated SNPs showed a unique position in the genome. When comparing these SNPs against 238 572 markers currently available in two other Atlantic salmon arrays, only 4.6% of the SNP overlapped with the panel developed in this study. This novel high-density SNP panel will be very useful for the dissection of economically and ecologically relevant traits, enhancing breeding programmes through genomic selection as well as supporting genetic studies in both wild and farmed populations of Atlantic salmon using high-resolution genomewide information. © 2016 John Wiley & Sons Ltd.

  20. [Correlation analysis between single nucleotide polymorphism of FGF5 gene and wool yield in rabbits].

    PubMed

    Li, Chun-Xiao; Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia

    2008-07-01

    Single nucleotide polymorphism (SNP) in exon 1 and 3 of fibroblast growth factor (FGF5) gene was studied by DNA sequencing in Yingjing angora rabbit, Tianfu black rabbit and California rabbit. A frameshift mutation (TCT insert) at base position 217 (site A) of exon 1 and a T/C missense mutation at base position 59 (site B) of exon 3 were found in Yingjing angora rabbit with a high frequency; a T/C same-sense mutation at base position 3 (site C) of exon 3 was found with similar frequency in three rabbit breeds. Least square analysis showed that different genotypes had no significant association with wool yield in site A, and had high significant association with wool yield in site B (P<0.01) and significant association with wool yield in site C (P<0.05). It was concluded from the results that FGF5 gene could be the potential major gene affecting wool yield or link with the major gene, and polymorphic loci B and C may be used as molecular markers for im-proving wool yield in angora rabbits.

  1. Prediction of maize phenotype based on whole-genome single nucleotide polymorphisms using deep belief networks

    NASA Astrophysics Data System (ADS)

    Rachmatia, H.; Kusuma, W. A.; Hasibuan, L. S.

    2017-05-01

    Selection in plant breeding could be more effective and more efficient if it is based on genomic data. Genomic selection (GS) is a new approach for plant-breeding selection that exploits genomic data through a mechanism called genomic prediction (GP). Most of GP models used linear methods that ignore effects of interaction among genes and effects of higher order nonlinearities. Deep belief network (DBN), one of the architectural in deep learning methods, is able to model data in high level of abstraction that involves nonlinearities effects of the data. This study implemented DBN for developing a GP model utilizing whole-genome Single Nucleotide Polymorphisms (SNPs) as data for training and testing. The case study was a set of traits in maize. The maize dataset was acquisitioned from CIMMYT’s (International Maize and Wheat Improvement Center) Global Maize program. Based on Pearson correlation, DBN is outperformed than other methods, kernel Hilbert space (RKHS) regression, Bayesian LASSO (BL), best linear unbiased predictor (BLUP), in case allegedly non-additive traits. DBN achieves correlation of 0.579 within -1 to 1 range.

  2. The single-nucleotide polymorphisms in CHD5 affect the prognosis of patients with hepatocellular carcinoma

    PubMed Central

    Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui

    2018-01-01

    Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352

  3. Digital camera and smartphone as detectors in paper-based chemiluminometric genotyping of single nucleotide polymorphisms.

    PubMed

    Spyrou, Elena M; Kalogianni, Despina P; Tragoulias, Sotirios S; Ioannou, Penelope C; Christopoulos, Theodore K

    2016-10-01

    Chemi(bio)luminometric assays have contributed greatly to various areas of nucleic acid analysis due to their simplicity and detectability. In this work, we present the development of chemiluminometric genotyping methods in which (a) detection is performed by using either a conventional digital camera (at ambient temperature) or a smartphone and (b) a lateral flow assay configuration is employed for even higher simplicity and suitability for point of care or field testing. The genotyping of the C677T single nucleotide polymorphism (SNP) of methylenetetrahydropholate reductase (MTHFR) gene is chosen as a model. The interrogated DNA sequence is amplified by polymerase chain reaction (PCR) followed by a primer extension reaction. The reaction products are captured through hybridization on the sensing areas (spots) of the strip. Streptavidin-horseradish peroxidase conjugate is used as a reporter along with a chemiluminogenic substrate. Detection of the emerging chemiluminescence from the sensing areas of the strip is achieved by digital camera or smartphone. For this purpose, we constructed a 3D-printed smartphone attachment that houses inexpensive lenses and converts the smartphone into a portable chemiluminescence imager. The device enables spatial discrimination of the two alleles of a SNP in a single shot by imaging of the strip, thus avoiding the need of dual labeling. The method was applied successfully to genotyping of real clinical samples. Graphical abstract Paper-based genotyping assays using digital camera and smartphone as detectors.

  4. Novel single-nucleotide polymorphism markers confirm successful spawning of endangered pallid sturgeon in the upper Missouri River Basin

    USGS Publications Warehouse

    Eichelberger, Jennifer S.; Braaten, P. J.; Fuller, D. B.; Krampe, Matthew S.; Heist, Edward J.

    2014-01-01

    Spawning of the federally endangered Pallid Sturgeon Scaphirhynchus albus is known to occur in the upper Missouri River basin, but progeny from natural reproductive events have not been observed and recruitment to juvenile or adult life stages has not been documented in recent decades. Identification of Pallid Sturgeon progeny is confounded by the fact that Shovelnose Sturgeon S. platorynchus occurs throughout the entire range of Pallid Sturgeon and the two species are essentially indistinguishable (morphometrically and meristically) during early life stages. Moreover, free embryos of sympatric Paddlefish Polyodon spathula are very similar to the two sturgeon species. In this study, three single-nucleotide polymorphism (SNP) assays were employed to screen acipenseriform free embryos and larvae collected from the upper Missouri River basin in 2011, 2012, and 2013. A mitochondrial DNA SNP discriminates Paddlefish from sturgeon, and specific multilocus genotypes at two nuclear DNA SNPs occurred in 98.9% of wild adult Pallid Sturgeon but only in 3% of Shovelnose Sturgeon sampled in the upper Missouri River. Individuals identified as potential Pallid Sturgeon based on SNP genotypes were further analyzed at 19 microsatellite loci for species discrimination. Out of 1,423 free embryos collected over 3 years of sampling, 971 Paddlefish, 446 Shovelnose Sturgeon, and 6 Pallid Sturgeon were identified. Additionally, 249 Scaphirhynchus spp. benthic larvae were screened, but no Pallid Sturgeon were detected. These SNP markers provide an efficient method of screening acipenseriform early life stages for the presence of Pallid Sturgeon in the Missouri River basin. Detection of wild Pallid Sturgeon free embryos in the upper Missouri and Yellowstone rivers supports the hypothesis that the failure of wild Pallid Sturgeon to recruit to the juvenile life stage in the upper Missouri River basin is caused by early life stage mortality rather than by lack of successful spawning.

  5. RNA sequencing to study gene expression and single nucleotide polymorphism variation associated with citrate content in cow milk.

    PubMed

    Cánovas, A; Rincón, G; Islas-Trejo, A; Jimenez-Flores, R; Laubscher, A; Medrano, J F

    2013-04-01

    The technological properties of milk have significant importance for the dairy industry. Citrate, a normal constituent of milk, forms one of the main buffer systems that regulate the equilibrium between Ca(2+) and H(+) ions. Higher-than-normal citrate content is associated with poor coagulation properties of milk. To identify the genes responsible for the variation of citrate content in milk in dairy cattle, the metabolic steps involved in citrate and fatty acid synthesis pathways in ruminant mammary tissue using RNA sequencing were studied. Genetic markers that could influence milk citrate content in Holstein cows were used in a marker-trait association study to establish the relationship between 74 single nucleotide polymorphisms (SNP) in 20 candidate genes and citrate content in 250 Holstein cows. This analysis revealed 6 SNP in key metabolic pathway genes [isocitrate dehydrogenase 1 (NADP+), soluble (IDH1); pyruvate dehydrogenase (lipoamide) β (PDHB); pyruvate kinase (PKM2); and solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 (SLC25A1)] significantly associated with increased milk citrate content. The amount of the phenotypic variation explained by the 6 SNP ranged from 10.1 to 13.7%. Also, genotype-combination analysis revealed the highest phenotypic variation was explained combining IDH1_23211, PDHB_5562, and SLC25A1_4446 genotypes. This specific genotype combination explained 21.3% of the phenotypic variation. The largest citrate associated effect was in the 3' untranslated region of the SLC25A1 gene, which is responsible for the transport of citrate across the mitochondrial inner membrane. This study provides an approach using RNA sequencing, metabolic pathway analysis, and association studies to identify genetic variation in functional target genes determining complex trait phenotypes. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  6. Comparative Analysis of Disease-Linked Single Nucleotide Polymorphic Markers from Brassica rapa for Their Applicability to Brassica oleracea

    PubMed Central

    Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun

    2015-01-01

    Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283

  7. Genetic diversity revealed by single nucleotide polymorphism markers in a worldwide germplasm collection of durum wheat.

    PubMed

    Ren, Jing; Sun, Daokun; Chen, Liang; You, Frank M; Wang, Jirui; Peng, Yunliang; Nevo, Eviatar; Sun, Dongfa; Luo, Ming-Cheng; Peng, Junhua

    2013-03-28

    Evaluation of genetic diversity and genetic structure in crops has important implications for plant breeding programs and the conservation of genetic resources. Newly developed single nucleotide polymorphism (SNP) markers are effective in detecting genetic diversity. In the present study, a worldwide durum wheat collection consisting of 150 accessions was used. Genetic diversity and genetic structure were investigated using 946 polymorphic SNP markers covering the whole genome of tetraploid wheat. Genetic structure was greatly impacted by multiple factors, such as environmental conditions, breeding methods reflected by release periods of varieties, and gene flows via human activities. A loss of genetic diversity was observed from landraces and old cultivars to the modern cultivars released during periods of the Early Green Revolution, but an increase in cultivars released during the Post Green Revolution. Furthermore, a comparative analysis of genetic diversity among the 10 mega ecogeographical regions indicated that South America, North America, and Europe possessed the richest genetic variability, while the Middle East showed moderate levels of genetic diversity.

  8. Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases

    PubMed Central

    Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten

    2013-01-01

    Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002

  9. Exploring single nucleotide polymorphisms previously related to obesity and metabolic traits in pediatric-onset type 2 diabetes.

    PubMed

    Miranda-Lora, América Liliana; Cruz, Miguel; Aguirre-Hernández, Jesús; Molina-Díaz, Mario; Gutiérrez, Jorge; Flores-Huerta, Samuel; Klünder-Klünder, Miguel

    2017-07-01

    To evaluate the association of 64 obesity-related polymorphisms with pediatric-onset type 2 diabetes and other glucose- and insulin-related traits in Mexican children. Case-control and case-sibling designs were followed. We studied 99 patients with pediatric-onset type 2 diabetes, their siblings (n = 101) without diabetes, 83 unrelated pediatric controls and 137 adult controls. Genotypes were determined for 64 single nucleotide polymorphisms, and a possible association was examined between those genotypes and type 2 diabetes and other quantitative traits, after adjusting for age, sex and body mass index. In the case-pediatric control and case-adult control analyses, five polymorphisms were associated with increased likelihood of pediatric-onset type 2 diabetes; only one of these polymorphisms (CADM2/rs1307880) also showed a consistent effect in the case-sibling analysis. The associations in the combined analysis were as follows: ADORA1/rs903361 (OR 1.9, 95% CI 1.2; 3.0); CADM2/rs13078807 (OR 2.2, 95% CI 1.2; 4.0); GNPDA2/rs10938397 (OR 2.2, 95% CI 1.4; 3.7); VEGFA/rs6905288 (OR 1.4, 95% CI 1.1; 2.1) and FTO/rs9939609 (OR 1.8, 95% CI 1.0; 3.2). We also identified 16 polymorphisms nominally associated with quantitative traits in participants without diabetes. ADORA/rs903361, CADM2/rs13078807, GNPDA2/rs10938397, VEGFA/rs6905288 and FTO/rs9939609 are associated with an increased risk of pediatric-onset type 2 diabetes in the Mexican population.

  10. Single Nucleotide Polymorphisms Can Create Alternative Polyadenylation Signals and Affect Gene Expression through Loss of MicroRNA-Regulation

    PubMed Central

    Thomas, Laurent F.; Sætrom, Pål

    2012-01-01

    Alternative polyadenylation (APA) can for example occur when a protein-coding gene has several polyadenylation (polyA) signals in its last exon, resulting in messenger RNAs (mRNAs) with different 3′ untranslated region (UTR) lengths. Different 3′UTR lengths can give different microRNA (miRNA) regulation such that shortened transcripts have increased expression. The APA process is part of human cells' natural regulatory processes, but APA also seems to play an important role in many human diseases. Although altered APA in disease can have many causes, we reasoned that mutations in DNA elements that are important for the polyA process, such as the polyA signal and the downstream GU-rich region, can be one important mechanism. To test this hypothesis, we identified single nucleotide polymorphisms (SNPs) that can create or disrupt APA signals (APA-SNPs). By using a data-integrative approach, we show that APA-SNPs can affect 3′UTR length, miRNA regulation, and mRNA expression—both between homozygote individuals and within heterozygote individuals. Furthermore, we show that a significant fraction of the alleles that cause APA are strongly and positively linked with alleles found by genome-wide studies to be associated with disease. Our results confirm that APA-SNPs can give altered gene regulation and that APA alleles that give shortened transcripts and increased gene expression can be important hereditary causes for disease. PMID:22915998

  11. A panel of 130 autosomal single-nucleotide polymorphisms for ancestry assignment in five Asian populations and in Caucasians.

