Sample records for ii intron splicing

  1. Group II Intron Self-Splicing.


    Pyle, Anna Marie


    Group II introns are large, autocatalytic ribozymes that catalyze RNA splicing and retrotransposition. Splicing by group II introns plays a major role in the metabolism of plants, fungi, and yeast and contributes to genetic variation in many bacteria. Group II introns have played a major role in genome evolution, as they are likely progenitors of spliceosomal introns, retroelements, and other machinery that controls genetic variation and stability. The structure and catalytic mechanism of group II introns have recently been elucidated through a combination of genetics, chemical biology, solution biochemistry, and crystallography. These studies reveal a dynamic machine that cycles progressively through multiple conformations as it stimulates the various stages of splicing. A central active site, containing a reactive metal ion cluster, catalyzes both steps of self-splicing. These studies provide insights into RNA structure, folding, and catalysis, as they raise new questions about the behavior of RNA machines. PMID:27391926

  2. Bacterial group II introns: not just splicing.


    Toro, Nicolás; Jiménez-Zurdo, José Ignacio; García-Rodríguez, Fernando Manuel


    Group II introns are both catalytic RNAs (ribozymes) and mobile retroelements that were discovered almost 14 years ago. It has been suggested that eukaryotic mRNA introns might have originated from the group II introns present in the alphaproteobacterial progenitor of the mitochondria. Bacterial group II introns are of considerable interest not only because of their evolutionary significance, but also because they could potentially be used as tools for genetic manipulation in biotechnology and for gene therapy. This review summarizes what is known about the splicing mechanisms and mobility of bacterial group II introns, and describes the recent development of group II intron-based gene-targetting methods. Bacterial group II intron diversity, evolutionary relationships, and behaviour in bacteria are also discussed. PMID:17374133

  3. Crystal Structure of a Self-Spliced Group II Intron

    SciTech Connect

    Toor, Navtej; Keating, Kevin S.; Taylor, Sean D.; Pyle, Anna Marie


    Group II introns are self-splicing ribozymes that catalyze their own excision from precursor transcripts and insertion into new genetic locations. Here we report the crystal structure of an intact, self-spliced group II intron from Oceanobacillus iheyensis at 3.1 angstrom resolution. An extensive network of tertiary interactions facilitates the ordered packing of intron subdomains around a ribozyme core that includes catalytic domain V. The bulge of domain V adopts an unusual helical structure that is located adjacent to a major groove triple helix (catalytic triplex). The bulge and catalytic triplex jointly coordinate two divalent metal ions in a configuration that is consistent with a two-metal ion mechanism for catalysis. Structural and functional analogies support the hypothesis that group II introns and the spliceosome share a common ancestor.

  4. Multiple splicing pathways of group II trans-splicing introns in wheat mitochondria.


    Massel, Karen; Silke, Jordan R; Bonen, Linda


    Trans-splicing of discontinuous introns in plant mitochondria requires the assembly of independently-transcribed precursor RNAs into splicing-competent structures, and they are expected to be excised as Y-branched molecules ("broken lariats") because these introns belong to the group II ribozyme family. We now demonstrate that this is just one of several trans-splicing pathways for wheat mitochondrial nad1 intron 4 and nad5 intron 2; they also use a hydrolytic pathway and the liberated 5'-half-intron linear molecules are unexpectedly abundant in the RNA population. We also observe a third productive splicing pathway for nad5 intron 2 that yields full-length excised introns in which the termini are joined in vivo and possess non-encoded nucleotides. In the case of trans-splicing nad1 intron 1, which has a weakly-structured and poorly-conserved core sequence, excision appears to be solely through a hydrolytic pathway. When wheat embryos are germinated in the cold rather than at room temperature, an increased complexity in trans-splicing products is seen for nad1 intron 4, suggesting that there can be environmental effects on the RNA folding of bipartite introns. Our observations provide insights into intron evolution and the complexity of RNA processing events in plant mitochondria. PMID:26970277

  5. Alternative splicing of a group II intron in a surface layer protein gene in Clostridium tetani.


    McNeil, Bonnie A; Simon, Dawn M; Zimmerly, Steven


    Group II introns are ribozymes and retroelements found in bacteria, and are thought to have been the ancestors of nuclear pre-mRNA introns. Whereas nuclear introns undergo prolific alternative splicing in some species, group II introns are not known to carry out equivalent reactions. Here we report a group II intron in the human pathogen Clostridium tetani, which undergoes four alternative splicing reactions in vivo. Together with unspliced transcript, five mRNAs are produced, each encoding a distinct surface layer protein isoform. Correct fusion of exon reading frames requires a shifted 5' splice site located 8 nt upstream of the canonical boundary motif. The shifted junction is accomplished by an altered IBS1-EBS1 pairing between the intron and 5' exon. Growth of C. tetani under a variety of conditions did not result in large changes in alternative splicing levels, raising the possibility that alternative splicing is constitutive. This work demonstrates a novel type of gene organization and regulation in bacteria, and provides an additional parallel between group II and nuclear pre-mRNA introns. PMID:24214997

  6. Nuclear mutations that block group II RNA splicing in maize chloroplasts reveal several intron classes with distinct requirements for splicing factors.

    PubMed Central

    Jenkins, B D; Kulhanek, D J; Barkan, A


    To elucidate mechanisms that regulate chloroplast RNA splicing in multicellular plants, we sought nuclear mutations in maize that result in chloroplast splicing defects. Evidence is presented for two nuclear genes whose function is required for the splicing of group II introns in maize chloroplasts. A mutation in the crs1 (for chloroplast RNA splicing 1) gene blocks the splicing of only the atpF intron, whereas a mutation in the crs2 gene blocks the splicing of many chloroplast introns. In addition, a correlation was observed between the absence of plastid ribosomes and the failure to splice several chloroplast introns. Our results suggest that a chloroplast-encoded factor and a nuclear-encoded factor whose activity requires crs2 function facilitate the splicing of distinct sets of group II introns. These two genetically defined intron sets also differ with regard to intron structure: one set consists of only subgroup IIA introns and the other of only subgroup IIB introns. Therefore, it is likely that distinct splicing factors recognize subgroup-specific features of intron structure or facilitate subgroup-specific aspects of the splicing reaction. Of the 12 pre-mRNA introns in the maize chloroplast genome, only one is normally spliced in both crs2 mutants and in mutants lacking plastid ribosomes, indicating that few, if any, of the group II introns in the chloroplast genome undergo autocatalytic splicing in vivo. PMID:9090875

  7. Novel RNA structural features of an alternatively splicing group II intron from Clostridium tetani.


    McNeil, Bonnie A; Zimmerly, Steven


    Group II introns are ribozymes in bacterial and organellar genomes that function as self-splicing introns and as retroelements. Previously, we reported that the group II intron C.te.I1 of Clostridium tetani alternatively splices in vivo to produce five distinct coding mRNAs. Accurate fusion of upstream and downstream reading frames requires a shifted 5' splice site located 8 nt upstream of the usual 5' GUGYG motif. This site is specified by the ribozyme through an altered intron/exon-binding site 1 (IBS1-EBS1) pairing. Here we use mutagenesis and self-splicing assays to investigate in more detail the significance of the structural features of the C.te.I1 ribozyme. The shifted 5' splice site is shown to be affected by structures in addition to IBS1-EBS1, and unlike other group II introns, C.te.I1 appears to require a spacer between IBS1 and the GUGYG motif. In addition, the mechanism of 3' exon recognition is modified from the ancestral IIB mechanism to a IIA-like mechanism that appears to be longer than the typical single base-pair interaction and may extend up to 4 bp. The novel ribozyme properties that have evolved for C.te.I1 illustrate the plasticity of group II introns in adapting new structural and catalytic properties that can be utilized to affect gene expression. PMID:24751650

  8. Novel RNA structural features of an alternatively splicing group II intron from Clostridium tetani

    PubMed Central

    McNeil, Bonnie A.; Zimmerly, Steven


    Group II introns are ribozymes in bacterial and organellar genomes that function as self-splicing introns and as retroelements. Previously, we reported that the group II intron C.te.I1 of Clostridium tetani alternatively splices in vivo to produce five distinct coding mRNAs. Accurate fusion of upstream and downstream reading frames requires a shifted 5′ splice site located 8 nt upstream of the usual 5′ GUGYG motif. This site is specified by the ribozyme through an altered intron/exon-binding site 1 (IBS1–EBS1) pairing. Here we use mutagenesis and self-splicing assays to investigate in more detail the significance of the structural features of the C.te.I1 ribozyme. The shifted 5′ splice site is shown to be affected by structures in addition to IBS1–EBS1, and unlike other group II introns, C.te.I1 appears to require a spacer between IBS1 and the GUGYG motif. In addition, the mechanism of 3′ exon recognition is modified from the ancestral IIB mechanism to a IIA-like mechanism that appears to be longer than the typical single base-pair interaction and may extend up to 4 bp. The novel ribozyme properties that have evolved for C.te.I1 illustrate the plasticity of group II introns in adapting new structural and catalytic properties that can be utilized to affect gene expression. PMID:24751650

  9. Origin of Spliceosomal Introns and Alternative Splicing

    PubMed Central

    Irimia, Manuel; Roy, Scott William


    In this work we review the current knowledge on the prehistory, origins, and evolution of spliceosomal introns. First, we briefly outline the major features of the different types of introns, with particular emphasis on the nonspliceosomal self-splicing group II introns, which are widely thought to be the ancestors of spliceosomal introns. Next, we discuss the main scenarios proposed for the origin and proliferation of spliceosomal introns, an event intimately linked to eukaryogenesis. We then summarize the evidence that suggests that the last eukaryotic common ancestor (LECA) had remarkably high intron densities and many associated characteristics resembling modern intron-rich genomes. From this intron-rich LECA, the different eukaryotic lineages have taken very distinct evolutionary paths leading to profoundly diverged modern genome structures. Finally, we discuss the origins of alternative splicing and the qualitative differences in alternative splicing forms and functions across lineages. PMID:24890509

  10. Structure-function relationships in a self-splicing group II intron: a large part of domain II of the mitochondrial intron aI5 is not essential for self-splicing.

    PubMed Central

    Kwakman, J H; Konings, D; Pel, H J; Grivell, L A


    An oligonucleotide-directed deletion of 156 nucleotides has been introduced into the yeast mitochondrial group II intron al5 (887 nt). The deletion comprises almost all of domain II, which is one of the six phylogenetically conserved structural elements of group II introns. This mutant displays reduced self-splicing activity, but results of chemical probing with dimethylsulphate suggest that sequences at the site of the deletion interfere with the normal folding of the intron. This is supported by computer analyses, which predict a number of alternative structures involving conserved intron sequences. Splicing activity could be restored by insertion of a 10-nucleotide palindromic sequence into the unique Smal site of the deletion mutant, resulting in the formation of a small stable stem-loop element at the position of domain II. These results provide a direct correlation between folding of the RNA and its activity. We conclude that at least a large part of domain II of the group II intron al5 is not required for self-splicing activity. This deletion mutant with a length of 731 nucleotides represents the smallest self-splicing group II intron so far known. Images PMID:2472604

  11. A three-dimensional perspective on exon binding by a group II self-splicing intron

    PubMed Central

    Costa, Maria; Michel, François; Westhof, Eric


    We have used chemical footprinting, kinetic dissection of reactions and comparative sequence analysis to show that in self-splicing introns belonging to subgroup IIB, the sites that bind the 5′ and 3′ exons are connected to one another by tertiary interactions. This unanticipated arrangement, which contrasts with the direct covalent linkage that prevails in the other major subdivision of group II (subgroup IIA), results in a unique three-dimensional architecture for the complex between the exons, their binding sites and intron domain V. A key feature of the modeled complex is the presence of several close contacts between domain V and one of the intron–exon pairings. These contacts, whose existence is supported by hydroxyl radical footprinting, provide a structural framework for the known role of domain V in catalysis and its recently demonstrated involvement in binding of the 5′ exon. PMID:10990464

  12. Activating the branch-forming splicing pathway by reengineering the ribozyme component of a natural group II intron.


    Monachello, Dario; Michel, François; Costa, Maria


    When assayed in vitro, group IIC self-splicing introns, which target bacterial Rho-independent transcription terminators, generally fail to yield branched products during splicing despite their possessing a seemingly normal branchpoint. Starting with intron O.i.I1 from Oceanobacillus iheyensis, whose crystallographically determined structure lacks branchpoint-containing domain VI, we attempted to determine what makes this intron unfit for in vitro branch formation. A major factor was found to be the length of the helix at the base of domain VI: 4 base pairs (bp) are required for efficient branching, even though a majority of group IIC introns have a 3-bp helix. Equally important for lariat formation is the removal of interactions between ribozyme domains II and VI, which are specific to the second step of splicing. Conversely, mismatching of domain VI and its proposed first-step receptor in subdomain IC1 was found to be detrimental; these data suggest that the intron-encoded protein may promote branch formation partly by modulating the equilibrium between conformations specific to the first and second steps of splicing. As a practical application, we show that by making just two changes to the O.i.I1 ribozyme, it is possible to generate sufficient amounts of lariat intron for the latter to be purified and used in kinetic assays in which folding and reaction are uncoupled. PMID:26769855

  13. A short PPR protein required for the splicing of specific group II introns in angiosperm chloroplasts

    PubMed Central

    Khrouchtchova, Anastassia; Monde, Rita-Ann; Barkan, Alice


    A maize gene designated thylakoid assembly 8 (tha8) emerged from a screen for nuclear mutations that cause defects in the biogenesis of chloroplast thylakoid membranes. The tha8 gene encodes an unusual member of the pentatricopeptide repeat (PPR) family, a family of helical repeat proteins that participate in various aspects of organellar RNA metabolism. THA8 localizes to chloroplasts, where it associates specifically with the ycf3-2 and trnA group II introns. The splicing of ycf3-2 is eliminated in tha8 mutants, and trnA splicing is strongly compromised. Reverse-genetic analysis of the tha8 ortholog in Arabidopsis thaliana showed that these molecular functions are conserved, although null alleles are embryo lethal in Arabidopsis and seedling lethal in maize. Whereas most PPR proteins have more than 10 PPR motifs, THA8 belongs to a subfamily of plant PPR proteins with only four PPR motifs and little else. THA8 is the first member of this subfamily with a defined molecular function, and illustrates that even small PPR proteins have the potential to mediate specific intermolecular interactions in vivo. PMID:22495966

  14. Group II Intron-Mediated Trans-Splicing in the Gene-Rich Mitochondrial Genome of an Enigmatic Eukaryote, Diphylleia rotans

    PubMed Central

    Kamikawa, Ryoma; Shiratori, Takashi; Ishida, Ken-Ichiro; Miyashita, Hideaki; Roger, Andrew J.


    Although mitochondria have evolved from a single endosymbiotic event, present day mitochondria of diverse eukaryotes display a great range of genome structures, content and features. Group I and group II introns are two features that are distributed broadly but patchily in mitochondrial genomes across branches of the tree of eukaryotes. While group I intron-mediated trans-splicing has been reported from some lineages distantly related to each other, findings of group II intron-mediated trans-splicing has been restricted to members of the Chloroplastida. In this study, we found the mitochondrial genome of the unicellular eukaryote Diphylleia rotans possesses currently the second largest gene repertoire. On the basis of a probable phylogenetic position of Diphylleia, which is located within Amorphea, current mosaic gene distribution in Amorphea must invoke parallel gene losses from mitochondrial genomes during evolution. Most notably, although the cytochrome c oxidase subunit (cox) 1 gene was split into four pieces which located at a distance to each other, we confirmed that a single mature mRNA that covered the entire coding region could be generated by group II intron-mediated trans-splicing. This is the first example of group II intron-mediated trans-splicing outside Chloroplastida. Similar trans-splicing mechanisms likely work for bipartitely split cox2 and nad3 genes to generate single mature mRNAs. We finally discuss origin and evolution of this type of trans-splicing in D. rotans as well as in eukaryotes. PMID:26833505

  15. Group II Intron-Mediated Trans-Splicing in the Gene-Rich Mitochondrial Genome of an Enigmatic Eukaryote, Diphylleia rotans.


    Kamikawa, Ryoma; Shiratori, Takashi; Ishida, Ken-Ichiro; Miyashita, Hideaki; Roger, Andrew J


    Although mitochondria have evolved from a single endosymbiotic event, present day mitochondria of diverse eukaryotes display a great range of genome structures, content and features. Group I and group II introns are two features that are distributed broadly but patchily in mitochondrial genomes across branches of the tree of eukaryotes. While group I intron-mediated trans-splicing has been reported from some lineages distantly related to each other, findings of group II intron-mediated trans-splicing has been restricted to members of the Chloroplastida. In this study, we found the mitochondrial genome of the unicellular eukaryote Diphylleia rotans possesses currently the second largest gene repertoire. On the basis of a probable phylogenetic position of Diphylleia, which is located within Amorphea, current mosaic gene distribution in Amorphea must invoke parallel gene losses from mitochondrial genomes during evolution. Most notably, although the cytochrome c oxidase subunit (cox) 1 gene was split into four pieces which located at a distance to each other, we confirmed that a single mature mRNA that covered the entire coding region could be generated by group II intron-mediated trans-splicing. This is the first example of group II intron-mediated trans-splicing outside Chloroplastida. Similar trans-splicing mechanisms likely work for bipartitely split cox2 and nad3 genes to generate single mature mRNAs. We finally discuss origin and evolution of this type of trans-splicing in D. rotans as well as in eukaryotes. PMID:26833505

  16. A horizontally acquired group II intron in the chloroplast psbA gene of a psychrophilic Chlamydomonas: In vitro self-splicing and genetic evidence for maturase activity

    PubMed Central



    The majority of known group II introns are from chloroplast genomes, yet the first self-splicing group II intron from a chloroplast gene was reported only recently, from the psbA gene of the euglenoid, Euglena myxocylindracea. Herein, we describe a large (2.6-kb) group II intron from the psbA gene (psbA1) of a psychrophilic Chlamydomonas sp. from Antarctica that self-splices accurately in vitro. Remarkably, this intron, which also encodes an ORF with putative reverse transcriptase, maturase, and endonuclease domains, is in the same location, and is related to the E. myxocylindracea intron, as well as to group IIB2 introns from cyanobacteria. In vitro self-splicing of Chs.psbA1 occurred via a lariat, and required Mg2+ (>12 mM) and NH4+. Self-splicing was improved by deleting most of the ORF and by using pre-RNAs directly from transcription reactions, suggestive of a role for folding during transcription. Self-splicing of Chs.psbA1 pre-RNAs showed temperature optima of ~44°C, but with a broad shoulder on the low side of the peak; splicing was nearly absent at 50°C, indicative of thermolability. Splicing of wild-type Chs.psbA1 also occurred in Escherichia coli, but not when the ORF was disrupted by mutations, providing genetic evidence that it has maturase activity. This work provides the first description of a ribozyme from a psychrophilic organism. It also appears to provide a second instance of interkingdom horizontal transfer of this group IIB2 intron (or a close relative) from cyanobacteria to chloroplasts. PMID:15208445

  17. Who Activates the Nucleophile in Ribozyme Catalysis? An Answer from the Splicing Mechanism of Group II Introns.


    Casalino, Lorenzo; Palermo, Giulia; Rothlisberger, Ursula; Magistrato, Alessandra


    Group II introns are Mg(2+)-dependent ribozymes that are considered to be the evolutionary ancestors of the eukaryotic spliceosome, thus representing an ideal model system to understand the mechanism of conversion of premature messenger RNA (mRNA) into mature mRNA. Neither in splicing nor for self-cleaving ribozymes has the role of the two Mg(2+) ions been established, and even the way the nucleophile is activated is still controversial. Here we employed hybrid quantum-classical QM(Car-Parrinello)/MM molecular dynamics simulations in combination with thermodynamic integration to characterize the molecular mechanism of the first and rate-determining step of the splicing process (i.e., the cleavage of the 5'-exon) catalyzed by group II intron ribozymes. Remarkably, our results show a new RNA-specific dissociative mechanism in which the bulk water accepts the nucleophile's proton during its attack on the scissile phosphate. The process occurs in a single step with no Mg(2+) ion activating the nucleophile, at odds with nucleases enzymes. We suggest that the novel reaction path elucidated here might be an evolutionary ancestor of the more efficient two-metal-ion mechanism found in enzymes. PMID:27309711

  18. Group II Introns and Their Protein Collaborators

    NASA Astrophysics Data System (ADS)

    Solem, Amanda; Zingler, Nora; Pyle, Anna Marie; Li-Pook-Than, Jennifer

    Group II introns are an abundant class of autocatalytic introns that excise themselves from precursor mRNAs. Although group II introns are catalytic RNAs, they require the assistance of proteins for efficient splicing in vivo. Proteins that facilitate splicing of organellar group II introns fall into two main categories: intron-encoded maturases and host-encoded proteins. This chapter will focus on the host proteins that group II introns recruited to ensure their function. It will discuss the great diversity of these proteins, define common features, and describe different strategies employed to achieve specificity. Special emphasis will be placed on DEAD-box ATPases, currently the best studied example of host-encoded proteins with a role in group II intron splicing. Since the exact mechanisms by which splicing is facilitated is not known for any of the host proteins, general mechanistic strategies for protein-mediated RNA folding are described and assessed for their potential role in group II intron splicing.

  19. Crystal Structure of a Self-Spliced Group ll Intron

    SciTech Connect

    Toor,N.; Keating, K.; Taylor, S.; Pyle, A.


    Group II introns are self-splicing ribozymes that catalyze their own excision from precursor transcripts and insertion into new genetic locations. Here we report the crystal structure of an intact, self-spliced group II intron from Oceanobacillus iheyensis at 3.1 angstrom resolution. An extensive network of tertiary interactions facilitates the ordered packing of intron subdomains around a ribozyme core that includes catalytic domain V. The bulge of domain V adopts an unusual helical structure that is located adjacent to a major groove triple helix (catalytic triplex). The bulge and catalytic triplex jointly coordinate two divalent metal ions in a configuration that is consistent with a two-metal ion mechanism for catalysis. Structural and functional analogies support the hypothesis that group II introns and the spliceosome share a common ancestor.

  20. An Alu-derived intronic splicing enhancer facilitates intronic processing and modulates aberrant splicing in ATM

    PubMed Central

    Pastor, Tibor; Talotti, Gabriele; Lewandowska, Marzena Anna; Pagani, Franco


    We have previously reported a natural GTAA deletion within an intronic splicing processing element (ISPE) of the ataxia telangiectasia mutated (ATM) gene that disrupts a non-canonical U1 snRNP interaction and activates the excision of the upstream portion of the intron. The resulting pre-mRNA splicing intermediate is then processed to a cryptic exon, whose aberrant inclusion in the final mRNA is responsible for ataxia telangiectasia. We show here that the last 40 bases of a downstream intronic antisense Alu repeat are required for the activation of the cryptic exon by the ISPE deletion. Evaluation of the pre-mRNA splicing intermediate by a hybrid minigene assay indicates that the identified intronic splicing enhancer represents a novel class of enhancers that facilitates processing of splicing intermediates possibly by recruiting U1 snRNP to defective donor sites. In the absence of this element, the splicing intermediate accumulates and is not further processed to generate the cryptic exon. Our results indicate that Alu-derived sequences can provide intronic splicing regulatory elements that facilitate pre-mRNA processing and potentially affect the severity of disease-causing splicing mutations. PMID:19773425

  1. Determinants of Plant U12-Dependent Intron Splicing Efficiency

    PubMed Central

    Lewandowska, Dominika; Simpson, Craig G.; Clark, Gillian P.; Jennings, Nikki S.; Barciszewska-Pacak, Maria; Lin, Chiao-Feng; Makalowski, Wojciech; Brown, John W.S.; Jarmolowski, Artur


    Factors affecting splicing of plant U12-dependent introns have been examined by extensive mutational analyses in an in vivo tobacco (Nicotiana tabacum) protoplast system using introns from three different Arabidopsis thaliana genes: CBP20, GSH2, and LD. The results provide evidence that splicing efficiency of plant U12 introns depends on a combination of factors, including UA content, exon bridging interactions between the U12 intron and flanking U2-dependent introns, and exon splicing enhancer sequences (ESEs). Unexpectedly, all three plant U12 introns required an adenosine at the upstream purine position in the branchpoint consensus UCCUURAUY. The exon upstream of the LD U12 intron is a major determinant of its higher level of splicing efficiency and potentially contains two ESE regions. These results suggest that in plants, U12 introns represent a level at which expression of their host genes can be regulated. PMID:15100401

  2. Identification of a Chloroplast Ribonucleoprotein Complex Containing Trans-splicing Factors, Intron RNA, and Novel Components*

    PubMed Central

    Jacobs, Jessica; Marx, Christina; Kock, Vera; Reifschneider, Olga; Fränzel, Benjamin; Krisp, Christoph; Wolters, Dirk; Kück, Ulrich


    Maturation of chloroplast psaA pre-mRNA from the green alga Chlamydomonas reinhardtii requires the trans-splicing of two split group II introns. Several nuclear-encoded trans-splicing factors are required for the correct processing of psaA mRNA. Among these is the recently identified Raa4 protein, which is involved in splicing of the tripartite intron 1 of the psaA precursor mRNA. Part of this tripartite group II intron is the chloroplast encoded tscA RNA, which is specifically bound by Raa4. Using Raa4 as bait in a combined tandem affinity purification and mass spectrometry approach, we identified core components of a multisubunit ribonucleoprotein complex, including three previously identified trans-splicing factors (Raa1, Raa3, and Rat2). We further detected tscA RNA in the purified protein complex, which seems to be specific for splicing of the tripartite group II intron. A yeast-two hybrid screen and co-immunoprecipitation identified chloroplast-localized Raa4-binding protein 1 (Rab1), which specifically binds tscA RNA from the tripartite psaA group II intron. The yeast-two hybrid system provides evidence in support of direct interactions between Rab1 and four trans-splicing factors. Our findings contribute to our knowledge of chloroplast multisubunit ribonucleoprotein complexes and are discussed in support of the generally accepted view that group II introns are the ancestors of the eukaryotic spliceosomal introns. PMID:23559604

  3. Structural basis for exon recognition by a group II intron

    SciTech Connect

    Toor, Navtej; Rajashankar, Kanagalaghatta; Keating, Kevin S.; Pyle, Anna Marie


    Free group II introns are infectious retroelements that can bind and insert themselves into RNA and DNA molecules via reverse splicing. Here we report the 3.4-A crystal structure of a complex between an oligonucleotide target substrate and a group IIC intron, as well as the refined free intron structure. The structure of the complex reveals the conformation of motifs involved in exon recognition by group II introns.

  4. Evolution of trans-splicing plant mitochondrial introns in pre-Permian times

    PubMed Central

    Malek, Olaf; Brennicke, Axel; Knoop, Volker


    Trans-splicing in angiosperm plant mitochondria connects exons from independent RNA molecules by means of group II intron fragments. Homologues of trans-splicing introns in the angiosperm mitochondrial nad2 and nad5 genes are now identified as uninterrupted group II introns in the ferns Asplenium nidus and Marsilea drummondii. These fern introns are correctly spliced from the pre-mRNA at the sites predicted from their well-conserved secondary structures. The flanking exon sequences of the nad2 and nad5 genes in the ferns require RNA editing, including the removal of in-frame stop codons by U-to-C changes for correct expression of the genetic information. We conclude that cis-splicing introns like the ones now identified in ferns are the ancestors of trans-splicing introns in angiosperm mitochondria. Intron disruption is apparently due to a size increase of the structurally variable group II intron domain IV followed by DNA recombination in the plant mitochondrial genome. PMID:9012822

  5. Splicing of many human genes involves sites embedded within introns

    PubMed Central

    Kelly, Steven; Georgomanolis, Theodore; Zirkel, Anne; Diermeier, Sarah; O'Reilly, Dawn; Murphy, Shona; Längst, Gernot; Cook, Peter R.; Papantonis, Argyris


    The conventional model for splicing involves excision of each intron in one piece; we demonstrate this inaccurately describes splicing in many human genes. First, after switching on transcription of SAMD4A, a gene with a 134 kb-long first intron, splicing joins the 3′ end of exon 1 to successive points within intron 1 well before the acceptor site at exon 2 is made. Second, genome-wide analysis shows that >60% of active genes yield products generated by such intermediate intron splicing. These products are present at ∼15% the levels of primary transcripts, are encoded by conserved sequences similar to those found at canonical acceptors, and marked by distinctive structural and epigenetic features. Finally, using targeted genome editing, we demonstrate that inhibiting the formation of these splicing intermediates affects efficient exon–exon splicing. These findings greatly expand the functional and regulatory complexity of the human transcriptome. PMID:25897131

  6. Bacterial Group II Introns: Identification and Mobility Assay.


    Toro, Nicolás; Molina-Sánchez, María Dolores; Nisa-Martínez, Rafael; Martínez-Abarca, Francisco; García-Rodríguez, Fernando Manuel


    Group II introns are large catalytic RNAs and mobile retroelements that encode a reverse transcriptase. Here, we provide methods for their identification in bacterial genomes and further analysis of their splicing and mobility capacities. PMID:26895044

  7. The Peculiarities of Large Intron Splicing in Animals

    PubMed Central

    Fedorov, Alexei


    In mammals a considerable 92% of genes contain introns, with hundreds and hundreds of these introns reaching the incredible size of over 50,000 nucleotides. These “large introns” must be spliced out of the pre-mRNA in a timely fashion, which involves bringing together distant 5′ and 3′ acceptor and donor splice sites. In invertebrates, especially Drosophila, it has been shown that larger introns can be spliced efficiently through a process known as recursive splicing—a consecutive splicing from the 5′-end at a series of combined donor-acceptor splice sites called RP-sites. Using a computational analysis of the genomic sequences, we show that vertebrates lack the proper enrichment of RP-sites in their large introns, and, therefore, require some other method to aid splicing. We analyzed over 15,000 non-redundant, large introns from six mammals, 1,600 from chicken and zebrafish, and 560 non-redundant large introns from five invertebrates. Our bioinformatic investigation demonstrates that, unlike the studied invertebrates, the studied vertebrate genomes contain consistently abundant amounts of direct and complementary strand interspersed repetitive elements (mainly SINEs and LINEs) that may form stems with each other in large introns. This examination showed that predicted stems are indeed abundant and stable in the large introns of mammals. We hypothesize that such stems with long loops within large introns allow intron splice sites to find each other more quickly by folding the intronic RNA upon itself at smaller intervals and, thus, reducing the distance between donor and acceptor sites. PMID:19924226

  8. Circularization pathway of a bacterial group II intron.


    Monat, Caroline; Cousineau, Benoit


    Group II introns are large RNA enzymes that can excise as lariats, circles or in a linear form through branching, circularization or hydrolysis, respectively. Branching is by far the main and most studied splicing pathway while circularization was mostly overlooked. We previously showed that removal of the branch point A residue from Ll.LtrB, the group II intron from Lactococcus lactis, exclusively leads to circularization. However, the majority of the released intron circles harbored an additional C residue of unknown origin at the splice junction. Here, we exploited the Ll.LtrB-ΔA mutant to study the circularization pathway of bacterial group II introns in vivo. We demonstrated that the non-encoded C residue, present at the intron circle splice junction, corresponds to the first nt of exon 2. Intron circularization intermediates, harboring the first 2 or 3 nts of exon 2, were found to accumulate showing that branch point removal leads to 3' splice site misrecognition. Traces of properly ligated exons were also detected functionally confirming that a small proportion of Ll.LtrB-ΔA circularizes accurately. Overall, our data provide the first detailed molecular analysis of the group II intron circularization pathway and suggests that circularization is a conserved splicing pathway in bacteria. PMID:26673697

  9. Retrohoming of a Mobile Group II Intron in Human Cells Suggests How Eukaryotes Limit Group II Intron Proliferation

    PubMed Central

    Truong, David M.; Hewitt, F. Curtis; Hanson, Joseph H.; Cui, Xiaoxia; Lambowitz, Alan M.


    Mobile bacterial group II introns are evolutionary ancestors of spliceosomal introns and retroelements in eukaryotes. They consist of an autocatalytic intron RNA (a “ribozyme”) and an intron-encoded reverse transcriptase, which function together to promote intron integration into new DNA sites by a mechanism termed “retrohoming”. Although mobile group II introns splice and retrohome efficiently in bacteria, all examined thus far function inefficiently in eukaryotes, where their ribozyme activity is limited by low Mg2+ concentrations, and intron-containing transcripts are subject to nonsense-mediated decay (NMD) and translational repression. Here, by using RNA polymerase II to express a humanized group II intron reverse transcriptase and T7 RNA polymerase to express intron transcripts resistant to NMD, we find that simply supplementing culture medium with Mg2+ induces the Lactococcus lactis Ll.LtrB intron to retrohome into plasmid and chromosomal sites, the latter at frequencies up to ~0.1%, in viable HEK-293 cells. Surprisingly, under these conditions, the Ll.LtrB intron reverse transcriptase is required for retrohoming but not for RNA splicing as in bacteria. By using a genetic assay for in vivo selections combined with deep sequencing, we identified intron RNA mutations that enhance retrohoming in human cells, but <4-fold and not without added Mg2+. Further, the selected mutations lie outside the ribozyme catalytic core, which appears not readily modified to function efficiently at low Mg2+ concentrations. Our results reveal differences between group II intron retrohoming in human cells and bacteria and suggest constraints on critical nucleotide residues of the ribozyme core that limit how much group II intron retrohoming in eukaryotes can be enhanced. These findings have implications for group II intron use for gene targeting in eukaryotes and suggest how differences in intracellular Mg2+ concentrations between bacteria and eukarya may have impacted the

  10. Spectrum of splicing errors caused by CHRNE mutations affecting introns and intron/exon boundaries

    PubMed Central

    Ohno, K; Tsujino, A; Shen, X; Milone, M; Engel, A


    Background: Mutations in CHRNE, the gene encoding the muscle nicotinic acetylcholine receptor ε subunit, cause congenital myasthenic syndromes. Only three of the eight intronic splice site mutations of CHRNE reported to date have had their splicing consequences characterised. Methods: We analysed four previously reported and five novel splicing mutations in CHRNE by introducing the entire normal and mutant genomic CHRNEs into COS cells. Results and conclusions: We found that short introns (82–109 nucleotides) favour intron retention, whereas medium to long introns (306–1210 nucleotides) flanking either or both sides of an exon favour exon skipping. Two mutations are of particular interest. Firstly, a G→T substitution at the 3' end of exon 8 predicts an R286M missense mutation, but instead results in skipping of exon 8. In human genes, a mismatch of the last exonic nucleotide to U1 snRNP is frequently compensated by a matching nucleotide at intron position +6. CHRNE intron 8 has a mismatch at position +6, and accordingly fails to compensate for the exonic mutation at position –1. Secondly, a 16 bp duplication, giving rise to two 3' splice sites (g.IVS10-9_c.1167dup16), results in silencing of the downstream 3' splice site. This conforms to the scanning model of recognition of the 3' splice site, which predicts that the first "ag" occurring after the branch point is selected for splicing. PMID:16061559

  11. Functional studies on the ATM intronic splicing processing element

    PubMed Central

    Lewandowska, Marzena A.; Stuani, Cristiana; Parvizpur, Alireza; Baralle, Francisco E.; Pagani, Franco


    In disease-associated genes, the understanding of the functional significance of deep intronic nucleotide variants may represent a difficult challenge. We have previously reported a new disease-causing mechanism that involves an intronic splicing processing element (ISPE) in ATM, composed of adjacent consensus 5′ and 3′ splice sites. A GTAA deletion within ISPE maintains potential adjacent splice sites, disrupts a non-canonical U1 snRNP interaction and activates an aberrant exon. In this paper, we demonstrate that binding of U1 snRNA through complementarity within a ∼40 nt window downstream of the ISPE prevents aberrant splicing. By selective mutagenesis at the adjacent consensus ISPE splice sites, we show that this effect is not due to a resplicing process occurring at the ISPE. Functional comparison of the ATM mouse counterpart and evaluation of the pre-mRNA splicing intermediates derived from affected cell lines and hybrid minigene assays indicate that U1 snRNP binding at the ISPE interferes with the cryptic acceptor site. Activation of this site results in a stringent 5′–3′ order of intron sequence removal around the cryptic exon. Artificial U1 snRNA loading by complementarity to heterologous exonic sequences represents a potential therapeutic method to prevent the usage of an aberrant CFTR cryptic exon. Our results suggest that ISPE-like intronic elements binding U1 snRNPs may regulate correct intron processing. PMID:16030351

  12. Crystal structure of a group II intron in the pre-catalytic state

    SciTech Connect

    Chan, Russell T.; Robart, Aaron R.; Rajashankar, Kanagalaghatta R.; Pyle, Anna Marie; Toor, Navtej


    Group II introns are self-splicing catalytic RNAs that are thought to be ancestral to the spliceosome. Here we report the 3.65-{angstrom} crystal structure of the group II intron from Oceanobacillus iheyensis in the pre-catalytic state. The structure reveals the conformation of the 5' splice site in the catalytic core and represents the first structure of an intron prior to the first step of splicing.

  13. Ancient nature of alternative splicing and functions of introns

    SciTech Connect

    Zhou, Kemin; Salamov, Asaf; Kuo, Alan; Aerts, Andrea; Grigoriev, Igor


    Using four genomes: Chamydomonas reinhardtii, Agaricus bisporus, Aspergillus carbonarius, and Sporotricum thermophile with EST coverage of 2.9x, 8.9x, 29.5x, and 46.3x respectively, we identified 11 alternative splicing (AS) types that were dominated by intron retention (RI; biased toward short introns) and found 15, 35, 52, and 63percent AS of multiexon genes respectively. Genes with AS were more ancient, and number of AS correlated with number of exons, expression level, and maximum intron length of the gene. Introns with tendency to be retained had either stop codons or length of 3n+1 or 3n+2 presumably triggering nonsense-mediated mRNA decay (NMD), but introns retained in major isoforms (0.2-6percent of all introns) were biased toward 3n length and stop codon free. Stopless introns were biased toward phase 0, but 3n introns favored phase 1 that introduced more flexible and hydrophilic amino acids on both ends of introns which would be less disruptive to protein structure. We proposed a model in which minor RI intron could evolve into major RI that could facilitate intron loss through exonization.

  14. Detained introns are a novel, widespread class of post-transcriptionally spliced introns

    PubMed Central

    Boutz, Paul L.; Bhutkar, Arjun


    Deep sequencing of embryonic stem cell RNA revealed many specific internal introns that are significantly more abundant than the other introns within polyadenylated transcripts; we classified these as “detained” introns (DIs). We identified thousands of DIs, many of which are evolutionarily conserved, in human and mouse cell lines as well as the adult mouse liver. DIs can have half-lives of over an hour yet remain in the nucleus and are not subject to nonsense-mediated decay (NMD). Drug inhibition of Clk, a stress-responsive kinase, triggered rapid splicing changes for a specific subset of DIs; half showed increased splicing, and half showed increased intron detention, altering transcript pools of >300 genes. Srsf4, which undergoes a dramatic phosphorylation shift in response to Clk kinase inhibition, regulates the splicing of some DIs, particularly in genes encoding RNA processing and splicing factors. The splicing of some DIs—including those in Mdm4, a negative regulator of p53—was also altered following DNA damage. After 4 h of Clk inhibition, the expression of >400 genes changed significantly, and almost one-third of these are p53 transcriptional targets. These data suggest a widespread mechanism by which the rate of splicing of DIs contributes to the level of gene expression. PMID:25561496

  15. Splice Sites Seldom Slide: Intron Evolution in Oomycetes

    PubMed Central

    Sêton Bocco, Steven; Csűrös, Miklós


    We examine exon junctions near apparent amino acid insertions and deletions in alignments of orthologous protein-coding genes. In 1,917 ortholog families across nine oomycete genomes, 10–20% of introns are near an alignment gap, indicating at first sight that splice-site displacements are frequent. We designed a robust algorithmic procedure for the delineation of intron-containing homologous regions, and combined it with a parsimony-based reconstruction of intron loss, gain, and splice-site shift events on a phylogeny. The reconstruction implies that 12% of introns underwent an acceptor-site shift, and 10% underwent a donor-site shift. In order to offset gene annotation problems, we amended the procedure with the reannotation of intron boundaries using alignment evidence. The corresponding reconstruction involves much fewer intron gain and splice-site shift events. The frequency of acceptor- and donor-side shifts drops to 4% and 3%, respectively, which are not much different from what one would expect by random codon insertions and deletions. In other words, gaps near exon junctions are mostly artifacts of gene annotation rather than evidence of sliding intron boundaries. Our study underscores the importance of using well-supported gene structure annotations in comparative studies. When transcription evidence is not available, we propose a robust ancestral reconstruction procedure that corrects misannotated intron boundaries using sequence alignments. The results corroborate the view that boundary shifts and complete intron sliding are only accidental in eukaryotic genome evolution and have a negligible impact on protein diversity. PMID:27412607

  16. Influence of Intron Length on Alternative Splicing of CD44

    PubMed Central

    Bell, Martyn V.; Cowper, Alison E.; Lefranc, Marie-Paule; Bell, John I.; Screaton, Gavin R.


    Although the splicing of transcripts from most eukaryotic genes occurs in a constitutive fashion, some genes can undergo a process of alternative splicing. This is a genetically economical process which allows a single gene to give rise to several protein isoforms by the inclusion or exclusion of sequences into or from the mature mRNA. CD44 provides a unique example; more than 1,000 possible isoforms can be produced by the inclusion or exclusion of a central tandem array of 10 alternatively spliced exons. Certain alternatively spliced exons have been ascribed specific functions; however, independent regulation of the inclusion or skipping of each of these exons would clearly demand an extremely complex regulatory network. Such a network would involve the interaction of many exon-specific trans-acting factors with the pre-mRNA. Therefore, to assess whether the exons are indeed independently regulated, we have examined the alternative exon content of a large number of individual CD44 cDNA isoforms. This analysis shows that the downstream alternatively spliced exons are favored over those lying upstream and that alternative exons are often included in blocks rather than singly. Using a novel in vivo alternative splicing assay, we show that intron length has a major influence upon the alternative splicing of CD44. We propose a kinetic model in which short introns may overcome the poor recognition of alternatively spliced exons. These observations suggest that for CD44, intron length has been exploited in the evolution of the genomic structure to enable tissue-specific patterns of splicing to be maintained. PMID:9742110

  17. Species-specific signals for the splicing of a short Drosophila intron in vitro.

    PubMed Central

    Guo, M; Lo, P C; Mount, S M


    The effects of branchpoint sequence, the pyrimidine stretch, and intron size on the splicing efficiency of the Drosophila white gene second intron were examined in nuclear extracts from Drosophila and human cells. This 74-nucleotide intron is typical of many Drosophila introns in that it lacks a significant pyrimidine stretch and is below the minimum size required for splicing in human nuclear extracts. Alteration of sequences of adjacent to the 3' splice site to create a pyrimidine stretch was necessary for splicing in human, but not Drosophila, extracts. Increasing the size of this intron with insertions between the 5' splice site and the branchpoint greatly reduced the efficiency of splicing of introns longer than 79 nucleotides in Drosophila extracts but had an opposite effect in human extracts, in which introns longer than 78 nucleotides were spliced with much greater efficiency. The white-apricot copia insertion is immediately adjacent to the branchpoint normally used in the splicing of this intron, and a copia long terminal repeat insertion prevents splicing in Drosophila, but not human, extracts. However, a consensus branchpoint does not restore the splicing of introns containing the copia long terminal repeat, and alteration of the wild-type branchpoint sequence alone does not eliminate splicing. These results demonstrate species specificity of splicing signals, particularly pyrimidine stretch and size requirements, and raise the possibility that variant mechanisms not found in mammals may operate in the splicing of small introns in Drosophila and possibly other species. Images PMID:8423778

  18. Role of the 3′ Splice Site in U12-Dependent Intron Splicing

    PubMed Central

    Dietrich, Rosemary C.; Peris, Marian J.; Seyboldt, Andrew S.; Padgett, Richard A.


    U12-dependent introns containing alterations of the 3′ splice site AC dinucleotide or alterations in the spacing between the branch site and the 3′ splice site were examined for their effects on splice site selection in vivo and in vitro. Using an intron with a 5′ splice site AU dinucleotide, any nucleotide could serve as the 3′-terminal nucleotide, although a C residue was most active, while a U residue was least active. The penultimate A residue, by contrast, was essential for 3′ splice site function. A branch site-to-3′ splice site spacing of less than 10 or more than 20 nucleotides strongly activated alternative 3′ splice sites. A strong preference for a spacing of about 12 nucleotides was observed. The combined in vivo and in vitro results suggest that the branch site is recognized in the absence of an active 3′ splice site but that formation of the prespliceosomal complex A requires an active 3′ splice site. Furthermore, the U12-type spliceosome appears to be unable to scan for a distal 3′ splice site. PMID:11238930

  19. The Brown Algae Pl.LSU/2 Group II Intron-Encoded Protein Has Functional Reverse Transcriptase and Maturase Activities

    PubMed Central

    Zerbato, Madeleine; Holic, Nathalie; Moniot-Frin, Sophie; Ingrao, Dina; Galy, Anne; Perea, Javier


    Group II introns are self-splicing mobile elements found in prokaryotes and eukaryotic organelles. These introns propagate by homing into precise genomic locations, following assembly of a ribonucleoprotein complex containing the intron-encoded protein (IEP) and the spliced intron RNA. Engineered group II introns are now commonly used tools for targeted genomic modifications in prokaryotes but not in eukaryotes. We speculate that the catalytic activation of currently known group II introns is limited in eukaryotic cells. The brown algae Pylaiella littoralis Pl.LSU/2 group II intron is uniquely capable of in vitro ribozyme activity at physiological level of magnesium but this intron remains poorly characterized. We purified and characterized recombinant Pl.LSU/2 IEP. Unlike most IEPs, Pl.LSU/2 IEP displayed a reverse transcriptase activity without intronic RNA. The Pl.LSU/2 intron could be engineered to splice accurately in Saccharomyces cerevisiae and splicing efficiency was increased by the maturase activity of the IEP. However, spliced transcripts were not expressed. Furthermore, intron splicing was not detected in human cells. While further tool development is needed, these data provide the first functional characterization of the PI.LSU/2 IEP and the first evidence that the Pl.LSU/2 group II intron splicing occurs in vivo in eukaryotes in an IEP-dependent manner. PMID:23505475

  20. Mobile Bacterial Group II Introns at the Crux of Eukaryotic Evolution

    PubMed Central

    Lambowitz, Alan M.; Belfort, Marlene


    SUMMARY This review focuses on recent developments in our understanding of group II intron function, the relationships of these introns to retrotransposons and spliceosomes, and how their common features have informed thinking about bacterial group II introns as key elements in eukaryotic evolution. Reverse transcriptase-mediated and host factor-aided intron retrohoming pathways are considered along with retrotransposition mechanisms to novel sites in bacteria, where group II introns are thought to have originated. DNA target recognition and movement by target-primed reverse transcription infer an evolutionary relationship among group II introns, non-LTR retrotransposons, such as LINE elements, and telomerase. Additionally, group II introns are almost certainly the progenitors of spliceosomal introns. Their profound similarities include splicing chemistry extending to RNA catalysis, reaction stereochemistry, and the position of two divalent metals that perform catalysis at the RNA active site. There are also sequence and structural similarities between group II introns and the spliceosome’s small nuclear RNAs (snRNAs) and between a highly conserved core spliceosomal protein Prp8 and a group II intron-like reverse transcriptase. It has been proposed that group II introns entered eukaryotes during bacterial endosymbiosis or bacterial-archaeal fusion, proliferated within the nuclear genome, necessitating evolution of the nuclear envelope, and fragmented giving rise to spliceosomal introns. Thus, these bacterial self-splicing mobile elements have fundamentally impacted the composition of extant eukaryotic genomes, including the human genome, most of which is derived from close relatives of mobile group II introns. PMID:25878921

  1. The RAD52-like protein ODB1 is required for the efficient excision of two mitochondrial introns spliced via first-step hydrolysis.


    Gualberto, José M; Le Ret, Monique; Beator, Barbara; Kühn, Kristina


    Transcript splicing in plant mitochondria involves numerous nucleus-encoded factors, most of which are of eukaryotic origin. Some of these belong to protein families initially characterised to perform unrelated functions. The RAD52-like ODB1 protein has been reported to have roles in homologous recombination-dependent DNA repair in the nuclear and mitochondrial compartments in Arabidopsis thaliana. We show that it is additionally involved in splicing and facilitates the excision of two cis-spliced group II introns, nad1 intron 2 and nad2 intron 1, in Arabidopsis mitochondria. odb1 mutants lacking detectable amounts of ODB1 protein over-accumulated incompletely spliced nad1 and nad2 transcripts. The two ODB1-dependent introns were both found to splice via first-step hydrolysis and to be released as linear or circular molecules instead of lariats. Our systematic analysis of the structures of excised introns in Arabidopsis mitochondria revealed several other hydrolytically spliced group II introns in addition to nad1 intron 2 and nad2 intron 1, indicating that ODB1 is not a general determinant of the hydrolytic splicing pathway. PMID:26048959

  2. The RAD52-like protein ODB1 is required for the efficient excision of two mitochondrial introns spliced via first-step hydrolysis

    PubMed Central

    Gualberto, José M.; Le Ret, Monique; Beator, Barbara; Kühn, Kristina


    Transcript splicing in plant mitochondria involves numerous nucleus-encoded factors, most of which are of eukaryotic origin. Some of these belong to protein families initially characterised to perform unrelated functions. The RAD52-like ODB1 protein has been reported to have roles in homologous recombination-dependent DNA repair in the nuclear and mitochondrial compartments in Arabidopsis thaliana. We show that it is additionally involved in splicing and facilitates the excision of two cis-spliced group II introns, nad1 intron 2 and nad2 intron 1, in Arabidopsis mitochondria. odb1 mutants lacking detectable amounts of ODB1 protein over-accumulated incompletely spliced nad1 and nad2 transcripts. The two ODB1-dependent introns were both found to splice via first-step hydrolysis and to be released as linear or circular molecules instead of lariats. Our systematic analysis of the structures of excised introns in Arabidopsis mitochondria revealed several other hydrolytically spliced group II introns in addition to nad1 intron 2 and nad2 intron 1, indicating that ODB1 is not a general determinant of the hydrolytic splicing pathway. PMID:26048959

  3. The Mitochondrial Genome of the Prasinophyte Prasinoderma coloniale Reveals Two Trans-Spliced Group I Introns in the Large Subunit rRNA Gene

    PubMed Central

    Pombert, Jean-François; Otis, Christian; Turmel, Monique; Lemieux, Claude


    Organelle genes are often interrupted by group I and or group II introns. Splicing of these mobile genetic occurs at the RNA level via serial transesterification steps catalyzed by the introns'own tertiary structures and, sometimes, with the help of external factors. These catalytic ribozymes can be found in cis or trans configuration, and although trans-arrayed group II introns have been known for decades, trans-spliced group I introns have been reported only recently. In the course of sequencing the complete mitochondrial genome of the prasinophyte picoplanktonic green alga Prasinoderma coloniale CCMP 1220 (Prasinococcales, clade VI), we uncovered two additional cases of trans-spliced group I introns. Here, we describe these introns and compare the 54,546 bp-long mitochondrial genome of Prasinoderma with those of four other prasinophytes (clades II, III and V). This comparison underscores the highly variable mitochondrial genome architecture in these ancient chlorophyte lineages. Both Prasinoderma trans-spliced introns reside within the large subunit rRNA gene (rnl) at positions where cis-spliced relatives, often containing homing endonuclease genes, have been found in other organelles. In contrast, all previously reported trans-spliced group I introns occur in different mitochondrial genes (rns or coxI). Each Prasinoderma intron is fragmented into two pieces, forming at the RNA level a secondary structure that resembles those of its cis-spliced counterparts. As observed for other trans-spliced group I introns, the breakpoint of the first intron maps to the variable loop L8, whereas that of the second is uniquely located downstream of P9.1. The breakpoint In each Prasinoderma intron corresponds to the same region where the open reading frame (ORF) occurs when present in cis-spliced orthologs. This correlation between the intron breakpoint and the ORF location in cis-spliced orthologs also holds for other trans-spliced introns; we discuss the possible implications

  4. Cotranscriptional splicing of a group I intron is facilitated by the Cbp2 protein

    SciTech Connect

    Lewin, A.S.; Thomas, J. Jr.; Tirupati, H.K.


    This report investigates the coupling between transcription and splicing of a mitochondrial group I intron in Saccharomyces cerevisiae and the effect of the Cbp2 protein on splicing. 65 refs., 7 figs.

  5. IntSplice: prediction of the splicing consequences of intronic single-nucleotide variations in the human genome.


    Shibata, Akihide; Okuno, Tatsuya; Rahman, Mohammad Alinoor; Azuma, Yoshiteru; Takeda, Jun-Ichi; Masuda, Akio; Selcen, Duygu; Engel, Andrew G; Ohno, Kinji


    Precise spatiotemporal regulation of splicing is mediated by splicing cis-elements on pre-mRNA. Single-nucleotide variations (SNVs) affecting intronic cis-elements possibly compromise splicing, but no efficient tool has been available to identify them. Following an effect-size analysis of each intronic nucleotide on annotated alternative splicing, we extracted 105 parameters that could affect the strength of the splicing signals. However, we could not generate reliable support vector regression models to predict the percent-splice-in (PSI) scores for normal human tissues. Next, we generated support vector machine (SVM) models using 110 parameters to directly differentiate pathogenic SNVs in the Human Gene Mutation Database and normal SNVs in the dbSNP database, and we obtained models with a sensitivity of 0.800±0.041 (mean and s.d.) and a specificity of 0.849±0.021. Our IntSplice models were more discriminating than SVM models that we generated with Shapiro-Senapathy score and MaxEntScan::score3ss. We applied IntSplice to a naturally occurring and nine artificial intronic mutations in RAPSN causing congenital myasthenic syndrome. IntSplice correctly predicted the splicing consequences for nine of the ten mutants. We created a web service program, IntSplice ( to predict splicing-affecting SNVs at intronic positions from -50 to -3. PMID:27009626

  6. Comparative Analyses between Retained Introns and Constitutively Spliced Introns in Arabidopsis thaliana Using Random Forest and Support Vector Machine

    PubMed Central

    Mao, Rui; Raj Kumar, Praveen Kumar; Guo, Cheng; Zhang, Yang; Liang, Chun


    One of the important modes of pre-mRNA post-transcriptional modification is alternative splicing. Alternative splicing allows creation of many distinct mature mRNA transcripts from a single gene by utilizing different splice sites. In plants like Arabidopsis thaliana, the most common type of alternative splicing is intron retention. Many studies in the past focus on positional distribution of retained introns (RIs) among different genic regions and their expression regulations, while little systematic classification of RIs from constitutively spliced introns (CSIs) has been conducted using machine learning approaches. We used random forest and support vector machine (SVM) with radial basis kernel function (RBF) to differentiate these two types of introns in Arabidopsis. By comparing coordinates of introns of all annotated mRNAs from TAIR10, we obtained our high-quality experimental data. To distinguish RIs from CSIs, We investigated the unique characteristics of RIs in comparison with CSIs and finally extracted 37 quantitative features: local and global nucleotide sequence features of introns, frequent motifs, the signal strength of splice sites, and the similarity between sequences of introns and their flanking regions. We demonstrated that our proposed feature extraction approach was more accurate in effectively classifying RIs from CSIs in comparison with other four approaches. The optimal penalty parameter C and the RBF kernel parameter in SVM were set based on particle swarm optimization algorithm (PSOSVM). Our classification performance showed F-Measure of 80.8% (random forest) and 77.4% (PSOSVM). Not only the basic sequence features and positional distribution characteristics of RIs were obtained, but also putative regulatory motifs in intron splicing were predicted based on our feature extraction approach. Clearly, our study will facilitate a better understanding of underlying mechanisms involved in intron retention. PMID:25110928

  7. Comparative analyses between retained introns and constitutively spliced introns in Arabidopsis thaliana using random forest and support vector machine.


    Mao, Rui; Raj Kumar, Praveen Kumar; Guo, Cheng; Zhang, Yang; Liang, Chun


    One of the important modes of pre-mRNA post-transcriptional modification is alternative splicing. Alternative splicing allows creation of many distinct mature mRNA transcripts from a single gene by utilizing different splice sites. In plants like Arabidopsis thaliana, the most common type of alternative splicing is intron retention. Many studies in the past focus on positional distribution of retained introns (RIs) among different genic regions and their expression regulations, while little systematic classification of RIs from constitutively spliced introns (CSIs) has been conducted using machine learning approaches. We used random forest and support vector machine (SVM) with radial basis kernel function (RBF) to differentiate these two types of introns in Arabidopsis. By comparing coordinates of introns of all annotated mRNAs from TAIR10, we obtained our high-quality experimental data. To distinguish RIs from CSIs, We investigated the unique characteristics of RIs in comparison with CSIs and finally extracted 37 quantitative features: local and global nucleotide sequence features of introns, frequent motifs, the signal strength of splice sites, and the similarity between sequences of introns and their flanking regions. We demonstrated that our proposed feature extraction approach was more accurate in effectively classifying RIs from CSIs in comparison with other four approaches. The optimal penalty parameter C and the RBF kernel parameter [Formula: see text] in SVM were set based on particle swarm optimization algorithm (PSOSVM). Our classification performance showed F-Measure of 80.8% (random forest) and 77.4% (PSOSVM). Not only the basic sequence features and positional distribution characteristics of RIs were obtained, but also putative regulatory motifs in intron splicing were predicted based on our feature extraction approach. Clearly, our study will facilitate a better understanding of underlying mechanisms involved in intron retention. PMID:25110928

  8. Ancestors of trans-splicing mitochondrial introns support serial sister group relationships of hornworts and mosses with vascular plants.


    Groth-Malonek, Milena; Pruchner, Dagmar; Grewe, Felix; Knoop, Volker


    Some group II introns in the organelle genomes of plants and algae are disrupted and require trans-splicing of the affected exons from independent transcripts. A peculiar mitochondrial nad5 gene structure is universally conserved in flowering plants where two trans-splicing introns frame a tiny exon of only 22 nucleotides, and two additional conventional group II introns interrupt the nad5 reading frame at other sites. These four introns are absent in the liverwort Marchantia polymorpha, which carries a group I intron at an unrelated site in nad5. To determine how intron gains and losses have sculptured mitochondrial gene structures in early land-plant evolution, we have investigated the full nad5 gene structures in the three bryophyte classes and the fern Asplenium nidus. We find the single Marchantia group I intron nad5i753 present as the only intervening sequence in both closely (Corsinia and Monoclea) and distantly related (Noteroclada, Bazzania, and Haplomitrium) liverwort genera. In a taxonomically wide spectrum of mosses (Sphagnum, Encalypta, Timmia, Ulota, and Rhacocarpus); however, we additionally identify the angiosperm-type group II introns nad5i230 and nad5i1455. The latter is a cis-arranged homolog to one of the two angiosperm trans-splicing introns, notably the first of its kind in mosses. In the hornwort Anthoceros, the "moss and liverwort-type" group I intron nad5i753 is absent, and, besides nad5i230 and nad5i1455, intron nad5i1477 is present as the second ancestral group II intron which has evolved into a trans-splicing arrangement in angiosperms. The influence of highly frequent RNA editing, most notably in the genera Haplomitrium, Anthoceros, and Asplenium, on phylogenetic tree construction is investigated and discussed. Taken together, the data (1) support a sister group relationship of liverworts as a whole to all other embryophytes, (2) indicate loss of a group I and serial entries of group II introns in the nad5 gene during early evolution of

  9. A point mutation in an intronic branch site results in aberrant splicing of COL5A1 and in Ehlers-Danlos syndrome type II in two British families.


    Burrows, N P; Nicholls, A C; Richards, A J; Luccarini, C; Harrison, J B; Yates, J R; Pope, F M


    Ehlers-Danlos syndrome (EDS) is a heterogeneous group of connective-tissue disorders characterized by skin fragility, joint laxity, and skeletal deformities. Type V collagen appears to have a causal role in EDS types I and II, which show phenotypic overlap and may sometimes be allelic. Type V collagen can exist as a heterotrimer, [alpha1(V)]2alpha2(V), and it both coassembles with and regulates type I collagen-fibril diameter. Using an intragenic COL5A1 polymorphism, we have demonstrated linkage, at zero recombination, to the same allele in two large British EDS type II families (LOD scores 4.1 and 4.3). Affected members from each family were heterozygous for a point mutation in intron 32 (IVS32:T-25G), causing the 45-bp exon 33 to be lost from the mRNA in approximately 60% of transcripts from the mutant gene. This mutation lies only 2 bp upstream of a highly conserved adenosine in the consensus branch-site sequence, which is required for lariat formation. Although both families shared the same marker allele, we have been unable to identify a common genealogy. This is the first description of a mutation at the lariat branch site, which plays a pivotal role in the splicing mechanism, in a collagen gene. Very probably, the resulting in-frame exon skip has a dominant-negative effect due to incorporation of the mutant proalpha chain into the triple-helical molecule. These findings further confirm the importance of type V collagen in the causation of EDS type II, and the novel collagen mutation indicates the importance of the lariat branch site in splicing. PMID:9683580

  10. Tertiary architecture of the Oceanobacillus iheyensis group II intron

    SciTech Connect

    Toor, Navtej; Keating, Kevin S.; Fedorova, Olga; Rajashankar, Kanagalaghatta; Wang, Jimin; Pyle, Anna Marie


    Group II introns are large ribozymes that act as self-splicing and retrotransposable RNA molecules. They are of great interest because of their potential evolutionary relationship to the eukaryotic spliceosome, their continued influence on the organization of many genomes in bacteria and eukaryotes, and their potential utility as tools for gene therapy and biotechnology. One of the most interesting features of group II introns is their relative lack of nucleobase conservation and covariation, which has long suggested that group II intron structures are stabilized by numerous unusual tertiary interactions and backbone-mediated contacts. Here, we provide a detailed description of the tertiary interaction networks within the Oceanobacillus iheyensis group IIC intron, for which a crystal structure was recently solved to 3.1 {angstrom} resolution. The structure can be described as a set of several intricately constructed tertiary interaction nodes, each of which contains a core of extended stacking networks and elaborate motifs. Many of these nodes are surrounded by a web of ribose zippers, which appear to further stabilize local structure. As predicted from biochemical and genetic studies, the group II intron provides a wealth of new information on strategies for RNA folding and tertiary structural organization.

  11. Influence of intron length on interaction characters between post-spliced intron and its CDS in ribosomal protein genes

    NASA Astrophysics Data System (ADS)

    Zhao, Xiaoqing; Li, Hong; Bao, Tonglaga; Ying, Zhiqiang


    Many experiment evidences showed that sequence structures of introns and intron loss/gain can influence gene expression, but current mechanisms did not refer to the functions of post-spliced introns directly. We propose that postspliced introns play their functions in gene expression by interacting with their mRNA sequences and the interaction is characterized by the matched segments between introns and their CDS. In this study, we investigated the interaction characters with length series by improved Smith-Waterman local alignment software for the ribosomal protein genes in C. elegans and D. melanogaster. Our results showed that RF values of five intron groups are significantly high in the central non-conserved region and very low in 5'-end and 3'-end splicing region. It is interesting that the number of the optimal matched regions gradually increases with intron length. Distributions of the optimal matched regions are different for five intron groups. Our study revealed that there are more interaction regions between longer introns and their CDS than shorter, and it provides a positive pattern for regulating the gene expression.

  12. Host Factors Influencing the Retrohoming Pathway of Group II Intron RmInt1, Which Has an Intron-Encoded Protein Naturally Devoid of Endonuclease Activity.


    Nisa-Martínez, Rafael; Molina-Sánchez, María Dolores; Toro, Nicolás


    Bacterial group II introns are self-splicing catalytic RNAs and mobile retroelements that have an open reading frame encoding an intron-encoded protein (IEP) with reverse transcriptase (RT) and RNA splicing or maturase activity. Some IEPs carry a DNA endonuclease (En) domain, which is required to cleave the bottom strand downstream from the intron-insertion site for target DNA-primed reverse transcription (TPRT) of the inserted intron RNA. Host factors complete the insertion of the intron. By contrast, the major retrohoming pathway of introns with IEPs naturally lacking endonuclease activity, like the Sinorhizobium meliloti intron RmInt1, is thought to involve insertion of the intron RNA into the template for lagging strand DNA synthesis ahead of the replication fork, with possible use of the nascent strand to prime reverse transcription of the intron RNA. The host factors influencing the retrohoming pathway of such introns have not yet been described. Here, we identify key candidates likely to be involved in early and late steps of RmInt1 retrohoming. Some of these host factors are common to En+ group II intron retrohoming, but some have different functions. Our results also suggest that the retrohoming process of RmInt1 may be less dependent on the intracellular free Mg2+ concentration than those of other group II introns. PMID:27588750

  13. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.


    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou


    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  14. Changes in exon–intron structure during vertebrate evolution affect the splicing pattern of exons

    PubMed Central

    Gelfman, Sahar; Burstein, David; Penn, Osnat; Savchenko, Anna; Amit, Maayan; Schwartz, Schraga; Pupko, Tal; Ast, Gil


    Exon–intron architecture is one of the major features directing the splicing machinery to the short exons that are located within long flanking introns. However, the evolutionary dynamics of exon–intron architecture and its impact on splicing is largely unknown. Using a comparative genomic approach, we analyzed 17 vertebrate genomes and reconstructed the ancestral motifs of both 3′ and 5′ splice sites, as also the ancestral length of exons and introns. Our analyses suggest that vertebrate introns increased in length from the shortest ancestral introns to the longest primate introns. An evolutionary analysis of splice sites revealed that weak splice sites act as a restrictive force keeping introns short. In contrast, strong splice sites allow recognition of exons flanked by long introns. Reconstruction of the ancestral state suggests these phenomena were not prevalent in the vertebrate ancestor, but appeared during vertebrate evolution. By calculating evolutionary rate shifts in exons, we identified cis-acting regulatory sequences that became fixed during the transition from early vertebrates to mammals. Experimental validations performed on a selection of these hexamers confirmed their regulatory function. We additionally revealed many features of exons that can discriminate alternative from constitutive exons. These features were integrated into a machine-learning approach to predict whether an exon is alternative. Our algorithm obtains very high predictive power (AUC of 0.91), and using these predictions we have identified and successfully validated novel alternatively spliced exons. Overall, we provide novel insights regarding the evolutionary constraints acting upon exons and their recognition by the splicing machinery. PMID:21974994

  15. Conserved intron elements repress splicing of a neuron-specific c-src exon in vitro.

    PubMed Central

    Chan, R C; Black, D L


    The neuron-specific N1 exon of the mouse c-src transcript is normally skipped in nonneuronal cells. In this study, we examined the sequence requirements for the exclusion of this exon in nonneuronal HeLa cell nuclear extracts. We found that the repression of the N1 exon is mediated by specific intron sequences that flank the N1 exon. Mutagenesis experiments identified conserved CUCUCU elements within these intron regions that are required for the repression of N1 splicing. The addition of an RNA competitor containing the upstream regulatory sequence to the HeLa extract induced splicing of the intron downstream of N1, indicating that the competitor sequence binds to splicing repressor proteins. The similarities between this mechanism for src splicing repression and the repression of other regulated exons point to a common role of exon-spanning interactions in splicing repression. PMID:7565790

  16. Alternative splicing mechanisms orchestrating post-transcriptional gene expression: intron retention and the intron-rich genome of apicomplexan parasites.


    Lunghi, Matteo; Spano, Furio; Magini, Alessandro; Emiliani, Carla; Carruthers, Vern B; Di Cristina, Manlio


    Apicomplexan parasites including Toxoplasma gondii and Plasmodium species have complex life cycles that include multiple hosts and differentiation through several morphologically distinct stages requiring marked changes in gene expression. This review highlights emerging evidence implicating regulation of mRNA splicing as a mechanism to prime these parasites for rapid gene expression upon differentiation. We summarize the most important insights in alternative splicing including its role in regulating gene expression by decreasing mRNA abundance via 'Regulated Unproductive Splicing and Translation'. As a related but less well-understood mechanism, we discuss also our recent work suggesting a role for intron retention for precluding translation of stage specific isoforms of T. gondii glycolytic enzymes. We additionally provide new evidence that intron retention might be a widespread mechanism during parasite differentiation. Supporting this notion, recent genome-wide analysis of Toxoplasma and Plasmodium suggests intron retention is more pervasive than heretofore thought. These findings parallel recent emergence of intron retention being more prevalent in mammals than previously believed, thereby adding to the established roles in plants, fungi and unicellular eukaryotes. Deeper mechanistic studies of intron retention will provide important insight into its role in regulating gene expression in apicomplexan parasites and more general in eukaryotic organisms. PMID:26194054

  17. Modern origin of numerous alternatively spliced human introns from tandem arrays

    PubMed Central

    Zhuo, Degen; Madden, Richard; Elela, Sherif Abou; Chabot, Benoit


    Despite the widespread occurrence of spliceosomal introns in the genomes of higher eukaryotes, their origin remains controversial. One model proposes that the duplication of small genomic portions could have provided the boundaries for new introns. If this mechanism has occurred recently, the 5′ and 3′ boundaries of each resulting intron should display distinctive sequence similarity. Here, we report that the human genome contains an excess of introns with perfect matching sequences at boundaries. One-third of these introns interrupt the protein-coding sequences of known genes. Introns with the best-matching boundaries are invariably found in tandem arrays of direct repeats. Sequence analysis of the arrays indicates that many intron-breeding repeats have disseminated in several genes at different times during human evolution. A comparison with orthologous regions in mouse and chimpanzee suggests a young age for the human introns with the most-similar boundaries. Finally, we show that these human introns are alternatively spliced with exceptionally high frequency. Our study indicates that genomic duplication has been an important mode of intron gain in mammals. The alternative splicing of transcripts containing these intron-breeding repeats may provide the plasticity required for the rapid evolution of new human proteins. PMID:17210920

  18. Aberrant splicing of U12-type introns is the hallmark of ZRSR2 mutant myelodysplastic syndrome

    PubMed Central

    Madan, Vikas; Kanojia, Deepika; Li, Jia; Okamoto, Ryoko; Sato-Otsubo, Aiko; Kohlmann, Alexander; Sanada, Masashi; Grossmann, Vera; Sundaresan, Janani; Shiraishi, Yuichi; Miyano, Satoru; Thol, Felicitas; Ganser, Arnold; Yang, Henry; Haferlach, Torsten; Ogawa, Seishi; Koeffler, H. Phillip


    Somatic mutations in the spliceosome gene ZRSR2 — located on the X chromosome — are associated with myelodysplastic syndrome (MDS). ZRSR2 is involved in the recognition of 3΄ splice site during the early stages of spliceosome assembly; however, its precise role in RNA splicing has remained unclear. Here, we characterize ZRSR2 as an essential component of the minor spliceosome (U12-dependent) assembly. shRNA mediated knockdown of ZRSR2 leads to impaired splicing of the U12-type introns, and RNA-Sequencing of MDS bone marrow reveals that loss of ZRSR2 activity causes increased mis-splicing. These splicing defects involve retention of the U12-type introns while splicing of the U2-type introns remain mostly unaffected. ZRSR2 deficient cells also exhibit reduced proliferation potential and distinct alterations in myeloid and erythroid differentiation in vitro. These data identify a specific role for ZRSR2 in RNA splicing and highlight dysregulated splicing of U12-type introns as a characteristic feature of ZRSR2 mutations in MDS. PMID:25586593

  19. Aberrant splicing of U12-type introns is the hallmark of ZRSR2 mutant myelodysplastic syndrome.


    Madan, Vikas; Kanojia, Deepika; Li, Jia; Okamoto, Ryoko; Sato-Otsubo, Aiko; Kohlmann, Alexander; Sanada, Masashi; Grossmann, Vera; Sundaresan, Janani; Shiraishi, Yuichi; Miyano, Satoru; Thol, Felicitas; Ganser, Arnold; Yang, Henry; Haferlach, Torsten; Ogawa, Seishi; Koeffler, H Phillip


    Somatic mutations in the spliceosome gene ZRSR2-located on the X chromosome-are associated with myelodysplastic syndrome (MDS). ZRSR2 is involved in the recognition of 3'-splice site during the early stages of spliceosome assembly; however, its precise role in RNA splicing has remained unclear. Here we characterize ZRSR2 as an essential component of the minor spliceosome (U12 dependent) assembly. shRNA-mediated knockdown of ZRSR2 leads to impaired splicing of the U12-type introns and RNA-sequencing of MDS bone marrow reveals that loss of ZRSR2 activity causes increased mis-splicing. These splicing defects involve retention of the U12-type introns, while splicing of the U2-type introns remain mostly unaffected. ZRSR2-deficient cells also exhibit reduced proliferation potential and distinct alterations in myeloid and erythroid differentiation in vitro. These data identify a specific role for ZRSR2 in RNA splicing and highlight dysregulated splicing of U12-type introns as a characteristic feature of ZRSR2 mutations in MDS. PMID:25586593

  20. Enhancement of Transcription by a Splicing-Competent Intron Is Dependent on Promoter Directionality

    PubMed Central

    Agarwal, Neha; Ansari, Athar


    Enhancement of transcription by a splicing-competent intron is an evolutionarily conserved feature among eukaryotes. The molecular mechanism underlying the phenomenon, however, is not entirely clear. Here we show that the intron is an important regulator of promoter directionality. Employing strand-specific transcription run-on (TRO) analysis, we show that the transcription of mRNA is favored over the upstream anti-sense transcripts (uaRNA) initiating from the promoter in the presence of an intron. Mutation of either the 5′ or 3′ splice site resulted in the reversal of promoter directionality, thereby suggesting that it is not merely the 5′ splice site but the entire splicing-competent intron that regulates transcription directionality. ChIP analysis revealed the recruitment of termination factors near the promoter region in the presence of an intron. Removal of intron or the mutation of splice sites adversely affected the promoter localization of termination factors. We have earlier demonstrated that the intron-mediated enhancement of transcription is dependent on gene looping. Here we show that gene looping is crucial for the recruitment of termination factors in the promoter-proximal region of an intron-containing gene. In a looping-defective mutant, despite normal splicing, the promoter occupancy of factors required for poly(A)-dependent termination of transcription was compromised. This was accompanied by a concomitant loss of transcription directionality. On the basis of these results, we propose that the intron-dependent gene looping places the terminator-bound factors in the vicinity of the promoter region for termination of the promoter-initiated upstream antisense transcription, thereby conferring promoter directionality. PMID:27152651

  1. The Genomic Signature of Splicing-Coupled Selection Differs between Long and Short Introns

    PubMed Central

    Farlow, Ashley; Dolezal, Marlies; Hua, Liushuai; Schlötterer, Christian


    Understanding the function of noncoding regions in the genome, such as introns, is of central importance to evolutionary biology. One approach is to assay for the targets of natural selection. On one hand, the sequence of introns, especially short introns, appears to evolve in an almost neutral manner. Whereas on the other hand, a large proportion of intronic sequence is under selective constraint. This discrepancy is largely dependent on intron length and differences in the methods used to infer selection. We have used a method based on DNA strand asymmetery that does not require comparison with any putatively neutrally evolving sequence, nor sequence conservation between species, to detect selection within introns. The strongest signal we identify is associated with short introns. This signal comes from a family of motifs that could act as cryptic 5′ splice sites during mRNA processing, suggesting a mechanistic justification underlying this signal of selection. Together with an analysis of intron length and splice site strength, we observe that the genomic signature of splicing-coupled selection differs between long and short introns. PMID:21878685

  2. A conserved intronic U1 snRNP-binding sequence promotes trans-splicing in Drosophila

    PubMed Central

    Gao, Jun-Li; Fan, Yu-Jie; Wang, Xiu-Ye; Zhang, Yu; Pu, Jia; Li, Liang; Shao, Wei; Zhan, Shuai; Hao, Jianjiang


    Unlike typical cis-splicing, trans-splicing joins exons from two separate transcripts to produce chimeric mRNA and has been detected in most eukaryotes. Trans-splicing in trypanosomes and nematodes has been characterized as a spliced leader RNA-facilitated reaction; in contrast, its mechanism in higher eukaryotes remains unclear. Here we investigate mod(mdg4), a classic trans-spliced gene in Drosophila, and report that two critical RNA sequences in the middle of the last 5′ intron, TSA and TSB, promote trans-splicing of mod(mdg4). In TSA, a 13-nucleotide (nt) core motif is conserved across Drosophila species and is essential and sufficient for trans-splicing, which binds U1 small nuclear RNP (snRNP) through strong base-pairing with U1 snRNA. In TSB, a conserved secondary structure acts as an enhancer. Deletions of TSA and TSB using the CRISPR/Cas9 system result in developmental defects in flies. Although it is not clear how the 5′ intron finds the 3′ introns, compensatory changes in U1 snRNA rescue trans-splicing of TSA mutants, demonstrating that U1 recruitment is critical to promote trans-splicing in vivo. Furthermore, TSA core-like motifs are found in many other trans-spliced Drosophila genes, including lola. These findings represent a novel mechanism of trans-splicing, in which RNA motifs in the 5′ intron are sufficient to bring separate transcripts into close proximity to promote trans-splicing. PMID:25838544

  3. Oligonucleotide directed misfolding of RNA inhibits Candida albicans group I intron splicing

    PubMed Central

    Childs, Jessica L.; Disney, Matthew D.; Turner, Douglas H.


    RNA is becoming an important therapeutic target. Many potential RNA targets require secondary or tertiary structure for function. Examples include ribosomal RNAs, RNase P RNAs, mRNAs with untranslated regions that regulate translation, and group I and group II introns. Here, a method is described to inhibit RNA function by exploiting the propensity of RNA to adopt multiple folded states that are of similar free energy. This method, called oligonucleotide directed misfolding of RNA (ODMiR), uses short oligonucleotides to stabilize inactive structures. The ODMiR method is demonstrated with the group I intron from Candida albicans, a human pathogen. The oligonucleotides, L(TACCTTTC) and TLCTLACLGALCGLGCLC, with L denoting a locked nucleic acid residue, inhibit 50% of group I intron splicing in a transcription mixture at about 150 and 30 nM oligonucleotide concentration, respectively. Both oligonucleotides induce misfolds as determined by native gel electrophoresis and diethyl pyrocarbonate modification. The ODMiR approach provides a potential therapeutic strategy applicable to RNAs with secondary or tertiary structures required for function. PMID:12169671

  4. Localization of a bacterial group II intron-encoded protein in human cells.


    Reinoso-Colacio, Mercedes; García-Rodríguez, Fernando Manuel; García-Cañadas, Marta; Amador-Cubero, Suyapa; García Pérez, José Luis; Toro, Nicolás


    Group II introns are mobile retroelements that self-splice from precursor RNAs to form ribonucleoparticles (RNP), which can invade new specific genomic DNA sites. This specificity can be reprogrammed, for insertion into any desired DNA site, making these introns useful tools for bacterial genetic engineering. However, previous studies have suggested that these elements may function inefficiently in eukaryotes. We investigated the subcellular distribution, in cultured human cells, of the protein encoded by the group II intron RmInt1 (IEP) and several mutants. We created fusions with yellow fluorescent protein (YFP) and with a FLAG epitope. We found that the IEP was localized in the nucleus and nucleolus of the cells. Remarkably, it also accumulated at the periphery of the nuclear matrix. We were also able to identify spliced lariat intron RNA, which co-immunoprecipitated with the IEP, suggesting that functional RmInt1 RNPs can be assembled in cultured human cells. PMID:26244523

  5. Introns, alternative splicing, spliced leader trans-splicing and differential expression of pcna and cyclin in Perkinsus marinus.


    Zhang, Huan; Dungan, Christopher F; Lin, Senjie


    To gain understanding on the structure and regulation of growth-related genes of the parasitic alveolatePerkinsus marinus, we analyzed genes encoding proliferating cell nuclear antigen (pcna) and cyclins (cyclin). Comparison of the full-length cDNAs with the corresponding genomic sequences revealedtrans-splicing of the mRNAs of these genes with a conserved 21-22 nt spliced leader. Over 10 copies ofpcnawere detected, with identical gene structures and similar nucleotide (nt) sequences (88-99%), encoding largely identical amino acid sequences (aa). Two distinct types ofcyclin(Pmacyclin1 andPmacyclin2) were identified, with 66-69% nt and 81-85% aa similarities.Pmacyclin2 was organized in tandem repeats, and was alternatively spliced, giving rise to five subtypes of transcripts. For bothpcnaandcyclingenes, 6-10 introns were found. Quantitative RT-PCR assays showed thatpcnaandPmacyclin2 expression levels were low with small variations during a 28-h time course, whereasPmacyclin1 transcript abundance was 10-100 times higher, and increased markedly during active cell division, suggesting that it is a mitoticcyclinand can be a useful growth marker for this species. The gene structure and expression features along with phylogenetic results position this organism between dinoflagellates and apicomplexans, but its definitive affiliation among alveolates requires further studies. PMID:20650682

  6. CYP17A1 intron mutation causing cryptic splicing in 17α-hydroxylase deficiency.


    Hwang, Daw-Yang; Hung, Chi-Chih; Riepe, Felix G; Auchus, Richard J; Kulle, Alexandra E; Holterhus, Paul-Martin; Chao, Mei-Chyn; Kuo, Mei-Chuan; Hwang, Shang-Jyh; Chen, Hung-Chun


    17α-Hydroxylase/17, 20-lyase deficiency (17OHD) is an autosomal recessive disease causing congenital adrenal hyperplasia and a rare cause of hypertension with hypokalemia. The CYP17A1 gene mutation leads to 17OHD and its clinical features. We described an 18 y/o female with clinical features of 17α-hydroxylase/17, 20-lyase deficiency and characterized the functional consequences of an intronic CYP17A1 mutation. The coding regions and flanking intronic bases of the CYP17A1 gene were amplified by PCR and sequenced. The patient is a compound heterozygote for the previously described p.R358X and IVS1 +2T>C mutations. A first intron splice donor site mutation was re-created in minigene and full-length expression vectors. Pre-mRNA splicing of the variant CYP17A1 intron was studied in transfected cells and in a transformed lymphoblastoid cell line. When the full-length CYP17A1 gene and minigene containing the intronic mutation was expressed in transfected cells, the majority (>90%) of mRNA transcripts were incorrectly spliced. Only the p.R358X transcript was detected in the EBV-transformed lymphoblastoid cell line. The IVS1 +2T>C mutation abolished most 17α-hydroxylase/17, 20-lyase enzyme activity by aberrant mRNA splicing to an intronic pseudo-exon, causing a frame shift and early termination. PMID:21966534

  7. CYP17A1 Intron Mutation Causing Cryptic Splicing in 17α-Hydroxylase Deficiency

    PubMed Central

    Hwang, Daw-Yang; Hung, Chi-Chih; Riepe, Felix G.; Auchus, Richard J.; Kulle, Alexandra E.; Holterhus, Paul-Martin; Chao, Mei-Chyn; Kuo, Mei-Chuan; Hwang, Shang-Jyh; Chen, Hung-Chun


    17α-hydroxylase/17, 20-lyase deficiency (17OHD) is an autosomal recessive disease causing congenital adrenal hyperplasia and a rare cause of hypertension with hypokalemia. The CYP17A1 gene mutation leads to 17OHD and its clinical features. We described an 18 y/o female with clinical features of 17α-hydroxylase/17, 20-lyase deficiency and characterized the functional consequences of an intronic CYP17A1 mutation. The coding regions and flanking intronic bases of the CYP17A1 gene were amplified by PCR and sequenced. The patient is a compound heterozygote for the previously described p.R358X and IVS1 +2T>C mutations. A first intron splice donor site mutation was re-created in minigene and full-length expression vectors. Pre-mRNA splicing of the variant CYP17A1 intron was studied in transfected cells and in a transformed lymphoblastoid cell line. When the full-length CYP17A1 gene and minigene containing the intronic mutation was expressed in transfected cells, the majority (>90%) of mRNA transcripts were incorrectly spliced. Only the p.R358X transcript was detected in the EBV-transformed lymphoblastoid cell line. The IVS1 +2T>C mutation abolished most 17α-hydroxylase/17, 20-lyase enzyme activity by aberrant mRNA splicing to an intronic pseudo-exon, causing a frame shift and early termination. PMID:21966534

  8. An Intronic G Run within HIV-1 Intron 2 Is Critical for Splicing Regulation of vif mRNA

    PubMed Central

    Widera, Marek; Erkelenz, Steffen; Hillebrand, Frank; Krikoni, Aikaterini; Widera, Darius; Kaisers, Wolfgang; Deenen, René; Gombert, Michael; Dellen, Rafael; Pfeiffer, Tanya; Kaltschmidt, Barbara; Münk, Carsten; Bosch, Valerie; Köhrer, Karl


    Within target T lymphocytes, human immunodeficiency virus type I (HIV-1) encounters the retroviral restriction factor APOBEC3G (apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3G; A3G), which is counteracted by the HIV-1 accessory protein Vif. Vif is encoded by intron-containing viral RNAs that are generated by splicing at 3′ splice site (3′ss) A1 but lack splicing at 5′ss D2, which results in the retention of a large downstream intron. Hence, the extents of activation of 3′ss A1 and repression of D2, respectively, determine the levels of vif mRNA and thus the ability to evade A3G-mediated antiviral effects. The use of 3′ss A1 can be enhanced or repressed by splicing regulatory elements that control the recognition of downstream 5′ss D2. Here we show that an intronic G run (GI2-1) represses the use of a second 5′ss, termed D2b, that is embedded within intron 2 and, as determined by RNA deep-sequencing analysis, is normally inefficiently used. Mutations of GI2-1 and activation of D2b led to the generation of transcripts coding for Gp41 and Rev protein isoforms but primarily led to considerable upregulation of vif mRNA expression. We further demonstrate, however, that higher levels of Vif protein are actually detrimental to viral replication in A3G-expressing T cell lines but not in A3G-deficient cells. These observations suggest that an appropriate ratio of Vif-to-A3G protein levels is required for optimal virus replication and that part of Vif level regulation is effected by the novel G run identified here. PMID:23255806

  9. Enhanced group II intron retrohoming in magnesium-deficient Escherichia coli via selection of mutations in the ribozyme core

    PubMed Central

    Truong, David M.; Sidote, David J.; Russell, Rick; Lambowitz, Alan M.


    Mobile group II introns are bacterial retrotransposons thought to be evolutionary ancestors of spliceosomal introns and retroelements in eukaryotes. They consist of a catalytically active intron RNA (“ribozyme”) and an intron-encoded reverse transcriptase, which function together to promote RNA splicing and intron mobility via reverse splicing of the intron RNA into new DNA sites (“retrohoming”). Although group II introns are active in bacteria, their natural hosts, they function inefficiently in eukaryotes, where lower free Mg2+ concentrations decrease their ribozyme activity and constitute a natural barrier to group II intron proliferation within nuclear genomes. Here, we show that retrohoming of the Ll.LtrB group II intron is strongly inhibited in an Escherichia coli mutant lacking the Mg2+ transporter MgtA, and we use this system to select mutations in catalytic core domain V (DV) that partially rescue retrohoming at low Mg2+ concentrations. We thus identified mutations in the distal stem of DV that increase retrohoming efficiency in the MgtA mutant up to 22-fold. Biochemical assays of splicing and reverse splicing indicate that the mutations increase the fraction of intron RNA that folds into an active conformation at low Mg2+ concentrations, and terbium-cleavage assays suggest that this increase is due to enhanced Mg2+ binding to the distal stem of DV. Our findings indicate that DV is involved in a critical Mg2+-dependent RNA folding step in group II introns and demonstrate the feasibility of selecting intron variants that function more efficiently at low Mg2+ concentrations, with implications for evolution and potential applications in gene targeting. PMID:24043808

  10. Intron Retention in the Alternatively Spliced Region of RON Results from Weak 3’ Splice Site Recognition

    PubMed Central

    Smith, Lindsay D.; Lucas, Christian M.; Eperon, Ian C.


    The RON gene encodes a tyrosine kinase receptor for macrophage-stimulating protein. A constitutively active isoform that arises by skipping of exon 11 is expressed in carcinomas and contributes to an invasive phenotype. However, a high proportion of the mRNA expressed from the endogenous gene, or from transfected minigenes, appears to retain introns 10 and 11. It is not known whether this represents specific repression or the presence of weak splicing signals. We have used chimeric pre-mRNAs spliced in vitro to investigate the reason for intron retention. A systematic test showed that, surprisingly, the exon sequences known to modulate exon 11 skipping were not limiting, but the 3’ splice site regions adjacent to exons 11 and 12 were too weak to support splicing when inserted into a globin intron. UV-crosslinking experiments showed binding of hnRNP F/H just 5’ of these regions, but the hnRNP F/H target sequences did not mediate inhibition. Instead, the failure of splicing is linked to weak binding of U2AF65, and spliceosome assembly stalls prior to formation of any of the ATP-dependent complexes. We discuss mechanisms by which U2AF65 binding is facilitated in vivo. PMID:24155930

  11. A purine-rich intronic element enhances alternative splicing of thyroid hormone receptor mRNA.

    PubMed Central

    Hastings, M L; Wilson, C M; Munroe, S H


    The mammalian thyroid hormone receptor gene c-erbAalpha gives rise to two mRNAs that code for distinct isoforms, TRalpha1 and TRalpha2, with antagonistic functions. Alternative processing of these mRNAs involves the mutually exclusive use of a TRalpha1-specific polyadenylation site or TRalpha2-specific 5' splice site. A previous investigation of TRalpha minigene expression defined a critical role for the TRalpha2 5' splice site in directing alternative processing. Mutational analysis reported here shows that purine residues within a highly conserved intronic element, SEa2, enhance splicing of TRalpha2 in vitro as well as in vivo. Although SEalpha2 is located within the intron of TRalpha2 mRNA, it activates splicing of a heterologous dsx pre-mRNA when located in the downstream exon. Competition with wild-type and mutant RNAs indicates that SEalpha2 functions by binding trans-acting factors in HeLa nuclear extract. Protein-RNA crosslinking identifies several proteins, including SF2/ASF and hnRNP H, that bind specifically to SEalpha2. SEalpha2 also includes an element resembling a 5' splice site consensus sequence that is critical for splicing enhancer activity. Mutations within this pseudo-5' splice site sequence have a dramatic effect on splicing and protein binding. Thus SEa2 and its associated factors are required for splicing of TRalpha2 pre-mRNA. PMID:11421362

  12. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou


    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  13. Trans-splicing with the group I intron ribozyme from Azoarcus

    PubMed Central

    Dolan, Gregory F.; Müller, Ulrich F.


    Group I introns are ribozymes (catalytic RNAs) that excise themselves from RNA primary transcripts by catalyzing two successive transesterification reactions. These cis-splicing ribozymes can be converted into trans-splicing ribozymes, which can modify the sequence of a separate substrate RNA, both in vitro and in vivo. Previous work on trans-splicing ribozymes has mostly focused on the 16S rRNA group I intron ribozyme from Tetrahymena thermophila. Here, we test the trans-splicing potential of the tRNAIle group I intron ribozyme from the bacterium Azoarcus. This ribozyme is only half the size of the Tetrahymena ribozyme and folds faster into its active conformation in vitro. Our results showed that in vitro, the Azoarcus and Tetrahymena ribozymes favored the same set of splice sites on a substrate RNA. Both ribozymes showed the same trans-splicing efficiency when containing their individually optimized 5′ terminus. In contrast to the previously optimized 5′-terminal design of the Tetrahymena ribozyme, the Azoarcus ribozyme was most efficient with a trans-splicing design that resembled the secondary structure context of the natural cis-splicing Azoarcus ribozyme, which includes base-pairing between the substrate 5′ portion and the ribozyme 3′ exon. These results suggested preferred trans-splicing interactions for the Azoarcus ribozyme under near-physiological in vitro conditions. Despite the high activity in vitro, however, the splicing efficiency of the Azoarcus ribozyme in Escherichia coli cells was significantly below that of the Tetrahymena ribozyme. PMID:24344321

  14. Connections between RNA splicing and DNA intron mobility in yeast mitochondria: RNA maturase and DNA endonuclease switching experiments.

    PubMed Central

    Goguel, V; Delahodde, A; Jacq, C


    The intron-encoded proteins bI4 RNA maturase and aI4 DNA endonuclease can be faithfully expressed in yeast cytoplasm from engineered forms of their mitochondrial coding sequences. In this work we studied the relationships between these two activities associated with two homologous intron-encoded proteins: the bI4 RNA maturase encoded in the fourth intron of the cytochrome b gene and the aI4 DNA endonuclease (I-SceII) encoded in the fourth intron of the gene coding for the subunit I of cytochrome oxidase. Taking advantage of both the high recombinogenic properties of yeast and the similarities between the two genes, we constructed in vivo a family of hybrid genes carrying parts of both RNA maturase and DNA endonuclease coding sequences. The presence of a sequence coding for a mitochondrial targeting peptide upstream from these hybrid genes allowed us to study the properties of their translation products within the mitochondria in vivo. We thus could analyze the ability of the recombinant proteins to complement RNA maturase deficiencies in different strains. Many combinations of the two parental intronic sequences were found in the recombinants. Their structural and functional analysis revealed the following features. (i) The N-terminal half of the bI4 RNA maturase could be replaced in total by its equivalent from the aI4 DNA endonuclease without affecting the RNA maturase activity. In contrast, replacing the C-terminal half of the bI4 RNA maturase with its equivalent from the aI4 DNA endonuclease led to a very weak RNA maturase activity, indicating that this region is more differentiated and linked to the maturase activity. (ii) None of the hybrid proteins carrying an RNA maturase activity kept the DNA endonuclease activity, suggesting that the latter requires the integrity of the aI4 protein. These observations are interesting because the aI4 DNA endonuclease is known to promote the propagation, at the DNA level, of the aI4 intron, whereas the bI4 RNA maturase

  15. Nucleotide sequence composition adjacent to intronic splice sites improves splicing efficiency via its effect on pre-mRNA local folding in fungi.


    Zafrir, Zohar; Tuller, Tamir


    RNA splicing is the central process of intron removal in eukaryotes known to regulate various cellular functions such as growth, development, and response to external signals. The canonical sequences indicating the splicing sites needed for intronic boundary recognition are well known. However, the roles and evolution of the local folding of intronic and exonic sequence features adjacent to splice sites has yet to be thoroughly studied. Here, focusing on four fungi (Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus nidulans, and Candida albicans), we performed for the first time a comprehensive high-resolution study aimed at characterizing the encoding of intronic splicing efficiency in pre-mRNA transcripts and its effect on intron evolution. Our analysis supports the conjecture that pre-mRNA local folding strength at intronic boundaries is under selective pressure, as it significantly affects splicing efficiency. Specifically, we show that in the immediate region of 12-30 nucleotides (nt) surrounding the intronic donor site there is a preference for weak pre-mRNA folding; similarly, in the region of 15-33 nt surrounding the acceptor and branch sites there is a preference for weak pre-mRNA folding. We also show that in most cases there is a preference for strong pre-mRNA folding further away from intronic splice sites. In addition, we demonstrate that these signals are not associated with gene-specific functions, and they correlate with splicing efficiency measurements (r = 0.77, P = 2.98 × 10(-21)) and with expression levels of the corresponding genes (P = 1.24 × 10(-19)). We suggest that pre-mRNA folding strength in the above-mentioned regions has a direct effect on splicing efficiency by improving the recognition of intronic boundaries. These new discoveries are contributory steps toward a broader understanding of splicing regulation and intronic/transcript evolution. PMID:26246046

  16. Bronze-2 Gene Expression and Intron Splicing Patterns in Cells and Tissues of Zea mays L.


    Nash, J; Walbot, V


    A large fraction of the transcripts of the Bronze-2 (Bz2) gene of maize (Zea mays L.) are unspliced in purple husk tissues. The accumulation of unspliced messages could have destructive potential if the intron-bearing mRNAs are translated into aberrant proteins. Our initial studies suggested that both genetic and physiological factors may influence the degree of splicing failure. Nuclear background rather than cis-sequence effects is shown to contribute to the genetic component. The accumulation of unspliced message does not appear to be directly influenced by diurnal effects on transcript abundance, by the expression level of the Bz2 gene, or by thermal stress. We also show that maize cell cultures (Black Mexican Sweet, BMS) can be used to examine the molecular details involved in splicing failure. Much like whole maize plants, the BMS cells excise the Bz2 intron with varying degrees of efficiency. In contrast with heterologous constructs containing plant introns, splicing of the native Bz2 intron can appproach 100% in BMS cells. Splicing of transcripts from a marked, introduced gene can be compared to the endogeneous Bz2 gene facilitating analysis of the impact of sequence changes. PMID:16652984

  17. Dinoflagellate Gene Structure and Intron Splice Sites in a Genomic Tandem Array.


    Mendez, Gregory S; Delwiche, Charles F; Apt, Kirk E; Lippmeier, J Casey


    Dinoflagellates are one of the last major lineages of eukaryotes for which little is known about genome structure and organization. We report here the sequence and gene structure of a clone isolated from a cosmid library which, to our knowledge, represents the largest contiguously sequenced, dinoflagellate genomic, tandem gene array. These data, combined with information from a large transcriptomic library, allowed a high level of confidence of every base pair call. This degree of confidence is not possible with PCR-based contigs. The sequence contains an intron-rich set of five highly expressed gene repeats arranged in tandem. One of the tandem repeat gene members contains an intron 26,372 bp long. This study characterizes a splice site consensus sequence for dinoflagellate introns. Two to nine base pairs around the 3' splice site are repeated by an identical two to nine base pairs around the 5' splice site. The 5' and 3' splice sites are in the same locations within each repeat so that the repeat is found only once in the mature mRNA. This identically repeated intron boundary sequence might be useful in gene modeling and annotation of genomes. PMID:25963315

  18. EMPTY PERICARP16 is required for mitochondrial nad2 intron 4 cis-splicing, complex I assembly and seed development in maize.


    Xiu, Zhihui; Sun, Feng; Shen, Yun; Zhang, Xiaoyan; Jiang, Ruicheng; Bonnard, Géraldine; Zhang, Jianhua; Tan, Bao-Cai


    In higher plants, chloroplast and mitochondrial transcripts contain a number of group II introns that need to be precisely spliced before translation into functional proteins. However, the mechanism of splicing and the factors involved in this process are not well understood. By analysing a seed mutant in maize, we report here the identification of Empty pericarp16 (Emp16) that is required for splicing of nad2 intron 4 in mitochondria. Disruption of Emp16 function causes developmental arrest in the embryo and endosperm, giving rise to an empty pericarp phenotype in maize. Differentiation of the basal endosperm transfer layer cells is severely affected. Molecular cloning indicates that Emp16 encodes a P-type pentatricopeptide repeat (PPR) protein with 11 PPR motifs and is localized in the mitochondrion. Transcript analysis revealed that mitochondrial nad2 intron 4 splicing is abolished in the emp16 mutants, leading to severely reduced assembly and activity of complex I. In response, the mutant dramatically increases the accumulation of mitochondrial complex III and the expression of alternative oxidase AOX2. These results imply that EMP16 is specifically required for mitochondrial nad2 intron 4 cis-splicing and is essential for complex I assembly and embryogenesis and development endosperm in maize. PMID:26764126

  19. Modulation of splicing of the preceding intron by antisense oligonucleotide complementary to intra-exon sequence deleted in dystrophin Kobe

    SciTech Connect

    Takeshima, Y.; Matuso, M.; Sakamoto, H.; Nishio, H.


    Molecular analysis of dystrophin Kobe showed that exon 19 of the dystrophin gene bearing a 52 bp deletion was skipped during splicing, although the known consensus sequences at the 5{prime} and 3{prime} splice site of exon 19 were maintained. These data suggest that the deleted sequence of exon 19 may function as a cis-acting factor for exact splicing for the upstream intron. To investigate this potential role, an in vitro splicing system using dystrophin precursors was established. A two-exon precursor containing exon 18, truncated intron 18, and exon 19 was accurately spliced. However, splicing of intron 18 was dramatically inhibited when wild exon 19 was replaced with mutated exon 19. Even though the length of exon 19 was restored to normal by replacing the deleted sequence with other sequence, splicing of intron 18 was not fully reactivated. Characteristically, splicing of intron 18 was inactivated more markedly when the replaced sequence contained less polypurine stretches. These data suggested that modification of the exon sequence would result in a splicing abnormality. Antisense 31 mer 2`-O-methyl ribonucleotide was targeted against 5{prime} end of deleted region of exon 19 to modulate splicing of the mRNA precursor. Splicing of intron 18 was inhibited in a dose- and time-dependent manner. This is the first in vitro evidence to show splicing of dystrophin pre-mRNA can be managed by antisense oligonucleotides. These experiments represent an approach in which antisense oligonucleotides are used to restore the function of a defective dystrophin gene in Duchenne muscular dystrophy by inducing skipping of certain exons during splicing.

  20. Intronic motif pairs cooperate across exons to promote pre-mRNA splicing

    PubMed Central


    Background A very early step in splice site recognition is exon definition, a process that is as yet poorly understood. Communication between the two ends of an exon is thought to be required for this step. We report genome-wide evidence for exons being defined through the combinatorial activity of motifs located in flanking intronic regions. Results Strongly co-occurring motifs were found to specifically reside in four intronic regions surrounding a large number of human exons. These paired motifs occur around constitutive and alternative exons but not pseudo exons. Most co-occurring motifs are limited to intronic regions within 100 nucleotides of the exon. They are preferentially associated with weaker exons. Their pairing is conserved in evolution and they exhibit a lower frequency of single nucleotide polymorphism when paired. Paired motifs display specificity with respect to distance from the exon borders and in constitutive versus alternative splicing. Many resemble binding sites for heterogeneous nuclear ribonucleoproteins. Specific pairs are associated with tissue-specific genes, the higher expression of which coincides with that of the pertinent RNA binding proteins. Tested pairs acted synergistically to enhance exon inclusion, and this enhancement was found to be exon-specific. Conclusions The exon-flanking sequence pairs identified here by genomic analysis promote exon inclusion and may play a role in the exon definition step in pre-mRNA splicing. We propose a model in which multiple concerted interactions are required between exonic sequences and flanking intronic sequences to effect exon definition. PMID:20704715

  1. Evidence for a group II intron-like catalytic triplex in the spliceosome

    PubMed Central

    Piccirilli, Joseph A.; Staley, Jonathan P.


    To catalyze pre-mRNA splicing, U6 snRNA positions two metals that interact directly with the scissile phosphates. The U6 metal ligands correspond stereospecifically to metal ligands within the catalytic domain V of a group II self-splicing intron. In domain V, the ligands are organized by base-triple interactions, which also juxtapose the 3′ splice site with the catalytic metals. However, in the spliceosome, the mechanism for organizing catalytic metals and recruiting the substrate has remained unclear. Here we show by genetics, crosslinking, and biochemistry in yeast that analogous triples form in U6 and promote catalytic metal binding and both chemical steps of splicing. Because the triples include an element that defines the 5′ splice site, the triples also provide a mechanism for juxtaposing the pre-mRNA substrate with the catalytic metals. Our data indicate that U6 adopts a group II intron-like tertiary conformation to catalyze splicing. PMID:24747940

  2. Finding intron/exon splice junctions using INFO, INterruption Finder and Organizer.


    Laub, M T; Smith, D W


    INFO, INterruption Finder and Organizer, has been used to find coding sequence intron-exon splice junctions in human and other DNA by comparing the six conceptual translations of the input DNA sequence with sequences in protein databanks using a similarity matrix and windowing algorithm. Similarities detected both delineate position of the gene and provide clues as to the function of the gene product. In addition to use of a standard similarity matrix and windowing algorithm, INFO uses two novel steps, the MiniLibrary and Reverse Sequence steps, to enhance identification of small exons and to improve precision of junction nucleotide delineation. Exons as small as about 30 bases can be reliably found, and > 90% of junctions are precisely identified when canonical splice junction information is used. With the MiniLibrary and Reverse Sequence steps, INFO parameters need not be optimized by the user. In comparative test runs using 19 human DNA sequences, INFO found 108 of 111 exons, with 0 reported false positives, compared with 111 exons and 51 false positives for BLASTX, 99 exons and 6 false positives for GRAIL II, 77 exons and 24 false positives for GeneMark, 61 exons and 9 false positives for GeneID, and 105 exons and 6 false positives for PROCRUSTES. The correlation coefficient for finding and positioning these 111 exons was greater than 98% for INFO. Comparable results were obtained in test runs of 13 nonhuman DNA sequences. INFO is applicable to DNA from any species, will become more robust as sequence databanks expand, and complements other heuristic approaches. PMID:9672834

  3. Association of Carney Complex with an Intronic Splice Site Mutation in the PRKAR1A Gene.


    Guo, H; Xiong, H; Li, Z; Xu, J; Zhang, H; Chen, X; Hu, S


    This study was aimed to investigate the clinical features and mutations in the PRKAR1A gene of a multigenerational kindred including 17 individuals at risk for Carney complex. Eight patients were diagnosed with Carney complex among the 17 individuals (47.1%). Among the 8 affected patients, 4 had cardiac myxomas, 8 had skin pigmentation, and 3 had diabetes. Genomic DNA sequencing in 14 surviving patients showed 6 had the same germline mutation in the sixth intron and affected the splice site. cDNA sequencing and DNAMAN software showed 159 bases were absent, resulting in the absence of the amino acids 249 to 301 from the protein. All 6 patients with this PRKAR1A gene mutation had skin pigmentation. In conclusion, the present study reported for the first time an intronic splice site mutation in the PRKAR1A gene of a Chinese family with Carney complex, which probably caused skin pigmentation observed in affected family members. PMID:26788925

  4. Intronic mutations affecting splicing of MBTPS2 cause ichthyosis follicularis, alopecia and photophobia (IFAP) syndrome.


    Oeffner, Frank; Martinez, Francisco; Schaffer, Julie; Salhi, Aïcha; Monfort, Sandra; Oltra, Silvestre; Neidel, Ulrike; Bornholdt, Dorothea; van Bon, Bregje; König, Arne; Happle, Rudolf; Grzeschik, Karl-Heinz


    Ichthyosis follicularis, alopecia and photophobia (IFAP) syndrome is an X-linked genodermatosis with congenital atrichia being the most prominent feature. Recently, we have shown that functional deficiency of MBTPS2 (membrane-bound transcription factor protease site 2) - a zinc metalloprotease essential for cholesterol homeostasis and endoplasmic reticulum stress response - causes the disease. Here, we present results obtained by analysing two intronic MBTPS2 mutations, c.671-9T>G and c.225-6T>A, using in silico and cell-based splicing assays. Accordingly, the c.225-6T>A transversion generated a new splice acceptor site, which caused extension of exon 3 by four bases and subsequently introduced a premature stop codon. Both, minigene experiments and RT-PCR analysis with patient-derived mRNA, demonstrated that the c.671-9T>G mutation resulted in skipping of exon 6, most likely because of disruption of the polypyrimidin tract or a putative intronic splicing enhancer (ISE). Our combined biocomputational and experimental analysis strongly suggested that both intronic alterations are disease-causing mutations. PMID:21426410

  5. PCR differentiation of commercial yeast strains using intron splice site primers.

    PubMed Central

    de Barros Lopes, M; Soden, A; Henschke, P A; Langridge, P


    The increased use of pure starter cultures in the wine industry has made it necessary to develop a rapid and simple identification system for yeast strains. A method based upon the PCR using oligonucleotide primers that are complementary to intron splice sites has been developed. Since most introns are not essential for gene function, introns have evolved with minimal constraint. By targeting these highly variable sequences, the PCR has proved to be very effective in uncovering polymorphisms in commercial yeast strains. The speed of the method and the ability to analyze many samples in a single day permit the monitoring of specific yeast strains during fermentations. Furthermore, the simplicity of the technique, which does not require the isolation of DNA, makes it accessible to industrial laboratories that have limited molecular expertise and resources. PMID:8953723

  6. Insertion of a self-splicing intron into the mtDNA of atriploblastic animal

    SciTech Connect

    Valles, Y.; Halanych, K.; Boore, J.L.


    Nephtys longosetosa is a carnivorous polychaete worm that lives in the intertidal and subtidal zones with worldwide distribution (pleijel&rouse2001). Its mitochondrial genome has the characteristics typical of most metazoans: 37 genes; circular molecule; almost no intergenic sequence; and no significant gene rearrangements when compared to other annelid mtDNAs (booremoritz19981995). Ubiquitous features as small intergenic regions and lack of introns suggested that metazoan mtDNAs are under strong selective pressures to reduce their genome size allowing for faster replication requirements (booremoritz19981995Lynch2005). Yet, in 1996 two type I introns were found in the mtDNA of the basal metazoan Metridium senile (FigureX). Breaking a long-standing rule (absence of introns in metazoan mtDNA), this finding was later supported by the further presence of group I introns in other cnidarians. Interestingly, only the class Anthozoa within cnidarians seems to harbor such introns. Although several hundreds of triploblastic metazoan mtDNAs have been sequenced, this study is the first evidence of mitochondrial introns in triploblastic metazoans. The cox1 gene of N. longosetosa has an intron of almost 2 kbs in length. This finding represents as well the first instance of a group II intron (anthozoans harbor group I introns) in all metazoan lineages. Opposite trends are observed within plants, fungi and protist mtDNAs, where introns (both group I and II) and other non-coding sequences are widespread. Plant, fungal and protist mtDNA structure and organization differ enormously from that of metazoan mtDNA. Both, plant and fungal mtDNA are dynamic molecules that undergo high rates of recombination, contain long intergenic spacer regions and harbor both group I and group II introns. However, as metazoans they have a conserved gene content. Protists, on the other hand have a striking variation of gene content and introns that account for the genome size variation. In contrast to

  7. Efficient transcription of the human angiotensin II type 2 receptor gene requires intronic sequence elements.

    PubMed Central

    Warnecke, C; Willich, T; Holzmeister, J; Bottari, S P; Fleck, E; Regitz-Zagrosek, V


    To investigate mechanisms of human angiotensin II type 2 receptor (hAT2) gene regulation we functionally characterized the promoter and downstream regions of the gene. 5'-Terminal deletion mutants from -1417/+100 to -46/+100 elicited significant but low functional activity in luciferase reporter gene assays with PC12W cells. Inclusion into the promoter constructs of intron 1 and the transcribed region of the hAT2 gene up to the translation start enhanced luciferase activity 6.7+/-1.6-fold and 11.6+/-1.7-fold (means+/-S.E.M.) respectively, whereas fusion of the promoter to the spliced 5' untranslated region of hAT2 cDNA did not, which indicated an enhancement caused by intronic sequence elements. Reverse transcriptase-mediated PCR confirmed that the chimaeric hAT2-luciferase mRNA was regularly spliced in PC12W cells. A Northern blot analysis of transfected cells showed levels of luciferase mRNA expression consistent with the respective enzyme activities. Mapping of intron 1 revealed that a 12 bp sequence in the centre of the intron was required for the increase in promoter activity, whereas the 5' adjacent intronic region mediated a decrease in luciferase activity. Mutation of the 12 bp region led to altered protein binding and markedly decreased luciferase activity. Cloned into a promoterless luciferase vector, a 123 bp intron 1 fragment was able to direct reporter gene expression to the same activity as occurred in conjunction with the 5' flanking region. These results indicate that sequence elements in intron 1 are necessary for efficient transcription of hAT2. In reporter gene assays, intron 1 might by itself function as a promoter and initiate transcription from an alternative start point. PMID:10229654

  8. Biased exon/intron distribution of cryptic and de novo 3′ splice sites

    PubMed Central

    Královičová, Jana; Christensen, Mikkel B.; Vořechovský, Igor


    We compiled sequences of previously published aberrant 3′ splice sites (3′ss) that were generated by mutations in human disease genes. Cryptic 3′ss, defined here as those resulting from a mutation of the 3′YAG consensus, were more frequent in exons than in introns. They clustered in ∼20 nt region adjacent to authentic 3′ss, suggesting that their under-representation in introns is due to a depletion of AG dinucleotides in the polypyrimidine tract (PPT). In contrast, most aberrant 3′ss that were induced by mutations outside the 3′YAG consensus (designated ‘de novo’) were in introns. The activation of intronic de novo 3′ss was largely due to AG-creating mutations in the PPT. In contrast, exonic de novo 3′ss were more often induced by mutations improving the PPT, branchpoint sequence (BPS) or distant auxiliary signals, rather than by direct AG creation. The Shapiro–Senapathy matrix scores had a good prognostic value for cryptic, but not de novo 3′ss. Finally, AG-creating mutations in the PPT that produced aberrant 3′ss upstream of the predicted BPS in vivo shared a similar ‘BPS-new AG’ distance. Reduction of this distance and/or the strength of the new AG PPT in splicing reporter pre-mRNAs improved utilization of authentic 3′ss, suggesting that AG-creating mutations that are located closer to the BPS and are preceded by weaker PPT may result in less severe splicing defects. PMID:16141195

  9. Sequential splicing of a group II twintron in the marine cyanobacterium Trichodesmium

    PubMed Central

    Pfreundt, Ulrike; Hess, Wolfgang R.


    The marine cyanobacterium Trichodesmium is unusual in its genomic architecture as 40% of the genome is occupied by non-coding DNA. Although the majority of it is transcribed into RNA, it is not well understood why such a large non-coding genome fraction is maintained. Mobile genetic elements can contribute to genome expansion. Many bacteria harbor introns whereas twintrons, introns-in-introns, are rare and not known to interrupt protein-coding genes in bacteria. Here we show the sequential in vivo splicing of a 5400 nt long group II twintron interrupting a highly conserved gene that is associated with RNase HI in some cyanobacteria, but free-standing in others, including Trichodesmium erythraeum. We show that twintron splicing results in a putatively functional mRNA. The full genetic arrangement was found conserved in two geospatially distinct metagenomic datasets supporting its functional relevance. We further show that splicing of the inner intron yields the free intron as a true circle. This reaction requires the spliced exon reopening (SER) reaction to provide a free 5′ exon. The fact that Trichodesmium harbors a functional twintron fits in well with the high intron load of these genomes, and suggests peculiarities in its genetic machinery permitting such arrangements. PMID:26577185

  10. An intronic (A/U)GGG repeat enhances the splicing of an alternative intron of the chicken beta-tropomyosin pre-mRNA.

    PubMed Central

    Sirand-Pugnet, P; Durosay, P; Brody, E; Marie, J


    Computer analysis of human intron sequences have revealed a 50 nucleotide (nt) GC-rich region downstream of the 5' splice site; the trinucleotide GGG occurs almost four times as frequently as it would in a random sequence. The 5' part of a beta-tropomyosin intron exhibits six repetitions of the motif (A/U)GGG. In order to test whether these motifs play a role in the splicing process we have mutated some or all of them. Mutated RNAs show a lower in vitro splicing efficiency when compared with the wild-type, especially when all six motifs are mutated (> 70% inhibition). Assembly of the spliceosome complex B and, to a lesser extent, of the pre-spliceosome complex A also appears to be strongly affected by this mutation. A 55 kDa protein within HeLa cell nuclear extract is efficiently cross-linked to the G-rich region. This protein is present in the splicing complexes and its cross-linking to the pre-mRNA requires the presence of one or several snRNP. Altogether our results suggest that the G-rich sequences present in the 5' part of introns may act as an enhancer of the splicing reaction at the level of spliceosome assembly. Images PMID:7567462

  11. Rescue of splicing-mediated intron loss maximizes expression in lentiviral vectors containing the human ubiquitin C promoter

    PubMed Central

    Cooper, Aaron R.; Lill, Georgia R.; Gschweng, Eric H.; Kohn, Donald B.


    Lentiviral vectors almost universally use heterologous internal promoters to express transgenes. One of the most commonly used promoter fragments is a 1.2-kb sequence from the human ubiquitin C (UBC) gene, encompassing the promoter, some enhancers, first exon, first intron and a small part of the second exon of UBC. Because splicing can occur after transcription of the vector genome during vector production, we investigated whether the intron within the UBC promoter fragment is faithfully transmitted to target cells. Genetic analysis revealed that more than 80% of proviral forms lack the intron of the UBC promoter. The human elongation factor 1 alpha (EEF1A1) promoter fragment intron was not lost during lentiviral packaging, and this difference between the UBC and EEF1A1 promoter introns was conferred by promoter exonic sequences. UBC promoter intron loss caused a 4-fold reduction in transgene expression. Movement of the expression cassette to the opposite strand prevented intron loss and restored full expression. This increase in expression was mostly due to non-classical enhancer activity within the intron, and movement of putative intronic enhancer sequences to multiple promoter-proximal sites actually repressed expression. Reversal of the UBC promoter also prevented intron loss and restored full expression in bidirectional lentiviral vectors. PMID:25520191

  12. Dysferlin rescue by spliceosome-mediated pre-mRNA trans-splicing targeting introns harbouring weakly defined 3' splice sites.


    Philippi, Susanne; Lorain, Stéphanie; Beley, Cyriaque; Peccate, Cécile; Précigout, Guillaume; Spuler, Simone; Garcia, Luis


    The modification of the pre-mRNA cis-splicing process employing a pre-mRNA trans-splicing molecule (PTM) is an attractive strategy for the in situ correction of genes whose careful transcription regulation and full-length expression is determinative for protein function, as it is the case for the dysferlin (DYSF, Dysf) gene. Loss-of-function mutations of DYSF result in different types of muscular dystrophy mainly manifesting as limb girdle muscular dystrophy 2B (LGMD2B) and Miyoshi muscular dystrophy 1 (MMD1). We established a 3' replacement strategy for mutated DYSF pre-mRNAs induced by spliceosome-mediated pre-mRNA trans-splicing (SmaRT) by the use of a PTM. In contrast to previously established SmaRT strategies, we particularly focused on the identification of a suitable pre-mRNA target intron other than the optimization of the PTM design. By targeting DYSF pre-mRNA introns harbouring differentially defined 3' splice sites (3' SS), we found that target introns encoding weakly defined 3' SSs were trans-spliced successfully in vitro in human LGMD2B myoblasts as well as in vivo in skeletal muscle of wild-type and Dysf(-/-) mice. For the first time, we demonstrate rescue of Dysf protein by SmaRT in vivo. Moreover, we identified concordant qualities among the successfully targeted Dysf introns and targeted endogenous introns in previously reported SmaRT approaches that might facilitate a selective choice of target introns in future SmaRT strategies. PMID:25904108

  13. Large introns in relation to alternative splicing and gene evolution: a case study of Drosophila bruno-3

    PubMed Central

    Kandul, Nikolai P; Noor, Mohamed AF


    Background Alternative splicing (AS) of maturing mRNA can generate structurally and functionally distinct transcripts from the same gene. Recent bioinformatic analyses of available genome databases inferred a positive correlation between intron length and AS. To study the interplay between intron length and AS empirically and in more detail, we analyzed the diversity of alternatively spliced transcripts (ASTs) in the Drosophila RNA-binding Bruno-3 (Bru-3) gene. This gene was known to encode thirteen exons separated by introns of diverse sizes, ranging from 71 to 41,973 nucleotides in D. melanogaster. Although Bru-3's structure is expected to be conducive to AS, only two ASTs of this gene were previously described. Results Cloning of RT-PCR products of the entire ORF from four species representing three diverged Drosophila lineages provided an evolutionary perspective, high sensitivity, and long-range contiguity of splice choices currently unattainable by high-throughput methods. Consequently, we identified three new exons, a new exon fragment and thirty-three previously unknown ASTs of Bru-3. All exon-skipping events in the gene were mapped to the exons surrounded by introns of at least 800 nucleotides, whereas exons split by introns of less than 250 nucleotides were always spliced contiguously in mRNA. Cases of exon loss and creation during Bru-3 evolution in Drosophila were also localized within large introns. Notably, we identified a true de novo exon gain: exon 8 was created along the lineage of the obscura group from intronic sequence between cryptic splice sites conserved among all Drosophila species surveyed. Exon 8 was included in mature mRNA by the species representing all the major branches of the obscura group. To our knowledge, the origin of exon 8 is the first documented case of exonization of intronic sequence outside vertebrates. Conclusion We found that large introns can promote AS via exon-skipping and exon turnover during evolution likely due to

  14. Group II Intron-Anchored Gene Deletion in Clostridium

    PubMed Central

    Jia, Kaizhi; Zhu, Yan; Zhang, Yanping; Li, Yin


    Clostridium plays an important role in commercial and medical use, for which targeted gene deletion is difficult. We proposed an intron-anchored gene deletion approach for Clostridium, which combines the advantage of the group II intron “ClosTron” system and homologous recombination. In this approach, an intron carrying a fragment homologous to upstream or downstream of the target site was first inserted into the genome by retrotransposition, followed by homologous recombination, resulting in gene deletion. A functional unknown operon CAC1493–1494 located in the chromosome, and an operon ctfAB located in the megaplasmid of C. acetobutylicum DSM1731 were successfully deleted by using this approach, without leaving antibiotic marker in the genome. We therefore propose this approach can be used for targeted gene deletion in Clostridium. This approach might also be applicable for gene deletion in other bacterial species if group II intron retrotransposition system is established. PMID:21304965

  15. Crystal structures of a group II intron maturase reveal a missing link in spliceosome evolution.


    Zhao, Chen; Pyle, Anna Marie


    Group II introns are self-splicing ribozymes that are essential in many organisms, and they have been hypothesized to share a common evolutionary ancestor with the spliceosome. Although structural similarity of RNA components supports this connection, it is of interest to determine whether associated protein factors also share an evolutionary heritage. Here we present the crystal structures of reverse transcriptase (RT) domains from two group II intron-encoded proteins (maturases) from Roseburia intestinalis and Eubacterium rectale, obtained at 1.2-Å and 2.1-Å resolution, respectively. These domains are more similar in architecture to the spliceosomal Prp8 RT-like domain than to any other RTs, and they share substantial similarity with flaviviral RNA polymerases. The RT domain itself is sufficient for binding intron RNA with high affinity and specificity, and it is contained within an active RT enzyme. These studies provide a foundation for understanding structure-function relationships within group II intron-maturase complexes. PMID:27136328

  16. Construction of a yeast strain devoid of mitochondrial introns and its use to screen nuclear genes involved in mitochondrial splicing.

    PubMed Central

    Séraphin, B; Boulet, A; Simon, M; Faye, G


    We have constructed a respiring yeast strain devoid of mitochondrial introns to screen nuclear pet- mutants for those that play a direct role in mitochondrial intron excision. Intron-less mitochondria are introduced by cytoduction into pet- strains that have been made rho0; cytoductants therefrom recover respiratory competency if the original pet- mutation is required only for mitochondrial splicing. By this means, we have identified 11 complementation groups of such genes. Their total number may be estimated as about 18. Images PMID:3309947

  17. Genome-wide analysis of alternative splicing events in Hordeum vulgare: Highlighting retention of intron-based splicing and its possible function through network analysis.


    Panahi, Bahman; Mohammadi, Seyed Abolghasem; Ebrahimi Khaksefidi, Reyhaneh; Fallah Mehrabadi, Jalil; Ebrahimie, Esmaeil


    In this study, using homology mapping of assembled expressed sequence tags against the genomic data, we identified alternative splicing events in barley. Results demonstrated that intron retention is frequently associated with specific abiotic stresses. Network analysis resulted in discovery of some specific sub-networks between miRNAs and transcription factors in genes with high number of alternative splicing, such as cross talk between SPL2, SPL10 and SPL11 regulated by miR156 and miR157 families. To confirm the alternative splicing events, elongation factor protein (MLOC_3412) was selected followed by experimental verification of the predicted splice variants by Semi quantitative Reverse Transcription PCR (qRT-PCR). Our novel integrative approach opens a new avenue for functional annotation of alternative splicing through regulatory-based network discovery. PMID:26454178

  18. Insights into the history of a bacterial group II intron remnant from the genomes of the nitrogen-fixing symbionts Sinorhizobium meliloti and Sinorhizobium medicae

    PubMed Central

    Toro, N; Martínez-Rodríguez, L; Martínez-Abarca, F


    Group II introns are self-splicing catalytic RNAs that act as mobile retroelements. In bacteria, they are thought to be tolerated to some extent because they self-splice and home preferentially to sites outside of functional genes, generally within intergenic regions or in other mobile genetic elements, by mechanisms including the divergence of DNA target specificity to prevent target site saturation. RmInt1 is a mobile group II intron that is widespread in natural populations of Sinorhizobium meliloti and was first described in the GR4 strain. Like other bacterial group II introns, RmInt1 tends to evolve toward an inactive form by fragmentation, with loss of the 3′ terminus. We identified genomic evidence of a fragmented intron closely related to RmInt1 buried in the genome of the extant S. meliloti/S. medicae species. By studying this intron, we obtained evidence for the occurrence of intron insertion before the divergence of ancient rhizobial species. This fragmented group II intron has thus existed for a long time and has provided sequence variation, on which selection can act, contributing to diverse genetic rearrangements, and to generate pan-genome divergence after strain differentiation. The data presented here suggest that fragmented group II introns within intergenic regions closed to functionally important neighboring genes may have been microevolutionary forces driving adaptive evolution of these rhizobial species. PMID:24736785

  19. Insights into the history of a bacterial group II intron remnant from the genomes of the nitrogen-fixing symbionts Sinorhizobium meliloti and Sinorhizobium medicae.


    Toro, N; Martínez-Rodríguez, L; Martínez-Abarca, F


    Group II introns are self-splicing catalytic RNAs that act as mobile retroelements. In bacteria, they are thought to be tolerated to some extent because they self-splice and home preferentially to sites outside of functional genes, generally within intergenic regions or in other mobile genetic elements, by mechanisms including the divergence of DNA target specificity to prevent target site saturation. RmInt1 is a mobile group II intron that is widespread in natural populations of Sinorhizobium meliloti and was first described in the GR4 strain. Like other bacterial group II introns, RmInt1 tends to evolve toward an inactive form by fragmentation, with loss of the 3' terminus. We identified genomic evidence of a fragmented intron closely related to RmInt1 buried in the genome of the extant S. meliloti/S. medicae species. By studying this intron, we obtained evidence for the occurrence of intron insertion before the divergence of ancient rhizobial species. This fragmented group II intron has thus existed for a long time and has provided sequence variation, on which selection can act, contributing to diverse genetic rearrangements, and to generate pan-genome divergence after strain differentiation. The data presented here suggest that fragmented group II introns within intergenic regions closed to functionally important neighboring genes may have been microevolutionary forces driving adaptive evolution of these rhizobial species. PMID:24736785

  20. Intron splicing in 5' untranslated region of the rolA transcript in transgenic apple.


    Xue, Zhong-Tian; Holefors, Anna; Welander, Margareta


    The rolA gene encoded on the Ri plasmid of Agrobacterium rhizogenes causes developmental alterations, including dwarfing characteristics in the transgenic plants. In an attempt to introduce dwarfing characteristics into apple rootstocks for breeding purposes, the rolA gene was incorporated into the apple rootstock M26 and obtained four transgenic clones. All the clones exhibited reduced growth compared to untransformed control plants but different degree of dwarfing and wrinkled leaves. In the present study, expression of the rolA gene was further investigated by analysing the structure of the rolA transcript and the levels of the rolA mRNAs from these clones. The nucleotide (nt) sequence of the rolA transcript showed two forms of the transcript: one, the unspliced form, was co-linear with the rolA sequence in the genomic DNA; the other was spliced mRNA in which an 85-base pair (bp) intron sequence in the 5' untranslated region (5'UTR) was spliced out. The position of splicing is different from that in Arabidopsis thaliana but similar to the splicing site found in tobacco. The transcription start region of the rolA gene in apple was 206bp upstream of that in Arabidopsis and 277bp upstream to Nicotiana tabacum transcription start. A hairpin-like secondary structure and an upstream open reading frame (uORF) were revealed in the rolA 5'UTR. The levels of the rolA mRNA in the apple transgenic clones were analysed by semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR). The results showed slight variation in the shoot tissues of the transgenic clones. PMID:17490782

  1. The splicing regulatory element, UGCAUG, is phylogenetically and spatially conserved in introns that flank tissue-specific alternative exons

    PubMed Central

    Minovitsky, Simon; Gee, Sherry L.; Schokrpur, Shiruyeh; Dubchak, Inna; Conboy, John G.


    Previous studies have identified UGCAUG as an intron splicing enhancer that is frequently located adjacent to tissue-specific alternative exons in the human genome. Here, we show that UGCAUG is phylogenetically and spatially conserved in introns that flank brain-enriched alternative exons from fish to man. Analysis of sequence from the mouse, rat, dog, chicken and pufferfish genomes revealed a strongly statistically significant association of UGCAUG with the proximal intron region downstream of brain-enriched alternative exons. The number, position and sequence context of intronic UGCAUG elements were highly conserved among mammals and in chicken, but more divergent in fish. Control datasets, including constitutive exons and non-tissue-specific alternative exons, exhibited a much lower incidence of closely linked UGCAUG elements. We propose that the high sequence specificity of the UGCAUG element, and its unique association with tissue-specific alternative exons, mark it as a critical component of splicing switch mechanism(s) designed to activate a limited repertoire of splicing events in cell type-specific patterns. We further speculate that highly conserved UGCAUG-binding protein(s) related to the recently described Fox-1 splicing factor play a critical role in mediating this specificity. PMID:15691898

  2. A Novel Pathway for Sensory-Mediated Arousal Involves Splicing of an Intron in the period Clock Gene

    PubMed Central

    Cao, Weihuan; Edery, Isaac


    Study Objectives: D. melanogaster is an excellent animal model to study how the circadian (≅ 24-h) timing system and sleep regulate daily wake-sleep cycles. Splicing of a temperature-sensitive 3'-terminal intron (termed dmpi8) from the circadian clock gene period (per) regulates the distribution of daily activity in Drosophila. The role of dmpi8 splicing on daily behavior was further evaluated by analyzing sleep. Design: Transgenic flies of the same genetic background but expressing either a wild-type recombinant per gene or one where the efficiency of dmpi8 splicing was increased were exposed to different temperatures in daily light-dark cycles and sleep parameters measured. In addition, transgenic flies were briefly exposed to a variety of sensory-mediated stimuli to measure arousal responses. Results: Surprisingly, we show that the effect of dmpi8 splicing on daytime activity levels does not involve a circadian role for per but is linked to adjustments in sensory-dependent arousal and sleep behavior. Genetically altered flies with high dmpi8 splicing efficiency remain aroused longer following short treatments with light and non-photic cues such as mechanical stimulation. Conclusions: We propose that the thermal regulation of dmpi8 splicing acts as a temperature-calibrated rheostat in a novel arousal mechanism, so that on warm days the inefficient splicing of the dmpi8 intron triggers an increase in quiescence by decreasing sensory-mediated arousal, thus ensuring flies minimize being active during the hot midday sun despite the presence of light in the environment, which is usually a strong arousal cue for diurnal animals. Citation: Cao W, Edery I. A novel pathway for sensory-mediated arousal involves splicing of an intron in the period clock gene. SLEEP 2015;38(1):41–51. PMID:25325457

  3. Dispersion of the RmInt1 group II intron in the Sinorhizobium meliloti genome upon acquisition by conjugative transfer

    PubMed Central

    Nisa-Martínez, Rafael; Jiménez-Zurdo, José I.; Martínez-Abarca, Francisco; Muñoz-Adelantado, Estefanía; Toro, Nicolás


    RmInt1 is a self-splicing and mobile group II intron initially identified in the bacterium Sinorhizobium meliloti, which encodes a reverse transcriptase–maturase (Intron Encoded Protein, IEP) lacking the C-terminal DNA binding (D) and DNA endonuclease domains (En). RmInt1 invades cognate intronless homing sites (ISRm2011-2) by a mechanism known as retrohoming. This work describes how the RmInt1 intron spreads in the S.meliloti genome upon acquisition by conjugation. This process was revealed by using the wild-type intron RmInt1 and engineered intron-donor constructs based on ribozyme coding sequence (ΔORF)-derivatives with higher homing efficiency than the wild-type intron. The data demonstrate that RmInt1 propagates into the S.meliloti genome primarily by retrohoming with a strand bias related to replication of the chromosome and symbiotic megaplasmids. Moreover, we show that when expressed in trans from a separate plasmid, the IEP is able to mobilize genomic ΔORF ribozymes that afterward displayed wild-type levels of retrohoming. Our results contribute to get further understanding of how group II introns spread into bacterial genomes in nature. PMID:17158161

  4. Dispersion of the RmInt1 group II intron in the Sinorhizobium meliloti genome upon acquisition by conjugative transfer.


    Nisa-Martínez, Rafael; Jiménez-Zurdo, José I; Martínez-Abarca, Francisco; Muñoz-Adelantado, Estefanía; Toro, Nicolás


    RmInt1 is a self-splicing and mobile group II intron initially identified in the bacterium Sinorhizobium meliloti, which encodes a reverse transcriptase-maturase (Intron Encoded Protein, IEP) lacking the C-terminal DNA binding (D) and DNA endonuclease domains (En). RmInt1 invades cognate intronless homing sites (ISRm2011-2) by a mechanism known as retrohoming. This work describes how the RmInt1 intron spreads in the S.meliloti genome upon acquisition by conjugation. This process was revealed by using the wild-type intron RmInt1 and engineered intron-donor constructs based on ribozyme coding sequence (DeltaORF)-derivatives with higher homing efficiency than the wild-type intron. The data demonstrate that RmInt1 propagates into the S.meliloti genome primarily by retrohoming with a strand bias related to replication of the chromosome and symbiotic megaplasmids. Moreover, we show that when expressed in trans from a separate plasmid, the IEP is able to mobilize genomic DeltaORF ribozymes that afterward displayed wild-type levels of retrohoming. Our results contribute to get further understanding of how group II introns spread into bacterial genomes in nature. PMID:17158161

  5. Control of human PLP1 expression through transcriptional regulatory elements and alternatively spliced exons in intron 1.


    Hamdan, Hamdan; Kockara, Neriman T; Jolly, Lee Ann; Haun, Shirley; Wight, Patricia A


    Although the myelin proteolipid protein gene (PLP1) encodes the most abundant protein in central nervous system (CNS) myelin, not much is known about the mechanisms that govern expression of the human gene (hPLP1). Much more is known about the processes that regulate Plp1 gene expression in rodents. From studies with Plp1-lacZ transgenic mice, it was determined that the first intron of mouse Plp1 (mPlp1) is required to attain high levels of expression in brain, concurrent with the active myelination period. Other studies have suggested that within mPlp1 intron 1 (>8 kb) lie several regions with enhancer-like activity. To test whether these sequences (and possibly others) in hPLP1 intron 1 are functional, deletion-transfection analysis was performed with hPLP1-lacZ constructs that contain various portions of the intron, or lack it altogether. Results presented here demonstrate the importance of hPLP1 intron 1 in achieving maximal levels of expression in the immortalized oligodendroglial cell line, Oli-neu. Deletion analysis indicates that the intron contains multiple positive regulatory elements which are active in Oli-neu cells. Some of these elements appear to be functionally conserved between human and mouse, while others are not. Furthermore, our studies demonstrate that multiple splice variants can be formed due to inclusion of extra (supplementary) exons from what is classically thought of as hPLP1 intron 1. Thus, splicing of these novel exons (which are not recognized as such in mPlp1 due to lack of conserved splice sites) must utilize factors common to both human and mouse since Oli-neu cells are of mouse origin. PMID:25694552

  6. Why Selection Might Be Stronger When Populations Are Small: Intron Size and Density Predict within and between-Species Usage of Exonic Splice Associated cis-Motifs

    PubMed Central

    Wu, XianMing; Hurst, Laurence D.


    The nearly neutral theory predicts that small effective population size provides the conditions for weakened selection. This is postulated to explain why our genome is more “bloated” than that of, for example, yeast, ours having large introns and large intergene spacer. If a bloated genome is also an error prone genome might it, however, be the case that selection for error-mitigating properties is stronger in our genome? We examine this notion using splicing as an exemplar, not least because large introns can predispose to noisy splicing. We thus ask whether, owing to genomic decay, selection for splice error-control mechanisms is stronger, not weaker, in species with large introns and small populations. In humans much information defining splice sites is in cis-exonic motifs, most notably exonic splice enhancers (ESEs). These act as splice-error control elements. Here then we ask whether within and between-species intron size is a predictor of the commonality of exonic cis-splicing motifs. We show that, as predicted, the proportion of synonymous sites that are ESE-associated and under selection in humans is weakly positively correlated with the size of the flanking intron. In a phylogenetically controlled framework, we observe, also as expected, that mean intron size is both predicted by Ne.μ and is a good predictor of cis-motif usage across species, this usage coevolving with splice site definition. Unexpectedly, however, across taxa intron density is a better predictor of cis-motif usage than intron size. We propose that selection for splice-related motifs is driven by a need to avoid decoy splice sites that will be more common in genes with many and large introns. That intron number and density predict ESE usage within human genes is consistent with this, as is the finding of intragenic heterogeneity in ESE density. As intronic content and splice site usage across species is also well predicted by Ne.μ, the result also suggests an unusual circumstance in

  7. Probing the interplay between the two steps of group I intron splicing: competition of exogenous guanosine with omega G.


    Zarrinkar, P P; Sullenger, B A


    One largely unexplored question about group I intron splicing is how the cleavage and ligation steps of the reaction are coordinated. We describe a simple in vitro trans-splicing model system in which both steps take place, including the exchange of ligands in the guanosine-binding site that must occur between the two steps. Using this model system, we show that the switch is accomplished by modulating the relative affinity of the binding site for the two ligands. While the terminal guanosine of the intron (omegaG) and exogenous guanosine compete for binding during the first step of splicing, no competition is apparent during the second step, when omegaG is bound tightly. These results help explain how the ribozyme orchestrates progression through the splicing reaction. In addition to providing a new tool to ask basic questions about RNA catalysis, the trans-splicing model system will also facilitate the development of therapeutically useful group I ribozymes that can repair mutant mRNAs. PMID:9922174

  8. Using Group II Introns for Attenuating the In Vitro and In Vivo Expression of a Homing Endonuclease

    PubMed Central

    Guha, Tuhin Kumar; Hausner, Georg


    In Chaetomium thermophilum (DSM 1495) within the mitochondrial DNA (mtDNA) small ribosomal subunit (rns) gene a group IIA1 intron interrupts an open reading frame (ORF) encoded within a group I intron (mS1247). This arrangement offers the opportunity to examine if the nested group II intron could be utilized as a regulatory element for the expression of the homing endonuclease (HEase). Constructs were generated where the codon-optimized ORF was interrupted with either the native group IIA1 intron or a group IIB type intron. This study showed that the expression of the HEase (in vivo) in Escherichia coli can be regulated by manipulating the splicing efficiency of the HEase ORF-embedded group II introns. Exogenous magnesium chloride (MgCl2) stimulated the expression of a functional HEase but the addition of cobalt chloride (CoCl2) to growth media antagonized the expression of HEase activity. Ultimately the ability to attenuate HEase activity might be useful in precision genome engineering, minimizing off target activities, or where pathways have to be altered during a specific growth phase. PMID:26909494

  9. Skipping of exons by premature termination of transcription and alternative splicing within intron-5 of the sheep SCF gene: a novel splice variant.


    Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta


    Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (-) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as 'soluble' isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a 'novel' mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D(175)G site which is necessary to produce 'soluble' form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6-9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (-) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

  10. Comparison of mitochondrial and chloroplast genome segments from three onion (Allium cepa L.) cytoplasm types and identification of a trans-splicing intron of cox2.


    Kim, Sunggil; Yoon, Moo-Kyoung


    To study genetic relatedness of two male sterility-inducing cytotypes, the phylogenetic relationship among three cytotypes of onions (Allium cepa L.) was assessed by analyzing polymorphisms of the mitochondrial DNA organization and chloroplast sequences. The atp6 gene and a small open reading frame, orf22, did not differ between the normal and CMS-T cytotypes, but two SNPs and one 4-bp insertion were identified in CMS-S cytotype. Partial sequences of the chloroplast ycf2 gene were integrated in the upstream sequence of the cob gene via short repeat sequence-mediated recombination. However, this chloroplast DNA-integrated organization was detected only in CMS-S. Interestingly, disruption of a group II intron of cox2 was identified for the first time in this study. Like other trans-splicing group II introns in mitochondrial genomes, fragmentation of the intron occurred in domain IV. Two variants of each exon1 and exon2 flanking sequences were identified. The predominant types of four variants were identical in both the normal and the CMS-T cytotypes. These predominant types existed as sublimons in CMS-S cytotypes. Altogether, no differences were identified between normal and CMS-T, but significant differences in gene organization and nucleotide sequences were identified in CMS-S, suggesting recent origin of CMS-T male-sterility from the normal cytotype. PMID:20127247

  11. Splicing analysis of unclassified variants in COL2A1 and COL11A1 identifies deep intronic pathogenic mutations

    PubMed Central

    Richards, Allan J; McNinch, Annie; Whittaker, Joanne; Treacy, Becky; Oakhill, Kim; Poulson, Arabella; Snead, Martin P


    UK NHS diagnostic service sequence analysis of genes generally examines and reports on variations within a designated region 5′ and 3′ of each exon, typically 30 bp up and downstream. However, because of the degenerate nature of the splice sites, intronic variants outside the AG and GT dinucleotides of the acceptor and donor splice sites (ASS and DSS) are most often classified as being of unknown clinical significance, unless there is some functional evidence of their pathogenicity. It is now becoming clear that mutations deep within introns can also interfere with normal processing of pre-mRNA and result in pathogenic effects on the mature transcript. In diagnostic laboratories, these deep intronic variants most often fall outside of the regions analysed and so are rarely reported. With the likelihood that next generation sequencing will identify more of these unclassified variants, it will become important to perform additional studies to determine the pathogenicity of such sequence anomalies. Here, we analyse variants detected in either COL2A1 or COL11A1 in patients with Stickler syndrome. These have been analysed both in silico and functionally using either RNA isolated from the patient's cells or, more commonly, minigenes as splicing reporters. We show that deep intronic mutations are not a rare occurrence, including one variant that results in multiple transcripts, where both de novo donor and ASS are created by the mutation. Another variant produces transcripts that result in either haploinsufficiency or a dominant negative effect, potentially modifying the disease phenotype. PMID:22189268

  12. Using intron splicing trick for preferential gene expression in transduced cells: an approach for suicide gene therapy.


    Pourzadegan, F; Shariati, L; Taghizadeh, R; Khanahmad, H; Mohammadi, Z; Tabatabaiefar, M A


    Suicide gene therapy is one of the most innovative approaches in which a potential toxic gene is delivered to the targeted cancer cell by different target delivery methods. We constructed a transfer vector to express green fluorescent protein (GFP) in transduced cells but not in packaging cells. We placed gfp under the control of the cytomegalovirus (CMV) promoter, which is positioned between the two long-terminal repeats in reverse direction. The intron-2 sequence of the human beta globin gene with two poly-A signals and several stop codons on the antisense strand was placed on the leading strand between the CMV promoter and gfp. For lentiviral production, the HEK293T and line were co-transfected with the PMD2G, psPAX2 and pLentiGFP-Ins2 plasmids. The HEK293T and line were transduced with this virus. PCR was performed for evaluation of intron splicing in transduced cells. The GFP expression was seen in 65% of the cells transduced. The PCR amplification of the genomic DNA of transduced cells confirmed the splicing of intron 2. The strategy is significant to accomplish our goal for preserving the packaging cells from the toxic gene expression during viral assembly and the resultant reduction in viral titration. Also it serves to address several other issues in the gene therapy. PMID:26679755

  13. Motifs within the CA-repeat-rich region of Surfactant Protein B (SFTPB) intron 4 differentially affect mRNA splicing

    PubMed Central

    Yang, Wenjun; Ni, Lan; Silveyra, Patricia; Wang, Guirong; Noutsios, Georgios T; Singh, Anamika; DiAngelo, Susan L; Sanusi, Olabisi; Raval, Manmeet; Floros, Joanna


    The first half of the surfactant protein B (SP-B) gene intron 4 is a CA-repeat-rich region that contains 11 motifs. To study the role of this region on SP-B mRNA splicing, minigenes were generated by systematic removal of motifs from either the 5′ or 3′ end. These were transfected in CHO cells to study their splicing efficiency. The latter was determined as the ratio of completely to incompletely spliced SP-B RNA. Our results indicate that SP-B intron 4 motifs differentially affect splicing. Motifs 8 and 9 significantly enhanced and reduced splicing of intron 4, respectively. RNA mobility shift assays performed with a Motif 8 sequence that contains a CAUC cis-element and cell extracts resulted in a RNA:protein shift that was lost upon mutation of the element. Furthermore, in silico analysis of mRNA secondary structure stability for minigenes with and without motif 8 indicated a correlation between mRNA stability and splicing ratio. We conclude that differential loss of specific intron 4 motifs results in one or more of the following: a) altered splicing, b) differences in RNA stability and c) changes in secondary structure. These, in turn, may affect SP-B content in lung health or disease. PMID:23687636

  14. Recurrent insertion of 5'-terminal nucleotides and loss of the branchpoint motif in lineages of group II introns inserted in mitochondrial preribosomal RNAs.