    PubMed

    Hwa, Hsiao-Lin; Lin, Chih-Peng; Huang, Tsun-Ying; Kuo, Po-Hsiu; Hsieh, Wei-Hsin; Lin, Chun-Yen; Yin, Hsiang-I; Tseng, Li-Hui; Lee, James Chun-I

    2017-06-01

    Ancestry informative single-nucleotide polymorphism (AISNP) panels for differentiating between East and Southeast Asian populations are scarce. This study aimed to identify AISNPs for ancestry assignment of five East and Southeast Asian populations, and Caucasians. We analyzed 145 autosomal SNPs of the 627 DNA samples from individuals of six populations (234 Taiwanese Han, 91 Filipinos, 79 Indonesians, 60 Thais, 71 Vietnamese, and 92 Caucasians) using arrays. The multiple logistic regression model and a multi-tier approach were used for ancestry classification. We observed that 130 AISNPs were effective for classifying the ethnic origins with fair accuracy. Among the 130 AISNPs, 122 were useful for stratification between these five Asian populations and 64 were effective for differentiating between Caucasians and these Asian populations. For differentiation between Caucasians and Asians, an accuracy rate of 100% was achieved in these 627 subjects with 50 optimal AISNPs among the 64 effective SNPs. For classification of the five Asian populations, the accuracy rates of ancestry inference using 20 to 57 SNPs for each of the two Asian populations ranged from 74.1% to 100%. Another 14 degraded DNA samples with incomplete profiling were analyzed, and the ancestry of 12 (85.7%) of those subjects was accurately assigned. We developed a 130-AISNP panel for ethnic origin differentiation between the five East and Southeast Asian populations and Caucasians. This AISNP set may be helpful for individual ancestral assignment of these populations in forensic casework.

  12. Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

    PubMed

    Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

    2017-11-01

    Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

  13. Association of arterial stiffness with single nucleotide polymorphism rs1333049 and metabolic risk factors.

    PubMed

    Phababpha, Suphawadee; Kukongviriyapan, Upa; Pakdeechote, Poungrat; Senggunprai, Laddawan; Kukongviriyapan, Veerapol; Settasatian, Chatri; Tatsanavivat, Pyatat; Intharaphet, Phongsak; Senthong, Vichai; Komanasin, Nantarat; Settasatian, Nongnuch; Greenwald, Stephen E

    2013-06-21

    Increased arterial stiffness is a cardiovascular outcome of metabolic syndrome (MetS). The chromosome 9p21 locus has been identified as a major locus for risk of coronary artery disease (CAD). The single nucleotide polymorphism (SNP), rs1333049 on chromosome 9p21.3 has been strongly associated with CAD and myocardial infarction. Increased arterial stiffness could be the link between the 9p21 polymorphism and increased cardiovascular risk. Since the impact of a genetic polymorphism on arterial stiffness especially in Asian populations has not been well defined, we aimed to investigate the association of arterial stiffness with rs 1333049 variant on chromosome 9p21.3 in Thai subjects with and without MetS risk factors. A total of 208 Thai subjects, aged 35-75 years, 135 with and 73 without MetS, according to IDF and NCEP-ATPIII criteria, were included in this study. Aortic-femoral pulse wave velocity (afPWV), brachial-ankle pulse wave velocity (baPWV) and aortic ankle pulse wave velocity (aaPWV) were measured and used as markers of arterial stiffness. The chromosome 9p21.3 locus, represented by the rs 1333049 variant and blood biochemistry were evaluated. Arterial stiffness was elevated in subjects with MetS when compared with nonMetS subjects. PWV, especially afPWV increased progressively with increasing number of MetS risk factors (r = 0.322, P <0.001). We also found that the frequency distribution of the rs1333049 genotypes is significantly associated with the afPWV (P <0.05). In multivariate analyses, there was an association between homozygous C allele and afPWV (Odds ratio (OR), 8.16; 95% confidence interval (CI), 1.91 to 34.90; P = 0.005), while the GC genotype was not related to afPWV (OR, 1.79; 95% CI, 0.84 to 3.77; P = 0.129) when compared with the GG genotype. Our findings demonstrate for the first time that arterial stiffness is associated with genetic polymorphism in 9p21 and metabolic risk factors in a Thai population.

  14. Clonal Lineages of Erysipelothrix rhusiopathiae Responsible for Acute Swine Erysipelas in Japan Identified by Using Genome-Wide Single-Nucleotide Polymorphism Analysis.

    PubMed

    Ogawa, Yohsuke; Shiraiwa, Kazumasa; Ogura, Yoshitoshi; Ooka, Tadasuke; Nishikawa, Sayaka; Eguchi, Masahiro; Hayashi, Tetsuya; Shimoji, Yoshihiro

    2017-06-01

    Erysipelothrix rhusiopathiae causes swine erysipelas, an important infectious disease in the swine industry. In Japan, the incidence of acute swine erysipelas due to E. rhusiopathiae serovar 1a has recently increased markedly. To study the genetic relatedness of the strains from the recent cases, we analyzed 34 E. rhusiopathiae serovar 1a swine isolates collected between 1990 and 2011 and further investigated the possible association of the live Koganei 65-0.15 vaccine strain (serovar 1a) with the increase in cases. Pulsed-field gel electrophoresis analysis revealed no marked variation among the isolates; however, sequencing analysis of a hypervariable region in the surface-protective antigen A gene ( spaA ) revealed that the strains isolated after 2007 exhibited the same spaA genotype and could be differentiated from older strains. Phylogenetic analysis based on genome-wide single-nucleotide polymorphisms (SNPs) revealed that the Japanese strains examined were closely related, showing a relatively small number of SNPs among them. The strains were classified into four major lineages, with Koganei 65-0.15 (lineage III) being phylogenetically separated from the other three lineages. The strains isolated after 2007 and the two older strains constituted one major lineage (lineage IV) with a specific spaA genotype (M203/I257-SpaA), while the recent isolates were further divided into two geographic groups. The remaining older isolates belonged to either lineage I, with the I203/L257-SpaA type, or lineage II, with the I203/I257-SpaA type. These results indicate that the recent increased incidence of acute swine erysipelas in Japan is associated with two sublineages of lineage IV, which have independently evolved in two different geographic regions. IMPORTANCE Using large-scale whole-genome sequence data from Erysipelothrix rhusiopathiae isolates from a wide range of hosts and geographic origins, a recent study clarified the existence of three distinct clades (clades 1, 2

  15. Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.).

    PubMed

    Diopere, Eveline; Hellemans, Bart; Volckaert, Filip A M; Maes, Gregory E

    2013-03-01

    Genomic methodologies applied in evolutionary and fisheries research have been of great benefit to understand the marine ecosystem and the management of natural resources. Although single nucleotide polymorphisms (SNPs) are attractive for the study of local adaptation, spatial stock management and traceability, and investigating the effects of fisheries-induced selection, they have rarely been exploited in non-model organisms. This is partly due to difficulties in finding and validating SNPs in species with limited or no genomic resources. Complementary to random genome-scan approaches, a targeted candidate gene approach has the potential to unveil pre-selected functional diversity and provides more in depth information on the action of selection at specific genes. For example genes can be under selective pressure due to climate change and sustained periods of heavy fishing pressure. In this study, we applied a candidate gene approach in sole (Solea solea L.), an important member of the demersal ecosystem. As consumption flatfish it is heavy exploited and has experienced associated life-history changes over the last 60years. To discover novel genetic polymorphisms in or around genes linked to important life history traits in sole, we screened a total of 76 candidate genes related to growth and maturation using a targeted resequencing approach. We identified in total 86 putative SNPs in 22 genes and validated 29 SNPs using a multiplex single-base extension genotyping assay. We found 22 informative SNPs, of which two represent non-synonymous mutations, potentially of functional relevance. These novel markers should be rapidly and broadly applicable in analyses of natural sole populations, as a measure of the evolutionary signature of overfishing and for initiatives on marker assisted selection. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

    PubMed

    Shirasu, Naoto; Kuroki, Masahide

    2014-01-01

    We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

  17. Single-nucleotide polymorphisms in the SEPTIN12 gene may be a genetic risk factor for Japanese patients with Sertoli cell-only syndrome.

    PubMed

    Miyakawa, Hiroe; Miyamoto, Toshinobu; Koh, Eitetsu; Tsujimura, Akira; Miyagawa, Yasushi; Saijo, Yasuaki; Namiki, Mikio; Sengoku, Kazuo

    2012-01-01

    Genetic mechanisms have been implicated as a cause of some cases of male infertility. Recently, 10 novel genes involved in human spermatogenesis, including human SEPTIN12, were identified by expression microarray analysis of human testicular tissue. Septin12 is a member of the septin family of conserved cytoskeletal GTPases that form heteropolymeric filamentous structures in interphase cells. It is expressed specifically in the testis. Therefore, we hypothesized that mutation or polymorphisms of SEPTIN12 participate in male infertility, especially Sertoli cell-only syndrome (SCOS). To investigate whether SEPTIN12 gene defects are associated with azoospermia caused by SCOS, mutational analysis was performed in 100 Japanese patients by direct sequencing of coding regions. Statistical analysis was performed in patients with SCOS and in 140 healthy control men. No mutations were found in SEPTIN12 ; however, 8 coding single-nucleotide polymorphisms (SNP1-SNP8) could be detected in the patients with SCOS. The genotype and allele frequencies in SNP3, SNP4, and SNP6 were notably higher in the SCOS group than in the control group (P < .001). These results suggest that SEPTIN12 might play a critical role in human spermatogenesis.

  18. Unique Structural and Nucleotide Exchange Features of the Rho1 GTPase of Entamoeba histolytica

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bosch, Dustin E.; Wittchen, Erika S.; Qiu, Connie

    The single-celled human parasite Entamoeba histolytica possesses a dynamic actin cytoskeleton vital for its intestinal and systemic pathogenicity. The E. histolytica genome encodes several Rho family GTPases known to regulate cytoskeletal dynamics. EhRho1, the first family member identified, was reported to be insensitive to the Rho GTPase-specific Clostridium botulinum C3 exoenzyme, raising the possibility that it may be a misclassified Ras family member. Here, we report the crystal structures of EhRho1 in both active and inactive states. EhRho1 is activated by a conserved switch mechanism, but diverges from mammalian Rho GTPases in lacking a signature Rho insert helix. EhRho1 engagesmore » a homolog of mDia, EhFormin1, suggesting a role in mediating serum-stimulated actin reorganization and microtubule formation during mitosis. EhRho1, but not a constitutively active mutant, interacts with a newly identified EhRhoGDI in a prenylation-dependent manner. Furthermore, constitutively active EhRho1 induces actin stress fiber formation in mammalian fibroblasts, thereby identifying it as a functional Rho family GTPase. EhRho1 exhibits a fast rate of nucleotide exchange relative to mammalian Rho GTPases due to a distinctive switch one isoleucine residue reminiscent of the constitutively active F28L mutation in human Cdc42, which for the latter protein, is sufficient for cellular transformation. Nonconserved, nucleotide-interacting residues within EhRho1, revealed by the crystal structure models, were observed to contribute a moderating influence on fast spontaneous nucleotide exchange. Collectively, these observations indicate that EhRho1 is a bona fide member of the Rho GTPase family, albeit with unique structural and functional aspects compared with mammalian Rho GTPases.« less

  19. Genetic findings and functional studies of human CYP3A5 single nucleotide polymorphisms in different ethnic groups.

    PubMed

    Lee, Su-Jun; Usmani, Khawja A; Chanas, Brian; Ghanayem, Burhan; Xi, Tina; Hodgson, Ernest; Mohrenweiser, Harvey W; Goldstein, Joyce A

    2003-08-01

    Genetic polymorphisms of cytochromes P450 (CYPs) are a principal reason for inter-individual variations in the metabolism of therapeutic drugs and environmental chemicals in humans. The present study identifies 34 single nucleotide polymorphisms (SNPs) of CYP3A5 including 27 previously unidentified SNPs by direct sequencing of the exons, intron-exon junctions and 5'-upstream region of CYP3A5 from 92 racially diverse individuals (24 Caucasians, 24 Africans, 24 Asians, and 20 individuals of unknown racial origin). Four new CYP3A5 SNPs produced coding changes: R28C, L82R, A337T, and F446S. CYP3A5 R28C occurred in African populations (allelic frequency of 4%). CYP3A5 A337T occurred in Asians (2% allelic frequency), CYP3A5 L82R (occurred in the racially unidentified group) and CYP3A5 F446S (identified in Caucasians with a 2% allelic frequency) were on an allele containing the splice change g.6986A>G known as CYP3A5*3. The newly identified allelic proteins were constructed by site-directed mutagenesis, expressed in Escherichia coli and purified. CYP3A5 L82R was expressed only as denatured CYP420, suggesting it may be unstable. CYP3A5*1 exhibited the highest maximal clearance for testosterone followed by CYP3A5 A337T > CYP3A5 R28C > CYP3A5 F446S. CYP3A5*1 exhibited a higher V(max) for nifedipine oxidation than CYP3A5 A337T > CYP3A5 R28C > CYP3A5 F446S. CYP3A5 A337T and CYP3A5 R28C exhibited a 42-64% lower V(max) for nifedipine oxidation than CYP3A5*1. CYP3A5 F446S exhibited a > 95% decrease in the intrinsic clearance for both 6beta-hydroxytestosterone and nifedipine oxidation. This study identifies four new potentially defective coding alleles. CYP3A5 F446S is predicted to be more catalytically defective than the splice change alone.

  20. Rapid single nucleotide polymorphism detection for personalized medicine applications using planar waveguide fluorescence sensors

    NASA Astrophysics Data System (ADS)

    Herron, James N.; Tolley, Samuel E.; Smith, Richard; Christensen, Douglas A.

    2006-02-01

    Personalized medicine is an emerging field in which clinical diagnostics information about a patient's genotype or phenotype is used to optimize his/her pharmacotherapy. This article evaluates whether planar waveguide fluorescent sensors are suitable for determining such information from patient testing in point-of-care (POC) settings. The model system was Long QT Syndrome, a congenital disease associated with single nucleotide polymorphisms (SNPs) in genes encoding for cardiac ion channels. Three different SNP assay formats were examined: DNA/DNA hybridization, DNA/PNA hybridization (PNA: "peptide nucleic acid"), and single base extension (SBEX). Although DNA/DNA hybridization produced a strong intensity-time response for both wildtype and SNP analytes in a 5-min assay at 32°C, their hybridization rates differed by only 32.7%, which was insufficient for clinical decision-making. Much better differentiation of the two rates was observed at 53°C, where the wildtype's hybridization rate was two-thirds of its maximum value, while that of the SNP was essentially zero. Such all-or-nothing resolution would be adequate for clinical decision-making; however, the elevated temperature and precise temperature control would be hard to achieve in a POC setting. Results from DNA/PNA hybridization studies were more promising. Nearly 20-fold discrimination between wildtype and SNP hybridization rates was observed in a 5-min assay at 30°C, although the low ionic strength conditions required necessitated a de-salting step between sample preparation and SNP detection. SBEX was the most promising of the three, determining the absolute identity of the suspected polymorphism in a 5-min assay at 40°C.