    Li, Cheng-Fang; Costa, Maria; Bassi, Gurminder; Lai, Yiu-Kay; Michel, François


    A survey of sequence databases revealed 10 instances of subgroup IIB1 mitochondrial ribosomal introns with 1 to 33 additional nucleotides inserted between the 5' exon and the consensus sequence at the intron 5' end. These 10 introns depart further from the IIB1 consensus in their predicted domain VI structure: In contrast to its basal helix and distal GNRA terminal loop, the middle part of domain VI is highly variable and lacks the bulging A that serves as the branchpoint in lariat formation. In vitro experiments using two closely related IIB1 members inserted at the same ribosomal RNA site in the basidiomycete fungi Grifola frondosa and Pycnoporellus fulgens revealed that both ribozymes are capable of efficient self-splicing. However, whereas the Grifola intron was excised predominantly as a lariat, the Pycnoporellus intron, which possesses six additional nucleotides at the 5' end, yielded only linear products, consistent with its predicted domain VI structure. Strikingly, all of the introns with 5' terminal insertions lack the EBS2 exon-binding site. Moreover, several of them are part of the small subset of group II introns that encode potentially functional homing endonucleases of the LAGLIDADG family rather than reverse transcriptases. Such coincidences suggest causal relationships between the shift to DNA-based mobility, the loss of one of the two ribozyme sites for binding the 5' exon, and the exclusive use of hydrolysis to initiate splicing. PMID:21613530

  15. Insertion of part of an intron into the 5[prime] untranslated region of a Caenorhabditis elegans gene converts it into a trans-spliced gene

    SciTech Connect

    Conrad, R.; Thomas, J.; Spieth, J.; Blumenthal, T. )


    In nematodes, the RNA products of some genes are trans-spliced to a 22-nucleotide spliced leader (SL), while the RNA products of other genes are not. In Caenorhabditis elegans, there are two SLs, Sl1 and SL2, donated by two distinct small nuclear ribonucleoprotein particles in a process functionally quite similar to nuclear intron removal. The authors demonstrate here that it is possible to convert a non-trans-spliced gene into a trans-spliced gene by placement of an intron missing only the 5[prime] splice site into the 5[prime] untranslated region. Stable transgenic strains were isolated expressing a gene in which 69 nucleotides of a vit-5 intron, including the 3[prime] splice site, were inserted into the 5[prime] untranslated region of a vit-2/vit-6 fusion gene. The RNA product of this gene was examined by primer extension and PCR amplification. Although the vit-2/vit-6 transgene product is not normally trans-spliced, the majority of transcripts from this altered gene were trans-spliced to SL1. They termed the region of a trans-spliced mRNA precursor between the 5[prime] end and the first 3[prime] splice site an 'outrun'. The results suggest that if a transcript begins with intronlike sequence followed by a 3[prime] splice site, this alone may constitute an outrun and be sufficient to demarcate a transcript as a trans-splice acceptor. These findings leave open the possibility that specific sequences are required to increase the efficiency of trans-splicing.

  16. Insertion of part of an intron into the 5' untranslated region of a Caenorhabditis elegans gene converts it into a trans-spliced gene.

    PubMed Central

    Conrad, R; Thomas, J; Spieth, J; Blumenthal, T


    In nematodes, the RNA products of some genes are trans-spliced to a 22-nucleotide spliced leader (SL), while the RNA products of other genes are not. In Caenorhabditis elegans, there are two SLs, SL1 and SL2, donated by two distinct small nuclear ribonucleoprotein particles in a process functionally quite similar to nuclear intron removal. We demonstrate here that it is possible to convert a non-trans-spliced gene into a trans-spliced gene by placement of an intron missing only the 5' splice site into the 5' untranslated region. Stable transgenic strains were isolated expressing a gene in which 69 nucleotides of a vit-5 intron, including the 3' splice site, were inserted into the 5' untranslated region of a vit-2/vit-6 fusion gene. The RNA product of this gene was examined by primer extension and PCR amplification. Although the vit-2/vit-6 transgene product is not normally trans-spliced, the majority of transcripts from this altered gene were trans-spliced to SL1. We termed the region of a trans-spliced mRNA precursor between the 5' end and the first 3' splice site an "outron." Our results suggest that if a transcript begins with intronlike sequence followed by a 3' splice site, this alone may constitute an outron and be sufficient to demarcate a transcript as a trans-splice acceptor. These findings leave open the possibility that specific sequences are required to increase the efficiency of trans-splicing. Images PMID:1848665

  17. Characterization of a Disease-associated Mutation Affecting a Putative Splicing Regulatory Element in Intron 6b of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene*

    PubMed Central

    Faà, Valeria; Incani, Federica; Meloni, Alessandra; Corda, Denise; Masala, Maddalena; Baffico, A. Maria; Seia, Manuela; Cao, Antonio; Rosatelli, M. Cristina


    Cystic fibrosis (CF) is a common recessive disorder caused by >1600 mutations in the CF transmembrane conductance regulator (CFTR) gene. About 13% of CFTR mutations are classified as “splicing mutations,” but for almost 40% of these, their role in affecting the pre-mRNA splicing of the gene is not yet defined. In this work, we describe a new splicing mutation detected in three unrelated Italian CF patients. By DNA analyses and mRNA studies, we identified the c.1002–1110_1113delTAAG mutation localized in intron 6b of the CFTR gene. At the mRNA level, this mutation creates an aberrant inclusion of a sequence of 101 nucleotides between exons 6b and 7. This sequence corresponds to a portion of intron 6b and resembles a cryptic exon because it is characterized by an upstream ag and a downstream gt sequence, which are most probably recognized as 5′- and 3′-splice sites by the spliceosome. Through functional analysis of this splicing defect, we show that this mutation abolishes the interaction of the splicing regulatory protein heterogeneous nuclear ribonucleoprotein A2/B1 with an intronic splicing regulatory element and creates a new recognition motif for the SRp75 splicing factor, causing activation of the cryptic exon. Our results show that the c.1002–1110_1113delTAAG mutation creates a new intronic splicing regulatory element in intron 6b of the CFTR gene exclusively recognized by SRp75. PMID:19759008

  18. Convergent Evolution of Fern-Specific Mitochondrial Group II Intron atp1i361g2 and Its Ancient Source Paralogue rps3i249g2 and Independent Losses of Intron and RNA Editing among Pteridaceae.


    Zumkeller, Simon Maria; Knoop, Volker; Knie, Nils


    Mitochondrial intron patterns are highly divergent between the major land plant clades. An intron in the atp1 gene, atp1i361g2, is an example for a group II intron specific to monilophytes (ferns). Here, we report that atp1i361g2 is lost independently at least 4 times in the fern family Pteridaceae. Such plant organelle intron losses have previously been found to be accompanied by loss of RNA editing sites in the flanking exon regions as a consequence of genomic recombination of mature cDNA. Instead, we now observe that RNA editing events in both directions of pyrimidine exchange (C-to-U and U-to-C) are retained in atp1 exons after loss of the intron in Pteris argyraea/biaurita and in Actiniopteris and Onychium We find that atp1i361g2 has significant similarity with intron rps3i249g2 present in lycophytes and gymnosperms, which we now also find highly conserved in ferns. We conclude that atp1i361g2 may have originated from the more ancestral rps3i249g2 paralogue by a reverse splicing copy event early in the evolution of monilophytes. Secondary structure elements of the two introns, most characteristically their domains III, show strikingly convergent evolution in the monilophytes. Moreover, the intron paralogue rps3i249g2 reveals relaxed evolution in taxa where the atp1i361g2 paralogue is lost. Our findings may reflect convergent evolution of the two related mitochondrial introns exerted by co-evolution with an intron-binding protein simultaneously acting on the two paralogues. PMID:27492234

  19. Convergent Evolution of Fern-Specific Mitochondrial Group II Intron atp1i361g2 and Its Ancient Source Paralogue rps3i249g2 and Independent Losses of Intron and RNA Editing among Pteridaceae

    PubMed Central

    Zumkeller, Simon Maria; Knoop, Volker; Knie, Nils


    Mitochondrial intron patterns are highly divergent between the major land plant clades. An intron in the atp1 gene, atp1i361g2, is an example for a group II intron specific to monilophytes (ferns). Here, we report that atp1i361g2 is lost independently at least 4 times in the fern family Pteridaceae. Such plant organelle intron losses have previously been found to be accompanied by loss of RNA editing sites in the flanking exon regions as a consequence of genomic recombination of mature cDNA. Instead, we now observe that RNA editing events in both directions of pyrimidine exchange (C-to-U and U-to-C) are retained in atp1 exons after loss of the intron in Pteris argyraea/biaurita and in Actiniopteris and Onychium. We find that atp1i361g2 has significant similarity with intron rps3i249g2 present in lycophytes and gymnosperms, which we now also find highly conserved in ferns. We conclude that atp1i361g2 may have originated from the more ancestral rps3i249g2 paralogue by a reverse splicing copy event early in the evolution of monilophytes. Secondary structure elements of the two introns, most characteristically their domains III, show strikingly convergent evolution in the monilophytes. Moreover, the intron paralogue rps3i249g2 reveals relaxed evolution in taxa where the atp1i361g2 paralogue is lost. Our findings may reflect convergent evolution of the two related mitochondrial introns exerted by co-evolution with an intron-binding protein simultaneously acting on the two paralogues. PMID:27492234

  20. Skipping of Exons by Premature Termination of Transcription and Alternative Splicing within Intron-5 of the Sheep SCF Gene: A Novel Splice Variant

    PubMed Central

    Saravanaperumal, Siva Arumugam; Pediconi, Dario; Renieri, Carlo; La Terza, Antonietta


    Stem cell factor (SCF) is a growth factor, essential for haemopoiesis, mast cell development and melanogenesis. In the hematopoietic microenvironment (HM), SCF is produced either as a membrane-bound (−) or soluble (+) forms. Skin expression of SCF stimulates melanocyte migration, proliferation, differentiation, and survival. We report for the first time, a novel mRNA splice variant of SCF from the skin of white merino sheep via cloning and sequencing. Reverse transcriptase (RT)-PCR and molecular prediction revealed two different cDNA products of SCF. Full-length cDNA libraries were enriched by the method of rapid amplification of cDNA ends (RACE-PCR). Nucleotide sequencing and molecular prediction revealed that the primary 1519 base pair (bp) cDNA encodes a precursor protein of 274 amino acids (aa), commonly known as ‘soluble’ isoform. In contrast, the shorter (835 and/or 725 bp) cDNA was found to be a ‘novel’ mRNA splice variant. It contains an open reading frame (ORF) corresponding to a truncated protein of 181 aa (vs 245 aa) with an unique C-terminus lacking the primary proteolytic segment (28 aa) right after the D175G site which is necessary to produce ‘soluble’ form of SCF. This alternative splice (AS) variant was explained by the complete nucleotide sequencing of splice junction covering exon 5-intron (5)-exon 6 (948 bp) with a premature termination codon (PTC) whereby exons 6 to 9/10 are skipped (Cassette Exon, CE 6–9/10). We also demonstrated that the Northern blot analysis at transcript level is mediated via an intron-5 splicing event. Our data refine the structure of SCF gene; clarify the presence (+) and/or absence (−) of primary proteolytic-cleavage site specific SCF splice variants. This work provides a basis for understanding the functional role and regulation of SCF in hair follicle melanogenesis in sheep beyond what was known in mice, humans and other mammals. PMID:22719917

  1. The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development.


    Xu, Tao; Kim, Bo Mi; Kwak, Kyung Jin; Jung, Hyun Ju; Kang, Hunseung


    The minor U12 introns are removed from precursor mRNAs by the U12 intron-specific minor spliceosome. Among the seven ribonucleoproteins unique to the minor spliceosome, denoted as U11/U12-20K, U11/U12-25K, U11/U12-31K, U11/U12-65K, U11-35K, U11-48K, and U11-59K, the roles of only U11/U12-31K and U11/U12-65K have been demonstrated in U12 intron splicing and plant development. Here, the functional role of the Arabidopsis homolog of human U11-48K in U12 intron splicing and the development of Arabidopsis thaliana was examined using transgenic knockdown plants. The u11-48k mutants exhibited several defects in growth and development, such as severely arrested primary inflorescence stems, formation of serrated leaves, production of many rosette leaves after bolting, and delayed senescence. The splicing of most U12 introns analyzed was impaired in the u11-48k mutants. Comparative analysis of the splicing defects and phenotypes among the u11/u12-31k, u11-48k, and u11/12-65k mutants showed that the severity of abnormal development was closely correlated with the degree of impairment in U12 intron splicing. Taken together, these results provide compelling evidence that the Arabidopsis homolog of human U11-48K protein, as well as U11/U12-31K and U11/U12-65K proteins, is necessary for correct splicing of U12 introns and normal plant growth and development. PMID:27091878

  2. The Arabidopsis homolog of human minor spliceosomal protein U11-48K plays a crucial role in U12 intron splicing and plant development

    PubMed Central

    Xu, Tao; Kim, Bo Mi; Kwak, Kyung Jin; Jung, Hyun Ju; Kang, Hunseung


    The minor U12 introns are removed from precursor mRNAs by the U12 intron-specific minor spliceosome. Among the seven ribonucleoproteins unique to the minor spliceosome, denoted as U11/U12-20K, U11/U12-25K, U11/U12-31K, U11/U12-65K, U11-35K, U11-48K, and U11-59K, the roles of only U11/U12-31K and U11/U12-65K have been demonstrated in U12 intron splicing and plant development. Here, the functional role of the Arabidopsis homolog of human U11-48K in U12 intron splicing and the development of Arabidopsis thaliana was examined using transgenic knockdown plants. The u11-48k mutants exhibited several defects in growth and development, such as severely arrested primary inflorescence stems, formation of serrated leaves, production of many rosette leaves after bolting, and delayed senescence. The splicing of most U12 introns analyzed was impaired in the u11-48k mutants. Comparative analysis of the splicing defects and phenotypes among the u11/u12-31k, u11-48k, and u11/12-65k mutants showed that the severity of abnormal development was closely correlated with the degree of impairment in U12 intron splicing. Taken together, these results provide compelling evidence that the Arabidopsis homolog of human U11-48K protein, as well as U11/U12-31K and U11/U12-65K proteins, is necessary for correct splicing of U12 introns and normal plant growth and development. PMID:27091878

  3. Abiotic stresses affect differently the intron splicing and expression of chloroplast genes in coffee plants (Coffea arabica) and rice (Oryza sativa).


    Nguyen Dinh, Sy; Sai, Than Zaw Tun; Nawaz, Ghazala; Lee, Kwanuk; Kang, Hunseung


    Despite the increasing understanding of the regulation of chloroplast gene expression in plants, the importance of intron splicing and processing of chloroplast RNA transcripts under stress conditions is largely unknown. Here, to understand how abiotic stresses affect the intron splicing and expression patterns of chloroplast genes in dicots and monocots, we carried out a comprehensive analysis of the intron splicing and expression patterns of chloroplast genes in the coffee plant (Coffea arabica) as a dicot and rice (Oryza sativa) as a monocot under abiotic stresses, including drought, cold, or combined drought and heat stresses. The photosynthetic activity of both coffee plants and rice seedlings was significantly reduced under all stress conditions tested. Analysis of the transcript levels of chloroplast genes revealed that the splicing of tRNAs and mRNAs in coffee plants and rice seedlings were significantly affected by abiotic stresses. Notably, abiotic stresses affected differently the splicing of chloroplast tRNAs and mRNAs in coffee plants and rice seedlings. The transcript levels of most chloroplast genes were markedly downregulated in both coffee plants and rice seedlings upon stress treatment. Taken together, these results suggest that coffee and rice plants respond to abiotic stresses via regulating the intron splicing and expression of different sets of chloroplast genes. PMID:27448724

  4. G to A substitution in 5{prime} donor splice site of introns 18 and 48 of COL1A1 gene of type I collagen results in different splicing alternatives in osteogenesis imperfecta type I cell strains

    SciTech Connect

    Willing, M.; Deschenes, S.


    We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exon 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.

  5. Mobile group II intron targeting: applications in prokaryotes and perspectives in eukaryotes.


    Cui, Xiaoxia; Davis, Greg


    Mobile group II introns are ribozymes and use a novel mechanism--target DNA-primed reverse transcription--to proliferate in DNA. Group II introns are a unique mobile element for their high sequence-specific, yet readily flexible target site recognition. Both the intron RNA and the intron-encoded protein (IEP) are involved in target site recognition, and the specificity is determined primarily by base pairing between the intron RNA and DNA target. Therefore, the intron RNA can be modified according to the desired target sequence for specific gene disruption. Group II intron knockout technology is mature in bacteria and is currently being developed in eukaryotes. This technology has great potential to revolutionize fields such as functional genomics, gene therapy, and cell line engineering. PMID:17569624

  6. Antisense modulation of both exonic and intronic splicing motifs induces skipping of a DMD pseudo-exon responsible for x-linked dilated cardiomyopathy.


    Rimessi, Paola; Fabris, Marina; Bovolenta, Matteo; Bassi, Elena; Falzarano, Sofia; Gualandi, Francesca; Rapezzi, Claudio; Coccolo, Fabio; Perrone, Daniela; Medici, Alessandro; Ferlini, Alessandra


    Antisense-mediated exon skipping has proven to be efficacious for subsets of Duchenne muscular dystrophy mutations. This approach is based on targeting specific splicing motifs that interfere with the spliceosome assembly by steric hindrance. Proper exon recognition by the splicing machinery is thought to depend on exonic splicing enhancer sequences, often characterized by purine-rich stretches, representing potential targets for antisense-mediated exon skipping. We identified and functionally characterized two purine-rich regions located within dystrophin intron 11 and involved in splicing regulation of a pseudo-exon. A functional role for these sequences was suggested by a pure intronic DMD deletion causing X-linked dilated cardiomyopathy through the prevalent cardiac incorporation of the aberrant pseudo-exon, marked as Alu-exon, into the dystrophin transcript. The first splicing sequence is contained within the pseudo-exon, whereas the second is localized within its 3' intron. We demonstrated that the two sequences actually behave as splicing enhancers in cell-free splicing assays because their deletion strongly interferes with the pseudo-exon inclusion. Cell-free results were then confirmed in myogenic cells derived from the patient with X-linked dilated cardiomyopathy, by targeting the identified motifs with antisense molecules and obtaining a reduction in dystrophin pseudo-exon recognition. The splicing motifs identified could represent target sequences for a personalized molecular therapy in this particular DMD mutation. Our results demonstrated for the first time the role of intronic splicing sequences in antisense modulation with implications in exon skipping-mediated therapeutic approaches. PMID:20486769

  7. Compound heterozygous mutations in the noncoding RNU4ATAC cause Roifman Syndrome by disrupting minor intron splicing

    PubMed Central

    Merico, Daniele; Roifman, Maian; Braunschweig, Ulrich; Yuen, Ryan K. C.; Alexandrova, Roumiana; Bates, Andrea; Reid, Brenda; Nalpathamkalam, Thomas; Wang, Zhuozhi; Thiruvahindrapuram, Bhooma; Gray, Paul; Kakakios, Alyson; Peake, Jane; Hogarth, Stephanie; Manson, David; Buncic, Raymond; Pereira, Sergio L.; Herbrick, Jo-Anne; Blencowe, Benjamin J.; Roifman, Chaim M.; Scherer, Stephen W.


    Roifman Syndrome is a rare congenital disorder characterized by growth retardation, cognitive delay, spondyloepiphyseal dysplasia and antibody deficiency. Here we utilize whole-genome sequencing of Roifman Syndrome patients to reveal compound heterozygous rare variants that disrupt highly conserved positions of the RNU4ATAC small nuclear RNA gene, a minor spliceosome component that is essential for minor intron splicing. Targeted sequencing confirms allele segregation in six cases from four unrelated families. RNU4ATAC rare variants have been recently reported to cause microcephalic osteodysplastic primordial dwarfism, type I (MOPD1), whose phenotype is distinct from Roifman Syndrome. Strikingly, all six of the Roifman Syndrome cases have one variant that overlaps MOPD1-implicated structural elements, while the other variant overlaps a highly conserved structural element not previously implicated in disease. RNA-seq analysis confirms extensive and specific defects of minor intron splicing. Available allele frequency data suggest that recessive genetic disorders caused by RNU4ATAC rare variants may be more prevalent than previously reported. PMID:26522830

  8. Slow formation of a pseudoknot structure is rate limiting in the productive co-transcriptional folding of the self-splicing Candida intron.


    Zhang, Libin; Bao, Penghui; Leibowitz, Michael J; Zhang, Yi


    Pseudoknots play critical roles in packing the active structure of various functional RNAs. The importance of the P3-P7 pseudoknot in refolding of group I intron ribozymes has been recently appreciated, while little is known about the pseudoknot function in co-transcriptional folding. Here we used the Candida group I intron as a model to address the question. We show that co-transcriptional folding of the active self-splicing intron is twice as fast as refolding. The P3-P7 pseudoknot folds slowly during co-transcriptional folding at a rate constant similar to the folding of the active ribozyme, and folding of both P3-P7 and P1-P10 pseudoknots are inhibited by antisense oligonucleotides. We conclude that when RNA folding is coupled with transcription, formation of pseudoknot structures dominates the productive folding pathway and serves as a rate-limiting step in producing the self-splicing competent Candida intron. PMID:19710184

  9. Fluorescence and solution NMR study of the active site of a 160-kDa group II intron ribozyme

    PubMed Central

    Gumbs, Orlando H.; Padgett, Richard A.; Dayie, Kwaku T.


    We have reconstructed the group II intron from Pylaiella littoralis (PL) into a hydrolytic ribozyme, comprising domains 1–3 (D123) connected in cis plus domain 5 (D5) supplied in trans that efficiently cleaves spliced exon substrates. Using a novel gel-based fluorescence assay and nuclear magnetic resonance (NMR) spectroscopy, we monitored the direct binding of D5 to D123, characterized the kinetics of the spliced exon hydrolysis reaction (which is mechanistically analogous to the reverse of the second catalytic step of splicing), and identified the binding surface of D123 on D5. This PL ribozyme acts as an RNA endonuclease even at low monovalent (100 mM KCl) and divalent ion concentrations (1–10 mM MgCl2). This is in contrast to other group II intron ribozyme systems that require high levels of salt, making NMR analysis problematic. D5 binds tightly to D123 with a K d of 650 ± 250 nM, a K m of ∼300 nM, and a K cat of 0.02 min−1 under single turnover conditions. Within the ∼160-kDa D123–D5 binary complex, site-specific binding to D123 leads to dramatic chemical shift perturbation of residues localized to the tetraloop and internal bulge within D5, suggesting a structural switch model for D5-assisted splicing. This minimal ribozyme thus recapitulates the essential features of the reverse of the second catalytic step and represents a well-behaved system for ongoing high-resolution structural work to complement folding and catalytic functional studies. PMID:16894219

  10. Origin and evolution of spliceosomal introns

    PubMed Central


    Evolution of exon-intron structure of eukaryotic genes has been a matter of long-standing, intensive debate. The introns-early concept, later rebranded ‘introns first’ held that protein-coding genes were interrupted by numerous introns even at the earliest stages of life's evolution and that introns played a major role in the origin of proteins by facilitating recombination of sequences coding for small protein/peptide modules. The introns-late concept held that introns emerged only in eukaryotes and new introns have been accumulating continuously throughout eukaryotic evolution. Analysis of orthologous genes from completely sequenced eukaryotic genomes revealed numerous shared intron positions in orthologous genes from animals and plants and even between animals, plants and protists, suggesting that many ancestral introns have persisted since the last eukaryotic common ancestor (LECA). Reconstructions of intron gain and loss using the growing collection of genomes of diverse eukaryotes and increasingly advanced probabilistic models convincingly show that the LECA and the ancestors of each eukaryotic supergroup had intron-rich genes, with intron densities comparable to those in the most intron-rich modern genomes such as those of vertebrates. The subsequent evolution in most lineages of eukaryotes involved primarily loss of introns, with only a few episodes of substantial intron gain that might have accompanied major evolutionary innovations such as the origin of metazoa. The original invasion of self-splicing Group II introns, presumably originating from the mitochondrial endosymbiont, into the genome of the emerging eukaryote might have been a key factor of eukaryogenesis that in particular triggered the origin of endomembranes and the nucleus. Conversely, splicing errors gave rise to alternative splicing, a major contribution to the biological complexity of multicellular eukaryotes. There is no indication that any prokaryote has ever possessed a spliceosome

  11. In vitro genetic analysis of the structural features of the pre-tRNA required for determination of the 3' splice site in the intron excision reaction.

    PubMed Central

    Bufardeci, E; Fabbri, S; Baldi, M I; Mattoccia, E; Tocchini-Valentini, G P


    During processing of intron-containing pre-tRNAs, the Xenopus laevis splicing endonuclease binds the precursor and cleaves it at both the 5' and 3' splice sites. In vitro selection was used to determine structural features characteristic of precursor tRNA molecules that are active in this reaction. We performed two types of selection, one for molecules that are not cut, the other for molecules that are cut at only one site. The results shed light on various aspects of the intron excision reaction, including the importance of the three-dimensional structure of the mature domain for recognition and binding of the enzyme, the active role played by the single-stranded region of the intron, and the importance of the cardinal positions which, although not necessarily occupied by the same base in all precursors, nevertheless play a fundamental role in the splicing reaction. A precursor can be cut at the 3' site if a base in the single-stranded loop of the intron is allowed to pair (A-I pair) with the base of the 5' exon situated at the position immediately following the anticodon stem [first cardinal position (CP1)]. The nature of the bases involved in the A-I pair is important, as is the position of the base in the single-stranded loop of the intron. We discuss the role of the cardinal positions in the reaction. Images PMID:8223479

  12. Rhodopsin mutations in a Scottish retinitis pigmentosa population, including a novel splice site mutation in intron four.

    PubMed Central

    Bell, C; Converse, C A; Hammer, H M; Osborne, A; Haites, N E


    Retinitis pigmentosa (RP) is the name given to a group of disorders, both clinically and genetically heterogeneous, that primarily affect the photoreceptor function of the eye. Mutations in the genes encoding for rhodopsin, RDS-peripherin, or the beta subunit of the cGMP phosphodiesterase enzyme can be responsible for the phenotype. In this study the rhodopsin gene has been screened for mutations in a panel of RP individuals and five different sequence changes have been detected to date in three dominantly inherited and two unclassified families. One of these, a base substitution in the 3'UTR, has not yet been confirmed as disease specific, while three missense substitutions have previously been reported and are likely to be responsible for the phenotype. The fifth change, a base substitution at the intron 4 acceptor splice site, represents a novel mutation and is assumed to be the causative mutation. Images PMID:7819178

  13. N-Ethyl-N-Nitrosourea (ENU) Mutagenesis Reveals an Intronic Residue Critical for Caenorhabditis elegans 3' Splice Site Function in Vivo.


    Itani, Omar A; Flibotte, Stephane; Dumas, Kathleen J; Guo, Chunfang; Blumenthal, Thomas; Hu, Patrick J


    Metazoan introns contain a polypyrimidine tract immediately upstream of the AG dinucleotide that defines the 3' splice site. In the nematode Caenorhabditis elegans, 3' splice sites are characterized by a highly conserved UUUUCAG/R octamer motif. While the conservation of pyrimidines in this motif is strongly suggestive of their importance in pre-mRNA splicing, in vivo evidence in support of this is lacking. In an N-ethyl-N-nitrosourea (ENU) mutagenesis screen in Caenorhabditis elegans, we have isolated a strain containing a point mutation in the octamer motif of a 3' splice site in the daf-12 gene. This mutation, a single base T-to-G transversion at the -5 position relative to the splice site, causes a strong daf-12 loss-of-function phenotype by abrogating splicing. The resulting transcript is predicted to encode a truncated DAF-12 protein generated by translation into the retained intron, which contains an in-frame stop codon. Other than the perfectly conserved AG dinucleotide at the site of splicing, G at the -5 position of the octamer motif is the most uncommon base in C. elegans 3' splice sites, occurring at closely paired sites where the better match to the splicing consensus is a few bases downstream. Our results highlight both the biological importance of the highly conserved -5 uridine residue in the C. elegans 3' splice site octamer motif as well as the utility of using ENU as a mutagen to study the function of polypyrimidine tracts and other AU- or AT-rich motifs in vivo. PMID:27172199

  14. N-Ethyl-N-Nitrosourea (ENU) Mutagenesis Reveals an Intronic Residue Critical for Caenorhabditis elegans 3′ Splice Site Function in Vivo

    PubMed Central

    Itani, Omar A.; Flibotte, Stephane; Dumas, Kathleen J.; Guo, Chunfang; Blumenthal, Thomas; Hu, Patrick J.


    Metazoan introns contain a polypyrimidine tract immediately upstream of the AG dinucleotide that defines the 3′ splice site. In the nematode Caenorhabditis elegans, 3′ splice sites are characterized by a highly conserved UUUUCAG/R octamer motif. While the conservation of pyrimidines in this motif is strongly suggestive of their importance in pre-mRNA splicing, in vivo evidence in support of this is lacking. In an N-ethyl-N-nitrosourea (ENU) mutagenesis screen in Caenorhabditis elegans, we have isolated a strain containing a point mutation in the octamer motif of a 3′ splice site in the daf-12 gene. This mutation, a single base T-to-G transversion at the -5 position relative to the splice site, causes a strong daf-12 loss-of-function phenotype by abrogating splicing. The resulting transcript is predicted to encode a truncated DAF-12 protein generated by translation into the retained intron, which contains an in-frame stop codon. Other than the perfectly conserved AG dinucleotide at the site of splicing, G at the –5 position of the octamer motif is the most uncommon base in C. elegans 3′ splice sites, occurring at closely paired sites where the better match to the splicing consensus is a few bases downstream. Our results highlight both the biological importance of the highly conserved –5 uridine residue in the C. elegans 3′ splice site octamer motif as well as the utility of using ENU as a mutagen to study the function of polypyrimidine tracts and other AU- or AT-rich motifs in vivo. PMID:27172199

  15. Structural Divergence of the Group I Intron Binding Surface in Fungal Mitochondrial Tyrosyl-tRNA Synthetases That Function in RNA Splicing.


    Lamech, Lilian T; Saoji, Maithili; Paukstelis, Paul J; Lambowitz, Alan M


    The mitochondrial tyrosyl-tRNA synthetases (mtTyrRSs) of Pezizomycotina fungi, a subphylum that includes many pathogenic species, are bifunctional proteins that both charge mitochondrial tRNA(Tyr) and act as splicing cofactors for autocatalytic group I introns. Previous studies showed that one of these proteins, Neurospora crassa CYT-18, binds group I introns by using both its N-terminal catalytic and C-terminal anticodon binding domains and that the catalytic domain uses a newly evolved group I intron binding surface that includes an N-terminal extension and two small insertions (insertions 1 and 2) with distinctive features not found in non-splicing mtTyrRSs. To explore how this RNA binding surface diverged to accommodate different group I introns in other Pezizomycotina fungi, we determined x-ray crystal structures of C-terminally truncated Aspergillus nidulans and Coccidioides posadasii mtTyrRSs. Comparisons with previous N. crassa CYT-18 structures and a structural model of the Aspergillus fumigatus mtTyrRS showed that the overall topology of the group I intron binding surface is conserved but with variations in key intron binding regions, particularly the Pezizomycotina-specific insertions. These insertions, which arose by expansion of flexible termini or internal loops, show greater variation in structure and amino acids potentially involved in group I intron binding than do neighboring protein core regions, which also function in intron binding but may be more constrained to preserve mtTyrRS activity. Our results suggest a structural basis for the intron specificity of different Pezizomycotina mtTyrRSs, highlight flexible terminal and loop regions as major sites for enzyme diversification, and identify targets for therapeutic intervention by disrupting an essential RNA-protein interaction in pathogenic fungi. PMID:27036943

  16. Processing of intronic microRNAs

    PubMed Central

    Kim, Young-Kook; Kim, V Narry


    The majority of human microRNA (miRNA) loci are located within intronic regions and are transcribed by RNA polymerase II as part of their hosting transcription units. The primary transcripts are cleaved by Drosha to release ∼70 nt pre-miRNAs that are subsequently processed by Dicer to generate mature ∼22 nt miRNAs. It is generally believed that intronic miRNAs are released by Drosha from excised introns after the splicing reaction has occurred. However, our database searches and experiments indicate that intronic miRNAs can be processed from unspliced intronic regions before splicing catalysis. Intriguingly, cleavage of an intron by Drosha does not significantly affect the production of mature mRNA, suggesting that a continuous intron may not be required for splicing and that the exons may be tethered to each other. Hence, Drosha may cleave intronic miRNAs between the splicing commitment step and the excision step, thereby ensuring both miRNA biogenesis and protein synthesis from a single primary transcript. Our study provides a novel example of eukaryotic gene organization and RNA-processing control. PMID:17255951

  17. Identification of a pentatricopeptide repeat protein implicated in splicing of intron 1 of mitochondrial nad7 transcripts.


    Koprivova, Anna; des Francs-Small, Catherine Colas; Calder, Grant; Mugford, Sam T; Tanz, Sandra; Lee, Bok-Rye; Zechmann, Bernd; Small, Ian; Kopriva, Stanislav


    Splicing of plant organellar transcripts is facilitated by members of a large protein family, the pentatricopeptide repeat proteins. We have identified a pentatricopeptide repeat protein in a genetic screen for mutants resistant to inhibition of root growth by buthionine sulfoximine (BSO), an inhibitor of glutathione synthesis and consequently named BIR6 (BSO-insensitive roots 6). BIR6 is involved in splicing of intron 1 of the mitochondrial nad7 transcript. Loss-of-function mutations in BIR6 result in a strongly reduced accumulation of fully processed nad7 transcript. This affects assembly of Complex I and results in moderate growth retardation. In agreement with disruption of Complex I function, the genes encoding alternative NADH oxidizing enzymes are induced in the mutant, and the mutant plants are less sensitive to mannitol and salt stress. Mutation in the BIR6 gene allowed normal root growth in presence of BSO and strongly attenuated depletion of glutathione content at these conditions. The same phenotype was observed with other mutants affected in function of Complex I, thus reinforcing the importance of Complex I function for cellular redox homeostasis. PMID:20682769

  18. Identification of a Pentatricopeptide Repeat Protein Implicated in Splicing of Intron 1 of Mitochondrial nad7 Transcripts

    PubMed Central

    Koprivova, Anna; des Francs-Small, Catherine Colas; Calder, Grant; Mugford, Sam T.; Tanz, Sandra; Lee, Bok-Rye; Zechmann, Bernd; Small, Ian; Kopriva, Stanislav


    Splicing of plant organellar transcripts is facilitated by members of a large protein family, the pentatricopeptide repeat proteins. We have identified a pentatricopeptide repeat protein in a genetic screen for mutants resistant to inhibition of root growth by buthionine sulfoximine (BSO), an inhibitor of glutathione synthesis and consequently named BIR6 (BSO-insensitive roots 6). BIR6 is involved in splicing of intron 1 of the mitochondrial nad7 transcript. Loss-of-function mutations in BIR6 result in a strongly reduced accumulation of fully processed nad7 transcript. This affects assembly of Complex I and results in moderate growth retardation. In agreement with disruption of Complex I function, the genes encoding alternative NADH oxidizing enzymes are induced in the mutant, and the mutant plants are less sensitive to mannitol and salt stress. Mutation in the BIR6 gene allowed normal root growth in presence of BSO and strongly attenuated depletion of glutathione content at these conditions. The same phenotype was observed with other mutants affected in function of Complex I, thus reinforcing the importance of Complex I function for cellular redox homeostasis. PMID:20682769

  19. RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing

    PubMed Central

    Tang, Thean Hock; Rozhdestvensky, Timofey S.; d’Orval, Béatrice Clouet; Bortolin, Marie-Line; Huber, Harald; Charpentier, Bruno; Branlant, Christiane; Bachellerie, Jean-Pierre; Brosius, Jürgen; Hüttenhofer, Alexander


    The bulge–helix–bulge (BHB) motif recognised by the archaeal splicing endonuclease is also found in the long processing stems of archaeal rRNA precursors in which it is cleaved to generate pre-16S and pre-23S rRNAs. We show that in two species, Archaeoglobus fulgidus and Sulfolobus solfataricus, representatives from the two major archaeal kingdoms Euryarchaeota and Crenarchaeota, respectively, the pre-rRNA spacers cleaved at the BHB motifs surrounding pre-16S and pre-23S rRNAs subsequently become ligated. In addition, we present evidence that this is accompanied by circularisation of ribosomal pre-16S and pre-23S rRNAs in both species. These data reveal a further link between intron splicing and pre-rRNA processing in Archaea, which might reflect a common evolutionary origin of the two processes. One spliced RNA species designated 16S-D RNA, resulting from religation at the BHB motif of 16S pre-rRNA, is a highly abundant and stable RNA which folds into a three-stem structure interrupted by two single-stranded regions as assessed by chemical probing. It spans a region of the pre-rRNA 5′ external transcribed spacer exhibiting a highly conserved folding pattern in Archaea. Surprisingly, 16S-D RNA contains structural motifs found in archaeal C/D box small RNAs and binds to the L7Ae protein, a core component of archaeal C/D box RNPs. This supports the notion that it might have an important but still unknown role in pre-rRNA biogenesis or might even target RNA molecules other than rRNA. PMID:11842103

  20. Fox-2 Splicing Factor Binds to a Conserved Intron Motif to PromoteInclusion of Protein 4.1R Alternative Exon 16

    SciTech Connect

    Ponthier, Julie L.; Schluepen, Christina; Chen, Weiguo; Lersch,Robert A.; Gee, Sherry L.; Hou, Victor C.; Lo, Annie J.; Short, Sarah A.; Chasis, Joel A.; Winkelmann, John C.; Conboy, John G.


    Activation of protein 4.1R exon 16 (E16) inclusion during erythropoiesis represents a physiologically important splicing switch that increases 4.1R affinity for spectrin and actin. Previous studies showed that negative regulation of E16 splicing is mediated by the binding of hnRNP A/B proteins to silencer elements in the exon and that downregulation of hnRNP A/B proteins in erythroblasts leads to activation of E16 inclusion. This paper demonstrates that positive regulation of E16 splicing can be mediated by Fox-2 or Fox-1, two closely related splicing factors that possess identical RNA recognition motifs. SELEX experiments with human Fox-1 revealed highly selective binding to the hexamer UGCAUG. Both Fox-1 and Fox-2 were able to bind the conserved UGCAUG elements in the proximal intron downstream of E16, and both could activate E16 splicing in HeLa cell co-transfection assays in a UGCAUG-dependent manner. Conversely, knockdown of Fox-2 expression, achieved with two different siRNA sequences resulted in decreased E16 splicing. Moreover, immunoblot experiments demonstrate mouse erythroblasts express Fox-2, but not Fox-1. These findings suggest that Fox-2 is a physiological activator of E16 splicing in differentiating erythroid cells in vivo. Recent experiments show that UGCAUG is present in the proximal intron sequence of many tissue-specific alternative exons, and we propose that the Fox family of splicing enhancers plays an important role in alternative splicing switches during differentiation in metazoan organisms.

  1. An Intronic MBTPS2 Variant Results in a Splicing Defect in Horses with Brindle Coat Texture

    PubMed Central

    Murgiano, Leonardo; Waluk, Dominik P.; Towers, Rachel; Wiedemar, Natalie; Dietrich, Joëlle; Jagannathan, Vidhya; Drögemüller, Michaela; Balmer, Pierre; Druet, Tom; Galichet, Arnaud; Penedo, M. Cecilia; Müller, Eliane J.; Roosje, Petra; Welle, Monika M.; Leeb, Tosso


    We investigated a family of horses exhibiting irregular vertical stripes in their hair coat texture along the neck, back, hindquarters, and upper legs. This phenotype is termed “brindle” by horse breeders. We propose the term “brindle 1 (BR1)” for this specific form of brindle. In some BR1 horses, the stripes were also differentially pigmented. Pedigree analyses were suggestive of a monogenic X-chromosomal semidominant mode of inheritance. Haplotype analyses identified a 5 Mb candidate region on chromosome X. Whole genome sequencing of four BR1 and 60 nonbrindle horses identified 61 private variants in the critical interval, none of them located in an exon of an annotated gene. However, one of the private variants was close to an exon/intron boundary in intron 10 of the MBTPS2 gene encoding the membrane bound transcription factor peptidase, site 2 (c.1437+4T>C). Different coding variants in this gene lead to three related genodermatoses in human patients. We therefore analyzed MBTPS2 transcripts in skin, and identified an aberrant transcript in a BR1 horse, which lacked the entire exon 10 and parts of exon 11. The MBTPS2:c1437+4T>C variant showed perfect cosegregation with the brindle phenotype in the investigated family, and was absent from 457 control horses of diverse breeds. Altogether, our genetic data, and previous knowledge on MBTPS2 function in the skin, suggest that the identified MBTPS2 intronic variant leads to partial exon skipping, and causes the BR1 phenotype in horses. PMID:27449517

  2. Sequence specificity of a group II intron ribozyme: multiple mechanisms for promoting unusually high discrimination against mismatched targets.


    Xiang, Q; Qin, P Z; Michels, W J; Freeland, K; Pyle, A M


    Group II intron ai5 gamma was reconstructed into a multiple-turnover ribozyme that efficiently cleaves small oligonucleotide substrates in-trans. This construct makes it possible to investigate sequence specificity, since second-order rate constants (kcat/K(m), or the specificity constant) can be obtained and compared with values for mutant substrates and with other ribozymes. The ribozyme used in this study consists of intron domains 1 and 3 connected in-cis, together with domain 5 as a separate catalytic cofactor. This ribozyme has mechanistic features similar to the first step of reverse-splicing, in which a lariat intron attacks exogenous RNA and DNA substrates, and it therefore serves as a model for the sequence specificity of group II intron mobility. To quantitatively evaluate the sequence specificity of this ribozyme, the WT kcat/Km value was compared to individual kcat/Km values for a series of mutant substrates and ribozymes containing single base changes, which were designed to create mismatches at varying positions along the two ribozyme-substrate recognition helices. These mismatches had remarkably large effects on the discrimination index (1/relative kcat/K(m)), resulting in values > 10,000 in several cases. The delta delta G++ for mismatches ranged from 2 to 6 kcal/mol depending on the mismatch and its position. The high specificity of the ribozyme is attributable to effects on duplex stabilization (1-3 kcal/mol) and unexpectedly large effects on the chemical step of reaction (0.5-2.5 kcal/mol). In addition, substrate association is accompanied by an energetic penalty that lowers the overall binding energy between ribozyme and substrate, thereby causing the off-rate to be faster than the rate of catalysis and resulting in high specificity for the cleavage of long target sequences (> or = 13 nucleotides). PMID:9521704

  3. Group II intron–ribosome association protects intron RNA from degradation

    PubMed Central

    Contreras, Lydia M.; Huang, Tao; Piazza, Carol Lyn; Smith, Dorie; Qu, Guosheng; Gelderman, Grant; Potratz, Jeffrey P.; Russell, Rick; Belfort, Marlene


    The influence of the cellular environment on the structures and properties of catalytic RNAs is not well understood, despite great interest in ribozyme function. Here we report on ribosome association of group II introns, which are ribozymes that are important because of their putative ancestry to spliceosomal introns and retrotransposons, their retromobility via an RNA intermediate, and their application as gene delivery agents. We show that group II intron RNA, in complex with the intron-encoded protein from the native Lactoccocus lactis host, associates strongly with ribosomes in vivo. Ribosomes have little effect on intron ribozyme activities; rather, the association with host ribosomes protects the intron RNA against degradation by RNase E, an enzyme previously shown to be a silencer of retromobility in Escherichia coli. The ribosome interacts strongly with the intron, exerting protective effects in vivo and in vitro, as demonstrated by genetic and biochemical experiments. These results are consistent with the ribosome influencing the integrity of catalytic RNAs in bacteria in the face of degradative nucleases that regulate intron mobility. PMID:24046482

  4. An intronic structure enabled by a long-distance interaction serves as a novel target for splicing correction in spinal muscular atrophy

    PubMed Central

    Singh, Natalia N.; Lawler, Mariah N.; Ottesen, Eric W.; Upreti, Daya; Kaczynski, Jennifer R.; Singh, Ravindra N.


    Here, we report a long-distance interaction (LDI) as a critical regulator of alternative splicing of Survival Motor Neuron 2 (SMN2) exon 7, skipping of which is linked to spinal muscular atrophy (SMA), a leading genetic disease of children and infants. We show that this LDI is linked to a unique intra-intronic structure that we term internal stem through LDI-1 (ISTL1). We used site-specific mutations and Selective 2′-Hydroxyl Acylation analyzed by Primer Extension to confirm the formation and functional significance of ISTL1. We demonstrate that the inhibitory effect of ISTL1 is independent of hnRNP A1/A2B1 and PTB1 previously implicated in SMN2 exon 7 splicing. We show that an antisense oligonucleotide-mediated sequestration of the 3′ strand of ISTL1 fully corrects SMN2 exon 7 splicing and restores high levels of SMN and Gemin2, a SMN-interacting protein, in SMA patient cells. Our results also reveal that the 3′ strand of ISTL1 and upstream sequences constitute an inhibitory region that we term intronic splicing silencer N2 (ISS-N2). This is the first report to demonstrate a critical role of a structure-associated LDI in splicing regulation of an essential gene linked to a genetic disease. Our findings expand the repertoire of potential targets for an antisense oligonucleotide-mediated therapy of SMA. PMID:23861442

  5. Modeling study on the cleavage step of the self-splicing reaction in group I introns

    NASA Technical Reports Server (NTRS)

    Setlik, R. F.; Garduno-Juarez, R.; Manchester, J. I.; Shibata, M.; Ornstein, R. L.; Rein, R.


    A three-dimensional model of the Tetrahymena thermophila group I intron is used to further explore the catalytic mechanism of the transphosphorylation reaction of the cleavage step. Based on the coordinates of the catalytic core model proposed by Michel and Westhof (Michel, F., Westhof, E. J. Mol. Biol. 216, 585-610 (1990)), we first converted their ligation step model into a model of the cleavage step by the substitution of several bases and the removal of helix P9. Next, an attempt to place a trigonal bipyramidal transition state model in the active site revealed that this modified model for the cleavage step could not accommodate the transition state due to insufficient space. A lowering of P1 helix relative to surrounding helices provided the additional space required. Simultaneously, it provided a better starting geometry to model the molecular contacts proposed by Pyle et al. (Pyle, A. M., Murphy, F. L., Cech, T. R. Nature 358, 123-128. (1992)), based on mutational studies involving the J8/7 segment. Two hydrated Mg2+ complexes were placed in the active site of the ribozyme model, using the crystal structure of the functionally similar Klenow fragment (Beese, L.S., Steitz, T.A. EMBO J. 10, 25-33 (1991)) as a guide. The presence of two metal ions in the active site of the intron differs from previous models, which incorporate one metal ion in the catalytic site to fulfill the postulated roles of Mg2+ in catalysis. The reaction profile is simulated based on a trigonal bipyramidal transition state, and the role of the hydrated Mg2+ complexes in catalysis is further explored using molecular orbital calculations.

  6. Functional characterization of two novel splicing mutations in the OCA2 gene associated with oculocutaneous albinism type II.


    Rimoldi, Valeria; Straniero, Letizia; Asselta, Rosanna; Mauri, Lucia; Manfredini, Emanuela; Penco, Silvana; Gesu, Giovanni P; Del Longo, Alessandra; Piozzi, Elena; Soldà, Giulia; Primignani, Paola


    Oculocutaneous albinism (OCA) is characterized by hypopigmentation of the skin, hair and eye, and by ophthalmologic abnormalities caused by a deficiency in melanin biosynthesis. OCA type II (OCA2) is one of the four commonly-recognized forms of albinism, and is determined by mutation in the OCA2 gene. In the present study, we investigated the molecular basis of OCA2 in two siblings and one unrelated patient. The mutational screening of the OCA2 gene identified two hitherto-unknown putative splicing mutations. The first one (c.1503+5G>A), identified in an Italian proband and her affected sibling, lies in the consensus sequence of the donor splice site of OCA2 intron 14 (IVS14+5G>A), in compound heterozygosity with a frameshift mutation, c.1450_1451insCTGCCCTGACA, which is predicted to determine the premature termination of the polypeptide chain (p.I484Tfs*19). In-silico prediction of the effect of the IVS14+5G>A mutation on splicing showed a score reduction for the mutant splice site and indicated the possible activation of a newly-created deep-intronic acceptor splice site. The second mutation is a synonymous transition (c.2139G>A, p.K713K) involving the last nucleotide of exon 20. This mutation was found in a young African albino patient in compound heterozygosity with a previously-reported OCA2 missense mutation (p.T404M). In-silico analysis predicted that the mutant c.2139G>A allele would result in the abolition of the splice donor site. The effects on splicing of these two novel mutations were investigated using an in-vitro hybrid-minigene approach that led to the demonstration of the causal role of the two mutations and to the identification of aberrant transcript variants. PMID:24361966

  7. Defective histone supply causes changes in RNA polymerase II elongation rate and cotranscriptional pre-mRNA splicing

    PubMed Central

    Jimeno-González, Silvia; Payán-Bravo, Laura; Muñoz-Cabello, Ana M.; Guijo, Macarena; Gutierrez, Gabriel; Prado, Félix; Reyes, José C.


    RNA polymerase II (RNAPII) transcription elongation is a highly regulated process that greatly influences mRNA levels as well as pre-mRNA splicing. Despite many studies in vitro, how chromatin modulates RNAPII elongation in vivo is still unclear. Here, we show that a decrease in the level of available canonical histones leads to more accessible chromatin with decreased levels of canonical histones and variants H2A.X and H2A.Z and increased levels of H3.3. With this altered chromatin structure, the RNAPII elongation rate increases, and the kinetics of pre-mRNA splicing is delayed with respect to RNAPII elongation. Consistent with the kinetic model of cotranscriptional splicing, the rapid RNAPII elongation induced by histone depletion promotes the skipping of variable exons in the CD44 gene. Indeed, a slowly elongating mutant of RNAPII was able to rescue this defect, indicating that the defective splicing induced by histone depletion is a direct consequence of the increased elongation rate. In addition, genome-wide analysis evidenced that histone reduction promotes widespread alterations in pre-mRNA processing, including intron retention and changes in alternative splicing. Our data demonstrate that pre-mRNA splicing may be regulated by chromatin structure through the modulation of the RNAPII elongation rate. PMID:26578803

  8. Slow formation of a pseudoknot structure is rate limiting in the productive co-transcriptional folding of the self-splicing Candida intron

    PubMed Central

    Zhang, Libin; Bao, Penghui; Leibowitz, Michael J.; Zhang, Yi


    Pseudoknots play critical roles in packing the active structure of various functional RNAs. The importance of the P3–P7 pseudoknot in refolding of group I intron ribozymes has been recently appreciated, while little is known about the pseudoknot function in co-transcriptional folding. Here we used the Candida group I intron as a model to address the question. We show that co-transcriptional folding of the active self-splicing intron is twice as fast as refolding. The P3–P7 pseudoknot folds slowly during co-transcriptional folding at a rate constant similar to the folding of the active ribozyme, and folding of both P3–P7 and P1–P10 pseudoknots are inhibited by antisense oligonucleotides. We conclude that when RNA folding is coupled with transcription, formation of pseudoknot structures dominates the productive folding pathway and serves as a rate-limiting step in producing the self-splicing competent Candida intron. PMID:19710184

  9. The origin of introns and their role in eukaryogenesis: a compromise solution to the introns-early versus introns-late debate?

    PubMed Central

    Koonin, Eugene V


    Background Ever since the discovery of 'genes in pieces' and mRNA splicing in eukaryotes, origin and evolution of spliceosomal introns have been considered within the conceptual framework of the 'introns early' versus 'introns late' debate. The 'introns early' hypothesis, which is closely linked to the so-called exon theory of gene evolution, posits that protein-coding genes were interrupted by numerous introns even at the earliest stages of life's evolution and that introns played a major role in the origin of proteins by facilitating recombination of sequences coding for small protein/peptide modules. Under this scenario, the absence of spliceosomal introns in prokaryotes is considered to be a result of "genome streamlining". The 'introns late' hypothesis counters that spliceosomal introns emerged only in eukaryotes, and moreover, have been inserted into protein-coding genes continuously throughout the evolution of eukaryotes. Beyond the formal dilemma, the more substantial side of this debate has to do with possible roles of introns in the evolution of eukaryotes. Results I argue that several lines of evidence now suggest a coherent solution to the introns-early versus introns-late debate, and the emerging picture of intron evolution integrates aspects of both views although, formally, there seems to be no support for the original version of introns-early. Firstly, there is growing evidence that spliceosomal introns evolved from group II self-splicing introns which are present, usually, in small numbers, in many bacteria, and probably, moved into the evolving eukaryotic genome from the α-proteobacterial progenitor of the mitochondria. Secondly, the concept of a primordial pool of 'virus-like' genetic elements implies that self-splicing introns are among the most ancient genetic entities. Thirdly, reconstructions of the ancestral state of eukaryotic genes suggest that the last common ancestor of extant eukaryotes had an intron-rich genome. Thus, it appears that

  10. Crystal structure of group II intron domain 1 reveals a template for RNA assembly

    PubMed Central

    Zhao, Chen; Rajashankar, Kanagalaghatta R.; Marcia, Marco; Pyle, Anna Marie


    Although the importance of large noncoding RNAs is increasingly appreciated, our understanding of their structures and architectural dynamics remains limited. In particular, we know little about RNA folding intermediates and how they facilitate the productive assembly of RNA tertiary structures. Here, we report the crystal structure of an obligate intermediate that is required during the earliest stages of group II intron folding. Comprised of intron domain 1 from the Oceanobacillus iheyensis group II intron (D1, 266 nts), this intermediate retains native-like features but adopts a compact conformation in which the active-site cleft is closed. Transition between this closed and open (native) conformation is achieved through discrete rotations of hinge motifs in two regions of the molecule. The open state is then stabilized by sequential docking of downstream intron domains, suggesting a “first comes, first folds” strategy that may represent a generalizable pathway for assembly of large RNA and ribonucleoprotein structures. PMID:26502156

  11. Solution Structure of the HIV-1 Intron Splicing Silencer and Its Interactions with the UP1 Domain of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1.


    Jain, Niyati; Morgan, Christopher E; Rife, Brittany D; Salemi, Marco; Tolbert, Blanton S


    Splicing patterns in human immunodeficiency virus type 1 (HIV-1) are maintained through cis regulatory elements that recruit antagonistic host RNA-binding proteins. The activity of the 3' acceptor site A7 is tightly regulated through a complex network of an intronic splicing silencer (ISS), a bipartite exonic splicing silencer (ESS3a/b), and an exonic splicing enhancer (ESE3). Because HIV-1 splicing depends on protein-RNA interactions, it is important to know the tertiary structures surrounding the splice sites. Herein, we present the NMR solution structure of the phylogenetically conserved ISS stem loop. ISS adopts a stable structure consisting of conserved UG wobble pairs, a folded 2X2 (GU/UA) internal loop, a UU bulge, and a flexible AGUGA apical loop. Calorimetric and biochemical titrations indicate that the UP1 domain of heterogeneous nuclear ribonucleoprotein A1 binds the ISS apical loop site-specifically and with nanomolar affinity. Collectively, this work provides additional insights into how HIV-1 uses a conserved RNA structure to commandeer a host RNA-binding protein. PMID:26607354

  12. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.


    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P


    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

  13. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

    PubMed Central

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.


    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

  14. Evolutionary dynamics of the mS952 intron: a novel mitochondrial group II intron encoding a LAGLIDADG homing endonuclease gene.


    Mullineux, Sahra-Taylor; Willows, Karla; Hausner, Georg


    Examination of the mitochondrial small subunit ribosomal RNA (rns) gene of five species of the fungal genus Leptographium revealed that the gene has been invaded at least once at position 952 by a group II intron encoding a LAGLIDADG homing endonuclease gene. Phylogenetic analyses of the intron and homing endonuclease sequences indicated that each element in Leptographium species forms a single clade and is closely related to the group II intron/homing endonuclease gene composite element previously reported at position 952 of the mitochondrial rns gene of Cordyceps species and of Cryphonectria parasitica. The results of an intron survey of the mt rns gene of Leptographium species superimposed onto the phylogenetic analysis of the host organisms suggest that the composite element was transmitted vertically in Leptographium lundbergii. However, its stochastic distribution among strains of L. wingfieldii, L. terebrantis, and L. truncatum suggests that it has been horizontally transmitted by lateral gene transfer among these species, although the random presence of the intron may reflect multiple random loss events. A model is proposed describing the initial invasion of the group II intron in the rns gene of L. lundbergii by a LAGLIDADG homing endonuclease gene and subsequent evolution of this gene to recognize a novel DNA target site, which may now promote the mobility of the intron and homing endonuclease gene as a composite element. PMID:21479820

  15. Thermal activation of a group II intron ribozyme reveals multiple conformational states.


    Franzen, J S; Zhang, M; Chay, T R; Peebles, C L


    Conformational changes often accompany biological catalysis. Group II introns promote a variety of reactions in vitro that show an unusually sharp temperature dependence. This suggests that the chemical steps are accompanied by the conversion of a folded-but-inactive form to a differently folded active state. We report here the kinetic analysis of 5'-splice-junction hydrolysis (SJH) by E1:12345, a transcript containing the 5'-exon plus the first five of six intron secondary structure domains. The pseudo-first-order SJH reaction shows (1) activation by added KCl to 1.5 M; (2) cooperative activation by added MgCl2, nHill = 4.1-4.3, and [MgCl2]vmax/2 approximately 0.040 M; and (3) a rather high apparent activation energy, Ea approximately 50 kcal mol-l. In contrast, the 5'-terminal phosphodiester bond of a domain 5 transcript (GGD5) was hydrolyzed with Ea approximately 30 kcal mol-1 under SJH conditions; the 5'-GG leader dinucleotide presumably lacks secondary structure constraints. The effect of adding the chaotropic salt tetraethylammonium chloride (TEA) was also investigated. TEA reduced the melting temperatures of GGD5 and E1:12345. TEA also shifted the profile of rate versus temperature for SJH by E1:12345 toward lower temperatures without affecting the maximum rate. TEA had little effect on the rate of hydrolysis of the 5'-phosphodiester bond of GGD5. The high apparent activation enthalpy and entropy for SJH along with the effect of TEA on these parameters imply that conversion of an inactive form of E1:12345 to an active conformation accompanies enhanced occupation of the transition state as the temperature is raised to that for maximum SJH. Analytical modeling indicates that either a two-state model (open and disordered, with open being active) or a three-state model (compact, open, and disordered) could account for the temperature dependence of kSJH. However, the three-state model is clearly preferable, since it does not require that the activation parameters

  16. The En/Spm transposable element of Zea mays contains splice sites at the termini generating a novel intron from a dSpm element in the A2 gene.

    PubMed Central

    Menssen, A; Höhmann, S; Martin, W; Schnable, P S; Peterson, P A; Saedler, H; Gierl, A


    The A2 locus of Zea mays, identified as one of the genes affecting anthocyanin biosynthesis, was cloned using the transposable elements rcy and dSpm as gene tags. The A2 gene encodes a putative protein of 395 amino acids and is devoid of introns. Two a2-m1 alleles, containing dSpm insertions of different sizes, were characterized. The dSpm element from the original state allele has perfect termini and undergoes frequent transposition. The element from the class II state allele is no longer competent to transpose. It has retained the 13 bp terminal inverted repeat but has lost all subterminal sites at the 5' end, which are recognized by tnpA protein, the most abundant product of the En/Spm transposable element system. The relatively high A2 gene expression of one a2-m1 allele is due to removal of almost all dSpm sequences by splicing. The slightly altered A2 enzyme is still functional as shown by complementation of an a2 mutant with the corresponding cDNA. The 5' and 3' splice sites are constituted by the termini of the dSpm element; it therefore represents a novel intron of the A2 gene. Images Fig. 3. Fig. 4. Fig. 6. Fig. 8. PMID:2170105

  17. RNA-seq of human reference RNA samples using a thermostable group II intron reverse transcriptase.


    Nottingham, Ryan M; Wu, Douglas C; Qin, Yidan; Yao, Jun; Hunicke-Smith, Scott; Lambowitz, Alan M


    Next-generation RNA sequencing (RNA-seq) has revolutionized our ability to analyze transcriptomes. Current RNA-seq methods are highly reproducible, but each has biases resulting from different modes of RNA sample preparation, reverse transcription, and adapter addition, leading to variability between methods. Moreover, the transcriptome cannot be profiled comprehensively because highly structured RNAs, such as tRNAs and snoRNAs, are refractory to conventional RNA-seq methods. Recently, we developed a new method for strand-specific RNA-seq using thermostable group II intron reverse transcriptases (TGIRTs). TGIRT enzymes have higher processivity and fidelity than conventional retroviral reverse transcriptases plus a novel template-switching activity that enables RNA-seq adapter addition during cDNA synthesis without using RNA ligase. Here, we obtained TGIRT-seq data sets for well-characterized human RNA reference samples and compared them to previous data sets obtained for these RNAs by the Illumina TruSeq v2 and v3 methods. We find that TGIRT-seq recapitulates the relative abundance of human transcripts and RNA spike-ins in ribo-depleted, fragmented RNA samples comparably to non-strand-specific TruSeq v2 and better than strand-specific TruSeq v3. Moreover, TGIRT-seq is more strand specific than TruSeq v3 and eliminates sampling biases from random hexamer priming, which are inherent to TruSeq. The TGIRT-seq data sets also show more uniform 5' to 3' gene coverage and identify more splice junctions, particularly near the 5' ends of mRNAs, than do the TruSeq data sets. Finally, TGIRT-seq enables the simultaneous profiling of mRNAs and lncRNAs in the same RNA-seq experiment as structured small ncRNAs, including tRNAs, which are essentially absent with TruSeq. PMID:26826130

  18. Polymorphisms in an intronic region of the myocilin gene associated with primary open-angle glaucoma—a possible role for alternate splicing

    PubMed Central

    Pandaranayaka, P.J. Eswari; Prasanthi, N.; Kannabiran, N.; Rangachari, K.; Dhivya, M.; Krishnadas, Subbiah R.; Sundaresan, P.


    Purpose To examine the possible role of alternate splicing leading to aggregation of myocilin in primary open-angle glaucoma. Methods Several single nucleotide variations found in the myocilin (MYOC) genomic region were collected and examined for their possible role in causing splice-site alterations. A model for myocilin built using a knowledge-based consensus method was used to map the altered protein products. A total of 150 open-angle glaucoma patients and 50 normal age-matched control subjects were screened for the predicted polymorphisms, and clustering was performed. Results A total of 124 genomic variations were screened, and six polymorphisms that lead to altered protein products were detected as possible candidates for the alternative splicing mechanism. Five of these lay in the intronic regions, and the one that lay in the exon region corresponded to the previously identified polymorphism (Tyr347Tyr) implicated in primary open-angle glaucoma. Experimentally screening the intronic region of the MYOC gene showed the presence of the predicted g.14072G>A polymorphism, g.1293C/T heterozygous polymorphism, instead of our predicted g.1293C/- polymorphism. Other than the prediction, two novel SNPs (g.1295G>T and g.1299T>G) and two reported SNPs (g.1284G>T and g.1286G>T) were also identified. Cluster analysis showed the g.14072G>A homozygous condition was more common in this cohort than the heterozygous condition. Conclusions We previously proposed that the disruption of dimer or oligomer formation by the C-term region allows greater chances of nucleation for aggregation. Here we suggest that polymorphisms in the myocilin genomic region that cause synonymous codon changes or those that occur in the intron regions can possibly lead to altered myocilin protein products through altered intron–exon splicing. PMID:21203411

  19. Structural basis for recognition of intron branchpoint RNA by yeast Msl5 and selective effects of interfacial mutations on splicing of yeast pre-mRNAs

    PubMed Central

    Jacewicz, Agata; Chico, Lidia; Smith, Paul


    Saccharomyces cerevisiae Msl5 orchestrates spliceosome assembly by binding the intron branchpoint sequence 5′-UACUAAC and, with its heterodimer partner protein Mud2, establishing cross intron-bridging interactions with the U1 snRNP at the 5′ splice site. Here we define the central Msl5 KH-QUA2 domain as sufficient for branchpoint RNA recognition. The 1.8 Å crystal structure of Msl5-(KH-QUA2) bound to the branchpoint highlights an extensive network of direct and water-mediated protein–RNA and intra-RNA atomic contacts at the interface that illuminate how Msl5 recognizes each nucleobase of the UACUAAC element. The Msl5 structure rationalizes a large body of mutational data and inspires new functional studies herein, which reveal how perturbations of the Msl5·RNA interface impede the splicing of specific yeast pre-mRNAs. We also identify interfacial mutations in Msl5 that bypass the essentiality of Sub2, a DExD-box ATPase implicated in displacing Msl5 from the branchpoint in exchange for the U2 snRNP. These studies establish an atomic resolution framework for understanding splice site selection and early spliceosome dynamics. PMID:25587180

  20. Clinical expression and new SPINK5 splicing defects in Netherton syndrome: unmasking a frequent founder synonymous mutation and unconventional intronic mutations.


    Lacroix, Matthieu; Lacaze-Buzy, Laetitia; Furio, Laetitia; Tron, Elodie; Valari, Manthoula; Van der Wier, Gerda; Bodemer, Christine; Bygum, Anette; Bursztejn, Anne-Claire; Gaitanis, George; Paradisi, Mauro; Stratigos, Alexander; Weibel, Lisa; Deraison, Céline; Hovnanian, Alain


    Netherton syndrome (NS) is a severe skin disease caused by loss-of-function mutations in SPINK5 (serine protease inhibitor Kazal-type 5) encoding the serine protease inhibitor LEKTI (lympho-epithelial Kazal type-related inhibitor). Here, we disclose new SPINK5 defects in 12 patients, who presented a clinical triad suggestive of NS with variations in inter- and intra-familial disease expression. We identified a new and frequent synonymous mutation c.891C>T (p.Cys297Cys) in exon 11 of the 12 NS patients. This mutation disrupts an exonic splicing enhancer sequence and causes out-of-frame skipping of exon 11. Haplotype analysis indicates that this mutation is a founder mutation in Greece. Two other new deep intronic mutations, c.283-12T>A in intron 4 and c.1820+53G>A in intron 19, induced partial intronic sequence retention. A new nonsense c.2557C>T (p.Arg853X) mutation was also identified. All mutations led to a premature termination codon resulting in no detectable LEKTI on skin sections. Two patients with deep intronic mutations showed residual LEKTI fragments in cultured keratinocytes. These fragments retained some functional activity, and could therefore, together with other determinants, contribute to modulate the disease phenotype. This new founder mutation, the most frequent mutation described in European populations so far, and these unusual intronic mutations, widen the clinical and molecular spectrum of NS and offer new diagnostic perspectives for NS patients. PMID:22089833

  1. Crystal structure of group II intron domain 1 reveals a template for RNA assembly.


    Zhao, Chen; Rajashankar, Kanagalaghatta R; Marcia, Marco; Pyle, Anna Marie


    Although the importance of large noncoding RNAs is increasingly appreciated, our understanding of their structures and architectural dynamics remains limited. In particular, we know little about RNA folding intermediates and how they facilitate the productive assembly of RNA tertiary structures. Here, we report the crystal structure of an obligate intermediate that is required during the earliest stages of group II intron folding. Composed of domain 1 from the Oceanobacillus iheyensis group II intron (266 nucleotides), this intermediate retains native-like features but adopts a compact conformation in which the active site cleft is closed. Transition between this closed and the open (native) conformation is achieved through discrete rotations of hinge motifs in two regions of the molecule. The open state is then stabilized by sequential docking of downstream intron domains, suggesting a 'first come, first folded' strategy that may represent a generalizable pathway for assembly of large RNA and ribonucleoprotein structures. PMID:26502156

  2. Genome Editing via Mobile Group-II Introns and Cre/lox

    NASA Astrophysics Data System (ADS)

    Enyeart, P. E.; Perutka, J.; Dao, M.; Ellington, A. E.


    Mobile group-II introns and the Cre/lox systems are combined to allow large segments of DNA to be removed or transferred within/between bacterial genomes. Planned applications include metabolic optimization and development of novel dissimilatory metal-reducing bacteria.

  3. Trans-splicing Group I Intron Targeting Hepatitis C Virus IRES Mediates Cell Death upon Viral Infection in Huh7.5 Cells

    PubMed Central

    Nawtaisong, Pruksa; Fraser, Mark E.; Carter, James R.; Fraser, Malcolm J.


    The HCV-IRES sequence is vital for both protein translation and genome replication and serves as a potential target for anti-HCV therapy. We constructed a series of anti-HCV Group I introns (αHCV-GrpIs) to attack conserved target sites within the HCV IRES. These αHCV-GrpIs were designed to mediate a trans-splicing reaction that replaces the viral RNA genome downstream of the 5’ splice site with a 3’ exon that encodes an apoptosis-inducing gene. Pro-active forms of the apoptosis inducing genes BID, Caspase 3, Caspase 8, or tBax were modified by incorporation of the HCV NS5A/5B cleavage sequence in place of their respective endogenous cleavage sites to ensure that only HCV infected cells would undergo apoptosis following splicing and expression. Huh7.5 cells transfected with each intron were challenged at MOI 0.1 with HCV-Jc1FLAG2 which expresses a Gaussia Luciferase (GLuc) marker. Virus-containing supernatants were then assayed for GLuc expression as a measure of viral replication inhibition. Cellular extracts were analyzed for the presence of correct splice products by RT-PCR and DNA sequencing. We also measured levels of Caspase 3 activity as a means of quantifying apoptotic cell death. Each of these αHCV-GrpI introns was able to correctly splice their 3’ apoptotic exons onto the virus RNA genome at the targeted Uracil, and resulted in greater than 80% suppression of the GLuc marker. A more pronounced suppression effect was observed with TCID50 virus titrations, which demonstrated that these αHCV-GrpIs were able to suppress viral replication by more than 2 logs, or greater than 99%. Robust activation of the apoptotic factor within the challenged cells was evidenced by a significant increase of Caspase 3 activity upon viral infection compared to non-challenged cells. This novel genetic intervention tool may prove beneficial in certain HCV subjects. PMID:25840398

  4. Deep intron elements mediate nested splicing events at consecutive AG dinucleotides to regulate alternative 3' splice site choice in vertebrate 4.1 genes.