  1. Electroactive chitosan nanoparticles for the detection of single-nucleotide polymorphisms using peptide nucleic acids.

    PubMed

    Kerman, Kagan; Saito, Masato; Tamiya, Eiichi

    2008-08-01

    Here we report an electrochemical biosensor that would allow for simple and rapid analysis of nucleic acids in combination with nuclease activity on nucleic acids and electroactive bionanoparticles. The detection of single-nucleotide polymorphisms (SNPs) using PNA probes takes advantage of the significant structural and physicochemical differences between the full hybrids and SNPs in PNA/DNA and DNA/DNA duplexes. Ferrocene-conjugated chitosan nanoparticles (Chi-Fc) were used as the electroactive indicator of hybridization. Chi-Fc had no affinity towards the neutral PNA probe immobilized on a gold electrode (AuE) surface. When the PNA probe on the electrode surface hybridized with a full-complementary target DNA, Chi-Fc electrostatically attached to the negatively-charged phosphate backbone of DNA on the surface and gave rise to a high electrochemical oxidation signal from ferrocene at approximately 0.30 V. Exposing the surface to a single-stranded DNA specific nuclease, Nuclease S1, was found to be very effective for removing the nonspecifically adsorbed SNP DNA. An SNP in the target DNA to PNA made it susceptible to the enzymatic digestion. After the enzymatic digestion and subsequent exposure to Chi-Fc, the presence of SNPs was determined by monitoring the changes in the electrical current response of Chi-Fc. The method provided a detection limit of 1 fM (S/N = 3) for the target DNA oligonucleotide. Additionally, asymmetric PCR was employed to detect the presence of genetically modified organism (GMO) in standard Roundup Ready soybean samples. PNA-mediated PCR amplification of real DNA samples was performed to detect SNPs related to alcohol dehydrogenase (ALDH). Chitosan nanoparticles are promising biomaterials for various analytical and pharmaceutical applications.

  2. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    NASA Astrophysics Data System (ADS)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  3. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    PubMed Central

    Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver

    2017-01-01

    Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes. PMID:28341698

  4. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats.

    PubMed

    Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver

    2017-05-05

    Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade + reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2 FEN1 Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe , but contributes to DNA repeat stability in MMR-independent processes. Copyright © 2017 Villahermosa et al.

  5. Single nucleotide polymorphisms in obesity-related genes and the risk of esophageal cancers.

    PubMed

    Doecke, James D; Zhao, Zhen Zhen; Stark, Mitchell S; Green, Adèle C; Hayward, Nicholas K; Montgomery, Grant W; Webb, Penelope M; Whiteman, David C

    2008-04-01

    Rates of adenocarcinoma of the esophagus (EAC) and esophagogastric junction (EGJAC) have been rising rapidly in recent decades, in contrast to the declining rates of esophageal squamous cell carcinomas (ESCC). Obesity is a major risk factor for both EAC and EGJAC, but not ESCC, and there is speculation that obesity promotes adenocarcinoma development through endocrine and related pathways. We therefore compared the prevalence of 12 single nucleotide polymorphisms (SNPs) in nine candidate genes previously implicated in obesity pathways (LEP, LEPR, ADIPOQ, POMC, PPARalpha, PPARgamma, RXRgamma, GHRL, and INSIG2) in a large Australian case-control study comprising DNA samples from 260 EAC cases, 301 EGJAC cases, 213 ESCC cases, and 1,352 population controls. No SNPs were associated with EGJAC or ESCC. Although several SNPs seemed to be associated with EAC on crude analysis [ADIPOQ (rs1501299), LEP (5'-untranslated region), PPARgamma (H447H), and GHRL (M72L)], effect sizes were modest and none of the associations was significant after correcting for multiple comparisons. Further, we found no consistent evidence that any of the genotypes were associated with risk of EAC or EGJAC within strata of body mass index (<25.0 kg/m(2), 25.0-29.9 kg/m(2), >30 kg/m(2)). In conclusion, our data suggest that these SNPs do not play a major role in esophageal carcinogenesis.

  6. Segtor: Rapid Annotation of Genomic Coordinates and Single Nucleotide Variations Using Segment Trees

    PubMed Central

    Renaud, Gabriel; Neves, Pedro; Folador, Edson Luiz; Ferreira, Carlos Gil; Passetti, Fabio

    2011-01-01

    Various research projects often involve determining the relative position of genomic coordinates, intervals, single nucleotide variations (SNVs), insertions, deletions and translocations with respect to genes and their potential impact on protein translation. Due to the tremendous increase in throughput brought by the use of next-generation sequencing, investigators are routinely faced with the need to annotate very large datasets. We present Segtor, a tool to annotate large sets of genomic coordinates, intervals, SNVs, indels and translocations. Our tool uses segment trees built using the start and end coordinates of the genomic features the user wishes to use instead of storing them in a database management system. The software also produces annotation statistics to allow users to visualize how many coordinates were found within various portions of genes. Our system currently can be made to work with any species available on the UCSC Genome Browser. Segtor is a suitable tool for groups, especially those with limited access to programmers or with interest to analyze large amounts of individual genomes, who wish to determine the relative position of very large sets of mapped reads and subsequently annotate observed mutations between the reads and the reference. Segtor (http://lbbc.inca.gov.br/segtor/) is an open-source tool that can be freely downloaded for non-profit use. We also provide a web interface for testing purposes. PMID:22069465

  7. Profiling of Sugar Nucleotides.

    PubMed

    Rejzek, Martin; Hill, Lionel; Hems, Edward S; Kuhaudomlarp, Sakonwan; Wagstaff, Ben A; Field, Robert A

    2017-01-01

    Sugar nucleotides are essential building blocks for the glycobiology of all living organisms. Detailed information on the types of sugar nucleotides present in a particular cell and how they change as a function of metabolic, developmental, or disease status is vital. The extraction, identification, and quantification of sugar nucleotides in a given sample present formidable challenges. In this chapter, currently used techniques for sugar nucleotide extraction from cells, separation from complex biological matrices, and detection by optical and mass spectrometry methods are discussed. © 2017 Elsevier Inc. All rights reserved.

  8. A Primary Assembly of a Bovine Haplotype Block Map Based on a 15,036-Single-Nucleotide Polymorphism Panel Genotyped in Holstein–Friesian Cattle

    PubMed Central

    Khatkar, Mehar S.; Zenger, Kyall R.; Hobbs, Matthew; Hawken, Rachel J.; Cavanagh, Julie A. L.; Barris, Wes; McClintock, Alexander E.; McClintock, Sara; Thomson, Peter C.; Tier, Bruce; Nicholas, Frank W.; Raadsma, Herman W.

    2007-01-01

    Analysis of data on 1000 Holstein–Friesian bulls genotyped for 15,036 single-nucleotide polymorphisms (SNPs) has enabled genomewide identification of haplotype blocks and tag SNPs. A final subset of 9195 SNPs in Hardy–Weinberg equilibrium and mapped on autosomes on the bovine sequence assembly (release Btau 3.1) was used in this study. The average intermarker spacing was 251.8 kb. The average minor allele frequency (MAF) was 0.29 (0.05–0.5). Following recent precedents in human HapMap studies, a haplotype block was defined where 95% of combinations of SNPs within a region are in very high linkage disequilibrium. A total of 727 haplotype blocks consisting of ≥3 SNPs were identified. The average block length was 69.7 ± 7.7 kb, which is ∼5–10 times larger than in humans. These blocks comprised a total of 2964 SNPs and covered 50,638 kb of the sequence map, which constitutes 2.18% of the length of all autosomes. A set of tag SNPs, which will be useful for further fine-mapping studies, has been identified. Overall, the results suggest that as many as 75,000–100,000 tag SNPs would be needed to track all important haplotype blocks in the bovine genome. This would require ∼250,000 SNPs in the discovery phase. PMID:17435229

  9. Evidence from single nucleotide polymorphism analyses of ADVANCE study demonstrates EFNB3 as a hypertension risk gene.

    PubMed

    Tremblay, Johanne; Wang, Yujia; Raelson, John; Marois-Blanchet, Francois-Christophe; Wu, Zenghui; Luo, Hongyu; Bradley, Edward; Chalmers, John; Woodward, Mark; Harrap, Stephen; Hamet, Pavel; Wu, Jiangping

    2017-03-08

    EPH kinases and their ligands, ephrins (EFNs), have vital and diverse biological functions. We recently reported that Efnb3 gene deletion results in hypertension in female but not male mice. These data suggest that EFNB3 regulates blood pressure in a sex- and sex hormone-dependent way. In the present study, we conducted a human genetic study to assess the association of EFNB3 single nucleotide polymorphisms with human hypertension risks, using 3,448 patients with type 2 diabetes from the ADVANCE study (Action in Diabetes and Vascular Disease: Peterax and Diamicron MR Controlled Evaluation). We have observed significant association between 2 SNPs in the 3' untranslated region or within the adjacent region just 3' of the EFNB3 gene with hypertension, corroborating our findings from the mouse model. Thus, our investigation has shown that EFNB3 is a hypertension risk gene in certain individuals.

  10. Dissecting tocopherols content in maize (Zea mays L.), using two segregating populations and high-density single nucleotide polymorphism markers

    PubMed Central

    2012-01-01

    Background Tocopherols, which are vitamin E compounds, play an important role in maintaining human health. Compared with other staple foods, maize grains contain high level of tocopherols. Results Two F2 populations (K22/CI7 and K22/Dan340, referred to as POP-1 and POP-2, respectively), which share a common parent (K22), were developed and genotyped using a GoldenGate assay containing 1,536 single nucleotide polymorphism (SNP) markers. An integrated genetic linkage map was constructed using 619 SNP markers, spanning a total of 1649.03 cM of the maize genome with an average interval of 2.67 cM. Seventeen quantitative trait loci (QTLs) for all the traits were detected in the first map and 13 in the second. In these two maps, QTLs for different traits were localized to the same genomic regions and some were co-located with candidate genes in the tocopherol biosynthesis pathway. Single QTL was responsible for 3.03% to 52.75% of the phenotypic variation and the QTLs in sum explained23.4% to 66.52% of the total phenotypic variation. A major QTL (qc5-1/qd5-1) affecting α-tocopherol (αT) was identified on chromosome 5 between the PZA03161.1 and PZA02068.1 in the POP-2. The QTL region was narrowed down from 18.7 Mb to 5.4 Mb by estimating the recombination using high-density markers of the QTL region. This allowed the identification of the candidate gene VTE4 which encodes γ-tocopherol methyltransferase, an enzyme that transforms γ-tocopherol (γT)to αT. Conclusions These results demonstrate that a few QTLs with major effects and several QTLs with medium to minor effects might contribute to the natural variation of tocopherols in maize grain. The high-density markers will help to fine map and identify the QTLs with major effects even in the preliminary segregating populations. Furthermore, this study provides a simple guide line for the breeders to improve traits that minimize the risk of malnutrition, especially in developing countries. PMID:23122295

  11. Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

    PubMed Central

    O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

    2006-01-01

    Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

  12. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  13. Rapid Identification of Echinococcus granulosus and E. canadensis Using High-Resolution Melting (HRM) Analysis by Focusing on a Single Nucleotide Polymorphism.

    PubMed

    Safa, Ahmad Hosseini; Harandi, Majid Fasihi; Tajaddini, Mohammadhasan; Rostami-Nejad, Mohammad; Mohtashami-Pour, Mehdi; Pestehchian, Nader

    2016-07-22

    High-resolution melting (HRM) is a reliable and sensitive scanning method to detect variation in DNA sequences. We used this method to better understand the epidemiology and transmission of Echinococcus granulosus. We tested the use of HRM to discriminate the genotypes of E. granulosus and E. canadensis. One hundred forty-one hydatid cysts were collected from slaughtered animals in different parts of Isfahan-Iran in 2013. After DNA extraction, the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene was amplified using PCR coupled with the HRM curve. The result of HRM analysis using partial the sequences of cox1 gene revealed that 93, 35, and 2 isolates were identified as G1, G3, and G6 genotypes, respectively. A single nucleotide polymorphism (SNP) was found in locus 9867 of the cox1 gene. This is a critical locus for the differentiation between the G6 and G7 genotypes. In the phylogenic tree, the sample with a SNP was located between the G6 and G7 genotypes, which suggest that this isolate has a G6/G7 genotype. The HRM analysis developed in the present study provides a powerful technique for molecular and epidemiological studies on echinococcosis in humans and animals.

  14. IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non-syndromic cleft palate but not with cleft lip with or without palate in south Indian population.