    Parra, Marilyn K; Gallagher, Thomas L; Amacher, Sharon L; Mohandas, Narla; Conboy, John G


    Distal intraexon (iE) regulatory elements in 4.1R pre-mRNA govern 3' splice site choice at exon 2 (E2) via nested splicing events, ultimately modulating expression of N-terminal isoforms of cytoskeletal 4.1R protein. Here we explored intrasplicing in other normal and disease gene contexts and found conservation of intrasplicing through vertebrate evolution. In the paralogous 4.1B gene, we identified ∼120 kb upstream of E2 an ultradistal intraexon, iE(B), that mediates intrasplicing by promoting two intricately coupled splicing events that ensure selection of a weak distal acceptor at E2 (E2dis) by prior excision of the competing proximal acceptor (E2prox). Mutating iE(B) in minigene splicing reporters abrogated intrasplicing, as did blocking endogenous iE(B) function with antisense morpholinos in live mouse and zebrafish animal models. In a human elliptocytosis patient with a mutant 4.1R gene lacking E2 through E4, we showed that aberrant splicing is consistent with iE(R)-mediated intrasplicing at the first available exons downstream of iE(R), namely, alternative E5 and constitutive E6. Finally, analysis of heterologous acceptor contexts revealed a strong preference for nested 3' splice events at consecutive pairs of AG dinucleotides. Distal regulatory elements may control intrasplicing at a subset of alternative 3' splice sites in vertebrate pre-mRNAs to generate proteins with functional diversity. PMID:22473990

  5. Mosses share mitochondrial group II introns with flowering plants, not with liverworts.


    Pruchner, D; Nassal, B; Schindler, M; Knoop, V


    Extant bryophytes are regarded as the closest living relatives of the first land plants, but relationships among the bryophyte classes (mosses, liverworts and hornworts) and between them and other embryophytes have remained unclear. We have recently found that plant mitochondrial genes with positionally stable introns are well suited for addressing questions of plant phylogeny at a deep level. To explore further data sets we have chosen to investigate the mitochondrial genes nad4 and nad7, which are particularly rich in intron sequences. Surprisingly, we find that in these genes mosses share three group II introns with flowering plants, but none with the liverwort Marchantia polymorpha or other liverworts investigated here. In mitochondria of Marchantia, nad7 is a pseudogene containing stop codons, but nad7 appears as a functional mitochondrial gene in mosses, including the isolated genus Takakia. We observe the necessity for strikingly frequent C-to-U RNA editing to reconstitute conserved codons in Takakia when compared to other mosses. The findings underline the great evolutionary distances among the bryophytes as the presumptive oldest division of land plants. A scenario involving differential intron gains from fungal sources in what are perhaps the two earliest diverging land plant lineages, liverworts and other embryophytes, is discussed. With their positionally stable introns, nad4 and nad7 represent novel marker genes that may permit a detailed phylogenetic resolution of early clades of land plants. PMID:11810232

  6. The SR splicing factors ASF/SF2 and SC35 have antagonistic effects on intronic enhancer-dependent splicing of the beta-tropomyosin alternative exon 6A.

    PubMed Central

    Gallego, M E; Gattoni, R; Stévenin, J; Marie, J; Expert-Bezançon, A


    Exons 6A and 6B of the chicken beta-tropomyosin gene are mutually exclusive and selected in a tissue-specific manner. Exon 6A is present in non-muscle and smooth muscle cells, while exon 6B is present in skeletal muscle cells. In this study we have investigated the mechanism underlying exon 6A recognition in non-muscle cells. Previous reports have identified a pyrimidine-rich intronic enhancer sequence (S4) downstream of exon 6A as essential for exon 6A 5'-splice site recognition. We show here that preincubation of HeLa cell extracts with an excess of RNA containing this sequence specifically inhibits exon 6A recognition by the splicing machinery. Splicing inhibition by an excess of this RNA can be rescued by addition of the SR protein ASF/SF2, but not by the SR proteins SC35 or 9G8. ASF/SF2 stimulates exon 6A splicing through specific interaction with the enhancer sequence. Surprisingly, SC35 behaves as an inhibitor of exon 6A splicing, since addition to HeLa nuclear extracts of increasing amounts of the SC35 protein completely abolish the stimulatory effect of ASF/SF2 on exon 6A splicing. We conclude that exon 6A recognition in vitro depends on the ratio of the ASF/SF2 to SC35 SR proteins. Taken together our results suggest that variations in the level or activity of these proteins could contribute to the tissue-specific choice of beta-tropomyosin exon 6A. In support of this we show that SR proteins isolated from skeletal muscle tissues are less efficient for exon 6A stimulation than SR proteins isolated from HeLa cells. PMID:9130721

  7. The mitochondrial genome of the arbuscular mycorrhizal fungus Gigaspora margarita reveals two unsuspected trans-splicing events of group I introns.


    Pelin, Adrian; Pombert, Jean-François; Salvioli, Alessandra; Bonen, Linda; Bonfante, Paola; Corradi, Nicolas


    • Arbuscular mycorrhizal fungi (AMF) are ubiquitous organisms that benefit ecosystems through the establishment of an association with the roots of most plants: the mycorrhizal symbiosis. Despite their ecological importance, however, these fungi have been poorly studied at the genome level. • In this study, total DNA from the AMF Gigaspora margarita was subjected to a combination of 454 and Illumina sequencing, and the resulting reads were used to assemble its mitochondrial genome de novo. This genome was annotated and compared with those of other relatives to better comprehend the evolution of the AMF lineage. • The mitochondrial genome of G. margarita is unique in many ways, exhibiting a large size (97 kbp) and elevated GC content (45%). This genome also harbors molecular events that were previously unknown to occur in fungal mitochondrial genomes, including trans-splicing of group I introns from two different genes coding for the first subunit of the cytochrome oxidase and for the small subunit of the rRNA. • This study reports the second published genome from an AMF organelle, resulting in relevant DNA sequence information from this poorly studied fungal group, and providing new insights into the frequency, origin and evolution of trans-spliced group I introns found across the mitochondrial genomes of distantly related organisms. PMID:22320438

  8. Absence of an Intron Splicing Silencer in Porcine Smn1 Intron 7 Confers Immunity to the Exon Skipping Mutation in Human SMN2

    PubMed Central

    Doktor, Thomas Koed; Schrøder, Lisbeth Dahl; Andersen, Henriette Skovgaard; Brøner, Sabrina; Kitewska, Anna; Sørensen, Charlotte Brandt; Andresen, Brage Storstein


    Spinal Muscular Atrophy is caused by homozygous loss of SMN1. All patients retain at least one copy of SMN2 which produces an identical protein but at lower levels due to a silent mutation in exon 7 which results in predominant exclusion of the exon. Therapies targeting the splicing of SMN2 exon 7 have been in development for several years, and their efficacy has been measured using either in vitro cellular assays or in vivo small animal models such as mice. In this study we evaluated the potential for constructing a mini-pig animal model by introducing minimal changes in the endogenous porcine Smn1 gene to maintain the native genomic structure and regulation. We found that while a Smn2-like mutation can be introduced in the porcine Smn1 gene and can diminish the function of the ESE, it would not recapitulate the splicing pattern seen in human SMN2 due to absence of a functional ISS immediately downstream of exon 7. We investigated the ISS region and show here that the porcine ISS is inactive due to disruption of a proximal hnRNP A1 binding site, while a distal hnRNP A1 binding site remains functional but is unable to maintain the functionality of the ISS as a whole. PMID:24892836

  9. Lack of excision of introns from primary transcripts of certain chicken vitellogenin II minigenes.


    Millan, C L; Gibbins, A M


    Two truncated versions of the chicken vitellogenin II gene VTGII were designed and constructed to include all known essential regulatory elements of the complete gene. Both pCB123 and pCB123/4 contain 945 base pairs (bp) of the 5'-flanking sequence, introns and exons 1-3, and a subset of the remaining 32 exons of VTGII, inserted into a pBluescript SK (+/-) vector. pCB123/4 contains 752 bp of legitimate VTGII 3'-flanking sequences, while the 3' end of pCB123 terminates at the VTGII cDNA end, followed by AT-tailing and vector sequences carried over during cloning. Expression of these plasmids was tested following their lipofection into primary cultures of chicken hepatocytes established from day 14 embryos. Poly(A)+ RNA derived from pCB123 was detected by Northern blotting and reverse transcription-polyacrylamide chain reaction. No evidence was observed for appropriate hormonal control of expression, despite the presence of 17 beta-estradiol or colipofection with the estrogen receptor clone pHEO. VTGII sequences at the 3' end of pCB123/4 led to an apparent destabilization of the RNA transcript. Unexpectedly, unprocessed pCB123 transcripts of varying lengths accumulated in the cells. These experiments constitute the first reported attempts to express authentic VTGII coding sequences in cultured cells and highlight the dilemma of which introns to include in a minigene. Despite reports that some minigenes are expressed more efficiently if one or two introns are included, other minigenes may be expressed more effectively in the absence of introns. In the case of a complex gene with many introns, such as VTGII, there may be a preferential order in which introns are removed from the primary construct. The truncation of complex genes to give functional minigenes for transgenic studies may require considerable experimentation. PMID:7529508

  10. Factor IXMadrid 2: a deletion/insertion in factor IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site.

    PubMed Central

    Solera, J; Magallón, M; Martin-Villar, J; Coloma, A


    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5' end of intron d and the two last coding nucleotides located at the 3' end of exon IV in the normal factor IX gene; this fragment has been replaced by a 47-bp sequence from the normal factor IX gene, although this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment. Images Figure 1 PMID:1346483

  11. Cation-induced kinetic heterogeneity of the intron–exon recognition in single group II introns

    PubMed Central

    Kowerko, Danny; König, Sebastian L. B.; Skilandat, Miriam; Kruschel, Daniela; Hadzic, Mélodie C. A. S.; Cardo, Lucia; Sigel, Roland K. O.


    RNA is commonly believed to undergo a number of sequential folding steps before reaching its functional fold, i.e., the global minimum in the free energy landscape. However, there is accumulating evidence that several functional conformations are often in coexistence, corresponding to multiple (local) minima in the folding landscape. Here we use the 5′-exon–intron recognition duplex of a self-splicing ribozyme as a model system to study the influence of Mg2+ and Ca2+ on RNA tertiary structure formation. Bulk and single-molecule spectroscopy reveal that near-physiological M2+ concentrations strongly promote interstrand association. Moreover, the presence of M2+ leads to pronounced kinetic heterogeneity, suggesting the coexistence of multiple docked and undocked RNA conformations. Heterogeneity is found to decrease at saturating M2+ concentrations. Using NMR, we locate specific Mg2+ binding pockets and quantify their affinity toward Mg2+. Mg2+ pulse experiments show that M2+ exchange occurs on the timescale of seconds. This unprecedented combination of NMR and single-molecule Förster resonance energy transfer demonstrates for the first time to our knowledge that a rugged free energy landscape coincides with incomplete occupation of specific M2+ binding sites at near-physiological M2+ concentrations. Unconventional kinetics in nucleic acid folding frequently encountered in single-molecule experiments are therefore likely to originate from a spectrum of conformations that differ in the occupation of M2+ binding sites. PMID:25737541

  12. The 5'UTR Intron of Arabidopsis GGT1 Aminotransferase Enhances Promoter Activity by Recruiting RNA Polymerase II.


    Laxa, Miriam; Müller, Kristin; Lange, Natalie; Doering, Lennart; Pruscha, Jan Thomas; Peterhänsel, Christoph


    Photorespiration is essential for the detoxification of glycolate and recycling of carbon to the Calvin Benson Bassham cycle. Enzymes participating in the pathway have been identified, and investigations now focus on the regulation of photorespiration by transporters and metabolites. However, regulation of photorespiration on the gene level has not been intensively studied. Here, we show that maximum transcript abundance of Glu:glyoxylate aminotransferase 1 (GGT1) is regulated by intron-mediated enhancement (IME) of the 5' leader intron rather than by regulatory elements in the 5' upstream region. The intron is rich in CT-stretches and contains the motif TGTGATTTG that is highly similar to the IME-related motif TTNGATYTG. The GGT1 intron also confers leaf-specific expression of foreign promoters. Quantitative PCR analysis and GUS activity measurements revealed that IME of the GGT1 5'UTR intron is controlled on the transcriptional level. IME by the GGT1 5'UTR intron was at least 2-fold. Chromatin immunoprecipitation experiments showed that the abundance of RNA polymerase II binding to the intron-less construct is reduced. PMID:27418588

  13. Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

    PubMed Central

    Hiesel, Rudolf; Brennicke, Axel


    The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

  14. Mechanistic investigations of a ribozyme derived from the Tetrahymena group I intron: insights into catalysis and the second step of self-splicing.


    Mei, R; Herschlag, D


    Self-splicing of Tetrahymena pre-rRNA proceeds in two consecutive phosphoryl transesterification steps. One major difference between these steps is that in the first an exogenous guanosine (G) binds to the active site, while in the second the 3'-terminal G414 residue of the intron binds. The first step has been extensively characterized in studies of the L-21ScaI ribozyme, which uses exogenous G as a nucleophile. In this study, mechanistic features involved in the second step are investigated by using the L-21G414 ribozyme. The L-21G414 reaction has been studied in both directions, with G414 acting as a leaving group in the second step and a nucleophile in its reverse. The rate constant of chemical step is the same with exogenous G bound to the L-21ScaI ribozyme and with the intramolecular guanosine residue of the L-21G414 ribozyme. The result supports the previously proposed single G-binding site model and further suggests that the orientation of the bound G and the overall active site structure is the same in both steps of the splicing reaction. An evolutionary rationale for the use of exogenous G in the first step is also presented. The results suggest that the L-21G414 ribozyme exists predominantly with the 3'-terminal G414 docked into the G-binding site. This docking is destabilized by approximately 100-fold when G414 is attached to an electron-withdrawing pA group. The internal equilibrium with K(int) = 0.7 for the ribozyme reaction indicates that bound substrate and product are thermodynamically matched and is consistent with a degree of symmetry within the active site. These observations are consistent with the presence of a second Mg ion in the active site. Finally, the slow dissociation of a 5' exon analog relative to a ligated exon analog from the L-21G414 ribozyme suggests a kinetic mechanism for ensuring efficient ligation of exons and raises new questions about the overall self-splicing reaction. PMID:8639540

  15. Generalized bacterial genome editing using mobile group II introns and Cre-lox

    PubMed Central

    Enyeart, Peter J; Chirieleison, Steven M; Dao, Mai N; Perutka, Jiri; Quandt, Erik M; Yao, Jun; Whitt, Jacob T; Keatinge-Clay, Adrian T; Lambowitz, Alan M; Ellington, Andrew D


    Efficient bacterial genetic engineering approaches with broad-host applicability are rare. We combine two systems, mobile group II introns (‘targetrons') and Cre/lox, which function efficiently in many different organisms, into a versatile platform we call GETR (Genome Editing via Targetrons and Recombinases). The introns deliver lox sites to specific genomic loci, enabling genomic manipulations. Efficiency is enhanced by adding flexibility to the RNA hairpins formed by the lox sites. We use the system for insertions, deletions, inversions, and one-step cut-and-paste operations. We demonstrate insertion of a 12-kb polyketide synthase operon into the lacZ gene of Escherichia coli, multiple simultaneous and sequential deletions of up to 120 kb in E. coli and Staphylococcus aureus, inversions of up to 1.2 Mb in E. coli and Bacillus subtilis, and one-step cut-and-pastes for translocating 120 kb of genomic sequence to a site 1.5 Mb away. We also demonstrate the simultaneous delivery of lox sites into multiple loci in the Shewanella oneidensis genome. No selectable markers need to be placed in the genome, and the efficiency of Cre-mediated manipulations typically approaches 100%. PMID:24002656

  16. ida4-1, ida4-2, and ida4-3 are intron splicing mutations affecting the locus encoding p28, a light chain of Chlamydomonas axonemal inner dynein arms.

    PubMed Central

    LeDizet, M; Piperno, G


    We recently determined the nucleotide sequence of the gene encoding p28, a light chain of inner dynein arms of Chlamydomonas axonemes. Here, we show that p28 is the protein encoded by the IDA4 locus. p28, and the dynein heavy chains normally associated with it, are completely absent from the flagella and cell bodies of three allelic strains of ida4, named ida4-1, ida4-2, and ida4-3. We determined the nucleotide sequence of the three alleles of the p28 gene and found in each case a single nucleotide change, affecting the splice sites of the first, second, and fourth introns, respectively. Reverse transcriptase-polymerase chain reaction amplification of RNAs prepared from ida4 cells confirmed that these mutations prevent the correct splicing of the affected introns, thereby blocking the synthesis of full-length p28. These are the first intron splicing mutations described in Chlamydomonas and the first inner dynein arm mutations characterized at the molecular level. The absence in ida4 axonemes of the dynein heavy chains normally found in association with p28 suggests that p28 is necessary for stable assembly of a subset of inner dynein arms or for the binding of these arms to the microtubule doublets. Images PMID:7579690

  17. Solving nucleic acid structures by molecular replacement: examples from group II intron studies

    SciTech Connect

    Marcia, Marco Humphris-Narayanan, Elisabeth; Keating, Kevin S.; Somarowthu, Srinivas; Rajashankar, Kanagalaghatta; Pyle, Anna Marie


    Strategies for phasing nucleic acid structures by molecular replacement, using both experimental and de novo designed models, are discussed. Structured RNA molecules are key players in ensuring cellular viability. It is now emerging that, like proteins, the functions of many nucleic acids are dictated by their tertiary folds. At the same time, the number of known crystal structures of nucleic acids is also increasing rapidly. In this context, molecular replacement will become an increasingly useful technique for phasing nucleic acid crystallographic data in the near future. Here, strategies to select, create and refine molecular-replacement search models for nucleic acids are discussed. Using examples taken primarily from research on group II introns, it is shown that nucleic acids are amenable to different and potentially more flexible and sophisticated molecular-replacement searches than proteins. These observations specifically aim to encourage future crystallographic studies on the newly discovered repertoire of noncoding transcripts.

  18. A novel point mutation (G-1 to T) in a 5' splice donor site of intron 13 of the dystrophin gene results in exon skipping and is responsible for Becker muscular dystrophy.

    PubMed Central

    Hagiwara, Y.; Nishio, H.; Kitoh, Y.; Takeshima, Y.; Narita, N.; Wada, H.; Yokoyama, M.; Nakamura, H.; Matsuo, M.


    The mutations in one-third of Duchenne and Becker muscular dystrophy patients remain unknown, as they do not involve gross rearrangements of the dystrophin gene. We now report a defect in the splicing of precursor mRNA (pre-mRNA), resulting from a maternally inherited mutation of the dystrophin gene in a patient with Becker muscular dystrophy. This defect results from a G-to-T transversion at the terminal nucleotide of exon 13, within the 5' splice site of intron 13, and causes complete skipping of exon 13 during processing of dystrophin pre-mRNA. The predicted polypeptide encoded by the aberrant mRNA is a truncated dystrophin lacking 40 amino acids from the amino-proximal end of the rod domain. This is the first report of an intraexon point mutation that completely inactivates a 5' splice donor site in dystrophin pre-mRNA. Analysis of the genomic context of the G-1-to-T mutation at the 5' splice site supports the exon-definition model of pre-mRNA splicing and contributes to the understanding of splice-site selection. Images Figure 2 Figure 5 PMID:8279470

  19. A novel point mutation (G-1 to T) in a 5' splice donor site of intron 13 of the dystrophin gene results in exon skipping and is responsible for Becker muscular dystrophy.


    Hagiwara, Y; Nishio, H; Kitoh, Y; Takeshima, Y; Narita, N; Wada, H; Yokoyama, M; Nakamura, H; Matsuo, M


    The mutations in one-third of Duchenne and Becker muscular dystrophy patients remain unknown, as they do not involve gross rearrangements of the dystrophin gene. We now report a defect in the splicing of precursor mRNA (pre-mRNA), resulting from a maternally inherited mutation of the dystrophin gene in a patient with Becker muscular dystrophy. This defect results from a G-to-T transversion at the terminal nucleotide of exon 13, within the 5' splice site of intron 13, and causes complete skipping of exon 13 during processing of dystrophin pre-mRNA. The predicted polypeptide encoded by the aberrant mRNA is a truncated dystrophin lacking 40 amino acids from the amino-proximal end of the rod domain. This is the first report of an intraexon point mutation that completely inactivates a 5' splice donor site in dystrophin pre-mRNA. Analysis of the genomic context of the G-1-to-T mutation at the 5' splice site supports the exon-definition model of pre-mRNA splicing and contributes to the understanding of splice-site selection. PMID:8279470

  20. A novel point mutation (G[sup [minus]1] to T) in a 5[prime] splice donor site of intron 13 of the dystrophin gene results in exon skipping and is responsible for Becker Muscular Dystrophy

    SciTech Connect

    Hagiwara, Yoko; Nishio, Hisahide; Kitoh, Yoshihiko; Takeshima, Yasuhiro; Narita, Naoko; Wada, Hiroko; Yokoyama, Mitsuhiro; Nakamura, Hajime; Matsuo, Masafumi )


    The mutations in one-third of Duchenne and Becker muscular dystrophy patients remain unknown, as they do not involve gross rearrangements of the dystrophin gene. The authors now report a defect in the splicing of precursor mRNA (pre-mRNA), resulting from a maternally inherited mutation of the dystrophin gene in a patient with Becker muscular dystrophy. This defect results from a G-to-T transversion at the terminal nucleotide of exon 13, within the 5[prime] splice site of intron 13, and causes complete skipping of exon 13 during processing of dystrophin pre-mRNA. The predicted polypeptide encoded by the aberrant mRNA is a truncated dystrophin lacking 40 amino acids from the amino-proximal end of the rod domain. This is the first report of an intraexon point mutation that completely inactivates a 5[prime] splice donor site in dystrophin pre-mRNA. Analysis of the genomic context of the G[sup [minus]1]-to-T mutation at the 5[prime] splice site supports the exon-definition model of pre-mRNA splicing and contributes to the understanding of splice-site selection. 48 refs., 5 figs.

  1. Use of the computer-retargeted group II intron RmInt1 of Sinorhizobium meliloti for gene targeting

    PubMed Central

    M García-Rodríguez, Fernando; Hernández-Gutiérrez, Teresa; Díaz-Prado, Vanessa; Toro, Nicolás


    Gene-targeting vectors derived from mobile group II introns capable of forming a ribonucleoprotein (RNP) complex containing excised intron lariat RNA and an intron-encoded protein (IEP) with reverse transcriptase (RT), maturase, and endonuclease (En) activities have been described. RmInt1 is an efficient mobile group II intron with an IEP lacking the En domain. We performed a comprehensive study of the rules governing RmInt1 target site recognition based on selection experiments with donor and recipient plasmid libraries, with randomization of the elements of the intron RNA involved in target recognition and the wild-type target site. The data obtained were used to develop a computer algorithm for identifying potential RmInt1 targets in any DNA sequence. Using this algorithm, we modified RmInt1 for the efficient recognition of DNA target sites at different locations in the Sinorhizobium meliloti chromosome. The retargeted RmInt1 integrated efficiently into the chromosome, regardless of the location of the target gene. Our results suggest that RmInt1 could be efficiently adapted for gene targeting. PMID:24646865

  2. Introns in gene evolution.


    Fedorova, Larisa; Fedorov, Alexei


    Introns are integral elements of eukaryotic genomes that perform various important functions and actively participate in gene evolution. We review six distinct roles of spliceosomal introns: (1) sources of non-coding RNA; (2) carriers of transcription regulatory elements; (3) actors in alternative and trans-splicing; (4) enhancers of meiotic crossing over within coding sequences; (5) substrates for exon shuffling; and (6) signals for mRNA export from the nucleus and nonsense-mediated decay. We consider transposable capacities of introns and the current state of the long-lasting debate on the 'early-or-late' origin of introns. Cumulative data on known types of contemporary exon shuffling and the estimation of the size of the underlying exon universe are also discussed. We argue that the processes central to introns-early (exon shuffling) and introns-late (intron insertion) theories are entirely compatible. Each has provided insight: the latter through elucidating the transposon capabilities of introns, and the former through understanding the importance of introns in genomic recombination leading to gene rearrangements and evolution. PMID:12868603

  3. Coupling of RNA Polymerase II Transcription Elongation with Pre-mRNA Splicing.


    Saldi, Tassa; Cortazar, Michael A; Sheridan, Ryan M; Bentley, David L


    Pre-mRNA maturation frequently occurs at the same time and place as transcription by RNA polymerase II. The co-transcriptionality of mRNA processing has permitted the evolution of mechanisms that functionally couple transcription elongation with diverse events that occur on the nascent RNA. This review summarizes the current understanding of the relationship between transcriptional elongation through a chromatin template and co-transcriptional splicing including alternative splicing decisions that affect the expression of most human genes. PMID:27107644

  4. Alternative splicing of human T-cell-specific MAL mRNA and its correlation with the exon/intron organization of the gene

    SciTech Connect

    Rancano, C.; Rubio, T.; Alonso, M.A. )


    Sequence analysis of the T-cell-specific MAL gene revealed four exons, each encoding a hydrophobic, presumably membrane-associated, segment and its adjacent hydrophilic sequence. Amplification by the polymerase chain reaction of cDNA from different T-cell samples indicated the existence of four different forms of MAL mRNA, termed MAL-a, -b, -c, and -d, that arise from differential usage of exons II and/or III. As the three introns were located between complete codons, the reading frame was maintained in all the transcripts. A model resembling the structures postulated for different proteolipid proteins is proposed for the protein encoded by each alternative mRNA species. 9 refs., 3 figs.

  5. Regular spliceosomal introns are invasive in Chlamydomonas reinhardtii: 15 introns in the recently relocated mitochondrial cox2 and cox3 genes.


    Watanabe, K I; Ohama, T


    In the unicellular green alga, Chlamydomonas reinhardtii, cytochrome oxidase subunit 2 (cox2) and 3 (cox3) genes are missing from the mitochondrial genome. We isolated and sequenced a BAC clone that carries the whole cox3 gene and its corresponding cDNA. Almost the entire cox2 gene and its cDNA were also determined. Comparison of the genomic and the corresponding cDNA sequences revealed that the cox3 gene contains as many as nine spliceosomal introns and that cox2 bears six introns. Putative mitochondria targeting signals were predicted at each N terminal of the cox genes. These spliceosomal introns were typical GT-AG-type introns, which are very common not only in Chlamydomonas nuclear genes but also in diverse eukaryotic taxa. We found no particular distinguishing features in the cox introns. Comparative analysis of these genes with the various mitochondrial genes showed that 8 of the 15 introns were interrupting the conserved mature protein coding segments, while the other 7 introns were located in the N-terminal target peptide regions. Phylogenetic analysis of the evolutionary position of C. reinhardtii in Chlorophyta was carried out and the existence of the cox2 and cox3 genes in the mitochondrial genome was superimposed in the tree. This analysis clearly shows that these cox genes were relocated during the evolution of Chlorophyceae. It is apparent that long before the estimated period of relocation of these mitochondrial genes, the cytosol had lost the splicing ability for group II introns. Therefore, at least eight introns located in the mature protein coding region cannot be the direct descendant of group II introns. Here, we conclude that the presence of these introns is due to the invasion of spliceosomal introns, which occurred during the evolution of Chlorophyceae. This finding provides concrete evidence supporting the "intron-late" model, which rests largely on the mobility of spliceosomal introns. PMID:11675593

  6. Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing

    PubMed Central

    Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R.; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M.


    Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility (“retrohoming”) by a process that requires reverse transcription of a highly structured, 2–2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3′ ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications. PMID:23697550

  7. Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing.


    Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M


    Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility ("retrohoming") by a process that requires reverse transcription of a highly structured, 2-2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3' ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications. PMID:23697550

  8. Nonsense-Mediated Decay Enables Intron Gain in Drosophila

    PubMed Central

    Dolezal, Marlies; Hua, Liushuai; Schlötterer, Christian


    Intron number varies considerably among genomes, but despite their fundamental importance, the mutational mechanisms and evolutionary processes underlying the expansion of intron number remain unknown. Here we show that Drosophila, in contrast to most eukaryotic lineages, is still undergoing a dramatic rate of intron gain. These novel introns carry significantly weaker splice sites that may impede their identification by the spliceosome. Novel introns are more likely to encode a premature termination codon (PTC), indicating that nonsense-mediated decay (NMD) functions as a backup for weak splicing of new introns. Our data suggest that new introns originate when genomic insertions with weak splice sites are hidden from selection by NMD. This mechanism reduces the sequence requirement imposed on novel introns and implies that the capacity of the spliceosome to recognize weak splice sites was a prerequisite for intron gain during eukaryotic evolution. PMID:20107520

  9. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    SciTech Connect

    Solera, J. ); Magallon, M.; Martin-Villar, J. ); Coloma, A. )


    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment.

  10. Human GC-AG alternative intron isoforms with weak donor sites show enhanced consensus at acceptor exon positions

    PubMed Central

    Thanaraj, T. A.; Clark, Francis


    It has been previously observed that the intrinsically weak variant GC donor sites, in order to be recognized by the U2-type spliceosome, possess strong consensus sequences maximized for base pair formation with U1 and U5/U6 snRNAs. However, variability in signal strength is a fundamental mechanism for splice site selection in alternative splicing. Here we report human alternative GC-AG introns (for the first time from any species), and show that while constitutive GC-AG introns do possess strong signals at their donor sites, a large subset of alternative GC-AG introns possess weak consensus sequences at their donor sites. Surprisingly, this subset of alternative isoforms shows strong consensus at acceptor exon positions 1 and 2. The improved consensus at the acceptor exon can facilitate a strong interaction with U5 snRNA, which tethers the two exons for ligation during the second step of splicing. Further, these isoforms nearly always possess alternative acceptor sites and exhibit particularly weak polypyrimidine tracts characteristic of AG-dependent introns. The acceptor exon nucleotides are part of the consensus required for the U2AF35-mediated recognition of AG in such introns. Such improved consensus at acceptor exons is not found in either normal or alternative GT-AG introns having weak donor sites or weak polypyrimidine tracts. The changes probably reflect mechanisms that allow GC-AG alternative intron isoforms to cope with two conflicting requirements, namely an apparent need for differential splice strength to direct the choice of alternative sites and a need for improved donor signals to compensate for the central mismatch base pair (C-A) in the RNA duplex of U1 snRNA and the pre-mRNA. The other important findings include (i) one in every twenty alternative introns is a GC-AG intron, and (ii) three of every five observed GC-AG introns are alternative isoforms. PMID:11410667

  11. RNA catalyzes nuclear pre-mRNA splicing

    PubMed Central

    Fica, Sebastian M.; Tuttle, Nicole; Novak, Thaddeus; Li, Nan-Sheng; Lu, Jun; Koodathingal, Prakash; Dai, Qing; Staley, Jonathan P.; Piccirilli, Joseph A.


    SUMMARY In nuclear pre-messenger RNA splicing, introns are excised by the spliceosome, a multi-megadalton machine composed of both proteins and small nuclear RNAs (snRNAs). Over thirty years ago, following the discovery of self-splicing group II intron RNAs, the snRNAs were hypothesized to catalyze splicing. However, no definitive evidence for a role of either RNA or protein in catalysis by the spliceosome has been reported to date. By using metal rescue strategies, here we show that the U6 snRNA catalyzes both splicing reactions by positioning divalent metals that stabilize the leaving groups during each reaction. Strikingly, all of the U6 catalytic metal ligands we identified correspond to the ligands observed to position catalytic, divalent metals in crystal structures of a group II intron RNA. These findings indicate that group II introns and the spliceosome share common catalytic mechanisms, and likely common evolutionary origins. Our results demonstrate that RNA mediates catalysis within the spliceosome. PMID:24196718

  12. A heroin addiction severity-associated intronic single nucleotide polymorphism modulates alternative pre-mRNA splicing of the μ opioid receptor gene OPRM1 via hnRNPH interactions.


    Xu, Jin; Lu, Zhigang; Xu, Mingming; Pan, Ling; Deng, Yi; Xie, Xiaohu; Liu, Huifen; Ding, Shixiong; Hurd, Yasmin L; Pasternak, Gavril W; Klein, Robert J; Cartegni, Luca; Zhou, Wenhua; Pan, Ying-Xian


    Single nucleotide polymorphisms (SNPs) in the OPRM1 gene have been associated with vulnerability to opioid dependence. The current study identifies an association of an intronic SNP (rs9479757) with the severity of heroin addiction among Han-Chinese male heroin addicts. Individual SNP analysis and haplotype-based analysis with additional SNPs in the OPRM1 locus showed that mild heroin addiction was associated with the AG genotype, whereas severe heroin addiction was associated with the GG genotype. In vitro studies such as electrophoretic mobility shift assay, minigene, siRNA, and antisense morpholino oligonucleotide studies have identified heterogeneous nuclear ribonucleoprotein H (hnRNPH) as the major binding partner for the G-containing SNP site. The G-to-A transition weakens hnRNPH binding and facilitates exon 2 skipping, leading to altered expressions of OPRM1 splice-variant mRNAs and hMOR-1 proteins. Similar changes in splicing and hMOR-1 proteins were observed in human postmortem prefrontal cortex with the AG genotype of this SNP when compared with the GG genotype. Interestingly, the altered splicing led to an increase in hMOR-1 protein levels despite decreased hMOR-1 mRNA levels, which is likely contributed by a concurrent increase in single transmembrane domain variants that have a chaperone-like function on MOR-1 protein stability. Our studies delineate the role of this SNP as a modifier of OPRM1 alternative splicing via hnRNPH interactions, and suggest a functional link between an SNP-containing splicing modifier and the severity of heroin addiction. PMID:25122903

  13. A Heroin Addiction Severity-Associated Intronic Single Nucleotide Polymorphism Modulates Alternative Pre-mRNA Splicing of the μ Opioid Receptor Gene OPRM1 via hnRNPH Interactions

    PubMed Central

    Xu, Jin; Lu, Zhigang; Xu, Mingming; Pan, Ling; Deng, Yi; Xie, Xiaohu; Liu, Huifen; Ding, Shixiong; Hurd, Yasmin L.; Pasternak, Gavril W.; Klein, Robert J.; Cartegni, Luca


    Single nucleotide polymorphisms (SNPs) in the OPRM1 gene have been associated with vulnerability to opioid dependence. The current study identifies an association of an intronic SNP (rs9479757) with the severity of heroin addiction among Han-Chinese male heroin addicts. Individual SNP analysis and haplotype-based analysis with additional SNPs in the OPRM1 locus showed that mild heroin addiction was associated with the AG genotype, whereas severe heroin addiction was associated with the GG genotype. In vitro studies such as electrophoretic mobility shift assay, minigene, siRNA, and antisense morpholino oligonucleotide studies have identified heterogeneous nuclear ribonucleoprotein H (hnRNPH) as the major binding partner for the G-containing SNP site. The G-to-A transition weakens hnRNPH binding and facilitates exon 2 skipping, leading to altered expressions of OPRM1 splice-variant mRNAs and hMOR-1 proteins. Similar changes in splicing and hMOR-1 proteins were observed in human postmortem prefrontal cortex with the AG genotype of this SNP when compared with the GG genotype. Interestingly, the altered splicing led to an increase in hMOR-1 protein levels despite decreased hMOR-1 mRNA levels, which is likely contributed by a concurrent increase in single transmembrane domain variants that have a chaperone-like function on MOR-1 protein stability. Our studies delineate the role of this SNP as a modifier of OPRM1 alternative splicing via hnRNPH interactions, and suggest a functional link between an SNP-containing splicing modifier and the severity of heroin addiction. PMID:25122903

  14. Reenacting the birth of an intron

    SciTech Connect

    Hellsten, Uffe; Aspden, Julie L.; Rio, Donald C.; Rokhsar, Daniel S.


    An intron is an extended genomic feature whose function requires multiple constrained positions - donor and acceptor splice sites, a branch point, a polypyrimidine tract and suitable splicing enhancers - that may be distributed over hundreds or thousands of nucleotides. New introns are therefore unlikely to emerge by incremental accumulation of functional sub-elements. Here we demonstrate that a functional intron can be created de novo in a single step by a segmental genomic duplication. This experiment recapitulates in vivo the birth of an intron that arose in the ancestral jawed vertebrate lineage nearly half a billion years ago.

  15. A Conserved Nuclear Cyclophilin Is Required for Both RNA Polymerase II Elongation and Co-transcriptional Splicing in Caenorhabditis elegans

    PubMed Central

    Ahn, Jeong H.; Rechsteiner, Andreas; Strome, Susan; Kelly, William G.


    The elongation phase of transcription by RNA Polymerase II (Pol II) involves numerous events that are tightly coordinated, including RNA processing, histone modification, and chromatin remodeling. RNA splicing factors are associated with elongating Pol II, and the interdependent coupling of splicing and elongation has been documented in several systems. Here we identify a conserved, multi-domain cyclophilin family member, SIG-7, as an essential factor for both normal transcription elongation and co-transcriptional splicing. In embryos depleted for SIG-7, RNA levels for over a thousand zygotically expressed genes are substantially reduced, Pol II becomes significantly reduced at the 3’ end of genes, marks of transcription elongation are reduced, and unspliced mRNAs accumulate. Our findings suggest that SIG-7 plays a central role in both Pol II elongation and co-transcriptional splicing and may provide an important link for their coordination and regulation. PMID:27541139

  16. A Conserved Nuclear Cyclophilin Is Required for Both RNA Polymerase II Elongation and Co-transcriptional Splicing in Caenorhabditis elegans.


    Ahn, Jeong H; Rechsteiner, Andreas; Strome, Susan; Kelly, William G


    The elongation phase of transcription by RNA Polymerase II (Pol II) involves numerous events that are tightly coordinated, including RNA processing, histone modification, and chromatin remodeling. RNA splicing factors are associated with elongating Pol II, and the interdependent coupling of splicing and elongation has been documented in several systems. Here we identify a conserved, multi-domain cyclophilin family member, SIG-7, as an essential factor for both normal transcription elongation and co-transcriptional splicing. In embryos depleted for SIG-7, RNA levels for over a thousand zygotically expressed genes are substantially reduced, Pol II becomes significantly reduced at the 3' end of genes, marks of transcription elongation are reduced, and unspliced mRNAs accumulate. Our findings suggest that SIG-7 plays a central role in both Pol II elongation and co-transcriptional splicing and may provide an important link for their coordination and regulation. PMID:27541139

  17. A composite regulatory element in the first intron of the estrogen-responsive very low density apolipoprotein II gene.


    Shuler, F D; Chu, W W; Wang, S; Evans, M I


    During periods of egg laying in the chicken, when circulating levels of estrogen are increased, the liver-specific estrogen-dependent very low density apolipoprotein II (apoVLDLII) gene is expressed. This expression takes place primarily at the level of transcription, driven by two estrogen response elements that reside in the promoter. In transient transfection assays, expression is increased fourfold when the first intron is added to the promoter construct, indicating that 75% of the regulation comes from intron A. Using in vitro DNase I footprinting, six protein-binding sites were revealed throughout the first intron. The functional significance of these binding sites was evaluated by mutation and transient transfection. Two of the protein-binding regions were shown to increase transcription. Site-specific mutations introduced at either the +66 to +86 or +112 to +129 sites disrupted trans-factor binding and reduced the estrogen-dependent expression by 45% and 34%, respectively. A plasmid containing both mutations resulted in a 43% decrease in expression, indicating that the contributions of these regions are not additive. Competition with known sequences in electrophoretic mobility shift assays suggested that the +66 to +86 site binds a chicken member of the nuclear receptor transcription factor family. PMID:9726251

  18. TCERG1 Regulates Alternative Splicing of the Bcl-x Gene by Modulating the Rate of RNA Polymerase II Transcription

    PubMed Central

    Montes, Marta; Cloutier, Alexandre; Sánchez-Hernández, Noemí; Michelle, Laetitia; Lemieux, Bruno; Blanchette, Marco; Hernández-Munain, Cristina; Chabot, Benoit


    Complex functional coupling exists between transcriptional elongation and pre-mRNA alternative splicing. Pausing sites and changes in the rate of transcription by RNA polymerase II (RNAPII) may therefore have fundamental impacts in the regulation of alternative splicing. Here, we show that the elongation and splicing-related factor TCERG1 regulates alternative splicing of the apoptosis gene Bcl-x in a promoter-dependent manner. TCERG1 promotes the splicing of the short isoform of Bcl-x (Bcl-xs) through the SB1 regulatory element located in the first half of exon 2. Consistent with these results, we show that TCERG1 associates with the Bcl-x pre-mRNA. A transcription profile analysis revealed that the RNA sequences required for the effect of TCERG1 on Bcl-x alternative splicing coincide with a putative polymerase pause site. Furthermore, TCERG1 modifies the impact of a slow polymerase on Bcl-x alternative splicing. In support of a role for an elongation mechanism in the transcriptional control of Bcl-x alternative splicing, we found that TCERG1 modifies the amount of pre-mRNAs generated at distal regions of the endogenous Bcl-x. Most importantly, TCERG1 affects the rate of RNAPII transcription of endogenous human Bcl-x. We propose that TCERG1 modulates the elongation rate of RNAPII to relieve pausing, thereby activating the proapoptotic Bcl-xS 5′ splice site. PMID:22158966

  19. Aberrant splicing in transgenes containing introns, exons, and V5 epitopes: lessons from developing an FSHD mouse model expressing a D4Z4 repeat with flanking genomic sequences.


    Ansseau, Eugénie; Domire, Jacqueline S; Wallace, Lindsay M; Eidahl, Jocelyn O; Guckes, Susan M; Giesige, Carlee R; Pyne, Nettie K; Belayew, Alexandra; Harper, Scott Q


    The DUX4 gene, encoded within D4Z4 repeats on human chromosome 4q35, has recently emerged as a key factor in the pathogenic mechanisms underlying Facioscapulohumeral muscular dystrophy (FSHD). This recognition prompted development of animal models expressing the DUX4 open reading frame (ORF) alone or embedded within D4Z4 repeats. In the first published model, we used adeno-associated viral vectors (AAV) and strong viral control elements (CMV promoter, SV40 poly A) to demonstrate that the DUX4 cDNA caused dose-dependent toxicity in mouse muscles. As a follow-up, we designed a second generation of DUX4-expressing AAV vectors to more faithfully genocopy the FSHD-permissive D4Z4 repeat region located at 4q35. This new vector (called AAV.D4Z4.V5.pLAM) contained the D4Z4/DUX4 promoter region, a V5 epitope-tagged DUX4 ORF, and the natural 3' untranslated region (pLAM) harboring two small introns, DUX4 exons 2 and 3, and the non-canonical poly A signal required for stabilizing DUX4 mRNA in FSHD. AAV.D4Z4.V5.pLAM failed to recapitulate the robust pathology of our first generation vectors following delivery to mouse muscle. We found that the DUX4.V5 junction sequence created an unexpected splice donor in the pre-mRNA that was preferentially utilized to remove the V5 coding sequence and DUX4 stop codon, yielding non-functional DUX4 protein with 55 additional residues on its carboxyl-terminus. Importantly, we further found that aberrant splicing could occur in any expression construct containing a functional splice acceptor and sequences resembling minimal splice donors. Our findings represent an interesting case study with respect to AAV.D4Z4.V5.pLAM, but more broadly serve as a note of caution for designing constructs containing V5 epitope tags and/or transgenes with downstream introns and exons. PMID:25742305

  20. Estimation of the minimum mRNA splicing error rate in vertebrates.


    Skandalis, A


    The majority of protein coding genes in vertebrates contain several introns that are removed by the mRNA splicing machinery. Errors during splicing can generate aberrant transcripts and degrade the transmission of genetic information thus contributing to genomic instability and disease. However, estimating the error rate of constitutive splicing is complicated by the process of alternative splicing which can generate multiple alternative transcripts per locus and is particularly active in humans. In order to estimate the error frequency of constitutive mRNA splicing and avoid bias by alternative splicing we have characterized the frequency of splice variants at three loci, HPRT, POLB, and TRPV1 in multiple tissues of six vertebrate species. Our analysis revealed that the frequency of splice variants varied widely among loci, tissues, and species. However, the lowest observed frequency is quite constant among loci and approximately 0.1% aberrant transcripts per intron. Arguably this reflects the "irreducible" error rate of splicing, which consists primarily of the combination of replication errors by RNA polymerase II in splice consensus sequences and spliceosome errors in correctly pairing exons. PMID:26811995

  1. Monilophyte mitochondrial rps1 genes carry a unique group II intron that likely originated from an ancient paralog in rpl2.


    Knie, Nils; Grewe, Felix; Knoop, Volker


    Intron patterns in plant mitochondrial genomes differ significantly between the major land plant clades. We here report on a new, clade-specific group II intron in the rps1 gene of monilophytes (ferns). This intron, rps1i25g2, is strikingly similar to rpl2i846g2 previously identified in the mitochondrial rpl2 gene of seed plants, ferns, and the lycophyte Phlegmariurus squarrosus Although mitochondrial ribosomal protein genes are frequently subject to endosymbiotic gene transfer among plants, we could retrieve the mitochondrial rps1 gene in a taxonomically wide sampling of 44 monilophyte taxa including basal lineages such as the Ophioglossales, Psilotales, and Marattiales with the only exception being the Equisetales (horsetails). Introns rps1i25g2 and rpl2i846g2 were likewise consistently present with only two exceptions: Intron rps1i25g2 is lost in the genus Ophioglossum and intron rpl2i846g2 is lost in Equisetum bogotense Both intron sequences are moderately affected by RNA editing. The unprecedented primary and secondary structure similarity of rps1i25g2 and rpl2i846g2 suggests an ancient retrotransposition event copying rpl2i846g2 into rps1, for which we suggest a model. Our phylogenetic analysis adding the new rps1 locus to a previous data set is fully congruent with recent insights on monilophyte phylogeny and further supports a sister relationship of Gleicheniales and Hymenophyllales. PMID:27354706

  2. Exclusive conservation of mitochondrial group II intron nad4i548 among liverworts and its use for phylogenetic studies in this ancient plant clade.


    Volkmar, U; Groth-Malonek, M; Heinrichs, J; Muhle, H; Polsakiewicz, M; Knoop, V


    Liverworts occupy a pivotal position in land plant (embryophyte) phylogeny as the presumed earliest-branching major clade, sister to all other land plants, including the mosses, hornworts, lycophytes, monilophytes and seed plants. Molecular support for this earliest dichotomy in land plant phylogeny comes from strikingly different occurrences of introns in mitochondrial genes distinguishing liverworts from all other embryophytes. Exceptionally, however, the nad5 gene--the mitochondrial locus hitherto used most widely to elucidate early land plant phylogeny--carries a group I type intron that is shared between liverworts and mosses. We here explored whether a group II intron, the other major type of organellar intron, would similarly be conserved in position across the entire diversity of extant liverworts and could be of use for phylogenetic analyses in this supposedly most ancient embryophyte clade. To this end, we investigated the nad4 gene as a candidate locus possibly featuring different introns in liverworts as opposed to the non-liverwort embryophyte (NLE) lineage. We indeed found group II intron nad4i548 universally conserved in a wide phylogenetic sampling of 55 liverwort taxa, confirming clade specificity and surprising evolutionary stability of plant mitochondrial introns. As expected, intron nad4i548g2 carries phylogenetic information in its variable sequences, which confirms and extends previous cladistic insights on liverwort evolution. We integrate the new nad4 data with those of the previously established mitochondrial nad5 and the chloroplast rbcL and rps4 genes and present a phylogeny based on the fused datasets. Notably, the phylogenetic analyses suggest a reconsideration of previous phylogenetic and taxonomic assignments for the genera Calycularia and Mylia and resolve a sister group relationship of Ptilidiales and Porellales. PMID:21973214

  3. Live-cell visualization of pre-mRNA splicing with single-molecule sensitivity

    PubMed Central

    Martin, Robert M.; Rino, José; Carvalho, Célia; Kirchhausen, Tomas; Carmo-Fonseca, Maria


    SUMMARY Removal of introns from pre-mRNAs via splicing provides a versatile means of genetic regulation that is often disrupted in human diseases. To decipher how splicing occurs in real time, we have directly examined with single-molecule sensitivity the kinetics of intron excision from pre-mRNA in the nucleus of living human cells. By using two different RNA labeling methods, MS2 and λN, we show that beta-globin introns are transcribed and excised in 20-30 s. We further show that replacing the weak polypyrimidine (Py) tract in mouse immunoglobulin μ (IgM) pre-mRNA by a U-rich Py decreases the intron lifetime, thus providing direct evidence that splice site strength influences splicing kinetics. We also found that RNA polymerase II transcribes at elongation rates ranging between 3 and 6 kb min-1, and that transcription can be rate limiting for splicing. These results have important implications for mechanistic understanding of co-transcriptional splicing regulation in the live-cell context. PMID:24035393

  4. Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis

    PubMed Central


    Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into ‘targetrons.’ Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and ‘cut-and-pastes’ (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA

  5. A Functional Interaction between the Carboxy-Terminal Domain of RNA Polymerase II and Pre-mRNA Splicing

    PubMed Central

    Du, Lei; Warren, Stephen L.


    In the preceding study we found that Sm snRNPs and SerArg (SR) family proteins co-immunoprecipitate with Pol II molecules containing a hyperphosphorylated CTD (Kim et al., 1997). The association between Pol IIo and splicing factors is maintained in the absence of pre-mRNA, and the polymerase need not be transcriptionally engaged (Kim et al., 1997). The latter findings led us to hypothesize that a phosphorylated form of the CTD interacts with pre-mRNA splicing components in vivo. To test this idea, a nested set of CTD-derived proteins was assayed for the ability to alter the nuclear distribution of splicing factors, and to interfere with splicing in vivo. Proteins containing heptapeptides 1-52 (CTD52), 1-32 (CTD32), 1-26 (CTD26), 1-13 (CTD13), 1-6 (CTD6), 1-3 (CTD3), or 1 (CTD1) were expressed in mammalian cells. The CTD-derived proteins become phosphorylated in vivo, and accumulate in the nucleus even though they lack a conventional nuclear localization signal. CTD52 induces a selective reorganization of splicing factors from discrete nuclear domains to the diffuse nucleoplasm, and significantly, it blocks the accumulation of spliced, but not unspliced, human β-globin transcripts. The extent of splicing factor disruption, and the degree of inhibition of splicing, are proportional to the number of heptapeptides added to the protein. The above results indicate a functional interaction between Pol II's CTD and pre-mRNA splicing. PMID:9008699

  6. Two regulatory elements of similar structure and placed in tandem account for the repressive activity of the first intron of the human apolipoprotein A-II gene.

    PubMed Central

    Bossu, J P; Chartier, F L; Fruchart, J C; Auwerx, J; Staels, B; Laine, B


    Recent reports indicate that apolipoprotein (apo) A-II, the second most abundant protein of high-density lipoproteins, plays a crucial role in counteracting the beneficial effect of apo A-I against atherogenesis. Transcription of the human apo A-II gene is controlled by an enhancer comprising 14 regulatory elements located upstream of its promoter whereas the first intron of this gene behaves as a silencer. Here we show that two sequence elements account for the repressive activity of this intron and correspond to negative regulatory elements termed NRE I and NRE II. The activity of intron I and the nuclear proteins binding to NRE I and II are encountered in hepatic cells but not in non-hepatic cells studied here. Both NREs form nucleoprotein complexes of very similar physicochemical characteristics and bind the same or closely related proteins. Site-directed mutagenesis, transient transfection and gel-shift analysis experiments indicate that both NREs exhibit similar structures, being composed of two sites required for maximal activity and optimal binding of transcription factors. Therefore two negative regulatory elements of similar structure and function, placed in tandem, account for the repressive activity of the first intron of the human apo A-II gene. These NREs do not exhibit structural similarity with known NREs of other genes. PMID:8809045

  7. FUS functions in coupling transcription to splicing by mediating an interaction between RNAP II and U1 snRNP

    PubMed Central

    Yu, Yong; Reed, Robin


    Pre-mRNA splicing is coupled to transcription by RNA polymerase II (RNAP II). We previously showed that U1 small nuclear ribonucleoprotein (snRNP) associates with RNAP II, and both RNAP II and U1 snRNP are also the most abundant factors associated with the protein fused-in-sarcoma (FUS), which is mutated to cause the neurodegenerative disease amyotrophic lateral sclerosis. Here, we show that an antisense morpholino that base-pairs to the 5′ end of U1 snRNA blocks splicing in the coupled system and completely disrupts the association between U1 snRNP and both FUS and RNAP II, but has no effect on the association between FUS and RNAP II. Conversely, we found that U1 snRNP does not interact with RNAP II in FUS knockdown extracts. Moreover, using these extracts, we found that FUS must be present during the transcription reaction in order for splicing to occur. Together, our data lead to a model that FUS functions in coupling transcription to splicing via mediating an interaction between RNAP II and U1 snRNP. PMID:26124092

  8. Plant pre-tRNA splicing enzymes are targeted to multiple cellular compartments.


    Englert, Markus; Latz, Andreas; Becker, Dirk; Gimple, Olaf; Beier, Hildburg; Akama, Kazuhito


    Splicing of precursor tRNAs in plants requires the concerted action of three enzymes: an endonuclease to cleave the intron at the two splice sites, an RNA ligase for joining the resulting tRNA halves and a 2'-phosphotransferase to remove the 2'-phosphate from the splice junction. Pre-tRNA splicing has been demonstrated to occur exclusively in the nucleus of vertebrates and in the cytoplasm of budding yeast cells, respectively. We have investigated the subcellular localization of plant splicing enzymes fused to GFP by their transient expression in Allium epidermal and Vicia guard cells. Our results show that all three classes of splicing enzymes derived from Arabidopsis and Oryza are localized in the nucleus, suggesting that plant pre-tRNA splicing takes place preferentially in the nucleus. Moreover, two of the splicing enzymes, i.e., tRNA ligase and 2'-phosphotransferase, contain chloroplast transit signals at their N-termini and are predominantly targeted to chloroplasts and proplastids, respectively. The putative transit sequences are effective also in the heterologous context fused directly to GFP. Chloroplast genomes do not encode intron-containing tRNA genes of the nuclear type and consequently tRNA ligase and 2'-phosphotransferase are not required for classical pre-tRNA splicing in these organelles but they may play a role in tRNA repair and/or splicing of atypical group II introns. Additionally, 2'-phosphotransferase-GFP fusion protein has been found to be associated with mitochondria, as confirmed by colocalization studies with MitoTracker Red. In vivo analyses with mutated constructs suggest that alternative initiation of translation is one way utilized by tRNA splicing enzymes for differential targeting. PMID:17698277

  9. Influence of Intron II microsatellite polymorphism in human toll-like receptor 2 gene in leprosy.


    Suryadevara, Naveen Chandra; Neela, Venkata Sanjeev Kumar; Devalraju, Kamakshi Prudhula; Jain, Suman; SivaSai, Krovvidi S R; Valluri, Vijaya Lakshmi; Jonnalagada, Subbanna; Anandaraj, M P J S


    Leprosy is a chronic granulomatous infection caused by the obligate intracellular organism Mycobacterium leprae. TLR2 plays a key role when activated by M. leprae lipoproteins initiating protective responses which induce bacterial killing and therefore control of disease spread. Microsatellite polymorphisms in intron2 of TLR2 gene have been reported to be associated with development of clinical features of several infectious diseases. The study aims to evaluate the influence of GT microsatellite on the expression of TLR2 which could make humans prone to M. leprae infections. A total of 279 individuals were enrolled in the study, 88 were leprosy patients, 95 were house hold contacts (HHC) and 96 were healthy controls (HC). Genotyping was done using PCR-Sequencing method. TLR2 mRNA expression was analyzed by RT-PCR. IL-10 and IFN-γ levels were measured using ELISA in MLSA stimulated cell culture supernatants. Statistical analysis was performed using Chi-Square (χ(2)) test and t-tests. Allele/genotype of TLR2 microsatellite which includes longer GT repeats was associated with low TLR2 mRNA expression and high IL-10 production while that including shorter GT repeats was associated with high TLR2 mRNA expression and low IL-10 production. High IL10 producing allele of TLR2 microsatellite might predispose house hold contacts to leprosy. PMID:23619473

  10. Mutations in Nuclear Gene Cyt-4 of Neurospora Crassa Result in Pleiotropic Defects in Processing and Splicing of Mitochondrial Rnas

    PubMed Central

    Dobinson, K. F.; Henderson, M.; Kelley, R. L.; Collins, R. A.; Lambowitz, A. M.


    The nuclear cyt-4 mutants of Neurospora crassa have been shown previously to be defective in splicing the group I intron in the mitochondrial large rRNA gene and in 3' end synthesis of the mitochondrial large rRNA. Here, Northern hybridization experiments show that the cyt-4-1 mutant has alterations in a number of mitochondrial RNA processing pathways, including those for cob, coI, coII and ATPase 6 mRNAs, as well as mitochondrial tRNAs. Defects in these pathways include inhibition of 5' and 3' end processing, accumulation of aberrant RNA species, and inhibition of splicing of both group I introns in the cob gene. The various defects in mitochondrial RNA synthesis in the cyt-4-1 mutant cannot be accounted for by deficiency of mitochondrial protein synthesis or energy metabolism, and they suggest that the cyt-4-1 mutant is defective in a component or components required for processing and/or turnover of a number of different mitochondrial RNAs. Defective splicing of the mitochondrial large rRNA intron in the cyt-4-1 mutant may be a secondary effect of failure to synthesize pre-rRNAs having the correct 3' end. However, a similar explanation cannot be invoked to account for defective splicing of the cob pre-mRNA introns, and the cyt-4-1 mutation may directly affect splicing of these introns. PMID:2478417

  11. A novel intronic splice site deletion of the IL-2 receptor common gamma chain results in expression of a dysfunctional protein and T-cell-positive X-linked Severe combined immunodeficiency.


    Gray, P E A; Logan, G J; Alexander, I E; Poulton, S; Roscioli, T; Ziegler, J


    X-linked severe combined immunodeficiency is caused by mutations in the IL-2 receptor common gamma chain and classically presents in the first 6 months of life with predisposition to bacterial, viral and fungal infections. In most instances, affected individuals are lymphopenic with near complete absence of T cells and NK cells. We report a boy who presented at 12 months of age with Pneumocystis jiroveci pneumonia and a family history consistent with X-linked recessive inheritance. He had a normal lymphocyte count including the presence of T cells and a broad T-cell-receptor diversity, as well as normal surface expression of the common gamma chain (CD132) protein. He however had profound hypogammaglobulinaemia, and IL-2-induced STAT5 phosphorylation was absent. Sequencing of IL-2RG demonstrated a 12-base pair intronic deletion close to the canonical splice site of exon 5, which resulted in a variety of truncated IL2RG mRNA species. A review of the literature identified 4 other patients with T-cell-positive X-SCID, with the current patient being the first associated with an mRNA splicing defect. This case raises the question of how a dysfunctional protein incapable of mediating STAT5 phosphorylation might nonetheless support T-cell development. Possible explanations are that STAT5-mediated signal transduction may be less relevant to IL7-receptor-mediated T-cell development than are other IL7R-induced intracellular transduction pathways or that a low level of STAT5 phosphorylation, undetectable in the laboratory, may be sufficient to support some T-cell development. PMID:25443657

  12. RNA structure in splicing: An evolutionary perspective.


    Lin, Chien-Ling; Taggart, Allison J; Fairbrother, William G


    Pre-mRNA splicing is a key post-transcriptional regulation process in which introns are excised and exons are ligated together. A novel class of structured intron was recently discovered in fish. Simple expansions of complementary AC and GT dimers at opposite boundaries of an intron were found to form a bridging structure, thereby enforcing correct splice site pairing across the intron. In some fish introns, the RNA structures are strong enough to bypass the need of regulatory protein factors for splicing. Here, we discuss the prevalence and potential functions of highly structured introns. In humans, structured introns usually arise through the co-occurrence of C and G-rich repeats at intron boundaries. We explore the potentially instructive example of the HLA receptor genes. In HLA pre-mRNA, structured introns flank the exons that encode the highly polymorphic β sheet cleft, making the processing of the transcript robust to variants that disrupt splicing factor binding. While selective forces that have shaped HLA receptor are fairly atypical, numerous other highly polymorphic genes that encode receptors contain structured introns. Finally, we discuss how the elevated mutation rate associated with the simple repeats that often compose structured intron can make structured introns themselves rapidly evolving elements. PMID:27454491

  13. Connecting the dots: chromatin and alternative splicing in EMT

    PubMed Central

    Warns, Jessica A.; Davie, James R.; Dhasarathy, Archana


    Nature has devised sophisticated cellular machinery to process mRNA transcripts produced by RNA Polymerase II, removing intronic regions and connecting exons together, to produce mature RNAs. This process, known as splicing, is very closely linked to transcription. Alternative splicing, or the ability to produce different combinations of exons that are spliced together from the same genomic template, is a fundamental means of regulating protein complexity. Similar to transcription, both constitutive and alternative splicing can be regulated by chromatin and its associated factors in response to various signal transduction pathways activated by external stimuli. This regulation can vary between different cell types, and interference with these pathways can lead to changes in splicing, often resulting in aberrant cellular states and disease. The epithelial to mesenchymal transition (EMT), which leads to cancer metastasis, is influenced by alternative splicing events of chromatin remodelers and epigenetic factors such as DNA methylation and non-coding RNAs. In this review, we will discuss the role of epigenetic factors including chromatin, chromatin remodelers, DNA methyltransferases and microRNAs in the context of alternative splicing, and discuss their potential involvement in alternative splicing during the EMT process. PMID:26291837

  14. An RNA-splicing mutation (G+5IVS20) in the type II collagen gene (COL2A1) in a family with spondyloepiphyseal dysplasia congenita.


    Tiller, G E; Weis, M A; Polumbo, P A; Gruber, H E; Rimoin, D L; Cohn, D H; Eyre, D R


    Defects in type II collagen have been demonstrated in a phenotypic continuum of chondrodysplasias that includes achondrogenesis II, hypochondrogenesis, spondyloepiphyseal dysplasia congenita (SEDC), Kniest dysplasia, and Stickler syndrome. We have determined that cartilage from a terminated fetus with an inherited form of SEDC contained both normal alpha 1(II) collagen chains and chains that lacked amino acids 256-273 of the triple-helical domain. PCR amplification of this region of COL2A1, from genomic DNA, yielded products of normal size, while amplification of cDNA yielded a normal sized species and a shorter fragment missing exon 20. Sequence analysis of genomic DNA from the fetus revealed a G-->T transversion at position +5 of intron 20; the affected father was also heterozygous for the mutation. Allele-specific PCR and heteroduplex analysis of a VNTR in COL2A1 independently confirmed the unaffected status of a fetus in a subsequent pregnancy. Thermodynamic calculations suggest that the mutation prevents normal splicing of exon 20 by interfering with binding of U1 small-nuclear RNA to pre-mRNA, thus leading to skipping of exon 20 in transcripts from the mutant allele. Electron micrographs of diseased cartilage showed intracellular inclusion bodies, which were stained by an antibody to alpha 1(II) procollagen. Our findings support the hypothesis that alpha-chain length alterations that preserve the Gly-X-Y repeat motif of the triple helix result in partial intracellular retention of alpha 1(II) procollagen and produce mild to moderate chondrodysplasia phenotypes. PMID:7847372

  15. An RNA-splicing mutation (G{sup +51VS20}) in the Type II collagen gene (COL2A1) in a family with spondyloepiphyseal dysplasia congenita

    SciTech Connect

    Tiller, G.E.; Polumbo, P.A.; Weis, M.A.; Eyre, D.R.; Gruber, H.E.; Rimoin, D.L.; Cohn, D.H. |


    Defects in type II collagen have been demonstrated in a phenotypic continuum of chondrodysplasias that includes achondrogenesis II, hypochondrogenesis, spondyloepiphyseal dysplasia congenita (SEDC), Kniest dysplasia, and Stickler syndrome. We have determined that cartilage from a terminated fetus with an inherited form of SEDC contained both normal {alpha}1(II) collagen chains and chains that lacked amino acids 256-273 of the triple-helical domain. PCR amplification of this region of COL2A1, from genomic DNA, yielded products of normal size, while amplification of cDNA yielded a normal sized species and a shorter fragment missing exon 20. Sequence analysis of genomic DNA from the fetus revealed a G{yields}T transversion at position +5 of intron 20; the affected father was also heterozygous for the mutation. Allele-specific PCR and heteroduplex analysis of a VNTR in COL2A1 independently confirmed the unaffected status of a fetus in a subsequent pregnancy. Thermodynamic calculations suggest that the mutation prevents normal splicing of exon 20 by interfering with binding of U{sub 1} small-nuclear RNA to pre-mRNA, thus leading to skipping of exon 20 in transcripts from the mutant allele. Electron micrographs of diseased cartilage showed intracellular inclusion bodies, which were stained by an antibody to {alpha}1(II) procollagen. Our findings support the hypothesis that {alpha}-chain length alterations that preserve the Gly-X-Y repeat motif of the triple helix result in partial intracellular retention of {alpha}1(II) procollagen and produce mild to moderate chondrodysplasia phenotypes. 50 refs., 6 figs., 1 tab.

  16. Intron-exon organization of the gene for the multifunctional animal fatty acid synthase.

    PubMed Central

    Amy, C M; Williams-Ahlf, B; Naggert, J; Smith, S


    The complete intron-exon organization of the gene encoding a multifunctional mammalian fatty acid synthase has been elucidated, and specific exons have been assigned to coding sequences for the component domains of the protein. The rat gene is interrupted by 42 introns and the sequences bordering the splice-site junctions universally follow the GT/AG rule. However, of the 41 introns that interrupt the coding region of the gene, 23 split the reading frame in phase I, 14 split the reading frame in phase 0, and only 4 split the reading frame in phase II. Remarkably, 46% of the introns interrupt codons for glycine. With only one exception, boundaries between the constituent enzymes of the multifunctional polypeptide coincide with the location of introns in the gene. The significance of the predominance of phase I introns, the almost uniformly short length of the 42 introns and the overall small size of the gene, is discussed in relation to the evolution of multifunctional proteins. Images PMID:1736293

  17. A novel donor splice site in intron 11 of the CFTR gene, created by mutation 1811+1.6kbA-->G, produces a new exon: high frequency in Spanish cystic fibrosis chromosomes and association with severe phenotype.

    PubMed Central

    Chillón, M; Dörk, T; Casals, T; Giménez, J; Fonknechten, N; Will, K; Ramos, D; Nunes, V; Estivill, X


    mRNA analysis of the cystic fibrosis transmembrane regulator (CFTR) gene in tissues of cystic fibrosis (CF) patients has allowed us to detect a cryptic exon. The new exon involves 49 base pairs between exons 11 and 12 and is due to a point mutation (1811+1.6kbA-->G) that creates a new donor splice site in intron 11. Semiquantitative mRNA analysis showed that 1811+1.6kbA-->G-mRNA was 5-10-fold less abundant than delta F508 mRNA. Mutation 1811+1.6kbA-->G was found in 21 Spanish and 1 German CF chromosomes, making it the fourth-most-frequent mutation (2%) in the Spanish population. Individuals with genotype delta F508/1811+1.6kbA-->G have only 1%-3% of normal CFTR mRNA. This loss of 97% of normal CFTR mRNA must be responsible for the pancreatic insufficiency and for the severe CF phenotype in these patients. Images Figure 3 PMID:7534040

  18. A novel donor splice site in intron 11 of the CFTR gene, created by mutation 1811 + 1.6kbA {yields} G, produces a new exon: High frequency in spanish cystic fibrosis chromosomes and association with severe phenotype

    SciTech Connect

    Chillon, M.; Casals, T.; Gimenez, J.; Ramos, D.; Nunes, V.; Estivill, X.; Doerk, T.; Will, K.; Fonknechten, N.


    mRNA analysis of the cystic fibrosis transmembrane regulator (CFTR) gene in tissues of cystic fibrosis (CF) patients has allowed us to detect a cryptic exon. The new exon involves 49 base pairs between exons 11 and 12 and is due to a point mutation (1811+1.6bA{yields}G) that creates a new donor splice site in intron 11. Semiquantitative mRNA analysis showed that 1811+1.6kbA{r_arrow}G-mRNA was 5-10-fold less abundant than {triangle}F508 mRNA. Mutations 1811+1.6kbA{yields}G was found in 21 Spanish and 1 German CF chromosome(s), making it the fourth-most-frequent mutation (2%) in the Spanish population. Individuals with genotype {triangle}F508/1811+1.6kbA{yields}G have only 1%-3% of normal CFTR mRNA. This loss of 97% of normal CFTR mRNA must be responsible for the pancreatic insufficiency and for the severe CF phenotype in these patients. 30 refs., 3 figs., 2 tabs.

  19. A role for U2/U6 helix Ib in 5' splice site selection.

    PubMed Central

    Luukkonen, B G; Séraphin, B


    Selection of pre-mRNA splice sites is a highly accurate process involving many trans-acting factors. Recently, we described a role for U6 snRNA position G52 in selection of the first intron nucleotide (+1G). Because some U2 alleles suppress U6-G52 mutations, we investigated whether the corresponding U2 snRNA region also influenced 5' splice site selection. Our results demonstrate that U2 snRNAs mutated at position U23, but not adjacent nucleotides, specifically affect 5' splice site cleavage. Furthermore, all U2 position U23 mutations are synthetic lethal with the thermosensitive U6-G52U allele. Interestingly, the U2-U23C substitution has an unprecedented hyperaccurate splicing phenotype in which cleavage of introns with a +1G substitution is reduced, whereas the strain grows with wild-type kinetics. U2 position U23 forms the first base pair with U6 position A59 in U2/U6 helix Ib. Restoration of the helical structure suppresses 5' splice site cleavage defects, showing an important role for the helix Ib structure in 5' splice site selection. U2/U6 helix Ib and helix II have recently been described as being functionally redundant. This report demonstrates a unique role for helix Ib in 5' splice site selection that is not shared with helix II. PMID:9701283

  20. The exon-intron organization of the human erythroid [beta]-spectrin gene

    SciTech Connect

    Amin, K.M.; Forget, B.G. ); Scarpa, A.L.; Curtis, P.J. ); Winkelmann, J.C. )


    The human erythrocyte [beta]-spectrin gene DNA has been cloned from overlapping human genomic phage and cosmid recombinants. The entire erythroid [beta]-spectrin mRNA is encoded by 32 exons that range in size from 49 to 871 bases. The exon/intron junctions have been identified and the exons mapped. There is no correlation between intron positions and the repeat units of 106 amino acids within domain II of the [beta]-spectrin gene. The scatter of the introns over the 17 repeats argues against the 106-amino-acid unit representing a minigene that underwent repeated duplication resulting in the present [beta]-spectrin gene. In fact, the two largest exons, exon 14 (871 bp) and 16 (757 bp), extend over 4 and 3 repeat units of 106 amino acids, respectively, while repeat [beta]10 is encoded by 4 exons. No single position of an intron in the [beta]-spectrin gene is conserved between any of the 17 [beta]-spectrin and 22 [alpha]-spectrin repeat units. The nucleotide sequences of the exon/intron boundaries conform to the consensus splice site sequences except for exon 20, whose 5[prime] donor splice-site sequence begins with GC. The [beta]-spectrin isoform present in the human brain, the skeletal muscle, and the cardiac muscle is an alternatively spliced product of the erythroid [beta]-spectrin gene. This splice site is located within the coding sequences of exon 32 and its utilization in nonerythroid tissues leads to the use of 4 additional downstream exons with a size range of 44 to 530 bp. 55 refs., 3 figs., 3 tabs.