    PubMed

    Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S

    2017-06-26

    Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  15. Identification of Splice Variants, Targeted MicroRNAs and Functional Single Nucleotide Polymorphisms of the BOLA-DQA2 Gene in Dairy Cattle

    PubMed Central

    Hou, Qinlei; Huang, Jinming; Ju, Zhihua; Li, Qiuling; Li, Liming; Wang, Changfa; Sun, Tao; Wang, Lingling; Hou, Minghai

    2012-01-01

    Major histocompatibility complex, class II, DQ alpha 2, also named BOLA-DQA2, belongs to the Bovine Leukocyte Antigen (BOLA) class II genes which are involved in the immune response. To explore the variability of the BOLA-DQA2 gene and resistance to mastitis in cows, the splice variants (SV), targeted microRNAs (miRNAs), and single nucleotide polymorphisms (SNPs) were identified in this study. A new SV (BOLA-DQA2-SV1) lacking part of exon 3 (195 bp) and two 3′-untranslated regions (UTR) (52 bp+167 bp) of the BOLA-DQA2 gene was found in the healthy and mastitis-infected mammary gland tissues. Four of 13 new SNPs and multiple nucleotide polymorphisms resulted in amino acid changes in the protein and SNP (c. +1283 C>T) may affect the binding to the seed sequence of bta-miR-2318. Further, we detected the relative expressions of two BOLA-DQA2 transcripts and five candidated microRNAs binding to the 3′-UTR of two transcripts in the mammary gland tissues in dairy cattle by using the quantitative real-time polymerase chain reaction. The result showed that expression of the BOLA-DQA2-SV1 mRNA was significantly upregulated 2.67-fold (p<0.05) in mastitis-infected mammary tissues (n=5) compared with the healthy mammary gland mammary tissues (n=5). Except for bta-miR-1777a, miRNA expression (bta-miR-296, miR-2430, and miR-671) was upregulated 1.75 to 2.59-fold (p<0.05), whereas miR-2318 was downregulated in the mastitis cows. Our findings reveal that BOLA-DQA2-SV1 may play an important role in the mastitis resistance in dairy cattle. Whether the SNPs affect the structure of the BOLA-DQA2 gene or association with mastitis resistance is unknown and warrants further investigation. PMID:22084936

  16. Detection of a single nucleotide polymorphism in the human alpha-lactalbumin gene: implications for human milk proteins.

    PubMed

    Chowanadisai, Winyoo; Kelleher, Shannon L; Nemeth, Jennifer F; Yachetti, Stephen; Kuhlman, Charles F; Jackson, Joan G; Davis, Anne M; Lien, Eric L; Lönnerdal, Bo

    2005-05-01

    Variability in the protein composition of breast milk has been observed in many women and is believed to be due to natural variation of the human population. Single nucleotide polymorphisms (SNPs) are present throughout the entire human genome, but the impact of this variation on human milk composition and biological activity and infant nutrition and health is unclear. The goals of this study were to characterize a variant of human alpha-lactalbumin observed in milk from a Filipino population by determining the location of the polymorphism in the amino acid and genomic sequences of alpha-lactalbumin. Milk and blood samples were collected from 20 Filipino women, and milk samples were collected from an additional 450 women from nine different countries. alpha-Lactalbumin concentration was measured by high-performance liquid chromatography (HPLC), and milk samples containing the variant form of the protein were identified with both HPLC and mass spectrometry (MS). The molecular weight of the variant form was measured by MS, and the location of the polymorphism was narrowed down by protein reduction, alkylation and trypsin digestion. Genomic DNA was isolated from whole blood, and the polymorphism location and subject genotype were determined by amplifying the entire coding sequence of human alpha-lactalbumin by PCR, followed by DNA sequencing. A variant form of alpha-lactalbumin was observed in HPLC chromatograms, and the difference in molecular weight was determined by MS (wild type=14,070 Da, variant=14,056 Da). Protein reduction and digestion narrowed the polymorphism between the 33rd and 77th amino acid of the protein. The genetic polymorphism was identified as adenine to guanine, which translates to a substitution from isoleucine to valine at amino acid 46. The frequency of variation was higher in milk from China, Japan and Philippines, which suggests that this polymorphism is most prevalent in Asia. There are SNPs in the genome for human milk proteins and their

  17. Use of causative variants and SNP weighting in a single-step GBLUP context

    USDA-ARS?s Scientific Manuscript database

    Much effort has been recently put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, aiming genomic prediction. Among the genomic methods available, single-step GBLUP (ssGBLUP) became the choice because of its simplicity and potentially higher accuracy. When QTN are ...

  18. Hamiltonian identifiability assisted by a single-probe measurement

    NASA Astrophysics Data System (ADS)

    Sone, Akira; Cappellaro, Paola

    2017-02-01

    We study the Hamiltonian identifiability of a many-body spin-1 /2 system assisted by the measurement on a single quantum probe based on the eigensystem realization algorithm approach employed in Zhang and Sarovar, Phys. Rev. Lett. 113, 080401 (2014), 10.1103/PhysRevLett.113.080401. We demonstrate a potential application of Gröbner basis to the identifiability test of the Hamiltonian, and provide the necessary experimental resources, such as the lower bound in the number of the required sampling points, the upper bound in total required evolution time, and thus the total measurement time. Focusing on the examples of the identifiability in the spin-chain model with nearest-neighbor interaction, we classify the spin-chain Hamiltonian based on its identifiability, and provide the control protocols to engineer the nonidentifiable Hamiltonian to be an identifiable Hamiltonian.

  19. Top single nucleotide polymorphisms affecting carbohydrate metabolism in metabolic syndrome: from the LIPGENE study.

    PubMed

    Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José

    2014-02-01

    Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.

  20. Accuracy of Assignment of Atlantic Salmon (Salmo salar L.) to Rivers and Regions in Scotland and Northeast England Based on Single Nucleotide Polymorphism (SNP) Markers

    PubMed Central

    Gilbey, John; Cauwelier, Eef; Coulson, Mark W.; Stradmeyer, Lee; Sampayo, James N.; Armstrong, Anja; Verspoor, Eric; Corrigan, Laura; Shelley, Jonathan; Middlemas, Stuart

    2016-01-01

    Understanding the habitat use patterns of migratory fish, such as Atlantic salmon (Salmo salar L.), and the natural and anthropogenic impacts on them, is aided by the ability to identify individuals to their stock of origin. Presented here are the results of an analysis of informative single nucleotide polymorphic (SNP) markers for detecting genetic structuring in Atlantic salmon in Scotland and NE England and their ability to allow accurate genetic stock identification. 3,787 fish from 147 sites covering 27 rivers were screened at 5,568 SNP markers. In order to identify a cost-effective subset of SNPs, they were ranked according to their ability to differentiate between fish from different rivers. A panel of 288 SNPs was used to examine both individual assignments and mixed stock fisheries and eighteen assignment units were defined. The results improved greatly on previously available methods and, for the first time, fish caught in the marine environment can be confidently assigned to geographically coherent units within Scotland and NE England, including individual rivers. As such, this SNP panel has the potential to aid understanding of the various influences acting upon Atlantic salmon on their marine migrations, be they natural environmental variations and/or anthropogenic impacts, such as mixed stock fisheries and interactions with marine power generation installations. PMID:27723810

  1. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    PubMed

    Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

    2016-01-01

    Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  2. Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

    PubMed Central

    Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

    2013-01-01

    Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

  3. High-density single nucleotide polymorphism (SNP) array mapping in Brassica oleracea: identification of QTL associated with carotenoid variation in broccoli florets.

    PubMed

    Brown, Allan F; Yousef, Gad G; Chebrolu, Kranthi K; Byrd, Robert W; Everhart, Koyt W; Thomas, Aswathy; Reid, Robert W; Parkin, Isobel A P; Sharpe, Andrew G; Oliver, Rebekah; Guzman, Ivette; Jackson, Eric W

    2014-09-01

    A high-resolution genetic linkage map of B. oleracea was developed from a B. napus SNP array. The work will facilitate genetic and evolutionary studies in Brassicaceae. A broccoli population, VI-158 × BNC, consisting of 150 F2:3 families was used to create a saturated Brassica oleracea (diploid: CC) linkage map using a recently developed rapeseed (Brassica napus) (tetraploid: AACC) Illumina Infinium single nucleotide polymorphism (SNP) array. The map consisted of 547 non-redundant SNP markers spanning 948.1 cM across nine chromosomes with an average interval size of 1.7 cM. As the SNPs are anchored to the genomic reference sequence of the rapid cycling B. oleracea TO1000, we were able to estimate that the map provides 96 % coverage of the diploid genome. Carotenoid analysis of 2 years data identified 3 QTLs on two chromosomes that are associated with up to half of the phenotypic variation associated with the accumulation of total or individual compounds. By searching the genome sequences of the two related diploid species (B. oleracea and B. rapa), we further identified putative carotenoid candidate genes in the region of these QTLs. This is the first description of the use of a B. napus SNP array to rapidly construct high-density genetic linkage maps of one of the constituent diploid species. The unambiguous nature of these markers with regard to genomic sequences provides evidence to the nature of genes underlying the QTL, and demonstrates the value and impact this resource will have on Brassica research.

  4. An integrated pipeline of open source software adapted for multi-CPU architectures: use in the large-scale identification of single nucleotide polymorphisms.

    PubMed

    Jayashree, B; Hanspal, Manindra S; Srinivasan, Rajgopal; Vigneshwaran, R; Varshney, Rajeev K; Spurthi, N; Eshwar, K; Ramesh, N; Chandra, S; Hoisington, David A

    2007-01-01

    The large amounts of EST sequence data available from a single species of an organism as well as for several species within a genus provide an easy source of identification of intra- and interspecies single nucleotide polymorphisms (SNPs). In the case of model organisms, the data available are numerous, given the degree of redundancy in the deposited EST data. There are several available bioinformatics tools that can be used to mine this data; however, using them requires a certain level of expertise: the tools have to be used sequentially with accompanying format conversion and steps like clustering and assembly of sequences become time-intensive jobs even for moderately sized datasets. We report here a pipeline of open source software extended to run on multiple CPU architectures that can be used to mine large EST datasets for SNPs and identify restriction sites for assaying the SNPs so that cost-effective CAPS assays can be developed for SNP genotyping in genetics and breeding applications. At the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), the pipeline has been implemented to run on a Paracel high-performance system consisting of four dual AMD Opteron processors running Linux with MPICH. The pipeline can be accessed through user-friendly web interfaces at http://hpc.icrisat.cgiar.org/PBSWeb and is available on request for academic use. We have validated the developed pipeline by mining chickpea ESTs for interspecies SNPs, development of CAPS assays for SNP genotyping, and confirmation of restriction digestion pattern at the sequence level.

  5. DNA Nucleotides Detection via capacitance properties of Graphene

    NASA Astrophysics Data System (ADS)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  6. Use of single-nucleotide polymorphisms (SNPs) to distinguish gene expression subtypes of chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME).

    PubMed

    Shimosako, Nana; Kerr, Jonathan R

    2014-12-01

    We have reported gene expression changes in patients with chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME) and the fact that such gene expression data can be used to identify subtypes of CFS/ME with distinct clinical phenotypes. Due to the difficulties in using a comparative gene expression method as an aid to CFS/ME disease and subtype-specific diagnosis, we have attempted to develop such a method based on single-nucleotide polymorphism (SNP) analysis. To identify SNP allele associations with CFS/ME and CFS/ME subtypes, we tested genomic DNA of patients with CFS/ME (n=108), patients with endogenous depression (n=17) and normal blood donors (n=68) for 504 human SNP alleles located within 88 CFS-associated human genes using the SNP Genotyping GoldenGate Assay (Illumina, San Diego, California, USA). 360 ancestry informative markers (AIM) were also examined. 21 SNPs were significantly associated with CFS/ME compared with depression and normal groups. 148 SNP alleles had a significant association with one or more CFS/ME subtypes. For each subtype, associated SNPs tended to be grouped together within particular genes. AIM SNPs indicated that 4 subjects were of Asian origin while the remainder were Caucasian. Hierarchical clustering of AIM data revealed the relatedness between 2 couples of patients with CFS only and confirmed the overall heterogeneity of all subjects. This study provides evidence that human SNPs located within CFS/ME associated genes are associated with particular genomic subtypes of CFS/ME. Further work is required to develop this into a clinically useful subtype-specific diagnostic test. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  7. High-throughput informative single nucleotide polymorphism-based typing of Neisseria gonorrhoeae using the Sequenom MassARRAY iPLEX platform.

    PubMed

    Trembizki, Ella; Smith, Helen; Lahra, Monica M; Chen, Marcus; Donovan, Basil; Fairley, Christopher K; Guy, Rebecca; Kaldor, John; Regan, David; Ward, James; Nissen, Michael D; Sloots, Theo P; Whiley, David M

    2014-06-01

    Neisseria gonorrhoeae antimicrobial resistance (AMR) is a global problem heightened by emerging resistance to ceftriaxone. Appropriate molecular typing methods are important for understanding the emergence and spread of N. gonorrhoeae AMR. We report on the development, validation and testing of a Sequenom MassARRAY iPLEX method for multilocus sequence typing (MLST)-style genotyping of N. gonorrhoeae isolates. An iPLEX MassARRAY method (iPLEX14SNP) was developed targeting 14 informative gonococcal single nucleotide polymorphisms (SNPs) previously shown to predict MLST types. The method was initially validated using 24 N. gonorrhoeae control isolates and was then applied to 397 test isolates collected throughout Queensland, Australia in the first half of 2012. The iPLEX14SNP method provided 100% accuracy for the control isolates, correctly identifying all 14 SNPs for all 24 isolates (336/336). For the 397 test isolates, the iPLEX14SNP assigned results for 5461 of the possible 5558 SNPs (SNP call rate 98.25%), with complete 14 SNP profiles obtained for 364 isolates. Based on the complete SNP profile data, there were 49 different sequence types identified in Queensland, with 11 of the 49 SNP profiles accounting for the majority (n = 280; 77%) of isolates. AMR was dominated by several geographically clustered sequence types. Using the iPLEX14SNP method, up to 384 isolates could be tested within 1 working day for less than Aus$10 per isolate. The iPLEX14SNP offers an accurate and high-throughput method for the MLST-style genotyping of N. gonorrhoeae and may prove particularly useful for large-scale studies investigating the emergence and spread of gonococcal AMR. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Clinical Relevance of Multiple Single-Nucleotide Polymorphisms in Pneumocystis jirovecii Pneumonia: Development of a Multiplex PCR-Single-Base-Extension Methodology▿

    PubMed Central

    Esteves, F.; Gaspar, J.; De Sousa, B.; Antunes, F.; Mansinho, K.; Matos, O.

    2011-01-01

    Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP. PMID:21389160

  9. Clinical relevance of multiple single-nucleotide polymorphisms in Pneumocystis jirovecii Pneumonia: development of a multiplex PCR-single-base-extension methodology.

    PubMed

    Esteves, F; Gaspar, J; De Sousa, B; Antunes, F; Mansinho, K; Matos, O

    2011-05-01

    Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP.