  1. An artificial riboswitch for controlling pre-mRNA splicing.


    Kim, Dong-Suk; Gusti, Veronica; Pillai, Sailesh G; Gaur, Rajesh K


    Riboswitches, as previously reported, are natural RNA aptamers that regulate the expression of numerous bacterial metabolic genes in response to small molecule ligands. It has recently been shown that these RNA genetic elements are also present near the splice site junctions of plant and fungal introns, thus raising the possibility of their involvement in regulating mRNA splicing. Here it is shown for the first time that a riboswitch can be engineered to regulate pre-mRNA splicing in vitro. We show that insertion of a high-affinity theophylline binding aptamer into the 3' splice site (3' ss) region of a model pre-mRNA (AdML-Theo29AG) enables its splicing to be repressed by the addition theophylline. Our results indicate that the location of 3' ss AG within the aptamer plays a crucial role in conferring theophylline-dependent control of pre-mRNA splicing. We also show that theophylline-mediated control of pre-mRNA splicing is highly specific by first demonstrating that a small molecule ligand similar in shape and size to theophylline had no effect on the splicing of AdML-Theo29AG pre-mRNA. Second, theophylline failed to exert any influence on the splicing of a pre-mRNA that does not contain its binding site. Third, theophylline specifically blocks the step II of the splicing reaction. Finally, we provide evidence that theophylline-dependent control of pre-mRNA splicing is functionally relevant. PMID:16244133

  2. Evolution of the Exon-Intron Structure in Ciliate Genomes.


    Bondarenko, Vladyslav S; Gelfand, Mikhail S


    A typical eukaryotic gene is comprised of alternating stretches of regions, exons and introns, retained in and spliced out a mature mRNA, respectively. Although the length of introns may vary substantially among organisms, a large fraction of genes contains short introns in many species. Notably, some Ciliates (Paramecium and Nyctotherus) possess only ultra-short introns, around 25 bp long. In Paramecium, ultra-short introns with length divisible by three (3n) are under strong evolutionary pressure and have a high frequency of in-frame stop codons, which, in the case of intron retention, cause premature termination of mRNA translation and consequent degradation of the mis-spliced mRNA by the nonsense-mediated decay mechanism. Here, we analyzed introns in five genera of Ciliates, Paramecium, Tetrahymena, Ichthyophthirius, Oxytricha, and Stylonychia. Introns can be classified into two length classes in Tetrahymena and Ichthyophthirius (with means 48 bp, 69 bp, and 55 bp, 64 bp, respectively), but, surprisingly, comprise three distinct length classes in Oxytricha and Stylonychia (with means 33-35 bp, 47-51 bp, and 78-80 bp). In most ranges of the intron lengths, 3n introns are underrepresented and have a high frequency of in-frame stop codons in all studied species. Introns of Paramecium, Tetrahymena, and Ichthyophthirius are preferentially located at the 5' and 3' ends of genes, whereas introns of Oxytricha and Stylonychia are strongly skewed towards the 5' end. Analysis of evolutionary conservation shows that, in each studied genome, a significant fraction of intron positions is conserved between the orthologs, but intron lengths are not correlated between the species. In summary, our study provides a detailed characterization of introns in several genera of Ciliates and highlights some of their distinctive properties, which, together, indicate that splicing spellchecking is a universal and evolutionarily conserved process in the biogenesis of short introns in

  3. Mammalian Introns: When the Junk Generates Molecular Diversity

    PubMed Central

    Hubé, Florent; Francastel, Claire


    Introns represent almost half of the human genome, yet their vast majority is eliminated from eukaryotic transcripts through RNA splicing. Nevertheless, they feature key elements and functions that deserve further interest. At the level of DNA, introns are genomic segments that can shelter independent transcription units for coding and non-coding RNAs which transcription may interfere with that of the host gene, and regulatory elements that can influence gene expression and splicing itself. From the RNA perspective, some introns can be subjected to alternative splicing. Intron retention appear to provide some plasticity to the nature of the protein produced, its distribution in a given cell type and timing of its translation. Intron retention may also serve as a switch to produce coding or non-coding RNAs from the same transcription unit. Conversely, splicing of introns has been directly implicated in the production of small regulatory RNAs. Hence, splicing of introns also appears to provide plasticity to the type of RNA produced from a genetic locus (coding, non-coding, short or long). We addressed these aspects to add to our understanding of mechanisms that control the fate of introns and could be instrumental in regulating genomic output and hence cell fate. PMID:25710723

  4. Recursive splicing in long vertebrate genes

    PubMed Central

    Blazquez, Lorea; Faro, Ana; Haberman, Nejc; Briese, Michael; Trabzuni, Daniah; Ryten, Mina; Weale, Michael E; Hardy, John; Modic, Miha; Curk, Tomaž; Wilson, Stephen W; Plagnol, Vincent; Ule, Jernej


    It is generally believed that splicing removes introns as single units from pre-mRNA transcripts. However, some long D. melanogaster introns contain a cryptic site, called a recursive splice site (RS-site), that enables a multi-step process of intron removal termed recursive splicing1,2. The extent to which recursive splicing occurs in other species and its mechanistic basis remain unclear. Here we identify highly conserved RS-sites in genes expressed in the mammalian brain that encode proteins functioning in neuronal development. Moreover, the RS-sites are found in some of the longest introns across vertebrates. We find that vertebrate recursive splicing requires initial definition of a “RS-exon” that follows the RS-site. The RS-exon is then excluded from the dominant mRNA isoform due to competition with a reconstituted 5′ splice site formed at the RS-site after the first splicing step. Conversely, the RS-exon is included when preceded by cryptic exons or promoters that are prevalent in long introns, but which fail to reconstitute an efficient 5′ splice site. Most RS-exons contain a premature stop codon such that their inclusion may decrease mRNA stability. Thus, by establishing a binary splicing switch, RS-sites demarcate different mRNA isoforms emerging from long genes by coupling inclusion of cryptic elements with RS-exons. PMID:25970246

  5. Splicing in action: assessing disease causing sequence changes

    PubMed Central

    Baralle, D; Baralle, M


    Variations in new splicing regulatory elements are difficult to identify exclusively by sequence inspection and may result in deleterious effects on precursor (pre) mRNA splicing. These mutations can result in either complete skipping of the exon, retention of the intron, or the introduction of a new splice site within an exon or intron. Sometimes mutations that do not disrupt or create a splice site activate pre-existing pseudo splice sites, consistent with the proposal that introns contain splicing inhibitory sequences. These variants can also affect the fine balance of isoforms produced by alternatively spliced exons and in consequence cause disease. Available genomic pathology data reveal that we are still partly ignorant of the basic mechanisms that underlie the pre-mRNA splicing process. The fact that human pathology can provide pointers to new modulatory elements of splicing should be exploited. PMID:16199547

  6. Identification and Validation of Evolutionarily Conserved Unusually Short Pre-mRNA Introns in the Human Genome

    PubMed Central

    Shimada, Makoto K.; Sasaki-Haraguchi, Noriko; Mayeda, Akila


    According to the length distribution of human introns, there is a large population of short introns with a threshold of 65 nucleotides (nt) and a peak at 85 nt. Using human genome and transcriptome databases, we investigated the introns shorter than 66 nt, termed ultra-short introns, the identities of which are scarcely known. Here, we provide for the first time a list of bona fide human ultra-short introns, which have never been characterized elsewhere. By conducting BLAST searches of the databases, we screened 22 introns (37–65 nt) with conserved lengths and sequences among closely related species. We then provide experimental and bioinformatic evidence for the splicing of 15 introns, of which 12 introns were remarkably G-rich and 9 introns contained completely inefficient splice sites and/or branch sites. These unorthodox characteristics of ultra-short introns suggest that there are unknown splicing mechanisms that differ from the well-established mechanism. PMID:25961948

  7. Identification and Validation of Evolutionarily Conserved Unusually Short Pre-mRNA Introns in the Human Genome.


    Shimada, Makoto K; Sasaki-Haraguchi, Noriko; Mayeda, Akila


    According to the length distribution of human introns, there is a large population of short introns with a threshold of 65 nucleotides (nt) and a peak at 85 nt. Using human genome and transcriptome databases, we investigated the introns shorter than 66 nt, termed ultra-short introns, the identities of which are scarcely known. Here, we provide for the first time a list of bona fide human ultra-short introns, which have never been characterized elsewhere. By conducting BLAST searches of the databases, we screened 22 introns (37-65 nt) with conserved lengths and sequences among closely related species. We then provide experimental and bioinformatic evidence for the splicing of 15 introns, of which 12 introns were remarkably G-rich and 9 introns contained completely inefficient splice sites and/or branch sites. These unorthodox characteristics of ultra-short introns suggest that there are unknown splicing mechanisms that differ from the well-established mechanism. PMID:25961948

  8. Genome-wide bioinformatic and molecular analysis of introns in Saccharomyces cerevisiae.

    PubMed Central

    Spingola, M; Grate, L; Haussler, D; Ares, M


    Introns have typically been discovered in an ad hoc fashion: introns are found as a gene is characterized for other reasons. As complete eukaryotic genome sequences become available, better methods for predicting RNA processing signals in raw sequence will be necessary in order to discover genes and predict their expression. Here we present a catalog of 228 yeast introns, arrived at through a combination of bioinformatic and molecular analysis. Introns annotated in the Saccharomyces Genome Database (SGD) were evaluated, questionable introns were removed after failing a test for splicing in vivo, and known introns absent from the SGD annotation were added. A novel branchpoint sequence, AAUUAAC, was identified within an annotated intron that lacks a six-of-seven match to the highly conserved branchpoint consensus UACUAAC. Analysis of the database corroborates many conclusions about pre-mRNA substrate requirements for splicing derived from experimental studies, but indicates that splicing in yeast may not be as rigidly determined by splice-site conservation as had previously been thought. Using this database and a molecular technique that directly displays the lariat intron products of spliced transcripts (intron display), we suggest that the current set of 228 introns is still not complete, and that additional intron-containing genes remain to be discovered in yeast. The database can be accessed at o/yeast_introns.html. PMID:10024174

  9. Polypurine sequences within a downstream exon function as a splicing enhancer

    SciTech Connect

    Tanaka, Kenji; Watakabe, Akiya; Shimura, Yoshiro


    We have previously shown that a purine-rich sequence located within exon M2 of the mouse immunoglobulin {mu} gene functions as a splicing enhancer, as judged by its ability to stimulate splicing of a distant upstream intron. This sequence element has been designated ERS (exon recognition sequence). In this study, we investigated the stimulatory effects of various ERS-like sequences, using the in vitro splicing system with HeLa cell nuclear extracts. Here, we show that purine-rich sequences of several natural exons that have previously been shown to be required for splicing function as a splicing enhancer like the ERS of the immunoglobulin {mu} gene. Moreover, even synthetic polypurine sequences had stimulatory effects on the upstream splicing. Evaluation of the data obtained from the analyses of both natural and synthetic purine-rich sequences shows that (i) alternating purine sequences can stimulate splicing, while poly(A) or poly(G) sequences cannot, and (ii) the presence of U residues within the polypurine sequence greatly reduces the level of stimulation. Competition experiments strongly suggest that the stimulatory effects of various purine-rich sequences are mediated by the same trans-acting factor(s). We conclude from these results that the purine-rich sequences that we examined in this study also represent examples of ERS. Thus, ERS is considered a general splicing element that is present in various exons and plays an important role in splice site selection. 50 refs., 7 figs., 2 tabs.

  10. The Octatricopeptide Repeat Protein Raa8 Is Required for Chloroplast trans Splicing

    PubMed Central

    Marx, Christina; Wünsch, Christiane


    The mRNA maturation of the tripartite chloroplast psaA gene from the green alga Chlamydomonas reinhardtii depends on various nucleus-encoded factors that participate in trans splicing of two group II introns. Recently, a multiprotein complex was identified that is involved in processing the psaA precursor mRNA. Using coupled tandem affinity purification (TAP) and mass spectrometry analyses with the trans-splicing factor Raa4 as a bait protein, we recently identified a multisubunit ribonucleoprotein (RNP) complex comprising the previously characterized trans-splicing factors Raa1, Raa3, Raa4, and Rat2 plus novel components. Raa1 and Rat2 share a structural motif, an octatricopeptide repeat (OPR), that presumably functions as an RNA interaction module. Two of the novel RNP complex components also exhibit a predicted OPR motif and were therefore considered potential trans-splicing factors. In this study, we selected bacterial artificial chromosome (BAC) clones encoding these OPR proteins and conducted functional complementation assays using previously generated trans-splicing mutants. Our assay revealed that the trans-splicing defect of mutant F19 was restored by a new factor we named RAA8; molecular characterization of complemented strains verified that Raa8 participates in splicing of the first psaA group II intron. Three of six OPR motifs are located in the C-terminal end of Raa8, which was shown to be essential for restoring psaA mRNA trans splicing. Our results support the important role played by OPR proteins in chloroplast RNA metabolism and also demonstrate that combining TAP and mass spectrometry with functional complementation studies represents a vigorous tool for identifying trans-splicing factors. PMID:26209695

  11. Intron Evolution in Saccharomycetaceae

    PubMed Central

    Hooks, Katarzyna B.; Delneri, Daniela; Griffiths-Jones, Sam


    Introns in protein-coding genes are very rare in hemiascomycetous yeast genomes. It has been suggested that these species have experienced extensive intron loss during their evolution from the postulated intron-rich fungal ancestor. However, no intron-devoid yeast species have been identified and some of the introns remaining within the genomes of intron-poor species, such as Saccharomyces cerevisiae, appear to be beneficial during growth under stress conditions. In order to reveal the pattern of intron retention within intron-poor yeast species and better understand the mechanisms of intron evolution, we generated a comprehensive set of 250 orthologous introns in the 20 species that comprise the Saccharomycetaceae, by analyzing RNA deep-sequencing data and alignments of intron-containing genes. Analysis of these intron sets shows that intron loss is at least two orders of magnitude more frequent than intron gain. Fine mapping of intron positions shows that intron sliding is rare, and that introns are almost always removed without changing the primary sequence of the encoded protein. The latter finding is consistent with the prevailing view that homologous recombination between reverse-transcribed mature mRNAs and the corresponding genomic locus is the primary mechanism of intron loss. However, we also find evidence that loss of a small number of introns is mediated by micro-homology, and that the number of intron losses is diminished in yeast species that have lost the microhomology end joining and nonhomologous end joining machinery. PMID:25364803

  12. Bioinformatics analysis of plant orthologous introns: identification of an intronic tRNA-like sequence.


    Akkuratov, Evgeny E; Walters, Lorraine; Saha-Mandal, Arnab; Khandekar, Sushant; Crawford, Erin; Zirbel, Craig L; Leisner, Scott; Prakash, Ashwin; Fedorova, Larisa; Fedorov, Alexei


    Orthologous introns have identical positions relative to the coding sequence in orthologous genes of different species. By analyzing the complete genomes of five plants we generated a database of 40,512 orthologous intron groups of dicotyledonous plants, 28,519 orthologous intron groups of angiosperms, and 15,726 of land plants (moss and angiosperms). Multiple sequence alignments of each orthologous intron group were obtained using the Mafft algorithm. The number of conserved regions in plant introns appeared to be hundreds of times fewer than that in mammals or vertebrates. Approximately three quarters of conserved intronic regions among angiosperms and dicots, in particular, correspond to alternatively-spliced exonic sequences. We registered only a handful of conserved intronic ncRNAs of flowering plants. However, the most evolutionarily conserved intronic region, which is ubiquitous for all plants examined in this study, including moss, possessed multiple structural features of tRNAs, which caused us to classify it as a putative tRNA-like ncRNA. Intronic sequences encoding tRNA-like structures are not unique to plants. Bioinformatics examination of the presence of tRNA inside introns revealed an unusually long-term association of four glycine tRNAs inside the Vac14 gene of fish, amniotes, and mammals. PMID:25014137

  13. Evolution of RNA-Protein Interactions: Non-Specific Binding Led to RNA Splicing Activity of Fungal Mitochondrial Tyrosyl-tRNA Synthetases

    PubMed Central

    Lamech, Lilian T.; Mallam, Anna L.; Lambowitz, Alan M.


    The Neurospora crassa mitochondrial tyrosyl-tRNA synthetase (mtTyrRS; CYT-18 protein) evolved a new function as a group I intron splicing factor by acquiring the ability to bind group I intron RNAs and stabilize their catalytically active RNA structure. Previous studies showed: (i) CYT-18 binds group I introns by using both its N-terminal catalytic domain and flexibly attached C-terminal anticodon-binding domain (CTD); and (ii) the catalytic domain binds group I introns specifically via multiple structural adaptations that occurred during or after the divergence of Peziomycotina and Saccharomycotina. However, the function of the CTD and how it contributed to the evolution of splicing activity have been unclear. Here, small angle X-ray scattering analysis of CYT-18 shows that both CTDs of the homodimeric protein extend outward from the catalytic domain, but move inward to bind opposite ends of a group I intron RNA. Biochemical assays show that the isolated CTD of CYT-18 binds RNAs non-specifically, possibly contributing to its interaction with the structurally different ends of the intron RNA. Finally, we find that the yeast mtTyrRS, which diverged from Pezizomycotina fungal mtTyrRSs prior to the evolution of splicing activity, binds group I intron and other RNAs non-specifically via its CTD, but lacks further adaptations needed for group I intron splicing. Our results suggest a scenario of constructive neutral (i.e., pre-adaptive) evolution in which an initial non-specific interaction between the CTD of an ancestral fungal mtTyrRS and a self-splicing group I intron was “fixed” by an intron RNA mutation that resulted in protein-dependent splicing. Once fixed, this interaction could be elaborated by further adaptive mutations in both the catalytic domain and CTD that enabled specific binding of group I introns. Our results highlight a role for non-specific RNA binding in the evolution of RNA-binding proteins. PMID:25536042

  14. Recursive splicing in long vertebrate genes.


    Sibley, Christopher R; Emmett, Warren; Blazquez, Lorea; Faro, Ana; Haberman, Nejc; Briese, Michael; Trabzuni, Daniah; Ryten, Mina; Weale, Michael E; Hardy, John; Modic, Miha; Curk, Tomaž; Wilson, Stephen W; Plagnol, Vincent; Ule, Jernej


    It is generally believed that splicing removes introns as single units from precursor messenger RNA transcripts. However, some long Drosophila melanogaster introns contain a cryptic site, known as a recursive splice site (RS-site), that enables a multi-step process of intron removal termed recursive splicing. The extent to which recursive splicing occurs in other species and its mechanistic basis have not been examined. Here we identify highly conserved RS-sites in genes expressed in the mammalian brain that encode proteins functioning in neuronal development. Moreover, the RS-sites are found in some of the longest introns across vertebrates. We find that vertebrate recursive splicing requires initial definition of an 'RS-exon' that follows the RS-site. The RS-exon is then excluded from the dominant mRNA isoform owing to competition with a reconstituted 5' splice site formed at the RS-site after the first splicing step. Conversely, the RS-exon is included when preceded by cryptic promoters or exons that fail to reconstitute an efficient 5' splice site. Most RS-exons contain a premature stop codon such that their inclusion can decrease mRNA stability. Thus, by establishing a binary splicing switch, RS-sites demarcate different mRNA isoforms emerging from long genes by coupling cryptic elements with inclusion of RS-exons. PMID:25970246

  15. Functional analysis of splicing mutations in the IDS gene and the use of antisense oligonucleotides to exploit an alternative therapy for MPS II.


    Matos, Liliana; Gonçalves, Vânia; Pinto, Eugénia; Laranjeira, Francisco; Prata, Maria João; Jordan, Peter; Desviat, Lourdes R; Pérez, Belén; Alves, Sandra


    Mucopolysaccharidosis II is a lysosomal storage disorder caused by mutations in the IDS gene, including exonic alterations associated with aberrant splicing. In the present work, cell-based splicing assays were performed to study the effects of two splicing mutations in exon 3 of IDS, i.e., c.241C>T and c.257C>T, whose presence activates a cryptic splice site in exon 3 and one in exon 8, i.e., c.1122C>T that despite being a synonymous mutation is responsible for the creation of a new splice site in exon 8 leading to a transcript shorter than usual. Mutant minigene analysis and overexpression assays revealed that SRSF2 and hnRNP E1 might be involved in the use and repression of the constitutive 3' splice site of exon 3 respectively. For the c.1122C>T the use of antisense therapy to correct the splicing defect was explored, but transfection of patient fibroblasts with antisense morpholino oligonucleotides (n=3) and a locked nucleic acid failed to abolish the abnormal transcript; indeed, it resulted in the appearance of yet another aberrant splicing product. Interestingly, the oligonucleotides transfection in control fibroblasts led to the appearance of the aberrant transcript observed in patients' cells after treatment, which shows that the oligonucleotides are masking an important cis-acting element for 5' splice site regulation of exon 8. These results highlight the importance of functional studies for understanding the pathogenic consequences of mis-splicing and highlight the difficulty in developing antisense therapies involving gene regions under complex splicing regulation. PMID:26407519

  16. Autocatalytic activities of intron 5 of the cob gene of yeast mitochondria.

    PubMed Central

    Partono, S; Lewin, A S


    The terminal intron of the mitochondrial cob gene of Saccharomyces cerevisiae can undergo autocatalytic splicing in vitro. Efficient splicing of this intron required a high concentration of monovalent ion (1 M). We found that at a high salt concentration this intron was very active and performed many of the reactions described for other group I introns. The rate of the splicing reaction was dependent on the choice of the monovalent ion; the reaction intermediate, the intron-3' exon molecule, accumulated in NH4Cl but not in KCl. In addition, the intron was more reactive in KCl, accumulating in two different circular forms: one cyclized at the 5' intron boundary and the other at 236 nucleotides from the 5' end. These circular forms were able to undergo the opening and recyclization reactions previously described for the Tetrahymena rRNA intron. Cleavage of the 5' exon-intron boundary by the addition of GTP did not require the 3' terminus of the intron and the downstream exon. An anomalous guanosine addition at the 3' exon and at the middle of the intron was also detected. Hence, this intron, which requires a functional protein to splice in vivo, demonstrated a full spectrum of characteristic reactions in the absence of proteins. Images PMID:3043183

  17. ERISdb: a database of plant splice sites and splicing signals.


    Szcześniak, Michał Wojciech; Kabza, Michał; Pokrzywa, Rafał; Gudyś, Adam; Makałowska, Izabela


    Splicing is one of the major contributors to observed spatiotemporal diversification of transcripts and proteins in metazoans. There are numerous factors that affect the process, but splice sites themselves along with the adjacent splicing signals are critical here. Unfortunately, there is still little known about splicing in plants and, consequently, further research in some fields of plant molecular biology will encounter difficulties. Keeping this in mind, we performed a large-scale analysis of splice sites in eight plant species, using novel algorithms and tools developed by us. The analyses included identification of orthologous splice sites, polypyrimidine tracts and branch sites. Additionally we identified putative intronic and exonic cis-regulatory motifs, U12 introns as well as splice sites in 45 microRNA genes in five plant species. We also provide experimental evidence for plant splice sites in the form of expressed sequence tag and RNA-Seq data. All the data are stored in a novel database called ERISdb and are freely available at PMID:23299413

  18. Intron gain by tandem genomic duplication: a novel case in a potato gene encoding RNA-dependent RNA polymerase.


    Ma, Ming-Yue; Lan, Xin-Ran; Niu, Deng-Ke


    The origin and subsequent accumulation of spliceosomal introns are prominent events in the evolution of eukaryotic gene structure. However, the mechanisms underlying intron gain remain unclear because there are few proven cases of recently gained introns. In an RNA-dependent RNA polymerase (RdRp) gene, we found that a tandem duplication occurred after the divergence of potato and its wild relatives among other Solanum plants. The duplicated sequence crosses the intron-exon boundary of the first intron and the second exon. A new intron was detected at this duplicated region, and it includes a small previously exonic segment of the upstream copy of the duplicated sequence and the intronic segment of the downstream copy of the duplicated sequence. The donor site of this new intron was directly obtained from the small previously exonic segment. Most of the splicing signals were inherited directly from the parental intron/exon structure, including a putative branch site, the polypyrimidine tract, the 3' splicing site, two putative exonic splicing enhancers, and the GC contents differed between the intron and exon. In the widely cited model of intron gain by tandem genomic duplication, the duplication of an AGGT-containing exonic segment provides the GT and AG splicing sites for the new intron. Our results illustrate that the tandem duplication model of intron gain should be diverse in terms of obtaining the proper splicing signals. PMID:27547574

  19. Intron gain by tandem genomic duplication: a novel case in a potato gene encoding RNA-dependent RNA polymerase

    PubMed Central

    Ma, Ming-Yue; Lan, Xin-Ran


    The origin and subsequent accumulation of spliceosomal introns are prominent events in the evolution of eukaryotic gene structure. However, the mechanisms underlying intron gain remain unclear because there are few proven cases of recently gained introns. In an RNA-dependent RNA polymerase (RdRp) gene, we found that a tandem duplication occurred after the divergence of potato and its wild relatives among other Solanum plants. The duplicated sequence crosses the intron-exon boundary of the first intron and the second exon. A new intron was detected at this duplicated region, and it includes a small previously exonic segment of the upstream copy of the duplicated sequence and the intronic segment of the downstream copy of the duplicated sequence. The donor site of this new intron was directly obtained from the small previously exonic segment. Most of the splicing signals were inherited directly from the parental intron/exon structure, including a putative branch site, the polypyrimidine tract, the 3′ splicing site, two putative exonic splicing enhancers, and the GC contents differed between the intron and exon. In the widely cited model of intron gain by tandem genomic duplication, the duplication of an AGGT-containing exonic segment provides the GT and AG splicing sites for the new intron. Our results illustrate that the tandem duplication model of intron gain should be diverse in terms of obtaining the proper splicing signals. PMID:27547574

  20. Reverse transcriptase and intron number evolution

    PubMed Central

    Kuo, Alan; Grigoriev, Igor V.


    Background Introns are universal in eukaryotic genomes and play important roles in transcriptional regulation, mRNA export to the cytoplasm, nonsense-mediated decay as both a regulatory and a splicing quality control mechanism, R-loop avoidance, alternative splicing, chromatin structure, and evolution by exon-shuffling. Methods Sixteen complete fungal genomes were used 13 of which were sequenced and annotated by JGI. Ustilago maydis, Cryptococcus neoformans, and Coprinus cinereus (also named Coprinopsis cinerea) were from the Broad Institute. Gene models from JGI-annotated genomes were taken from the GeneCatalog track that contained the best representative gene models. Varying fractions of the GeneCatalog were manually curated by external users. For clarity, we used the JGI unique database identifier. Results The last common ancestor of eukaryotes (LECA) has an estimated 6.4 coding exons per gene (EPG) and evolved into the diverse eukaryotic life forms, which is recapitulated by the development of a stem cell. We found a parallel between the simulated reverse transcriptase (RT)-mediated intron loss and the comparative analysis of 16 fungal genomes that spanned a wide range of intron density. Although footprints of RT (RTF) were dynamic, relative intron location (RIL) to the 5'-end of mRNA faithfully traced RT-mediated intron loss and revealed 7.7 EPG for LECA. The mode of exon length distribution was conserved in simulated intron loss, which was exemplified by the shared mode of 75 nt between fungal and Chlamydomonas genomes. The dominant ancient exon length was corroborated by the average exon length of the most intron-rich genes in fungal genomes and consistent with ancient protein modules being ~25 aa. Combined with the conservation of a protein length of 400 aa, the earliest ancestor of eukaryotes could have 16 EPG. During earlier evolution, Ascomycota’s ancestor had significantly more 3'-biased RT-mediated intron loss that was followed by dramatic RTF loss

  1. SplicingTypesAnno: annotating and quantifying alternative splicing events for RNA-Seq data.


    Sun, Xiaoyong; Zuo, Fenghua; Ru, Yuanbin; Guo, Jiqiang; Yan, Xiaoyan; Sablok, Gaurav


    Alternative splicing plays a key role in the regulation of the central dogma. Four major types of alternative splicing have been classified as intron retention, exon skipping, alternative 5 splice sites or alternative donor sites, and alternative 3 splice sites or alternative acceptor sites. A few algorithms have been developed to detect splice junctions from RNA-Seq reads. However, there are few tools targeting at the major alternative splicing types at the exon/intron level. This type of analysis may reveal subtle, yet important events of alternative splicing, and thus help gain deeper understanding of the mechanism of alternative splicing. This paper describes a user-friendly R package, extracting, annotating and analyzing alternative splicing types for sequence alignment files from RNA-Seq. SplicingTypesAnno can: (1) provide annotation for major alternative splicing at exon/intron level. By comparing the annotation from GTF/GFF file, it identifies the novel alternative splicing sites; (2) offer a convenient two-level analysis: genome-scale annotation for users with high performance computing environment, and gene-scale annotation for users with personal computers; (3) generate a user-friendly web report and additional BED files for IGV visualization. SplicingTypesAnno is a user-friendly R package for extracting, annotating and analyzing alternative splicing types at exon/intron level for sequence alignment files from RNA-Seq. It is publically available at or PMID:25720307

  2. TinII intron, an enhancer to affect the function of the cytoplasmic male sterility related gene T in Brassica juncea.


    Jin, ZhuPing; Wu, LingLing; Cao, JiaShu; Chen, ZhuJun; Pei, YanXi


    The T gene, which was cloned from the mitochondria of tumorous stem mustard (Brassica juncea var. tumida), is a cytoplasmic male sterility (CMS)-related gene that can produce two transcripts, T1170 and T1243. The latter is transcribed with the uncleaved intron TinII. In our previous study, transgenic Arabidopsis thaliana plants over-expressing the T1243 transcript (OE-T1243) showed a severe male-sterile phenotype, whereas OE-T1170 plants did not. However, the functional mechanism of the T gene in B. Juncea remained unknown. In this study, microscopic analyses of paraffin sections of anthers confirmed that OE-T1243 plants did not produce normal pollen, whereas OE-T1170 plants did. We analyzed the transcription of 15 anther development-related genes and found that transcript levels of nozzle/sporocyteless and barely any meristem 1 and 2 were markedly lower in OE-T1243 plants than those in wild type, while the transcript levels of these genes in OE-T1170 plants were unchanged. To investigate the potential roles of TinII, we inserted the TinII sequence upstream of a minimal region (-60) of the cauliflower mosaic virus 35S promoter fused to the 5' end of the β-glucuronidase (GUS) reporter gene. Analysis of the transgenic plants suggested that TinII acted as an enhancer to significantly increase GUS expression. The potential action mechanism is that the TinII intron acts as an enhancer to affect the function of the CMS-related gene T. PMID:24302291

  3. Identification of novel splicing variants from RON proto-oncogene pre-mRNA.


    Moon, Heegyum; Cho, Sunghee; Yang, Xiaoming; Zhou, Jianhua; Loh, Tiing Jen; Zheng, Xuexiu; Shen, Haihong


    RON is a proto-oncogene that induces cell dissociation, migration and matrix invasion. RON∆160, a splicing variant of RON, is a natural splicing product in colon cancers that is produced through skipping of exons 5 and 6 in alternative splicing process. RON∆160 promotes cellular transformation in vitro and tumor formation in vivo. We present, here, two novel splicing variants of RON in the partial splicing events that involve exons 5 and 6. The common facts of these two novel splicing variants are that exons 4-7 are included. In addition, intron 4 is spliced whereas intron 5 is included in both variants. The difference of these two isoforms is the inclusion or skipping of intron 6. In one variant intron 6 is included, but intron 6 is skipped in another variant. These two variants should be truncated but these proteins have not yet been detected. PMID:22993024

  4. MapSplice: Accurate mapping of RNA-seq reads for splice junction discovery

    PubMed Central

    Wang, Kai; Singh, Darshan; Zeng, Zheng; Coleman, Stephen J.; Huang, Yan; Savich, Gleb L.; He, Xiaping; Mieczkowski, Piotr; Grimm, Sara A.; Perou, Charles M.; MacLeod, James N.; Chiang, Derek Y.; Prins, Jan F.; Liu, Jinze


    The accurate mapping of reads that span splice junctions is a critical component of all analytic techniques that work with RNA-seq data. We introduce a second generation splice detection algorithm, MapSplice, whose focus is high sensitivity and specificity in the detection of splices as well as CPU and memory efficiency. MapSplice can be applied to both short (<75 bp) and long reads (≥75 bp). MapSplice is not dependent on splice site features or intron length, consequently it can detect novel canonical as well as non-canonical splices. MapSplice leverages the quality and diversity of read alignments of a given splice to increase accuracy. We demonstrate that MapSplice achieves higher sensitivity and specificity than TopHat and SpliceMap on a set of simulated RNA-seq data. Experimental studies also support the accuracy of the algorithm. Splice junctions derived from eight breast cancer RNA-seq datasets recapitulated the extensiveness of alternative splicing on a global level as well as the differences between molecular subtypes of breast cancer. These combined results indicate that MapSplice is a highly accurate algorithm for the alignment of RNA-seq reads to splice junctions. Software download URL: PMID:20802226

  5. MapSplice: accurate mapping of RNA-seq reads for splice junction discovery.


    Wang, Kai; Singh, Darshan; Zeng, Zheng; Coleman, Stephen J; Huang, Yan; Savich, Gleb L; He, Xiaping; Mieczkowski, Piotr; Grimm, Sara A; Perou, Charles M; MacLeod, James N; Chiang, Derek Y; Prins, Jan F; Liu, Jinze


    The accurate mapping of reads that span splice junctions is a critical component of all analytic techniques that work with RNA-seq data. We introduce a second generation splice detection algorithm, MapSplice, whose focus is high sensitivity and specificity in the detection of splices as well as CPU and memory efficiency. MapSplice can be applied to both short (<75 bp) and long reads (≥ 75 bp). MapSplice is not dependent on splice site features or intron length, consequently it can detect novel canonical as well as non-canonical splices. MapSplice leverages the quality and diversity of read alignments of a given splice to increase accuracy. We demonstrate that MapSplice achieves higher sensitivity and specificity than TopHat and SpliceMap on a set of simulated RNA-seq data. Experimental studies also support the accuracy of the algorithm. Splice junctions derived from eight breast cancer RNA-seq datasets recapitulated the extensiveness of alternative splicing on a global level as well as the differences between molecular subtypes of breast cancer. These combined results indicate that MapSplice is a highly accurate algorithm for the alignment of RNA-seq reads to splice junctions. Software download URL: PMID:20802226

  6. RNA splicing. The human splicing code reveals new insights into the genetic determinants of disease.


    Xiong, Hui Y; Alipanahi, Babak; Lee, Leo J; Bretschneider, Hannes; Merico, Daniele; Yuen, Ryan K C; Hua, Yimin; Gueroussov, Serge; Najafabadi, Hamed S; Hughes, Timothy R; Morris, Quaid; Barash, Yoseph; Krainer, Adrian R; Jojic, Nebojsa; Scherer, Stephen W; Blencowe, Benjamin J; Frey, Brendan J


    To facilitate precision medicine and whole-genome annotation, we developed a machine-learning technique that scores how strongly genetic variants affect RNA splicing, whose alteration contributes to many diseases. Analysis of more than 650,000 intronic and exonic variants revealed widespread patterns of mutation-driven aberrant splicing. Intronic disease mutations that are more than 30 nucleotides from any splice site alter splicing nine times as often as common variants, and missense exonic disease mutations that have the least impact on protein function are five times as likely as others to alter splicing. We detected tens of thousands of disease-causing mutations, including those involved in cancers and spinal muscular atrophy. Examination of intronic and exonic variants found using whole-genome sequencing of individuals with autism revealed misspliced genes with neurodevelopmental phenotypes. Our approach provides evidence for causal variants and should enable new discoveries in precision medicine. PMID:25525159

  7. The complete nucleotide sequence of the cassava (Manihot esculenta) chloroplast genome and the evolution of atpF in Malpighiales: RNA editing and multiple losses of a group II intron

    PubMed Central

    Wurdack, Kenneth J.; Kanagaraj, Anderson; Lee, Seung-Bum; Saski, Christopher; Jansen, Robert K.


    The complete sequence of the chloroplast genome of cassava (Manihot esculenta, Euphorbiaceae) has been determined. The genome is 161,453 bp in length and includes a pair of inverted repeats (IR) of 26,954 bp. The genome includes 128 genes; 96 are single copy and 16 are duplicated in the IR. There are four rRNA genes and 30 distinct tRNAs, seven of which are duplicated in the IR. The infA gene is absent; expansion of IRb has duplicated 62 amino acids at the 3′ end of rps19 and a number of coding regions have large insertions or deletions, including insertions within the 23S rRNA gene. There are 17 intron-containing genes in cassava, 15 of which have a single intron while two (clpP, ycf3) have two introns. The usually conserved atpF group II intron is absent and this is the first report of its loss from land plant chloroplast genomes. The phylogenetic distribution of the atpF intron loss was determined by a PCR survey of 251 taxa representing 34 families of Malpighiales and 16 taxa from closely related rosids. The atpF intron is not only missing in cassava but also from closely related Euphorbiaceae and other Malpighiales, suggesting that there have been at least seven independent losses. In cassava and all other sequenced Malphigiales, atpF gene sequences showed a strong association between C-to-T substitutions at nucleotide position 92 and the loss of the intron, suggesting that recombination between an edited mRNA and the atpF gene may be a possible mechanism for the intron loss. PMID:18214421

  8. Handling tRNA introns, archaeal way and eukaryotic way

    PubMed Central

    Yoshihisa, Tohru


    Introns are found in various tRNA genes in all the three kingdoms of life. Especially, archaeal and eukaryotic genomes are good sources of tRNA introns that are removed by proteinaceous splicing machinery. Most intron-containing tRNA genes both in archaea and eukaryotes possess an intron at a so-called canonical position, one nucleotide 3′ to their anticodon, while recent bioinformatics have revealed unusual types of tRNA introns and their derivatives especially in archaeal genomes. Gain and loss of tRNA introns during various stages of evolution are obvious both in archaea and eukaryotes from analyses of comparative genomics. The splicing of tRNA molecules has been studied extensively from biochemical and cell biological points of view, and such analyses of eukaryotic systems provided interesting findings in the past years. Here, I summarize recent progresses in the analyses of tRNA introns and the splicing process, and try to clarify new and old questions to be solved in the next stages. PMID:25071838

  9. Molecular characterization of MHC class II in the Australian invasive cane toad reveals multiple splice variants.


    Lillie, Mette; Cui, Jian; Shine, Richard; Belov, Katherine


    The cane toad has gained notoriety for its invasion across the Australian landscape, with significant impacts on the native Australian fauna. The invasion has accelerated over time, with invading cane toads adapted for highly dispersive traits. This, however, has come at the cost of the immune system, with lower investment in some immune functions. To investigate the cane toad's immunogenetics, we characterized four major histocompatibility complex (MHC) class IIA and three MHC class IIB loci. Preliminary observations suggest very low allelic diversity at all loci. We also observed various splice isoforms. One isoform seen at one class IIA and two class IIB loci was missing exon 2, which is essential to peptide binding and presentation. The other isoform, observed at a class IIA locus, is likely to be a soluble MHC product. These results may suggest a significant role of alternative splicing of MHC loci in the Australian cane toad. PMID:27233954

  10. Splicing mutations in glycogen-storage disease type II: evaluation of the full spectrum of mutations and their relation to patients' phenotypes

    PubMed Central

    Zampieri, Stefania; Buratti, Emanuele; Dominissini, Silvia; Montalvo, Anna Lisa; Pittis, Maria Gabriela; Bembi, Bruno; Dardis, Andrea


    Glycogen-storage disease type II is an autosomal recessive-inherited disorder due to the deficiency of acid α-glucosidase. A large number of mutations in the acid α-glucosidase gene have been described to date. Among them, ∼15% are variations that may affect mRNA splicing process. In this study, we have for the first time comprehensively reviewed the available information on splicing mutations of the acid α-glucosidase gene and we have evaluated their possible impact on the splicing process using different in silico approaches. Out of the 39 different GAA-sequence variations described, an in silico analysis using seven different programs showed that 97% of them are predicted to have an impact on the splicing process. Moreover, this analysis showed a quite good correlation between the impact of the mutation on the splicing process and the clinical phenotype. In addition, we have performed the functional characterization of three novel sequence variants found in Italian patients and still uncharacterized. Using a minigene system, we have confirmed their pathogenic nature. In conclusion, this study has shown that in silico analysis represents a useful tool to select mutations that affect the splicing process of the acid α-glucosidase gene and provides an updated picture of all this kind of mutations reported till now. PMID:21179066

  11. Coordinated tissue-specific regulation of adjacent alternative 3′ splice sites in C. elegans

    PubMed Central

    Ragle, James Matthew; Katzman, Sol; Akers, Taylor F.; Barberan-Soler, Sergio; Zahler, Alan M.


    Adjacent alternative 3′ splice sites, those separated by ≤18 nucleotides, provide a unique problem in the study of alternative splicing regulation; there is overlap of the cis-elements that define the adjacent sites. Identification of the intron's 3′ end depends upon sequence elements that define the branchpoint, polypyrimidine tract, and terminal AG dinucleotide. Starting with RNA-seq data from germline-enriched and somatic cell-enriched Caenorhabditis elegans samples, we identify hundreds of introns with adjacent alternative 3′ splice sites. We identify 203 events that undergo tissue-specific alternative splicing. For these, the regulation is monodirectional, with somatic cells preferring to splice at the distal 3′ splice site (furthest from the 5′ end of the intron) and germline cells showing a distinct shift toward usage of the adjacent proximal 3′ splice site (closer to the 5′ end of the intron). Splicing patterns in somatic cells follow C. elegans consensus rules of 3′ splice site definition; a short stretch of pyrimidines preceding an AG dinucleotide. Splicing in germline cells occurs at proximal 3′ splice sites that lack a preceding polypyrimidine tract, and in three instances the germline-specific site lacks the AG dinucleotide. We provide evidence that use of germline-specific proximal 3′ splice sites is conserved across Caenorhabditis species. We propose that there are differences between germline and somatic cells in the way that the basal splicing machinery functions to determine the intron terminus. PMID:25922281

  12. The genetics of splicing in neuroblastoma

    PubMed Central

    Chen, Justin; Hackett, Christopher S.; Zhang, Shile; Song, Young K.; Bell, Robert J.A.; Molinaro, Annette M.; Quigley, David A.; Balmain, Allan; Song, Jun S.; Costello, Joseph F.; Gustafson, W. Clay; Dyke, Terry Van; Kwok, Pui-Yan; Khan, Javed; Weiss, William A.


    Regulation of mRNA splicing, a critical and tightly regulated cellular function, underlies the majority of proteomic diversity, and is frequently disrupted in disease. Using an integrative genomics approach, we combined both genome and exon level transcriptome data in two somatic tissues (cerebella and peripheral ganglia) from a transgenic mouse model of neuroblastoma, a tumor that arises from peripheral neural crest. Here we describe splicing quantitative trait loci (sQTL) associated with differential splicing across the genome that we use to identify genes with previously unknown functions within the splicing pathway and to define de novo intronic splicing motifs that influence splicing from hundreds of bases away. Our results show that these splicing motifs represent sites for functional recurrent mutations and highlight novel candidate genes in human cancers, including childhood neuroblastoma. PMID:25637275

  13. A novel splice site mutation in the GNPTAB gene in an Iranian patient with mucolipidosis II α/β.


    Hashemi-Gorji, Feyzollah; Ghafouri-Fard, Soudeh; Salehpour, Shadab; Yassaee, Vahid Reza; Miryounesi, Mohammad


    Mucolipidosis type II α/β (ML II α/β) and mucolipidosis type III α/β (ML III α/β) have been shown to be caused by an absence or reduced level of uridine diphosphate (UDP)-N-acetylglucosamine-1-phosphotransferase enzyme (EC activity, respectively. Both disorders are caused by mutations in the GNPTAB gene and are inherited in an autosomal recessive manner. Here we report a 2-year-old female patient being diagnosed as a case of ML II α/β due to coarse face, severe developmental delay, multiple dysostosis, noticeable increase of multiple lysosomal enzymes activity in plasma and normal acid mucopolysaccharides in urine. Mutational analysis of the GNPTAB gene has revealed a novel homozygous mutation in the patient (c.3250-2A>G) with both parents being heterozygote. Transcript analyses showed that this novel splice site mutation leads to exon 17 skipping and a frameshift afterwards (p.P1084_R1112del F1113Vfs*1). Consequently, we confirmed the association of this mutation with ML II α/β. Our finding expands the number of reported cases of this rare metabolic disorder and adds to the GNPTAB mutation database. PMID:27180337

  14. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs.


    Zhang, Xiao-Ou; Dong, Rui; Zhang, Yang; Zhang, Jia-Lin; Luo, Zheng; Zhang, Jun; Chen, Ling-Ling; Yang, Li


    Circular RNAs (circRNAs) derived from back-spliced exons have been widely identified as being co-expressed with their linear counterparts. A single gene locus can produce multiple circRNAs through alternative back-splice site selection and/or alternative splice site selection; however, a detailed map of alternative back-splicing/splicing in circRNAs is lacking. Here, with the upgraded CIRCexplorer2 pipeline, we systematically annotated different types of alternative back-splicing and alternative splicing events in circRNAs from various cell lines. Compared with their linear cognate RNAs, circRNAs exhibited distinct patterns of alternative back-splicing and alternative splicing. Alternative back-splice site selection was correlated with the competition of putative RNA pairs across introns that bracket alternative back-splice sites. In addition, all four basic types of alternative splicing that have been identified in the (linear) mRNA process were found within circRNAs, and many exons were predominantly spliced in circRNAs. Unexpectedly, thousands of previously unannotated exons were detected in circRNAs from the examined cell lines. Although these novel exons had similar splice site strength, they were much less conserved than known exons in sequences. Finally, both alternative back-splicing and circRNA-predominant alternative splicing were highly diverse among the examined cell lines. All of the identified alternative back-splicing and alternative splicing in circRNAs are available in the CIRCpedia database ( Collectively, the annotation of alternative back-splicing and alternative splicing in circRNAs provides a valuable resource for depicting the complexity of circRNA biogenesis and for studying the potential functions of circRNAs in different cells. PMID:27365365

  15. Selection for reduced translation costs at the intronic 5′ end in fungi

    PubMed Central

    Zafrir, Zohar; Zur, Hadas; Tuller, Tamir


    It is generally believed that introns are not translated; therefore, the potential intronic features that may be related to the translation step (occurring after splicing) have yet to be thoroughly studied. Here, focusing on four fungi, we performed for the first time a comprehensive study aimed at characterizing how translation efficiency is encoded in introns and affects their evolution. By analysing their intronome we provide evidence of selection for STOP codons close to the intronic 5′ end, and show that the beginning of introns are selected for significantly high translation, presumably to reduce translation and metabolic costs in cases of non-spliced introns. Ribosomal profiling data analysis in Saccharomyces cerevisiae supports the conjecture that in this organism intron retention frequently occurs, introns are partially translated, and their translation efficiency affects organismal fitness. We show that the reported results are more significant in highly translated and highly spliced genes, but are not associated only with genes with a specific function. We also discuss the potential relation of the reported signals to efficient nonsense-mediated decay due to splicing errors. These new discoveries are supported by population-genetics considerations. In addition, they are contributory steps towards a broader understanding of intron evolution and the effect of silent mutations on gene expression and organismal fitness. PMID:27260512

  16. Autogenous Regulation of Splicing of the Transcript of a Yeast Ribosomal Protein Gene

    NASA Astrophysics Data System (ADS)

    Dabeva, Mariana D.; Post-Beittenmiller, Martha A.; Warner, Jonathan R.


    The gene for a yeast ribosomal protein, RPL32, contains a single intron. The product of this gene appears to participate in feedback control of the splicing of the intron from the transcript. This autogenous regulation of splicing provides a striking analogy to the autogenous regulation of translation of ribosomal proteins in Escherichia coli.

  17. PRMT9 is a Type II methyltransferase that methylates the splicing factor SAP145

    PubMed Central

    Yang, Yanzhong; Hadjikyriacou, Andrea; Xia, Zheng; Gayatri, Sitaram; Kim, Daehoon; Zurita-Lopez, Cecilia; Kelly, Ryan; Guo, Ailan; Li, Wei; Clarke, Steven G.; Bedford, Mark T.


    The human genome encodes a family of nine protein arginine methyltransferases (PRMT1-9), which members can catalyze three distinct types of methylation on arginine residues. Here, we identify two spliceosome-associated proteins – SAP145 and SAP49 – as PRMT9 binding partners, linking PRMT9 to U2snRNP maturation. We show that SAP145 is methylated by PRMT9 at arginine 508, which takes the form of monomethylated arginine (MMA) and symmetrically dimethylated arginine (SDMA). PRMT9 thus joins PRMT5 as the only mammalian enzymes capable of depositing the SDMA mark. Methylation of SAP145 on Arg508 generates a binding site for the Tudor domain of the Survival of Motor Neuron (SMN) protein, and RNA-seq analysis reveals gross splicing changes when PRMT9 levels are attenuated. These results identify PRMT9 as a non-histone methyltransferase that primes the U2snRNP for interaction with SMN. PMID:25737013

  18. Widespread alternative and aberrant splicing revealed by lariat sequencing

    PubMed Central

    Stepankiw, Nicholas; Raghavan, Madhura; Fogarty, Elizabeth A.; Grimson, Andrew; Pleiss, Jeffrey A.


    Alternative splicing is an important and ancient feature of eukaryotic gene structure, the existence of which has likely facilitated eukaryotic proteome expansions. Here, we have used intron lariat sequencing to generate a comprehensive profile of splicing events in Schizosaccharomyces pombe, amongst the simplest organisms that possess mammalian-like splice site degeneracy. We reveal an unprecedented level of alternative splicing, including alternative splice site selection for over half of all annotated introns, hundreds of novel exon-skipping events, and thousands of novel introns. Moreover, the frequency of these events is far higher than previous estimates, with alternative splice sites on average activated at ∼3% the rate of canonical sites. Although a subset of alternative sites are conserved in related species, implying functional potential, the majority are not detectably conserved. Interestingly, the rate of aberrant splicing is inversely related to expression level, with lowly expressed genes more prone to erroneous splicing. Although we validate many events with RNAseq, the proportion of alternative splicing discovered with lariat sequencing is far greater, a difference we attribute to preferential decay of aberrantly spliced transcripts. Together, these data suggest the spliceosome possesses far lower fidelity than previously appreciated, highlighting the potential contributions of alternative splicing in generating novel gene structures. PMID:26261211

  19. Quantification of pre-mRNA escape rate and synergy in splicing

    PubMed Central

    Bonde, Marie Mi; Voegeli, Sylvia; Baudrimont, Antoine; Séraphin, Bertrand; Becskei, Attila


    Splicing reactions generally combine high speed with accuracy. However, some of the pre-mRNAs escape the nucleus with a retained intron. Intron retention can control gene expression and increase proteome diversity. We calculated the escape rate for the yeast PTC7 intron and pre-mRNA. This prediction was facilitated by the observation that splicing is a linear process and by deriving simple algebraic expressions from a model of co- and post-transcriptional splicing and RNA surveillance that determines the rate of the nonsense-mediated decay (NMD) of the pre-mRNAs with the retained intron. The escape rate was consistent with the observed threshold of splicing rate below which the mature mRNA level declined. When an mRNA contains multiple introns, the outcome of splicing becomes more difficult to predict since not only the escape rate of the pre-mRNA has to be considered, but also the possibility that the splicing of each intron is influenced by the others. We showed that the two adjacent introns in the SUS1 mRNA are spliced cooperatively, but this does not counteract the escape of the partially spliced mRNA. These findings will help to infer promoter activity and to predict the behavior of and to control splicing regulatory networks. PMID:25352554

  20. Quantification of pre-mRNA escape rate and synergy in splicing.


    Bonde, Marie Mi; Voegeli, Sylvia; Baudrimont, Antoine; Séraphin, Bertrand; Becskei, Attila


    Splicing reactions generally combine high speed with accuracy. However, some of the pre-mRNAs escape the nucleus with a retained intron. Intron retention can control gene expression and increase proteome diversity. We calculated the escape rate for the yeast PTC7 intron and pre-mRNA. This prediction was facilitated by the observation that splicing is a linear process and by deriving simple algebraic expressions from a model of co- and post-transcriptional splicing and RNA surveillance that determines the rate of the nonsense-mediated decay (NMD) of the pre-mRNAs with the retained intron. The escape rate was consistent with the observed threshold of splicing rate below which the mature mRNA level declined. When an mRNA contains multiple introns, the outcome of splicing becomes more difficult to predict since not only the escape rate of the pre-mRNA has to be considered, but also the possibility that the splicing of each intron is influenced by the others. We showed that the two adjacent introns in the SUS1 mRNA are spliced cooperatively, but this does not counteract the escape of the partially spliced mRNA. These findings will help to infer promoter activity and to predict the behavior of and to control splicing regulatory networks. PMID:25352554

  1. Position-dependent splicing activation and repression by SR and hnRNP proteins rely on common mechanisms

    PubMed Central

    Erkelenz, Steffen; Mueller, William F.; Evans, Melanie S.; Busch, Anke; Schöneweis, Katrin; Hertel, Klemens J.; Schaal, Heiner


    Alternative splicing is regulated by splicing factors that modulate splice site selection. In some cases, however, splicing factors show antagonistic activities by either activating or repressing splicing. Here, we show that these opposing outcomes are based on their binding location relative to regulated 5′ splice sites. SR proteins enhance splicing only when they are recruited to the exon. However, they interfere with splicing by simply relocating them to the opposite intronic side of the splice site. hnRNP splicing factors display analogous opposing activities, but in a reversed position dependence. Activation by SR or hnRNP proteins increases splice site recognition at the earliest steps of exon definition, whereas splicing repression promotes the assembly of nonproductive complexes that arrest spliceosome assembly prior to splice site pairing. Thus, SR and hnRNP splicing factors exploit similar mechanisms to positively or negatively influence splice site selection. PMID:23175589

  2. Invasion of protein coding genes by green algal ribosomal group I introns.


    McManus, Hilary A; Lewis, Louise A; Fučíková, Karolina; Haugen, Peik


    The spread of group I introns depends on their association with intron-encoded homing endonucleases. Introns that encode functional homing endonuclease genes (HEGs) are highly invasive, whereas introns that only encode the group I ribozyme responsible for self-splicing are generally stably inherited (i.e., vertical inheritance). A number of recent case studies have provided new knowledge on the evolution of group I introns, however, there are still large gaps in understanding of their distribution on the tree of life, and how they have spread into new hosts and genic sites. During a larger phylogenetic survey of chlorophyceaen green algae, we found that 23 isolates contain at least one group I intron in the rbcL chloroplast gene. Structural analyses show that the introns belong to one of two intron lineages, group IA2 intron-HEG (GIY-YIG family) elements inserted after position 462 in the rbcL gene, and group IA1 introns inserted after position 699. The latter intron type sometimes encodes HNH homing endonucleases. The distribution of introns was analyzed on an exon phylogeny and patterns were recovered that are consistent with vertical inheritance and possible horizontal transfer. The rbcL 462 introns are thus far reported only within the Volvocales, Hydrodictyaceae and Bracteacoccus, and closely related isolates of algae differ in the presence of rbcL introns. Phylogenetic analysis of the intron conserved regions indicates that the rbcL699 and rbcL462 introns have distinct evolutionary origins. The rbcL699 introns were likely derived from ribosomal RNA L2449 introns, whereas the rbcL462 introns form a close relationship with psbA introns. PMID:22056605

  3. Structure and conformational dynamics of the domain 5 RNA hairpin of a bacterial group II intron revealed by solution nuclear magnetic resonance and molecular dynamics simulations.


    Pechlaner, Maria; Sigel, Roland K O; van Gunsteren, Wilfred F; Dolenc, Jožica


    Nuclear magnetic resonance (NMR) nuclear Overhauser enhancement (NOE) data obtained for a 35-nucleotide RNA segment of a bacterial group II intron indicate a helical hairpin structure in which three parts, a terminal pentaloop, a bulge, and a G-A mismatch, display no Watson-Crick base pairing. The 668 NOE upper distance bounds for atom pairs are insufficient to uniquely determine the conformation of these segments. Therefore, molecular dynamics simulations including time-averaged distance restraints have been used to obtain a conformational ensemble compatible with the observed NMR data. The ensemble shows alternating hydrogen bonding patterns for the mentioned segments. In particular, in the pentaloop and in the bulge, the hydrogen bonding networks correspond to distinct conformational clusters that could not be captured by using conventional single-structure refinement techniques. This implies that, to obtain a realistic picture of the conformational ensemble of such flexible biomolecules, it is necessary to properly account for the conformational variability in the structure refinement of RNA fragments. PMID:24001362

  4. The Pentatricopeptide Repeat Proteins TANG2 and ORGANELLE TRANSCRIPT PROCESSING439 Are Involved in the Splicing of the Multipartite nad5 Transcript Encoding a Subunit of Mitochondrial Complex I1[W][OPEN

    PubMed Central

    Colas des Francs-Small, Catherine; Falcon de Longevialle, Andéol; Li, Yunhai; Lowe, Elizabeth; Tanz, Sandra K.; Smith, Caroline; Bevan, Michael W.; Small, Ian


    Pentatricopeptide repeat proteins constitute a large family of RNA-binding proteins in higher plants (around 450 genes in Arabidopsis [Arabidopsis thaliana]), mostly targeted to chloroplasts and mitochondria. Many of them are involved in organelle posttranscriptional processes, in a very specific manner. Splicing is necessary to remove the group II introns, which interrupt the coding sequences of several genes encoding components of the mitochondrial respiratory chain. The nad5 gene is fragmented in five exons, belonging to three distinct transcription units. Its maturation requires two cis- and two trans-splicing events. These steps need to be performed in a very precise order to generate a functional transcript. Here, we characterize two pentatricopeptide repeat proteins, ORGANELLE TRANSCRIPT PROCESSING439 and TANG2, and show that they are involved in the removal of nad5 introns 2 and 3, respectively. To our knowledge, they are the first two specific nad5 splicing factors found in plants so far. PMID:24958715

  5. The Pentatricopeptide Repeat Proteins TANG2 and ORGANELLE TRANSCRIPT PROCESSING439 Are Involved in the Splicing of the Multipartite nad5 Transcript Encoding a Subunit of Mitochondrial Complex I.


    Colas des Francs-Small, Catherine; Falcon de Longevialle, Andéol; Li, Yunhai; Lowe, Elizabeth; Tanz, Sandra K; Smith, Caroline; Bevan, Michael W; Small, Ian


    Pentatricopeptide repeat proteins constitute a large family of RNA-binding proteins in higher plants (around 450 genes in Arabidopsis [Arabidopsis thaliana]), mostly targeted to chloroplasts and mitochondria. Many of them are involved in organelle posttranscriptional processes, in a very specific manner. Splicing is necessary to remove the group II introns, which interrupt the coding sequences of several genes encoding components of the mitochondrial respiratory chain. The nad5 gene is fragmented in five exons, belonging to three distinct transcription units. Its maturation requires two cis- and two trans-splicing events. These steps need to be performed in a very precise order to generate a functional transcript. Here, we characterize two pentatricopeptide repeat proteins, ORGANELLE TRANSCRIPT PROCESSING439 and TANG2, and show that they are involved in the removal of nad5 introns 2 and 3, respectively. To our knowledge, they are the first two specific nad5 splicing factors found in plants so far. PMID:24958715

  6. Split-Intron Retroviral Vectors: Enhanced Expression with Improved Safety

    PubMed Central

    Ismail, Said I.; Kingsman, Susan M.; Kingsman, Alan J.; Uden, Mark


    The inclusion of retrovirus-derived introns within retrovirus-based expression vectors leads to a fraction of the resulting transcripts being spliced. Such splicing has been shown to markedly improve expression (W. J. Krall et al., Gene Ther. 3:37–48, 1996). One way to improve upon this still further might involve the use of more efficient introns instead of those from the provirus. Currently, however, incorporation of such introns remains self-defeating since they are removed in the nucleus of the producer cell. In the past, elaborate ways to overcome this problem have included the use of alphaviruses to make the vector transcripts within the cytoplasm, thus avoiding the nuclear splicing machinery during vector production (K. J. Li and H. Garoff, Proc. Natl. Acad. Sci. USA 95:3650–3654, 1998). We now present a novel design for the inclusion of introns within a retroviral vector. In essence, this is achieved by exploiting the retroviral replication process to copy not only the U3 promoter but also a synthetic splice donor to the 5′-long-terminal-repeat position during reverse transcription. Once copied, synthesized transcripts then contain a splice donor at their 5′ end capable of interacting with a consensus splice acceptor engineered downstream of the packaging signal. Upon transduction, we demonstrate these vectors to produce enhanced expression from near fully spliced (and thus packaging signal minus) transcripts. The unique design of these high titer and high-expression retroviral vectors may be of use in a number of gene therapy applications. PMID:10666267

  7. Split-intron retroviral vectors: enhanced expression with improved safety.


    Ismail, S I; Kingsman, S M; Kingsman, A J; Uden, M


    The inclusion of retrovirus-derived introns within retrovirus-based expression vectors leads to a fraction of the resulting transcripts being spliced. Such splicing has been shown to markedly improve expression (W. J. Krall et al., Gene Ther. 3:37-48, 1996). One way to improve upon this still further might involve the use of more efficient introns instead of those from the provirus. Currently, however, incorporation of such introns remains self-defeating since they are removed in the nucleus of the producer cell. In the past, elaborate ways to overcome this problem have included the use of alphaviruses to make the vector transcripts within the cytoplasm, thus avoiding the nuclear splicing machinery during vector production (K. J. Li and H. Garoff, Proc. Natl. Acad. Sci. USA 95:3650-3654, 1998). We now present a novel design for the inclusion of introns within a retroviral vector. In essence, this is achieved by exploiting the retroviral replication process to copy not only the U3 promoter but also a synthetic splice donor to the 5'-long-terminal-repeat position during reverse transcription. Once copied, synthesized transcripts then contain a splice donor at their 5' end capable of interacting with a consensus splice acceptor engineered downstream of the packaging signal. Upon transduction, we demonstrate these vectors to produce enhanced expression from near fully spliced (and thus packaging signal minus) transcripts. The unique design of these high titer and high-expression retroviral vectors may be of use in a number of gene therapy applications. PMID:10666267

  8. Functional comparison of three transformer gene introns regulating conditional female lethality

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The trasformer gene plays a critical role in the sex determination pathways of many insects. We cloned two transformer gene introns from Anastrepha suspensa, the Caribbean fruit fly. These introns have sequences that putatively have a role in sex-specific splicing patterns that affect sex determinat...

  9. Global analysis of the nuclear processing of transcripts with unspliced U12-type introns by the exosome.


    Niemelä, Elina H; Oghabian, Ali; Staals, Raymond H J; Greco, Dario; Pruijn, Ger J M; Frilander, Mikko J


    U12-type introns are a rare class of introns in the genomes of diverse eukaryotes. In the human genome, they number over 700. A subset of these introns has been shown to be spliced at a slower rate compared to the major U2-type introns. This suggests a rate-limiting regulatory function for the minor spliceosome in the processing of transcripts containing U12-type introns. However, both the generality of slower splicing and the subsequent fate of partially processed pre-mRNAs remained unknown. Here, we present a global analysis of the nuclear retention of transcripts containing U12-type introns and provide evidence for the nuclear decay of such transcripts in human cells. Using SOLiD RNA sequencing technology, we find that, in normal cells, U12-type introns are on average 2-fold more retained than the surrounding U2-type introns. Furthermore, we find that knockdown of RRP41 and DIS3 subunits of the exosome stabilizes an overlapping set of U12-type introns. RRP41 knockdown leads to slower decay kinetics of U12-type introns and globally upregulates the retention of U12-type, but not U2-type, introns. Our results indicate that U12-type introns are spliced less efficiently and are targeted by the exosome. These characteristics support their role in the regulation of cellular mRNA levels. PMID:24848017

  10. SNPlice: variants that modulate Intron retention from RNA-sequencing data

    PubMed Central

    Movassagh, Mercedeh; Kowsari, Kamran; Seyfi, Ali; Kokkinaki, Maria; Edwards, Nathan J.; Golestaneh, Nady; Horvath, Anelia


    Rationale: The growing recognition of the importance of splicing, together with rapidly accumulating RNA-sequencing data, demand robust high-throughput approaches, which efficiently analyze experimentally derived whole-transcriptome splice profiles. Results: We have developed a computational approach, called SNPlice, for identifying cis-acting, splice-modulating variants from RNA-seq datasets. SNPlice mines RNA-seq datasets to find reads that span single-nucleotide variant (SNV) loci and nearby splice junctions, assessing the co-occurrence of variants and molecules that remain unspliced at nearby exon–intron boundaries. Hence, SNPlice highlights variants preferentially occurring on intron-containing molecules, possibly resulting from altered splicing. To illustrate co-occurrence of variant nucleotide and exon–intron boundary, allele-specific sequencing was used. SNPlice results are generally consistent with splice-prediction tools, but also indicate splice-modulating elements missed by other algorithms. SNPlice can be applied to identify variants that correlate with unexpected splicing events, and to measure the splice-modulating potential of canonical splice-site SNVs. Availability and implementation: SNPlice is freely available for download from as a self-contained binary package for 64-bit Linux computers and as python source-code. Contact: or Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25481010

  11. Regulation of Telomerase Alternative Splicing: A New Target for Chemotherapy

    PubMed Central

    Wong, Mandy S.; Chen, Ling; Foster, Christopher; Kainthla, Radhika; Shay, Jerry W.; Wright, Woodring E.


    SUMMARY Telomerase is present in human cancer cells but absent in most somatic tissues. The mRNA of human telomerase (hTERT) is alternatively spliced into mostly non-functional products. We sought to understand splicing so we could decrease functional splice isoforms to reduce telomerase activity to complement direct enzyme inhibition. Unexpectedly, minigenes containing hTERT exons 5–10 flanked by 150–300bp intronic sequences did not produce alternative splicing. A 1.1kb region of 38bp repeats ~2kb from the exon 6/intron junction restored exclusion of exons 7/8. An element within intron 8, also >1kb from intron/exon junctions, modulated this effect. Transducing an oligonucleotide complementary to this second element increased non-functional hTERT mRNA from endogenous telomerase. These results demonstrate the potential of manipulating hTERT splicing for both chemotherapy and regenerative medicine, and provide the first specific sequences deep within introns that regulate alternative splicing in mammalian cells by mechanisms other than introducing cryptic splice sites. PMID:23562158

  12. In vitro splicing of fibronectin pre-mRNAs.

    PubMed Central

    Norton, P A; Hynes, R O


    We have investigated the alternative splicing of the EIIIB exon of the rat fibronectin gene. Mini-gene constructs containing this exon and portions of adjacent introns and exons, when transfected into HeLa cells, are transcribed and spliced, but omit the EIIIB exon. In vitro, HeLa nuclear extracts similarly splice out (skip) the EIIIB exon from similarly structured transcripts. Therefore, the HeLa splicing apparatus recognizes as atypical the EIIIB exon and its flanking intron sequences, both in vivo and in vitro. We also report that alterations in the ionic conditions of the in vitro splicing reaction can promote the initiation of EIIIB exon inclusion, as reflected by the formation of intermediate and product RNAs related to the removal of the intron upstream of EIIIB. Processing of this intron correlates with the formation of complexes resembling intermediates in spliceosome assembly. The branch sites involved in this alternative processing pathway are rather distant from the EIIIB 3' splice site, and lie within a region which is well conserved in the fibronectin genes of other species. Thus, the intron upstream of EIIIB shows singular structure and behavior which probably have a bearing on the regulated alternative splicing of this exon. Images PMID:2377454

  13. Involvement of the nuclear cap-binding protein complex in alternative splicing in Arabidopsis thaliana

    PubMed Central

    Raczynska, Katarzyna Dorota; Simpson, Craig G.; Ciesiolka, Adam; Szewc, Lukasz; Lewandowska, Dominika; McNicol, Jim; Szweykowska-Kulinska, Zofia; Brown, John W. S.; Jarmolowski, Artur


    The nuclear cap-binding protein complex (CBC) participates in 5′ splice site selection of introns that are proximal to the mRNA cap. However, it is not known whether CBC has a role in alternative splicing. Using an RT–PCR alternative splicing panel, we analysed 435 alternative splicing events in Arabidopsis thaliana genes, encoding mainly transcription factors, splicing factors and stress-related proteins. Splicing profiles were determined in wild type plants, the cbp20 and cbp80(abh1) single mutants and the cbp20/80 double mutant. The alternative splicing events included alternative 5′ and 3′ splice site selection, exon skipping and intron retention. Significant changes in the ratios of alternative splicing isoforms were found in 101 genes. Of these, 41% were common to all three CBC mutants and 15% were observed only in the double mutant. The cbp80(abh1) and cbp20/80 mutants had many more changes in alternative splicing in common than did cbp20 and cbp20/80 suggesting that CBP80 plays a more significant role in alternative splicing than CBP20, probably being a platform for interactions with other splicing factors. Cap-binding proteins and the CBC are therefore directly involved in alternative splicing of some Arabidopsis genes and in most cases influenced alternative splicing of the first intron, particularly at the 5′ splice site. PMID:19864257

  14. Intron retention-dependent gene regulation in Cryptococcus neoformans

    PubMed Central

    Gonzalez-Hilarion, Sara; Paulet, Damien; Lee, Kyung-Tae; Hon, Chung-Chau; Lechat, Pierre; Mogensen, Estelle; Moyrand, Frédérique; Proux, Caroline; Barboux, Rony; Bussotti, Giovanni; Hwang, Jungwook; Coppée, Jean-Yves; Bahn, Yong-Sun; Janbon, Guilhem


    The biological impact of alternative splicing is poorly understood in fungi, although recent studies have shown that these microorganisms are usually intron-rich. In this study, we re-annotated the genome of C. neoformans var. neoformans using RNA-Seq data. Comparison with C. neoformans var. grubii revealed that more than 99% of ORF-introns are in the same exact position in the two varieties whereas UTR-introns are much less evolutionary conserved. We also confirmed that alternative splicing is very common in C. neoformans, affecting nearly all expressed genes. We also observed specific regulation of alternative splicing by environmental cues in this yeast. However, alternative splicing does not appear to be an efficient method to diversify the C. neoformans proteome. Instead, our data suggest the existence of an intron retention-dependent mechanism of gene expression regulation that is not dependent on NMD. This regulatory process represents an additional layer of gene expression regulation in fungi and provides a mechanism to tune gene expression levels in response to any environmental modification. PMID:27577684

  15. Intron retention-dependent gene regulation in Cryptococcus neoformans.


    Gonzalez-Hilarion, Sara; Paulet, Damien; Lee, Kyung-Tae; Hon, Chung-Chau; Lechat, Pierre; Mogensen, Estelle; Moyrand, Frédérique; Proux, Caroline; Barboux, Rony; Bussotti, Giovanni; Hwang, Jungwook; Coppée, Jean-Yves; Bahn, Yong-Sun; Janbon, Guilhem


    The biological impact of alternative splicing is poorly understood in fungi, although recent studies have shown that these microorganisms are usually intron-rich. In this study, we re-annotated the genome of C. neoformans var. neoformans using RNA-Seq data. Comparison with C. neoformans var. grubii revealed that more than 99% of ORF-introns are in the same exact position in the two varieties whereas UTR-introns are much less evolutionary conserved. We also confirmed that alternative splicing is very common in C. neoformans, affecting nearly all expressed genes. We also observed specific regulation of alternative splicing by environmental cues in this yeast. However, alternative splicing does not appear to be an efficient method to diversify the C. neoformans proteome. Instead, our data suggest the existence of an intron retention-dependent mechanism of gene expression regulation that is not dependent on NMD. This regulatory process represents an additional layer of gene expression regulation in fungi and provides a mechanism to tune gene expression levels in response to any environmental modification. PMID:27577684

  16. Module-intron correlation and intron sliding in family F/10 xylanase genes.


    Sato, Y; Niimura, Y; Yura, K; Go, M


    Xylanases are classified into two families, numbered F/10 and G/11 according to the similarity of amino acid sequences of their catalytic domain (Henrissat, B., Bairoch, A., 1993. New families in the classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem. J. 293, 781-788). Three-dimensional structure of the catalytic domain of the family F/10 xylanase was reported (White, A., Withers, S.G., Gilkes, N.R., Rose, D.R., 1994. Crystal structure of the catalytic domain of the beta-1,4-glycanase Cex from Cellulomonas fimi. Biochemistry 33, 12546-12552). The domain was decomposed into 22 modules by centripetal profiles (Go, M., Nosaka, M., 1987. Protein architecture and the origin of introns. Cold Spring Harbor Symp. Quant. Biol. 52, 915-924; Noguti, T., Sakakibara, H., Go, M., 1993. Localization of hydrogen-bonds within modules in barnase. Proteins 16, 357-363). A module is a contiguous polypeptide segment of amino acid residues having a compact conformation within a globular domain. Collected 31 intron sites of the family F/10 xylanase genes from fungus were found to be correlated to module boundaries with considerable statistical force (p values <0.001). The relationship between the intron locations and protein structures provides supporting evidence for the ancient origin of introns, because such a relationship cannot be expected by random insertion of introns into eukaryotic genes, but it rather suggests pre-existence of introns in the ancestral genes of prokaryotes and eukaryotes. A phylogenetic tree of the fungal and bacterial xylanase sequences made two clusters; one includes both the bacterial and fungal genes, but the other consists of only fungal genes. The mixed cluster of bacterial genes without introns and the fungal genes with introns further supports the ancient origin of introns. Comparison of the conserved base sequences of introns indicates that sliding of a splice site occurred in Aspergillus kawachii gene by one base

  17. The exon junction complex is required for definition and excision of neighboring introns in Drosophila

    PubMed Central

    Hayashi, Rippei; Handler, Dominik; Ish-Horowicz, David


    Splicing of pre-mRNAs results in the deposition of the exon junction complex (EJC) upstream of exon–exon boundaries. The EJC plays crucial post-splicing roles in export, translation, localization, and nonsense-mediated decay of mRNAs. It also aids faithful splicing of pre-mRNAs containing large introns, albeit via an unknown mechanism. Here, we show that the core EJC plus the accessory factors RnpS1 and Acinus aid in definition and efficient splicing of neighboring introns. This requires prior deposition of the EJC in close proximity to either an upstream or downstream splicing event. If present in isolation, EJC-dependent introns are splicing-defective also in wild-type cells. Interestingly, the most affected intron belongs to the piwi locus, which explains the reported transposon desilencing in EJC-depleted Drosophila ovaries. Based on a transcriptome-wide analysis, we propose that the dependency of splicing on the EJC is exploited as a means to control the temporal order of splicing events. PMID:25081352

  18. A general role for splicing enhancers in exon definition.

    PubMed Central

    Lam, Bianca J; Hertel, Klemens J


    Exonic splicing enhancers (ESEs) facilitate exon definition by assisting in the recruitment of splicing factors to the adjacent intron. Here we demonstrate that suboptimal 5' and 3' splice sites are activated independently by ESEs when they are located on different exons. However, when they are situated within a single exon, the same weak 5' and 3' splice sites are activated simultaneously by a single ESE. These findings demonstrate that a single ESE promotes the recognition of both exon/intron junctions within the same step during exon definition. Our results suggest that ESEs recruit a multicomponent complex that minimally contains components of the splicing machinery required for 5' and 3' splice site selection. PMID:12403462

  19. Unmasking alternative splicing inside protein-coding exons defines exitrons and their role in proteome plasticity.


    Marquez, Yamile; Höpfler, Markus; Ayatollahi, Zahra; Barta, Andrea; Kalyna, Maria


    Alternative splicing (AS) diversifies transcriptomes and proteomes and is widely recognized as a key mechanism for regulating gene expression. Previously, in an analysis of intron retention events in Arabidopsis, we found unusual AS events inside annotated protein-coding exons. Here, we also identify such AS events in human and use these two sets to analyse their features, regulation, functional impact, and evolutionary origin. As these events involve introns with features of both introns and protein-coding exons, we name them exitrons (exonic introns). Though exitrons were detected as a subset of retained introns, they are clearly distinguishable, and their splicing results in transcripts with different fates. About half of the 1002 Arabidopsis and 923 human exitrons have sizes of multiples of 3 nucleotides (nt). Splicing of these exitrons results in internally deleted proteins and affects protein domains, disordered regions, and various post-translational modification sites, thus broadly impacting protein function. Exitron splicing is regulated across tissues, in response to stress and in carcinogenesis. Intriguingly, annotated intronless genes can be also alternatively spliced via exitron usage. We demonstrate that at least some exitrons originate from ancestral coding exons. Based on our findings, we propose a "splicing memory" hypothesis whereby upon intron loss imprints of former exon borders defined by vestigial splicing regulatory elements could drive the evolution of exitron splicing. Altogether, our studies show that exitron splicing is a conserved strategy for increasing proteome plasticity in plants and animals, complementing the repertoire of AS events. PMID:25934563

  20. Unmasking alternative splicing inside protein-coding exons defines exitrons and their role in proteome plasticity

    PubMed Central

    Marquez, Yamile; Höpfler, Markus; Ayatollahi, Zahra; Barta, Andrea; Kalyna, Maria


    Alternative splicing (AS) diversifies transcriptomes and proteomes and is widely recognized as a key mechanism for regulating gene expression. Previously, in an analysis of intron retention events in Arabidopsis, we found unusual AS events inside annotated protein-coding exons. Here, we also identify such AS events in human and use these two sets to analyse their features, regulation, functional impact, and evolutionary origin. As these events involve introns with features of both introns and protein-coding exons, we name them exitrons (exonic introns). Though exitrons were detected as a subset of retained introns, they are clearly distinguishable, and their splicing results in transcripts with different fates. About half of the 1002 Arabidopsis and 923 human exitrons have sizes of multiples of 3 nucleotides (nt). Splicing of these exitrons results in internally deleted proteins and affects protein domains, disordered regions, and various post-translational modification sites, thus broadly impacting protein function. Exitron splicing is regulated across tissues, in response to stress and in carcinogenesis. Intriguingly, annotated intronless genes can be also alternatively spliced via exitron usage. We demonstrate that at least some exitrons originate from ancestral coding exons. Based on our findings, we propose a “splicing memory” hypothesis whereby upon intron loss imprints of former exon borders defined by vestigial splicing regulatory elements could drive the evolution of exitron splicing. Altogether, our studies show that exitron splicing is a conserved strategy for increasing proteome plasticity in plants and animals, complementing the repertoire of AS events. PMID:25934563

  1. The excess of 5' introns in eukaryotic genomes.


    Lin, Kui; Zhang, Da-Yong


    In this work, 21 completely sequenced eukaryotic genomes were analyzed using an intragene comparison approach. We found that all of these genomes show a significant 5'-biased distribution of introns of protein-coding genes. Our findings are different from previous studies based on the intergene method, where introns are biased towards the 5' end of genes only in intron-poor genomes, but are evenly distributed in intron-rich genomes. In addition, by analyzing the patterns of intron distribution of a set of well-compiled housekeeping genes from human and their respective orthologs identified by a bidirectional best BLAST hit method from the other genomes, we found that the trend of 5'-biased intron positions of the set of housekeeping genes for each genome is much more skewed than that of all genes of the same genome, and rarely if any of the housekeeping genes examined have an extremely 3'-biased position distribution in which all introns of a gene are located only at the 3' portion of the gene. The most parsimonious explanation for our findings may be the model in which intron loss is caused by homologous recombination between the genomic copy of a gene and a reverse transcriptase product of a spliced mRNA. PMID:16314314

  2. Inhibition of Splicing but not Cleavage at the 5' Splice Site by Truncating Human β -globin Pre-mRNA

    NASA Astrophysics Data System (ADS)

    Furdon, Paul J.; Kole, Ryszard


    Human β -globin mRNAs truncated in the second exon or in the first intron have been processed in vitro in a HeLa cell nuclear extract. Transcripts containing a fragment of the second exon as short as 53 nucleotides are efficiently spliced, whereas transcripts truncated 24 or 14 nucleotides downstream from the 3' splice site are spliced inefficiently, if at all. All of these transcripts, however, are efficiently and accurately cleaved at the 5' splice site. In contrast, RNA truncated in the first intron, 54 nucleotides upstream from the 3' splice site, is not processed at all. These findings suggest that cleavage at the 5' splice site and subsequent splicing steps--i.e., cleavage at the 3' splice site and exon ligation--need not be coupled. Anti-Sm serum inhibits the complete splicing reaction and cleavage at the 5' splice site, suggesting involvement of certain ribonucleoprotein particles in the cleavage reaction. ATP and Mg2+ are required for cleavage at the 5' splice site at concentrations similar to those for the complete splicing reaction.