  10. Global Phylogeny of Mycobacterium tuberculosis Based on Single Nucleotide Polymorphism (SNP) Analysis: Insights into Tuberculosis Evolution, Phylogenetic Accuracy of Other DNA Fingerprinting Systems, and Recommendations for a Minimal Standard SNP Set†

    PubMed Central

    Filliol, Ingrid; Motiwala, Alifiya S.; Cavatore, Magali; Qi, Weihong; Hazbón, Manzour Hernando; Bobadilla del Valle, Miriam; Fyfe, Janet; García-García, Lourdes; Rastogi, Nalin; Sola, Christophe; Zozio, Thierry; Guerrero, Marta Inírida; León, Clara Inés; Crabtree, Jonathan; Angiuoli, Sam; Eisenach, Kathleen D.; Durmaz, Riza; Joloba, Moses L.; Rendón, Adrian; Sifuentes-Osornio, José; Ponce de León, Alfredo; Cave, M. Donald; Fleischmann, Robert; Whittam, Thomas S.; Alland, David

    2006-01-01

    We analyzed a global collection of Mycobacterium tuberculosis strains using 212 single nucleotide polymorphism (SNP) markers. SNP nucleotide diversity was high (average across all SNPs, 0.19), and 96% of the SNP locus pairs were in complete linkage disequilibrium. Cluster analyses identified six deeply branching, phylogenetically distinct SNP cluster groups (SCGs) and five subgroups. The SCGs were strongly associated with the geographical origin of the M. tuberculosis samples and the birthplace of the human hosts. The most ancestral cluster (SCG-1) predominated in patients from the Indian subcontinent, while SCG-1 and another ancestral cluster (SCG-2) predominated in patients from East Asia, suggesting that M. tuberculosis first arose in the Indian subcontinent and spread worldwide through East Asia. Restricted SCG diversity and the prevalence of less ancestral SCGs in indigenous populations in Uganda and Mexico suggested a more recent introduction of M. tuberculosis into these regions. The East African Indian and Beijing spoligotypes were concordant with SCG-1 and SCG-2, respectively; X and Central Asian spoligotypes were also associated with one SCG or subgroup combination. Other clades had less consistent associations with SCGs. Mycobacterial interspersed repetitive unit (MIRU) analysis provided less robust phylogenetic information, and only 6 of the 12 MIRU microsatellite loci were highly differentiated between SCGs as measured by GST. Finally, an algorithm was devised to identify two minimal sets of either 45 or 6 SNPs that could be used in future investigations to enable global collaborations for studies on evolution, strain differentiation, and biological differences of M. tuberculosis. PMID:16385065

  11. Identification of Pyrus single nucleotide polymorphisms (SNPs) and evaluation for genetic mapping in European pear and interspecific Pyrus hybrids.

    PubMed

    Montanari, Sara; Saeed, Munazza; Knäbel, Mareike; Kim, YoonKyeong; Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E; Crowhurst, Ross N; Chagné, David

    2013-01-01

    We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear ('Old Home'×'Louise Bon Jersey') and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality.

  12. Identification of Pyrus Single Nucleotide Polymorphisms (SNPs) and Evaluation for Genetic Mapping in European Pear and Interspecific Pyrus Hybrids

    PubMed Central

    Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E.; Crowhurst, Ross N.; Chagné, David

    2013-01-01

    We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear (‘Old Home’בLouise Bon Jersey’) and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality. PMID:24155917

  13. Prokaryotic Nucleotide Composition Is Shaped by Both Phylogeny and the Environment

    DOE PAGES

    Reichenberger, Erin R.; Rosen, Gail; Hershberg, Uri; ...

    2015-04-09

    Here, the causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences inmore » nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences—which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated.« less

  14. Single-nucleotide polymorphism discovery in Leptographium longiclavatum, a mountain pine beetle-associated symbiotic fungus, using whole-genome resequencing.

    PubMed

    Ojeda, Dario I; Dhillon, Braham; Tsui, Clement K M; Hamelin, Richard C

    2014-03-01

    Single-nucleotide polymorphisms (SNPs) are rapidly becoming the standard markers in population genomics studies; however, their use in nonmodel organisms is limited due to the lack of cost-effective approaches to uncover genome-wide variation, and the large number of individuals needed in the screening process to reduce ascertainment bias. To discover SNPs for population genomics studies in the fungal symbionts of the mountain pine beetle (MPB), we developed a road map to discover SNPs and to produce a genotyping platform. We undertook a whole-genome sequencing approach of Leptographium longiclavatum in combination with available genomics resources of another MPB symbiont, Grosmannia clavigera. We sequenced 71 individuals pooled into four groups using the Illumina sequencing technology. We generated between 27 and 30 million reads of 75 bp that resulted in a total of 1, 181 contigs longer than 2 kb and an assembled genome size of 28.9 Mb (N50 = 48 kb, average depth = 125x). A total of 9052 proteins were annotated, and between 9531 and 17,266 SNPs were identified in the four pools. A subset of 206 genes (containing 574 SNPs, 11% false positives) was used to develop a genotyping platform for this species. Using this roadmap, we developed a genotyping assay with a total of 147 SNPs located in 121 genes using the Illumina(®) Sequenom iPLEX Gold. Our preliminary genotyping (success rate = 85%) of 304 individuals from 36 populations supports the utility of this approach for population genomics studies in other MPB fungal symbionts and other fungal nonmodel species. © 2013 John Wiley & Sons Ltd.

  15. Single-nucleotide variants in two Hedgehog genes, SHH and HHIP, as genetic cause of combined pituitary hormone deficiency.

    PubMed

    Gorbenko del Blanco, Darya; de Graaff, Laura C G; Visser, Theo J; Hokken-Koelega, Anita C S

    2013-03-01

    Combined pituitary hormone deficiency (CPHD) is characterized by deficiencies of two or more anterior pituitary hormones. Its genetic cause is unknown in the majority of cases. The Hedgehog (Hh) signalling pathway has been implicated in disorders associated with pituitary development. Mutations in Sonic Hedgehog (SHH) have been described in patients with holoprosencephaly (with or without pituitary involvement). Hedgehog interacting protein (HHIP) has been associated with variations in adult height in genome wide association studies. We investigated whether mutations in these two genes of the Hh pathway, SHH and HHIP, could result in 'idiopathic' CPHD. We directly sequenced the coding regions and exon - intron boundaries of SHH and HHIP in 93 CPHD patients of the Dutch HYPOPIT study in whom mutations in the classical CPHD genes PROP1, POU1F1, HESX1, LHX3 and LHX4 had been ruled out. We compared the expression of Hh genes in Hep3B transfected cells between wild-type proteins and mutants. We identified three single-nucleotide variants (p.Ala226Thr, c.1078C>T and c.*8G>T) in SHH. The function of the latter was severely affected in our in vitro assay. In HHIP, we detected a new activating variant c.-1G>C, which increases HHIP's inhibiting function on the Hh pathway. Our results suggest involvement of the Hedgehog pathway in CPHD. We suggest that both SHH and HHIP are investigated as a second screening in CPHD, after mutations in the classical CPHD genes have been ruled out. © 2012 Blackwell Publishing Ltd.

  16. Financial and Psychological Risk Attitudes Associated with Two Single Nucleotide Polymorphisms in the Nicotine Receptor (CHRNA4) Gene

    PubMed Central

    Roe, Brian E.; Tilley, Michael R.; Gu, Howard H.; Beversdorf, David Q.; Sadee, Wolfgang; Haab, Timothy C.; Papp, Audrey C.

    2009-01-01

    With recent advances in understanding of the neuroscience of risk taking, attention is now turning to genetic factors that may contribute to individual heterogeneity in risk attitudes. In this paper we test for genetic associations with risk attitude measures derived from both the psychology and economics literature. To develop a long-term prospective study, we first evaluate both types of risk attitudes and find that the economic and psychological measures are poorly correlated, suggesting that different genetic factors may underlie human response to risk faced in different behavioral domains. We then examine polymorphisms in a spectrum of candidate genes that affect neurotransmitter systems influencing dopamine regulation or are thought to be associated with risk attitudes or impulsive disorders. Analysis of the genotyping data identified two single nucleotide polymorphisms (SNPs) in the gene encoding the alpha 4 nicotine receptor (CHRNA4, rs4603829 and rs4522666) that are significantly associated with harm avoidance, a risk attitude measurement drawn from the psychology literature. Novelty seeking, another risk attitude measure from the psychology literature, is associated with several COMT (catechol-O-methyl transferase) SNPs while economic risk attitude measures are associated with several VMAT2 (vesicular monoamine transporter) SNPs, but the significance of these associations did not withstand statistical adjustment for multiple testing and requires larger cohorts. These exploratory results provide a starting point for understanding the genetic basis of risk attitudes by considering the range of methods available for measuring risk attitudes and by searching beyond the traditional direct focus on dopamine and serotonin receptor and transporter genes. PMID:19693267

  17. Precise Estimation of Allele Frequencies of Single-Nucleotide Polymorphisms by a Quantitative SSCP Analysis of Pooled DNA

    PubMed Central

    Sasaki, Tomonari; Tahira, Tomoko; Suzuki, Akari; Higasa, Koichiro; Kukita, Yoji; Baba, Shingo; Hayashi, Kenshi

    2001-01-01

    We show that single-nucleotide polymorphisms (SNPs) of moderate to high heterozygosity (minor allele frequencies >10%) can be efficiently detected, and their allele frequencies accurately estimated, by pooling the DNA samples and applying a capillary-based SSCP analysis. In this method, alleles are separated into peaks, and their frequencies can be reliably and accurately quantified from their peak heights (SD <1.8%). We found that as many as 40% of publicly available SNPs that were analyzed by this method have widely differing allele frequency distributions among groups of different ethnicity (parents of Centre d'Etude Polymorphisme Humaine families vs. Japanese individuals). These results demonstrate the effectiveness of the present pooling method in the reevaluation of candidate SNPs that have been collected by examination of limited numbers of individuals. The method should also serve as a robust quantitative technique for studies in which a precise estimate of SNP allele frequencies is essential—for example, in linkage disequilibrium analysis. PMID:11083945

  18. The allele frequency of two single nucleotide polymorphisms in the von Hippel-Lindau (VHL) tumor suppressor gene in the Taiwanese population.

    PubMed

    Wang, Wen-Chung; Chen, Hui-Ju; Shu, Wei-Pang; Tsai, Yi-Chang; Lai, Yen-Chein

    2011-10-01

    The von Hippel-Lindau (VHL) tumor suppressor gene located on chromosome 3p25-26 is implicated in VHL disease. Two informative single nucleotide polymorphisms are at positions 19 and 1149 on the nucleotide sequence from Gene Bank NM_000551. In this study we examined the allele frequencies at these two loci in the Taiwanese population and compared the results to those from European ethnic populations. The allele frequency was examined in 616 healthy individuals including 301 university students and 315 neonates. Both A/G polymorphisms were investigated using restriction fragment length polymorphism analysis created by restriction enzymes, BsaJ I and Acc I. Among these subjects, the allele frequencies at 19 SNP and 1149 SNP for variant G were 0.130 and 0.133, respectively. And these results were significant differences from those of the Caucasian populations. In addition, 90% of the tested subjects had identical genotypes at these two loci suggesting the existence of nonrandom association of alleles. We found that the G allele frequency at these two loci in the Taiwanese population is much lower than that in people from Western countries. This phenomenon may be attributed to ethnic effects. Copyright © 2011. Published by Elsevier B.V.

  19. Identification of relevant single-nucleotide polymorphisms in Pneumocystis jirovecii: relationship with clinical data.

    PubMed

    Esteves, F; Gaspar, J; Marques, T; Leite, R; Antunes, F; Mansinho, K; Matos, O

    2010-07-01

    Pneumocystis jirovecii is a poorly understood pathogen that causes opportunistic pneumonia (Pneumocystis pneumonia (PcP)) in patients with AIDS. The present study was aimed at correlating genetic differences in P. jirovecii isolates and clinical patient data. A description of genetic diversity in P. jirovecii isolates from human immunodeficiency virus-positive patients, based on the identification of multiple single-nucleotide polymorphisms (SNPs) at five distinct loci encoding mitochondrial large-subunit rRNA (mtLSU rRNA), cytochrome b (CYB), superoxide dismutase (SOD), dihydrofolate reductase (DHFR), and dihydropteroate synthase (DHPS), was achieved using PCR with DNA sequencing and restriction fragment length polymorphism analysis. The statistical analysis revealed several interesting correlations among the four most relevant SNPs (mt85, SOD110, SOD215, and DHFR312) and specific clinical parameters: mt85C was associated with undiagnosed or atypical PcP episodes and favourable follow-up; SOD215C was associated with favourable follow-up; and DHFR312T was associated with PcP cases presenting moderate to high parasite burdens. The genotypes mt85C/SOD215C and SOD110T/SOD215C were found to be associated with less virulent P. jirovecii infections, whereas the genotype SOD110T/SOD215T was found to be related to more virulent PcP episodes. The present work demonstrated that potential P. jirovecii haplotypes may be related to the clinical data and outcome of PcP.

  20. Nano-enabled bioanalytical approaches to ultrasensitive detection of low abundance single nucleotide polymorphisms

    PubMed Central

    Lapitan Jr., Lorico D. S.; Guo, Yuan

    2015-01-01

    Single nucleotide polymorphisms (SNPs) constitute the most common types of genetic variations in the human genome. A number of SNPs have been linked to the development of life threatening diseases including cancer, cardiovascular diseases and neurodegenerative diseases. The ability for ultrasensitive and accurate detection of low abundant disease-related SNPs in bodily fluids (e.g. blood, serum, etc.) holds a significant value in the development of non-invasive future biodiagnostic tools. Over the past two decades, nanomaterials have been utilized in a myriad of biosensing applications due to their ability of detecting extremely low quantities of biologically important biomarkers with high sensitivity and accuracy. Of particular interest is the application of such technologies in the detection of SNPs. The use of various nanomaterials, coupled with different powerful signal amplification strategies, has paved the way for a new generation of ultrasensitive SNP biodiagnostic assays. Over the past few years, several ultrasensitive SNP biosensors capable of detecting specific targets down to the ultra-low regimes (ca. aM and below) and therefore holding great promises for early clinical diagnosis of diseases have been developed. This mini review will highlight some of the most recent, significant advances in nanomaterial-based ultrasensitive SNP sensing technologies capable of detecting specific targets on the attomolar (10–18 M) regime or below. In particular, the design of novel, powerful signal amplification strategies that hold the key to the ultrasensitivity is highlighted. PMID:25785914

  1. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    PubMed Central

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John J; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M; Asmann, Yan W; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I; Bertrand, Kimberly A; Birmann, Brenda M; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M; Brennan, Paul; Brooks-Wilson, Angela R; Cerhan, James R; Chanock, Stephen J; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J; de Sanjose, Silvia; Di Lollo, Simonetta; Diver, W Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G; Glimelius, Bengt; Habermann, Thomas M; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R; Holly, Elizabeth A; Jackson, Rebecca D; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S; Klein, Robert J; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry J; Monnereau, Alain; Morton, Lindsay M; Nieters, Alexandra; North, Kari E; Novak, Anne J; Offit, Kenneth; Purdue, Mark P; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K; Skibola, Christine F; Slager, Susan L; Smith, Alex; Smith, Martyn T; Southey, Melissa C; Staines, Anthony; Teras, Lauren R; Thompson, Carrie A; Tilly, Hervé; Tinker, Lesley F; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL. Methods GWAS data on European Caucasians from the International Lymphoma Epidemiology Consortium (InterLymph) provided a total of 3857 DLBCL cases and 7666 general-population controls. Data were pooled in a random-effects meta-analysis. Results Among the 28 SLE-related SNPs investigated, the two most convincingly associated with risk of DLBCL included the CD40 SLE risk allele rs4810485 on chromosome 20q13 (OR per risk allele=1.09, 95% CI 1.02 to 1.16, p=0.0134), and the HLA SLE risk allele rs1270942 on chromosome 6p21.33 (OR per risk allele=1.17, 95% CI 1.01 to 1.36, p=0.0362). Of additional possible interest were rs2205960 and rs12537284. The rs2205960 SNP, related to a cytokine of the tumour necrosis factor superfamily TNFSF4, was associated with an OR per risk allele of 1.07, 95% CI 1.00 to 1.16, p=0.0549. The OR for the rs12537284 (chromosome 7q32, IRF5 gene) risk allele was 1.08, 95% CI 0.99 to 1.18, p=0.0765. Conclusions These data suggest several plausible genetic links between DLBCL and SLE. PMID:29214033

  2. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  3. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  4. Single nucleotide polymorphisms in CETP, SLC46A1, SLC19A1, CD36, BCOM1, APOA5, and ABCA1 are significant predictors of plasma HDL in healthy adults

    USDA-ARS?s Scientific Manuscript database

    In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...

  5. Deep sequencing revealed genome-wide single-nucleotide polymorphism and plasmid content of Erwinia amylovora strains isolated in Middle Atlas, Morocco.

    PubMed

    Hannou, Najat; Mondy, Samuel; Planamente, Sara; Moumni, Mohieddine; Llop, Pablo; López, María; Manceau, Charles; Barny, Marie-Anne; Faure, Denis

    2013-10-01

    Erwinia amylovora causes economic losses that affect pear and apple production in Morocco. Here, we report comparative genomics of four Moroccan E. amylovora strains with the European strain CFBP1430 and North-American strain ATCC49946. Analysis of single nucleotide polymorphisms (SNPs) revealed genetic homogeneity of Moroccan's strains and their proximity to the European strain CFBP1430. Moreover, the collected sequences allowed the assembly of a 65 kpb plasmid, which is highly similar to the plasmid pEI70 harbored by several European E. amylovora isolates. This plasmid was found in 33% of the 40 E. amylovora strains collected from several host plants in 2009 and 2010 in Morocco. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  6. Association of arterial stiffness with single nucleotide polymorphism rs1333049 and metabolic risk factors

    PubMed Central

    2013-01-01

    Background Increased arterial stiffness is a cardiovascular outcome of metabolic syndrome (MetS). The chromosome 9p21 locus has been identified as a major locus for risk of coronary artery disease (CAD). The single nucleotide polymorphism (SNP), rs1333049 on chromosome 9p21.3 has been strongly associated with CAD and myocardial infarction. Increased arterial stiffness could be the link between the 9p21 polymorphism and increased cardiovascular risk. Since the impact of a genetic polymorphism on arterial stiffness especially in Asian populations has not been well defined, we aimed to investigate the association of arterial stiffness with rs 1333049 variant on chromosome 9p21.3 in Thai subjects with and without MetS risk factors. Methods A total of 208 Thai subjects, aged 35–75 years, 135 with and 73 without MetS, according to IDF and NCEP-ATPIII criteria, were included in this study. Aortic-femoral pulse wave velocity (afPWV), brachial-ankle pulse wave velocity (baPWV) and aortic ankle pulse wave velocity (aaPWV) were measured and used as markers of arterial stiffness. The chromosome 9p21.3 locus, represented by the rs 1333049 variant and blood biochemistry were evaluated. Results Arterial stiffness was elevated in subjects with MetS when compared with nonMetS subjects. PWV, especially afPWV increased progressively with increasing number of MetS risk factors (r = 0.322, P <0.001). We also found that the frequency distribution of the rs1333049 genotypes is significantly associated with the afPWV (P <0.05). In multivariate analyses, there was an association between homozygous C allele and afPWV (Odds ratio (OR), 8.16; 95% confidence interval (CI), 1.91 to 34.90; P = 0.005), while the GC genotype was not related to afPWV (OR, 1.79; 95% CI, 0.84 to 3.77; P = 0.129) when compared with the GG genotype. Conclusions Our findings demonstrate for the first time that arterial stiffness is associated with genetic polymorphism in 9p21 and metabolic risk factors in a Thai

  7. A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing.

    PubMed

    Gao, Guangtu; Nome, Torfinn; Pearse, Devon E; Moen, Thomas; Naish, Kerry A; Thorgaard, Gary H; Lien, Sigbjørn; Palti, Yniv

    2018-01-01

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout ( Oncorhynchus mykiss ), SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL) and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway) that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU) and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1) which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup , followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs) and multi-sequence variants (MSVs). Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25). The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and heterozygosity

  8. Antinociceptive effect of purine nucleotides.

    PubMed

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  9. Associations between novel single nucleotide polymorphisms in the Bos taurus growth hormone gene and performance traits in Holstein-Friesian dairy cattle.

    PubMed

    Mullen, M P; Berry, D P; Howard, D J; Diskin, M G; Lynch, C O; Berkowicz, E W; Magee, D A; MacHugh, D E; Waters, S M

    2010-12-01

    Growth hormone, produced in the anterior pituitary gland, stimulates the release of insulin-like growth factor-I from the liver and is of critical importance in the control of nutrient utilization and partitioning for lactogenesis, fertility, growth, and development in cattle. The aim of this study was to discover novel polymorphisms in the bovine growth hormone gene (GH1) and to quantify their association with performance using estimates of genetic merit on 848 Holstein-Friesian AI (artificial insemination) dairy sires. Associations with previously reported polymorphisms in the bovine GH1 gene were also undertaken. A total of 38 novel single nucleotide polymorphisms (SNP) were identified across a panel of 22 beef and dairy cattle by sequence analysis of the 5' promoter, intronic, exonic, and 3' regulatory regions, encompassing approximately 7 kb of the GH1 gene. Following multiple regression analysis on all SNP, associations were identified between 11 SNP (2 novel and 9 previously identified) and milk fat and protein yield, milk composition, somatic cell score, survival, body condition score, and body size. The G allele of a previously identified SNP in exon 5 at position 2141 of the GH1 sequence, resulting in a nonsynonymous substitution, was associated with decreased milk protein yield. The C allele of a novel SNP, GH32, was associated with inferior carcass conformation. In addition, the T allele of a previously characterized SNP, GH35, was associated with decreased survival. Both GH24 (novel) and GH35 were independently associated with somatic cell count, and 3 SNP, GH21, 2291, and GH35, were independently associated with body depth. Furthermore, 2 SNP, GH24 and GH63, were independently associated with carcass fat. Results of this study further demonstrate the multifaceted influences of GH1 on milk production, fertility, and growth-related traits in cattle. Copyright © 2010 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. Single Nucleotide Polymorphism in ATM Gene, Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study

    PubMed Central

    Shen, Li; Yin, Zhihua; Wu, Wei; Ren, Yangwu; Li, Xuelian; Zhou, Baosen

    2014-01-01

    Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism, environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained, 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44, 95% confidence interval (CI) 1.02–2.02, P = 0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89, 95%CI 1.03–3.49, P = 0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore, ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. PMID:24819391

  11. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    PubMed

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  12. Nucleotide-binding oligomerization domain containing 1 (NOD1) haplotypes and single nucleotide polymorphisms modify susceptibility to inflammatory bowel diseases in a New Zealand caucasian population: a case-control study

    PubMed Central

    Huebner, Claudia; Ferguson, Lynnette R; Han, Dug Yeo; Philpott, Martin; Barclay, Murray L; Gearry, Richard B; McCulloch, Alan; Demmers, Pieter S; Browning, Brian L

    2009-01-01

    Background The nucleotide-binding oligomerization domain containing 1 (NOD1) gene encodes a pattern recognition receptor that senses pathogens, leading to downstream responses characteristic of innate immunity. We investigated the role of NOD1 single nucleotide polymorphisms (SNPs) on IBD risk in a New Zealand Caucasian population, and studied Nod1 expression in response to bacterial invasion in the Caco2 cell line. Findings DNA samples from 388 Crohn's disease (CD), 405 ulcerative colitis (UC), 27 indeterminate colitis patients and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common SNPs in NOD1, using the MassARRAY® iPLEX Gold assay. Transcriptional activation of the protein produced by NOD1 (Nod1) was studied after infection of Caco2 cells with Escherichia coli LF82. Carrying the rs2075818 G allele decreased the risk of CD (OR = 0.66, 95% CI = 0.50–0.88, p < 0.002) but not UC. There was an increased frequency of the three SNP (rs2075818, rs2075822, rs2907748) haplotype, CTG (p = 0.004) and a decreased frequency of the GTG haplotype (p = 0.02).in CD. The rs2075822 CT or TT genotypes were at an increased frequency (genotype p value = 0.02), while the rs2907748 AA or AG genotypes showed decreased frequencies in UC (p = 0.04), but not in CD. Functional assays showed that Nod1 is produced 6 hours after bacterial invasion of the Caco2 cell line. Conclusion The NOD1 gene is important in signalling invasion of colonic cells by pathogenic bacteria, indicative of its' key role in innate immunity. Carrying specific SNPs in this gene significantly modifies the risk of CD and/or UC in a New Zealand Caucasian population. PMID:19327158

  13. A Heroin Addiction Severity-Associated Intronic Single Nucleotide Polymorphism Modulates Alternative Pre-mRNA Splicing of the μ Opioid Receptor Gene OPRM1 via hnRNPH Interactions

    PubMed Central

    Xu, Jin; Lu, Zhigang; Xu, Mingming; Pan, Ling; Deng, Yi; Xie, Xiaohu; Liu, Huifen; Ding, Shixiong; Hurd, Yasmin L.; Pasternak, Gavril W.; Klein, Robert J.; Cartegni, Luca

    2014-01-01

    Single nucleotide polymorphisms (SNPs) in the OPRM1 gene have been associated with vulnerability to opioid dependence. The current study identifies an association of an intronic SNP (rs9479757) with the severity of heroin addiction among Han-Chinese male heroin addicts. Individual SNP analysis and haplotype-based analysis with additional SNPs in the OPRM1 locus showed that mild heroin addiction was associated with the AG genotype, whereas severe heroin addiction was associated with the GG genotype. In vitro studies such as electrophoretic mobility shift assay, minigene, siRNA, and antisense morpholino oligonucleotide studies have identified heterogeneous nuclear ribonucleoprotein H (hnRNPH) as the major binding partner for the G-containing SNP site. The G-to-A transition weakens hnRNPH binding and facilitates exon 2 skipping, leading to altered expressions of OPRM1 splice-variant mRNAs and hMOR-1 proteins. Similar changes in splicing and hMOR-1 proteins were observed in human postmortem prefrontal cortex with the AG genotype of this SNP when compared with the GG genotype. Interestingly, the altered splicing led to an increase in hMOR-1 protein levels despite decreased hMOR-1 mRNA levels, which is likely contributed by a concurrent increase in single transmembrane domain variants that have a chaperone-like function on MOR-1 protein stability. Our studies delineate the role of this SNP as a modifier of OPRM1 alternative splicing via hnRNPH interactions, and suggest a functional link between an SNP-containing splicing modifier and the severity of heroin addiction. PMID:25122903

  14. Gold nanoparticle enhanced fluorescence anisotropy for the assay of single nucleotide polymorphisms (SNPs) based on toehold-mediated strand-displacement reaction.

    PubMed

    Wang, Xinyi; Zou, Mingjian; Huang, Hongduan; Ren, Yuqian; Li, Limei; Yang, Xiaoda; Li, Na

    2013-03-15

    We developed a highly differentiating, homogeneous gold nanoparticle (AuNP) enhanced fluorescence anisotropic method for single nucleotide polymorphism (SNP) detection at nanomolar level using toehold-mediated strand-displacement reaction. The template strand, containing a toehold domain with an allele-specific site, was immobilized on the surface of AuNPs, and the solution fluorescence anisotropy was markedly enhanced when the fluorescein-labeled blocking DNA was attached to the AuNP via hybridization. Strand-displacement by the target ssDNA strand resulted in detachment of fluorescein-labeled DNA from AuNPs, and thus decreased fluorescence anisotropy. The drastic kinetic difference in strand-displacement from toehold design was used to distinguish between the perfectly matched and the single-base mismatched strands. Free energy changes were calculated to elucidate the dependence of the differentiation ability on the mutation site in the toehold region. A solid negative signal change can be obtained for single-base mismatched strand in the dynamic range of the calibration curve, and a more than 10-fold signal difference can still be observed in a mixed solution containing 100 times the single-base mismatched strand, indicating the good specificity of the method. This proposed method can be performed with a standard spectrofluorimeter in a homogeneous and cost-effective manner, and has the potential to be extended to the application of fluorescence anisotropy method of SNP detection. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    PubMed Central

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  16. Prokaryotic nucleotide composition is shaped by both phylogeny and the environment.