  3. Differential regulation of translation and endocytosis of alternatively spliced forms of the type II bone morphogenetic protein (BMP) receptor

    PubMed Central

    Amsalem, Ayelet R.; Marom, Barak; Shapira, Keren E.; Hirschhorn, Tal; Preisler, Livia; Paarmann, Pia; Knaus, Petra; Henis, Yoav I.; Ehrlich, Marcelo


    The expression and function of transforming growth factor-β superfamily receptors are regulated by multiple molecular mechanisms. The type II BMP receptor (BMPRII) is expressed as two alternatively spliced forms, a long and a short form (BMPRII-LF and –SF, respectively), which differ by an ∼500 amino acid C-terminal extension, unique among TGF-β superfamily receptors. Whereas this extension was proposed to modulate BMPRII signaling output, its contribution to the regulation of receptor expression was not addressed. To map regulatory determinants of BMPRII expression, we compared synthesis, degradation, distribution, and endocytic trafficking of BMPRII isoforms and mutants. We identified translational regulation of BMPRII expression and the contribution of a 3’ terminal coding sequence to this process. BMPRII-LF and -SF differed also in their steady-state levels, kinetics of degradation, intracellular distribution, and internalization rates. A single dileucine signal in the C-terminal extension of BMPRII-LF accounted for its faster clathrin-mediated endocytosis relative to BMPRII-SF, accompanied by mildly faster degradation. Higher expression of BMPRII-SF at the plasma membrane resulted in enhanced activation of Smad signaling, stressing the potential importance of the multilayered regulation of BMPRII expression at the plasma membrane. PMID:26739752

  4. Differential regulation of translation and endocytosis of alternatively spliced forms of the type II bone morphogenetic protein (BMP) receptor.


    Amsalem, Ayelet R; Marom, Barak; Shapira, Keren E; Hirschhorn, Tal; Preisler, Livia; Paarmann, Pia; Knaus, Petra; Henis, Yoav I; Ehrlich, Marcelo


    The expression and function of transforming growth factor-β superfamily receptors are regulated by multiple molecular mechanisms. The type II BMP receptor (BMPRII) is expressed as two alternatively spliced forms, a long and a short form (BMPRII-LF and -SF, respectively), which differ by an ∼500 amino acid C-terminal extension, unique among TGF-β superfamily receptors. Whereas this extension was proposed to modulate BMPRII signaling output, its contribution to the regulation of receptor expression was not addressed. To map regulatory determinants of BMPRII expression, we compared synthesis, degradation, distribution, and endocytic trafficking of BMPRII isoforms and mutants. We identified translational regulation of BMPRII expression and the contribution of a 3' terminal coding sequence to this process. BMPRII-LF and -SF differed also in their steady-state levels, kinetics of degradation, intracellular distribution, and internalization rates. A single dileucine signal in the C-terminal extension of BMPRII-LF accounted for its faster clathrin-mediated endocytosis relative to BMPRII-SF, accompanied by mildly faster degradation. Higher expression of BMPRII-SF at the plasma membrane resulted in enhanced activation of Smad signaling, stressing the potential importance of the multilayered regulation of BMPRII expression at the plasma membrane. PMID:26739752

  5. Genome-wide Identification of Zero Nucleotide Recursive Splicing in Drosophila

    PubMed Central

    Duff, Michael O.; Olson, Sara; Wei, Xintao; Garrett, Sandra C.; Osman, Ahmad; Bolisetty, Mohan; Plocik, Alex; Celniker, Susan; Graveley, Brenton R.


    Recursive splicing is a process in which large introns are removed in multiple steps by resplicing at ratchet points - 5′ splice sites recreated after splicing1. Recursive splicing was first identified in the Drosophila Ultrabithorax (Ubx) gene1 and only three additional Drosophila genes have since been experimentally shown to undergo recursive splicing2,3. Here, we identify 197 zero nucleotide exon ratchet points in 130 introns of 115 Drosophila genes from total RNA sequencing data generated from developmental time points, dissected tissues, and cultured cells. The sequential nature of recursive splicing was confirmed by identification of lariat introns generated by splicing to and from the ratchet points. We also show that recursive splicing is a constitutive process, that depletion of U2AF inhibits recursive splicing, and that the sequence and function of ratchet points are evolutionarily conserved in Drosophila. Finally, we identified four recursively spliced human genes, one of which is also recursively spliced in Drosophila. Together these results indicate that recursive splicing is commonly used in Drosophila, occurs in human and provides insight into the mechanisms by which some large introns are removed. PMID:25970244

  6. Development of a Gene Knockout System Using Mobile Group II Introns (Targetron) and Genetic Disruption of Acid Production Pathways in Clostridium beijerinckii

    PubMed Central

    Wang, Yi; Li, Xiangzhen; Milne, Caroline B.; Janssen, Holger; Lin, Weiyin; Phan, Gloria; Hu, Huiying; Jin, Yong-Su; Price, Nathan D.


    Clostridium beijerinckii is a well-known solvent-producing microorganism with great potential for biofuel and biochemical production. To better understand and improve the biochemical pathway to solvents, the development of genetic tools for engineering C. beijerinckii is highly desired. Based on mobile group II intron technology, a targetron gene knockout system was developed for C. beijerinckii in this study. This system was successfully employed to disrupt acid production pathways in C. beijerinckii, leading to pta (encoding phosphotransacetylase)- and buk (encoding butyrate kinase)-negative mutants. In addition to experimental characterization, the mutant phenotypes were analyzed in the context of our C. beijerinckii genome-scale model. Compared to those of the parental strain (C. beijerinckii 8052), acetate production in the pta mutant was substantially reduced and butyrate production was remarkably increased, while solvent production was dependent on the growth medium. The pta mutant also produced much higher levels of lactate, suggesting that disrupting pta influenced the energy generation and electron flow pathways. In contrast, acetate and butyrate production in the buk mutant was generally similar to that of the wild type, but solvent production was consistently 20 to 30% higher and glucose consumption was more rapid and complete. Our results suggest that the acid and solvent production of C. beijerinckii can be effectively altered by disrupting the acid production pathways. As the gene disruption method developed in this study does not leave any antibiotic marker in a disrupted allele, multiple and high-throughput gene disruption is feasible for elucidating genotype and phenotype relationships in C. beijerinckii. PMID:23872562

  7. SERRATE is required for intron suppression of RNA silencing in Arabidopsis

    PubMed Central

    Christie, Michael; Carroll, Bernard J.


    Transposons and viruses are generally devoid of introns and are prime targets for small interfering RNAs (siRNAs) and RNA silencing. Conversely, endogenous genes often contain introns and are not usually subjected to post-transcriptional gene silencing by siRNAs. In a recent study, we reported that efficient intron splicing directly suppresses siRNA biogenesis and RNA silencing of a Green Fluorescence Protein (GFP) transgene. Splicing-mediated suppression of GFP silencing was dependent on ABH1, the Arabidopsis ortholog of human mRNA cap-binding protein 80. Furthermore, genome-wide analyses of Arabidopsis small RNA libraries showed that exons from intron-containing genes accumulate less small RNAs than exons from intronless genes. Our in silico analysis therefore suggested that intron splicing has a fundamental role in protecting endogenous genes from becoming templates for siRNA biogenesis and RNA silencing. Here, we show that SERRATE (SE) is also required for splicing-mediated suppression of RNA silencing in Arabidopsis. SE encodes a zinc finger protein that, like ABH1, functions in micro-RNA (miRNA) biogenesis and intron splicing. The implications of our findings are also discussed in a broader context. PMID:22112452

  8. Re-splicing of mature mRNA in cancer cells promotes activation of distant weak alternative splice sites

    PubMed Central

    Kameyama, Toshiki; Suzuki, Hitoshi; Mayeda, Akila


    Transcripts of the human tumor susceptibility gene 101 (TSG101) are aberrantly spliced in many cancers. A major aberrant splicing event on the TSG101 pre-mRNA involves joining of distant alternative 5′ and 3′ splice sites within exon 2 and exon 9, respectively, resulting in the extensive elimination of the mRNA. The estimated strengths of the alternative splice sites are much lower than those of authentic splice sites. We observed that the equivalent aberrant mRNA could be generated from an intron-less TSG101 gene expressed ectopically in breast cancer cells. Remarkably, we identified a pathway-specific endogenous lariat RNA consisting solely of exonic sequences, predicted to be generated by a re-splicing between exon 2 and exon 9 on the spliced mRNA. Our results provide evidence for a two-step splicing pathway in which the initial constitutive splicing removes all 14 authentic splice sites, thereby bringing the weak alternative splice sites into close proximity. We also demonstrate that aberrant multiple-exon skipping of the fragile histidine triad (FHIT) pre-mRNA in cancer cells occurs via re-splicing of spliced FHIT mRNA. The re-splicing of mature mRNA can potentially generate mutation-independent diversity in cancer transcriptomes. Conversely, a mechanism may exist in normal cells to prevent potentially deleterious mRNA re-splicing events. PMID:22675076

  9. Mechanisms and Regulation of Alternative Pre-mRNA Splicing

    PubMed Central

    Lee, Yeon


    Precursor messenger RNA (pre-mRNA) splicing is a critical step in the posttranscriptional regulation of gene expression, providing significant expansion of the functional proteome of eukaryotic organisms with limited gene numbers. Split eukaryotic genes contain intervening sequences or introns disrupting protein-coding exons, and intron removal occurs by repeated assembly of a large and highly dynamic ribonucleoprotein complex termed the spliceosome, which is composed of five small nuclear ribonucleoprotein particles, U1, U2, U4/U6, and U5. Biochemical studies over the past 10 years have allowed the isolation as well as compositional, functional, and structural analysis of splicing complexes at distinct stages along the spliceosome cycle. The average human gene contains eight exons and seven introns, producing an average of three or more alternatively spliced mRNA isoforms. Recent high-throughput sequencing studies indicate that 100% of human genes produce at least two alternative mRNA isoforms. Mechanisms of alternative splicing include RNA–protein interactions of splicing factors with regulatory sites termed silencers or enhancers, RNA–RNA base-pairing interactions, or chromatin-based effects that can change or determine splicing patterns. Disease-causing mutations can often occur in splice sites near intron borders or in exonic or intronic RNA regulatory silencer or enhancer elements, as well as in genes that encode splicing factors. Together, these studies provide mechanistic insights into how spliceosome assembly, dynamics, and catalysis occur; how alternative splicing is regulated and evolves; and how splicing can be disrupted by cis- and trans-acting mutations leading to disease states. These findings make the spliceosome an attractive new target for small-molecule, antisense, and genome-editing therapeutic interventions. PMID:25784052

  10. Adenosine to Inosine editing frequency controlled by splicing efficiency.


    Licht, Konstantin; Kapoor, Utkarsh; Mayrhofer, Elisa; Jantsch, Michael F


    Alternative splicing and adenosine to inosine (A to I) RNA-editing are major factors leading to co- and post-transcriptional modification of genetic information. Both, A to I editing and splicing occur in the nucleus. As editing sites are frequently defined by exon-intron basepairing, mRNA splicing efficiency should affect editing levels. Moreover, splicing rates affect nuclear retention and will therefore also influence the exposure of pre-mRNAs to the editing-competent nuclear environment. Here, we systematically test the influence of splice rates on RNA-editing using reporter genes but also endogenous substrates. We demonstrate for the first time that the extent of editing is controlled by splicing kinetics when editing is guided by intronic elements. In contrast, editing sites that are exclusively defined by exonic structures are almost unaffected by the splicing efficiency of nearby introns. In addition, we show that editing levels in pre- and mature mRNAs do not match. This phenomenon can in part be explained by the editing state of an RNA influencing its splicing rate but also by the binding of the editing enzyme ADAR that interferes with splicing. PMID:27112566

  11. Intron retention and 3'-UTR analysis of Arabidopsis Dicer-like 2 transcripts.


    He, Qiongji; Peng, Jiejun; Yan, Fei; Lin, Lin; Lu, Yuwen; Zheng, Hongying; Chen, Hairu; Chen, Jianping


    Arabidopsis thaliana Dicer-like protein 2 (AtDCL2) plays an essential role in the RNA interference pathway. The function of AtDCL2 and other DCLs has been much studied but little has been done to characterize the DCLs transcripts before they are translated into proteins. Here, we investigated AtDCL2 transcripts and showed that all 21 introns of AtDCL2 except intron 9, 18, 20 and 21 could be retained although spliced sequences usually predominated. Intron 10 was more frequently retained and transient expression assays in Nicotiana benthamiana leaves showed that when AG/C at the 3' splicing site of the intron was changed to AG/G, the intron was more frequently spliced out. Conversely, a high retention of intron 18 was obtained if the AG/G at the 3' splicing site was changed to AG/C. These results suggest that the sequence at the 3' splicing site affects the efficiency of intron splicing. The 3'-UTRs of AtDCL2 had lengths between 54 and 154 nts, and the different 3'-UTRs differentially affected the transcriptional levels of fused GFP expressed transiently in N. benthamiana. Further comparisons and mutation experiments suggested that a putative SBF-1 binding site and an AU-rich element in the 3'-UTR both down-regulated expression of the upstream GFP fused to the 3'-UTR. Conversely, a second poly(A) consensus signal sequence in one 3'-UTR up-regulated gene expression. Our results provide insight into the character of AtDCL2 transcripts and demonstrate the potential complexity of factors that affect the frequency and patterns of alternative splicing. PMID:21698366

  12. Functional selection of splicing enhancers that stimulate trans-splicing in vitro.

    PubMed Central

    Boukis, L A; Bruzik, J P


    The role of exonic sequences in naturally occurring trans-splicing has not been explored in detail. Here, we have identified trans-splicing enhancers through the use of an iterative selection scheme. Several classes of enhancer sequences were identified that led to dramatic increases in trans-splicing efficiency. Two sequence families were investigated in detail. These include motifs containing the element (G/C)GAC(G/C) and also 5' splice site-like sequences. Distinct elements were tested for their ability to function as splicing enhancers and in competition experiments. In addition, discrete trans-acting factors were identified. This work demonstrates that splicing enhancers are able to effect a large increase in trans-splicing efficiency and that the process of exon definition is able to positively enhance trans-splicing even though the reaction itself is independent of the need for the 5' end of U1 snRNA. Due to the presence of internal introns in messages that are trans-spliced, the natural arrangement of 5' splice sites downstream of trans-splicing acceptors may lead to a general promotion of this unusual reaction. PMID:11421358

  13. Molecular characterization of a new member of the lariat capping twin-ribozyme introns

    PubMed Central


    Background Twin-ribozyme introns represent a complex class of mobile group I introns that harbour a lariat capping (LC) ribozyme and a homing endonuclease gene embedded in a conventional self-splicing group I ribozyme (GIR2). Twin-ribozyme introns have so far been confined to nucleolar DNA in Naegleria amoeboflagellates and the myxomycete Didymium iridis. Results We characterize structural organization, catalytic properties and molecular evolution of a new twin-ribozyme intron in Allovahlkampfia (Heterolobosea). The intron contains two ribozyme domains with different functions in ribosomal RNA splicing and homing endonuclease mRNA maturation. We found Allovahlkampfia GIR2 to be a typical group IC1 splicing ribozyme responsible for addition of the exogenous guanosine cofactor (exoG), exon ligation and circularization of intron RNA. The Allovahlkampfia LC ribozyme, by contrast, represents an efficient self-cleaving ribozyme that generates a small 2′,5′ lariat cap at the 5′ end of the homing endonuclease mRNA, and thus contributes to intron mobility. Conclusions The discovery of a twin-ribozyme intron in a member of Heterolobosea expands the distribution pattern of LC ribozymes. We identify a putative regulatory RNA element (AP2.1) in the Allovahlkampfia LC ribozyme that involves homing endonuclease mRNA coding sequences as an important structural component. PMID:25342998

  14. mCSF1, a nucleus-encoded CRM protein required for the processing of many mitochondrial introns, is involved in the biogenesis of respiratory complexes I and IV in Arabidopsis.


    Zmudjak, Michal; Colas des Francs-Small, Catherine; Keren, Ido; Shaya, Felix; Belausov, Eduard; Small, Ian; Ostersetzer-Biran, Oren


    The coding regions of many mitochondrial genes in plants are interrupted by intervening sequences that are classified as group II introns. Their splicing is essential for the expression of the genes they interrupt and hence for respiratory function, and is facilitated by various protein cofactors. Despite the importance of these cofactors, only a few of them have been characterized. CRS1-YhbY domain (CRM) is a recently recognized RNA-binding domain that is present in several characterized splicing factors in plant chloroplasts. The Arabidopsis genome encodes 16 CRM proteins, but these are largely uncharacterized. Here, we analyzed the intracellular location of one of these hypothetical proteins in Arabidopsis, mitochondrial CAF-like splicing factor 1 (mCSF1; At4 g31010), and analyzed the growth phenotypes and organellar activities associated with mcsf1 mutants in plants. Our data indicated that mCSF1 resides within mitochondria and its functions are essential during embryogenesis. Mutant plants with reduced mCSF1 displayed inhibited germination and retarded growth phenotypes that were tightly associated with reduced complex I and IV activities. Analogously to the functions of plastid-localized CRM proteins, analysis of the RNA profiles in wildtype and mcsf1 plants showed that mCSF1 acts in the splicing of many of the group II intron RNAs in Arabidopsis mitochondria. PMID:23646912

  15. Does distance matter? Variations in alternative 3' splicing regulation.


    Akerman, Martin; Mandel-Gutfreund, Yael


    Alternative splicing constitutes a major mechanism creating protein diversity in humans. This diversity can result from the alternative skipping of entire exons or by alternative selection of the 5' or 3' splice sites that define the exon boundaries. In this study, we analyze the sequence and evolutionary characteristics of alternative 3' splice sites conserved between human and mouse genomes for distances ranging from 3 to 100 nucleotides. We show that alternative splicing events can be distinguished from constitutive splicing by a combination of properties which vary depending on the distance between the splice sites. Among the unique features of alternative 3' splice sites, we observed an unexpectedly high occurrence of events in which a polypyrimidine tract was found to overlap the upstream splice site. By applying a machine-learning approach, we show that we can successfully discriminate true alternative 3' splice sites from constitutive 3' splice sites. Finally, we propose that the unique features of the intron flanking alternative splice sites are indicative of a regulatory mechanism that is involved in splice site selection. We postulate that the process of splice site selection is influenced by the distance between the competitive splice sites. PMID:17704130

  16. Distributions of transposable elements reveal hazardous zones in mammalian introns.


    Zhang, Ying; Romanish, Mark T; Mager, Dixie L


    Comprising nearly half of the human and mouse genomes, transposable elements (TEs) are found within most genes. Although the vast majority of TEs in introns are fixed in the species and presumably exert no significant effects on the enclosing gene, some markedly perturb transcription and result in disease or a mutated phenotype. Factors determining the likelihood that an intronic TE will affect transcription are not clear. In this study, we examined intronic TE distributions in both human and mouse and found several factors that likely contribute to whether a particular TE can influence gene transcription. Specifically, we observed that TEs near exons are greatly underrepresented compared to random distributions, but the size of these "underrepresentation zones" differs between TE classes. Compared to elsewhere in introns, TEs within these zones are shorter on average and show stronger orientation biases. Moreover, TEs in extremely close proximity (<20 bp) to exons show a strong bias to be near splice-donor sites. Interestingly, disease-causing intronic TE insertions show the opposite distributional trends, and by examining expressed sequence tag (EST) databases, we found that the proportion of TEs contributing to chimeric TE-gene transcripts is significantly higher within their underrepresentation zones. In addition, an analysis of predicted splice sites within human long terminal repeat (LTR) elements showed a significantly lower total number and weaker strength for intronic LTRs near exons. Based on these factors, we selectively examined a list of polymorphic mouse LTR elements in introns and showed clear evidence of transcriptional disruption by LTR element insertions in the Trpc6 and Kcnh6 genes. Taken together, these studies lend insight into the potential selective forces that have shaped intronic TE distributions and enable identification of TEs most likely to exert transcriptional effects on genes. PMID:21573203

  17. Splicing fidelity

    PubMed Central

    Koodathingal, Prakash; Staley, Jonathan P.


    The spliceosome discriminates against suboptimal substrates, both during assembly and catalysis, thereby enhancing specificity during pre-mRNA splicing. Central to such fidelity mechanisms are a conserved subset of the DEAD- and DEAH-box ATPases, which belong to a superfamily of proteins that mediate RNP rearrangements in almost all RNA-dependent processes in the cell. Through an investigation of the mechanisms contributing to the specificity of 5′ splice site cleavage, two related reports, one from our lab and the other from the Cheng lab, have provided insights into fidelity mechanisms utilized by the spliceosome. In our work, we found evidence for a kinetic proofreading mechanism in splicing in which the DEAH-box ATPase Prp16 discriminates against substrates undergoing slow 5′ splice site cleavage. Additionally, our study revealed that discriminated substrates are discarded through a general spliceosome disassembly pathway, mediated by another DEAH-box ATPase Prp43. In their work, Tseng et al. described the underlying molecular events through which Prp16 discriminates against a splicing substrate during 5′ splice site cleavage. Here, we present a synthesis of these two studies and, additionally, provide the first biochemical evidence for discrimination of a suboptimal splicing substrate just prior to 5′ splice site cleavage. Together, these findings support a general mechanism for a ubiquitous superfamily of ATPases in enhancing specificity during RNA-dependent processes in the cell. PMID:23770752

  18. Intron-loss evolution of hatching enzyme genes in Teleostei

    PubMed Central


    Background Hatching enzyme, belonging to the astacin metallo-protease family, digests egg envelope at embryo hatching. Orthologous genes of the enzyme are found in all vertebrate genomes. Recently, we found that exon-intron structures of the genes were conserved among tetrapods, while the genes of teleosts frequently lost their introns. Occurrence of such intron losses in teleostean hatching enzyme genes is an uncommon evolutionary event, as most eukaryotic genes are generally known to be interrupted by introns and the intron insertion sites are conserved from species to species. Here, we report on extensive studies of the exon-intron structures of teleostean hatching enzyme genes for insight into how and why introns were lost during evolution. Results We investigated the evolutionary pathway of intron-losses in hatching enzyme genes of 27 species of Teleostei. Hatching enzyme genes of basal teleosts are of only one type, which conserves the 9-exon-8-intron structure of an assumed ancestor. On the other hand, otocephalans and euteleosts possess two types of hatching enzyme genes, suggesting a gene duplication event in the common ancestor of otocephalans and euteleosts. The duplicated genes were classified into two clades, clades I and II, based on phylogenetic analysis. In otocephalans and euteleosts, clade I genes developed a phylogeny-specific structure, such as an 8-exon-7-intron, 5-exon-4-intron, 4-exon-3-intron or intron-less structure. In contrast to the clade I genes, the structures of clade II genes were relatively stable in their configuration, and were similar to that of the ancestral genes. Expression analyses revealed that hatching enzyme genes were high-expression genes, when compared to that of housekeeping genes. When expression levels were compared between clade I and II genes, clade I genes tends to be expressed more highly than clade II genes. Conclusions Hatching enzyme genes evolved to lose their introns, and the intron-loss events occurred at

  19. Plant Spliceosomal Introns: Not Only Cut and Paste

    PubMed Central

    Morello, L; Breviario, D


    Spliceosomal introns in higher eukaryotes are present in a high percentage of protein coding genes and represent a high proportion of transcribed nuclear DNA. In the last fifteen years, a growing mass of data concerning functional roles carried out by such intervening sequences elevated them from a selfish burden carried over by the nucleus to important active regulatory elements. Introns mediate complex gene regulation via alternative splicing; they may act in cis as expression enhancers through IME (intron-mediated enhancement of gene expression) and in trans as negative regulators through the generation of intronic microRNA. Furthermore, some introns also contain promoter sequences for alternative transcripts. Nevertheless, such regulatory roles do not require long conserved sequences, so that introns are relatively free to evolve faster than exons: this feature makes them important tools for evolutionary studies and provides the basis for the development of DNA molecular markers for polymorphisms detection. A survey of introns functions in the plant kingdom is presented. PMID:19452040

  20. Increased efficiency of evolved group I intron spliceozymes by decreased side product formation

    PubMed Central

    Amini, Zhaleh N.; Müller, Ulrich F.


    The group I intron ribozyme from Tetrahymena was recently reengineered into a trans-splicing variant that is able to remove 100-nt introns from pre-mRNA, analogous to the spliceosome. These spliceozymes were improved in this study by 10 rounds of evolution in Escherichia coli cells. One clone with increased activity in E. coli cells was analyzed in detail. Three of its 10 necessary mutations extended the substrate binding duplexes, which led to increased product formation and reduced cleavage at the 5′-splice site. One mutation in the conserved core of the spliceozyme led to a further reduction of cleavage at the 5′-splice site but an increase in cleavage side products at the 3′-splice site. The latter was partially reduced by six additional mutations. Together, the mutations increased product formation while reducing activity at the 5′-splice site and increasing activity at the 3′-splice site. These results show the adaptation of a ribozyme that evolved in nature for cis-splicing to trans-splicing, and they highlight the interdependent function of nucleotides within group I intron ribozymes. Implications for the possible use of spliceozymes as tools in research and therapy, and as a model for the evolution of the spliceosome, are discussed. PMID:26106216

  1. Characterization of rbcL group IA introns from two colonial volvocalean species (Chlorophyceae).


    Nozaki, H; Ohta, N; Yamada, T; Takano, H


    Group I introns were reported for the first time in the large subunit of Rubisco (rbcL) genes, using two colonial green algae, Pleodorina californica and Gonium multicoccum (Volvocales). The rbcL gene of P. californica contained an intron (PIC intron) of 1320 bp harboring an open reading frame (ORF). The G. multicoccum rbcL gene had two ORF-lacking introns of 549 (GM1 intron) and 295 (GM2 intron) base pairs. Based on the conserved nucleotide sequences of the secondary structure, the PIC and GM1 introns were assigned to group IA2 whereas the GM2 intron belonged to group IA1. Southern hybridization analyses of nuclear and chloroplast DNAs indicated that such intron-containing rbcL genes are located in the chloroplast genome. Sequencing RNAs from the two algae revealed that these introns are spliced out during mRNA maturation. In addition, the PIC and GM1 introns were inserted in the same position of the rbcL exons, and phylogenetic analysis of group IA introns indicated a close phylogenetic relationship between the PIC and GM1 introns within the lineage of bacteriophage group IA2 introns. However, P. californica and G. multicoccum occupy distinct clades in the phylogenetic trees of the colonial Volvocales, and the majority of other colonial volvocalean species do not have such introns in the rbcL genes. Therefore, these introns might have been recently inserted in the rbcL genes independently by horizontal transmission by viruses or bacteriophage. PMID:9620266

  2. Intron-less RNA injected into the nucleus of Xenopus oocytes accesses a regulated translation control pathway.


    Braddock, M; Muckenthaler, M; White, M R; Thorburn, A M; Sommerville, J; Kingsman, A J; Kingsman, S M


    The translation of a capped, polyadenylated RNA after injection into the nucleus of Xenopus oocytes occurs only if the RNA contains an intron. A single point mutation in the splice donor site prevents translation. Intron-less RNA is exported efficiently to the cytoplasm and is held, undegraded, in a translationally inert state for several days. Translation can be activated by treating the oocytes with progesterone or by injecting antibodies that bind the FRGY2 class of messenger RNA binding proteins, p56 and p60, but these antibodies are only effective if delivered to the nucleus. Inhibitors of casein kinase II also activate translation whereas phosphatase inhibitors block progesterone-mediated activation of translation. These data suggest the presence of an RNA handling pathway in the nucleus of Xenopus oocytes which is regulated by casein kinase type II phosphorylation and which directs transcripts to be sequestered by p56/p60 or by closely related proteins. This pathway can be bypassed if the RNA contains an intron and it can be reversed by progesterone treatment. These data may have implications for understanding translational control during early development. PMID:7816614

  3. Intron loss and gain during evolution of the catalase gene family in angiosperms.

    PubMed Central

    Frugoli, J A; McPeek, M A; Thomas, T L; McClung, C R


    Angiosperms (flowering plants), including both monocots and dicots, contain small catalase gene families. In the dicot, Arabidopsis thaliana, two catalase (CAT) genes, CAT1 and CAT3, are tightly linked on chromosome 1 and a third, CAT2, which is more similar to CAT1 than to CAT3, is unlinked on chromosome 4. Comparison of positions and numbers of introns among 13 angiosperm catalase genomic sequences indicates that intron positions are conserved, and suggests that an ancestral catalase gene common to monocots and dicots contained seven introns. Arabidopsis CAT2 has seven introns; both CAT1 and CAT3 have six introns in positions conserved with CAT2, but each has lost a different intron. We suggest the following sequence of events during the evolution of the Arabidopsis catalase gene family. An initial duplication of an ancestral catalase gene gave rise to CAT3 and CAT1. CAT1 then served as the template for a second duplication, yielding CAT2. Intron losses from CAT1 and CAT3 followed these duplications. One subclade of monocot catalases has lost all but the 5'-most and 3'-most introns, which is consistent with a mechanism of intron loss by replacement of an ancestral intron-containing gene with a reverse-transcribed DNA copy of a fully spliced mRNA. Following this event of concerted intron loss, the Oryza sativa (rice, a monocot) CAT1 lineage acquired an intron in a novel position, consistent with a mechanism of intron gain at proto-splice sites. PMID:9584109

  4. Splicing regulation: From a parts list of regulatory elements to an integrated splicing code

    PubMed Central

    Wang, Zefeng; Burge, Christopher B.


    Alternative splicing of pre-mRNAs is a major contributor to both proteomic diversity and control of gene expression levels. Splicing is tightly regulated in different tissues and developmental stages, and its disruption can lead to a wide range of human diseases. An important long-term goal in the splicing field is to determine a set of rules or “code” for splicing that will enable prediction of the splicing pattern of any primary transcript from its sequence. Outside of the core splice site motifs, the bulk of the information required for splicing is thought to be contained in exonic and intronic cis-regulatory elements that function by recruitment of sequence-specific RNA-binding protein factors that either activate or repress the use of adjacent splice sites. Here, we summarize the current state of knowledge of splicing cis-regulatory elements and their context-dependent effects on splicing, emphasizing recent global/genome-wide studies and open questions. PMID:18369186

  5. BRR2a Affects Flowering Time via FLC Splicing

    PubMed Central

    Mahrez, Walid; Shin, Juhyun; Exner, Vivien; Siretskiy, Alexey; Köhler, Claudia


    Several pathways control time to flowering in Arabidopsis thaliana through transcriptional and posttranscriptional gene regulation. In recent years, mRNA processing has gained interest as a critical regulator of flowering time control in plants. However, the molecular mechanisms linking RNA splicing to flowering time are not well understood. In a screen for Arabidopsis early flowering mutants we identified an allele of BRR2a. BRR2 proteins are components of the spliceosome and highly conserved in eukaryotes. Arabidopsis BRR2a is ubiquitously expressed in all analyzed tissues and involved in the processing of flowering time gene transcripts, most notably FLC. A missense mutation of threonine 895 in BRR2a caused defects in FLC splicing and greatly reduced FLC transcript levels. Reduced FLC expression increased transcription of FT and SOC1 leading to early flowering in both short and long days. Genome-wide experiments established that only a small set of introns was not correctly spliced in the brr2a mutant. Compared to control introns, retained introns were often shorter and GC-poor, had low H3K4me1 and CG methylation levels, and were often derived from genes with a high-H3K27me3-low-H3K36me3 signature. We propose that BRR2a is specifically needed for efficient splicing of a subset of introns characterized by a combination of factors including intron size, sequence and chromatin, and that FLC is most sensitive to splicing defects. PMID:27100965

  6. BRR2a Affects Flowering Time via FLC Splicing.


    Mahrez, Walid; Shin, Juhyun; Muñoz-Viana, Rafael; Figueiredo, Duarte D; Trejo-Arellano, Minerva S; Exner, Vivien; Siretskiy, Alexey; Gruissem, Wilhelm; Köhler, Claudia; Hennig, Lars


    Several pathways control time to flowering in Arabidopsis thaliana through transcriptional and posttranscriptional gene regulation. In recent years, mRNA processing has gained interest as a critical regulator of flowering time control in plants. However, the molecular mechanisms linking RNA splicing to flowering time are not well understood. In a screen for Arabidopsis early flowering mutants we identified an allele of BRR2a. BRR2 proteins are components of the spliceosome and highly conserved in eukaryotes. Arabidopsis BRR2a is ubiquitously expressed in all analyzed tissues and involved in the processing of flowering time gene transcripts, most notably FLC. A missense mutation of threonine 895 in BRR2a caused defects in FLC splicing and greatly reduced FLC transcript levels. Reduced FLC expression increased transcription of FT and SOC1 leading to early flowering in both short and long days. Genome-wide experiments established that only a small set of introns was not correctly spliced in the brr2a mutant. Compared to control introns, retained introns were often shorter and GC-poor, had low H3K4me1 and CG methylation levels, and were often derived from genes with a high-H3K27me3-low-H3K36me3 signature. We propose that BRR2a is specifically needed for efficient splicing of a subset of introns characterized by a combination of factors including intron size, sequence and chromatin, and that FLC is most sensitive to splicing defects. PMID:27100965

  7. Localized Retroprocessing as a Model of Intron Loss in the Plant Mitochondrial Genome.


    Cuenca, Argelia; Ross, T Gregory; Graham, Sean W; Barrett, Craig F; Davis, Jerrold I; Seberg, Ole; Petersen, Gitte


    Loss of introns in plant mitochondrial genes is commonly explained by retroprocessing. Under this model, an mRNA is reverse transcribed and integrated back into the genome, simultaneously affecting the contents of introns and edited sites. To evaluate the extent to which retroprocessing explains intron loss, we analyzed patterns of intron content and predicted RNA editing for whole mitochondrial genomes of 30 species in the monocot order Alismatales. In this group, we found an unusually high degree of variation in the intron content, even expanding the hitherto known variation among angiosperms. Some species have lost some two-third of the cis-spliced introns. We found a strong correlation between intron content and editing frequency, and detected 27 events in which intron loss is consistent with the presence of nucleotides in an edited state, supporting retroprocessing. However, we also detected seven cases of intron loss not readily being explained by retroprocession. Our analyses are also not consistent with the entire length of a fully processed cDNA copy being integrated into the genome, but instead indicate that retroprocessing usually occurs for only part of the gene. In some cases, several rounds of retroprocessing may explain intron loss in genes completely devoid of introns. A number of taxa retroprocessing seem to be very common and a possibly ongoing process. It affects the entire mitochondrial genome. PMID:27435795

  8. Localized Retroprocessing as a Model of Intron Loss in the Plant Mitochondrial Genome

    PubMed Central

    Cuenca, Argelia; Ross, T. Gregory; Graham, Sean W.; Barrett, Craig F.; Davis, Jerrold I.; Seberg, Ole; Petersen, Gitte


    Loss of introns in plant mitochondrial genes is commonly explained by retroprocessing. Under this model, an mRNA is reverse transcribed and integrated back into the genome, simultaneously affecting the contents of introns and edited sites. To evaluate the extent to which retroprocessing explains intron loss, we analyzed patterns of intron content and predicted RNA editing for whole mitochondrial genomes of 30 species in the monocot order Alismatales. In this group, we found an unusually high degree of variation in the intron content, even expanding the hitherto known variation among angiosperms. Some species have lost some two-third of the cis-spliced introns. We found a strong correlation between intron content and editing frequency, and detected 27 events in which intron loss is consistent with the presence of nucleotides in an edited state, supporting retroprocessing. However, we also detected seven cases of intron loss not readily being explained by retroprocession. Our analyses are also not consistent with the entire length of a fully processed cDNA copy being integrated into the genome, but instead indicate that retroprocessing usually occurs for only part of the gene. In some cases, several rounds of retroprocessing may explain intron loss in genes completely devoid of introns. A number of taxa retroprocessing seem to be very common and a possibly ongoing process. It affects the entire mitochondrial genome. PMID:27435795

  9. The exon junction complex controls transposable element activity by ensuring faithful splicing of the piwi transcript

    PubMed Central

    Malone, Colin D.; Mestdagh, Claire; Akhtar, Junaid; Kreim, Nastasja; Deinhard, Pia; Sachidanandam, Ravi; Treisman, Jessica


    The exon junction complex (EJC) is a highly conserved ribonucleoprotein complex that binds RNAs during splicing and remains associated with them following export to the cytoplasm. While the role of this complex in mRNA localization, translation, and degradation has been well characterized, its mechanism of action in splicing a subset of Drosophila and human transcripts remains to be elucidated. Here, we describe a novel function for the EJC and its splicing subunit, RnpS1, in preventing transposon accumulation in both Drosophila germline and surrounding somatic follicle cells. This function is mediated specifically through the control of piwi transcript splicing, where, in the absence of RnpS1, the fourth intron of piwi is retained. This intron contains a weak polypyrimidine tract that is sufficient to confer dependence on RnpS1. Finally, we demonstrate that RnpS1-dependent removal of this intron requires splicing of the flanking introns, suggesting a model in which the EJC facilitates the splicing of weak introns following its initial deposition at adjacent exon junctions. These data demonstrate a novel role for the EJC in regulating piwi intron excision and provide a mechanism for its function during splicing. PMID:25104425

  10. Intron-genome size relationship on a large evolutionary scale.


    Vinogradov, A E


    The intron-genome size relationship was studied across a wide evolutionary range (from slime mold and yeast to human and maize), as well as the relationship between genome size and the ratio of intervening/coding sequence size. The average intron size is scaled to genome size with a slope of about one-fourth for the log-transformed values; i.e., on the global scale its increase in evolution is lower than the increase in genome size by four orders of magnitude. There are exceptions to the general trend. In baker's yeast introns are extraordinarily long for its genome size. Tetrapods also have longer introns than expected for their genome sizes. In teleost fish the mean intron size does not differ significantly, notwithstanding the differences in genome size. In contrast to previous reports, avian introns were not found to be significantly shorter than introns of mammals, although avian genomes are smaller than genomes of mammals on average by about a factor of 2.5. The extra-/intragenic ratio of noncoding DNA can be higher in fungi than in animals, notwithstanding the smaller fungal genomes. In vertebrates and invertebrates taken separately, this ratio is increasing as the increase in genome size. Two hypotheses are proposed to explain the variation in the extra-/intragenic ratio of noncoding DNA in organisms with similar numbers of genes: transition (dynamic) and equilibrium (static). According to the transition model, this variation arises with the rapid shift of genome size because the bulk of extragenic DNA can be changed more rapidly than the finely interspersed intron sequences. The equilibrium model assumes that this variation is a result of selective adjustment of genome size with constraints imposed on the intron size due to its putative link to chromatin structure (and constraints of the splicing machinery). PMID:10473779

  11. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    NASA Technical Reports Server (NTRS)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.


    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  12. Introns: The Functional Benefits of Introns in Genomes.


    Jo, Bong-Seok; Choi, Sun Shim


    The intron has been a big biological mystery since it was first discovered in several aspects. First, all of the completely sequenced eukaryotes harbor introns in the genomic structure, whereas no prokaryotes identified so far carry introns. Second, the amount of total introns varies in different species. Third, the length and number of introns vary in different genes, even within the same species genome. Fourth, all introns are copied into RNAs by transcription and DNAs by replication processes, but intron sequences do not participate in protein-coding sequences. The existence of introns in the genome should be a burden to some cells, because cells have to consume a great deal of energy to copy and excise them exactly at the correct positions with the help of complicated spliceosomal machineries. The existence throughout the long evolutionary history is explained, only if selective advantages of carrying introns are assumed to be given to cells to overcome the negative effect of introns. In that regard, we summarize previous research about the functional roles or benefits of introns. Additionally, several other studies strongly suggesting that introns should not be junk will be introduced. PMID:26865841

  13. Altered PLP1 splicing causes hypomyelination of early myelinating structures

    PubMed Central

    Kevelam, Sietske H; Taube, Jennifer R; van Spaendonk, Rosalina M L; Bertini, Enrico; Sperle, Karen; Tarnopolsky, Mark; Tonduti, Davide; Valente, Enza Maria; Travaglini, Lorena; Sistermans, Erik A; Bernard, Geneviève; Catsman-Berrevoets, Coriene E; van Karnebeek, Clara D M; Østergaard, John R; Friederich, Richard L; Fawzi Elsaid, Mahmoud; Schieving, Jolanda H; Tarailo-Graovac, Maja; Orcesi, Simona; Steenweg, Marjan E; van Berkel, Carola G M; Waisfisz, Quinten; Abbink, Truus E M; van der Knaap, Marjo S; Hobson, Grace M; Wolf, Nicole I


    Objective The objective of this study was to investigate the genetic etiology of the X-linked disorder “Hypomyelination of Early Myelinating Structures” (HEMS). Methods We included 16 patients from 10 families diagnosed with HEMS by brain MRI criteria. Exome sequencing was used to search for causal mutations. In silico analysis of effects of the mutations on splicing and RNA folding was performed. In vitro gene splicing was examined in RNA from patients’ fibroblasts and an immortalized immature oligodendrocyte cell line after transfection with mutant minigene splicing constructs. Results All patients had unusual hemizygous mutations of PLP1 located in exon 3B (one deletion, one missense and two silent), which is spliced out in isoform DM20, or in intron 3 (five mutations). The deletion led to truncation of PLP1, but not DM20. Four mutations were predicted to affect PLP1/DM20 alternative splicing by creating exonic splicing silencer motifs or new splice donor sites or by affecting the local RNA structure of the PLP1 splice donor site. Four deep intronic mutations were predicted to destabilize a long-distance interaction structure in the secondary PLP1 RNA fragment involved in regulating PLP1/DM20 alternative splicing. Splicing studies in fibroblasts and transfected cells confirmed a decreased PLP1/DM20 ratio. Interpretation Brain structures that normally myelinate early are poorly myelinated in HEMS, while they are the best myelinated structures in Pelizaeus–Merzbacher disease, also caused by PLP1 alterations. Our data extend the phenotypic spectrum of PLP1-related disorders indicating that normal PLP1/DM20 alternative splicing is essential for early myelination and support the need to include intron 3 in diagnostic sequencing. PMID:26125040

  14. In vitro Splicing of Influenza Viral NS1 mRNA and NS1-β -globin Chimeras: Possible Mechanisms for the Control of Viral mRNA Splicing

    NASA Astrophysics Data System (ADS)

    Plotch, Stephen J.; Krug, Robert M.


    In influenza virus-infected cells, the splicing of the viral NS1 mRNA catalyzed by host nuclear enzymes is controlled so that the steady-state amount of the spliced NS2 mRNA is only 5-10% of that of the unspliced NS1 mRNA. Here we examine the splicing of NS1 mRNA in vitro, using nuclear extracts from HeLa cells. We show that in addition to its consensus 5' and 3' splice sites, NS1 mRNA has an intron branch-point adenosine residue that was functional in lariat formation. Nonetheless, this RNA was not detectably spliced in vitro under conditions in which a human β -globin precursor was efficiently spliced. Using chimeric RNA precursors containing both NS1 and β -globin sequences, we show that the NS1 5' splice site was effectively utilized by the β -globin branch-point sequence and 3' splice site to form a spliced RNA, whereas the NS1 3' splice site did not function in detectable splicing in vitro, even in the presence of the β -globin branch-point sequence or in the presence of both the branch-point sequence and 5' exon and splice site from β -globin With the chimeric precursors that were not detectably spliced, as with NS1 mRNA itself, a low level of a lariat structure containing only intron and not 3' exon sequences was formed. The inability of the consensus 3' splice site of NS1 mRNA to function effectively in in vitro splicing suggests that this site is structurally inaccessible to components of the splicing machinery. Based on these results, we propose two mechanisms whereby NS1 mRNA splicing in infected cells is controlled via the accessibility of its 3' splice site.

  15. Method of predicting Splice Sites based on signal interactions

    PubMed Central

    Churbanov, Alexander; Rogozin, Igor B; Deogun, Jitender S; Ali, Hesham


    Background Predicting and proper ranking of canonical splice sites (SSs) is a challenging problem in bioinformatics and machine learning communities. Any progress in SSs recognition will lead to better understanding of splicing mechanism. We introduce several new approaches of combining a priori knowledge for improved SS detection. First, we design our new Bayesian SS sensor based on oligonucleotide counting. To further enhance prediction quality, we applied our new de novo motif detection tool MHMMotif to intronic ends and exons. We combine elements found with sensor information using Naive Bayesian Network, as implemented in our new tool SpliceScan. Results According to our tests, the Bayesian sensor outperforms the contemporary Maximum Entropy sensor for 5' SS detection. We report a number of putative Exonic (ESE) and Intronic (ISE) Splicing Enhancers found by MHMMotif tool. T-test statistics on mouse/rat intronic alignments indicates, that detected elements are on average more conserved as compared to other oligos, which supports our assumption of their functional importance. The tool has been shown to outperform the SpliceView, GeneSplicer, NNSplice, Genio and NetUTR tools for the test set of human genes. SpliceScan outperforms all contemporary ab initio gene structural prediction tools on the set of 5' UTR gene fragments. Conclusion Designed methods have many attractive properties, compared to existing approaches. Bayesian sensor, MHMMotif program and SpliceScan tools are freely available on our web site. Reviewers This article was reviewed by Manyuan Long, Arcady Mushegian and Mikhail Gelfand. PMID:16584568

  16. Introns of plant pri-miRNAs enhance miRNA biogenesis

    PubMed Central

    Bielewicz, Dawid; Kalak, Malgorzata; Kalyna, Maria; Windels, David; Barta, Andrea; Vazquez, Franck; Szweykowska-Kulinska, Zofia; Jarmolowski, Artur


    Plant MIR genes are independent transcription units that encode long primary miRNA precursors, which usually contain introns. For two miRNA genes, MIR163 and MIR161, we show that introns are crucial for the accumulation of proper levels of mature miRNA. Removal of the intron in both cases led to a drop-off in the level of mature miRNAs. We demonstrate that the stimulating effects of the intron mostly reside in the 5′ss rather than on a genuine splicing event. Our findings are biologically significant as the presence of functional splice sites in the MIR163 gene appears mandatory for pathogen-triggered accumulation of miR163 and proper regulation of at least one of its targets. PMID:23681439

  17. U6 snRNA intron insertion occurred multiple times during fungi evolution.


    Canzler, Sebastian; Stadler, Peter F; Hertel, Jana


    U6 small nuclear RNAs are part of the splicing machinery. They exhibit several unique features setting them appart from other snRNAs. Reports of introns in structured non-coding RNAs have been very rare. U6 genes, however, were found to be interrupted by an intron in several Schizosaccharomyces species and in 2 Basidiomycota. We conducted a homology search across 147 currently available fungal genome and identified the U6 genes in all but 2 of them. A detailed comparison of their sequences and predicted secondary structures showed that intron insertion events in the U6 snRNA were much more common in the fungal lineage than previously thought. Their positional distribution across the entire mature snRNA strongly suggests a large number of independent events. All the intron sequences reported here show canonical splice site and branch site motifs indicating that they require the splicesomal pathway for their removal. PMID:26828373

  18. COL5A1: Fine genetic mapping, intron/exon organization, and exclusion as candidate gene in families with tuberous sclerosis complex 1, hereditary hemorrhagic telangiectasia, and Ehlers-Danlos syndrome type II

    SciTech Connect

    Greenspan, D.S.; Papenberg, K.A.; Marchuk, D.A.


    Type V collagen is the only fibrillar collagen which has yet to be implicated in the pathogenesis of genetic diseases in humans or mice. To begin examining the possible role of type V collagen in genetic disease, we have previously mapped COL5A1, the gene for the {alpha}1 chain of type V collagen, to 9q23.2{r_arrow}q34.3 and described two restriction site polymorphisms which allowed us to exclude COL5A1 as candidate gene for nail-patella syndrome. We have now used these polymorphisms to exclude COL5A1 as candidate gene for tuberous sclerosis complex 1 and Ehlers-Danlos syndrome type II. In addition, we describe a CA repeat, with observed heterozygosity of about 0.5, in a COL5A1 intron, which has allowed us to exclude COL5A1 as a candidate gene in hereditary hemorrhagic telangiectasia and to place COL5A1 on the CEPH family genetic map between markers D9S66 and D9S67. We have also determined the entire intron/exon organization of COL5A1, which will facilitate characterization of mutations in genetic diseases with which COL5A1 may be linked in future studies.

  19. The human XPG gene: gene architecture, alternative splicing and single nucleotide polymorphisms

    PubMed Central

    Emmert, Steffen; Schneider, Thomas D.; Khan, Sikandar G.; Kraemer, Kenneth H.


    Defects in the XPG DNA repair endonuclease gene can result in the cancer-prone disorders xeroderma pigmentosum (XP) or the XP–Cockayne syndrome complex. While the XPG cDNA sequence was known, determination of the genomic sequence was required to understand its different functions. In cells from normal donors, we found that the genomic sequence of the human XPG gene spans 30 kb, contains 15 exons that range from 61 to 1074 bp and 14 introns that range from 250 to 5763 bp. Analysis of the splice donor and acceptor sites using an information theory-based approach revealed three splice sites with low information content, which are components of the minor (U12) spliceosome. We identified six alternatively spliced XPG mRNA isoforms in cells from normal donors and from XPG patients: partial deletion of exon 8, partial retention of intron 8, two with alternative exons (in introns 1 and 6) and two that retained complete introns (introns 3 and 9). The amount of alternatively spliced XPG mRNA isoforms varied in different tissues. Most alternative splice donor and acceptor sites had a relatively high information content, but one has the U12 spliceosome sequence. A single nucleotide polymorphism has allele frequencies of 0.74 for 3507G and 0.26 for 3507C in 91 donors. The human XPG gene contains multiple splice sites with low information content in association with multiple alternatively spliced isoforms of XPG mRNA. PMID:11266544

  20. Alternative splicing of the maize Ac transposase transcript in transgenic sugar beet (Beta vulgaris L.)

    PubMed Central

    Lisson, Ralph; Hellert, Jan; Ringleb, Malte; Machens, Fabian; Kraus, Josef


    The maize Activator/Dissociation (Ac/Ds) transposable element system was introduced into sugar beet. The autonomous Ac and non-autonomous Ds element excise from the T-DNA vector and integrate at novel positions in the sugar beet genome. Ac and Ds excisions generate footprints in the donor T-DNA that support the hairpin model for transposon excision. Two complete integration events into genomic sugar beet DNA were obtained by IPCR. Integration of Ac leads to an eight bp duplication, while integration of Ds in a homologue of a sugar beet flowering locus gene did not induce a duplication. The molecular structure of the target site indicates Ds integration into a double strand break. Analyses of transposase transcription using RT–PCR revealed low amounts of alternatively spliced mRNAs. The fourth intron of the transposase was found to be partially misspliced. Four different splice products were identified. In addition, the second and third exon were found to harbour two and three novel introns, respectively. These utilize each the same splice donor but several alternative splice acceptor sites. Using the SplicePredictor online tool, one of the two introns within exon two is predicted to be efficiently spliced in maize. Most interestingly, splicing of this intron together with the four major introns of Ac would generate a transposase that lacks the DNA binding domain and two of its three nuclear localization signals, but still harbours the dimerization domain. PMID:20512402

  1. Alternative splicing of the maize Ac transposase transcript in transgenic sugar beet (Beta vulgaris L.).


    Lisson, Ralph; Hellert, Jan; Ringleb, Malte; Machens, Fabian; Kraus, Josef; Hehl, Reinhard


    The maize Activator/Dissociation (Ac/Ds) transposable element system was introduced into sugar beet. The autonomous Ac and non-autonomous Ds element excise from the T-DNA vector and integrate at novel positions in the sugar beet genome. Ac and Ds excisions generate footprints in the donor T-DNA that support the hairpin model for transposon excision. Two complete integration events into genomic sugar beet DNA were obtained by IPCR. Integration of Ac leads to an eight bp duplication, while integration of Ds in a homologue of a sugar beet flowering locus gene did not induce a duplication. The molecular structure of the target site indicates Ds integration into a double strand break. Analyses of transposase transcription using RT-PCR revealed low amounts of alternatively spliced mRNAs. The fourth intron of the transposase was found to be partially misspliced. Four different splice products were identified. In addition, the second and third exon were found to harbour two and three novel introns, respectively. These utilize each the same splice donor but several alternative splice acceptor sites. Using the SplicePredictor online tool, one of the two introns within exon two is predicted to be efficiently spliced in maize. Most interestingly, splicing of this intron together with the four major introns of Ac would generate a transposase that lacks the DNA binding domain and two of its three nuclear localization signals, but still harbours the dimerization domain. PMID:20512402

  2. A serine–arginine-rich (SR) splicing factor modulates alternative splicing of over a thousand genes in Toxoplasma gondii

    PubMed Central

    Yeoh, Lee M.; Goodman, Christopher D.; Hall, Nathan E.; van Dooren, Giel G.; McFadden, Geoffrey I.; Ralph, Stuart A.


    Single genes are often subject to alternative splicing, which generates alternative mature mRNAs. This phenomenon is widespread in animals, and observed in over 90% of human genes. Recent data suggest it may also be common in Apicomplexa. These parasites have small genomes, and economy of DNA is evolutionarily favoured in this phylum. We investigated the mechanism of alternative splicing in Toxoplasma gondii, and have identified and localized TgSR3, a homologue of ASF/SF2 (alternative-splicing factor/splicing factor 2, a serine-arginine–rich, or SR protein) to a subnuclear compartment. In addition, we conditionally overexpressed this protein, which was deleterious to growth. qRT-PCR was used to confirm perturbation of splicing in a known alternatively-spliced gene. We performed high-throughput RNA-seq to determine the extent of splicing modulated by this protein. Current RNA-seq algorithms are poorly suited to compact parasite genomes, and hence we complemented existing tools by writing a new program, GeneGuillotine, that addresses this deficiency by segregating overlapping reads into distinct genes. In order to identify the extent of alternative splicing, we released another program, JunctionJuror, that detects changes in intron junctions. Using this program, we identified about 2000 genes that were constitutively alternatively spliced in T. gondii. Overexpressing the splice regulator TgSR3 perturbed alternative splicing in over 1000 genes. PMID:25870410

  3. A serine-arginine-rich (SR) splicing factor modulates alternative splicing of over a thousand genes in Toxoplasma gondii.


    Yeoh, Lee M; Goodman, Christopher D; Hall, Nathan E; van Dooren, Giel G; McFadden, Geoffrey I; Ralph, Stuart A


    Single genes are often subject to alternative splicing, which generates alternative mature mRNAs. This phenomenon is widespread in animals, and observed in over 90% of human genes. Recent data suggest it may also be common in Apicomplexa. These parasites have small genomes, and economy of DNA is evolutionarily favoured in this phylum. We investigated the mechanism of alternative splicing in Toxoplasma gondii, and have identified and localized TgSR3, a homologue of ASF/SF2 (alternative-splicing factor/splicing factor 2, a serine-arginine-rich, or SR protein) to a subnuclear compartment. In addition, we conditionally overexpressed this protein, which was deleterious to growth. qRT-PCR was used to confirm perturbation of splicing in a known alternatively-spliced gene. We performed high-throughput RNA-seq to determine the extent of splicing modulated by this protein. Current RNA-seq algorithms are poorly suited to compact parasite genomes, and hence we complemented existing tools by writing a new program, GeneGuillotine, that addresses this deficiency by segregating overlapping reads into distinct genes. In order to identify the extent of alternative splicing, we released another program, JunctionJuror, that detects changes in intron junctions. Using this program, we identified about 2000 genes that were constitutively alternatively spliced in T. gondii. Overexpressing the splice regulator TgSR3 perturbed alternative splicing in over 1000 genes. PMID:25870410

  4. An intronic RNA structure modulates expression of the mRNA biogenesis factor Sus1

    PubMed Central

    AbuQattam, Ali; Gallego, José; Rodríguez-Navarro, Susana


    Sus1 is a conserved protein involved in chromatin remodeling and mRNA biogenesis. Unlike most yeast genes, the SUS1 pre-mRNA of Saccharomyces cerevisiae contains two introns and is alternatively spliced, retaining one or both introns in response to changes in environmental conditions. SUS1 splicing may allow the cell to control Sus1 expression, but the mechanisms that regulate this process remain unknown. Using in silico analyses together with NMR spectroscopy, gel electrophoresis, and UV thermal denaturation experiments, we show that the downstream intron (I2) of SUS1 forms a weakly stable, 37-nucleotide stem–loop structure containing the branch site near its apical loop and the 3′ splice site after the stem terminus. A cellular assay revealed that two of four mutants containing altered I2 structures had significantly impaired SUS1 expression. Semiquantitative RT-PCR experiments indicated that all mutants accumulated unspliced SUS1 pre-mRNA and/or induced distorted levels of fully spliced mRNA relative to wild type. Concomitantly, Sus1 cellular functions in histone H2B deubiquitination and mRNA export were affected in I2 hairpin mutants that inhibited splicing. This work demonstrates that I2 structure is relevant for SUS1 expression, and that this effect is likely exerted through modulation of splicing. PMID:26546116

  5. Involvement of PARP1 in the regulation of alternative splicing

    PubMed Central

    Matveeva, Elena; Maiorano, John; Zhang, Qingyang; Eteleeb, Abdallah M; Convertini, Paolo; Chen, Jing; Infantino, Vittoria; Stamm, Stefan; Wang, Jiping; Rouchka, Eric C; Fondufe-Mittendorf, Yvonne N


    Specialized chromatin structures such as nucleosomes with specific histone modifications decorate exons in eukaryotic genomes, suggesting a functional connection between chromatin organization and the regulation of pre-mRNA splicing. Through profiling the functional location of Poly (ADP) ribose polymerase, we observed that it is associated with the nucleosomes at exon/intron boundaries of specific genes, suggestive of a role for this enzyme in alternative splicing. Poly (ADP) ribose polymerase has previously been implicated in the PARylation of splicing factors as well as regulation of the histone modification H3K4me3, a mark critical for co-transcriptional splicing. In light of these studies, we hypothesized that interaction of the chromatin-modifying factor, Poly (ADP) ribose polymerase with nucleosomal structures at exon–intron boundaries, might regulate pre-mRNA splicing. Using genome-wide approaches validated by gene-specific assays, we show that depletion of PARP1 or inhibition of its PARylation activity results in changes in alternative splicing of a specific subset of genes. Furthermore, we observed that PARP1 bound to RNA, splicing factors and chromatin, suggesting that Poly (ADP) ribose polymerase serves as a gene regulatory hub to facilitate co-transcriptional splicing. These studies add another function to the multi-functional protein, Poly (ADP) ribose polymerase, and provide a platform for further investigation of this protein’s function in organizing chromatin during gene regulatory processes. PMID:27462443

  6. Nanoplasmonic probes of RNA folding and assembly during pre-mRNA splicing

    NASA Astrophysics Data System (ADS)

    Nguyen, Anh H.; Lee, Jong Uk; Sim, Sang Jun


    RNA splicing plays important roles in transcriptome and proteome diversity. Herein, we describe the use of a nanoplasmonic system that unveils RNA folding and assembly during pre-mRNA splicing wherein the quantification of mRNA splice variants is not taken into account. With a couple of SERS-probes and plasmonic probes binding at the boundary sites of exon-2/intron-2 and intron-2/exon-3 of the pre-mature RNA of the β-globin gene, the splicing process brings the probes into the plasmonic bands. For plasmonic probes, a plasmon shift increase of ~29 nm, corresponding to intron removal and exon-2 and exon-3 connection to form the mRNA molecule, is measured by plasmonic coupling. The increased scattering intensity and surface-enhanced Raman scattering (SERS) fingerprinting reveal the clear dynamics of pre-mRNA splicing. Moreover, a time-resolved experiment of individual RNA molecules exhibited a successful splicing and an inhibited splicing event by 33 μM biflavonoid isoginkgetin, a general inhibitor of RNA splicing. The results suggest that the RNA splicing is successfully monitored with the nanoplasmonic system. Thus, this platform can be useful for studying RNA nanotechnology, biomolecular folding, alternative splicing, and maturation of microRNA.

  7. Arabidopsis PTB1 and PTB2 proteins negatively regulate splicing of a mini-exon splicing reporter and affect alternative splicing of endogenous genes differentially.


    Simpson, Craig G; Lewandowska, Dominika; Liney, Michele; Davidson, Diane; Chapman, Sean; Fuller, John; McNicol, Jim; Shaw, Paul; Brown, John W S


    This paper examines the function of Arabidopsis thaliana AtPTB1 and AtPTB2 as plant splicing factors. The effect on splicing of overexpression of AtPTB1 and AtPTB2 was analysed in an in vivo protoplast transient expression system with a novel mini-exon splicing reporter. A range of mutations in pyrimidine-rich sequences were compared with and without AtPTB and NpU2AF65 overexpression. Splicing analyses of constructs in protoplasts and RNA from overexpression lines used high-resolution reverse transcription polymerase chain reaction (RT-PCR). AtPTB1 and AtPTB2 reduced inclusion/splicing of the potato invertase mini-exon splicing reporter, indicating that these proteins can repress plant intron splicing. Mutation of the polypyrimidine tract and closely associated Cytosine and Uracil-rich (CU-rich) sequences, upstream of the mini-exon, altered repression by AtPTB1 and AtPTB2. Coexpression of a plant orthologue of U2AF65 alleviated the splicing repression of AtPTB1. Mutation of a second CU-rich upstream of the mini-exon 3' splice site led to a decline in mini-exon splicing, indicating the presence of a splicing enhancer sequence. Finally, RT-PCR of AtPTB overexpression lines with c. 90 known alternative splicing (AS) events showed that AtPTBs significantly altered AS of over half the events. AtPTB1 and AtPTB2 are splicing factors that influence alternative splicing. This occurs in the potato invertase mini-exon via the polypyrimidine tract and associated pyrimidine-rich sequence. PMID:24749484

  8. The correlation between intron length and recombination in drosophila. Dynamic equilibrium between mutational and selective forces.


    Comeron, J M; Kreitman, M


    Intron length is negatively correlated with recombination in both Drosophila melanogaster and humans. This correlation is not likely to be the result of mutational processes alone: evolutionary analysis of intron length polymorphism in D. melanogaster reveals equivalent ratios of deletion to insertion in regions of high and low recombination. The polymorphism data do reveal, however, an excess of deletions relative to insertions (i.e., a deletion bias), with an overall deletion-to-insertion events ratio of 1.35. We propose two types of selection favoring longer intron lengths. First, the natural mutational bias toward deletion must be opposed by strong selection in very short introns to maintain the minimum intron length needed for the intron splicing reaction. Second, selection will favor insertions in introns that increase recombination between mutations under the influence of selection in adjacent exons. Mutations that increase recombination, even slightly, will be selectively favored because they reduce interference among selected mutations. Interference selection acting on intron length mutations must be very weak, as indicated by frequency spectrum analysis of Drosophila intron length polymorphism, making the equilibrium for intron length sensitive to changes in the recombinational environment and population size. One consequence of this sensitivity is that the advantage of longer introns is expected to decrease inversely with the rate of recombination, thus leading to a negative correlation between intron length and recombination rate. Also in accord with this model, intron length differs between closely related Drosophila species, with the longest variant present more often in D. melanogaster than in D. simulans. We suggest that the study of the proposed dynamic model, taking into account interference among selected sites, might shed light on many aspects of the comparative biology of genome sizes including the C value paradox. PMID:11063693

  9. Associations between intronic non-B DNA structures and exon skipping

    PubMed Central

    Tsai, Zing Tsung-Yeh; Chu, Wen-Yi; Cheng, Jen-Hao; Tsai, Huai-Kuang


    Non-B DNA structures are abundant in the genome and are often associated with critical biological processes, including gene regulation, chromosome rearrangement and genome stabilization. In particular, G-quadruplex (G4) may affect alternative splicing based on its ability to impede the activity of RNA polymerase II. However, the specific role of non-B DNA structures in splicing regulation still awaits investigation. Here, we provide a genome-wide and cross-species investigation of the associations between five non-B DNA structures and exon skipping. Our results indicate a statistically significant correlation of each examined non-B DNA structures with exon skipping in both human and mouse. We further show that the contributions of non-B DNA structures to exon skipping are influenced by the occurring region. These correlations and contributions are also significantly different in human and mouse. Finally, we detailed the effects of G4 by showing that occurring on the template strand and the length of G-run, which is highly related to the stability of a G4 structure, are significantly correlated with exon skipping activity. We thus show that, in addition to the well-known effects of RNA and protein structure, the relative positional arrangement of intronic non-B DNA structures may also impact exon skipping. PMID:24153112

  10. Purifying Selection on Exonic Splice Enhancers in Intronless Genes.


    Savisaar, Rosina; Hurst, Laurence D


    Exonic splice enhancers (ESEs) are short nucleotide motifs, enriched near exon ends, that enhance the recognition of the splice site and thus promote splicing. Are intronless genes under selection to avoid these motifs so as not to attract the splicing machinery to an mRNA that should not be spliced, thereby preventing the production of an aberrant transcript? Consistent with this possibility, we find that ESEs in putative recent retrocopies are at a higher density and evolving faster than those in other intronless genes, suggesting that they are being lost. Moreover, intronless genes are less dense in putative ESEs than intron-containing ones. However, this latter difference is likely due to the skewed base composition of intronless sequences, a skew that is in line with the general GC richness of few exon genes. Indeed, after controlling for such biases, we find that both intronless and intron-containing genes are denser in ESEs than expected by chance. Importantly, nucleotide-controlled analysis of evolutionary rates at synonymous sites in ESEs indicates that the ESEs in intronless genes are under purifying selection in both human and mouse. We conclude that on the loss of introns, some but not all, ESE motifs are lost, the remainder having functions beyond a role in splice promotion. These results have implications for the design of intronless transgenes and for understanding the causes of selection on synonymous sites. PMID:26802218

  11. Purifying Selection on Exonic Splice Enhancers in Intronless Genes

    PubMed Central

    Savisaar, Rosina; Hurst, Laurence D.


    Exonic splice enhancers (ESEs) are short nucleotide motifs, enriched near exon ends, that enhance the recognition of the splice site and thus promote splicing. Are intronless genes under selection to avoid these motifs so as not to attract the splicing machinery to an mRNA that should not be spliced, thereby preventing the production of an aberrant transcript? Consistent with this possibility, we find that ESEs in putative recent retrocopies are at a higher density and evolving faster than those in other intronless genes, suggesting that they are being lost. Moreover, intronless genes are less dense in putative ESEs than intron-containing ones. However, this latter difference is likely due to the skewed base composition of intronless sequences, a skew that is in line with the general GC richness of few exon genes. Indeed, after controlling for such biases, we find that both intronless and intron-containing genes are denser in ESEs than expected by chance. Importantly, nucleotide-controlled analysis of evolutionary rates at synonymous sites in ESEs indicates that the ESEs in intronless genes are under purifying selection in both human and mouse. We conclude that on the loss of introns, some but not all, ESE motifs are lost, the remainder having functions beyond a role in splice promotion. These results have implications for the design of intronless transgenes and for understanding the causes of selection on synonymous sites. PMID:26802218

  12. a Simple Symmetric Algorithm Using a Likeness with Introns Behavior in RNA Sequences

    NASA Astrophysics Data System (ADS)

    Regoli, Massimo


    The RNA-Crypto System (shortly RCS) is a symmetric key algorithm to cipher data. The idea for this new algorithm starts from the observation of nature. In particular from the observation of RNA behavior and some of its properties. The RNA sequences has some sections called Introns. Introns, derived from the term "intragenic regions", are non-coding sections of precursor mRNA (pre-mRNA) or other RNAs, that are removed (spliced out of the RNA) before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are known as introns as well. The nature and the role of Introns in the pre-mRNA is not clear and it is under ponderous researches by Biologists but, in our case, we will use the presence of Introns in the RNA-Crypto System output as a strong method to add chaotic non coding information and an unnecessary behaviour in the access to the secret key to code the messages. In the RNA-Crypto System algoritnm the introns are sections of the ciphered message with non-coding information as well as in the precursor mRNA.

  13. Pre-Mrna Introns as a Model for Cryptographic Algorithm:. Theory and Experiments

    NASA Astrophysics Data System (ADS)

    Regoli, Massimo


    The RNA-Crypto System (shortly RCS) is a symmetric key algorithm to cipher data. The idea for this new algorithm starts from the observation of nature. In particular from the observation of RNA behavior and some of its properties. In particular the RNA sequences have some sections called Introns. Introns, derived from the term "intragenic regions", are non-coding sections of precursor mRNA (pre-mRNA) or other RNAs, that are removed (spliced out of the RNA) before the mature RNA is formed. Once the introns have been spliced out of a pre-mRNA, the resulting mRNA sequence is ready to be translated into a protein. The corresponding parts of a gene are known as introns as well. The nature and the role of Introns in the pre-mRNA is not clear and it is under ponderous researches by Biologists but, in our case, we will use the presence of Introns in the RNA-Crypto System output as a strong method to add chaotic non coding information and an unnecessary behaviour in the access to the secret key to code the messages. In the RNA-Crypto System algorithm the introns are sections of the ciphered message with non-coding information as well as in the precursor mRNA.

  14. Stable intronic sequence RNAs (sisRNAs): a new layer of gene regulation.


    Osman, Ismail; Tay, Mandy Li-Ian; Pek, Jun Wei


    Upon splicing, introns are rapidly degraded. Hence, RNAs derived from introns are commonly deemed as junk sequences. However, the discoveries of intronic-derived small nucleolar RNAs (snoRNAs), small Cajal body associated RNAs (scaRNAs) and microRNAs (miRNAs) suggested otherwise. These non-coding RNAs are shown to play various roles in gene regulation. In this review, we highlight another class of intron-derived RNAs known as stable intronic sequence RNAs (sisRNAs). sisRNAs have been observed since the 1980 s; however, we are only beginning to understand their biological significance. Recent studies have shown or suggested that sisRNAs regulate their own host's gene expression, function as molecular sinks or sponges, and regulate protein translation. We propose that sisRNAs function as an additional layer of gene regulation in the cells. PMID:27147469

  15. Alternative splicing acting as a bridge in evolution

    PubMed Central

    Salamov, Asaf; Kuo, Alan; Aerts, Andrea L.; Kong, Xiangyang; Grigoriev, Igor V.


    Background Alternative splicing (AS) regulates diverse cellular and developmental functions through alternative protein structures of different isoforms. Alternative exons dominate AS in vertebrates; however, very little is known about the extent and function of AS in lower eukaryotes. To understand the role of introns in gene evolution, we examined AS from a green algal and five fungal genomes using a novel EST-based gene-modeling algorithm (COMBEST). Methods AS from each genome was classified with COMBEST that maps EST sequences to genomes to build gene models. Various aspects of AS were analyzed through statistical methods. The interplay of intron 3n length, phase, coding property, and intron retention (RI) were examined with Chi-square testing. Results With 3 to 834 times EST coverage, we identified up to 73% of AS in intron-containing genes and found preponderance of RI among 11 types of AS. The number of exons, expression level, and maximum intron length correlated with number of AS per gene (NAG), and intron-rich genes suppressed AS. Genes with AS were more ancient, and AS was conserved among fungal genomes. Among stopless introns, non-retained introns (NRI) avoided, but major RI preferred 3n length. In contrast, stop-containing introns showed uniform distribution among 3n, 3n+1, and 3n+2 lengths. We found a clue to the intron phase enigma: it was the coding function of introns involved in AS that dictates the intron phase bias. Conclusions Majority of AS is non-functional, and the extent of AS is suppressed for intron-rich genes. RI through 3n length, stop codon, and phase bias bridges the transition from functionless to functional alternative isoforms. PMID:27358887

  16. Optimal antisense target reducing INS intron 1 retention is adjacent to a parallel G quadruplex

    PubMed Central

    Kralovicova, Jana; Lages, Ana; Patel, Alpa; Dhir, Ashish; Buratti, Emanuele; Searle, Mark; Vorechovsky, Igor


    Splice-switching oligonucleotides (SSOs) have been widely used to inhibit exon usage but antisense strategies that promote removal of entire introns to increase splicing-mediated gene expression have not been developed. Here we show reduction of INS intron 1 retention by SSOs that bind transcripts derived from a human haplotype expressing low levels of proinsulin. This haplotype is tagged by a polypyrimidine tract variant rs689 that decreases the efficiency of intron 1 splicing and increases the relative abundance of mRNAs with extended 5' untranslated region (5' UTR), which curtails translation. Co-expression of haplotype-specific reporter constructs with SSOs bound to splicing regulatory motifs and decoy splice sites in primary transcripts revealed a motif that significantly reduced intron 1-containing mRNAs. Using an antisense microwalk at a single nucleotide resolution, the optimal target was mapped to a splicing silencer containing two pseudoacceptor sites sandwiched between predicted RNA guanine (G) quadruplex structures. Circular dichroism spectroscopy and nuclear magnetic resonance of synthetic G-rich oligoribonucleotide tracts derived from this region showed formation of a stable parallel 2-quartet G-quadruplex on the 3' side of the antisense retention target and an equilibrium between quadruplexes and stable hairpin-loop structures bound by optimal SSOs. This region interacts with heterogeneous nuclear ribonucleoproteins F and H that may interfere with conformational transitions involving the antisense target. The SSO-assisted promotion of weak intron removal from the 5' UTR through competing noncanonical and canonical RNA structures may facilitate development of novel strategies to enhance gene expression. PMID:24944197

  17. Characterization of I-Ppo, an intron-encoded endonuclease that mediates homing of a group I intron in the ribosomal DNA of Physarum polycephalum.

    PubMed Central

    Muscarella, D E; Ellison, E L; Ruoff, B M; Vogt, V M


    A novel and only recently recognized class of enzymes is composed of the site-specific endonucleases encoded by some group I introns. We have characterized several aspects of I-Ppo, the endonuclease that mediates the mobility of intron 3 in the ribosomal DNA of Physarum polycephalum. This intron is unique among mobile group I introns in that it is located in nuclear DNA. We found that I-Ppo is encoded by an open reading frame in the 5' half of intron 3, upstream of the sequences required for self-splicing of group I introns. Either of two AUG initiation codons could start this reading frame, one near the beginning of the intron and the other in the upstream exon, leading to predicted polypeptides of 138 and 160 amino acid residues. The longer polypeptide was the major form translated in vitro in a reticulocyte extract. From nuclease assays of proteins synthesized in vitro with partially deleted DNAs, we conclude that both polypeptides possess endonuclease activity. We also have expressed I-Ppo in Escherichia coli, using a bacteriophage T7 RNA polymerase expression system. The longer polypeptide also was the predominant form made in this system. It showed enzymatic activity in bacteria in vivo, as demonstrated by the cleavage of a plasmid carrying the target site. Like several other intron-encoded endonucleases, I-Ppo makes a four-base staggered cut in its ribosomal DNA target sequence, very near the site where intron 3 becomes integrated in crosses of intron 3-containing and intron 3-lacking Physarum strains. Images PMID:2355911

  18. Virus deletion mutants that affect a 3' splice site in the E3 transcription unit of adenovirus 2.

    PubMed Central

    Bhat, B M; Brady, H A; Wold, W S


    Five viable virus mutants were constructed with deletions near a 3' splice site located at nucleotide 2157 in the E3 transcription unit of adenovirus 2. The mutants were examined for splicing activity at the 2157 3' splice site in vivo by nuclease-gel analysis of steady-state cytoplasmic mRNA. Splicing was not prevented by an exon deletion (dl719) that leaves 16 5'-proximal exon nucleotides intact or by intron deletions that leave 34 (dl717, dl712) or 18 (dl716) 3'-proximal intron nucleotides intact. The sequences deleted in one of these intron mutants (dl716) include the putative branchpoint site used in lariat formation during splicing. Thus, a surrogate branchpoint site apparently can be used for splicing. Another intron mutant (dl714) has a deletion that leaves 15 3'-proximal intron nucleotides intact; remarkably, this deletion virtually abolished splicing, even though the deletion is only 3 nucleotides closer to the splice site than is the deletion in dl716 which splices normally. The three nucleotides deleted in dl714 that are retained by dl716 are the sequence TGT. The TGT sequence is located on the 5' boundary of the pyrimidine-rich region upstream of the nucleotide 2157 3' splice site. Such pyrimidine-rich regions are ubiquitous at 3' splice sites. Most likely, the TGT is required for splicing at the nucleotide 2157 3' splice site. The TGT may be important because of its specific sequence or because it forms the 5' boundary of the pyrimidine-rich region. Images PMID:3879768

  19. Mutations that alter RNA splicing of the human HPRT gene: a review of the spectrum.


    O'Neill, J P; Rogan, P K; Cariello, N; Nicklas, J A


    The human HPRT gene contains spans approximately 42,000 base pairs in genomic DNA, has a mRNA of approximately 900 bases and a protein coding sequence of 657 bases (initiation codon AUG to termination codon UAA). This coding sequence is distributed into 9 exons ranging from 18 (exon 5) to 184 (exon 3) base pairs. Intron sizes range from 170 (intron 7) to 13,075 (intron 1) base pairs. In a database of human HPRT mutations, 277 of 2224 (12.5%) mutations result in alterations in splicing of the mRNA as analyzed by both reverse transcriptase mediated production of a cDNA followed by PCR amplification and cDNA sequencing and by genomic DNA PCR amplification and sequencing. Mutations have been found in all eight 5' (donor) and 3' (acceptor) splice sequences. Mutations in the 5' splice sequences of introns 1 and 5 result in intron inclusion in the cDNA due to the use of cryptic donor splice sequences within the introns; mutations in the other six 5' sites result in simple exon exclusion. Mutations in the 3' splice sequences of introns 1, 3, 7 and 8 result in partial exon exclusion due to the use of cryptic acceptor splice sequences within the exons; mutations in the other four 3' sites result in simple exon exclusion. A base substitution in exon 3 (209G-->T) creates a new 5' (donor) splice site which results in the exclusion of 110 bases of exon 3 from the cDNA. Two base substitutions in intron 8 (IVS8-16G-->A and IVS8-3T-->G) result in the inclusion of intron 8 sequences in the cDNA due to the creation of new 3' (acceptor) splice sites. Base substitution within exons 1, 3, 4, 6 and 8 also result in splice alterations in cDNA. Those in exons 1 and 6 are at the 3' end of the exon and may directly affect splicing. Those within exons 3 and 4 may be the result of the creation of nonsense codons, while those in exon 8 cannot be explained by this mechanism. Lastly, many mutations that affect splicing of the HPRT mRNA have pleiotropic effects in that multiple cDNA products are

  20. Transcriptome Bioinformatical Analysis of Vertebrate Stages of Schistosoma japonicum Reveals Alternative Splicing Events

    PubMed Central

    Wang, Xinye; Xu, Xindong; Lu, Xingyu; Zhang, Yuanbin; Pan, Weiqing


    Alternative splicing is a molecular process that contributes greatly to the diversification of proteome and to gene functions. Understanding the mechanisms of stage-specific alternative splicing can provide a better understanding of the development of eukaryotes and the functions of different genes. Schistosoma japonicum is an infectious blood-dwelling trematode with a complex lifecycle that causes the tropical disease schistosomiasis. In this study, we analyzed the transcriptome of Schistosoma japonicum to discover alternative splicing events in this parasite, by applying RNA-seq to cDNA library of adults and schistosomula. Results were validated by RT-PCR and sequencing. We found 11,623 alternative splicing events among 7,099 protein encoding genes and average proportion of alternative splicing events per gene was 42.14%. We showed that exon skip is the most common type of alternative splicing events as found in high eukaryotes, whereas intron retention is the least common alternative splicing type. According to intron boundary analysis, the parasite possesses same intron boundaries as other organisms, namely the classic “GT-AG” rule. And in alternative spliced introns or exons, this rule is less strict. And we have attempted to detect alternative splicing events in genes encoding proteins with signal peptides and transmembrane helices, suggesting that alternative splicing could change subcellular locations of specific gene products. Our results indicate that alternative splicing is prevalent in this parasitic worm, and that the worm is close to its hosts. The revealed secretome involved in alternative splicing implies new perspective into understanding interaction between the parasite and its host. PMID:26407301

  1. Transcriptome Bioinformatical Analysis of Vertebrate Stages of Schistosoma japonicum Reveals Alternative Splicing Events.


    Wang, Xinye; Xu, Xindong; Lu, Xingyu; Zhang, Yuanbin; Pan, Weiqing


    Alternative splicing is a molecular process that contributes greatly to the diversification of proteome and to gene functions. Understanding the mechanisms of stage-specific alternative splicing can provide a better understanding of the development of eukaryotes and the functions of different genes. Schistosoma japonicum is an infectious blood-dwelling trematode with a complex lifecycle that causes the tropical disease schistosomiasis. In this study, we analyzed the transcriptome of Schistosoma japonicum to discover alternative splicing events in this parasite, by applying RNA-seq to cDNA library of adults and schistosomula. Results were validated by RT-PCR and sequencing. We found 11,623 alternative splicing events among 7,099 protein encoding genes and average proportion of alternative splicing events per gene was 42.14%. We showed that exon skip is the most common type of alternative splicing events as found in high eukaryotes, whereas intron retention is the least common alternative splicing type. According to intron boundary analysis, the parasite possesses same intron boundaries as other organisms, namely the classic "GT-AG" rule. And in alternative spliced introns or exons, this rule is less strict. And we have attempted to detect alternative splicing events in genes encoding proteins with signal peptides and transmembrane helices, suggesting that alternative splicing could change subcellular locations of specific gene products. Our results indicate that alternative splicing is prevalent in this parasitic worm, and that the worm is close to its hosts. The revealed secretome involved in alternative splicing implies new perspective into understanding interaction between the parasite and its host. PMID:26407301

  2. Biomedical Impact of Splicing Mutations Revealed through Exome Sequencing

    PubMed Central

    Taneri, Bahar; Asilmaz, Esra; Gaasterland, Terry


    Splicing is a cellular mechanism, which dictates eukaryotic gene expression by removing the noncoding introns and ligating the coding exons in the form of a messenger RNA molecule. Alternative splicing (AS) adds a major level of complexity to this mechanism and thus to the regulation of gene expression. This widespread cellular phenomenon generates multiple messenger RNA isoforms from a single gene, by utilizing alternative splice sites and promoting different exon–intron inclusions and exclusions. AS greatly increases the coding potential of eukaryotic genomes and hence contributes to the diversity of eukaryotic proteomes. Mutations that lead to disruptions of either constitutive splicing or AS cause several diseases, among which are myotonic dystrophy and cystic fibrosis. Aberrant splicing is also well established in cancer states. Identification of rare novel mutations associated with splice-site recognition, and splicing regulation in general, could provide further insight into genetic mechanisms of rare diseases. Here, disease relevance of aberrant splicing is reviewed, and the new methodological approach of starting from disease phenotype, employing exome sequencing and identifying rare mutations affecting splicing regulation is described. Exome sequencing has emerged as a reliable method for finding sequence variations associated with various disease states. To date, genetic studies using exome sequencing to find disease-causing mutations have focused on the discovery of nonsynonymous single nucleotide polymorphisms that alter amino acids or introduce early stop codons, or on the use of exome sequencing as a means to genotype known single nucleotide polymorphisms. The involvement of splicing mutations in inherited diseases has received little attention and thus likely occurs more frequently than currently estimated. Studies of exome sequencing followed by molecular and bioinformatic analyses have great potential to reveal the high impact of splicing

  3. Genomic features defining exonic variants that modulate splicing

    PubMed Central


    Background Single point mutations at both synonymous and non-synonymous positions within exons can have severe effects on gene function through disruption of splicing. Predicting these mutations in silico purely from the genomic sequence is difficult due to an incomplete understanding of the multiple factors that may be responsible. In addition, little is known about which computational prediction approaches, such as those involving exonic splicing enhancers and exonic splicing silencers, are most informative. Results We assessed the features of single-nucleotide genomic variants verified to cause exon skipping and compared them to a large set of coding SNPs common in the human population, which are likely to have no effect on splicing. Our findings implicate a number of features important for their ability to discriminate splice-affecting variants, including the naturally occurring density of exonic splicing enhancers and exonic splicing silencers of the exon and intronic environment, extensive changes in the number of predicted exonic splicing enhancers and exonic splicing silencers, proximity to the splice junctions and evolutionary constraint of the region surrounding the variant. By extending this approach to additional datasets, we also identified relevant features of variants that cause increased exon inclusion and ectopic splice site activation. Conclusions We identified a number of features that have statistically significant representation among exonic variants that modulate splicing. These analyses highlight putative mechanisms responsible for splicing outcome and emphasize the role of features important for exon definition. We developed a web-tool, Skippy, to score coding variants for these relevant splice-modulating features. PMID:20158892

  4. Spliceosomal DEAH-Box ATPases Remodel Pre-mRNA to Activate Alternative Splice Sites.


    Semlow, Daniel R; Blanco, Mario R; Walter, Nils G; Staley, Jonathan P


    During pre-mRNA splicing, a central step in the expression and regulation of eukaryotic genes, the spliceosome selects splice sites for intron excision and exon ligation. In doing so, the spliceosome must distinguish optimal from suboptimal splice sites. At the catalytic stage of splicing, suboptimal splice sites are repressed by the DEAH-box ATPases Prp16 and Prp22. Here, using budding yeast, we show that these ATPases function further by enabling the spliceosome to search for and utilize alternative branch sites and 3' splice sites. The ATPases facilitate this search by remodeling the splicing substrate to disengage candidate splice sites. Our data support a mechanism involving 3' to 5' translocation of the ATPases along substrate RNA and toward a candidate site, but, surprisingly, not across the site. Thus, our data implicate DEAH-box ATPases in acting at a distance by pulling substrate RNA from the catalytic core of the spliceosome. PMID:26919433

  5. Exon circularization requires canonical splice signals.


    Starke, Stefan; Jost, Isabelle; Rossbach, Oliver; Schneider, Tim; Schreiner, Silke; Hung, Lee-Hsueh; Bindereif, Albrecht


    Circular RNAs (circRNAs), an abundant class of noncoding RNAs in higher eukaryotes, are generated from pre-mRNAs by circularization of adjacent exons. Using a set of 15 circRNAs, we demonstrated their cell-type-specific expression and circular versus linear processing in mammalian cells. Northern blot analysis combined with RNase H cleavage conclusively proved a circular configuration for two examples, LPAR1 and HIPK3. To address the circularization mechanism, we analyzed the sequence requirements using minigenes derived from natural circRNAs. Both canonical splice sites are required for circularization, although they vary in flexibility and potential use of cryptic sites. Surprisingly, we found that no specific circRNA exon sequence is necessary and that potential flanking intron structures can modulate circularization efficiency. In combination with splice inhibitor assays, our results argue that the canonical spliceosomal machinery functions in circRNA biogenesis, constituting an alternative splicing mode. PMID:25543144

  6. Four novel cystic fibrosis mutations in splice junction sequences affecting the CFTR nucleotide binding folds

    SciTech Connect

    Doerk, T.; Wulbrand, U.; Tuemmler, B. )


    Single cases of the four novel splice site mutations 1525[minus]1 G [r arrow] A (intron 9), 3601[minus]2 A [r arrow] G (intron 18), 3850[minus]3 T [r arrow] G (intron 19), and 4374+1 G [r arrow] T (intron 23) were detected in the CFTR gene of cystic fibrosis patients of Indo-Iranian, Turkish, Polish, and Germany descent. The nucleotide substitutions at the +1, [minus]1, and [minus]2 positions all destroy splice sites and lead to severe disease alleles associated with features typical of gastrointestinal and pulmonary cystic fibrosis disease. The 3850[minus]3 T-to-G change was discovered in a very mildly affected 33-year-old [Delta]F508 compound heterozygote, suggesting that the T-to-G transversion at the less conserved [minus]3 position of the acceptor splice site may retain some wildtype function. 13 refs., 1 fig., 2 tabs.

  7. From Cryptic Toward Canonical Pre-mRNA Splicing in Pompe Disease: a Pipeline for the Development of Antisense Oligonucleotides.


    Bergsma, Atze J; In 't Groen, Stijn Lm; Verheijen, Frans W; van der Ploeg, Ans T; Pijnappel, Wwm Pim


    While 9% of human pathogenic variants have an established effect on pre-mRNA splicing, it is suspected that an additional 20% of otherwise classified variants also affect splicing. Aberrant splicing includes disruption of splice sites or regulatory elements, or creation or strengthening of cryptic splice sites. For the majority of variants, it is poorly understood to what extent and how these may affect splicing. We have identified cryptic splicing in an unbiased manner. Three types of cryptic splicing were analyzed in the context of pathogenic variants in the acid α-glucosidase gene causing Pompe disease. These involved newly formed deep intronic or exonic cryptic splice sites, and a natural cryptic splice that was utilized due to weakening of a canonical splice site. Antisense oligonucleotides that targeted the identified cryptic splice sites repressed cryptic splicing at the expense of canonical splicing in all three cases, as shown by reverse-transcriptase-quantitative polymerase chain reaction analysis and by enhancement of acid α-glucosidase enzymatic activity. This argues for a competition model for available splice sites, including intact or weakened canonical sites and natural or newly formed cryptic sites. The pipeline described here can detect cryptic splicing and correct canonical splicing using antisense oligonucleotides to restore the gene defect. PMID:27623443

  8. Genome-wide survey of Alternative Splicing in Sorghum Bicolor.


    Panahi, Bahman; Abbaszadeh, Bahram; Taghizadeghan, Mehdi; Ebrahimie, Esmaeil


    Sorghum bicolor is a member of grass family which is an attractive model plant for genome study due to interesting genome features like low genome size. In this research, we performed comprehensive investigation of Alternative Splicing and ontology aspects of genes those have undergone these events in sorghum bicolor. We used homology based alignments between gene rich transcripts, represented by tentative consensus (TC) transcript sequences, and genomic scaffolds to deduce the structure of genes and identify alternatively spliced transcripts in sorghum. Using homology mapping of assembled expressed sequence tags with genomics data, we identified 2,137 Alternative Splicing events in S. bicolor. Our study showed that complex events and intron retention are the main types of Alternative Splicing events in S. bicolor and highlights the prevalence of splicing site recognition for definition of introns in this plant. Annotations of the alternatively spliced genes revealed that they represent diverse biological process and molecular functions, suggesting a fundamental role for Alternative Splicing in affecting the development and physiology of S. bicolor. PMID:25049459

  9. The Silent Sway of Splicing by Synonymous Substitutions.


    Mueller, William F; Larsen, Liza S Z; Garibaldi, Angela; Hatfield, G Wesley; Hertel, Klemens J


    Alternative splicing diversifies mRNA transcripts in human cells. This sequence-driven process can be influenced greatly by mutations, even those that do not change the protein coding potential of the transcript. Synonymous mutations have been shown to alter gene expression through modulation of splicing, mRNA stability, and translation. Using a synonymous position mutation library in SMN1 exon 7, we show that 23% of synonymous mutations across the exon decrease exon inclusion, suggesting that nucleotide identity across the entire exon has been evolutionarily optimized to support a particular exon inclusion level. Although phylogenetic conservation scores are insufficient to identify synonymous positions important for exon inclusion, an alignment of organisms filtered based on similar exon/intron architecture is highly successful. Although many of the splicing neutral mutations are observed to occur, none of the exon inclusion reducing mutants was found in the filtered alignment. Using the modified phylogenetic comparison as an approach to evaluate the impact on pre-mRNA splicing suggests that up to 45% of synonymous SNPs are likely to alter pre-mRNA splicing. These results demonstrate that coding and pre-mRNA splicing pressures co-evolve and that a modified phylogenetic comparison based on the exon/intron architecture is a useful tool in identifying splice altering SNPs. PMID:26424794

  10. Splicing defects in the ataxia-telangiectasia gene, ATM: underlying mutations and consequences.

    PubMed Central

    Teraoka, S N; Telatar, M; Becker-Catania, S; Liang, T; Onengüt, S; Tolun, A; Chessa, L; Sanal, O; Bernatowska, E; Gatti, R A; Concannon, P


    Mutations resulting in defective splicing constitute a significant proportion (30/62 [48%]) of a new series of mutations in the ATM gene in patients with ataxia-telangiectasia (AT) that were detected by the protein-truncation assay followed by sequence analysis of genomic DNA. Fewer than half of the splicing mutations involved the canonical AG splice-acceptor site or GT splice-donor site. A higher percentage of mutations occurred at less stringently conserved sites, including silent mutations of the last nucleotide of exons, mutations in nucleotides other than the conserved AG and GT in the consensus splice sites, and creation of splice-acceptor or splice-donor sites in either introns or exons. These splicing mutations led to a variety of consequences, including exon skipping and, to a lesser degree, intron retention, activation of cryptic splice sites, or creation of new splice sites. In addition, 5 of 12 nonsense mutations and 1 missense mutation were associated with deletion in the cDNA of the exons in which the mutations occurred. No ATM protein was detected by western blotting in any AT cell line in which splicing mutations were identified. Several cases of exon skipping in both normal controls and patients for whom no underlying defect could be found in genomic DNA were also observed, suggesting caution in the interpretation of exon deletions observed in ATM cDNA when there is no accompanying identification of genomic mutations. PMID:10330348

  11. MapNext: a software tool for spliced and unspliced alignments and SNP detection of short sequence reads

    PubMed Central


    Background Next-generation sequencing technologies provide exciting avenues for studies of transcriptomics and population genomics. There is an increasing need to conduct spliced and unspliced alignments of short transcript reads onto a reference genome and estimate minor allele frequency from sequences of population samples. Results We have designed and implemented MapNext, a software tool for both spliced and unspliced alignments of short sequence reads onto reference sequences, and automated SNP detection using neighbourhood quality standards. MapNext provides four main analyses: (i) unspliced alignment and clustering of reads, (ii) spliced alignment of transcript reads over intron boundaries, (iii) SNP detection and estimation of minor allele frequency from population sequences, and (iv) storage of result data in a database to make it available for more flexible queries and for further analyses. The software tool has been tested using both simulated and real data. Conclusion MapNext is a comprehensive and powerful tool for both spliced and unspliced alignments of short reads and automated SNP detection from population sequences. The simplicity, flexibility and efficiency of MapNext makes it a valuable tool for transcriptomic and population genomic research. PMID:19958476

  12. Structure and activity of putative intronic miRNA promoters.


    Monteys, Alex Mas; Spengler, Ryan M; Wan, Ji; Tecedor, Luis; Lennox, Kimberly A; Xing, Yi; Davidson, Beverly L


    MicroRNAs (miRNAs) are RNA sequences of approximately 22 nucleotides that mediate post-transcriptional regulation of specific mRNAs. miRNA sequences are dispersed throughout the genome and are classified as intergenic (between genes) or intronic (embedded into a gene). Intergenic miRNAs are expressed by their own promoter, and until recently, it was supposed that intronic miRNAs are transcribed from their host gene. Here, we performed a genomic analysis of currently known intronic miRNA regions and observed that approximately 35% of intronic miRNAs have upstream regulatory elements consistent with promoter function. Among all intronic miRNAs, 30% have associated Pol II regulatory elements, including transcription start sites, CpG islands, expression sequence tags, and conserved transcription factor binding sites, while 5% contain RNA Pol III regulatory elements (A/B box sequences). We cloned intronic regions encompassing miRNAs and their upstream Pol II (miR-107, miR-126, miR-208b, miR-548f-2, miR-569, and miR-590) or Pol III (miR-566 and miR-128-2) sequences into a promoterless plasmid, and confirmed that miRNA expression occurs independent of host gene transcription. For miR-128-2, a miRNA overexpressed in acute lymphoblastic leukemia, ChIP analysis suggests dual regulation by both intronic (Pol III) and host gene (Pol II) promoters. These data support complex regulation of intronic miRNA expression, and have relevance to disregulation in disease settings. PMID:20075166

  13. Reverse transcriptase activity of an intron encoded polypeptide.

    PubMed Central

    Fassbender, S; Brühl, K H; Ciriacy, M; Kück, U


    A number of group II introns from eukaryotic organelles and prokaryotes contain open reading frames for polypeptides with homology to retroviral reverse transcriptases (RTs). We have used the yeast transposon (Ty) system to express ORFs for RTs from eukaryotic organelles. This includes the mitochondrial coxI intron i1 from the fungus Podospora anserina, the plastid petD intron from the alga Scenedesmus obliquus and the mitochondrial RTL gene from the alga Chlamydomonas reinhardtii. The ORFs were fused with the TYA ORF from the yeast retrotransposon Ty to produce virus-like particles in the recipient strains with detectable amounts of the RT-like polypeptides. Analysis of the heterologous gene products revealed biochemical evidence that the P. anserina intron encodes an RNA-directed DNA polymerase with properties typically found for RTs of viral or retrotransposable origin. In vitro assays showed that the intron encoded RT is sensitive to RT inhibitors such as N-ethylmaleimide and dideoxythymidine triphosphate but is insensitive against the DNA polymerase inhibitor aphidicolin. The direct biochemical evidence provided here supports the idea that intron encoded RTs are involved in intron transposition events. Images PMID:7514530

  14. Multiple interdependent sequence elements control splicing of a fibroblast growth factor receptor 2 alternative exon.

    PubMed Central

    Del Gatto, F; Plet, A; Gesnel, M C; Fort, C; Breathnach, R


    The fibroblast growth factor receptor 2 gene contains a pair of mutually exclusive alternative exons, one of which (K-SAM) is spliced specifically in epithelial cells. We have described previously (F. Del Gatto and R. Breathnach, Mol. Cell. Biol. 15:4825-4834, 1995) some elements controlling K-SAM exon splicing, namely weak exon splice sites, an exon-repressing sequence, and an intron-activating sequence. We identify here two additional sequences in the intron downstream from the K-SAM exon which activate splicing of the exon. The first sequence (intron-activating sequence 2 [IAS2]) lies 168 to 186 nucleotides downstream from the exon's 5' splice site. The second sequence (intron-activating sequence 3 [IAS3]) lies 933 to 1,052 nucleotides downstream from the exon's 5' splice site. IAS3 is a complex region composed of several parts, one of which (nucleotides 963 to 983) can potentially form an RNA secondary structure with IAS2. This structure is composed of two stems separated by an asymmetric bulge. Mutations which disrupt either stem decrease activation, while compensatory mutations which reestablish the stem restore activation, either completely or partially, depending on the mutation. We present a model for K-SAM exon splicing involving the intervention of multiple, interdependent pre-mRNA sequence elements. PMID:9271388

  15. RNA structure replaces the need for U2AF2 in splicing

    PubMed Central

    Lin, Chien-Ling; Taggart, Allison J.; Lim, Kian Huat; Cygan, Kamil J.; Ferraris, Luciana; Creton, Robbert; Huang, Yen-Tsung; Fairbrother, William G.


    RNA secondary structure plays an integral role in catalytic, ribosomal, small nuclear, micro, and transfer RNAs. Discovering a prevalent role for secondary structure in pre-mRNAs has proven more elusive. By utilizing a variety of computational and biochemical approaches, we present evidence for a class of nuclear introns that relies upon secondary structure for correct splicing. These introns are defined by simple repeat expansions of complementary AC and GT dimers that co-occur at opposite boundaries of an intron to form a bridging structure that enforces correct splice site pairing. Remarkably, this class of introns does not require U2AF2, a core component of the spliceosome, for its processing. Phylogenetic analysis suggests that this mechanism was present in the ancestral vertebrate lineage prior to the divergence of tetrapods from teleosts. While largely lost from land dwelling vertebrates, this class of introns is found in 10% of all zebrafish genes. PMID:26566657

  16. Nucleolar introns from Physarum flavicomum contain insertion elements that may explain how mobile group I introns gained their open reading frames.

    PubMed Central

    Vader, A; Naess, J; Haugli, K; Haugli, F; Johansen, S


    Comparison of two group I intron sequences in the nucleolar genome of the myxomycete Physarum flavicomum to their homologs in the closely related Physarum polycephalum revealed insertion-like elements. One of the insertion-like elements consists of two repetitive sequence motifs of 11 and 101 bp in five and three copies, respectively. The smaller motif, which flanks the larger, resembles a target duplication and indicates a relationship to transposons or retroelements. The insertion-like elements are found in the peripheral loops of the RNA structure; the positions occupied by the ORFs of mobile nucleolar group I introns. The P. flavicomum introns are 1184 and 637 bp in size, located in the large subunit ribosomal RNA gene, and can be folded into group I intron structures at the RNA level. However, the intron 2s from both P. flavicomum and P. polycephalum contain an unusual core region that lacks the P8 segment. None of the introns are able to self-splice in vitro. Southern analysis of different isolates indicates that the introns are not optional in myxomycetes. Images PMID:7984404

  17. P-class pentatricopeptide repeat protein PTSF1 is required for splicing of the plastid pre-tRNA(I) (le) in Physcomitrella patens.


    Goto, Seiya; Kawaguchi, Yasuhiro; Sugita, Chieko; Ichinose, Mizuho; Sugita, Mamoru


    Pentatricopeptide repeat (PPR) proteins are widely distributed in eukaryotes and are mostly localized in mitochondria or plastids. PPR proteins play essential roles in various RNA processing steps in organelles; however, the function of the majority of PPR proteins remains unknown. To examine the function of plastid PPR proteins, PpPPR_4 gene knock-out mutants were characterized in Physcomitrella patens. The knock-out mosses displayed severe growth retardation and reduced effective quantum yield of photosystem II. Immunoblot analysis showed that knock-out of PpPPR_4 resulted in a strongly reduced level of plastid-encoded proteins, such as photosystem II reaction center protein D1, the β subunit of ATP synthase, and the stromal enzyme, Rubisco. To further investigate whether knock-out of the PpPPR_4 gene affects plastid gene expression, we analyzed steady-state transcript levels of protein- and rRNA-coding genes by quantitative RT-PCR. This analysis showed that the level of many protein-coding transcripts increased in the mutants. In contrast, splicing of a spacer tRNA(I) (le) precursor encoded by the rrn operon was specifically impaired in the mutants, whereas the accumulation of other plastid tRNAs and rRNAs was not largely affected. Thus, the defect in tRNA(I) (le) splicing leads to a considerable reduction of mature tRNA(I) (le) , which may be accountable for the reduced protein level. An RNA mobility shift assay showed that the recombinant PpPPR_4 bound preferentially to domain III of the tRNA(I) (le) group-II intron. These results provide evidence that PpPPR_4 functions in RNA splicing of the tRNA(I) (le) intron, and hence PpPPR_4 was named plastid tRNA splicing factor 1 (PTSF1). PMID:27117879

  18. Splicing Programs and Cancer

    PubMed Central

    Germann, Sophie; Gratadou, Lise; Dutertre, Martin; Auboeuf, Didier


    Numerous studies report splicing alterations in a multitude of cancers by using gene-by-gene analysis. However, understanding of the role of alternative splicing in cancer is now reaching a new level, thanks to the use of novel technologies allowing the analysis of splicing at a large-scale level. Genome-wide analyses of alternative splicing indicate that splicing alterations can affect the products of gene networks involved in key cellular programs. In addition, many splicing variants identified as being misregulated in cancer are expressed in normal tissues. These observations suggest that splicing programs contribute to specific cellular programs that are altered during cancer initiation and progression. Supporting this model, recent studies have identified splicing factors controlling cancer-associated splicing programs. The characterization of splicing programs and their regulation by splicing factors will allow a better understanding of the genetic mechanisms involved in cancer initiation and progression and the development of new therapeutic targets. PMID:22132318

  19. The missing puzzle piece: splicing mutations

    PubMed Central

    Lewandowska, Marzena A


    Proper gene splicing is highly dependent on the correct recognition of exons. Among the elements allowing this process are the “cis” (conserved sequences) and “trans” (snRNP, splicing factors) elements. Splicing mutations are related with a number of genetic disorders and usually induce exon skipping, form new exon/intron boundaries or activate new cryptic exons as a result of alterations at donor/acceptor sites. They constitute more than 9% of the currently published mutations, but this value is highly underestimated as many of the potential mutations are located in the “cis” elements and should be confirmed experimentally. The most commonly detected splicing mutations are located at donor (5’) and acceptor (3’) sites. Mutations at the branch point are rare (only over a dozen are known to date), and are mostly searched and detected when no alteration has been detected in the sequenced exons and UTRs. Polypyrimidine tract mutations are equally rare. High throughput technologies, as well as traditional Sanger sequencing, allow detection of many changes in intronic sequences and intron/exon boundaries. However, the assessment whether a mutation affects exon recognition and results in a genetic disorder has to be conducted using molecular biology methods: in vitro transcription of the sequence of interest cloned into a plasmid, with and without alterations, or mutation analysis via a hybrid minigene system. Even though microarrays and new generation sequencing methods pose difficulties in detecting novel branch point mutations, these tools seem appropriate to expand the mutation detection panel especially for diagnostic purposes. PMID:24294354

  20. On splice site prediction using weight array models: a comparison of smoothing techniques

    NASA Astrophysics Data System (ADS)

    Taher, Leila; Meinicke, Peter; Morgenstern, Burkhard


    In most eukaryotic genes, protein-coding exons are separated by non-coding introns which are removed from the primary transcript by a process called "splicing". The positions where introns are cut and exons are spliced together are called "splice sites". Thus, computational prediction of splice sites is crucial for gene finding in eukaryotes. Weight array models are a powerful probabilistic approach to splice site detection. Parameters for these models are usually derived from m-tuple frequencies in trusted training data and subsequently smoothed to avoid zero probabilities. In this study we compare three different ways of parameter estimation for m-tuple frequencies, namely (a) non-smoothed probability estimation, (b) standard pseudo counts and (c) a Gaussian smoothing procedure that we recently developed.

  1. DBASS3 and DBASS5: databases of aberrant 3′- and 5′-splice sites

    PubMed Central

    Chivers, Martin; Hwang, Gyulin; Vorechovsky, Igor


    DBASS3 and DBASS5 provide comprehensive repositories of new exon boundaries that were induced by pathogenic mutations in human disease genes. Aberrant 5′- and 3′-splice sites were activated either by mutations in the consensus sequences of natural exon–intron junctions (cryptic sites) or elsewhere (‘de novo’ sites). DBASS3 and DBASS5 currently contain approximately 900 records of cryptic and de novo 3′- and 5′-splice sites that were produced by over a thousand different mutations in approximately 360 genes. DBASS3 and DBASS5 data can be searched by disease phenotype, gene, mutation, location of aberrant splice sites in introns and exons and their distance from authentic counterparts, by bibliographic references and by the splice-site strength estimated with several prediction algorithms. The user can also retrieve reference sequences of both aberrant and authentic splice sites with the underlying mutation. These data will facilitate identification of introns or exons frequently involved in aberrant splicing, mutation analysis of human disease genes and study of germline or somatic mutations that impair RNA processing. Finally, this resource will be useful for fine-tuning splice-site prediction algorithms, better definition of auxiliary splicing signals and design of new reporter assays. DBASS3 and DBASS5 are freely available at PMID:20929868

  2. Visualizing the ai5γ group IIB intron

    PubMed Central

    Somarowthu, Srinivas; Legiewicz, Michal; Keating, Kevin S.; Pyle, Anna Marie


    It has become apparent that much of cellular metabolism is controlled by large well-folded noncoding RNA molecules. In addition to crystallographic approaches, computational methods are needed for visualizing the 3D structure of large RNAs. Here, we modeled the molecular structure of the ai5γ group IIB intron from yeast using the crystal structure of a bacterial group IIC homolog. This was accomplished by adapting strategies for homology and de novo modeling, and creating a new computational tool for RNA refinement. The resulting model was validated experimentally using a combination of structure-guided mutagenesis and RNA structure probing. The model provides major insights into the mechanism and regulation of splicing, such as the position of the branch-site before and after the second step of splicing, and the location of subdomains that control target specificity, underscoring the feasibility of modeling large functional RNA molecules. PMID:24203709

  3. Biochemical and proteomic analysis of spliceosome factors interacting with intron-1 of human papillomavirus type-16.


    Martínez-Salazar, Martha; López-Urrutia, Eduardo; Arechaga-Ocampo, Elena; Bonilla-Moreno, Raul; Martínez-Castillo, Macario; Díaz-Hernández, Job; Del Moral-Hernández, Oscar; Cedillo-Barrón, Leticia; Martines-Juarez, Víctor; De Nova-Ocampo, Monica; Valdes, Jesús; Berumen, Jaime; Villegas-Sepúlveda, Nicolás


    The human papillomavirus type 16 (HPV-16) E6/E7 spliced transcripts are heterogeneously expressed in cervical carcinoma. The heterogeneity of the E6/E7 splicing profile might be in part due to the intrinsic variation of splicing factors in tumor cells. However, the splicing factors that bind the E6/E7 intron 1 (In-1) have not been defined. Therefore, we aimed to identify these factors; we used HeLa nuclear extracts (NE) for in vitro spliceosome assembly. The proteins were allowed to bind to an RNA/DNA hybrid formed by the In-1 transcript and a 5'-biotinylated DNA oligonucleotide complementary to the upstream exon sequence, which prevented interference in protein binding to the intron. The hybrid probes bound with the nuclear proteins were coupled to streptavidin magnetic beads for chromatography affinity purification. Proteins were eluted and identified by mass spectrometry (MS). Approximately 170 proteins were identified by MS, 80% of which were RNA binding proteins, including canonical spliceosome core components, helicases and regulatory splicing factors. The canonical factors were identified as components of the spliceosomal B-complex. Although 35-40 of the identified factors were cognate splicing factors or helicases, they have not been previously detected in spliceosome complexes that were assembled using in vivo or in vitro models. PMID:25108200

  4. Another heritage from the RNA world: self-excision of intron sequence from nuclear pre-tRNAs.

    PubMed Central

    Weber, U; Beier, H; Gross, H J


    The intervening sequences of nuclear tRNA precursors are known to be excised by tRNA splicing endonuclease. We show here that a T7 transcript corresponding to a pre-tRNA(Tyr) from Arabidopsis thaliana has a highly specific activity for autolytic intron excision. Self-cleavage occurs precisely at the authentic 3'-splice site and at the phosphodiester bond one nucleotide downstream of the authentic 5'-splice site. The reaction results in fragments with 2',3'-cyclic phosphate and 5'-OH termini. It is resistant to proteinase K and/or SDS treatment and is not inhibited by added tRNA. The self-cleavage depends on Mg2+ and is stimulated by spermine and Triton X-100. A set of sequence variants at the cleavage sites has been analysed for autolytic intron excision and, in parallel, for enzymatic in vitro splicing in wheat germ S23 extract. Single-stranded loops are a prerequisite for both reactions. Self-cleavage not only occurs at pyrimidine-A but also at U-U bonds. Since intron self-excision is only about five times slower than the enzymatic intron excision in a wheat germ S23 extract, we propose that the splicing endonuclease may function by improving the preciseness and efficiency of an inherent pre-tRNA self-cleavage activity. PMID:8710488

  5. Gene and alternative splicing annotation with AIR

    PubMed Central

    Florea, Liliana; Di Francesco, Valentina; Miller, Jason; Turner, Russell; Yao, Alison; Harris, Michael; Walenz, Brian; Mobarry, Clark; Merkulov, Gennady V.; Charlab, Rosane; Dew, Ian; Deng, Zuoming; Istrail, Sorin; Li, Peter; Sutton, Granger


    Designing effective and accurate tools for identifying the functional and structural elements in a genome remains at the frontier of genome annotation owing to incompleteness and inaccuracy of the data, limitations in the computational models, and shifting paradigms in genomics, such as alternative splicing. We present a methodology for the automated annotation of genes and their alternatively spliced mRNA transcripts based on existing cDNA and protein sequence evidence from the same species or projected from a related species using syntenic mapping information. At the core of the method is the splice graph, a compact representation of a gene, its exons, introns, and alternatively spliced isoforms. The putative transcripts are enumerated from the graph and assigned confidence scores based on the strength of sequence evidence, and a subset of the high-scoring candidates are selected and promoted into the annotation. The method is highly selective, eliminating the unlikely candidates while retaining 98% of the high-quality mRNA evidence in well-formed transcripts, and produces annotation that is measurably more accurate than some evidence-based gene sets. The process is fast, accurate, and fully automated, and combines the traditionally distinct gene annotation and alternative splicing detection processes in a comprehensive and systematic way, thus considerably aiding in the ensuing manual curation efforts. PMID:15632090

  6. In vivo recognition of a vertebrate mini-exon as an exon-intron-exon unit.

    PubMed Central

    Sterner, D A; Berget, S M


    Very small vertebrate exons are problematic for RNA splicing because of the proximity of their 3' and 5' splice sites. In this study, we investigated the recognition of a constitutive 7-nucleotide mini-exon from the troponin I gene that resides quite close to the adjacent upstream exon. The mini-exon failed to be included in spliced RNA when placed in a heterologous gene unless accompanied by the upstream exon. The requirement for the upstream exon disappeared when the mini-exon was internally expanded, suggesting that the splice sites bordering the mini-exon are compatible with those of other constitutive vertebrate exons and that the small size of the exon impaired inclusion. Mutation of the 5' splice site of the natural upstream exon did not result in either exon skipping or activation of a cryptic 5' splice site, the normal vertebrate phenotypes for such mutants. Instead, a spliced RNA accumulated that still contained the upstream intron. In vitro, the mini-exon failed to assemble into spliceosome complexes unless either internally expanded or accompanied by the upstream exon. Thus, impaired usage of the mini-exon in vivo was accompanied by impaired recognition in vitro, and recognition of the mini-exon was facilitated by the presence of the upstream exon in vivo and in vitro. Cumulatively, the atypical in vivo and in vitro properties of the troponin exons suggest a mechanism for the recognition of this mini-exon in which initial recognition of an exon-intron-exon unit is followed by subsequent recognition of the intron. Images PMID:7682652

  7. Evolution of alternative splicing regulation: changes in predicted exonic splicing regulators are not associated with changes in alternative splicing levels in primates.


    Irimia, Manuel; Rukov, Jakob Lewin; Roy, Scott William


    Alternative splicing is tightly regulated in a spatio-temporal and quantitative manner. This regulation is achieved by a complex interplay between spliceosomal (trans) factors that bind to different sequence (cis) elements. cis-elements reside in both introns and exons and may either enhance or silence splicing. Differential combinations of cis-elements allows for a huge diversity of overall splicing signals, together comprising a complex 'splicing code'. Many cis-elements have been identified, and their effects on exon inclusion levels demonstrated in reporter systems. However, the impact of interspecific differences in these elements on the evolution of alternative splicing levels has not yet been investigated at genomic level. Here we study the effect of interspecific differences in predicted exonic splicing regulators (ESRs) on exon inclusion levels in human and chimpanzee. For this purpose, we compiled and studied comprehensive datasets of predicted ESRs, identified by several computational and experimental approaches, as well as microarray data for changes in alternative splicing levels between human and chimpanzee. Surprisingly, we found no association between changes in predicted ESRs and changes in alternative splicing levels. This observation holds across different ESR exon positions, exon lengths, and 5' splice site strengths. We suggest that this lack of association is mainly due to the great importance of context for ESR functionality: many ESR-like motifs in primates may have little or no effect on splicing, and thus interspecific changes at short-time scales may primarily occur in these effectively neutral ESRs. These results underscore the difficulties of using current computational ESR prediction algorithms to identify truly functionally important motifs, and provide a cautionary tale for studies of the effect of SNPs on splicing in human disease. PMID:19495418

  8. UnSplicer: mapping spliced RNA-Seq reads in compact genomes and filtering noisy splicing.


    Burns, Paul D; Li, Yang; Ma, Jian; Borodovsky, Mark


    Accurate mapping of spliced RNA-Seq reads to genomic DNA has been known as a challenging problem. Despite significant efforts invested in developing efficient algorithms, with the human genome as a primary focus, the best solution is still not known. A recently introduced tool, TrueSight, has demonstrated better performance compared with earlier developed algorithms such as TopHat and MapSplice. To improve detection of splice junctions, TrueSight uses information on statistical patterns of nucleotide ordering in intronic and exonic DNA. This line of research led to yet another new algorithm, UnSplicer, designed for eukaryotic species with compact genomes where functional alternative splicing is likely to be dominated by splicing noise. Genome-specific parameters of the new algorithm are generated by GeneMark-ES, an ab initio gene prediction algorithm based on unsupervised training. UnSplicer shares several components with TrueSight; the difference lies in the training strategy and the classification algorithm. We tested UnSplicer on RNA-Seq data sets of Arabidopsis thaliana, Caenorhabditis elegans, Cryptococcus neoformans and Drosophila melanogaster. We have shown that splice junctions inferred by UnSplicer are in better agreement with knowledge accumulated on these well-studied genomes than predictions made by earlier developed tools. PMID:24259430

  9. The transcription elongation factor CA150 interacts with RNA polymerase II and the pre-mRNA splicing factor SF1.


    Goldstrohm, A C; Albrecht, T R; Suñé, C; Bedford, M T; Garcia-Blanco, M A


    CA150 represses RNA polymerase II (RNAPII) transcription by inhibiting the elongation of transcripts. The FF repeat domains of CA150 bind directly to the phosphorylated carboxyl-terminal domain of the largest subunit of RNAPII. We determined that this interaction is required for efficient CA150-mediated repression of transcription from the alpha(4)-integrin promoter. Additional functional determinants, namely, the WW1 and WW2 domains of CA150, were also required for efficient repression. A protein that interacted directly with CA150 WW1 and WW2 was identified as the splicing-transcription factor SF1. Previous studies have demonstrated a role for SF1 in transcription repression, and we found that binding of the CA150 WW1 and WW2 domains to SF1 correlated exactly with the functional contribution of these domains for repression. The binding specificity of the CA150 WW domains was found to be unique in comparison to known classes of WW domains. Furthermore, the CA150 binding site, within the carboxyl-terminal half of SF1, contains a novel type of proline-rich motif that may be recognized by the CA150 WW1 and WW2 domains. These results support a model for the recruitment of CA150 to repress transcription elongation. In this model, CA150 binds to the phosphorylated CTD of elongating RNAPII and SF1 targets the nascent transcript. PMID:11604498

  10. Exons, Introns, and DNA Thermodynamics

    NASA Astrophysics Data System (ADS)

    Carlon, Enrico; Malki, Mehdi Lejard; Blossey, Ralf


    The genes of eukaryotes are characterized by protein coding fragments, the exons, interrupted by introns, i.e., stretches of DNA which do not carry useful information for protein synthesis. We have analyzed the melting behavior of randomly selected human cDNA sequences obtained from genomic DNA by removing all introns. A clear correspondence is observed between exons and melting domains. This finding may provide new insights into the physical mechanisms underlying the evolution of genes.

  11. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.


    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  12. Tau exon 10 alternative splicing and tauopathies

    PubMed Central

    Liu, Fei; Gong, Cheng-Xin


    Abnormalities of microtubule-associated protein tau play a central role in neurofibrillary degeneration in several neurodegenerative disorders that collectively called tauopathies. Six isoforms of tau are expressed in adult human brain, which result from alternative splicing of pre-mRNA generated from a single tau gene. Alternative splicing of tau exon 10 results in tau isoforms containing either three or four microtubule-binding repeats (3R-tau and 4R-tau, respectively). Approximately equal levels of 3R-tau and 4R-tau are expressed in normal adult human brain, but the 3R-tau/4R-tau ratio is altered in the brains in several tauopathies. Discovery of silence mutations and intronic mutations of tau gene in some individuals with frontotemporal dementia with Parkinsonism linked to chromosome 17 (FTDP-17), which only disrupt tau exon 10 splicing but do not alter tau's primary sequence, demonstrates that dysregulation of tau exon 10 alternative splicing and consequently of 3R-tau/4R-tau balance is sufficient to cause neurodegeneration and dementia. Here, we review the gene structure, transcripts and protein isoforms of tau, followed by the regulation of exon 10 splicing that determines the expression of 3R-tau or 4R-tau. Finally, dysregulation of exon 10 splicing of tau in several tauopathies is discussed. Understanding the molecular mechanisms by which tau exon 10 splicing is regulated and how it is disrupted in tauopathies will provide new insight into the mechanisms of these tauopathies and help identify new therapeutic targets to treat these disorders. PMID:18616804

  13. Computational Analysis of an Evolutionarily Conserved VertebrateMuscle Alternative Splicing Program

    SciTech Connect

    Das, Debopriya; Clark, Tyson A.; Schweitzer, Anthony; Marr,Henry; Yamamoto, Miki L.; Parra, Marilyn K.; Arribere, Josh; Minovitsky,Simon; Dubchak, Inna; Blume, John E.; Conboy, John G.


    A novel exon microarray format that probes gene expression with single exon resolution was employed to elucidate critical features of a vertebrate muscle alternative splicing program. A dataset of 56 microarray-defined, muscle-enriched exons and their flanking introns were examined computationally in order to investigate coordination of the muscle splicing program. Candidate intron regulatory motifs were required to meet several stringent criteria: significant over-representation near muscle-enriched exons, correlation with muscle expression, and phylogenetic conservation among genomes of several vertebrate orders. Three classes of regulatory motifs were identified in the proximal downstream intron, within 200nt of the target exons: UGCAUG, a specific binding site for Fox-1 related splicing factors; ACUAAC, a novel branchpoint-like element; and UG-/UGC-rich elements characteristic of binding sites for CELF splicing factors. UGCAUG was remarkably enriched, being present in nearly one-half of all cases. These studies suggest that Fox and CELF splicing factors play a major role in enforcing the muscle-specific alternative splicing program, facilitating expression of a set of unique isoforms of cytoskeletal proteins that are critical to muscle cell differentiation. Supplementary materials: There are four supplementary tables and one supplementary figure. The tables provide additional detailed information concerning the muscle-enriched datasets, and about over-represented oligonucleotide sequences in the flanking introns. The supplementary figure shows RT-PCR data confirming the muscle-enriched expression of exons predicted from the microarray analysis.

  14. Group I intron renders differential susceptibility of Candida albicans to Bleomycin.


    Jayaguru, Prathiba; Raghunathan, Malathi


    The alarming increase in drug resistance gained by fungal pathogens has raised an urgent need to develop drugs against novel targets. Candida albicans, an opportunistic fungal pathogen, harbors in its 25S rRNA gene, a self-splicing Group I intron, which can act as a selective drug target. We report that Bleomycin selectively inhibits the self-splicing of Group I intron of C. albicans at IC(50) = 1.2 microM, leading to accumulation of precursor RNA as evinced by Reverse Transcriptase PCR. Drug susceptibility assays including MIC determination, growth curve analysis and disc diffusion assays indicate a strong susceptibility of the intron-containing strain (4-1) than the intronless strain (62-1). These results on the preferential targeting of Group I intron of C. albicans by Bleomycin might form a basis for design of small molecules that inhibit self-splicing of RNA as a antimicrobial tool against life-threatening microorganisms. PMID:17115251

  15. Intron retention is a widespread mechanism of tumor-suppressor inactivation.


    Jung, Hyunchul; Lee, Donghoon; Lee, Jongkeun; Park, Donghyun; Kim, Yeon Jeong; Park, Woong-Yang; Hong, Dongwan; Park, Peter J; Lee, Eunjung


    A substantial fraction of disease-causing mutations are pathogenic through aberrant splicing. Although genome profiling studies have identified somatic single-nucleotide variants (SNVs) in cancer, the extent to which these variants trigger abnormal splicing has not been systematically examined. Here we analyzed RNA sequencing and exome data from 1,812 patients with cancer and identified ∼900 somatic exonic SNVs that disrupt splicing. At least 163 SNVs, including 31 synonymous ones, were shown to cause intron retention or exon skipping in an allele-specific manner, with ∼70% of the SNVs occurring on the last base of exons. Notably, SNVs causing intron retention were enriched in tumor suppressors, and 97% of these SNVs generated a premature termination codon, leading to loss of function through nonsense-mediated decay or truncated protein. We also characterized the genomic features predictive of such splicing defects. Overall, this work demonstrates that intron retention is a common mechanism of tumor-suppressor inactivation. PMID:26437032

  16. Two group I ribozymes with different functions in a nuclear rDNA intron.

    PubMed Central

    Decatur, W A; Einvik, C; Johansen, S; Vogt, V M


    DiSSU1, a mobile intron in the nuclear rRNA gene of Didymium iridis, was previously reported to contain two independent catalytic RNA elements. We have found that both catalytic elements, renamed GIR1 and GIR2, are group I ribozymes, but with differing functionality. GIR2 carries out the several reactions associated with self-splicing. GIR1 carries out a hydrolysis reaction at an internal processing site (IPS-1). These conclusions are based on the catalytic properties of RNAs transcribed in vitro. Mutation of the P7 pairing segment of GIR2 abrogated self-splicing, while mutation of P7 in GIR1 abrogated hydrolysis at the IPS-1. Much of the P2 stem and all of the associated loop could be deleted without effect on self-splicing. These results are accounted for by a secondary structure model, in which a long P2 pairing segment brings the 5' splice site to the GIR2 catalytic core. GIR1 is the smallest natural group I ribozyme yet reported and is the first example of a group I ribozyme whose presumptive biological function is hydrolysis. We hypothesize that GIR1-mediated cleavage of the excised intron RNA functions in the generation and expression of the mRNA for the intron-encoded endonuclease I-DirI. Images PMID:7556099

  17. Constraints on intron evolution in the gene encoding the myosin alkali light chain in Drosophila

    SciTech Connect

    Leicht, B.G.; Muse, S.V.; Hanczyc, M.


    Interspecific comparisons of intron sequences reveal conserved blocks of invariant nucleotides and several other departures from the strictly neutral model of molecular evolution. To distinguish the past action of evolutionary forces in introns known to have regulatory information, we examined nucleotide sequence variation at 991 sites in a random sample of 16 Drosophila melanogaster alleles of the gene encoding the myosin alkali light chain (Mlc1). The Mlc1 gene of D. melanogaster encodes two Mlc1 isoforms via developmentally regulated alternative pre-mRNA splicing. Analyses of these data reveal that introns 4 and 5, which flank the alternatively spliced exon 5, have reduced levels of both intraspecific polymorphism and interspecific divergence relative to intron 3. No polymorphism was observed in any of the exons examined in D. melanogaster. A genealogical analysis clearly demonstrates the occurrence of intragenic recombination in the ancestral history of Mlc1. Recombination events are estimated to be 13 times more likely than mutation events over the span of the sequenced region. Although there is little evidence for pairwise linkage disequilibrium in the Mlc1 region, higher order disequilibrium. does seem to be present in the 5{prime} half of the portion of the gene that was examined. Predictions of the folding free energy of the pre-mRNA reveal that sampled alleles have a significantly higher (less stable) free energy than do randomly permuted sequences. These results are consistent with the hypothesis that introns surrounding an alternatively spliced exon are subjected to additional constraints, perhaps due to specific aspects of secondary structure required for appropriate splicing of the pre-mRNA molecule. 48 refs., 5 figs., 3 tabs.

  18. Alternative Splice in Alternative Lice.


    Tovar-Corona, Jaime M; Castillo-Morales, Atahualpa; Chen, Lu; Olds, Brett P; Clark, John M; Reynolds, Stuart E; Pittendrigh, Barry R; Feil, Edward J; Urrutia, Araxi O


    Genomic and transcriptomics analyses have revealed human head and body lice to be almost genetically identical; although con-specific, they nevertheless occupy distinct ecological niches and have differing feeding patterns. Most importantly, while head lice are not known to be vector competent, body lice can transmit three serious bacterial diseases; epidemictyphus, trench fever, and relapsing fever. In order to gain insights into the molecular bases for these differences, we analyzed alternative splicing (AS) using next-generation sequencing data for one strain of head lice and one strain of body lice. We identified a total of 3,598 AS events which were head or body lice specific. Exon skipping AS events were overrepresented among both head and body lice, whereas intron retention events were underrepresented in both. However, both the enrichment of exon skipping and the underrepresentation of intron retention are significantly stronger in body lice compared with head lice. Genes containing body louse-specific AS events were found to be significantly enriched for functions associated with development of the nervous system, salivary gland, trachea, and ovarian follicle cells, as well as regulation of transcription. In contrast, no functional categories were overrepresented among genes with head louse-specific AS events. Together, our results constitute the first evidence for transcript pool differences in head and body lice, providing insights into molecular adaptations that enabled human lice to adapt to clothing, and representing a powerful illustration of the pivotal role AS can play in functional adaptation. PMID:26169943

  19. Alternative Splice in Alternative Lice

    PubMed Central

    Tovar-Corona, Jaime M.; Castillo-Morales, Atahualpa; Chen, Lu; Olds, Brett P.; Clark, John M.; Reynolds, Stuart E.; Pittendrigh, Barry R.; Feil, Edward J.; Urrutia, Araxi O.


    Genomic and transcriptomics analyses have revealed human head and body lice to be almost genetically identical; although con-specific, they nevertheless occupy distinct ecological niches and have differing feeding patterns. Most importantly, while head lice are not known to be vector competent, body lice can transmit three serious bacterial diseases; epidemictyphus, trench fever, and relapsing fever. In order to gain insights into the molecular bases for these differences, we analyzed alternative splicing (AS) using next-generation sequencing data for one strain of head lice and one strain of body lice. We identified a total of 3,598 AS events which were head or body lice specific. Exon skipping AS events were overrepresented among both head and body lice, whereas intron retention events were underrepresented in both. However, both the enrichment of exon skipping and the underrepresentation of intron retention are significantly stronger in body lice compared with head lice. Genes containing body louse-specific AS events were found to be significantly enriched for functions associated with development of the nervous system, salivary gland, trachea, and ovarian follicle cells, as well as regulation of transcription. In contrast, no functional categories were overrepresented among genes with head louse-specific AS events. Together, our results constitute the first evidence for transcript pool differences in head and body lice, providing insights into molecular adaptations that enabled human lice to adapt to clothing, and representing a powerful illustration of the pivotal role AS can play in functional adaptation. PMID:26169943

  20. When good transcripts go bad: artifactual RT-PCR 'splicing' and genome analysis.


    Roy, Scott William; Irimia, Manuel


    Gene and intron prediction are essential for accurate inferences about genome evolution. Recently, two genome-wide studies searched for recent intron gains in humans, reaching very different conclusions: either of a complete absence of intron gain since early mammalian evolution, or of creation of numerous introns by genomic duplication in repetitive regions. We discuss one possible explanation: the underappreciated phenomenon of "template switching", by which reverse transcriptase may create artifactual splicing-like events in the preparation of cDNA/EST libraries, may cause complications in searches for newly gained introns in repetitive regions. We report large numbers of apparent template switching in transcript sequences from the intron-poor protists Trichomonas vaginalis and Giardia lamblia. Supplementary material for this article can be found on the BioEssays website ( PMID:18478540

  1. A dynamic intron retention program enriched in RNA processing genes regulates gene expression during terminal erythropoiesis

    PubMed Central

    Pimentel, Harold; Parra, Marilyn; Gee, Sherry L.; Mohandas, Narla; Pachter, Lior; Conboy, John G.


    Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentally-dynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ∼50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclear-localized. Splice site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. We conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease. PMID:26531823

  2. A Relaxed Active Site After Exon Ligation by the Group I Intron

    SciTech Connect

    Lipchock,S.; Strobel, S.


    During RNA maturation, the group I intron promotes two sequential phosphorotransfer reactions resulting in exon ligation and intron release. Here, we report the crystal structure of the intron in complex with spliced exons and two additional structures that examine the role of active-site metal ions during the second step of RNA splicing. These structures reveal a relaxed active site, in which direct metal coordination by the exons is lost after ligation, while other tertiary interactions are retained between the exon and the intron. Consistent with these structural observations, kinetic and thermodynamic measurements show that the scissile phosphate makes direct contact with metals in the ground state before exon ligation and in the transition state, but not after exon ligation. Despite no direct exonic interactions and even in the absence of the scissile phosphate, two metal ions remain bound within the active site. Together, these data suggest that release of the ligated exons from the intron is preceded by a change in substrate-metal coordination before tertiary hydrogen bonding contacts to the exons are broken.

  3. A dynamic intron retention program enriched in RNA processing genes regulates gene expression during terminal erythropoiesis

    SciTech Connect

    Pimentel, Harold; Parra, Marilyn; Gee, Sherry L.; Mohandas, Narla; Pachter, Lior; Conboy, John G.


    Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentallydynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ~50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclearlocalized. Splice site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. Finally, we conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease.

  4. A dynamic intron retention program enriched in RNA processing genes regulates gene expression during terminal erythropoiesis.


    Pimentel, Harold; Parra, Marilyn; Gee, Sherry L; Mohandas, Narla; Pachter, Lior; Conboy, John G


    Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentally-dynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ∼50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclear-localized. Splice site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. We conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease. PMID:26531823

  5. The MTL1 Pentatricopeptide Repeat Protein Is Required for Both Translation and Splicing of the Mitochondrial NADH DEHYDROGENASE SUBUNIT7 mRNA in Arabidopsis.


    Haïli, Nawel; Planchard, Noelya; Arnal, Nadège; Quadrado, Martine; Vrielynck, Nathalie; Dahan, Jennifer; des Francs-Small, Catherine Colas; Mireau, Hakim


    Mitochondrial translation involves a complex interplay of ancient bacteria-like features and host-derived functionalities. Although the basic components of the mitochondrial translation apparatus have been recognized, very few protein factors aiding in recruiting ribosomes on mitochondria-encoded messenger RNA (mRNAs) have been identified in higher plants. In this study, we describe the identification of the Arabidopsis (Arabidopsis thaliana) MITOCHONDRIAL TRANSLATION FACTOR1 (MTL1) protein, a new member of the Pentatricopeptide Repeat family, and show that it is essential for the translation of the mitochondrial NADH dehydrogenase subunit7 (nad7) mRNA. We demonstrate that mtl1 mutant plants fail to accumulate the Nad7 protein, even though the nad7 mature mRNA is produced and bears the same 5' and 3' extremities as in wild-type plants. We next observed that polysome association of nad7 mature mRNA is specifically disrupted in mtl1 mutants, indicating that the absence of Nad7 results from a lack of translation of nad7 mRNA. These findings illustrate that mitochondrial translation requires the intervention of gene-specific nucleus-encoded PPR trans-factors and that their action does not necessarily involve the 5' processing of their target mRNA, as observed previously. Interestingly, a partial decrease in nad7 intron 2 splicing was also detected in mtl1 mutants, suggesting that MTL1 is also involved in group II intron splicing. However, this second function appears to be less essential for nad7 expression than its role in translation. MTL1 will be instrumental to understand the multifunctionality of PPR proteins and the mechanisms governing mRNA translation and intron splicing in plant mitochondria. PMID:26537562

  6. Functional correction by antisense therapy of a splicing mutation in the GALT gene.


    Coelho, Ana I; Lourenço, Sílvia; Trabuco, Matilde; Silva, Maria João; Oliveira, Anabela; Gaspar, Ana; Diogo, Luísa; Tavares de Almeida, Isabel; Vicente, João B; Rivera, Isabel


    In recent years, antisense therapy has emerged as an increasingly important therapeutic approach to tackle several genetic disorders, including inborn errors of metabolism. Intronic mutations activating cryptic splice sites are particularly amenable to antisense therapy, as the canonical splice sites remain intact, thus retaining the potential for restoring constitutive splicing. Mutational analysis of Portuguese galactosemic patients revealed the intronic variation c.820+13A>G as the second most prevalent mutation, strongly suggesting its pathogenicity. The aim of this study was to functionally characterize this intronic variation, to elucidate its pathogenic molecular mechanism(s) and, ultimately, to correct it by antisense therapy. Minigene splicing assays in two distinct cell lines and patients' transcript analyses showed that the mutation activates a cryptic donor splice site, inducing an aberrant splicing of the GALT pre-mRNA, which in turn leads to a frameshift with inclusion of a premature stop codon (p.D274Gfs*17). Functional-structural studies of the recombinant wild-type and truncated GALT showed that the latter is devoid of enzymatic activity and prone to aggregation. Finally, two locked nucleic acid oligonucleotides, designed to specifically recognize the mutation, successfully restored the constitutive splicing, thus establishing a proof of concept for the application of antisense therapy as an alternative strategy for the clearly insufficient dietary treatment in classic galactosemia. PMID:25052314

  7. Identification of novel splice variants of the Arabidopsis DCL2 gene.


    Yan, Fei; Peng, Jiejun; Lu, Yuwen; Lin, Lin; Zheng, Hongying; Chen, Hairu; Chen, Jianping; Adams, Michael J


    In Arabidopsis thaliana, Dicer-like protein 2 (DCL2) cleaves double-stranded virus RNA, playing an essential role in the RNA interference pathway. Here, we describe three alternative splicing (AS) forms of AtDCL2: in one, both intron 8 and intron 10 are retained in the mRNA, in second only intron 8 is retained and in the third no intron is retained, but there is a deletion of 56 nucleotides at the end of exon 10. These splicing forms are present in stems and leaves at different development stages. AS was also detected in DCL2 of Brassica rapa, where intron 9, but not intron 8 or intron 10, was retained suggesting that AS may be a common phenomenon in cruciferous plant DCL2s. The retained introns and sequence deletions detected in AtDCL2 changed the reading frame and produced premature terminal codons. The AS forms appeared to be substrates of nonsense-mediated decay of mRNA. PMID:19011859

  8. Entropic contributions to the splicing process

    NASA Astrophysics Data System (ADS)

    Osella, Matteo; Caselle, Michele


    It has been recently argued that depletion attraction may play an important role in different aspects of cellular organization, ranging from the organization of transcriptional activity in transcription factories to the formation of nuclear bodies. In this paper, we suggest a new application of these ideas in the context of the splicing process, a crucial step of messenger RNA maturation in eukaryotes. We shall show that entropy effects and the resulting depletion attraction may explain the relevance of the aspecific intron length variable in the choice of splice-site recognition modality. On top of that, some qualitative features of the genome architecture of higher eukaryotes can find evolutionary realistic motivation in the light of our model.