    PubMed

    Reichenberger, Erin R; Rosen, Gail; Hershberg, Uri; Hershberg, Ruth

    2015-04-09

    The causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences in nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences-which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. OncoNEM: inferring tumor evolution from single-cell sequencing data.

    PubMed

    Ross, Edith M; Markowetz, Florian

    2016-04-15

    Single-cell sequencing promises a high-resolution view of genetic heterogeneity and clonal evolution in cancer. However, methods to infer tumor evolution from single-cell sequencing data lag behind methods developed for bulk-sequencing data. Here, we present OncoNEM, a probabilistic method for inferring intra-tumor evolutionary lineage trees from somatic single nucleotide variants of single cells. OncoNEM identifies homogeneous cellular subpopulations and infers their genotypes as well as a tree describing their evolutionary relationships. In simulation studies, we assess OncoNEM's robustness and benchmark its performance against competing methods. Finally, we show its applicability in case studies of muscle-invasive bladder cancer and essential thrombocythemia.

  18. Association between ErbB4 single nucleotide polymorphisms and susceptibility to schizophrenia: A meta-analysis of case-control studies.

    PubMed

    Feng, Yanguo; Cheng, Dejun; Zhang, Chaofeng; Li, Yuchun; Zhang, Zhiying; Wang, Juan; Feng, Xiao

    2017-02-01

    Accumulating studies have reported inconsistent association between ErbB4 single nucleotide polymorphisms (SNPs) and predisposition to schizophrenia. To better interpret this issue, here we conducted a meta-analysis using published case-control studies. We conducted a systematic search of MEDLINE (Pubmed), Embase (Ovid), Web of Science (Thomson-Reuters) to identify relevant references. The association between ErbB4 SNPs and schizophrenia was assessed by odds ratios (ORs) and 95% confidence intervals (CIs). Between-study heterogeneity was evaluated by I squared (I) statistics and Cochran's Q test. To appraise the stability of results, we employed sensitivity analysis by omitting 1 single study each time. To assess the potential publication bias, we conducted trim and fill analysis. Seven studies published in English comprising 3162 cases and 4264 controls were included in this meta-analysis. Meta-analyses showed that rs707284 is statistically significantly associated with schizophrenia susceptibility among Asian and Caucasian populations under the allelic model (OR = 0.91, 95% CI: 0.83-0.99, P = 0.035). Additionally, a marginal association (P < 0.1) was observed between rs707284 and schizophrenia risk among Asian and Caucasian populations under the recessive (OR = 0.85, 95% CI: 0.72-1.01, P = 0.065) and homozygous (OR = 0.84, 95% CI: 0.68-1.03, P = 0.094) models. In the Asian subgroup, rs707284 was also noted to be marginally associated with schizophrenia under the recessive model (OR = 0.84, 95% CI: 0.70-1.00, P = 0.053). However, no statistically significant association was found between rs839523, rs7598440, rs3748962, and rs2371276 and schizophrenia risk. This meta-analysis suggested that rs707284 may be a potential ErbB4 SNP associated with susceptibility to schizophrenia. Nevertheless, due to the limited sample size in this meta-analysis, more large-scale association studies are still needed to confirm the results.

  19. Extension of the COG and arCOG databases by amino acid and nucleotide sequences

    PubMed Central

    Meereis, Florian; Kaufmann, Michael

    2008-01-01

    Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

  20. A novel approach to exploring potential interactions among single-nucleotide polymorphisms of inflammation genes in gliomagenesis: an exploratory case-only study.

    PubMed

    Amirian, E Susan; Scheurer, Michael E; Liu, Yanhong; D'Amelio, Anthony M; Houlston, Richard S; Etzel, Carol J; Shete, Sanjay; Swerdlow, Anthony J; Schoemaker, Minouk J; McKinney, Patricia A; Fleming, Sarah J; Muir, Kenneth R; Lophatananon, Artitaya; Bondy, Melissa L

    2011-08-01

    Despite extensive research on the topic, glioma etiology remains largely unknown. Exploration of potential interactions between single-nucleotide polymorphisms (SNP) of immune genes is a promising new area of glioma research. The case-only study design is a powerful and efficient design for exploring possible multiplicative interactions between factors that are independent of one another. The purpose of our study was to use this exploratory design to identify potential pair wise SNP-SNP interactions from genes involved in several different immune-related pathways for investigation in future studies. The study population consisted of two case groups: 1,224 histologic confirmed, non-Hispanic white glioma cases from the United States and a validation population of 634 glioma cases from the United Kingdom. Polytomous logistic regression, in which one SNP was coded as the outcome and the other SNP was included as the exposure, was utilized to calculate the ORs of the likelihood of cases simultaneously having the variant alleles of two different SNPs. Potential interactions were examined only between SNPs located in different genes or chromosomes. Using this data mining strategy, we found 396 significant SNP-SNP interactions among polymorphisms of immune-related genes that were present in both the U.S. and U.K. study populations. This exploratory study was conducted for the purpose of hypothesis generation, and thus has provided several new hypotheses that can be tested using traditional case-control study designs to obtain estimates of risk. This is the first study, to our knowledge, to take this novel approach to identifying SNP-SNP interactions relevant to glioma etiology. ©2011 AACR.

  1. Analyses of single nucleotide polymorphisms in selected nutrient-sensitive genes in weight-regain prevention: the DIOGENES study.

    PubMed

    Larsen, Lesli H; Angquist, Lars; Vimaleswaran, Karani S; Hager, Jörg; Viguerie, Nathalie; Loos, Ruth J F; Handjieva-Darlenska, Teodora; Jebb, Susan A; Kunesova, Marie; Larsen, Thomas M; Martinez, J Alfredo; Papadaki, Angeliki; Pfeiffer, Andreas F H; van Baak, Marleen A; Sørensen, Thorkild Ia; Holst, Claus; Langin, Dominique; Astrup, Arne; Saris, Wim H M

    2012-05-01

    Differences in the interindividual response to dietary intervention could be modified by genetic variation in nutrient-sensitive genes. This study examined single nucleotide polymorphisms (SNPs) in presumed nutrient-sensitive candidate genes for obesity and obesity-related diseases for main and dietary interaction effects on weight, waist circumference, and fat mass regain over 6 mo. In total, 742 participants who had lost ≥ 8% of their initial body weight were randomly assigned to follow 1 of 5 different ad libitum diets with different glycemic indexes and contents of dietary protein. The SNP main and SNP-diet interaction effects were analyzed by using linear regression models, corrected for multiple testing by using Bonferroni correction and evaluated by using quantile-quantile (Q-Q) plots. After correction for multiple testing, none of the SNPs were significantly associated with weight, waist circumference, or fat mass regain. Q-Q plots showed that ALOX5AP rs4769873 showed a higher observed than predicted P value for the association with less waist circumference regain over 6 mo (-3.1 cm/allele; 95% CI: -4.6, -1.6; P/Bonferroni-corrected P = 0.000039/0.076), independently of diet. Additional associations were identified by using Q-Q plots for SNPs in ALOX5AP, TNF, and KCNJ11 for main effects; in LPL and TUB for glycemic index interaction effects on waist circumference regain; in GHRL, CCK, MLXIPL, and LEPR on weight; in PPARC1A, PCK2, ALOX5AP, PYY, and ADRB3 on waist circumference; and in PPARD, FABP1, PLAUR, and LPIN1 on fat mass regain for dietary protein interaction. The observed effects of SNP-diet interactions on weight, waist, and fat mass regain suggest that genetic variation in nutrient-sensitive genes can modify the response to diet. This trial was registered at clinicaltrials.gov as NCT00390637.

  2. Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

    PubMed

    Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

    2014-11-01

    Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

    PubMed

    Clendenen, Tess V; Rendleman, Justin; Ge, Wenzhen; Koenig, Karen L; Wirgin, Isaac; Currie, Diane; Shore, Roy E; Kirchhoff, Tomas; Zeleniuch-Jacquotte, Anne

    2015-01-01

    Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA. We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs) using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison. We observed that 60 of the 81 SNPs (74%) had high call frequencies (≥95%) using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95%) had highly concordant (>98%) genotype calls across all three sample types. High purity was not a critical factor to successful genotyping. Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

  4. Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects.

    PubMed

    Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine

    2003-10-01

    Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.

  5. Population Genetics of Verticillium dahliae in Iran Based on Microsatellite and Single Nucleotide Polymorphism Markers.

    PubMed

    Rafiei, Vahideh; Banihashemi, Ziaeddin; Bautista-Jalon, Laura S; Del Mar Jiménez-Gasco, Maria; Turgeon, B Gillian; Milgroom, Michael G

    2018-06-01

    Verticillium dahliae is a plant pathogenic fungus that reproduces asexually and its population structure is highly clonal. In the present study, 78 V. dahliae isolates from Iran were genotyped for mating type, single nucleotide polymorphisms (SNPs), and microsatellites to assign them to clonal lineages and to determine population genetic structure in Iran. The mating type of all isolates was MAT1-2. Based on neighbor-joining analysis and minimum spanning networks constructed from SNPs and microsatellite genotypes, respectively, all but four isolates were assigned to lineage 2B 824 ; four isolates were assigned to lineage 4B. The inferred coalescent genealogy of isolates in lineage 2B 824 showed a clear divergence into two clades that corresponded to geographic origin and host. Haplotypes of cotton and pistachio isolates sampled from central Iran were in one clade, and those of isolates from Prunus spp. sampled from northwestern Iran were in the other. The strong divergence in haplotypes between the two clades suggests that there were at least two separate introductions of lineage 2B 824 to different parts of Iran. Given the history of cotton and pistachio cultivation and Verticillium wilt in Iran, these results are consistent with the hypothesis that cotton was historically a likely source inoculum causing Verticillium wilt in pistachio.

  6. Bayesian pedigree inference with small numbers of single nucleotide polymorphisms via a factor-graph representation.

    PubMed

    Anderson, Eric C; Ng, Thomas C

    2016-02-01

    We develop a computational framework for addressing pedigree inference problems using small numbers (80-400) of single nucleotide polymorphisms (SNPs). Our approach relaxes the assumptions, which are commonly made, that sampling is complete with respect to the pedigree and that there is no genotyping error. It relies on representing the inferred pedigree as a factor graph and invoking the Sum-Product algorithm to compute and store quantities that allow the joint probability of the data to be rapidly computed under a large class of rearrangements of the pedigree structure. This allows efficient MCMC sampling over the space of pedigrees, and, hence, Bayesian inference of pedigree structure. In this paper we restrict ourselves to inference of pedigrees without loops using SNPs assumed to be unlinked. We present the methodology in general for multigenerational inference, and we illustrate the method by applying it to the inference of full sibling groups in a large sample (n=1157) of Chinook salmon typed at 95 SNPs. The results show that our method provides a better point estimate and estimate of uncertainty than the currently best-available maximum-likelihood sibling reconstruction method. Extensions of this work to more complex scenarios are briefly discussed. Published by Elsevier Inc.

  7. Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

    NASA Astrophysics Data System (ADS)

    Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli

    2013-09-01

    Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

  8. Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

    PubMed Central

    Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

    2009-01-01

    Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

  9. Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici

    PubMed Central

    McDonald, Megan C.; McGinness, Lachlan; Hane, James K.; Williams, Angela H.; Milgate, Andrew; Solomon, Peter S.

    2016-01-01

    Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene. PMID:26837952

  10. Cancer protection elicited by a single nucleotide polymorphism close to the adrenomedullin gene.

    PubMed

    Martínez-Herrero, Sonia; Martínez, Alfredo

    2013-04-01

    The risk of developing cancer is regulated by genetic variants, including polymorphisms. Characterizing such variants may help in developing protocols for personalized medicine. Adrenomedullin is a regulatory peptide involved in cancer promotion and progression. Carriers of a single nucleotide polymorphism (SNP) in the proximity of the adrenomedullin gene have lower levels of circulating peptide. The aim of the present work was to investigate whether carriers of this SNP (rs4910118) are protected against cancer. This was a retrospective study. DNA samples were obtained from the Carlos III DNA National Bank (University of Salamanca, Salamanca, Spain). Samples represent a variety of donors and patients from Spain. DNA from patients with breast cancer (n = 238), patients with lung cancer (n = 348), patients with cardiac insufficiency (n = 474), and healthy donors of advanced age (n = 500) was used. All samples were genotyped using double-mismatch PCR, and confirmation was achieved by direct sequencing. The minor allele frequency was calculated in all groups. The Pearson χ(2) was used to compare SNP frequencies. Of 1560 samples, 14 had the minor allele, with a minor allele frequency in healthy donors of 0.90%. Patients with cancer had a statistically significantly lower frequency than healthy donors (odds ratio = 0.216, 95% confidence interval = 0.048-0.967, P = .028). Carriers of the minor allele have a 4.6-fold lower risk of developing cancer than homozygotes for the major allele. Knowledge of the rs4910118 genotype may be useful for stratifying patients in clinical trials and for designing prevention strategies.