  9. mRNA-Associated Processes and Their Influence on Exon-Intron Structure in Drosophila melanogaster

    PubMed Central

    Lepennetier, Gildas; Catania, Francesco


    mRNA-associated processes and gene structure in eukaryotes are typically treated as separate research subjects. Here, we bridge this separation and leverage the extensive multidisciplinary work on Drosophila melanogaster to examine the roles that capping, splicing, cleavage/polyadenylation, and telescripting (i.e., the protection of nascent transcripts from premature cleavage/polyadenylation by the splicing factor U1) might play in shaping exon-intron architecture in protein-coding genes. Our findings suggest that the distance between subsequent internal 5′ splice sites (5′ss) in Drosophila genes is constrained such that telescripting effects are maximized, in theory, and thus nascent transcripts are less vulnerable to premature termination. Exceptionally weak 5′ss and constraints on intron-exon size at the gene 5′ end also indicate that capping might enhance the recruitment of U1 and, in turn, promote telescripting at this location. Finally, a positive correlation between last exon length and last 5′ss strength suggests that optimal donor splice sites in the proximity of the pre-mRNA tail may inhibit the processing of downstream polyadenylation signals more than weak donor splice sites do. These findings corroborate and build upon previous experimental and computational studies on Drosophila genes. They support the possibility, hitherto scantly explored, that mRNA-associated processes impose significant constraints on the evolution of eukaryotic gene structure. PMID:27172210

  10. The thermodynamic patterns of eukaryotic genes suggest a mechanism for intron-exon recognition.


    Nedelcheva-Veleva, Marina N; Sarov, Mihail; Yanakiev, Ivan; Mihailovska, Eva; Ivanov, Miroslav P; Panova, Greta C; Stoynov, Stoyno S


    The essential cis- and trans-acting elements required for RNA splicing have been defined, however, the detailed molecular mechanisms underlying intron-exon recognition are still unclear. Here we demonstrate that the ratio between stability of mRNA/DNA and DNA/DNA duplexes near 3'-spice sites is a characteristic feature that can contribute to intron-exon differentiation. Remarkably, throughout all transcripts, the most unstable mRNA/DNA duplexes, compared with the corresponding DNA/DNA duplexes, are situated upstream of the 3'-splice sites and include the polypyrimidine tracts. This characteristic instability is less pronounced in weak alternative splice sites and disease-associated cryptic 3'-splice sites. Our results suggest that this thermodynamic pattern can prevent the re-annealing of mRNA to the DNA template behind the RNA polymerase to ensure access of the splicing machinery to the polypyrimidine tract and the branch point. In support of this mechanism, we demonstrate that RNA/DNA duplex formation at this region prevents pre-spliceosome A complex assembly. PMID:23817463

  11. mRNA-Associated Processes and Their Influence on Exon-Intron Structure in Drosophila melanogaster.


    Lepennetier, Gildas; Catania, Francesco


    mRNA-associated processes and gene structure in eukaryotes are typically treated as separate research subjects. Here, we bridge this separation and leverage the extensive multidisciplinary work on Drosophila melanogaster to examine the roles that capping, splicing, cleavage/polyadenylation, and telescripting (i.e, the protection of nascent transcripts from premature cleavage/polyadenylation by the splicing factor U1) might play in shaping exon-intron architecture in protein-coding genes. Our findings suggest that the distance between subsequent internal 5' splice sites (5'ss) in Drosophila genes is constrained such that telescripting effects are maximized, in theory, and thus nascent transcripts are less vulnerable to premature termination. Exceptionally weak 5'ss and constraints on intron-exon size at the gene 5' end also indicate that capping might enhance the recruitment of U1 and, in turn, promote telescripting at this location. Finally, a positive correlation between last exon length and last 5'ss strength suggests that optimal donor splice sites in the proximity of the pre-mRNA tail may inhibit the processing of downstream polyadenylation signals more than weak donor splice sites do. These findings corroborate and build upon previous experimental and computational studies on Drosophila genes. They support the possibility, hitherto scantly explored, that mRNA-associated processes impose significant constraints on the evolution of eukaryotic gene structure. PMID:27172210

  12. Prp40 and early events in splice site definition.


    Becerra, Soraya; Andrés-León, Eduardo; Prieto-Sánchez, Silvia; Hernández-Munain, Cristina; Suñé, Carlos


    The alternative splicing (AS) of precursor messenger RNA (pre-mRNA) is a tightly regulated process through which introns are removed to leave the resulting exons in the mRNA appropriately aligned and ligated. The AS of pre-mRNA is a key mechanism for increasing the complexity of proteins encoded in the genome. In humans, more than 90% of genes undergo AS, underscoring the importance of this process in RNA biogenesis. As such, AS misregulation underlies multiple human diseases. The splicing reaction is catalyzed by the spliceosome, a highly dynamic complex that assembles at or near the intron/exon boundaries and undergoes sequential conformational and compositional changes during splicing. The initial recognition of splice sites defines the exons that are going to be removed, which is a critical step in the highly regulated splicing process. Although the available lines of evidence are increasing, the molecular mechanisms governing AS, including the initial interactions occurring at intron/exon boundaries, and the factors that modulate these critical connections by functioning as a scaffold for active-site RNAs or proteins, remain poorly understood. In this review, we summarize the major hallmarks of the initial steps in the splicing process and the role of auxiliary factors that contribute to the assembly of the spliceosomal complex. We also discuss the role of the essential yeast Prp40 protein and its mammalian homologs in the specificity of this pre-mRNA processing event. In addition, we provide the first exhaustive phylogenetic analysis of the molecular evolution of Prp40 family members. WIREs RNA 2016, 7:17-32. doi: 10.1002/wrna.1312 For further resources related to this article, please visit the WIREs website. PMID:26494226

  13. Evolution of small putative group I introns in the SSU rRNA gene locus of Phialophora species

    PubMed Central


    Background Group I introns (specifically subgroup IC1) are common in the nuclear ribosomal RNA genes of fungi. While most range in length from more than 200 to nearly 1800 nucleotides (nt) in length, several small putative (or degenerate) group I introns have been described that are between 56 and 81 nt. Although small, previously we demonstrated that the PaSSU intron in the rRNA small subunit gene of Phialophora americana isolate Wang 1046 is capable of in vitro splicing using a standard group I intron pathway, thus qualifying it as a functional ribozyme. Findings Here, we describe eight short putative group I introns, ranging in length from 63 to 75 nt, in the rRNA small subunit genes of Phialophora isolates, a fungal genus that ranges from saprobic to pathogenic on plants and animals. All contain putative pairing regions P1, P7, and P10, as well as a pairing region formed between the middle of the intron and part of the 3' exon. The other pairing regions common in the core of standard group I introns are absent. However, parts of the 3' exon may aid in the stabilization of these small introns. Although the eight putative group I introns were from at least three species of Phialophora, phylogenetic analysis indicated that the eight are monophyletic. They are also monophyletic with the small introns of two lichen-forming fungi, Porpidia crustulata and Arthonia lapidicola. Conclusions The small putative group I introns in Phialophora have common features that may represent group I introns at their minima. They appear to have a single origin as indicated by their monophyly in phylogenetic analyses. PMID:21781325

  14. Probabilistic simple splicing systems

    NASA Astrophysics Data System (ADS)

    Selvarajoo, Mathuri; Heng, Fong Wan; Sarmin, Nor Haniza; Turaev, Sherzod


    A splicing system, one of the early theoretical models for DNA computing was introduced by Head in 1987. Splicing systems are based on the splicing operation which, informally, cuts two strings of DNA molecules at the specific recognition sites and attaches the prefix of the first string to the suffix of the second string, and the prefix of the second string to the suffix of the first string, thus yielding the new strings. For a specific type of splicing systems, namely the simple splicing systems, the recognition sites are the same for both strings of DNA molecules. It is known that splicing systems with finite sets of axioms and splicing rules only generate regular languages. Hence, different types of restrictions have been considered for splicing systems in order to increase their computational power. Recently, probabilistic splicing systems have been introduced where the probabilities are initially associated with the axioms, and the probabilities of the generated strings are computed from the probabilities of the initial strings. In this paper, some properties of probabilistic simple splicing systems are investigated. We prove that probabilistic simple splicing systems can also increase the computational power of the splicing languages generated.

  15. Regulation of mRNA Levels by Decay-Promoting Introns that Recruit the Exosome Specificity Factor Mmi1

    PubMed Central

    Kilchert, Cornelia; Wittmann, Sina; Passoni, Monica; Shah, Sneha; Granneman, Sander; Vasiljeva, Lidia


    Summary In eukaryotic cells, inefficient splicing is surprisingly common and leads to the degradation of transcripts with retained introns. How pre-mRNAs are committed to nuclear decay is unknown. Here, we uncover a mechanism by which specific intron-containing transcripts are targeted for nuclear degradation in fission yeast. Sequence elements within these “decay-promoting” introns co-transcriptionally recruit the exosome specificity factor Mmi1, which induces degradation of the unspliced precursor and leads to a reduction in the levels of the spliced mRNA. This mechanism negatively regulates levels of the RNA helicase DDX5/Dbp2 to promote cell survival in response to stress. In contrast, fast removal of decay-promoting introns by co-transcriptional splicing precludes Mmi1 recruitment and relieves negative expression regulation. We propose that decay-promoting introns facilitate the regulation of gene expression. Based on the identification of multiple additional Mmi1 targets, including mRNAs, long non-coding RNAs, and sn/snoRNAs, we suggest a general role in RNA regulation for Mmi1 through transcript degradation. PMID:26670050

  16. Regulation of mRNA Levels by Decay-Promoting Introns that Recruit the Exosome Specificity Factor Mmi1.


    Kilchert, Cornelia; Wittmann, Sina; Passoni, Monica; Shah, Sneha; Granneman, Sander; Vasiljeva, Lidia


    In eukaryotic cells, inefficient splicing is surprisingly common and leads to the degradation of transcripts with retained introns. How pre-mRNAs are committed to nuclear decay is unknown. Here, we uncover a mechanism by which specific intron-containing transcripts are targeted for nuclear degradation in fission yeast. Sequence elements within these "decay-promoting" introns co-transcriptionally recruit the exosome specificity factor Mmi1, which induces degradation of the unspliced precursor and leads to a reduction in the levels of the spliced mRNA. This mechanism negatively regulates levels of the RNA helicase DDX5/Dbp2 to promote cell survival in response to stress. In contrast, fast removal of decay-promoting introns by co-transcriptional splicing precludes Mmi1 recruitment and relieves negative expression regulation. We propose that decay-promoting introns facilitate the regulation of gene expression. Based on the identification of multiple additional Mmi1 targets, including mRNAs, long non-coding RNAs, and sn/snoRNAs, we suggest a general role in RNA regulation for Mmi1 through transcript degradation. PMID:26670050

  17. Early base-pair fluctuations and the activation of mRNA splicing

    NASA Astrophysics Data System (ADS)

    Fernández, Ariel


    By means of multiprocessed Monte Carlo simulations we study the amplification in time structural fluctuations in sequential RNA folding concomitant with transcription. The simulations allow for an exploration of configuration space subject to the realistic time-constraints of RNA synthesis. The treatment focuses on the splicing YC4 intron as a study case. We show how an early disruption in the folding may result in a terminal structure which is active for splicing, bringing together the two cleavage sites at both ends of the intron.

  18. nagnag: Identification and quantification of NAGNAG alternative splicing using RNA-Seq data.


    Yan, Xiaoyan; Sablok, Gaurav; Feng, Gang; Ma, Jiaxin; Zhao, Hongwei; Sun, Xiaoyong


    Regulation of proteome diversity by alternative splicing has been widely demonstrated in plants and animals. NAGNAG splicing, which was recently defined as a tissue specific event, results in the production of two distinct isoforms that are distinguished by three nucleotides (NAG) as a consequence of the intron proximal or distal to the splice site. Since the NAGNAG mechanism is not well characterized, tools for the identification and quantification of NAGNAG splicing events remain under-developed. Here we report nagnag, an R-based NAGNAG splicing detection tool, which accurately identifies and quantifies NAGNAG splicing events using RNA-Seq. Overall, nagnag produces user-friendly visualization reports and highlights differences between the DNA/RNA/protein across the identified isoforms of the reported gene. The package is available on; or PMID:26028313

  19. Regulation of alternative splicing of tau exon 10.


    Qian, Wei; Liu, Fei


    The neuronal microtubule-associated protein tau is abnormally hyperphosphorylated and aggregated into neurofibrillary tangles in the brains of individuals with Alzheimer's disease and related neurodegenerative disorders. The adult human brain expresses six isoforms of tau generated by alternative splicing of exons 2, 3, and 10 of its pre-mRNA. Exon 10 encodes the second microtubule-binding repeat of tau. Its alternative splicing produces tau isoforms with either three or four microtubule-binding repeats, termed 3R-tau and 4Rtau. In the normal adult human brain, the level of 3R-tau is approximately equal to that of 4R-tau. Several silent and intronic mutations of the tau gene associated with FTDP-17T (frontotemporal dementia with Parkinsonism linked to chromosome 17 and specifically characterized by tau pathology) only disrupt exon 10 splicing, but do not influence the primary sequence of the tau protein. Thus, abnormal exon 10 splicing is sufficient to cause neurodegeneration and dementia. Here, we review the regulation of tau exon 10 splicing by cis-elements and trans-factors and summarize all the mutations associated with FTDP-17T and related tauopathies. The findings suggest that correction of exon 10 splicing may be a potential target for tau exon 10 splicing-related tauopathies. PMID:24627328

  20. Cauliflower mosaic virus Transcriptome Reveals a Complex Alternative Splicing Pattern

    PubMed Central

    Bouton, Clément; Geldreich, Angèle; Ramel, Laëtitia; Ryabova, Lyubov A.; Dimitrova, Maria; Keller, Mario


    The plant pararetrovirus Cauliflower mosaic virus (CaMV) uses alternative splic-ing to generate several isoforms from its polycistronic pregenomic 35S RNA. This pro-cess has been shown to be essential for infectivity. Previous works have identified four splice donor sites and a single splice acceptor site in the 35S RNA 5’ region and sug-gested that the main role of CaMV splicing is to downregulate expression of open read-ing frames (ORFs) I and II. In this study, we show that alternative splicing is a conserved process among CaMV isolates. In Cabb B-JI and Cabb-S isolates, splicing frequently leads to different fusion between ORFs, particularly between ORF I and II. The corresponding P1P2 fusion proteins expressed in E. coli interact with viral proteins P2 and P3 in vitro. However, they are detected neither during infection nor upon transient expression in planta, which suggests rapid degradation after synthesis and no important biological role in the CaMV infectious cycle. To gain a better understanding of the functional relevance of 35S RNA alternative splicing in CaMV infectivity, we inactivated the previously described splice sites. All the splicing mutants were as pathogenic as the corresponding wild-type isolate. Through RT-PCR-based analysis we demonstrate that CaMV 35S RNA exhibits a complex splicing pattern, as we identify new splice donor and acceptor sites whose selection leads to more than thirteen 35S RNA isoforms in infected turnip plants. Inactivating splice donor or acceptor sites is not lethal for the virus, since disrupted sites are systematically rescued by the activation of cryptic and/or seldom used splice sites. Taken together, our data depict a conserved, complex and flexible process, involving multiple sites, that ensures splicing of 35S RNA. PMID:26162084

  1. Distribution of introns in the mitochondrial gene nad1 in land plants: phylogenetic and molecular evolutionary implications.


    Dombrovska, Olena; Qiu, Yin-Long


    Forty-six species of diverse land plants were investigated by sequencing for their intron content in the mitochondrial gene nad1. A total of seven introns, all belonging to group II, were found, and two were newly discovered in this study. All 13 liverworts examined contain no intron, the same condition as in green algae. Mosses and hornworts, however, share one intron by themselves and another one with vascular plants. These intron distribution patterns are consistent with the hypothesis that liverworts represent the basal-most land plants and that the two introns were gained in the common ancestor of mosses-hornworts-vascular plants after liverworts had diverged. Hornworts also possess a unique intron of their own. A fourth intron was found only in Equisetum L., Marattiaceae, Ophioglossum L., Osmunda L., Asplenium L., and Adiantum L., and was likely acquired in their common ancestor, which supports the monophyly of moniliformopses. Three introns that were previously characterized in angiosperms and a few pteridophytes are now all extended to lycopods, and were likely gained in the common ancestor of vascular plants. Phylogenetic analyses of the intron sequences recovered topologies mirroring those of the plants, suggesting that the introns have all been vertically inherited. All seven nad1 group II introns show broad phylogenetic distribution patterns, with the narrowest being in moniliformopses and hornworts, lineages that date back to at least the Devonian (345 million years ago) and Silurian (435 million years ago), respectively. Hence, these introns must have invaded the genes via ancient transpositional events during the early stage of land plant evolution. Potentially heavy RNA editing was observed in nad1 of Haplomitrium Dedecek, Takakia Hatt. & Inoue, hornworts, Isoetes L., Ophioglossum, and Asplenium. A new nomenclature is proposed for group II introns. PMID:15186811

  2. Intronic regulation of Aire expression by Jmjd6 for self-tolerance induction in the thymus

    PubMed Central

    Yanagihara, Toyoshi; Sanematsu, Fumiyuki; Sato, Tetsuya; Uruno, Takehito; Duan, Xuefeng; Tomino, Takahiro; Harada, Yosuke; Watanabe, Mayuki; Wang, Yuqing; Tanaka, Yoshihiko; Nakanishi, Yoichi; Suyama, Mikita; Yoshinori, Fukui


    The thymus has spatially distinct microenvironments, the cortex and the medulla, where the developing T-cells are selected to mature or die through the interaction with thymic stromal cells. To establish the immunological self in the thymus, medullary thymic epithelial cells (mTECs) express diverse sets of tissue-specific self-antigens (TSAs). This ectopic expression of TSAs largely depends on the transcriptional regulator Aire, yet the mechanism controlling Aire expression itself remains unknown. Here, we show that Jmjd6, a dioxygenase that catalyses lysyl hydroxylation of splicing regulatory proteins, is critical for Aire expression. Although Jmjd6 deficiency does not affect abundance of Aire transcript, the intron 2 of Aire gene is not effectively spliced out in the absence of Jmjd6, resulting in marked reduction of mature Aire protein in mTECs and spontaneous development of multi-organ autoimmunity in mice. These results highlight the importance of intronic regulation in controlling Aire protein expression. PMID:26531897

  3. The Interplay of Temperature and Genotype on Patterns of Alternative Splicing in Drosophila melanogaster

    PubMed Central

    Jakšić, Ana Marija; Schlötterer, Christian


    Alternative splicing is the highly regulated process of variation in the removal of introns from premessenger-RNA transcripts. The consequences of alternative splicing on the phenotype are well documented, but the impact of the environment on alternative splicing is not yet clear. We studied variation in alternative splicing among four different temperatures, 13, 18, 23, and 29°, in two Drosophila melanogaster genotypes. We show plasticity of alternative splicing with up to 10% of the expressed genes being differentially spliced between the most extreme temperatures for a given genotype. Comparing the two genotypes at different temperatures, we found <1% of the genes being differentially spliced at 18°. At extreme temperatures, however, we detected substantial differences in alternative splicing—with almost 10% of the genes having differential splicing between the genotypes: a magnitude similar to between species differences. Genes with differential alternative splicing between genotypes frequently exhibit dominant inheritance. Remarkably, the pattern of surplus of differences in alternative splicing at extreme temperatures resembled the pattern seen for gene expression intensity. Since different sets of genes were involved for the two phenotypes, we propose that purifying selection results in the reduction of differences at benign temperatures. Relaxed purifying selection at temperature extremes, on the other hand, may cause the divergence in gene expression and alternative splicing between the two strains in rarely encountered environments. PMID:27440867

  4. Intrasplicing coordinates alternative first exons with alternative splicing in the protein 4.1R gene

    SciTech Connect

    Conboy, John G.; Parra, Marilyn K.; Tan, Jeff S.; Mohandas, Narla; Conboy, John G.


    In the protein 4.1R gene, alternative first exons splice differentially to alternative 3' splice sites far downstream in exon 2'/2 (E2'/2). We describe a novel intrasplicing mechanism by which exon 1A (E1A) splices exclusively to the distal E2'/2 acceptor via two nested splicing reactions regulated by novel properties of exon 1B (E1B). E1B behaves as an exon in the first step, using its consensus 5' donor to splice to the proximal E2'/2 acceptor. A long region of downstream intron is excised, juxtaposing E1B with E2'/2 to generate a new composite acceptor containing the E1B branchpoint/pyrimidine tract and E2 distal 3' AG-dinucleotide. Next, the upstream E1A splices over E1B to this distal acceptor, excising the remaining intron plus E1B and E2' to form mature E1A/E2 product. We mapped branch points for both intrasplicing reactions and demonstrated that mutation of the E1B 5' splice site or branchpoint abrogates intrasplicing. In the 4.1R gene, intrasplicing ultimately determines N-terminal protein structure and function. More generally, intrasplicing represents a new mechanism whereby alternative promoters can be coordinated with downstream alternative splicing.

  5. Genomic functions of U2AF in constitutive and regulated splicing

    PubMed Central

    Wu, Tongbin; Fu, Xiang-Dong


    The U2AF heterodimer is generally accepted to play a vital role in defining functional 3′ splice sites in pre-mRNA splicing. Given prevalent mutations in U2AF, particularly in the U2AF1 gene (which encodes for the U2AF35 subunit) in blood disorders and other human cancers, there are renewed interests in these classic splicing factors to further understand their regulatory functions in RNA metabolism in both physiological and disease settings. We recently reported that U2AF has a maximal capacity to directly bind ˜88% of functional 3′ splice sites in the human genome and that numerous U2AF binding events also occur in various exonic and intronic locations, thus providing additional mechanisms for the regulation of alternative splicing besides their traditional role in titrating weak splice sites in the cell. These findings, coupled with the existence of multiple related proteins to both U2AF65 and U2AF35, beg a series of questions on the universal role of U2AF in functional 3′ splice site definition, their binding specificities in vivo, potential mechanisms to bypass their requirement for certain intron removal events, contribution of splicing-independent functions of U2AF to important cellular functions, and the mechanism for U2AF mutations to invoke specific diseases in humans. PMID:25901584

  6. The evolution of spliced leader trans-splicing in nematodes.


    Pettitt, Jonathan; Harrison, Neale; Stansfield, Ian; Connolly, Bernadette; Müller, Berndt


    Spliced leader trans-splicing occurs in many primitive eukaryotes including nematodes. Most of our knowledge of trans-splicing in nematodes stems from the model organism Caenorhabditis elegans and relatives, and from work with Ascaris. Our investigation of spliced leader trans-splicing in distantly related Dorylaimia nematodes indicates that spliced-leader trans-splicing arose before the nematode phylum and suggests that the spliced leader RNA gene complements in extant nematodes have evolved from a common ancestor with a diverse set of spliced leader RNA genes. PMID:20659016

  7. The alternative splicing regulator Tra2b is required for somitogenesis and regulates splicing of an inhibitory Wnt11b isoform

    PubMed Central

    Dichmann, Darwin S; Walentek, Peter; Harland, Richard M


    SUMMARY Alternative splicing is pervasive in vertebrates, yet little is known about most isoforms or their regulation. transformer-2b (tra2b) encodes a splicing regulator whose endogenous function is poorly understood. Tra2b knockdown in Xenopus results in embryos with multiple defects, including defective somitogenesis. Using RNA-seq, we identify 142 splice changes, mostly intron retention and exon skipping, of which 89% are not in current annotations. A previously not described isoform of wnt11b retains the last intron, resulting in a truncated ligand (Wnt11b-short). We show that this isoform acts as a dominant-negative in cardiac gene induction and pronephric tubule formation. To determine the contribution of Wnt11b-short to the tra2b phenotype, we induce retention of intron4 in wnt11b, which recapitulates the failure to form somites but not other tra2b morphant defects. This alternative splicing of a Wnt ligand adds intricacy to a complex signaling pathway and highlights intron retention as a regulatory mechanism. PMID:25620705

  8. Identification of a truncated splice variant of IL-18 receptor alpha in the human and rat, with evidence of wider evolutionary conservation

    PubMed Central

    Grattan, David R.


    Interleukin-18 (IL-18) is a pro-inflammatory cytokine which stimulates activation of the nuclear factor kappa beta (NF-κB) pathway via interaction with the IL-18 receptor. The receptor itself is formed from a dimer of two subunits, with the ligand-binding IL-18Rα subunit being encoded by the IL18R1 gene. A splice variant of murine IL18r1, which has been previously described, is formed by transcription of an unspliced intron (forming a ‘type II’ IL18r1 transcript) and is predicted to encode a receptor with a truncated intracellular domain lacking the capacity to generate downstream signalling. In order to examine the relevance of this finding to human IL-18 function, we assessed the presence of a homologous transcript by reverse transcription-polymerase chain reaction (RT-PCR) in the human and rat as another common laboratory animal. We present evidence for type II IL18R1 transcripts in both species. While the mouse and rat transcripts are predicted to encode a truncated receptor with a novel 5 amino acid C-terminal domain, the human sequence is predicted to encode a truncated protein with a novel 22 amino acid sequence bearing resemblance to the ‘Box 1’ motif of the Toll/interleukin-1 receptor (TIR) domain, in a similar fashion to the inhibitory interleukin-1 receptor 2. Given that transcripts from these three species are all formed by inclusion of homologous unspliced intronic regions, an analysis of homologous introns across a wider array of 33 species with available IL18R1 gene records was performed, which suggests similar transcripts may encode truncated type II IL-18Rα subunits in other species. This splice variant may represent a conserved evolutionary mechanism for regulating IL-18 activity. PMID:25250214

  9. The human gene (CSNK2A1) coding for the casein kinase II subunit [alpha] is located on chromosome 20 and contains tandemly arranged Alu repeats

    SciTech Connect

    Wirkner, U.; Lichter, P.; Pyerin, W. ); Voss, H.; Ansorge, W. )


    The authors have isolated and characterized an 18.9-kb genomic clone representing a central portion of the human casein kinase II (CKII) subunit [alpha] gene (CSNK2A1). Using the whole clone as a probe, the gene was localized on chromosome 20p13. The clone contains eight exons whose sequences comprise bases 102 to 824 of the coding region of the human CKII[alpha]. The exon/intron splice junctions conform to the gt/ag rule. Three of the nine introns are located at positions corresponding to those in the CKII[alpha] gene of the nematode Caenorhabditis elegans. The introns contain eight complete and eight incomplete Alu repeats. Some of the Alu sequences are arranged in tandems of two or three, which seem to originate from insertions of younger Alu sequences into the poly(A) region of previously integrated Alu sequences, as indicated by flanking direct repeats. 50 refs., 5 figs., 1 tab.

  10. Dual Function for U2AF35 in AG-Dependent Pre-mRNA Splicing

    PubMed Central

    Guth, Sabine; Tange, Thomas O/.; Kellenberger, Esther; Valcárcel, Juan


    The splicing factor U2AF is required for the recruitment of U2 small nuclear RNP to pre-mRNAs in higher eukaryotes. The 65-kDa subunit of U2AF (U2AF65) binds to the polypyrimidine (Py) tract preceding the 3′ splice site, while the 35-kDa subunit (U2AF35) contacts the conserved AG dinucleotide at the 3′ end of the intron. It has been shown that the interaction between U2AF35 and the 3′ splice site AG can stabilize U2AF65 binding to weak Py tracts characteristic of so-called AG-dependent pre-mRNAs. U2AF35 has also been implicated in arginine-serine (RS) domain-mediated bridging interactions with splicing factors of the SR protein family bound to exonic splicing enhancers (ESE), and these interactions can also stabilize U2AF65 binding. Complementation of the splicing activity of nuclear extracts depleted of U2AF by chromatography in oligo(dT)-cellulose requires, for some pre-mRNAs, only the presence of U2AF65. In contrast, splicing of a mouse immunoglobulin M (IgM) M1-M2 pre-mRNA requires both U2AF subunits. In this report we have investigated the sequence elements (e.g., Py tract strength, 3′ splice site AG, ESE) responsible for the U2AF35 dependence of IgM. The results indicate that (i) the IgM substrate is an AG-dependent pre-mRNA, (ii) U2AF35 dependence correlates with AG dependence, and (iii) the identity of the first nucleotide of exon 2 is important for U2AF35 function. In contrast, RS domain-mediated interactions with SR proteins bound to the ESE appear to be dispensable, because the purine-rich ESE present in exon M2 is not essential for U2AF35 activity and because a truncation mutant of U2AF35 consisting only of the pseudo-RNA recognition motif domain and lacking the RS domain is active in our complementation assays. While some of the effects of U2AF35 can be explained in terms of enhanced U2AF65 binding, other activities of U2AF35 do not correlate with increased cross-linking of U2AF65 to the Py tract. Collectively, the results argue that

  11. The heteromeric Nanoarchaeum equitans splicing endonuclease cleaves noncanonical bulge–helix–bulge motifs of joined tRNA halves

    PubMed Central

    Randau, Lennart; Calvin, Kate; Hall, Michelle; Yuan, Jing; Podar, Mircea; Li, Hong; Söll, Dieter


    Among the tRNA population of the archaeal parasite Nanoarchaeum equitans are five species assembled from separate 5′ and 3′ tRNA halves and four species derived from tRNA precursors containing introns. In both groups an intervening sequence element must be removed during tRNA maturation. A bulge–helix–bulge (BHB) motif is the hallmark structure required by the archaeal splicing endonuclease for recognition and excision of all introns. BHB motifs are recognizable at the joining sites of all five noncontinuous tRNA species, although deviations from the canonical BHB motif are clearly present in at least two of them. Here, we show that the N. equitans splicing endonuclease cleaves tRNA precursors containing normal introns, as well as all five noncontinuous precursor tRNAs, at the predicted splice sites, indicating the enzyme's dual role in the removal of tRNA introns and processing of tRNA halves to be joined in trans. The cleavage activity on a set of synthetic canonical and noncanonical BHB constructs showed that the N. equitans splicing endonuclease accepts a broader range of substrates than the homodimeric Archaeoglobus fulgidus enzyme. In contrast to the A. fulgidus endonuclease, the N. equitans splicing enzyme possesses two different subunits. This heteromeric endonuclease type, found in N. equitans, in all Crenarchaeota, and in Methanopyrus kandleri, is able to act on the noncanonical tRNA introns present only in these organisms, which suggests coevolution of enzyme and substrate. PMID:16330750

  12. Cholesteryl Ester Transfer Protein (CETP) polymorphisms affect mRNA splicing, HDL levels, and sex-dependent cardiovascular risk.


    Papp, Audrey C; Pinsonneault, Julia K; Wang, Danxin; Newman, Leslie C; Gong, Yan; Johnson, Julie A; Pepine, Carl J; Kumari, Meena; Hingorani, Aroon D; Talmud, Philippa J; Shah, Sonia; Humphries, Steve E; Sadee, Wolfgang


    Polymorphisms in and around the Cholesteryl Ester Transfer Protein (CETP) gene have been associated with HDL levels, risk for coronary artery disease (CAD), and response to therapy. The mechanism of action of these polymorphisms has yet to be defined. We used mRNA allelic expression and splice isoform measurements in human liver tissues to identify the genetic variants affecting CETP levels. Allelic CETP mRNA expression ratios in 56 human livers were strongly associated with several variants 2.5-7 kb upstream of the transcription start site (e.g., rs247616 p = 6.4 × 10(-5), allele frequency 33%). In addition, a common alternatively spliced CETP isoform lacking exon 9 (Δ9), has been shown to prevent CETP secretion in a dominant-negative manner. The Δ 9 expression ranged from 10 to 48% of total CETP mRNA in 94 livers. Increased formation of this isoform was exclusively associated with an exon 9 polymorphism rs5883-C>T (p = 6.8 × 10(-10)) and intron 8 polymorphism rs9930761-T>C (5.6 × 10(-8)) (in high linkage disequilibrium with allele frequencies 6-7%). rs9930761 changes a key splicing branch point nucleotide in intron 8, while rs5883 alters an exonic splicing enhancer sequence in exon 9.The effect of these polymorphisms was evaluated in two clinical studies. In the Whitehall II study of 4745 subjects, both rs247616 and rs5883T/rs9930761C were independently associated with increased HDL-C levels in males with similar effect size (rs247616 p = 9.6 × 10(-28) and rs5883 p = 8.6 × 10(-10), adjusted for rs247616). In an independent multiethnic US cohort of hypertensive subjects with CAD (INVEST-GENE), rs5883T/rs9930761C alone were significantly associated with increased incidence of MI, stroke, and all-cause mortality in males (rs5883: OR 2.36 (CI 1.29-4.30), p = 0.005, n = 866). These variants did not reach significance in females in either study. Similar to earlier results linking low CETP activity with poor outcomes in males, our results suggest genetic, sex

  13. Preparation of group I introns for biochemical studies and crystallization assays by native affinity purification.


    Vicens, Quentin; Gooding, Anne R; Duarte, Luis F; Batey, Robert T


    The study of functional RNAs of various sizes and structures requires efficient methods for their synthesis and purification. Here, 23 group I intron variants ranging in length from 246 to 341 nucleotides -- some containing exons -- were subjected to a native purification technique previously applied only to shorter RNAs (<160 nucleotides). For the RNAs containing both exons, we adjusted the original purification protocol to allow for purification of radiolabeled molecules. The resulting RNAs were used in folding assays on native gel electrophoresis and in self-splicing assays. The intron-only RNAs were subjected to the regular native purification scheme, assayed for folding and employed in crystallization screens. All RNAs that contained a 3' overhang of one nucleotide were efficiently cleaved off from the support and were at least 90% pure after the non-denaturing purification. A representative subset of these RNAs was shown to be folded and self-splicing after purification. Additionally, crystals were grown for a 286 nucleotide long variant of the Clostridium botulinum intron. These results demonstrate the suitability of the native affinity purification method for the preparation of group I introns. We hope these findings will stimulate a broader application of this strategy to the preparation of other large RNA molecules. PMID:19710925

  14. Argonaute-1 binds transcriptional enhancers and controls constitutive and alternative splicing in human cells

    PubMed Central

    Alló, Mariano; Agirre, Eneritz; Bessonov, Sergey; Bertucci, Paola; Gómez Acuña, Luciana; Buggiano, Valeria; Bellora, Nicolás; Singh, Babita; Petrillo, Ezequiel; Blaustein, Matías; Miñana, Belén; Dujardin, Gwendal; Pozzi, Berta; Pelisch, Federico; Bechara, Elías; Agafonov, Dmitry E.; Srebrow, Anabella; Lührmann, Reinhard; Valcárcel, Juan; Eyras, Eduardo; Kornblihtt, Alberto R.


    The roles of Argonaute proteins in cytoplasmic microRNA and RNAi pathways are well established. However, their implication in small RNA-mediated transcriptional gene silencing in the mammalian cell nucleus is less understood. We have recently shown that intronic siRNAs cause chromatin modifications that inhibit RNA polymerase II elongation and modulate alternative splicing in an Argonaute-1 (AGO1)-dependent manner. Here we used chromatin immunoprecipitation followed by deep sequencing (ChIP-seq) to investigate the genome-wide distribution of AGO1 nuclear targets. Unexpectedly, we found that about 80% of AGO1 clusters are associated with cell-type-specific transcriptional enhancers, most of them (73%) overlapping active enhancers. This association seems to be mediated by long, rather than short, enhancer RNAs and to be more prominent in intragenic, rather than intergenic, enhancers. Paradoxically, crossing ChIP-seq with RNA-seq data upon AGO1 depletion revealed that enhancer-bound AGO1 is not linked to the global regulation of gene transcription but to the control of constitutive and alternative splicing, which was confirmed by an individual gene analysis explaining how AGO1 controls inclusion levels of the cassette exon 107 in the SYNE2 gene. PMID:25313066

  15. SPA: A Probabilistic Algorithm for Spliced Alignment

    PubMed Central

    van Nimwegen, Erik; Paul, Nicodeme; Sheridan, Robert; Zavolan, Mihaela


    Recent large-scale cDNA sequencing efforts show that elaborate patterns of splice variation are responsible for much of the proteome diversity in higher eukaryotes. To obtain an accurate account of the repertoire of splice variants, and to gain insight into the mechanisms of alternative splicing, it is essential that cDNAs are very accurately mapped to their respective genomes. Currently available algorithms for cDNA-to-genome alignment do not reach the necessary level of accuracy because they use ad hoc scoring models that cannot correctly trade off the likelihoods of various sequencing errors against the probabilities of different gene structures. Here we develop a Bayesian probabilistic approach to cDNA-to-genome alignment. Gene structures are assigned prior probabilities based on the lengths of their introns and exons, and based on the sequences at their splice boundaries. A likelihood model for sequencing errors takes into account the rates at which misincorporation, as well as insertions and deletions of different lengths, occurs during sequencing. The parameters of both the prior and likelihood model can be automatically estimated from a set of cDNAs, thus enabling our method to adapt itself to different organisms and experimental procedures. We implemented our method in a fast cDNA-to-genome alignment program, SPA, and applied it to the FANTOM3 dataset of over 100,000 full-length mouse cDNAs and a dataset of over 20,000 full-length human cDNAs. Comparison with the results of four other mapping programs shows that SPA produces alignments of significantly higher quality. In particular, the quality of the SPA alignments near splice boundaries and SPA's mapping of the 5′ and 3′ ends of the cDNAs are highly improved, allowing for more accurate identification of transcript starts and ends, and accurate identification of subtle splice variations. Finally, our splice boundary analysis on the human dataset suggests the existence of a novel non-canonical splice

  16. Group I introns interrupt the chloroplast psaB and psbC and the mitochondrial rrnL gene in Chlamydomonas.

    PubMed Central

    Turmel, M; Mercier, J P; Côté, M J


    The polymerase chain reaction was used to identify novel IAI subgroup introns in cpDNA-enriched preparations from the interfertile green algae Chlamydomonas eugametos and Chlamydomonas moewusii. These experiments along with sequence analysis disclosed the presence, in both green algae, of a single IA1 intron in the psaB gene and of two group I introns (IA2 and IA1) in the psbC gene. In addition, two group I introns (IA1 and IB4) were found in the peptidyltransferase region of the mitochondrial large subunit rRNA gene at the same positions as previously reported Chlamydomonas chloroplast introns. The 188 bp segment preceding the first mitochondrial intron revealed extensive sequence similarity to the distantly spaced rRNA-coding modules L7 and L8 in the Chlamydomonas reinhardtii mitochondrial DNA, indicating that these two modules have undergone rearrangements in Chlamydomonas. The IA1 introns in psaB and psbC were found to be related in sequence to the first intron in the C. moewusii chloroplast psbA gene. The similarity between the former introns extends to the immediate 5' flanking exon sequence, suggesting that group I intron transposition occurred from one of the two genes to the other through reverse splicing. PMID:7504814

  17. Splicing of goose parvovirus pre-mRNA influences cytoplasmic translation of the processed mRNA

    SciTech Connect

    Li, Long; Pintel, David J.


    Translation of goose parvovirus (GPV) 72 kDa Rep 1 is initiated from unspliced P9-generated mRNAs in ORF1 from the first in-frame AUG (537 AUG); however, this AUG is bypassed in spliced P9-generated RNA: translation of the 52 kDa Rep 2 protein from spliced RNA is initiated in ORF2 at the next AUG downstream (650 AUG). Usage of the 537 AUG was restored in spliced RNA when the GPV intron was replaced with a chimeric SV40 intron, or following specific mutations of the GPV intron which did not appear in the final spliced mRNA. Additionally, 650 AUG usage was gained in unspliced RNA when the GPV intron splice sites were debilitated. Splicing-dependent regulation of translation initiation was mediated in cis by GPV RNA surrounding the target AUGs. Thus, nuclear RNA processing of GPV P9-generated pre-mRNAs has a complex, but significant, effect on alternative translation initiation of the GPV Rep proteins.

  18. Molecular genetic analysis of U2AF59 in Schizosaccharomyces pombe: differential sensitivity of introns to mutational inactivation.

    PubMed Central

    Romfo, C M; Lakhe-Reddy, S; Wise, J A


    The large subunit of the mammalian U2AF heterodimer (U2AF65) is essential for splicing in vitro. To expand our understanding of how this protein functions in vivo, we have created a null allele of the gene encoding the Schizosaccharomyces pombe ortholog, U2AF59, and employed it in a variety of genetic complementation assays. First, analysis of an extensive series of double amino acid substitutions indicates that this splicing factor is surprisingly refractory to mutations. Second, despite extensive structural conservation, we find that metazoan large subunit orthologs cannot substitute in vivo for fission yeast U2AF59. Third, because the activity of U2AF65 in vitro involves binding to the 3' polypyrimidine tract, we examined the splicing of introns containing or lacking this feature in a U2AF59 mutant described here as well as a previously isolated temperature-sensitive mutant (Potashkin et al., 1993, Science 262:573-575). Our data indicate that all four introns tested, including two that lack extensive runs of pyrimidines between the branchpoint and 3' splice site, show splicing defects upon shifting to the nonpermissive condition. In all cases, splicing is blocked prior to the first transesterification reaction in the mutants, consistent with the role inferred for human U2AF65 based on in vitro experiments. PMID:9917066

  19. Correlated Evolution of Nucleotide Positions within Splice Sites in Mammals.


    Denisov, Stepan; Bazykin, Georgii; Favorov, Alexander; Mironov, Andrey; Gelfand, Mikhail


    Splice sites (SSs)--short nucleotide sequences flanking introns--are under selection for spliceosome binding, and adhere to consensus sequences. However, non-consensus nucleotides, many of which probably reduce SS performance, are frequent. Little is known about the mechanisms maintaining such apparently suboptimal SSs. Here, we study the correlations between strengths of nucleotides occupying different positions of the same SS. Such correlations may arise due to epistatic interactions between positions (i.e., a situation when the fitness effect of a nucleotide in one position depends on the nucleotide in another position), their evolutionary history, or to other reasons. Within both the intronic and the exonic parts of donor SSs, nucleotides that increase (decrease) SS strength tend to co-occur with other nucleotides increasing (respectively, decreasing) it, consistent with positive epistasis. Between the intronic and exonic parts of donor SSs, the correlations of nucleotide strengths tend to be negative, consistent with negative epistasis. In the course of evolution, substitutions at a donor SS tend to decrease the strength of its exonic part, and either increase or do not change the strength of its intronic part. In acceptor SSs, the situation is more complicated; the correlations between adjacent positions appear to be driven mainly by avoidance of the AG dinucleotide which may cause aberrant splicing. In summary, both the content and the evolution of SSs is shaped by a complex network of interdependences between adjacent nucleotides that respond to a range of sometimes conflicting selective constraints. PMID:26642327

  20. Kaposi's sarcoma-associated herpesvirus K8beta is derived from a spliced intermediate of K8 pre-mRNA and antagonizes K8alpha (K-bZIP) to induce p21 and p53 and blocks K8alpha-CDK2 interaction.


    Yamanegi, Koji; Tang, Shuang; Zheng, Zhi-Ming


    Kaposi's sarcoma-associated herpesvirus (KSHV) is a lymphotropic DNA tumor virus that induces Kaposi's sarcoma and AIDS-related primary effusion lymphoma. KSHV open reading frame 50 and K8 genes in early viral lytic infection express, respectively, a tricistronic and a bicistronic pre-mRNA, which undergo alternative splicing to create two major spliced mRNA isoforms, alpha and beta, by inclusion (beta) or exclusion (alpha) of an intron at nucleotides 75563 to 75645. This intron contains some suboptimal features, which cause the intron 5' splice site (ss) to interact weakly with U1 snRNA and the 3' ss to bind a U2 auxiliary factor, U2AF, with low affinity. Optimization of this intron in K8 (K8 intron 2) promoted the interaction of the 5' ss with U1 and the 3' ss with U2AF, resulting in a substantial increase in intron splicing. Splicing of K8 intron 2 has also been shown to be stimulated by the splicing of a downstream intron. This was confirmed by the insertion of a human beta-globin intron into the K8beta exon 3-exon 4 splice junction, which promoted splicing of K8beta intron 2 and conversion of the K8beta mRNA to the K8alpha mRNA that encodes a K-bZIP protein. Intron 2 contains a premature termination codon, yet the K8beta mRNA is insensitive to nonsense-mediated mRNA decay, suggesting that the truncated K8beta protein may have a biological function. Indeed, although the truncated K8beta protein is missing only a C-terminal leucine zipper domain from the K-bZIP, its expression antagonizes the ability of the K-bZIP to induce p53 and p21 and blocks K-bZIP-CDK2 interaction through interfering K8alpha mRNA production. PMID:16254356

  1. Intracellular Folding of the Tetrahymena Group I Intron Depends on Exon Sequence and Promoter Choice

    SciTech Connect

    Koduvayur,S.; Woodson, S.


    The Tetrahymena group I intron splices 20 to 50 times faster in Tetrahymena than in vitro, implying that the intron rapidly adopts its active conformation in the cell. The importance of cotranscriptional folding and the contribution of the rRNA exons to the stability of the active pre-RNA structure were investigated by comparing the activity of minimal pre-RNAs expressed in Escherichia coli. Pre-RNAs containing exons derived from E. coli 23 S rRNA were three to four times more active than the wild-type Tetrahymena pre-RNA. E. coli transcripts of the chimeric E. coli pre-RNA were two to eight times more active than were T7 transcripts. However, the effect of cotranscriptional folding depends on exon sequences. Unexpectedly, the unspliced pre-RNA decays more slowly than predicted from the rate of splicing. This observation is best explained by partitioning of transcripts into active and inactive pools. We propose that the active pool splices within a few seconds, whereas the inactive pool is degraded without appreciable splicing.

  2. Towards understanding pre-mRNA splicing mechanisms and the role of SR proteins.


    Sahebi, Mahbod; Hanafi, Mohamed M; van Wijnen, Andre J; Azizi, Parisa; Abiri, Rambod; Ashkani, Sadegh; Taheri, Sima


    Alternative pre-mRNA splicing provides a source of vast protein diversity by removing non-coding sequences (introns) and accurately linking different exonic regions in the correct reading frame. The regulation of alternative splicing is essential for various cellular functions in both pathological and physiological conditions. In eukaryotic cells, this process is commonly used to increase proteomic diversity and to control gene expression either co- or post-transcriptionally. Alternative splicing occurs within a megadalton-sized, multi-component machine consisting of RNA and proteins; during the splicing process, this complex undergoes dynamic changes via RNA-RNA, protein-protein and RNA-protein interactions. Co-transcriptional splicing functionally integrates the transcriptional machinery, thereby enabling the two processes to influence one another, whereas post-transcriptional splicing facilitates the coupling of RNA splicing with post-splicing events. This review addresses the structural aspects of spliceosomes and the mechanistic implications of their stepwise assembly on the regulation of pre-mRNA splicing. Moreover, the role of phosphorylation-based, signal-induced changes in the regulation of the splicing process is demonstrated. PMID:27154819

  3. Comprehensive splicing functional analysis of DNA variants of the BRCA2 gene by hybrid minigenes

    PubMed Central


    Introduction The underlying pathogenic mechanism of a large fraction of DNA variants of disease-causing genes is the disruption of the splicing process. We aimed to investigate the effect on splicing of the BRCA2 variants c.8488-1G > A (exon 20) and c.9026_9030del (exon 23), as well as 41 BRCA2 variants reported in the Breast Cancer Information Core (BIC) mutation database. Methods DNA variants were analyzed with the splicing prediction programs NNSPLICE and Human Splicing Finder. Functional analyses of candidate variants were performed by lymphocyte RT-PCR and/or hybrid minigene assays. Forty-one BIC variants of exons 19, 20, 23 and 24 were bioinformatically selected and generated by PCR-mutagenesis of the wild type minigenes. Results Lymphocyte RT-PCR of c.8488-1G > A showed intron 19 retention and a 12-nucleotide deletion in exon 20, whereas c.9026_9030del did not show any splicing anomaly. Minigene analysis of c.8488-1G > A displayed the aforementioned aberrant isoforms but also exon 20 skipping. We further evaluated the splicing outcomes of 41 variants of four BRCA2 exons by minigene analysis. Eighteen variants presented splicing aberrations. Most variants (78.9%) disrupted the natural splice sites, whereas four altered putative enhancers/silencers and had a weak effect. Fluorescent RT-PCR of minigenes accurately detected 14 RNA isoforms generated by cryptic site usage, exon skipping and intron retention events. Fourteen variants showed total splicing disruptions and were predicted to truncate or eliminate essential domains of BRCA2. Conclusions A relevant proportion of BRCA2 variants are correlated with splicing disruptions, indicating that RNA analysis is a valuable tool to assess the pathogenicity of a particular DNA change. The minigene system is a straightforward and robust approach to detect variants with an impact on splicing and contributes to a better knowledge of this gene expression step. PMID:22632462

  4. The strength of the HIV-1 3' splice sites affects Rev function

    PubMed Central

    Kammler, Susanne; Otte, Marianne; Hauber, Ilona; Kjems, Jørgen; Hauber, Joachim; Schaal, Heiner


    Background The HIV-1 Rev protein is a key component in the early to late switch in HIV-1 splicing from early intronless (e.g. tat, rev) to late intron-containing Rev-dependent (e.g. gag, vif, env) transcripts. Previous results suggested that cis-acting sequences and inefficient 5' and 3' splice sites are a prerequisite for Rev function. However, we and other groups have shown that two of the HIV-1 5' splice sites, D1 and D4, are efficiently used in vitro and in vivo. Here, we focus on the efficiency of the HIV-1 3' splice sites taking into consideration to what extent their intrinsic efficiencies are modulated by their downstream cis-acting exonic sequences. Furthermore, we delineate their role in RNA stabilization and Rev function. Results In the presence of an efficient upstream 5' splice site the integrity of the 3' splice site is not essential for Rev function whereas an efficient 3' splice site impairs Rev function. The detrimental effect of a strong 3' splice site on the amount of Rev-dependent intron-containing HIV-1 glycoprotein coding (env) mRNA is not compensatable by weakening the strength of the upstream 5' splice site. Swapping the HIV-1 3' splice sites in an RRE-containing minigene, we found a 3' splice site usage which was variably dependent on the presence of the usual downstream exonic sequence. The most evident activation of 3' splice site usage by its usual downstream exonic sequence was observed for 3' splice site A1 which was turned from an intrinsic very weak 3' splice site into the most active 3' splice site, even abolishing Rev activity. Performing pull-down experiments with nuclear extracts of HeLa cells we identified a novel ASF/SF2-dependent exonic splicing enhancer (ESE) within HIV-1 exon 2 consisting of a heptameric sequence motif occurring twice (M1 and M2) within this short non-coding leader exon. Single point mutation of M1 within an infectious molecular clone is detrimental for HIV-1 exon 2 recognition without affecting Rev

  5. Alternative Splicing in CKD.


    Stevens, Megan; Oltean, Sebastian


    Alternative splicing (AS) has emerged in the postgenomic era as one of the main drivers of proteome diversity, with ≥94% of multiexon genes alternatively spliced in humans. AS is therefore one of the main control mechanisms for cell phenotype, and is a process deregulated in disease. Numerous reports describe pathogenic mutations in splice factors, splice sites, or regulatory sequences. Additionally, compared with the physiologic state, disease often associates with an abnormal proportion of splice isoforms (or novel isoforms), without an apparent driver mutation. It is therefore essential to study how AS is regulated in physiology, how it contributes to pathogenesis, and whether we can manipulate faulty splicing for therapeutic advantage. Although the disease most commonly linked to deregulation of AS in several genes is cancer, many reports detail pathogenic splice variants in diseases ranging from neuromuscular disorders to diabetes or cardiomyopathies. A plethora of splice variants have been implicated in CKDs as well. In this review, we describe examples of these CKD-associated splice variants and ideas on how to manipulate them for therapeutic benefit. PMID:26763787

  6. Tafazzin splice variants and mutations in Barth syndrome.


    Kirwin, Susan M; Manolakos, Athena; Barnett, Sarah Swain; Gonzalez, Iris L


    Barth syndrome is caused by mutations in the TAZ (tafazzin) gene on human chromosome Xq28. The human tafazzin gene produces four major mRNA splice variants; two of which have been shown to be functional (TAZ lacking exon 5 and full-length) in complementation studies with yeast and Drosophila. This study characterizes the multiple alternative splice variants of TAZ mRNA and their proportions in blood samples from a cohort of individuals with Barth syndrome (BTHS). Because it has been reported that collection and processing methods can affect the expression of various genes, we tested and chose a stabilizing medium for collecting, shipping and processing of the blood samples of these individuals. In both healthy controls and in BTHS individuals, we found a greater variety of alternatively spliced forms than previously described, with a sizeable proportion of minor splice variants besides the four dominant isoforms. Individuals with certain exonic and intronic splice mutations produce additional mutant mRNAs that could be translated into two or more proteins with different amino acid substitutions in a single individual. A fraction of the minor splice variants is predicted to be non-productive. PMID:24342716

  7. Compensatory signals associated with the activation of human GC 5′ splice sites

    PubMed Central

    Kralovicova, Jana; Hwang, Gyulin; Asplund, A. Charlotta; Churbanov, Alexander; Smith, C. I. Edvard; Vorechovsky, Igor


    GC 5′ splice sites (5′ss) are present in ∼1% of human introns, but factors promoting their efficient selection are poorly understood. Here, we describe a case of X-linked agammaglobulinemia resulting from a GC 5′ss activated by a mutation in BTK intron 3. This GC 5′ss was intrinsically weak, yet it was selected in >90% primary transcripts in the presence of a strong and intact natural GT counterpart. We show that efficient selection of this GC 5′ss required a high density of GAA/CAA-containing splicing enhancers in the exonized segment and was promoted by SR proteins 9G8, Tra2β and SC35. The GC 5′ss was efficiently inhibited by splice-switching oligonucleotides targeting either the GC 5′ss itself or the enhancer. Comprehensive analysis of natural GC-AG introns and previously reported pathogenic GC 5′ss showed that their efficient activation was facilitated by higher densities of splicing enhancers and lower densities of silencers than their GT 5′ss equivalents. Removal of the GC-AG introns was promoted to a minor extent by the splice-site strength of adjacent exons and inhibited by flanking Alu repeats, with the first downstream Alus located on average at a longer distance from the GC 5′ss than other transposable elements. These results provide new insights into the splicing code that governs selection of noncanonical splice sites. PMID:21609956

  8. An intronic deletion in the PROM1 gene leads to autosomal recessive cone-rod dystrophy

    PubMed Central

    Eidinger, Osnat; Leibu, Rina; Newman, Hadas; Rizel, Leah; Perlman, Ido


    Purpose To investigate the genetic basis for autosomal recessive cone-rod dystrophy (CRD) in a consanguineous Israeli Jewish family. Methods Patients underwent a detailed ophthalmic evaluation, including eye examination, visual field testing, optical coherence tomography (OCT), and electrophysiological tests, electroretinography (ERG) and visual evoked potential (VEP). Genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array was performed to identify homozygous regions shared among two of the affected individuals. Mutation screening of the underlying gene was performed with direct sequencing. In silico and in vitro analyses were used to predict the effect of the identified mutation on splicing. Results The affected family members are three siblings who have various degrees of progressive visual deterioration, glare, color vision abnormalities, and night vision difficulties. Visual field tests revealed central scotomas of different extension. Cone and rod ERG responses were reduced, with cones more severely affected. Homozygosity mapping revealed several homozygous intervals shared among two of the affected individuals. One included the PROM1 gene. Sequence analysis of the 26 coding exons of PROM1 in one affected individual revealed no mutations in the coding sequence or in intronic splice sites. However, in intron 21, proximate to the intron–exon junction, we observed a homozygous 10 bp deletion between positions −26 and −17 (c.2281–26_-17del). The deletion was linked to a known SNP, c.2281–6C>G. The deletion cosegregated with the disease in the family, and was not detected in public databases or in 101 ethnically-matched control individuals. In silico analysis predicted that this deletion would lead to altered intron 21 splicing. Bioinformatic analysis predicted that a recognition site for the SRSF2 splicing factor is located within the deleted sequence. The in vitro splicing assay demonstrated that c.2281–26_-17del leads to

  9. The evolutionary conservation of rps3 introns and rps19-rps3-rpl16 gene cluster in Adiantum capillus-veneris mitochondria.


    Bonavita, Savino; Regina, Teresa Maria Rosaria


    Ferns are a large and evolutionarily critical group of vascular land plants for which quite limited mitochondrial gene content and genome organization data are, currently, available. This study reports that the gene for the ribosomal protein S3 (rps3) is preserved and physically clustered to an upstream rps19 and a downstream overlapping rpl16 locus in the mitochondrial DNA of the true fern Adiantum capillus-veneris L. Sequence analysis also revealed that the rps3 gene is interrupted by two cis-splicing group II introns, like the counterpart in lycopod and gymnosperm representatives. A preliminary polymerase chain reaction (PCR) survey confirmed a scattered distribution pattern of both the rps3 introns also in other fern lineages. Northern blot and reverse transcription (RT)-PCR analyses demonstrated that the three ribosomal protein genes are co-transcribed as a polycistronic mRNA and modified by RNA editing. Particularly, the U-to-C type editing amends numerous genomic stop codons in the A. capillus-veneris rps19, rps3 and rpl16 sequences, thus, assuring the synthesis of complete and functional polypeptides. Collectively, the findings from this study further expand our knowledge of the mitochondrial rps3 architecture and evolution, also, bridging the significant molecular data gaps across the so far underrepresented ferns and all land plants. PMID:26281979

  10. Biochemical identification of new proteins involved in splicing repression at the Drosophila P-element exonic splicing silencer

    PubMed Central

    Horan, Lucas; Yasuhara, Jiro C.; Kohlstaedt, Lori A.; Rio, Donald C.


    Splicing of the Drosophila P-element third intron (IVS3) is repressed in somatic tissues due to the function of an exonic splicing silencer (ESS) complex present on the 5′ exon RNA. To comprehensively characterize the mechanisms of this alternative splicing regulation, we used biochemical fractionation and affinity purification to isolate the silencer complex assembled in vitro and identify the constituent proteins by mass spectrometry. Functional assays using splicing reporter minigenes identified the proteins hrp36 and hrp38 and the cytoplasmic poly(A)-binding protein PABPC1 as novel functional components of the splicing silencer. hrp48, PSI, and PABPC1 have high-affinity RNA-binding sites on the P-element IVS3 5′ exon, whereas hrp36 and hrp38 proteins bind with low affinity to the P-element silencer RNA. RNA pull-down and immobilized protein assays showed that hrp48 protein binding to the silencer RNA can recruit hrp36 and hrp38. These studies identified additional components that function at the P-element ESS and indicated that proteins with low-affinity RNA-binding sites can be recruited in a functional manner through interactions with a protein bound to RNA at a high-affinity binding site. These studies have implications for the role of heterogeneous nuclear ribonucleoproteins (hnRNPs) in the control of alternative splicing at cis-acting regulatory sites. PMID:26545814

  11. Quantitation of normal CFTR mRNA in CF patients with splice-site mutations

    SciTech Connect

    Zhou, Z.; Olsen, J.C.; Silverman, L.M.


    Previously we identified two mutations in introns of the CFTR gene associated with partially active splice sites and unusual clinical phenotypes. One mutation in intron 19 (3849+10 kb C to T) is common in CF patients with normal sweat chloride values; an 84 bp sequence from intron 19, which contains a stop codon, is inserted between exon 19 and exon 20 in most nasal CFTR transcripts. The other mutation in intron 14B (2789+5 G to A) is associated with elevated sweat chloride levels, but mild pulmonary disease; exon 14B (38 bp) is spliced out of most nasal CFTR transcipts. The remaining CFTR cDNA sequences, other than the 84 bp insertion of exon 14B deletion, are identical to the published sequence. To correlate genotype and phenotype, we used quantitative RT-PCR to determine the levels of normally-spliced CFTR mRNA in nasal epithelia from these patients. CFTR cDNA was amplified (25 cycles) by using primers specific for normally-spliced species, {gamma}-actin cDNA was amplified as a standard.

  12. IRcall and IRclassifier: two methods for flexible detection of intron retention events from RNA-Seq data

    PubMed Central


    Background The emergence of next-generation RNA sequencing (RNA-Seq) provides tremendous opportunities for researchers to analyze alternative splicing on a genome-wide scale. However, accurate detection of intron retention (IR) events from RNA-Seq data has remained an unresolved challenge in next-generation sequencing (NGS) studies. Results We propose two new methods: IRcall and IRclassifier to detect IR events from RNA-Seq data. Our methods combine together gene expression information, read coverage within an intron, and read counts (within introns, within flanking exons, supporting splice junctions, and overlapping with 5' splice site/ 3' splice site), employing ranking strategy and classifiers to detect IR events. We applied our approaches to one published RNA-Seq data on contrasting skip mutant and wild-type in Arabidopsis thaliana. Compared with three state-of-the-art methods, IRcall and IRclassifier could effectively filter out false positives, and predict more accurate IR events. Availability The data and codes of IRcall and IRclassifier are available at PMID:25707295

  13. Complete androgen insensitivity syndrome caused by a deep intronic pseudoexon-activating mutation in the androgen receptor gene.


    Känsäkoski, Johanna; Jääskeläinen, Jarmo; Jääskeläinen, Tiina; Tommiska, Johanna; Saarinen, Lilli; Lehtonen, Rainer; Hautaniemi, Sampsa; Frilander, Mikko J; Palvimo, Jorma J; Toppari, Jorma; Raivio, Taneli


    Mutations in the X-linked androgen receptor (AR) gene underlie complete androgen insensitivity syndrome (CAIS), the most common cause of 46,XY sex reversal. Molecular genetic diagnosis of CAIS, however, remains uncertain in patients who show normal coding region of AR. Here, we describe a novel mechanism of AR disruption leading to CAIS in two 46,XY sisters. We analyzed whole-genome sequencing data of the patients for pathogenic variants outside the AR coding region. Patient fibroblasts from the genital area were used for AR cDNA analysis and protein quantification. Analysis of the cDNA revealed aberrant splicing of the mRNA caused by a deep intronic mutation (c.2450-118A>G) in the intron 6 of AR. The mutation creates a de novo 5' splice site and a putative exonic splicing enhancer motif, which leads to the preferential formation of two aberrantly spliced mRNAs (predicted to include a premature stop codon). Patient fibroblasts contained no detectable AR protein. Our results show that patients with CAIS and normal AR coding region need to be examined for deep intronic mutations that can lead to pseudoexon activation. PMID:27609317

  14. Complete androgen insensitivity syndrome caused by a deep intronic pseudoexon-activating mutation in the androgen receptor gene

    PubMed Central

    Känsäkoski, Johanna; Jääskeläinen, Jarmo; Jääskeläinen, Tiina; Tommiska, Johanna; Saarinen, Lilli; Lehtonen, Rainer; Hautaniemi, Sampsa; Frilander, Mikko J.; Palvimo, Jorma J.; Toppari, Jorma; Raivio, Taneli


    Mutations in the X-linked androgen receptor (AR) gene underlie complete androgen insensitivity syndrome (CAIS), the most common cause of 46,XY sex reversal. Molecular genetic diagnosis of CAIS, however, remains uncertain in patients who show normal coding region of AR. Here, we describe a novel mechanism of AR disruption leading to CAIS in two 46,XY sisters. We analyzed whole-genome sequencing data of the patients for pathogenic variants outside the AR coding region. Patient fibroblasts from the genital area were used for AR cDNA analysis and protein quantification. Analysis of the cDNA revealed aberrant splicing of the mRNA caused by a deep intronic mutation (c.2450-118A>G) in the intron 6 of AR. The mutation creates a de novo 5′ splice site and a putative exonic splicing enhancer motif, which leads to the preferential formation of two aberrantly spliced mRNAs (predicted to include a premature stop codon). Patient fibroblasts contained no detectable AR protein. Our results show that patients with CAIS and normal AR coding region need to be examined for deep intronic mutations that can lead to pseudoexon activation. PMID:27609317

  15. Regulation of PURA gene transcription by three promoters generating distinctly spliced 5-prime leaders: a novel means of fine control over tissue specificity and viral signals

    PubMed Central


    Background Purα is an evolutionarily conserved cellular protein participating in processes of DNA replication, transcription, and RNA transport; all involving binding to nucleic acids and altering conformation and physical positioning. The distinct but related roles of Purα suggest a need for expression regulated differently depending on intracellular and external signals. Results Here we report that human PURA (hPURA) transcription is regulated from three distinct and widely-separated transcription start sites (TSS). Each of these TSS is strongly homologous to a similar site in mouse chromosomal DNA. Transcripts from TSS I and II are characterized by the presence of large and overlapping 5'-UTR introns terminated at the same splice receptor site. Transfection of lung carcinoma cells with wild-type or mutated hPURA 5' upstream sequences identifies different regulatory elements. TSS III, located within 80 bp of the translational start codon, is upregulated by E2F1, CAAT and NF-Y binding elements. Transcription at TSS II is downregulated through the presence of adjacent consensus binding elements for interferon regulatory factors (IRFs). Chromatin immunoprecipitation reveals that IRF-3 protein binds hPURA promoter sequences at TSS II in vivo. By co-transfecting hPURA reporter plasmids with expression plasmids for IRF proteins we demonstrate that several IRFs, including IRF-3, down-regulate PURA transcription. Infection of NIH 3T3 cells with mouse cytomegalovirus results in a rapid decrease in levels of mPURA mRNA and Purα protein. The viral infection alters the degree of splicing of the 5'-UTR introns of TSS II transcripts. Conclusions Results provide evidence for a novel mechanism of transcriptional control by multiple promoters used differently in various tissues and cells. Viral infection alters not only the use of PURA promoters but also the generation of different non-coding RNAs from 5'-UTRs of the resulting transcripts. PMID:21062477

  16. Experimental approaches to studying the nature and impact of splicing variation in zebrafish.


    Keightley, M C; Markmiller, S; Love, C G; Rasko, J E J; Lieschke, G J; Heath, J K


    From a fixed number of genes carried in all cells, organisms create considerable diversity in cellular phenotype through differential regulation of gene expression. One prevalent source of transcriptome diversity is alternative pre-mRNA splicing, which is manifested in many different forms. Zebrafish models of splicing dysfunction due to mutated spliceosome components provide opportunity to link biochemical analyses of spliceosome structure and function with whole organism phenotypic outcomes. Drawing from experience with two zebrafish mutants: cephalophŏnus (a prpf8 mutant, isolated for defects in granulopoiesis) and caliban (a rnpc3 mutant, isolated for defects in digestive organ development), we describe the use of glycerol gradient sedimentation and native gel electrophoresis to resolve components of aberrant splicing complexes. We also describe how RNAseq can be employed to examine relatively rare alternative splicing events including intron retention. Such experimental approaches in zebrafish can promote understanding of how splicing variation and dysfunction contribute to phenotypic diversity and disease pathogenesis. PMID:27443930

  17. Structure of the human myelin/oligodendrocyte glycoprotein gene and multiple alternative spliced isoforms

    SciTech Connect

    Pham-Dinh, D.; Gaspera, D.B.; Dautigny, A.


    Myelin/oligodendrocyte glycoprotein (MOG), a special component of the central nervous system localization on the outermost lamellae of mature myelin, is a member of the immunoglobulin superfamily. We report here the organization of the human MOG gene, which spans approximately 17 kb, and the characterization of six MOG mRNA splicing variants. The intron/exon structure of the human MOG gene confirmed the splicing pattern, supporting the hypothesis that mRNA isoforms could arise by alternative splicing of a single gene. In addition to the eight exons coding for the major MOG isoform, the human MOG gene also contains 3` region, a previously unknown alternatively spliced coding exon, VIA. Alternative utilization of two acceptor splicing sites for exon VIII could produce two different C-termini. The nucleotide sequences presented here may be a useful tool to study further possible involvement if the MOG gene in hereditary neurological disorders. 23 refs., 5 figs.

  18. A dynamic intron retention program enriched in RNA processing genes regulates gene expression during terminal erythropoiesis


    Pimentel, Harold; Parra, Marilyn; Gee, Sherry L.; Mohandas, Narla; Pachter, Lior; Conboy, John G.


    Differentiating erythroblasts execute a dynamic alternative splicing program shown here to include extensive and diverse intron retention (IR) events. Cluster analysis revealed hundreds of developmentallydynamic introns that exhibit increased IR in mature erythroblasts, and are enriched in functions related to RNA processing such as SF3B1 spliceosomal factor. Distinct, developmentally-stable IR clusters are enriched in metal-ion binding functions and include mitoferrin genes SLC25A37 and SLC25A28 that are critical for iron homeostasis. Some IR transcripts are abundant, e.g. comprising ~50% of highly-expressed SLC25A37 and SF3B1 transcripts in late erythroblasts, and thereby limiting functional mRNA levels. IR transcripts tested were predominantly nuclearlocalized. Splicemore » site strength correlated with IR among stable but not dynamic intron clusters, indicating distinct regulation of dynamically-increased IR in late erythroblasts. Retained introns were preferentially associated with alternative exons with premature termination codons (PTCs). High IR was observed in disease-causing genes including SF3B1 and the RNA binding protein FUS. Comparative studies demonstrated that the intron retention program in erythroblasts shares features with other tissues but ultimately is unique to erythropoiesis. Finally, we conclude that IR is a multi-dimensional set of processes that post-transcriptionally regulate diverse gene groups during normal erythropoiesis, misregulation of which could be responsible for human disease.« less

  19. Functional Analysis of A Novel Splicing Mutation in The Mutase Gene of Two Unrelated Pedigrees

    PubMed Central

    Miryounesi, Mohammad; Pasalar, Parvin; Keramatipour, Mohammad


    Objective Methylmalonic acidura (MMA) is a rare autosomal recessive inborn error of metabolism. In this study we present a novel nucleotide change in the mutase (MUT) gene of two unrelated Iranian pedigrees and introduce the methods used for its functional analysis. Materials and Methods Two probands with definite diagnosis of MMA and a common novel variant in the MUT were included in a descriptive study. Bioinformatic prediction of the splicing variant was done with different prediction servers. Reverse transcriptionpolymerase chain reaction (RT-PCR) was done for splicing analysis and the products were analyzed by sequencing. Results The included index patients showed elevated levels of propionylcarnitine (C3). Urine organic acid analysis confirmed the diagnosis of MMA, and screening for mutations in the MUT revealed a novel C to G variation at the 3´ splice acceptor site in intron 12. In silico analysis suggested the change as a mutation in a conserved sequence. The splicing analysis showed that the C to G nucleotide change at position -3 in the acceptor splice site can lead to retention of the intron 12 sequence. Conclusion This is the first report of a mutation at the position -3 in the MUT intron 12 (c.2125-3C>G). The results suggest that the identified variation can be associated with the typical clinical manifestations of MMA. PMID:27602322

  20. Tissue-specific alternative splicing of TCF7L2.


    Prokunina-Olsson, Ludmila; Welch, Cullan; Hansson, Ola; Adhikari, Neeta; Scott, Laura J; Usher, Nicolle; Tong, Maurine; Sprau, Andrew; Swift, Amy; Bonnycastle, Lori L; Erdos, Michael R; He, Zhi; Saxena, Richa; Harmon, Brennan; Kotova, Olga; Hoffman, Eric P; Altshuler, David; Groop, Leif; Boehnke, Michael; Collins, Francis S; Hall, Jennifer L


    Common variants in the transcription factor 7-like 2 (TCF7L2) gene have been identified as the strongest genetic risk factors for type 2 diabetes (T2D). However, the mechanisms by which these non-coding variants increase risk for T2D are not well-established. We used 13 expression assays to survey mRNA expression of multiple TCF7L2 splicing forms in up to 380 samples from eight types of human tissue (pancreas, pancreatic islets, colon, liver, monocytes, skeletal muscle, subcutaneous adipose tissue and lymphoblastoid cell lines) and observed a tissue-specific pattern of alternative splicing. We tested whether the expression of TCF7L2 splicing forms was associated with single nucleotide polymorphisms (SNPs), rs7903146 and rs12255372, located within introns 3 and 4 of the gene and most strongly associated with T2D. Expression of two splicing forms was lower in pancreatic islets with increasing counts of T2D-associated alleles of the SNPs: a ubiquitous splicing form (P = 0.018 for rs7903146 and P = 0.020 for rs12255372) and a splicing form found in pancreatic islets, pancreas and colon but not in other tissues tested here (P = 0.009 for rs12255372 and P = 0.053 for rs7903146). Expression of this form in glucose-stimulated pancreatic islets correlated with expression of proinsulin (r(2) = 0.84-0.90, P < 0.00063). In summary, we identified a tissue-specific pattern of alternative splicing of TCF7L2. After adjustment for multiple tests, no association between expression of TCF7L2 in eight types of human tissue samples and T2D-associated genetic variants remained significant. Alternative splicing of TCF7L2 in pancreatic islets warrants future studies. GenBank Accession Numbers: FJ010164-FJ010174. PMID:19602480