  11. A self-assembled deoxyribonucleic acid concatemer for sensitive detection of single nucleotide polymorphism.

    PubMed

    Wu, Wei; Chen, Junhua; Fang, Zhiyuan; Ge, Chenchen; Xiang, Zhicheng; Ouyang, Chuanyan; Lie, Puchang; Xiao, Zhuo; Yu, Luxin; Wang, Lin; Zeng, Lingwen

    2013-12-04

    Polymerase-free and label-free strategies for DNA detection have shown excellent sensitivity and specificity in various biological samples. Herein, we propose a method for single nucleotide polymorphism (SNP) detection by using self-assembled DNA concatemers. Capture probes, bound to magnetic beads, can joint mediator probes by T4 DNA ligase in the presence of target DNA that is complementary to the capture probe and mediator probe. The mediator probes trigger self-assembly of two auxiliary probes on magnetic beads to form DNA concatemers. Separated by a magnetic rack, the double-stranded concatemers on beads can recruit a great amount of SYBR Green I and eventually result in amplified fluorescent signals. In comparison with reported methods for SNP detection, the concatemer-based approach has significant advantages of low background, simplicity, and ultrasensitivity, making it as a convenient platform for clinical applications. As a proof of concept, BRAF(T1799A) oncogene mutation, a SNP involved in diverse human cancers, was used as a model target. The developed approach using a fluorescent intercalator can detect as low as 0.1 fM target BRAF(T1799A) DNA, which is better than those previously published methods for SNP detection. This method is robust and can be used directly to measure the BRAF(T1799A) DNA in complex human serum with excellent recovery (94-103%). It is expected that this assay principle can be directed toward other SNP genes by simply changing the mediator probe and auxiliary probes. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Association of Single Nucleotide Polymorphisms in the ST3GAL4 Gene with VWF Antigen and Factor VIII Activity.

    PubMed

    Song, Jaewoo; Xue, Cheng; Preisser, John S; Cramer, Drake W; Houck, Katie L; Liu, Guo; Folsom, Aaron R; Couper, David; Yu, Fuli; Dong, Jing-Fei

    2016-01-01

    VWF is extensively glycosylated with biantennary core fucosylated glycans. Most N-linked and O-linked glycans on VWF are sialylated. FVIII is also glycosylated, with a glycan structure similar to that of VWF. ST3GAL sialyltransferases catalyze the transfer of sialic acids in the α2,3 linkage to termini of N- and O-glycans. This sialic acid modification is critical for VWF synthesis and activity. We analyzed genetic and phenotypic data from the Atherosclerosis Risk in Communities (ARIC) study for the association of single nucleotide polymorphisms (SNPs) in the ST3GAL4 gene with plasma VWF levels and FVIII activity in 12,117 subjects. We also analyzed ST3GAL4 SNPs found in 2,535 subjects of 26 ethnicities from the 1000 Genomes (1000G) project for ethnic diversity, SNP imputation, and ST3GAL4 haplotypes. We identified 14 and 1,714 ST3GAL4 variants in the ARIC GWAS and 1000G databases respectively, with 46% being ethnically diverse in their allele frequencies. Among the 14 ST3GAL4 SNPs found in ARIC GWAS, the intronic rs2186717, rs7928391, and rs11220465 were associated with VWF levels and with FVIII activity after adjustment for age, BMI, hypertension, diabetes, ever-smoking status, and ABO. This study illustrates the power of next-generation sequencing in the discovery of new genetic variants and a significant ethnic diversity in the ST3GAL4 gene. We discuss potential mechanisms through which these intronic SNPs regulate ST3GAL4 biosynthesis and the activity that affects VWF and FVIII.

  13. Quantitative DNA Methylation Analysis Identifies a Single CpG Dinucleotide Important for ZAP-70 Expression and Predictive of Prognosis in Chronic Lymphocytic Leukemia

    PubMed Central

    Claus, Rainer; Lucas, David M.; Stilgenbauer, Stephan; Ruppert, Amy S.; Yu, Lianbo; Zucknick, Manuela; Mertens, Daniel; Bühler, Andreas; Oakes, Christopher C.; Larson, Richard A.; Kay, Neil E.; Jelinek, Diane F.; Kipps, Thomas J.; Rassenti, Laura Z.; Gribben, John G.; Döhner, Hartmut; Heerema, Nyla A.; Marcucci, Guido; Plass, Christoph; Byrd, John C.

    2012-01-01

    Purpose Increased ZAP-70 expression predicts poor prognosis in chronic lymphocytic leukemia (CLL). Current methods for accurately measuring ZAP-70 expression are problematic, preventing widespread application of these tests in clinical decision making. We therefore used comprehensive DNA methylation profiling of the ZAP-70 regulatory region to identify sites important for transcriptional control. Patients and Methods High-resolution quantitative DNA methylation analysis of the entire ZAP-70 gene regulatory regions was conducted on 247 samples from patients with CLL from four independent clinical studies. Results Through this comprehensive analysis, we identified a small area in the 5′ regulatory region of ZAP-70 that showed large variability in methylation in CLL samples but was universally methylated in normal B cells. High correlation with mRNA and protein expression, as well as activity in promoter reporter assays, revealed that within this differentially methylated region, a single CpG dinucleotide and neighboring nucleotides are particularly important in ZAP-70 transcriptional regulation. Furthermore, by using clustering approaches, we identified a prognostic role for this site in four independent data sets of patients with CLL using time to treatment, progression-free survival, and overall survival as clinical end points. Conclusion Comprehensive quantitative DNA methylation analysis of the ZAP-70 gene in CLL identified important regions responsible for transcriptional regulation. In addition, loss of methylation at a specific single CpG dinucleotide in the ZAP-70 5′ regulatory sequence is a highly predictive and reproducible biomarker of poor prognosis in this disease. This work demonstrates the feasibility of using quantitative specific ZAP-70 methylation analysis as a relevant clinically applicable prognostic test in CLL. PMID:22564988

  14. Switching Cyclic Nucleotide-Selective Activation of Cyclic Adenosine Monophosphate-Dependent Protein Kinase Holoenzyme Reveals Distinct Roles of Tandem Cyclic Nucleotide-Binding Domains.

    PubMed

    He, Daniel; Lorenz, Robin; Kim, Choel; Herberg, Friedrich W; Lim, Chinten James

    2017-12-15

    The cyclic adenosine monophosphate (cAMP)- and cyclic guanosine monophosphate (cGMP)-dependent protein kinases (PKA and PKG) are key effectors of cyclic nucleotide signaling. Both share structural features that include tandem cyclic nucleotide-binding (CNB) domains, CNB-A and CNB-B, yet their functions are separated through preferential activation by either cAMP or cGMP. Based on structural studies and modeling, key CNB contact residues have been identified for both kinases. In this study, we explored the requirements for conversion of PKA activation from cAMP-dependent to cGMP-dependent. The consequences of the residue substitutions T192R/A212T within CNB-A or G316R/A336T within CNB-B of PKA-RIα on cyclic nucleotide binding and holoenzyme activation were assessed in vitro using purified recombinant proteins, and ex vivo using RIα-deficient mouse embryonic fibroblasts genetically reconstituted with wild-type or mutant PKA-RIα. In vitro, a loss of binding and activation selectivity was observed when residues in either one of the CNB domains were mutated, while mutations in both CNB domains resulted in a complete switch of selectivity from cAMP to cGMP. The switch in selectivity was also recapitulated ex vivo, confirming their functional roles in cells. Our results highlight the importance of key cyclic nucleotide contacts within each CNB domain and suggest that these domains may have evolved from an ancestral gene product to yield two distinct cyclic nucleotide-dependent protein kinases.

  15. Exome capture sequencing identifies a novel mutation in BBS4

    PubMed Central

    Wang, Hui; Chen, Xianfeng; Dudinsky, Lynn; Patenia, Claire; Chen, Yiyun; Li, Yumei; Wei, Yue; Abboud, Emad B.; Al-Rajhi, Ali A.; Lewis, Richard Alan; Lupski, James R.; Mardon, Graeme; Gibbs, Richard A.; Perkins, Brian D.

    2011-01-01

    Purpose Leber congenital amaurosis (LCA) is one of the most severe eye dystrophies characterized by severe vision loss at an early stage and accounts for approximately 5% of all retinal dystrophies. The purpose of this study was to identify a novel LCA disease allele or gene and to develop an approach combining genetic mapping with whole exome sequencing. Methods Three patients from King Khaled Eye Specialist Hospital (KKESH205) underwent whole genome single nucleotide polymorphism genotyping, and a single candidate region was identified. Taking advantage of next-generation high-throughput DNA sequencing technologies, whole exome capture sequencing was performed on patient KKESH205#7. Sanger direct sequencing was used during the validation step. The zebrafish model was used to examine the function of the mutant allele. Results A novel missense mutation in Bardet-Biedl syndrome 4 protein (BBS4) was identified in a consanguineous family from Saudi Arabia. This missense mutation in the fifth exon (c.253G>C;p.E85Q) of BBS4 is likely a disease-causing mutation as it segregates with the disease. The mutation is not found in the single nucleotide polymorphism (SNP) database, the 1000 Genomes Project, or matching normal controls. Functional analysis of this mutation in zebrafish indicates that the G253C allele is pathogenic. Coinjection of the G253C allele cannot rescue the mislocalization of rhodopsin in the retina when BBS4 is knocked down by morpholino injection. Immunofluorescence analysis in cell culture shows that this missense mutation in BBS4 does not cause obvious defects in protein expression or pericentriolar localization. Conclusions This mutation likely mainly reduces or abolishes BBS4 function in the retina. Further studies of this allele will provide important insights concerning the pleiotropic nature of BBS4 function. PMID:22219648

  16. Single nucleotide polymorphisms typing of Mycobacterium leprae reveals focal transmission of leprosy in high endemic regions of India.

    PubMed

    Lavania, M; Jadhav, R S; Turankar, R P; Chaitanya, V S; Singh, M; Sengupta, U

    2013-11-01

    Earlier studies indicate that genotyping of Mycobaterium leprae based on single-nucleotide polymorphisms (SNPs) is useful for analysis of the global spread of leprosy. In the present study, we investigated the diversity of M. leprae at eight SNP loci using 180 clinical isolates obtained from patients with leprosy residing mainly in Delhi and Purulia (West Bengal) regions. It was observed that the frequency of SNP type 1 and subtype D was most predominant in the Indian population. Further, the SNP type 2 subtype E was noted only from East Delhi region and SNP type 2 subtype G was noted only from the nearby areas of Hoogly district of West Bengal. These results indicate the occurrence of focal transmission of M. leprae infection and demonstrate that analysis by SNP typing has great potential to help researchers in understanding the transmission of M. leprae infection in the community. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  17. Relationships between Podolic cattle breeds assessed by single nucleotide polymorphisms (SNPs) genotyping.

    PubMed

    Pariset, L; Mariotti, M; Nardone, A; Soysal, M I; Ozkan, E; Williams, J L; Dunner, S; Leveziel, H; Maróti-Agóts, A; Bodò, I; Valentini, A

    2010-12-01

    Italian Maremmana, Turkish Grey and Hungarian Grey breeds belong to the same Podolic group of cattle, have a similar conformation and recently experienced a similar demographic reduction. The aim of this study was to assess the relationship among the analysed Podolic breeds and to verify whether their genetic state reflects their history. To do so, approximately 100 single nucleotide polymorphisms (SNPs) were genotyped on individuals belonging to these breeds and compared to genotypes of individuals of two Italian beef breeds, Marchigiana and Piemontese, which underwent different selection and migration histories. Population genetic parameters such as allelic frequencies and heterozygosity values were assessed, genetic distances calculated and assignment test performed to evaluate the possibility of recent admixture between the populations. The data show that the physical similarity among the Podolic breeds examined, and particularly between Hungarian Grey and Maremmana cattle that experienced admixture in the recent past, is mainly morphological. The assignment of individuals from genotype data was achieved using Bayesian inference, confirming that the set of chosen SNPs is able to distinguish among the breeds and that the breeds are genetically distinct. Individuals of Turkish Grey breed were clearly assigned to their breed of origin for all clustering alternatives, showing that this breed can be differentiated from the others on the basis of the allelic frequencies. Remarkably, in the Turkish Grey there were differences observed between the population of Enez district, where in situ conservation studies are practised, and that of Bandirma district of Balikesir, where ex situ conservation studies are practised out of the original raising area. In conclusion, this study demonstrates that molecular data could be used to reveal an unbiased view of past events and provide the basis for a rational exploitation of livestock, suggesting appropriate cross-breeding plans

  18. EnsembleGASVR: a novel ensemble method for classifying missense single nucleotide polymorphisms.

    PubMed

    Rapakoulia, Trisevgeni; Theofilatos, Konstantinos; Kleftogiannis, Dimitrios; Likothanasis, Spiros; Tsakalidis, Athanasios; Mavroudi, Seferina

    2014-08-15

    Single nucleotide polymorphisms (SNPs) are considered the most frequently occurring DNA sequence variations. Several computational methods have been proposed for the classification of missense SNPs to neutral and disease associated. However, existing computational approaches fail to select relevant features by choosing them arbitrarily without sufficient documentation. Moreover, they are limited to the problem of missing values, imbalance between the learning datasets and most of them do not support their predictions with confidence scores. To overcome these limitations, a novel ensemble computational methodology is proposed. EnsembleGASVR facilitates a two-step algorithm, which in its first step applies a novel evolutionary embedded algorithm to locate close to optimal Support Vector Regression models. In its second step, these models are combined to extract a universal predictor, which is less prone to overfitting issues, systematizes the rebalancing of the learning sets and uses an internal approach for solving the missing values problem without loss of information. Confidence scores support all the predictions and the model becomes tunable by modifying the classification thresholds. An extensive study was performed for collecting the most relevant features for the problem of classifying SNPs, and a superset of 88 features was constructed. Experimental results show that the proposed framework outperforms well-known algorithms in terms of classification performance in the examined datasets. Finally, the proposed algorithmic framework was able to uncover the significant role of certain features such as the solvent accessibility feature, and the top-scored predictions were further validated by linking them with disease phenotypes. Datasets and codes are freely available on the Web at http://prlab.ceid.upatras.gr/EnsembleGASVR/dataset-codes.zip. All the required information about the article is available through http

  19. A few nucleotide polymorphisms are sufficient to recruit nuclear factors differentially to the intron 1 of HPV-16 intratypic variants.

    PubMed

    López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

    2012-06-01

    The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer.

    PubMed

    Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E; Bowtell, David; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L; deFazio, Anna

    2014-05-09

    ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells.