Science.gov

Sample records for immunization procedures directed

  1. 26 CFR 301.7507-8 - Procedure during immunity.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 18 2013-04-01 2013-04-01 false Procedure during immunity. 301.7507-8 Section... States § 301.7507-8 Procedure during immunity. (a) Statements to be filed. As long as complete or partial immunity is claimed, a bank within section 7507(b) shall file with each income tax return a statement...

  2. 26 CFR 301.7507-8 - Procedure during immunity.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 18 2014-04-01 2014-04-01 false Procedure during immunity. 301.7507-8 Section... States § 301.7507-8 Procedure during immunity. (a) Statements to be filed. As long as complete or partial immunity is claimed, a bank within section 7507(b) shall file with each income tax return a statement...

  3. 26 CFR 301.7507-8 - Procedure during immunity.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 18 2011-04-01 2011-04-01 false Procedure during immunity. 301.7507-8 Section... States § 301.7507-8 Procedure during immunity. (a) Statements to be filed. As long as complete or partial immunity is claimed, a bank within section 7507(b) shall file with each income tax return a statement...

  4. 26 CFR 301.7507-8 - Procedure during immunity.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 18 2012-04-01 2012-04-01 false Procedure during immunity. 301.7507-8 Section... States § 301.7507-8 Procedure during immunity. (a) Statements to be filed. As long as complete or partial immunity is claimed, a bank within section 7507(b) shall file with each income tax return a statement...

  5. 75 FR 29915 - Direct Final Rulemaking Procedures

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-28

    ...: FMCSA amends its regulations by establishing direct final rulemaking procedures for use on routine or... in the direct final rule. These new procedures will expedite the promulgation of routine or... the NPRM, FMCSA will use the direct final rule process for routine and noncontroversial rules. In the...

  6. 26 CFR 301.7507-8 - Procedure during immunity.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... director may require. Whether or not additional statements shall be required, and the frequency thereof... States § 301.7507-8 Procedure during immunity. (a) Statements to be filed. As long as complete or partial immunity is claimed, a bank within section 7507(b) shall file with each income tax return a statement...

  7. Deriving directions through procedural task analysis.

    PubMed

    Yuen, H K; D'Amico, M

    1998-01-01

    Task analysis is one of the essential components of activity analysis. Procedural task analysis involves breaking down an activity into a sequence of steps. Directions are the sequence of steps resulting from the task analysis (i.e., the product of the task analysis). Directions become a guide for caregivers or trainers use in teaching clients a specific skill. However, occupational therapy students often have difficulty in writing directions that are clear enough for caregivers or trainers to carry out. Books on activity analysis only provide examples of directions without giving guidelines on how to perform the writing process. The purposes of this paper are to describe the process of procedural task analysis and to provide a guideline for writing steps of directions.

  8. 78 FR 18285 - Direct Final Rulemaking Procedures

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-26

    ... amendments that become effective a number of days (specified in the rule) after the date of publication of... direct final rule procedures for complex or controversial issues. ] DATES: Written comments must be... Docket ID number NHTSA-2013-0042 at any time. Follow the online instructions for submitting comments....

  9. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2008-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation. This may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) from prolonged immune dysregulation during exploration-class space flight has not yet been determined, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. Each of the clinical events resulting from immune dysfunction has the potential to impact mission critical objectives during exploration-class missions. To date, precious little in-flight immune data has been generated to assess this phenomenon. The majority of recent flight immune studies have been post-flight assessments, which may not accurately reflect the in-flight status of immunity as it resolves over prolonged flight. There are no procedures currently in place to monitor immune function or its effect on crew health. The objective of this Supplemental Medical Objective (SMO) is to develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. This SMO will assess immunity, latent viral reactivation and physiological stress during both short and long duration flights. Upon completion, it is expected that any clinical risks resulting from the adverse effects of space flight on the human immune system will have been determined. In addition, a flight-compatible immune monitoring strategy will have been developed with which countermeasures validation could be performed. This study will determine, to the best level allowed by current technology, the in-flight status of crewmembers' immune systems. The in-flight samples will allow a distinction between legitimate in-flight alterations and the physiological stresses of landing and readaptation which are believed to alter R+0 assessments. The overall status of the immune system during flight

  10. Validation of Procedures for Monitoring Crewmember Immune Function SDBI-1900, SMO-015 - Integrated Immune

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Nehlsen-Cannarella, Sandra; Morukov, Boris; Pierson, Duane; Sams, Clarence

    2007-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation. This may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk from prolonged immune dysregulation during space flight are not yet determined, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. Each of the clinical events resulting from immune dysfunction has the potential to impact mission critical objectives during exploration-class missions. To date, precious little in-flight immune data has been generated to assess this phenomenon. The majority of recent flight immune studies have been post-flight assessments, which may not accurately reflect the in-flight condition. There are no procedures currently in place to monitor immune function or its effect on crew health. The objective of this Supplemental Medical Objective (SMO) is to develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. This SMO will assess the clinical risks resulting from the adverse effects of space flight on the human immune system and will validate a flight-compatible immune monitoring strategy. Characterization of the clinical risk and the development of a monitoring strategy are necessary prerequisite activities prior to validating countermeasures. This study will determine, to the best level allowed by current technology, the in-flight status of crewmembers immune system. Pre-flight, in-flight and post-flight assessments of immune status, immune function, viral reactivation and physiological stress will be performed. The in-flight samples will allow a distinction between legitimate in-flight alterations and the physiological stresses of landing and readaptation which are believed to alter landing day assessments. The overall status of the immune system during flight (activation

  11. Validation of Procedures for Monitoring Crewmember Immune Function SDBI-1900, SMO-015 - Integrated Immune

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Nehlsen-Cannarella, Sandra; Morukov, Boris; Pierson, Duane; Sams, Clarence

    2007-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation. This may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk from prolonged immune dysregulation during space flight are not yet determined, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. Each of the clinical events resulting from immune dysfunction has the potential to impact mission critical objectives during exploration-class missions. To date, precious little in-flight immune data has been generated to assess this phenomenon. The majority of recent flight immune studies have been post-flight assessments, which may not accurately reflect the in-flight condition. There are no procedures currently in place to monitor immune function or its effect on crew health. The objective of this Supplemental Medical Objective (SMO) is to develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. This SMO will assess the clinical risks resulting from the adverse effects of space flight on the human immune system and will validate a flight-compatible immune monitoring strategy. Characterization of the clinical risk and the development of a monitoring strategy are necessary prerequisite activities prior to validating countermeasures. This study will determine, to the best level allowed by current technology, the in-flight status of crewmembers immune system. Pre-flight, in-flight and post-flight assessments of immune status, immune function, viral reactivation and physiological stress will be performed. The in-flight samples will allow a distinction between legitimate in-flight alterations and the physiological stresses of landing and readaptation which are believed to alter landing day assessments. The overall status of the immune system during flight (activation

  12. 49 CFR 389.39 - Direct final rulemaking procedures

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... PROCEDURES-FEDERAL MOTOR CARRIER SAFETY REGULATIONS Procedures for Adoption of Rules § 389.39 Direct final... change should be made to the rule. Under the direct final rule process, FMCSA does not consider...

  13. 49 CFR 389.39 - Direct final rulemaking procedures

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... PROCEDURES-FEDERAL MOTOR CARRIER SAFETY REGULATIONS Procedures for Adoption of Rules § 389.39 Direct final rulemaking procedures A direct final rule makes regulatory changes and states that those changes will take... adverse comment by the date specified in the direct final rule published in the Federal Register....

  14. Immune adjuvants as critical guides directing immunity triggered by therapeutic cancer vaccines.

    PubMed

    Schijns, Virgil; Tartour, Eric; Michalek, Jaroslav; Stathopoulos, Apostolos; Dobrovolskienė, Neringa T; Strioga, Marius M

    2014-04-01

    Tumor growth is controlled by natural antitumor immune responses alone or by augmented immune reactivity resulting from different forms of immunotherapy, which has demonstrated clinical benefit in numerous studies, although the overall percentage of patients with durable clinical responses remains limited. This is attributed to the heterogeneity of the disease, the inclusion of late-stage patients with no other treatment options and advanced tumor-associated immunosuppression, which may be consolidated by certain types of chemotherapy. Despite variable responsiveness to distinct types of immunotherapy, therapeutic cancer vaccination has shown meaningful efficacy for a variety of cancers. A key step during cancer vaccination involves the appropriate modeling of the functional state of dendritic cells (DCs) capable of co-delivering four critical signals for proper instruction of tumor antigen-specific T cells. However, the education of DCs, either directly in situ, or ex vivo by various complex procedures, lacks standardization. Also, it is questioned whether ex vivo-prepared DC vaccines are superior to in situ-administered adjuvant-guided vaccines, although both approaches have shown success. Evaluation of these variables is further complicated by a lack of consensus in evaluating vaccination clinical study end points. We discuss the role of signals needed for the preparation of classic in situ and modern ex vivo DC vaccines capable of proper reprogramming of antitumor immune responses in patients with cancer.

  15. 19 CFR 146.39 - Direct delivery procedures.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 19 Customs Duties 2 2011-04-01 2011-04-01 false Direct delivery procedures. 146.39 Section 146.39... TREASURY (CONTINUED) FOREIGN TRADE ZONES Admission of Merchandise to a Zone § 146.39 Direct delivery procedures. (a) General. This procedure is for delivery of merchandise to a zone without prior...

  16. 19 CFR 146.39 - Direct delivery procedures.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Direct delivery procedures. 146.39 Section 146.39... TREASURY (CONTINUED) FOREIGN TRADE ZONES Admission of Merchandise to a Zone § 146.39 Direct delivery procedures. (a) General. This procedure is for delivery of merchandise to a zone without prior...

  17. 24 CFR 291.210 - Direct sales procedures.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Direct sales procedures. 291.210... URBAN DEVELOPMENT HUD-OWNED PROPERTIES DISPOSITION OF HUD-ACQUIRED SINGLE FAMILY PROPERTY Sales Procedures § 291.210 Direct sales procedures. When HUD conducts the sales listed in § 291.90(c), it will...

  18. 75 FR 12720 - Direct Final Rulemaking Procedures

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-17

    ... that would become effective a specified number of days after the date of publication in the Federal... final rule procedures for complex or controversial issues. DATES: You must submit comments on or before... Number in the heading of this document by any of the following methods. Do not submit the same...

  19. Validation of Procedures for Monitoring Crewmember Immune Function - Short Duration Biological Investigation

    NASA Technical Reports Server (NTRS)

    Sams, Clarence; Crucian, Brian; Stowe, Raymond; Pierson, Duane; Mehta, Satish; Morukov, Boris; Uchakin, Peter; Nehlsen-Cannarella, Sandra

    2008-01-01

    Validation of Procedures for Monitoring Crew Member Immune Function - Short Duration Biological Investigation (Integrated Immune-SDBI) will assess the clinical risks resulting from the adverse effects of space flight on the human immune system and will validate a flightcompatible immune monitoring strategy. Immune system changes will be monitored by collecting and analyzing blood, urine and saliva samples from crewmembers before, during and after space flight.

  20. Structures, roles, and procedures of state advisory committees on immunization.

    PubMed

    Dolen, Virginia; Talkington, Kathy; Bhatt, Achal; Rodewald, Lance

    2013-01-01

    Advisory committees have the potential to play a critical role in decision making and implementation at the state level. Many states have advisory committees for their immunization programs to assist in decision making on topics such as implementing new vaccines in their states, school and childcare requirements and exemptions and addressing concerns about vaccine safety. This article describes how immunization advisory committees work; their roles, formation, organization, and structure; membership; the issues they address; and their benefit to state immunization programs. In 2011, the Association of State and Territorial Health Officials, in collaboration with the Centers for Disease Control and Prevention, conducted an online survey of immunization program managers to determine which states have immunization advisory committees, how these committees function, and the perceived benefits of the committees to state immunization programs. Follow-up half-hour telephone interviews were conducted with 5 states to gain in-depth information on specific advisory committees. One hundred percent of states and 3 territories responded, giving an overall response rate of 91%. Thirty-four of the 53 respondents (64%) reported having an advisory committee for immunization issues. Membership is composed of physicians, public health representatives, and nurses as well as public advocates and members of the public. States reported a variety of issues their committee has worked on; the most frequently mentioned issue was school and childcare vaccination requirements. Others included immunization information systems and vaccination of health care personnel. Overall, states with immunization advisory committees reported that the committees were helpful on issues faced by the program and worth the time and monetary commitment. Given the reported benefits of state immunization advisory committees and the complex program and policy decisions that states face in the dynamic immunization

  1. Symbiotic commensal bacteria direct maturation of the host immune system.

    PubMed

    Edelman, Sanna M; Kasper, Dennis L

    2008-11-01

    Although commensal bacteria are known to play an important role in the proper maturation of the immune system of their mammalian hosts, the molecular mechanisms underlying this immunomodulation are poorly characterized. The present review summarizes recent findings in the field and describes new knowledge on the interplay of the innate and adaptive arms of the immune response induced by symbiotic bacterial carbohydrate antigens. Commensal bacteria in the intestine not only interact directly with dendritic cells but also engage in cross-talk with epithelial cells. These interactions lead to the induction of tolerogenic antigen-presenting cells in the lamina propria and ultimately to the regulation of functional maturation of effector T cells. Upon recognition of capsular polysaccharide antigens of commensal bacteria by dendritic cells (through toll-like receptor 2), innate immune responses facilitate and act in conjunction with adaptive responses to promote optimal Th1 polarization. In contrast, adaptive immunoglobulin A responses to symbiotic bacteria regulate the magnitude of oxidative innate immune responses in the mucosa as well as bacterial epitope expression in the lumen. Accumulating evidence is elucidating surface carbohydrate structures of symbiotic bacteria that drive the modulation of the intestinal immune system, resulting in mature, balanced immune responses and oral tolerance.

  2. Procedures for mucosal immunization and analyses of cellular immune response to candidate HIV vaccines in murine and nonhuman primate models.

    PubMed

    Singh, Shailbala; Nehete, Pramod; Hanley, Patrick; Nehete, Bharti; Yang, Guojun; He, Hong; Anthony, Scott M; Schluns, Kimberly S; Sastry, K Jagannadha

    2014-01-01

    Sampling the mucosal tissues and analyses of immune responses are integral to vaccine-development strategies against human immunodeficiency virus (HIV), which is transmitted predominantly across the oro-genital mucosa. While immune assay development and standardization attempts employ mouse models, immunogenicity and protective efficacy that can be extrapolated to humans are realized only from experiments in nonhuman primates. Here, we describe commonly used practices for immunizations in rhesus macaques (Macaca mulatta) along with procedures for obtaining important mucosal tissues samples from macaques and mice. We also describe detailed protocols for two important assays applicable in mouse as well as primate experiments for determining antigen-specific T cells responses induced after vaccination.

  3. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Pierson, Duane; Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Sams, Clarence

    2010-01-01

    The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles, viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. To date, 18 short duration (now completed) and 8 long-duration crewmembers have completed the study. The long-duration phase of this study is ongoing. For this presentation, the final data set for the short duration subjects will be discussed.

  4. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2009-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation, however the nature of the phenomenon as it equilibrates over longer flights has not been determined. This dysregulation may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) for exploration-class space flight is unknown, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles (RNA, intracellular, secreted), viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. This study is currently ongoing. To date, 10 short duration and 5 long-duration crewmembers have completed the study. Technically, the study is progressing well. In-flight blood samples are being collected, and returned for analysis, including functional assays that require live cells. For all in-flight samples to date, sample viability has been acceptable. Preliminary data (n = 4/7; long/short duration, respectively) indicate that distribution of most peripheral leukocyte subsets is largely unaltered during flight. Exceptions include elevated T cells, reduced B/NK cells, increased memory T cells and increased central memory CD8+ T cells. General T cell function, early blastogenesis response to mitogenic stimulation, is markedly

  5. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2009-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation, however the nature of the phenomenon as it equilibrates over longer flights has not been determined. This dysregulation may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) for exploration-class space flight is unknown, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles (RNA, intracellular, secreted), viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. This study is currently ongoing. To date, 10 short duration and 5 long-duration crewmembers have completed the study. Technically, the study is progressing well. In-flight blood samples are being collected, and returned for analysis, including functional assays that require live cells. For all in-flight samples to date, sample viability has been acceptable. Preliminary data (n = 4/7; long/short duration, respectively) indicate that distribution of most peripheral leukocyte subsets is largely unaltered during flight. Exceptions include elevated T cells, reduced B/NK cells, increased memory T cells and increased central memory CD8+ T cells. General T cell function, early blastogenesis response to mitogenic stimulation, is markedly

  6. Direct and Electronic Health Record Access to the Clinical Decision Support for Immunizations in the Minnesota Immunization Information System

    PubMed Central

    Rajamani, Sripriya; Bieringer, Aaron; Wallerius, Stephanie; Jensen, Daniel; Winden, Tamara; Muscoplat, Miriam Halstead

    2016-01-01

    Immunization information systems (IIS) are population-based and confidential computerized systems maintained by public health agencies containing individual data on immunizations from participating health care providers. IIS hold comprehensive vaccination histories given across providers and over time. An important aspect to IIS is the clinical decision support for immunizations (CDSi), consisting of vaccine forecasting algorithms to determine needed immunizations. The study objective was to analyze the CDSi presentation by IIS in Minnesota (Minnesota Immunization Information Connection [MIIC]) through direct access by IIS interface and by access through electronic health records (EHRs) to outline similarities and differences. The immunization data presented were similar across the three systems examined, but with varying ability to integrate data across MIIC and EHR, which impacts immunization data reconciliation. Study findings will lead to better understanding of immunization data display, clinical decision support, and user functionalities with the ultimate goal of promoting IIS CDSi to improve vaccination rates. PMID:28050128

  7. Root microbiota drive direct integration of phosphate stress and immunity

    PubMed Central

    Castrillo, Gabriel; Lima Teixeira, Paulo José Pereira; Paredes, Sur Herrera; Law, Theresa F.; de Lorenzo, Laura; Feltcher, Meghan E.; Finkel, Omri M.; Breakfield, Natalie W.; Mieczkowski, Piotr; Jones, Corbin D.; Paz-Ares, Javier; Dangl, Jeffery L.

    2017-01-01

    Plants live in biogeochemically diverse soils that harbor extraordinarily diverse microbiota. Plant organs associate intimately with a subset of these microbes; this community’s structure can be altered by soil nutrient content. Plant-associated microbes can compete with the plant and with each other for nutrients; they can also provide traits that increase plant productivity. It is unknown how the plant immune system coordinates microbial recognition with nutritional cues during microbiome assembly. We establish that a genetic network controlling phosphate stress response influences root microbiome community structure, even under non-stress phosphate conditions. We define a molecular mechanism regulating coordination between nutrition and defense in the presence of a synthetic bacterial community. We demonstrate that the master transcriptional regulators of phosphate stress response in Arabidopsis also directly repress defense, consistent with plant prioritization of nutritional stress over defense. Our work will impact efforts to define and deploy useful microbes to enhance plant performance. PMID:28297714

  8. Direct vs. indirect sinus lift procedure: A comparison.

    PubMed

    Pal, U S; Sharma, Nanda Kishor; Singh, R K; Mahammad, Shadab; Mehrotra, Divya; Singh, Nimisha; Mandhyan, Devendra

    2012-01-01

    There are different techniques for the sinus augmentation; the factors that contribute to the survival rate of sinus augmentation and dental implant placement are still the subject of discussion. So we compare the two different ways of sinus floor elevation: a) Lateral antrostomy as a one or two step procedure as direct method. b) Osteotome technique with a crestal approach as indirect method. A total of twenty partially edentulous patients in maxillary posterior region who opted for implant retained prosthesis but had a low sinus and deficient alveolar ridge within the age group of 20-55 years were taken up, 25 implants were placed in combination with bone grafting material for sinus augmentation. The final bone height was measured from Orthopantomogram. Post-operative Clinical Evaluation was based on pain, gingival inflammation status, stability, swelling and bone height. Statistical analysis was done by using Statistical Package for Social Sciences (version 15.0) (SPSS Inc., Chicago, IL, USA). The gain in bone height was significantly greater in direct procedure through lateral antrostomy (mean 8.5 mm) than in indirect method through crestal approach by osteotome technique (mean 4.4 mm). Osteotome technique can be recommended when more than 6 mm of residual bone height is present and an increase of 3-4 mm is expected. In case of more advanced resorption direct method through lateral antrostomy has to be performed. Both sinus elevation techniques did not seem to affect the implant success rate.

  9. Cellular Immune Responses in Guinea Pigs Immunized with Cell Walls of Histoplasma capsulatum Prepared by Several Different Procedures

    PubMed Central

    Domer, Judith E.; Ichinose, H.

    1977-01-01

    Since guinea pigs immunized with water-washed cell walls of Histoplasma capsulatum developed cellular immune responses detectable with cytoplasmic substances, attempts were made to determine whether cytoplasmic contamination of the walls was responsible for the induction of the immune response. Cell walls were treated by several procedures designed to remove possible contamination, namely, extraction with lipid solvents, incubation with proteolytic enzymes, and washing with sodium dodecyl sulfate, and each of the treated preparations was compared with water-washed walls for its ability to induce cellular responses demonstrable with cytoplasmic substances. For comparison, wall glycoprotein was also used as a test antigen. Immune responses were assessed by gross and histological examinations of skin test sites and by assays for the production of migration inhibition factor. A portion of the material inducing the response detectable with cytoplasmic substances was apparently removed or altered by each of the purifying procedures. The cellular immune responses to wall glycoprotein were also altered, however, indicating that more than the mere removal of cytoplasmic substances had occurred. On the basis of the data collected from each of the cellular assays involving wall glycoprotein as the test antigen, the hypothesis is proposed that sodium dodecyl sulfate altered or removed protein from the wall and thus augmented its ability to induce a more intense immediate-type hypersensitivity, whereas incubation with Pronase altered the walls in such a way as to shift the balance toward a more intense delayed-type hypersensitivity. The latter effect was probably due to the removal of carbohydrate from the wall by glucanase or to mannosidase contaminating the Pronase preparation. Images PMID:326673

  10. Development of a lavage procedure to collect crop secretions from live chickens for studying crop immunity.

    PubMed

    Holt, Peter S; Vaughn, Lara E; Gast, Richard K; Stone, Henry D

    2002-12-01

    The crop (ingluvies), an organ for food storage in most avian species, is located at the base of the oesophagus. Previous work in our laboratory showed that, following infection with Salmonella enteritidis, significant anti-S. enteritidis antibody levels could be found in the crops of these birds. Samples in these previous studies were obtained by flushing the interiors of crops excised from killed birds, which is both labour and animal intensive. A method was sought that allowed multiple sampling of the same birds over time. We found that lavage fluid could be administered directly into the crop down the oesophagus using a narrow-diameter plastic tubing attached to a syringe, and the fluid could then be aspirated back into the syringe. Antibody-containing crop secretions could be collected with minimal discomfort to the test animals. In a study where birds were challenged with S. enteritidis, immunoglobulin A anti-S. enteritidis titres 3 weeks post-challenge were similar in crop samples obtained by live lavage versus the flushing of crops removed from killed birds. Such a sampling procedure may provide researchers with a simple method to follow mucosal immunity in chickens following infection or vaccination regimens.

  11. Root microbiota drive direct integration of phosphate stress and immunity.

    PubMed

    Castrillo, Gabriel; Teixeira, Paulo José Pereira Lima; Paredes, Sur Herrera; Law, Theresa F; de Lorenzo, Laura; Feltcher, Meghan E; Finkel, Omri M; Breakfield, Natalie W; Mieczkowski, Piotr; Jones, Corbin D; Paz-Ares, Javier; Dangl, Jeffery L

    2017-03-23

    Plants live in biogeochemically diverse soils with diverse microbiota. Plant organs associate intimately with a subset of these microbes, and the structure of the microbial community can be altered by soil nutrient content. Plant-associated microbes can compete with the plant and with each other for nutrients, but may also carry traits that increase the productivity of the plant. It is unknown how the plant immune system coordinates microbial recognition with nutritional cues during microbiome assembly. Here we establish that a genetic network controlling the phosphate stress response influences the structure of the root microbiome community, even under non-stress phosphate conditions. We define a molecular mechanism regulating coordination between nutrition and defence in the presence of a synthetic bacterial community. We further demonstrate that the master transcriptional regulators of phosphate stress response in Arabidopsis thaliana also directly repress defence, consistent with plant prioritization of nutritional stress over defence. Our work will further efforts to define and deploy useful microbes to enhance plant performance.

  12. Music Therapy as Procedural Support for Young Children Undergoing Immunizations: A Randomized Controlled Study.

    PubMed

    Yinger, Olivia Swedberg

    2016-01-01

    Children undergoing routine immunizations frequently experience severe distress, which may be improved through music therapy as procedural support. The purpose of this study was to examine effects of live, cognitive-behavioral music therapy during immunizations on (a) the behaviors of children, their parents, and their nurses; and (b) parental perceptions. Participants were children between the ages of 4 and 6 years (N = 58) who underwent immunizations, their parents (N = 62), and the nurses who administered the procedure (N = 19). Parent/child dyads were randomly assigned to receive music therapy (n = 29) or standard care (n = 29) during their immunization. Afterward, each parent rated their child's level of pain and the distress their child experienced compared to previous medical experiences. All procedures were videotaped and later viewed by trained observers, who classified child, parent, and nurse behaviors using the categories of the Child-Adult Medical Procedure Interaction Scale-Revised (CAMPIS-R). Significant differences between the music therapy and control groups were found in rates of child coping and distress behaviors and parent distress-promoting behaviors. Parents of children who received music therapy reported that their child's level of distress was less than during previous medical experiences, whereas parents of children in the control group reported that their child's level of distress was greater. No significant differences between groups were found in parents' ratings of children's pain or in rates of nurse behavior. Live, cognitive-behavioral music therapy has potential benefits for young children and their parents during immunizations. © the American Music Therapy Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. [Effects of different surgical procedures on immunity of children with obstructive sleep apnea hypopnea syndrome].

    PubMed

    Zhou, Juanjuan; Wang, Yan; Li, Yanzhong

    2016-03-01

    To explore the effects of pure adenoidectomy,adenoidectomy with partial tonsillectomy,and adenoidectomy with total tonsillectomy on humoral and cellular immunity of children with OSAHS. The children with OSAHS diagnosed by polysomnography were divided into pure adenoidectomy group(group A),adenoidectomy with partial tonsillectomy group(group B), and adenoidectomy with total tonsillectomy(group C), and there were 50 cases in each group. The serum IgG, IgA, IgM level and peripheral blood T cell subgroup per-centage were detected at 6 months preoperatively and postoperatively. Tonsil grading and polysomnography wereconducted, recording symptoms improvement situation at postoperative 6 months. There was no statisticallysignificant difference compared with preoperative(P>0. 05) in humoral immunity and cellular immunity index ofpostoperative 6 months. There was no significani difference(P>C. 05) in curative effect among three groups in the 6th month post-operatively. All of these three surgical procedures had no obvious effect on humoral orcellular immune function in children, and could effectively treat children OSAHS.

  14. Future directions in bladder cancer immunotherapy: towards adaptive immunity

    PubMed Central

    Smith, Sean G; Zaharoff, David A

    2016-01-01

    The clinical management of bladder cancer has not changed significantly in several decades. In particular, intravesical bacillus Calmette–Guérin (BCG) immunotherapy has been a mainstay for high-risk nonmuscle invasive bladder cancer since the late 1970s/early 1980s. This is despite the fact that bladder cancer has the highest recurrence rates of any cancer and BCG immunotherapy has not been shown to induce a tumor-specific immune response. We and others have hypothesized that immunotherapies capable of inducing tumor-specific adaptive immunity are needed to impact bladder cancer morbidity and mortality. This article summarizes the preclinical and clinical development of bladder cancer immunotherapies with an emphasis on the last 5 years. Expected progress in the near future is also discussed. PMID:26860539

  15. Future directions in bladder cancer immunotherapy: towards adaptive immunity.

    PubMed

    Smith, Sean G; Zaharoff, David A

    2016-01-01

    The clinical management of bladder cancer has not changed significantly in several decades. In particular, intravesical bacillus Calmette-Guérin (BCG) immunotherapy has been a mainstay for high-risk nonmuscle invasive bladder cancer since the late 1970s/early 1980s. This is despite the fact that bladder cancer has the highest recurrence rates of any cancer and BCG immunotherapy has not been shown to induce a tumor-specific immune response. We and others have hypothesized that immunotherapies capable of inducing tumor-specific adaptive immunity are needed to impact bladder cancer morbidity and mortality. This article summarizes the preclinical and clinical development of bladder cancer immunotherapies with an emphasis on the last 5 years. Expected progress in the near future is also discussed.

  16. Anodal transcranial direct current stimulation enhances procedural consolidation.

    PubMed

    Tecchio, Franca; Zappasodi, Filippo; Assenza, Giovanni; Tombini, Mario; Vollaro, Stefano; Barbati, Giulia; Rossini, Paolo Maria

    2010-08-01

    The primary motor cortex (M1) area recruitment enlarges while learning a finger tapping sequence. Also M1 excitability increases during procedural consolidation. Our aim was to investigate whether increasing M1 excitability by anodal transcranial DC stimulation (AtDCS) when procedural consolidation occurs was able to induce an early consolidation improvement. Forty-seven right-handed healthy participants were trained in a nine-element serial finger tapping task (SFTT) executed with the left hand. Random series blocks were interspersed with training series blocks. Anodal or sham tDCS was administered over the right M1 after the end of the training session. After stimulation, the motor skills of both trained and a new untrained sequential series blocks were tested again. For each block, performance was estimated as the median execution time of correct series. Early consolidation of the trained series, assessed by the performance difference between the first block after and the last block before stimulation normalized by the random, was enhanced by anodal and not by sham tDCS. Stimulation did not affect random series execution. No stimulation effect was found on the on-line learning of the trained and new untrained series. Our results suggest that AtDCS applied on M1 soon after training improves early consolidation of procedural learning. Our data highlight the importance of neuromodulation procedures for understanding learning processes and support their use in the motor rehabilitation setting, focusing on the timing of the application.

  17. The Procedurally Directive Approach to Teaching Controversial Issues

    ERIC Educational Resources Information Center

    Gregory, Maughn Rollins

    2014-01-01

    Recent articles on teaching controversial topics in schools have employed Michael Hand's distinction between "directive teaching," in which teachers attempt to persuade students of correct positions on topics that are not rationally controversial, and "nondirective teaching," in which teachers avoid persuading students on…

  18. The Procedurally Directive Approach to Teaching Controversial Issues

    ERIC Educational Resources Information Center

    Gregory, Maughn Rollins

    2014-01-01

    Recent articles on teaching controversial topics in schools have employed Michael Hand's distinction between "directive teaching," in which teachers attempt to persuade students of correct positions on topics that are not rationally controversial, and "nondirective teaching," in which teachers avoid persuading students on…

  19. A design procedure and handling quality criteria for lateral directional flight control systems

    NASA Technical Reports Server (NTRS)

    Stein, G.; Henke, A. H.

    1972-01-01

    A practical design procedure for aircraft augmentation systems is described based on quadratic optimal control technology and handling-quality-oriented cost functionals. The procedure is applied to the design of a lateral-directional control system for the F4C aircraft. The design criteria, design procedure, and final control system are validated with a program of formal pilot evaluation experiments.

  20. Procedure for Adapting Direct Simulation Monte Carlo Meshes

    NASA Technical Reports Server (NTRS)

    Woronowicz, Michael S.; Wilmoth, Richard G.; Carlson, Ann B.; Rault, Didier F. G.

    1992-01-01

    A technique is presented for adapting computational meshes used in the G2 version of the direct simulation Monte Carlo method. The physical ideas underlying the technique are discussed, and adaptation formulas are developed for use on solutions generated from an initial mesh. The effect of statistical scatter on adaptation is addressed, and results demonstrate the ability of this technique to achieve more accurate results without increasing necessary computational resources.

  1. 78 FR 63410 - Energy Conservation Program for Consumer Products: Test Procedures for Direct Heating Equipment...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-24

    ...The U.S. Department of Energy (DOE) proposes to revise its test procedures for direct heating equipment and pool heaters established under the Energy Policy and Conservation Act. This rulemaking will fulfill DOE's statutory obligation to review its test procedures for covered products at least once every seven years. For direct heating equipment, the proposed amendments would add provisions......

  2. 10 CFR 35.2041 - Records for procedures for administrations requiring a written directive

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 1 2014-01-01 2014-01-01 false Records for procedures for administrations requiring a written directive 35.2041 Section 35.2041 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL Records § 35.2041 Records for procedures for administrations requiring a written directive...

  3. 10 CFR 35.2041 - Records for procedures for administrations requiring a written directive

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Records for procedures for administrations requiring a written directive 35.2041 Section 35.2041 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL Records § 35.2041 Records for procedures for administrations requiring a written directive...

  4. 10 CFR 35.2041 - Records for procedures for administrations requiring a written directive

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 1 2012-01-01 2012-01-01 false Records for procedures for administrations requiring a written directive 35.2041 Section 35.2041 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL Records § 35.2041 Records for procedures for administrations requiring a written directive...

  5. MEMS reagent and sample handling procedure: Feasibility of viral antibody detection by passive immune agglutination

    NASA Technical Reports Server (NTRS)

    Bailey, G. D.; Tenoso, H. J.

    1975-01-01

    An attempt was made to develop a test requiring no preadsorption steps for the assessment of antibodies to rubella and mumps viruses using the passive immune agglutination (PIA) method. Both rubella and mumps antigens and antibodies were prepared. Direct PIA tests, using rubella antigen-coated beads, and indirect PIA tests, using rubella antibody-coated beads, were investigated. Attempts, using either method, were unsuccessful. Serum interference along with nonspecific agglutination of beads by the rubella antigen resulted in no specific response under the test conditions investigated. A new, highly sensitive approach, the enzyme immunoassay (EIA) test system, is recommended to overcome the nonspecificity. This system is a logical outgrowth of some of the solid phase work done on MEMS and represents the next generation tests system that can be directly applied to early disease detection and monitoring.

  6. Minimally Invasive Procedures - Direct and Video-Assisted Forms in the Treatment of Heart Diseases

    PubMed Central

    Castro, Josué Viana; Melo, Emanuel Carvalho; Silva, Juliana Fernandes; Rebouças, Leonardo Lemos; Corrêa, Larissa Chagas; Germano, Amanda de Queiroz; Machado, João José Aquino

    2014-01-01

    Background Minimally invasive cardiovascular procedures have been progressively used in heart surgery. Objective To describe the techniques and immediate results of minimally invasive procedures in 5 years. Methods Prospective and descriptive study in which 102 patients were submitted to minimally invasive procedures in direct and video-assisted forms. Clinical and surgical variables were evaluated as well as the in hospital follow-up of the patients. Results Fourteen patients were operated through the direct form and 88 through the video-assisted form. Between minimally invasive procedures in direct form, 13 had aortic valve disease. Between minimally invasive procedures in video-assisted forms, 43 had mitral valve disease, 41 atrial septal defect and four tumors. In relation to mitral valve disease, we replaced 26 and reconstructed 17 valves. Aortic clamp, extracorporeal and procedure times were, respectively, 91,6 ± 21,8, 112,7 ± 27,9 e 247,1 ± 20,3 minutes in minimally invasive procedures in direct form. Between minimally invasive procedures in video-assisted forms, 71,6 ± 29, 99,7 ± 32,6 e 226,1 ± 42,7 minutes. Considering intensive care and hospitalization times, these were 41,1 ± 14,7 hours and 4,6 ± 2 days in minimally invasive procedures in direct and 36,8 ± 16,3 hours and 4,3 ± 1,9 days in minimally invasive procedures in video-assisted forms procedures. Conclusion Minimally invasive procedures were used in two forms - direct and video-assisted - with safety in the surgical treatment of video-assisted, atrial septal defect and tumors of the heart. These procedures seem to result in longer surgical variables. However, hospital recuperation was faster, independent of the access or pathology. PMID:24553983

  7. Using Video Modeling with Voiceover Instruction Plus Feedback to Train Staff to Implement Direct Teaching Procedures.

    PubMed

    Giannakakos, Antonia R; Vladescu, Jason C; Kisamore, April N; Reeve, Sharon A

    2016-06-01

    Direct teaching procedures are often an important part of early intensive behavioral intervention for consumers with autism spectrum disorder. In the present study, a video model with voiceover (VMVO) instruction plus feedback was evaluated to train three staff trainees to implement a most-to-least direct (MTL) teaching procedure. Probes for generalization were conducted with untrained direct teaching procedures (i.e., least-to-most, prompt delay) and with an actual consumer. The results indicated that VMVO plus feedback was effective in training the staff trainees to implement the MTL procedure. Although additional feedback was required for the staff trainees to show mastery of the untrained direct teaching procedures (i.e., least-to-most and prompt delay) and with an actual consumer, moderate to high levels of generalization were observed.

  8. The innate immune protein Nod2 binds directly to MDP, a bacterial cell wall fragment.

    PubMed

    Grimes, Catherine Leimkuhler; Ariyananda, Lushanti De Zoysa; Melnyk, James E; O'Shea, Erin K

    2012-08-22

    Mammalian Nod2 is an intracellular protein that is implicated in the innate immune response to the bacterial cell wall and is associated with the development of Crohn's disease, Blau syndrome, and gastrointestinal cancers. Nod2 is required for an immune response to muramyl dipeptide (MDP), an immunostimulatory fragment of bacterial cell wall, but it is not known whether MDP binds directly to Nod2. We report the expression and purification of human Nod2 from insect cells. Using novel MDP self-assembled monolayers (SAMs), we provide the first biochemical evidence for a direct, high-affinity interaction between Nod2 and MDP.

  9. Coping strategies and immune neglect in affective forecasting: Direct evidence and key moderators

    PubMed Central

    Hoerger, Michael

    2012-01-01

    Affective forecasting skills have important implications for decision making. However, recent research suggests that immune neglect – the tendency to overlook coping strategies that reduce future distress – may lead to affective forecasting problems. Prior evidence for immune neglect has been indirect. More direct evidence and a deeper understanding of immune neglect are vital to informing the design of future decision-support interventions. In the current study, young adults (N = 325) supplied predicted, actual, and recollected reactions to an emotionally-evocative interpersonal event, Valentine’s Day. Based on participants’ qualitative descriptions of the holiday, a team of raters reliably coded the effectiveness of their coping strategies. Supporting the immune neglect hypothesis, participants overlooked the powerful role of coping strategies when predicting their emotional reactions. Immune neglect was present not only for those experiencing the holiday negatively (non-daters) but also for those experiencing it positively (daters), suggesting that the bias may be more robust than originally theorized. Immune neglect was greater for immediate emotional reactions than more enduring reactions. Further, immune neglect was conspicuously absent from recollected emotional reactions. Implications for decision-support interventions are discussed. PMID:22375161

  10. Immunizations

    MedlinePlus

    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Immunizations KidsHealth > For Teens > Immunizations Print A A A ... That Shot? en español Las vacunas Why Are Vaccinations Important? Measles, mumps, and whooping cough may seem ...

  11. Immunization

    MedlinePlus

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against things like measles, ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  12. 76 FR 63211 - Energy Efficiency Program: Test Procedures for Residential Water Heaters, Direct Heating...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-12

    ... Heating Equipment, and Pool Heaters AGENCY: Office of Energy Efficiency and Renewable Energy, Department... amendments to DOE's test procedures for residential water heaters, direct heating equipment, and pool heaters... heating equipment test procedures as applied to vented hearth heaters, and coverage of electric...

  13. 36 CFR 216.7 - Exemption of proposed Manual directives from normal procedures.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 36 Parks, Forests, and Public Property 2 2014-07-01 2014-07-01 false Exemption of proposed Manual directives from normal procedures. 216.7 Section 216.7 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE INVOLVING THE PUBLIC IN THE FORMULATION OF FOREST SERVICE DIRECTIVES § 216.7...

  14. 36 CFR 216.7 - Exemption of proposed Manual directives from normal procedures.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 36 Parks, Forests, and Public Property 2 2011-07-01 2011-07-01 false Exemption of proposed Manual directives from normal procedures. 216.7 Section 216.7 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE INVOLVING THE PUBLIC IN THE FORMULATION OF FOREST SERVICE DIRECTIVES § 216.7...

  15. 36 CFR 216.7 - Exemption of proposed Manual directives from normal procedures.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 36 Parks, Forests, and Public Property 2 2013-07-01 2013-07-01 false Exemption of proposed Manual directives from normal procedures. 216.7 Section 216.7 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE INVOLVING THE PUBLIC IN THE FORMULATION OF FOREST SERVICE DIRECTIVES § 216.7...

  16. 36 CFR 216.7 - Exemption of proposed Manual directives from normal procedures.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 36 Parks, Forests, and Public Property 2 2012-07-01 2012-07-01 false Exemption of proposed Manual directives from normal procedures. 216.7 Section 216.7 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE INVOLVING THE PUBLIC IN THE FORMULATION OF FOREST SERVICE DIRECTIVES § 216.7...

  17. 36 CFR 216.7 - Exemption of proposed Manual directives from normal procedures.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Exemption of proposed Manual directives from normal procedures. 216.7 Section 216.7 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE INVOLVING THE PUBLIC IN THE FORMULATION OF FOREST SERVICE DIRECTIVES § 216.7...

  18. Technical note: A procedure to estimate glucose requirements of an activated immune system in steers.

    PubMed

    Kvidera, S K; Horst, E A; Abuajamieh, M; Mayorga, E J; Sanz Fernandez, M V; Baumgard, L H

    2016-11-01

    Infection and inflammation impede efficient animal productivity. The activated immune system ostensibly requires large amounts of energy and nutrients otherwise destined for synthesis of agriculturally relevant products. Accurately determining the immune system's in vivo energy needs is difficult, but a better understanding may facilitate developing nutritional strategies to maximize productivity. The study objective was to estimate immune system glucose requirements following an i.v. lipopolysaccharide (LPS) challenge. Holstein steers (148 ± 9 kg; = 15) were jugular catheterized bilaterally and assigned to 1 of 3 i.v.

  19. 10 CFR 35.41 - Procedures for administrations requiring a written directive.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Procedures for administrations requiring a written directive. 35.41 Section 35.41 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL... the following items that are applicable to the licensee's use of byproduct material— (1) Verifying...

  20. 10 CFR 35.41 - Procedures for administrations requiring a written directive.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 1 2012-01-01 2012-01-01 false Procedures for administrations requiring a written directive. 35.41 Section 35.41 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL... the following items that are applicable to the licensee's use of byproduct material— (1) Verifying...

  1. 10 CFR 35.41 - Procedures for administrations requiring a written directive.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 1 2013-01-01 2013-01-01 false Procedures for administrations requiring a written directive. 35.41 Section 35.41 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL... the following items that are applicable to the licensee's use of byproduct material— (1) Verifying...

  2. 10 CFR 35.41 - Procedures for administrations requiring a written directive.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Procedures for administrations requiring a written directive. 35.41 Section 35.41 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL... the following items that are applicable to the licensee's use of byproduct material— (1) Verifying...

  3. 10 CFR 35.41 - Procedures for administrations requiring a written directive.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 1 2014-01-01 2014-01-01 false Procedures for administrations requiring a written directive. 35.41 Section 35.41 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL... the following items that are applicable to the licensee's use of byproduct material— (1) Verifying...

  4. Classical Item Analysis Using Latent Variable Modeling: A Note on a Direct Evaluation Procedure

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.

    2011-01-01

    A directly applicable latent variable modeling procedure for classical item analysis is outlined. The method allows one to point and interval estimate item difficulty, item correlations, and item-total correlations for composites consisting of categorical items. The approach is readily employed in empirical research and as a by-product permits…

  5. 34 CFR 685.307 - Withdrawal procedure for schools participating in the Direct Loan Program.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 34 Education 3 2010-07-01 2010-07-01 false Withdrawal procedure for schools participating in the Direct Loan Program. 685.307 Section 685.307 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION WILLIAM D. FORD...

  6. Improved Direct Viable Count Procedure for Quantitative Estimation of Bacterial Viability in Freshwater Environments

    PubMed Central

    Yokomaku, Daisaku; Yamaguchi, Nobuyasu; Nasu, Masao

    2000-01-01

    A direct viable count (DVC) procedure was developed which clearly and easily discriminates the viability of bacterial cells. In this quantitative DVC (qDVC) procedure, viable cells are selectively lysed by spheroplast formation caused by incubation with antibiotics and glycine. This glycine effect leads to swollen cells with a very loose cell wall. The viable cells then are lysed easily by a single freeze-thaw treatment. The number of viable cells was obtained by subtracting the number of remaining cells after the qDVC procedure from the total cell number before the qDVC incubation. This improved procedure should provide useful information about the metabolic potential of natural bacterial communities. PMID:11097948

  7. Cytoplasmic Actin Is an Extracellular Insect Immune Factor which Is Secreted upon Immune Challenge and Mediates Phagocytosis and Direct Killing of Bacteria, and Is a Plasmodium Antagonist

    PubMed Central

    Sandiford, Simone L.; Dong, Yuemei; Pike, Andrew; Blumberg, Benjamin J.; Bahia, Ana C.; Dimopoulos, George

    2015-01-01

    Actin is a highly versatile, abundant, and conserved protein, with functions in a variety of intracellular processes. Here, we describe a novel role for insect cytoplasmic actin as an extracellular pathogen recognition factor that mediates antibacterial defense. Insect actins are secreted from cells upon immune challenge through an exosome-independent pathway. Anopheles gambiae actin interacts with the extracellular MD2-like immune factor AgMDL1, and binds to the surfaces of bacteria, mediating their phagocytosis and direct killing. Globular and filamentous actins display distinct functions as extracellular immune factors, and mosquito actin is a Plasmodium infection antagonist. PMID:25658622

  8. Immune-Directed Support of Rich Microbial Communities in the Gut Has Ancient Roots

    PubMed Central

    Dishaw, Larry J.; Cannon, John P.; Litman, Gary W.; Parker, William

    2014-01-01

    The animal gut serves as a primary location for the complex host-microbe interplay that is essential for homeostasis and may also reflect the types of ancient selective pressures that spawned the emergence of immunity in metazoans. In this review, we present a phylogenetic survey of gut host-microbe interactions and suggest that host defense systems arose not only to protect tissue directly from pathogenic attack but also to actively support growth of specific communities of mutualists. This functional dichotomy resulted in the evolution of immune systems much more tuned for harmonious existence with microbes than previously thought, existing as dynamic but primarily cooperative entities in the present day. We further present the protochordate Ciona intestinalis as a promising model for studying gut host-bacterial dialogue. The taxonomic position, gut physiology and experimental tractability of Ciona offer unique advantages in dissecting host-microbe interplay and can complement studies in other model systems. PMID:24984114

  9. Cavity-based linear polarizer immune to the polarization direction of an incident plane wave.

    PubMed

    Wang, Jiang; Shen, Zhongxiang; Gao, Xiang; Wu, Wen

    2016-01-15

    We herein report a linear polarizer based on a 2D array of substrate integrated waveguide cavities, which can convert an arbitrary linearly polarized (LP) incident wave into an outgoing LP wave in a specified polarization direction with constant transmittance. Two orthogonal slots etched on the front surface of the cavity are utilized to couple a wave of arbitrary polarization into the cavity, while another slot on the back side helps to couple the field out along a desired polarization direction. Microwave experiments are performed as a proof of concept. The proposed polarizer exhibits very good performance with stable transmittance as 50% and a polarization extinction ratio over 45 dB. The new polarizer is potentially useful in novel polarization-selective devices that are immune to the polarization direction of an incident plane wave.

  10. The structure, role, and procedures of the U.S. Advisory Committee on Immunization Practices (ACIP).

    PubMed

    Smith, Jean Clare

    2010-04-19

    The National Immunization Technical Advisory Group (NITAG) in the United States is the Advisory Committee on Immunization Practices (ACIP). The ACIP was established in 1964 by the US Surgeon General to assist in the prevention and control of communicable diseases, and includes a chair, an executive secretary, 15 voting members, 8 ex officio members and liaison representatives from 26 health-related professional organizations. Meetings are regularly convened at the Centers for Disease Control and Prevention (CDC) and are open to the public. Stringent measures and rigorous screening are used to avoid both real and apparent conflicts of interest, and no special interest or lobbying groups provide any material support to ACIP or its members. The committee recommends licensed new vaccines to be incorporated into the routine immunization schedule, recommends vaccine formulations, and reviews older vaccines to consider revising its recommendations. Published by Elsevier Ltd.

  11. The roles of direct recognition by animal lectins in antiviral immunity and viral pathogenesis.

    PubMed

    Liu, Yang; Liu, Jianying; Pang, Xiaojing; Liu, Tao; Ning, Zhijie; Cheng, Gong

    2015-01-29

    Lectins are a group of proteins with carbohydrate recognition activity. Lectins are categorized into many families based on their different cellular locations as well as their specificities for a variety of carbohydrate structures due to the features of their carbohydrate recognition domain (CRD) modules. Many studies have indicated that the direct recognition of particular oligosaccharides on viral components by lectins is important for interactions between hosts and viruses. Herein, we aim to globally review the roles of this recognition by animal lectins in antiviral immune responses and viral pathogenesis. The different classes of mammalian lectins can either recognize carbohydrates to activate host immunity for viral elimination or can exploit those carbohydrates as susceptibility factors to facilitate viral entry, replication or assembly. Additionally, some arthropod C-type lectins were recently identified as key susceptibility factors that directly interact with multiple viruses and then facilitate infection. Summarization of the pleiotropic roles of direct viral recognition by animal lectins will benefit our understanding of host-virus interactions and could provide insight into the role of lectins in antiviral drug and vaccine development.

  12. Reducing direct-care staff absenteeism: effects of a combined reinforcement and punishment procedure.

    PubMed

    Briggs, R M

    1990-06-01

    Absenteeism of 130 direct-care staff was reduced by 27% through a mixed consequence procedure consisting of positive reinforcement for reliable attendance and punishment (progressive discipline) for attendance abuse. Reduced rates of absenteeism were maintained over a 12-month period. A 17% reduction in overtime and an increase in annual staff turnover from 34% to 45% also occurred. Results extend the findings of mixed consequence procedures to residential facilities for persons with developmental disabilities. Development of a more powerful positive reinforcement component was discussed.

  13. Immunization.

    ERIC Educational Resources Information Center

    Guerin, Nicole; And Others

    1986-01-01

    Contents of this double journal issue concern immunization and primary health care of children. The issue decribes vaccine storage and sterilization techniques, giving particular emphasis to the role of the cold chain, i.e., the maintenance of a specific temperature range to assure potency of vaccines as they are moved from a national storage…

  14. Immunization.

    ERIC Educational Resources Information Center

    Guerin, Nicole; And Others

    1986-01-01

    Contents of this double journal issue concern immunization and primary health care of children. The issue decribes vaccine storage and sterilization techniques, giving particular emphasis to the role of the cold chain, i.e., the maintenance of a specific temperature range to assure potency of vaccines as they are moved from a national storage…

  15. [Correction of the Hansen claw hand using direct Zancolli lasso procedures and 2 of its variations].

    PubMed

    Boucher, P; Vandroogenbroeck, J B; Hirzel, C

    1986-01-01

    The procedure of the Zancolli "Lasso" or V direct Zancolli uses a flexor superficialis tendon which after a distal section is turned inside out and is fixed on itself after forming a loop around the proximal pulley of the sheath of the flexor. The mode of distal fixation being the same, the authors also study two different methods which resort either to one tendon for two, three or four fingers, or only to one strip of the flexor tendon for one finger. 45 cases of this kind of operation are reported. In the most important series in which the principle procedure has been used, the results are good in 80% of the mobile claws and average in 70% of the stiffened claws. The cases operated according to the two different methods, less numerous, give approximately the same results. The suggested indications are in favour of the changes in the procedure.

  16. Procedure for direct measurement of general quantum states using weak measurement.

    PubMed

    Lundeen, Jeff S; Bamber, Charles

    2012-02-17

    Recent work by Lundeen et al. [Nature (London) 474, 188 (2011)] directly measured the wave function by weakly measuring a variable followed by a normal (i.e., "strong") measurement of the complementary variable. We generalize this method to mixed states by considering the weak measurement of various products of these observables, thereby providing the density matrix an operational definition in terms of a procedure for its direct measurement. The method only requires measurements in two bases and can be performed in situ, determining the quantum state without destroying it.

  17. Crustacean hyperglycemic hormones directly modulate the immune response of hemocytes in shrimp Litopenaeus vannamei.

    PubMed

    Wang, Lin; Chen, Hao; Xu, Jianchao; Xu, Qingsong; Wang, Mengqiang; Zhao, Depeng; Wang, Lingling; Song, Linsheng

    2017-03-01

    A robust immune response against invading pathogens is crucial for host to survive, which depends greatly on the well balance of metabolism. Increasing evidence has indicated that some metabolic hormones, such as insulin, could modulate immune responses directly. Crustacean hyperglycemic hormone (CHH) family is a group of ecdysozoans-specific peptide hormone involved in glucose metabolism and other biological events. In the present study, two members of CHH family (designated as LvCHH I and LvCHH II) in shrimp Litopenaeus vannamei with one and two crustacean neurohormone domains respectively were chosen to investigate their putative modulatory roles in both glucose metabolism and immune response. LvCHH I and LvCHH II were both expressed in the sinus gland and lamina ganglionalis of eyestalks and were significantly induced after white spot syndrome virus (WSSV) infection. Meanwhile, significant increases of hemolymph glucose levels were observed in shrimp at 12 and 24 h after WSSV infection while the glucose inside the hemocytes decreased at 6 h and then increased at 12 h. Gain-of-function of rLvCHHs was subsequently conducted in vivo by injecting the recombinant proteins (rLvCHH I and rLvCHH II). The hemolymph glucose increased significantly from 0.5 h to 3 h after the shrimps received an injection of rLvCHH I, while it decreased at 0.5 h and increased afterward at 3 h post rLvCHH II injection. At the meantime, significant decreases of reactive oxygen species level in hemocytes were observed at 3 h and 6 h post rLvCHH I injection, while it remained unchanged in rLvCHH II injection group. rLvCHH I and rLvCHH II could bind to the cytomembrane of primary shrimp hemocytes in vitro, and the expressions of superoxide dismutase and LvRelish increased when the hemocytes were incubated with rLvCHH I for 3 h. Meanwhile, the expression of antimicrobial peptides, crustin and penaeidin-4, were also induced by rLvCHH I and rLvCHH II. These results demonstrated that

  18. Direct plating procedure for enumerating Vibrio vulnificus in oysters (Crassostrea virginica).

    PubMed Central

    Miceli, G A; Watkins, W D; Rippey, S R

    1993-01-01

    A procedure for enumerating and identifying Vibrio vulnificus in oysters was developed and evaluated. This method consists of growth on a direct plating medium (VVE medium) for isolating the organism from shellfish tissues, followed by biochemical tests for differentiating and identifying presumptively positive isolates. Densities of V. vulnificus are reliably obtained in 2 to 4 days, and as few as 10 culturable cells per 100 g can be identified. The procedure was evaluated by using a DNA probe technique specific for the cytotoxin-hemolysin gene of V. vulnificus and gas chromatographic analysis of the fatty acid contents of positive isolates. Only 3.2 and 0.4% of the isolates gave false-positive and false-negative results, respectively. The average level of recovery on VVE medium for 33 strains, including both clinical and environmental isolates, was 92% of the level of recovery obtained with brain heart infusion agar supplemented with 1% NaCl. The densities of V. vulnificus in oyster homogenates and individual oysters harvested from gulf and Atlantic coastal waters revealed that seasonally high levels occurred. The VVE medium procedure facilitated enumeration of this pathogen in molluscan shellfish and had a distinct advantage over the widely used most-probable-number procedure for V. vulnificus enumeration, which requires 5 to 7 days and often gives improbable and imprecise results. PMID:8285658

  19. Choosing a treatment procedure for early stuttering: issues and future directions.

    PubMed

    Onslow, M

    1992-10-01

    The new responsibility of speech-language pathologists to provide direct, early intervention for stuttering creates a further responsibility for them to choose justifiable treatment procedures for that intervention. This paper has two purposes. The first is to encourage clinicians to evaluate the conceptual and practical aspects of the treatments they use for early stuttering. The second purpose of the paper is to overview available early intervention procedures and consider the advantages, disadvantages, and prominent issues associated with each. The procedures considered are environment manipulation, prolonged speech, and response-contingent stimulation. It is concluded that clinicians have no cause to be satisfied with any currently available early intervention procedure. Further, it is concluded that (a) although anticipatory struggle theories have made a useful contribution to scholarship, their line of theoretical reasoning is questionable for clinical practice; (b) although theoretically sound for the purpose, variants of prolonged speech pose prohibitive conceptual and practical shortcomings if they are used to treat very young stuttering children; (c) despite its disadvantages, response contingent stimulation is the most conceptually and practically justifiable method for early intervention with stuttering.

  20. Compendium of NPL listing policies and procedures, 1982 to 1985. Directive

    SciTech Connect

    Not Available

    1991-08-01

    The compendium is a collection of NPL listing policy and procedure directives issued from 1982 to 1985. The contents include: Guidance for Establishing the National Priorities List, February 1982 (9320.1-01); Guidance for Establishing the National Priorities List, June 1982 (9320.1-02); Guidance for Proposed NPL Update No. 3, February 1984 (9320.3-04); Guidance for Updating the National Priorities List, May 1983 (9320.3-01); Instructions for Promulgating the National Priorities List Update, January 1984 (9320.3-02); National Priorities List Categorization, July 1984 (9320.1-04); NPL Information Update - Update No. 4, April 1985 (9320.3-05); Procedures for Updating the National Priorities List, May 1984, (9320.3-03); Promulgation of the National Priorities List, May 1983 (9320.1-03); RCRA/NPL Listing Policy, September 1986 (9320.1-05); and Updating the National Priorities List: Update No. 6 Proposal, September 1985 (9320.3-06).

  1. Measles, immune suppression and vaccination: direct and indirect nonspecific vaccine benefits.

    PubMed

    Mina, Michael J

    2017-06-01

    The measles virus is among the most transmissible viruses known to infect humans. Prior to measles vaccination programs, measles infected over 95% of all children and was responsible for over 4 million deaths each year. Measles vaccination programs have been among the greatest public health achievements reducing, eliminating endemic measles in the whole of the Americas and across much of the globe. Where measles vaccines are introduced, unexpectedly large reductions in all-cause childhood mortality have been observed. These gains appear to derive in part from direct heterologous benefits of measles vaccines that enhance innate and adaptive immune responses. Additionally, by preventing measles infections, vaccination prevents measles-associated short- and long-term immunomodulating effects. Before vaccination, these invisible hallmarks of measles infections increased vulnerability to non-measles infections in nearly all children for weeks, months, or years following acute infections. By depleting measles incidence, vaccination has had important indirect benefits to reduce non-measles mortality. Delineating the relative importance of these two modes of survival benefits following measles vaccine introduction is of critical public health importance. While both support continued unwavering global commitments to measles vaccination programs until measles eradication is complete, direct heterologous benefits of measles vaccination further support continued commitment to measles vaccination programs indefinitely. We discuss what is known about direct and indirect nonspecific measles vaccine benefits, and their implications for continued measles vaccination programs. © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  2. Effects of FVIII immunity on hepatocyte and hematopoietic stem cell-directed gene therapy of murine hemophilia A.

    PubMed

    Lytle, Allison M; Brown, Harrison C; Paik, Na Yoon; Knight, Kristopher A; Wright, J Fraser; Spencer, H Trent; Doering, Christopher B

    2016-01-01

    Immune responses to coagulation factors VIII (FVIII) and IX (FIX) represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC) retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV)-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV) vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV.

  3. Effects of FVIII immunity on hepatocyte and hematopoietic stem cell–directed gene therapy of murine hemophilia A

    PubMed Central

    Lytle, Allison M; Brown, Harrison C; Paik, Na Yoon; Knight, Kristopher A; Wright, J Fraser; Spencer, H Trent; Doering, Christopher B

    2016-01-01

    Immune responses to coagulation factors VIII (FVIII) and IX (FIX) represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC) retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV)-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV) vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV. PMID:26909355

  4. Thermoadaptation-directed evolution of chloramphenicol acetyltransferase in an error-prone thermophile using improved procedures.

    PubMed

    Kobayashi, Jyumpei; Furukawa, Megumi; Ohshiro, Takashi; Suzuki, Hirokazu

    2015-07-01

    Enhancing the thermostability of thermolabile enzymes extends their practical utility. We previously demonstrated that an error-prone thermophile derived from Geobacillus kaustophilus HTA426 can generate mutant genes encoding enzyme variants that are more thermostable than the parent enzyme. Here, we used this approach, termed as thermoadaptation-directed enzyme evolution, to increase the thermostability of the chloramphenicol acetyltransferase (CAT) of Staphylococcus aureus and successfully generated a CAT variant with an A138T replacement (CAT(A138T)). This variant was heterologously produced, and its enzymatic properties were compared with those of the wild type. We found that CAT(A138T) had substantially higher thermostability than CAT but had comparable activities, showing that the A138T replacement enhanced protein thermostability without affecting the catalytic activity. Because variants CAT(A138S) and CAT(A138V), which were generated via in vitro site-directed mutagenesis, were more thermostable than CAT, the thermostability enhancement resulting from the A138T replacement can be attributed to both the presence of a hydroxyl group and the bulk of the threonine side chain. CAT(A138T) conferred chloramphenicol resistance to G. kaustophilus cells at high temperature more efficiently than CAT. Therefore, the gene encoding CAT(A138T) may be useful as a genetic marker in Geobacillus spp. Notably, CAT(A138T) generation was achieved only by implementing improved procedures (plasmid-based mutations on solid media); previous procedures (chromosome-based mutations in liquid media) were unsuccessful. This result suggests that this improved procedure is crucial for successful thermoadaptation-directed evolution in certain cases and increases the opportunities for generating thermostable enzymes.

  5. A direct procedure for interpolation on a structured curvilinear two-dimensional grid

    NASA Technical Reports Server (NTRS)

    Zingg, David W.; Yarrow, Maurice

    1989-01-01

    A direct procedure is presented for locally bicubic interpolation on a structured, curvilinear, two-dimensional grid. The physical (Cartesian) space is transformed to a computational space in which the grid is uniform and rectangular by a generalized curvilinear coordinate transformation. Required partial derivative information is obtained by finite differences in the computational space. The partial derivatives in physical space are determined by repeated application of the chain rule for partial differentiation. A bilinear transformation is used to analytically transform the individual quadrilateral cells in physical space into unit squares. The interpolation is performed within each unit square using a piecewise bicubic spline.

  6. Direct comparison of statistical damage frequency method and raster scan procedure

    NASA Astrophysics Data System (ADS)

    Batavičiūtė, G.; Ščiuka, M.; Plerpaitė, V.; Melninkaitis, A.

    2015-11-01

    Presented study addresses the nano-size defects acting as damage precursors in nanosecond laser pulse irradiation regime. Defects embedded within the surface of glass are investigated in terms of defect ensembles. Damage frequency method and raster scan procedure are directly compared on the set of two samples: uncoated fused silica substrates and SiO2 monolayer films. The extracted defect ensembles appear to be different from each other. The limitations of compared methods such as pulse-to-pulse variation of laser intensity and sample contamination induced by laser ablation were identified as the main causes of observed differences.

  7. A combination of HARMONIE short time direct normal irradiance forecasts and machine learning: The #hashtdim procedure

    NASA Astrophysics Data System (ADS)

    Gastón, Martín; Fernández-Peruchena, Carlos; Körnich, Heiner; Landelius, Tomas

    2017-06-01

    The present work describes the first approach of a new procedure to forecast Direct Normal Irradiance (DNI): the #hashtdim that treats to combine ground information and Numerical Weather Predictions. The system is centered in generate predictions for the very short time. It combines the outputs from the Numerical Weather Prediction Model HARMONIE with an adaptive methodology based on Machine Learning. The DNI predictions are generated with 15-minute and hourly temporal resolutions and presents 3-hourly updates. Each update offers forecasts to the next 12 hours, the first nine hours are generated with 15-minute temporal resolution meanwhile the last three hours present hourly temporal resolution. The system is proved over a Spanish emplacement with BSRN operative station in south of Spain (PSA station). The #hashtdim has been implemented in the framework of the Direct Normal Irradiance Nowcasting methods for optimized operation of concentrating solar technologies (DNICast) project, under the European Union's Seventh Programme for research, technological development and demonstration framework.

  8. Development of a drift-correction procedure for a direct-reading spectrometer

    NASA Technical Reports Server (NTRS)

    Chapman, G. B., II; Gordon, W. A.

    1977-01-01

    A procedure which provides automatic correction for drifts in the radiometric sensitivity of each detector channel in a direct-reading emission spectrometer is described. Such drifts are customarily controlled by the regular analyses of standards, which provide corrections for changes in the excitational, optical, and electronic components of the instrument. This standardization procedure, however, corrects for the optical and electronic drifts. It is a step that must be taken if the time, effort, and cost of processing standards is to be minimized. This method of radiometric drift correction uses a 1,000-W tungsten-halogen reference lamp to illuminate each detector through the same optical path as that traversed during sample analysis. The responses of the detector channels to this reference light are regularly compared with channel response to the same light intensity at the time of analytical calibration in order to determine and correct for drift. Except for placing the lamp in position, the procedure is fully automated and compensates for changes in spectral intensity due to variations in lamp current. A discussion of the implementation of this drift-correction system is included.

  9. Combined rigorous-generic direct orthorectification procedure for IRS-p6 sensors

    NASA Astrophysics Data System (ADS)

    Yousefzadeh, Meisam; Mojaradi, Barat

    2012-11-01

    The accessibility of global data, such as the digital elevation model (DEM), and the development of global visualisations allow promising new methods for minimising the distortion in the online generation of rough orthorectified products to be developed. Direct georeferencing (DG) has attracted a considerable amount of attention in the applications of pushbroom raw images in orthorectification or mono-plotting using ancillary satellite data. This study builds on recent DG studies to achieve an "orthoimage" from raw data and to determine potential mapping errors due to the DG procedure. Thus, this paper focuses on establishing a simple method for mitigating the misalignments of space-borne imageries to be used in direct orthorectification. Towards this goal, instead of image resectioning, affine transformation in different coordinate systems is employed in the orthorectification algorithm to compensate for the systematic DG errors. For a given point, the elevation corresponding to the obtained planimetric coordinate is extracted using available topographic maps and global DEMs, such as SRTM's and ASTER's DEMs. As a result, parameters no longer need to be updated, as in the conventional orthophoto generation methods. To evaluate the proposed procedures, experiments were conducted over three different IRS-p6 sensors in five datasets with different swath widths and tilt angles. The obtained results also demonstrate that the geographic coordinate system and a simple 2D affine transformation can efficiently correct misalignments.

  10. Evasion of Antiviral Innate Immunity by Theiler's Virus L* Protein through Direct Inhibition of RNase L

    PubMed Central

    Sorgeloos, Frédéric; Jha, Babal Kant; Silverman, Robert H.; Michiels, Thomas

    2013-01-01

    Theiler's virus is a neurotropic picornavirus responsible for chronic infections of the central nervous system. The establishment of a persistent infection and the subsequent demyelinating disease triggered by the virus depend on the expression of L*, a viral accessory protein encoded by an alternative open reading frame of the virus. We discovered that L* potently inhibits the interferon-inducible OAS/RNase L pathway. The antagonism of RNase L by L* was particularly prominent in macrophages where baseline oligoadenylate synthetase (OAS) and RNase L expression levels are elevated, but was detectable in fibroblasts after IFN pretreatment. L* mutations significantly affected Theiler's virus replication in primary macrophages derived from wild-type but not from RNase L-deficient mice. L* counteracted the OAS/RNase L pathway through direct interaction with the ankyrin domain of RNase L, resulting in the inhibition of this enzyme. Interestingly, RNase L inhibition was species-specific as Theiler's virus L* protein blocked murine RNase L but not human RNase L or RNase L of other mammals or birds. Direct RNase L inhibition by L* and species specificity were confirmed in an in vitro assay performed with purified proteins. These results demonstrate a novel viral mechanism to elude the antiviral OAS/RNase L pathway. By targeting the effector enzyme of this antiviral pathway, L* potently inhibits RNase L, underscoring the importance of this enzyme in innate immunity against Theiler's virus. PMID:23825954

  11. Fitting direct covariance structures by the MSTRUCT modeling language of the CALIS procedure.

    PubMed

    Yung, Yiu-Fai; Browne, Michael W; Zhang, Wei

    2015-02-01

    This paper demonstrates the usefulness and flexibility of the general structural equation modelling (SEM) approach to fitting direct covariance patterns or structures (as opposed to fitting implied covariance structures from functional relationships among variables). In particular, the MSTRUCT modelling language (or syntax) of the CALIS procedure (SAS/STAT version 9.22 or later: SAS Institute, 2010) is used to illustrate the SEM approach. The MSTRUCT modelling language supports a direct covariance pattern specification of each covariance element. It also supports the input of additional independent and dependent parameters. Model tests, fit statistics, estimates, and their standard errors are then produced under the general SEM framework. By using numerical and computational examples, the following tests of basic covariance patterns are illustrated: sphericity, compound symmetry, and multiple-group covariance patterns. Specification and testing of two complex correlation structures, the circumplex pattern and the composite direct product models with or without composite errors and scales, are also illustrated by the MSTRUCT syntax. It is concluded that the SEM approach offers a general and flexible modelling of direct covariance and correlation patterns. In conjunction with the use of SAS macros, the MSTRUCT syntax provides an easy-to-use interface for specifying and fitting complex covariance and correlation structures, even when the number of variables or parameters becomes large. © 2014 The British Psychological Society.

  12. Population-Level Impact of Ontario's Infant Rotavirus Immunization Program: Evidence of Direct and Indirect Effects.

    PubMed

    Wilson, Sarah E; Rosella, Laura C; Wang, Jun; Le Saux, Nicole; Crowcroft, Natasha S; Harris, Tara; Bolotin, Shelly; Deeks, Shelley L

    2016-01-01

    To evaluate the direct and indirect population impact of rotavirus (RV) immunization on hospitalizations and emergency department (ED) visits for acute gastroenteritis (AGE) in Ontario before and after the publicly-funded RV immunization program. Administrative data was used to identify ED visits and hospitalizations for all Ontarians using ICD-10 codes. We used two outcome definitions: RV-specific AGE (RV-AGE) and codes representing RV-, other viral and cause unspecified AGE ("overall AGE"). The pre-program and public program periods were August 1, 2005 to July 31, 2011; and August 1, 2011 to March 31, 2013, respectively. A negative binominal regression model that included the effect of time was used to calculate rates and rate ratios (RRs) and 95% confidence intervals (CIs) for RV-AGE and overall AGE between periods, after adjusting for age, seasonality and secular trends. Analyses were conducted for all ages combined and age stratified. Relative to the pre-program period, the adjusted RRs for RV-AGE and overall AGE hospitalizations in the public program period were 0.29 (95%CI: 0.22-0.39) and 0.68 (95%CI: 0.62-0.75), respectively. Significant reductions in RV-AGE hospitalizations were noted overall and for the following age bands: < 12 months, 12-23 months, 24-35 months, 3-4 years, and 5-19 years. Significant declines in overall AGE hospitalizations were observed across all age bands, including older adults > = 65 years (RR 0.80, 95%CI: 0.72-0.90). The program was associated with adjusted RRs of 0.32 (95% CI: 0.20-0.52) for RV-AGE ED visits and 0.90 (95% CI: 0.85-0.96) for overall AGE ED visits. This large, population-based study provides evidence of the impact of RV vaccine in preventing hospitalizations and ED visits for RV-AGE and overall AGE, including herd effects.

  13. Immune-directed therapy for type 1 diabetes at the clinical level: the Immune Tolerance Network (ITN) experience.

    PubMed

    Ehlers, Mario R; Nepom, Gerald T

    2012-01-01

    Reestablishing immune tolerance in type 1 diabetes (T1D), a chronic autoimmune disease, is a major goal. The Immune Tolerance Network (ITN) has initiated eight clinical trials of immunomodulatory therapies in recent-onset T1D over the past decade. Results have been mixed in terms of clinical efficacy, but the studies have provided valuable mechanistic insight that are enhancing our understanding of the disease and guiding the design of future trials. Trials of non-Fc-binding anti-CD3 mAbs have revealed that modulation of this target leads to partial responses, and ITN's AbATE trial led to identification of a robust responder group that could be distinguished from non-responders by baseline metabolic and immunologic features. A pilot study of the combination of IL-2 and rapamycin gave the first demonstration that frequency and function of regulatory T cells (Tregs) can be enhanced in T1D subjects, although the therapy triggered the activation of effectors with transient β-cell dysfunction. Similarly, therapy with anti-thymocyte globulin led to substantial lymphocyte depletion, but also to the activation of the acute-phase response with no clinical benefit during preliminary analyses. These and other results provide mechanistic tools that can be used as biomarkers for safety and efficacy in future trials. Furthermore, our results, together with those of other organizations, notably TrialNet, delineate the roles of the major components of the immune response in T1D. This information is setting the stage for future combination therapy trials. The development of disease-relevant biomarkers will also enable the implementation of innovative trial designs, notably adaptive trials, which will increase efficiencies in terms of study duration and sample size, and which will expedite the conduct of trials in which there are uncertainties about dose response and effect size.

  14. SU-F-P-44: A Direct Estimate of Peak Skin Dose for Interventional Fluoroscopy Procedures

    SciTech Connect

    Weir, V; Zhang, J

    2016-06-15

    Purpose: There is an increasing demand for medical physicist to calculate peak skin dose (PSD) for interventional fluoroscopy procedures. The dose information (Dose-Area-Product and Air Kerma) displayed in the console cannot directly be used for this purpose. Our clinical experience shows that the use of the existing methods may overestimate or underestimate PSD. This study attempts to develop a direct estimate of PSD from the displayed dose metrics. Methods: An anthropomorphic torso phantom was used for dose measurements for a common fluoroscopic procedure. Entrance skin doses were measured with a Piranha solid state point detector placed on the table surface below the torso phantom. An initial “reference dose rate” (RE) measurement was conducted by comparing the displayed dose rate (mGy/min) to the dose rate measured. The distance from table top to focal spot was taken as the reference distance (RD at the RE. Table height was then adjusted. The displayed air kerma and DAP were recorded and sent to three physicists to estimate PSD. An inverse square correction was applied to correct displayed air kerma at various table heights. The PSD estimated by physicists and the PSD by the proposed method were then compared with the measurements. The estimated DAPs were compared to displayed DAP readings (mGycm2). Results: The difference between estimated PSD by the proposed method and direct measurements was less than 5%. For the same set of data, the estimated PSD by each of three physicists is different from measurements by ±52%. The DAP calculated by the proposed method and displayed DAP readings in the console is less than 20% at various table heights. Conclusion: PSD may be simply estimated from displayed air kerma or DAP if the distance between table top and tube focal spot or if x-ray beam area on table top is available.

  15. Direct impression on agar surface as a diagnostic sampling procedure for candida balanitis.

    PubMed

    Lisboa, Carmen; Santos, António; Azevedo, Filomena; Pina-Vaz, Cidália; Rodrigues, Acácio Gonçalves

    2010-02-01

    The diagnosis of candida balanitis should be based upon both clinical and mycological data. The procedure of material collection is a critical issue to confirm or rule out the clinical diagnosis of candida balanitis. To compare direct impression of the glans on the agar surface of solid culture media with the collection of genital exudates with cotton swab for the diagnosis of candida balanitis. A prospective cross-sectional study was carried out during a 36-month period. Sexually transmitted disease clinic attendees with balanitis and asymptomatic men were included. Specimens for yeast culture were collected from the glans penis and inner preputial layer using the direct impression on CHROMagar candida medium and by swabbing with a sterile cotton swab. Among 478 men enrolled, 189 had balanitis. The prevalence of candida balanitis was 17.8% (85/478) confirmed after culture by direct impression; the swab method detected only 54/85 (63.5%) of these men. Of the 289 asymptomatic men, 36 (12.5%) yielded Candida spp; the swab method detected only 38.9% of these men. The risk of having candida balanitis is 8.9 (IC 95% 2.48 to 32.04) whenever the number of candida colonies recovered by direct impression was greater than 10. Direct impression on CHROMagar candida medium resulted in the highest Candida spp recovery rate. More than 10 colonies yielded by impression culture were statistically associated with candida balanitis. This method shows the ideal profile for sampling the male genital area for yeasts and should be included in the management of balanitis.

  16. Reassessing the MADE direct-push hydraulic conductivity data using a revised calibration procedure

    NASA Astrophysics Data System (ADS)

    Bohling, Geoffrey C.; Liu, Gaisheng; Dietrich, Peter; Butler, James J.

    2016-11-01

    In earlier work, we presented a geostatistical assessment of high-resolution hydraulic conductivity (K) profiles obtained at the MADE site using direct-push (DP) methods. The profiles are derived from direct-push injection logger (DPIL) measurements that provide a relative indicator of vertical variations in K with a sample spacing of 1.5 cm. The DPIL profiles are converted to K profiles by calibrating to the results of direct-push permeameter (DPP) tests performed at selected depths in some of the profiles. Our original calibration used a linear transform that failed to adequately account for an upper limit on DPIL responses in high-K zones and noise in the DPIL data. Here we present a revised calibration procedure that accounts for the upper limit and noise, leading to DPIL K values that display a somewhat different univariate distribution and a lower lnK variance (5.9 ± 1.5) than the original calibration values (6.9 ± 1.8), although each variance estimate falls within the other's 95% confidence interval. Despite the change in the univariate distribution, the autocorrelation structure and large-scale patterns exhibited by the revised DPIL K values still agree well with those exhibited by the flowmeter data from the site. We provide the DPIL and DPP data, along with our calibrated DPIL K values, in the Supporting Information.

  17. Immune reconstitution and vaccination outcome in HIV-1 infected children: present knowledge and future directions.

    PubMed

    Cagigi, Alberto; Cotugno, Nicola; Giaquinto, Carlo; Nicolosi, Luciana; Bernardi, Stefania; Rossi, Paolo; Douagi, Iyadh; Palma, Paolo

    2012-12-01

    Current evidence on routine immunization of HIV-1 infected children point out the need for a special vaccine schedule in this population. However, optimal strategies for identifying individuals susceptible to infections, and then offering them sustained protection through appropriate immunization schedule, both in terms of timing and number of vaccine doses, still remain to be elucidated. Understanding the degree of immune recovery after HAART initiation is important in guiding administration of routine vaccination in HIV-1 infected children. Although quantitative measures (e.g., CD4+ T-cell counts and immunoglobulin levels) are frequently performed to evaluate immune parameters, these measures do not fully mirror functional immune recovery. Here, we will review the status of single mandatory and recommended vaccines for HIV-1 infected children in relation to immune recovery after HAART initiation with the aim of identifying new means to help design personalized vaccine schedules for this population.

  18. Does a quorum sensing mechanism direct the behavior of immune cells?

    PubMed

    Perié, Leïla; Aru, Juhan; Kourilsky, Philippe; Slotine, Jean-Jacques

    2013-01-01

    Quorum sensing is a decision-making process used by decentralized groups such as colonies of bacteria to trigger a coordinated behavior. The existence of decentralized coordinated behavior has also been suggested in the immune system. In this paper, we explore the possibility for quorum sensing mechanisms in the immune response. Cytokines are good candidates as inducer of quorum sensing effects on migration, proliferation and differentiation of immune cells. The existence of a quorum sensing mechanism should be explored experimentally. It may provide new perspectives into immune responses and could lead to new therapeutic strategies. Copyright © 2013 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  19. 34 CFR 1100.24 - What are the procedures for payment of a fellowship award directly to the fellow?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 34 Education 4 2011-07-01 2011-07-01 false What are the procedures for payment of a fellowship... LEADER FELLOWSHIP PROGRAM How Does the Director Award a Fellowship? § 1100.24 What are the procedures for payment of a fellowship award directly to the fellow? (a) If the Director pays fellowship award...

  20. 34 CFR 1100.24 - What are the procedures for payment of a fellowship award directly to the fellow?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 34 Education 3 2010-07-01 2010-07-01 false What are the procedures for payment of a fellowship... LEADER FELLOWSHIP PROGRAM How Does the Director Award a Fellowship? § 1100.24 What are the procedures for payment of a fellowship award directly to the fellow? (a) If the Director pays fellowship award...

  1. The Anderson--Baird-Parker direct plating method versus the most probable number procedure for enumerating Escherichia coli in meats.

    PubMed

    Rayman, M K; Aris, B

    1981-01-01

    Comparison of the Anderson--Baird-Parker direct plating method (DP) and the North American most probable number procedure (MPN) for enumerating Escherichia coli in frozen meats revealed that the DP method is more precise and yields higher counts of E. coli than the MPN procedure. Any of three brands of membrane filters tested was suitable for use in the DP method.

  2. A direct screening procedure for gravitropism mutants in Arabidopsis thaliana (L.) Heynh

    NASA Technical Reports Server (NTRS)

    Bullen, B. L.; Best, T. R.; Gregg, M. M.; Poff, K. L.; Barsel, S-E (Principal Investigator)

    1990-01-01

    In order to isolate gravitropism mutants of Arabidopsis thaliana (L.) Heynh. var Estland for the genetic dissection of the gravitropism pathway, a direct screening procedure has been developed in which mutants are selected on the basis of their gravitropic response. Variability in hypocotyl curvature was dependent on the germination time of each seed stock, resulting in the incorrect identification of several lines as gravitropism mutants when a standard protocol for the potentiation of germination was used. When the protocol was adjusted to allow for differences in germination time, these lines were eliminated from the collection. Out of the 60,000 M2 seedlings screened, 0.3 to 0.4% exhibited altered gravitropism. In approximately 40% of these mutant lines, only gravitropism by the root or the hypocotyl was altered, while the response of the other organ was unaffected. These data support the hypothesis that root and hypocotyl gravitropism are genetically separable.

  3. Complications Following Direct Anterior Hip Procedures: Costs to Both Patients and Surgeons.

    PubMed

    Lee, Gwo-Chin; Marconi, Dante

    2015-09-01

    A systematic review of the literature on clinical outcomes following direct anterior approach (DAA) hip arthroplasty was performed. An aggregated 11,810 hip procedures were analyzed for intraoperative and early postoperative complications. The most common complication following DAA hip arthroplasty was nerve dysfunction (2.8%) followed by intraoperative fractures (2.3%). Postoperative dislocation, wound complications, and revision THA within the first 12 months were reported in 1.2% of cases. Thus, while DAA hip arthroplasty can be successfully performed, it is not without complications. Without definitive evidence of clinical superiority, surgeons considering switching to DAA should benchmark their personal complication rates against published reports. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. A direct screening procedure for gravitropism mutants in Arabidopsis thaliana (L. ) Heynh

    SciTech Connect

    Bullen, B.L.; Best, T.R.; Gregg, M.M.; Barsel, S.E.; Poff, K.L. )

    1990-06-01

    In order to isolate gravitropism mutants of Arabidopsis thaliana (L.) Heynh. var Estland for the genetic dissection of the gravitropism pathway, a direct screening procedure has been developed in which mutants are selected on the basis of their gravitropic response. Variability in hypocotyl curvature was dependent on the germination time of each seed stock, resulting in the incorrect identification of several lines as gravitropism mutants when a standard protocol for the potentiation of germination was used. When the protocol was adjusted to allow for differences in germination time, these lines were eliminated from the collection. Out of the 60,000 M2 seedlings screened, 0.3 to 0.4% exhibited altered gravitropism. In approximately 40% of these mutant lines, only gravitropism by the root or the hypocotyl was altered, while the response of the other organ was unaffected. These data support the hypothesis that root and hypocotyl gravitropism are genetically separable.

  5. Direct vision in minimally invasive epicardial procedures: preliminary tests of prototype instrumentation.

    PubMed

    Hack, B J; Ramon, S G; Hagen, Z A; Theran, M E; Burkhardt, J D; Gillies, G T

    2015-01-01

    This study investigated the use of direct visualization to enhance minimally invasive epicardial procedures. A commercially available miniature camera was placed in a prototype subxiphoid introducer needle and bench top, in vitro and in vivo tests of system performance were made during simulated and actual attempts at pericardial access and cardio-endoscopy. This system had an unshielded field of view of 100° and a resolution of 220 × 224 pixels. When a sleeve used to maintain depth of field was slid past the distal tip of the camera probe, the field of view would decrease by ≈15° per millimetre of sleeve extension, but without loss of image quality. While tests during in vivo subxiphoid access in a porcine model revealed that the pericardial membrane was difficult to localize, the results also showed excellent resolution of the coronary arteries on the epicardial surface. These findings and potential improvements are discussed in detail.

  6. [Harmonization procedures directed toward clinical trials in laboratory medicine at the National Cancer Center Hospital].

    PubMed

    Ozeki, Mitsuru; Shioya, Kana; Furuta, Koh

    2009-09-01

    Recent advances in pharmacology and molecular sciences made it possible to develop drugs for patients with various maladies. Frustration has existed concerning the delayed provision of these drugs for routine practices in the clinical field. To correct this problem, the importance of clinical trials is increasing. Although there exists a strong demand for participation of clinical laboratories in clinical trials, an awkward attitude in clinical laboratories frustrates those performing clinical trials. We are attempting to correct this problem by introducing our experience with harmonization procedures directed toward clinical trials in laboratory medicine in general. First we described the current status of clinical trials in our hospital. Then we will show personnel in need for clinical trials. Finally we describe in detail our clinical trial procedures. We focus particularly on three aspects of participation in clinical trials: pre-analytical, analytical, and post analytical. Additionally we describe the problems and perspectives in clinical trials by giving special reference to the clinical laboratories in general through discussion with various personnel and specialists. Our goal in the field of laboratory medicine is to benefit patients through the establishment of a harmony between clinical trials and clinical laboratories.

  7. Secreted Factors from Colorectal and Prostate Cancer Cells Skew the Immune Response in Opposite Directions

    PubMed Central

    Lundholm, Marie; Hägglöf, Christina; Wikberg, Maria L.; Stattin, Pär; Egevad, Lars; Bergh, Anders; Wikström, Pernilla; Palmqvist, Richard; Edin, Sofia

    2015-01-01

    Macrophage infiltration has been associated with an improved prognosis in patients with colorectal cancer (CRC), but a poor prognosis in prostate cancer (PC) patients. In this study, the distribution and prognostic value of proinflammatory M1 macrophages (NOS2+) and immunosuppressive M2 macrophages (CD163+) was evaluated in a cohort of 234 PC patients. We found that macrophages infiltrating PC were mainly of an M2 type and correlated with a more aggressive tumor and poor patient prognosis. Furthermore, the M1/M2 ratio was significantly decreased in PC compared to CRC. Using in vitro cell culture experiments, we could show that factors secreted from CRC and PC cells induced macrophages of a proinflammatory or immunosuppressive phenotype, respectively. These macrophages differentially affected autologous T lymphocyte proliferation and activation. Consistent with this, CRC specimens were found to have higher degrees of infiltrating T-helper 1 cells and active cytotoxic T lymphocytes, while PC specimens displayed functionally inactive T cells. In conclusion, our results imply that tumour-secreted factors from cancers of different origin can drive macrophage differentiation in opposite directions and thereby regulate the organization of the anti-tumour immune response. Our findings suggest that reprogramming of macrophages could be an important tool in the development of new immunotherapeutic strategies. PMID:26503803

  8. Directed transport of neutrophil-derived extracellular vesicles enables platelet-mediated innate immune response

    PubMed Central

    Rossaint, Jan; Kühne, Katharina; Skupski, Jennifer; Van Aken, Hugo; Looney, Mark R.; Hidalgo, Andres; Zarbock, Alexander

    2016-01-01

    The innate immune response to bacterial infections requires the interaction of neutrophils and platelets. Here, we show that a multistep reciprocal crosstalk exists between these two cell types, ultimately facilitating neutrophil influx into the lung to eliminate infections. Activated platelets adhere to intravascular neutrophils through P-selectin/P-selectin glycoprotein ligand-1 (PSGL-1)-mediated binding, a primary interaction that allows platelets glycoprotein Ibα (GPIbα)-induced generation of neutrophil-derived extracellular vesicles (EV). EV production is directed by exocytosis and allows shuttling of arachidonic acid into platelets. EVs are then specifically internalized into platelets in a Mac1-dependent fashion, and relocated into intracellular compartments enriched in cyclooxygenase1 (Cox1), an enzyme processing arachidonic acid to synthesize thromboxane A2 (TxA2). Finally, platelet-derived-TxA2 elicits a full neutrophil response by inducing the endothelial expression of ICAM-1, intravascular crawling, and extravasation. We conclude that critical substrate–enzyme pairs are compartmentalized in neutrophils and platelets during steady state limiting non-specific inflammation, but bacterial infection triggers regulated EV shuttling resulting in robust inflammation and pathogen clearance. PMID:27845343

  9. Role of laser irradiation in direct pulp capping procedures: a systematic review and meta-analysis.

    PubMed

    Javed, Fawad; Kellesarian, Sergio Varela; Abduljabbar, Tariq; Gholamiazizi, Elham; Feng, Changyong; Aldosary, Khaled; Vohra, Fahim; Romanos, Georgios E

    2017-02-01

    A variety of materials are available to treat exposed dental pulp by direct pulp capping. The healing response of the pulp is crucial to form a dentin bridge and seal off the exposed pulp. Studies have used lasers to stimulate the exposed pulp to form tertiary dentin. The aim of the present systematic review and meta-analysis was to evaluate the evidence on the effects of laser irradiation as an adjunctive therapy to stimulate healing after pulp exposure. A systematic literature search was conducted up to April 2016. A structured search using the keywords "Direct pulp capping," "Lasers," "Calcium hydroxide pulp capping," and "Resin pulp capping" was performed. Initially, 34 potentially relevant articles were identified. After removal of duplicates and screening by title, abstract, and full text when necessary, nine studies were included. Studies were assessed for bias and data were synthetized using a random-effects meta-analysis model. Six studies were clinical, and three were preclinical animal trials; the follow-up period ranged from 2 weeks to 54 months. More than two thirds of the included studies showed that laser therapy used as an adjunct for direct pulp capping was more effective in maintaining pulp vitality than conventional therapy alone. Meta-analysis showed that the success rate in the laser treatment group was significantly higher than the control group (log odds ratio = 1.737; 95 % confidence interval, 1.304-2.171). Lasers treatment of exposed pulps can improve the outcome of direct pulp capping procedures; a number of confounding factors may have influenced the outcomes of the included studies.

  10. Immune activity elevates energy expenditure of house sparrows: a link between direct and indirect costs?

    PubMed

    Martin, Lynn B; Scheuerlein, Alex; Wikelski, Martin

    2003-01-22

    The activation of an immune response is beneficial for organisms but may also have costs that affect fitness. Documented immune costs include those associated with acquisition of special nutrients, as well as immunopathology or autoimmunity. Here, we test whether an experimental induction of the immune system with a non-pathological stimulant can elevate energy turnover in passerine birds. We injected phytohaemagglutinin (PHA), a commonly used mitogen that activates the cell-mediated immune response, into the wing web of house sparrows, Passer domesticus. We then examined energetic costs resulting from this immune activity and related those costs to other physiological activities. We found that PHA injection significantly elevated resting metabolic rate (RMR) of challenged sparrows relative to saline controls. We calculated the total cost of this immune activity to be ca. 4.20 kJ per day (29% RMR), which is equivalent to the cost of production of half of an egg (8.23 kJ egg(-1)) in this species. We suggest that immune activity in wild passerines increases energy expenditure, which in turn may influence important life-history characteristics such as clutch size, timing of breeding or the scheduling of moult.

  11. 36 CFR 216.6 - Notice and comment procedures for proposed Manual directives identified for formal public review.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ..., and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE INVOLVING THE PUBLIC IN THE FORMULATION OF FOREST SERVICE DIRECTIVES § 216.6 Notice and comment procedures for proposed Manual directives... complete proposal or a summary of the proposal for review. (c) The responsible Forest Service official may...

  12. 36 CFR 216.6 - Notice and comment procedures for proposed Manual directives identified for formal public review.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ..., and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE INVOLVING THE PUBLIC IN THE FORMULATION OF FOREST SERVICE DIRECTIVES § 216.6 Notice and comment procedures for proposed Manual directives... complete proposal or a summary of the proposal for review. (c) The responsible Forest Service official may...

  13. 36 CFR 216.6 - Notice and comment procedures for proposed Manual directives identified for formal public review.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ..., and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE INVOLVING THE PUBLIC IN THE FORMULATION OF FOREST SERVICE DIRECTIVES § 216.6 Notice and comment procedures for proposed Manual directives... complete proposal or a summary of the proposal for review. (c) The responsible Forest Service official may...

  14. 36 CFR 216.6 - Notice and comment procedures for proposed Manual directives identified for formal public review.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ..., and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE INVOLVING THE PUBLIC IN THE FORMULATION OF FOREST SERVICE DIRECTIVES § 216.6 Notice and comment procedures for proposed Manual directives... complete proposal or a summary of the proposal for review. (c) The responsible Forest Service official may...

  15. Does direct observation of procedural skills reflect trainee's progress in otolaryngology?

    PubMed

    Awad, Z; Hayden, L; Muthuswamy, K; Ziprin, P; Darzi, A; Tolley, N S

    2014-06-01

    UK surgical trainees are required to undertake work-based assessments each year in order to progress in their training. Direct Observation of Procedural Skills (DOPS) is one of these assessments. We aim to investigate the validity of DOPS in assessing otolaryngology trainees at all levels. A retrospective search of the portfolios of all otolaryngology trainees in North Thames was carried out to identify otolaryngology-specific DOPS. A score (Cs) was calculated for each DOPS based on the percentage of satisfactorily-rated items. The overall performance rating (Ps) was analysed as a separate variable and compared with Cs. The Ps and Cs results were then compared across trainee grades and levels within each grade: Core trainees (CT1-CT2) and specialty trainees (ST3-ST8). Seven hundred and sixty-seven otolaryngology DOPS were completed between August 2008 and September 2013. The tool was found to be reliable and internally consistent. Trainees in ST grade had higher Cs and Ps scores than CT grade (P < 0.001). Pairwise comparison showed that both Cs and Ps increased from CT1 to ST3 (P = 0.005) but not from ST4 onwards (P = 0.198). Otolaryngology DOPS is a useful tool in assessing otolaryngology trainees especially from CT1-ST3 level. DOPS can also differentiate between junior and senior trainees. However, it was not able to demonstrate progress at levels above ST3, most likely due to the simplicity of the procedures which trainees tend to master in the first few years of training. © 2014 John Wiley & Sons Ltd.

  16. Engineering self-assembled materials to study and direct immune function.

    PubMed

    Tostanoski, Lisa H; Jewell, Christopher M

    2017-04-06

    The immune system is an awe-inspiring control structure that maintains a delicate and constantly changing balance between pro-immune functions that fight infection and cancer, regulatory or suppressive functions involved in immune tolerance, and homeostatic resting states. These activities are determined by integrating signals in space and time; thus, improving control over the densities, combinations, and durations with which immune signals are delivered is a central goal to better combat infectious disease, cancer, and autoimmunity. Self-assembly presents a unique opportunity to synthesize materials with well-defined compositions and controlled physical arrangement of molecular building blocks. This review highlights strategies exploiting these capabilities to improve the understanding of how precisely-displayed cues interact with immune cells and tissues. We present work centered on fundamental properties that regulate the nature and magnitude of immune response, highlight pre-clinical and clinical applications of self-assembled technologies in vaccines, cancer, and autoimmunity, and describe some of the key manufacturing and regulatory hurdles facing these areas.

  17. Development of a direct isolation procedure for free-living diazotrophs under controlled hypoxic conditions.

    PubMed

    Mirza, Babur S; Rodrigues, Jorge L M

    2012-08-01

    Free-living diazotrophs are diverse and ubiquitous in soil, contributing the nitrogen pool in natural ecosystems. The isolation of nitrogen-fixing microorganisms has relied on semisolid nitrogen-free medium enrichment, followed by multiple subculturing steps. These procedures limit the diversity of recovered isolates. In the current study, we investigated three different isolation strategies for free-living diazotrophs using a soil sample from the Amazon forest. The methods were (i) direct plating on solid nitrogen-free medium under a 2% O(2) concentration, (ii) enrichment in semisolid nitrogen-free medium before plating on solid nitrogen-free medium under 2% O(2), and (iii) enrichment followed by subculturing in the semisolid nitrogen-free medium before plating on nitrogen containing medium under a 21% O(2) concentration. A total of 794 isolates were differentiated by their genomic fingerprinting patterns, and strains with unique profiles were identified on the basis of sequencing of their 16S rRNA gene. Isolates belonged to four bacterial phyla: Proteobacteria, Firmicutes, Actinobacteria, and Bacteriodetes. The novel strategy of combining a solid N-free medium and hypoxic conditions showed an increase of 62.6% in the diversity of diazotrophs in comparison to that obtained by the conventional semisolid medium-based methods. All isolates grew on the nitrogen-free medium under a 2% O(2) concentration, 78% of them showed the presence of the nifH gene, and 39% tested positive for acetylene reduction activity. Our results suggest that direct plating of soil dilutions on nitrogen-free solid medium under a 2% O(2) concentration is a useful strategy for the isolation of the diverse diazotrophic communities.

  18. Effect of Bacillus subtilis-based direct-fed microbials on immune status in broiler chickens raised on fresh or used litter

    USDA-ARS?s Scientific Manuscript database

    The type of dietary direct-fed microbials (DFMs) or poultry litter could directly influence the composition of gut microbiota. Gut microbiota play an important role in shaping the developing immune system and maintaining homeostasis of the mature immune system in mammal and chickens. The present stu...

  19. Mesenchymal stem cells do not exert direct beneficial effects on CNS remyelination in the absence of the peripheral immune system.

    PubMed

    Salinas Tejedor, Laura; Berner, Gabriel; Jacobsen, Kristin; Gudi, Viktoria; Jungwirth, Nicole; Hansmann, Florian; Gingele, Stefan; Prajeeth, Chittappen K; Baumgärtner, Wolfgang; Hoffmann, Andrea; Skripuletz, Thomas; Stangel, Martin

    2015-11-01

    Remyelination is the natural repair mechanism in demyelinating disorders such as multiple sclerosis (MS) and it was proposed that it might protect from axonal loss. For unknown reasons, remyelination is often incomplete or fails in MS lesions and therapeutic treatments to enhance remyelination are not available. Recently, the transplantation of exogenous mesenchymal stem cells (MSC) has emerged as a promising tool to enhance repair processes. This included the animal model experimental autoimmune encephalomyelitis (EAE), a commonly used model for the autoimmune mechanisms of MS. However, in EAE it is not clear if the beneficial effect of MSC derives from a direct influence on brain resident cells or if this is an indirect phenomenon via modulation of the peripheral immune system. The aim of this study was to determine potential regenerative functions of MSC in the toxic cuprizone model of demyelination that allows studying direct effects on de- and remyelination without the influence of the peripheral immune system. MSC from three different species (human, murine, canine) were transplanted either intraventricularly into the cerebrospinal fluid or directly into the lesion of the corpus callosum at two time points: at the onset of oligodendrocyte progenitor cell (OPC) proliferation or the peak of OPC proliferation during cuprizone induced demyelination. Our results show that MSC did not exert any regenerative effects after cuprizone induced demyelination and oligodendrocyte loss. During remyelination, MSC did not influence the dynamics of OPC proliferation and myelin formation. In conclusion, MSC did not exert direct regenerative functions in a mouse model where peripheral immune cells and especially T lymphocytes do not play a role. We thus suggest that the peripheral immune system is required for MSC to exert their effects and this is independent from a direct influence of the central nervous system.

  20. Barley MLA Immune Receptors Directly Interfere with Antagonistically Acting Transcription Factors to Initiate Disease Resistance Signaling[C][W

    PubMed Central

    Chang, Cheng; Yu, Deshui; Jiao, Jian; Jing, Shaojuan; Schulze-Lefert, Paul; Shen, Qian-Hua

    2013-01-01

    The nucleotide binding domain and Leucine-rich repeat (NLR)–containing proteins in plants and animals mediate pathogen sensing inside host cells and mount innate immune responses against microbial pathogens. The barley (Hordeum vulgare) mildew A (MLA) locus encodes coiled-coil (CC)–type NLRs mediating disease resistance against the powdery mildew pathogen Blumeria graminis. Here, we report direct interactions between MLA and two antagonistically acting transcription factors, MYB6 and WRKY1. The N-terminal CC signaling domain of MLA interacts with MYB6 to stimulate its DNA binding activity. MYB6 functions as a positive regulator of basal and MLA-mediated immunity responses to B. graminis. MYB6 DNA binding is antagonized by direct association with WRKY1 repressor, which in turn also interacts with the MLA CC domain. The activated form of full-length MLA10 receptor is needed to release MYB6 activator from WRKY1 repression and to stimulate MYB6-dependent gene expression. This implies that, while sequestered by the WRKY1 repressor in the presence of the resting immune receptor, MYB6 acts as an immediate and positive postactivation signaling component of the active state of MLA during transcriptional reprogramming for innate immune responses. PMID:23532068

  1. Chemical analysis of rutile - a pyrocatechol violet spectrophotometric procedure for the direct microdetermination of zirconium

    USGS Publications Warehouse

    Meyrowitz, Robert

    1973-01-01

    The ZrO2 content of rutile is determined spectrophotometrically by a direct pyrocatechol violet procedure. The sample is decomposed by potassium pyrosulfate fusion in a transparent quartz crucible, and a sulfuric acid solution of the melt is used for the determination at a pH of 5.1. Of the elements commonly present in rutile, only titanium and niobium occur in concentrations large enough to interfere. Titanium and niobium interference is overcome by adding the titanium and niobium contents of the sample to the standard zirconium solutions used for the standard zirconium curve. The absorbance is measured at 570 nm. Beer's law is obeyed within the range of 0.05-1.50 ppm ZrO2. In the presence of 50 ppm TiO2, the range is 0.15-1.50 ppm ZrO2 . The tolerances of 47 elements were determined. The sensitivity is 0.0058 ug Zr/cm2 . The variables in the method were studied, and typical results are given for commercial rutile concentrates.

  2. Direct synthesis of L10 FePt nanoparticles within carbon nanotubes by wet chemical procedure

    NASA Astrophysics Data System (ADS)

    Capobianchi, A.; Laureti, S.; Fiorani, D.; Foglia, S.; Palange, E.

    2010-12-01

    This paper reports on the low temperature synthesis of L10 iron-platinum (FePt) particles within multiwall carbon nanotubes using a novel wet chemical method that allows the filling of the nanotube cavity keeping clean its external wall. In the proposed procedure, nanotubes are filled with a precursor salt of hexaaquairon(II) hexachloroplatinate, ([Fe(H2O)6][PtCl6]) and nanoparticles of the magnetically hard phase are directly obtained by heating at 400 °C in a reductive atmosphere. The advantage of such a precursor, allowing one to obtain at low temperature the L10 phase without passing through the soft fcc phase, is due to its structure, where the Fe and Pt atoms are arranged in alternating planes, as in the fct FePt structure. Morphological, structural and magnetic properties of the filled nanotubes have been investigated by transmission electron microscopy, x-ray diffraction and magnetization measurements. The results show the coexistence of nanoparticles in the superparamagnetic and blocked state, depending on the temperature, due to the particle size distribution.

  3. Immunodominant liver-specific expression suppresses transgene-directed immune responses in murine pompe disease.

    PubMed

    Zhang, Ping; Sun, Baodong; Osada, Takuya; Rodriguiz, Ramona; Yang, Xiao Yi; Luo, Xiaoyan; Kemper, Alex R; Clay, Timothy M; Koeberl, Dwight D

    2012-05-01

    Pompe disease can be treated effectively, if immune tolerance to enzyme replacement therapy (ERT) with acid α-glucosidase (GAA) is present. An adeno-associated viral (AAV) vector carrying a liver-specific regulatory cassette to drive GAA expression (AAV-LSPhGAA) established immune tolerance in GAA knockout (KO) mice, whereas ubiquitous expression with AAV-CBhGAA provoked immune responses. Therefore, we investigated the hypothesis that immune tolerance induced by hepatic-restricted expression was dominant. AAV-LSPhGAA and AAV-CBhGAA were administered singly or in combination to groups of adult GAA-KO mice, and AAV-LSPhGAA induced immune tolerance even in combination with AAV-CBhGAA. The dual vector approach to GAA expression improved biochemical correction of GAA deficiency and glycogen accumulations at 18 weeks, and improved motor function testing including wire-hang and grip-strength testing. The greatest efficacy was demonstrated by dual vector administration, when both vectors were pseudotyped as AAV8. T cells from mice injected with AAV-LSPhGAA failed to proliferate at all after an immune challenge with GAA and adjuvant, whereas mock-treated GAA-KO mice mounted vigorous T cell proliferation. Unlike AAV-LSPhGAA, AAV-CBhGAA induced selective cytokine and chemokine expression in liver and spleen after the immune challenge. AAV-CBhGAA transduced dendritic cells and expressed high-level GAA, whereas AAV-LSPhGAA failed to express GAA in dendritic cells. The level of transduction in liver was much higher after dual AAV8 vector administration at 18 weeks, in comparison with either vector alone. Dual vector administration failed to provoke antibody formation in response to GAA expression with AAV-CBhGAA; however, hepatic-restricted expression from dual vector expression did not prevent antibody formation after a strong immune challenge with GAA and adjuvant. The relevance of immune tolerance to gene therapy in Pompe disease indicates that hepatic expression might best

  4. Immunodominant Liver-Specific Expression Suppresses Transgene-Directed Immune Responses in Murine Pompe Disease

    PubMed Central

    Zhang, Ping; Sun, Baodong; Osada, Takuya; Rodriguiz, Ramona; Yang, Xiao Yi; Luo, Xiaoyan; Kemper, Alex R.; Clay, Timothy M.

    2012-01-01

    Abstract Pompe disease can be treated effectively, if immune tolerance to enzyme replacement therapy (ERT) with acid α-glucosidase (GAA) is present. An adeno-associated viral (AAV) vector carrying a liver-specific regulatory cassette to drive GAA expression (AAV-LSPhGAA) established immune tolerance in GAA knockout (KO) mice, whereas ubiquitous expression with AAV-CBhGAA provoked immune responses. Therefore, we investigated the hypothesis that immune tolerance induced by hepatic-restricted expression was dominant. AAV-LSPhGAA and AAV-CBhGAA were administered singly or in combination to groups of adult GAA-KO mice, and AAV-LSPhGAA induced immune tolerance even in combination with AAV-CBhGAA. The dual vector approach to GAA expression improved biochemical correction of GAA deficiency and glycogen accumulations at 18 weeks, and improved motor function testing including wire-hang and grip-strength testing. The greatest efficacy was demonstrated by dual vector administration, when both vectors were pseudotyped as AAV8. T cells from mice injected with AAV-LSPhGAA failed to proliferate at all after an immune challenge with GAA and adjuvant, whereas mock-treated GAA-KO mice mounted vigorous T cell proliferation. Unlike AAV-LSPhGAA, AAV-CBhGAA induced selective cytokine and chemokine expression in liver and spleen after the immune challenge. AAV-CBhGAA transduced dendritic cells and expressed high-level GAA, whereas AAV-LSPhGAA failed to express GAA in dendritic cells. The level of transduction in liver was much higher after dual AAV8 vector administration at 18 weeks, in comparison with either vector alone. Dual vector administration failed to provoke antibody formation in response to GAA expression with AAV-CBhGAA; however, hepatic-restricted expression from dual vector expression did not prevent antibody formation after a strong immune challenge with GAA and adjuvant. The relevance of immune tolerance to gene therapy in Pompe disease indicates that hepatic expression

  5. Modified procedure of a direct in vitro exposure system for mammalian cells to whole cigarette smoke.

    PubMed

    Fukano, Yasuo; Ogura, Maiko; Eguchi, Kentaro; Shibagaki, Makoto; Suzuki, Mutsuaki

    2004-03-01

    In vitro biological studies on cigarette smoke have usually been made using either cigarette smoke condensate--obtained by trapping the particulate phase of smoke on a filter, or soluble smoke components--obtained by trapping cigarette smoke in buffer solution. However, these approaches may not truly reflect the physical and chemical condition of freshly generated smoke. Clearly it is important to be able to evaluate the biological effects of fresh smoke on mammalian cells for a better understanding of the potential effects of smoking. The CULTEX technology is a new experimental system for cultivation and exposure techniques enhanced the efficiency of in vitro studies, and allows direct exposure of cells intermittently at the air/liquid interface with ultrafine particles, gases, or mixtures of both which fixedly flows. The CULTEX technology has therefore been modified to evaluate the biological effects of whole cigarette smoke in an in vitro system. The exposure system design was based on a combination of the sedimentation procedure and the CULTEX cultivation technique. After freshly generated smoke was delivered onto cells, the flow was shut off and the medium was slowly removed. In this manner, cells were exposed to both the vapor and particulate phase of smoke efficiently. Cells were maintained in the liquid medium except during the exposure period to maintain the culture conditions and to protect the cells from both the influence of puff pressure and the airflow, which served to remove residual cigarette smoke. The medium was changed at every puff of smoke and so effectively eliminating the possibility of any effects caused by accumulation of soluble cigarette smoke components into the medium. This cycle was repeated and cells were exposed to freshly generated cigarette smoke intermittently.

  6. Compendium of ERT surface-water and sediment sampling procedures. Directive

    SciTech Connect

    Not Available

    1991-01-01

    The Standard Operating Procedure (SOP) describes methods used for preventing or reducing cross-contamination, and provides general guidelines for sampling equipment decontamination procedures at a hazardous waste site. Preventing or minimizing cross-contamination in sampled media and in samples is important for preventing the introduction of error into sampling results and for protecting the health and safety of site personnel.

  7. The Use of Direct Instructions to Modify Hypnotic Performance: The Effects of Programmed Learning Procedures

    ERIC Educational Resources Information Center

    Diamond, Michael Jay; And Others

    1975-01-01

    The current study is concerned with developing a procedure designed to maximize subject attention to the written information while minimizing potentially confounding boredom or fatigue factors and second to cross-validate previous studies employing written information to modify performance with an improved experimental procedure. (Author/RK)

  8. Immunity induced by a broad class of inorganic crystalline materials is directly controlled by their chemistry.

    PubMed

    Williams, Gareth R; Fierens, Kaat; Preston, Stephen G; Lunn, Daniel; Rysnik, Oliwia; De Prijck, Sofie; Kool, Mirjam; Buckley, Hannah C; Lambrecht, Bart N; O'Hare, Dermot; Austyn, Jonathan M

    2014-06-02

    There is currently no paradigm in immunology that enables an accurate prediction of how the immune system will respond to any given agent. Here we show that the immunological responses induced by members of a broad class of inorganic crystalline materials are controlled purely by their physicochemical properties in a highly predictable manner. We show that structurally and chemically homogeneous layered double hydroxides (LDHs) can elicit diverse human dendritic cell responses in vitro. Using a systems vaccinology approach, we find that every measured response can be modeled using a subset of just three physical and chemical properties for all compounds tested. This correlation can be reduced to a simple linear equation that enables the immunological responses stimulated by newly synthesized LDHs to be predicted in advance from these three parameters alone. We also show that mouse antigen-specific antibody responses in vivo and human macrophage responses in vitro are controlled by the same properties, suggesting they may control diverse responses at both individual component and global levels of immunity. This study demonstrates that immunity can be determined purely by chemistry and opens the possibility of rational manipulation of immunity for therapeutic purposes.

  9. The impact of different directed forgetting instructions on implicit and explicit memory: new evidence from a modified process dissociation procedure.

    PubMed

    David, Daniel; Brown, Richard J

    2003-02-01

    In contrast to previous research on directed forgetting, the present studies adopted a recent modification of the process dissociation procedure (Jacoby, 1991; Richardson-Klavehn & Gardiner, 1995) to accommodate the cross-contamination of memory test performance by implicit and explicit memorial factors. In Experiment 1, 120 subjects were compared in global directed forgetting, item-by-item directed forgetting, and control conditions on estimates of voluntary conscious memory, involuntary conscious memory, and involuntary unconscious memory performance. In Experiment 2, 80 subjects were compared in specific directed forgetting and control conditions on estimates of voluntary conscious memory, involuntary conscious memory, and involuntary unconscious memory performance. Subjects showed significant decrements in voluntary and involuntary conscious memory performance following instructions for directed forgetting in all conditions. None of the directed forgetting conditions showed a decrement in involuntary unconscious memory performance. Results suggest that, regardless of instruction type, directed forgetting prevents the conscious expression of memorial information (both voluntary and involuntary) while leaving unconscious memory intact.

  10. Types of procedures performed by diagnostic radiology practices: past patterns and future directions.

    PubMed

    Sunshine, Jonathan H; Cypel, Yasmin S

    2004-11-01

    The purpose of our study was to determine the types of imaging procedures performed by diagnostic radiology practices and the patterns and differences related to practice characteristics. The American College of Radiology (ACR) surveyed 970 practices by mail, using a 65-item questionnaire, in 1999. A response rate of 66% was achieved. Weighting was used to make responses representative of all radiology practices in the United States. Trends were explored by making comparisons with data from a 1991-1992 ACR study. Among the types of procedures studied, the highest percentage of multiradiologist diagnostic-radiology-only practices performed mammography (95%) and sonography (94%). (General conventional radiography and fluoroscopy were not studied.) The lowest percentage of these practices performed interventional procedures (69%) and MRI (77%). Solo practices showed less diversity in types of procedures performed than did multiradiologist practices and were a good deal less likely to perform each type of procedure except mammography and sonography. Generally, higher percentages of practices in nonmetropolitan cities or towns and rural practices performed various types of procedures than practices in metropolitan areas. Practice size, types of settings served (hospital or nonhospital), and practice type also influenced the number of types of procedures performed by a practice. The fraction of practices performing CT decreased from 91% to 83% between 1991-1992 and 1999. Percentages for other types of procedures were generally stable over time. Certain practice characteristics play a role in determining the types of imaging procedures a diagnostic radiology practice performs. The decline in the percentage of practices providing CT and the failure during the 1990s of percentages for MRI and interventional radiology to increase from a relatively low base is worrisome. Future analyses based on a subsequent ACR survey will provide further insights into trends.

  11. Use of digital ciné-fluoroscopy and catheter-directed techniques to improve and simplify standard vascular procedures.

    PubMed

    Wain, R A; Veith, F J

    1999-06-01

    Digital ciné-fluoroscopy and catheter-directed treatments have become indispensable tools in the armamentarium of surgeons performing vascular procedures. These new technologies not only improve and simplify the performance of standard vascular operations but also allow surgeons to perform a wide range of interventions previously unavailable in the operating room.

  12. 20 CFR 667.600 - What local area, State and direct recipient grievance procedures must be established?

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 20 Employees' Benefits 3 2011-04-01 2011-04-01 false What local area, State and direct recipient grievance procedures must be established? 667.600 Section 667.600 Employees' Benefits EMPLOYMENT AND... affected participants and other individuals, including youth and those who are limited-English...

  13. Direct measurement of patient's entrance skin dose during neurointerventional procedure to avoid further radiation-induced skin injuries.

    PubMed

    Hayakawa, Mikito; Moritake, Takashi; Kataoka, Fumikatsu; Takigawa, Tomoji; Koguchi, Yasuhiro; Miyamoto, Yuka; Akahane, Keiichi; Matsumaru, Yuji

    2010-07-01

    Although several cases of radiation-induced skin injury (RSI) have been reported in association with neurointerventional procedures such as endovascular embolization for cerebral aneurysm, cerebral arteriovenous malformation, and dural arteriovenous fistula, in most cases the absorbed doses are not measured directly; therefore, we built the first direct measurement system that enables the ideal dosimetry for entrance skin dose (ESD) during neurointerventional procedures to be easily determined. This system was then applied to a 55-year-old man who underwent two transvenous embolizations with a 2-month interval, for a right cavernous sinus dural arteriovenous fistula, to establish the efficacy of precise mapping of ESDs. Throughout the procedures, the patient wore a fitted dosimetry cap that contained 60 radiophotoluminescence glass dosimeter (RPLGD) chips. After the first procedure, temporary epilation occurred in the occipital region. Precise mapping of ESDs revealed that this region was exposed to 4.2Gy. In the first procedure, the X-ray tube was generally positioned straight for an optimal posterior-anterior view; however, in the second procedure we intermittently used the second-best position to prevent further RSI. In this position, the maximum ESD was 1.0Gy in the right posterior-temporal region and the epilation site was exposed to direct dosimetry using multiple RPLGDs can accurately reveal the maximum ESD and that precise information regarding ESD can prevent further RSIs from subsequent procedures. Copyright 2010 Elsevier B.V. All rights reserved.

  14. Direct and immune-mediated cytotoxicity of interleukin-21 contributes to antitumor effects in mantle cell lymphoma.

    PubMed

    Bhatt, Shruti; Matthews, Julie; Parvin, Salma; Sarosiek, Kristopher A; Zhao, Dekuang; Jiang, Xiaoyu; Isik, Elif; Letai, Anthony; Lossos, Izidore S

    2015-09-24

    Mantle cell lymphoma (MCL) is a distinct subtype of non-Hodgkin lymphoma characterized by overexpression of cyclin D1 in 95% of patients. MCL patients experience frequent relapses resulting in median survival of 3 to 5 years, requiring more efficient therapeutic regimens. Interleukin (IL)-21, a member of the IL-2 cytokine family, possesses potent antitumor activity against a variety of cancers not expressing the IL-21 receptor (IL-21R) through immune activation. Previously, we established that IL-21 exerts direct cytotoxicity on IL-21R-expressing diffuse large B-cell lymphoma cells. Herein, we demonstrate that IL-21 possesses potent cytotoxicity against MCL cell lines and primary tumors. We identify that IL-21-induced direct cytotoxicity is mediated through signal transducer and activator of transcription 3-dependent cMyc upregulation, resulting in activation of Bax and inhibition of Bcl-2 and Bcl-XL. IL-21-mediated cMyc upregulation is only observed in IL-21-sensitive cells. Further, we demonstrate that IL-21 leads to natural killer (NK)-cell-dependent lysis of MCL cell lines that were resistant to direct cytotoxicity. In vivo treatment with IL-21 results in complete FC-muMCL1 tumor regression in syngeneic mice via NK- and T-cell-dependent mechanisms. Together, these data indicate that IL-21 has potent antitumor activity against MCL cells via direct cytotoxic and indirect, immune-mediated effects. © 2015 by The American Society of Hematology.

  15. Human immune response directed against Plasmodium falciparum heat shock-related proteins.

    PubMed Central

    Kumar, N; Zhao, Y; Graves, P; Perez Folgar, J; Maloy, L; Zheng, H

    1990-01-01

    Heat shock-related stress proteins present in all eucaryotes and procaryotes have been shown to be immune targets in a broad range of infections. We have analyzed sera from people exposed primarily to Plasmodium falciparum for specific antibodies against two heat shock-related proteins (proteins similar to the heat shock protein with a molecular weight of 75,000 [Pfhsp] and a glucose-regulated protein with a molecular weight of 72,000 [Pfgrp]). In an immunoprecipitation analysis with metabolically labeled parasites and synthetic peptides in an enzyme-linked immunosorbent assay, specific antibodies against Pfhsp and Pfgrp were detected in the sera of these individuals. Sera from people exposed to a different human malarial parasite, Plasmodium vivax, did not react with the peptides in an enzyme-linked immunosorbent assay. Southern blot analysis with DNA isolated from P. falciparum from different geographical locations showed a conservation of genes for these stress proteins; thus, they are likely to be immune targets in various endemic areas. Lymphocytes from two tested immune donors responded in proliferation assays to purified Pfhsp and Pfgrp and purified recombinant proteins. However, a similar response was also seen in lymphocytes from nonimmune individuals and has raised questions pertaining to a generalized responsiveness of lymphocytes to some common determinants present in heat shock-related proteins in various pathogens. Images PMID:1691147

  16. Reliability of the nanopheres-DNA immunization technology to produce polyclonal antibodies directed against human neogenic proteins.

    PubMed

    Arnaoty, Ahmed; Gouilleux-Gruart, Valérie; Casteret, Sophie; Pitard, Bruno; Bigot, Yves; Lecomte, Thierry

    2013-08-01

    The molecular domestication of several DNA transposons that occurred during the evolution of the mammalian lineage, has led to the emergence of at least 43 genes, known as neogenes. To date, the limited availability of efficient commercial antibodies directed against most of their protein isoforms hampers investigation of their expression in vitro and in situ. Since immunization protocols using peptides or recombinant proteins have revealed that it is difficult to recover antibodies, we planned to produce antisera in mice using a new technique of nanopheres/DNA immunization, the ICANtibodies™ technology. Here, we investigate the possibilities of obtaining polyclonal antibodies for 24 proteins or protein domains using this immunization strategy. We successfully obtained 13 antisera that were able to detect neogenic proteins by Western blotting and ELISA in protein extracts of transiently-transfected cells and various cancer cell lines, plus another two that only detected the in ELISA and in in situ hybridizations. The features required for the production of these antibodies are analyzed and discussed, and examples are given of the advantages they offer for the study of neogenic proteins.

  17. Enveloped Viruses Disable Innate Immune Responses in Dendritic Cells by Direct Activation of TAM Receptors

    PubMed Central

    Bhattacharyya, Suchita; Zagórska, Anna; Lew, Erin D.; Shrestha, Bimmi; Rothlin, Carla V.; Naughton, John; Diamond, Michael S.; Lemke, Greg; Young, John A.T.

    2013-01-01

    SUMMARY Upon activation by the ligands Gas6 and Protein S, TAM receptor tyrosine kinases promote phagocytic clearance of apoptotic cells and downregulate immune responses initiated by Toll-like receptors and type I interferons (IFNs). Many enveloped viruses display the phospholipid phosphatidylserine on their membranes, through which they bind Gas6 and Protein S and engage TAM receptors. We find that ligand-coated viruses activate TAM receptors on dendritic cells (DCs), dampen type I IFN signaling, and thereby evade host immunity and promote infection. Upon virus challenge, TAM-deficient DCs display type I IFN responses that are elevated in comparison to wild-type cells. As a consequence, TAM-deficient DCs are relatively resistant to infection by flaviviruses and pseudotyped retroviruses, but infection can be restored with neutralizing type I IFN antibodies. Correspondingly, a TAM kinase inhibitor antagonizes the infection of wild-type DCs. Thus, TAM receptors are engaged by viruses in order to attenuate type I IFN signaling and represent potential therapeutic targets. PMID:23954153

  18. Immune therapy in autism: historical experience and future directions with immunomodulatory therapy.

    PubMed

    Chez, Michael G; Guido-Estrada, Natalie

    2010-07-01

    Autism affects 1 in 110 new births, and it has no single etiology with uniform agreement. This has a significant impact on the quality of life for individuals who have been diagnosed with autism. Although autism has a spectrum quality with a shared diagnosis, it presents a uniquely different clinical appearance in each individual. Recent research of suspected immunological factors have provided more support for a probable immunological process or for processes that may play a role in the acquisition of an autistic condition. These factors include prenatal, genetic, and postnatal findings, as well as the discovery of a dysfunctional chronic pro-inflammatory state in brain tissue and cerebrospinal fluid in subsets of autistic patients. These findings offer new theories that may lead to the development of disease modification or preventative therapeutic options in the near future. This article reviews prenatal, genetic, and observed immune aspects of the autism condition that may be risk factors in the presentation of the autistic clinical phenotype. Historical immune interventions in autism are reviewed and potential new therapies and interventions are discussed. (c) 2010 The American Society for Experimental NeuroTherapeutics, Inc. Published by Elsevier Inc. All rights reserved.

  19. Verifying the Efficacy of Vocational Guidance Programs: Procedures, Problems, and Potential Directions

    ERIC Educational Resources Information Center

    Perry, Justin C.; Dauwalder, Jean Pierre; Bonnett, Heather R.

    2009-01-01

    This article summarizes 12 presentations in Group 7 of the 2007 joint symposium of the International Association for Educational and Vocational Guidance, Society for Vocational Psychology, and National Career Development Association held in Padua, Italy, that focused on procedures for verifying the efficacy of vocational guidance programs. Three…

  20. Directive Management Procedures, Staffing Patterns in Education for Emotionally Disturbed Students.

    ERIC Educational Resources Information Center

    DeYoung, Michael

    A systematic procedure is outlined which gives guidance to therapists and teachers in managing seriously emotionally disturbed (SED) students (9 to 18 years old) who reside at a licensed children's institution or are attending a centralized public school facility for SED students. Among findings from a review of the literature was that intensive…

  1. Predominant role for directly transfected dendritic cells in antigen presentation to CD8+ T cells after gene gun immunization.

    PubMed

    Porgador, A; Irvine, K R; Iwasaki, A; Barber, B H; Restifo, N P; Germain, R N

    1998-09-21

    Cutaneous gene (DNA) bombardment results in substantial expression of the encoded antigen in the epidermal layer as well as detectable expression in dendritic cells (DC) in draining lymph nodes (LNs). Under these conditions, two possible modes of DC antigen presentation to naive CD8+ T cells might exist: (a) presentation directly by gene-transfected DC trafficking to local lymph nodes, and (b) cross-presentation by untransfected DC of antigen released from or associated with transfected epidermal cells. The relative contributions of these distinct modes of antigen presentation to priming for cytotoxic T cell (CTL) responses have not been clearly established. Here we show that LN cells directly expressing the DNA-encoded antigen are rare; 24 h after five abdominal skin bombardments, the number of these cells does not exceed 50-100 cells in an individual draining LN. However, over this same time period, the total number of CD11c+ DC increases more than twofold, by an average of 20,000-30,000 DC per major draining node. This augmentation is due to gold bombardment and is independent of the presence of plasmid DNA. Most antigen-bearing cells in the LNs draining the site of DNA delivery appear to be DC and can be depleted by antibodies to an intact surface protein encoded by cotransfected DNA. This finding of predominant antigen presentation by directly transfected cells is also consistent with data from studies on cotransfection with antigen and CD86-encoding DNA, showing that priming of anti-mutant influenza nucleoprotein CTLs with a single immunization is dependent upon coexpression of the DNAs encoding nucleoprotein and B7.2 in the same cells. These observations provide insight into the relative roles of direct gene expression and cross-presentation in CD8+ T cell priming using gene gun immunization, and indicate that augmentation of direct DC gene expression may enhance such priming.

  2. Validation and scopolamine-reversal of latent learning in the water maze utilizing a revised direct platform placement procedure.

    PubMed

    Malin, David H; Schaar, Krystal L; Izygon, Jonathan J; Nghiem, Duyen M; Jabitta, Sikirat Y; Henceroth, Mallori M; Chang, Yu-Hsuan; Daggett, Jenny M; Ward, Christopher P

    2015-08-01

    The Morris water maze is routinely used to explore neurobiological mechanisms of working memory. Humans can often acquire working memory relevant to performing a task by mere sensory observation, without having to actually perform the task followed by reinforcement. This can be modeled in the water maze through direct placement of a rat on the escape platform so that it can observe the location, and then assessing the subject's performance in swimming back to the platform. However, direct placement procedures have hardly been studied for two decades, reflecting a controversy about whether direct placement resulted in sufficiently rapid and direct swims back to the platform. In the present study, utilizing revised training methods, a more comprehensive measure of trajectory directness, a more rigorous sham-trained control procedure and an optimal placement-test interval, rats swam almost directly back to the platform in under 4s, significantly more quickly and directly than sham-trained subjects. Muscarinic cholinergic mechanisms, which are inactivated by scopolamine, are essential to memory for standard learning paradigms in the water maze. This experiment determined whether this would also be true for latent learning. ANOVA revealed significant negative effects of scopolamine on both speed and accuracy of trajectory, as well as significant positive effects of direct placement training vs. sham-training. In a probe trial, placement-trained animals without scopolamine spent significantly more time and path length in the target quadrant than trained rats with scopolamine and sham-trained rats without scopolamine. Scopolamine impairments are likely due to effects on memory, since the same dose had little effect on performance with a visible platform. The revised direct placement model offers a means of further comparing the neural mechanisms of latent learning with those of standard instrumental learning.

  3. Centriole polarisation to the immunological synapse directs secretion from cytolytic cells of both the innate and adaptive immune systems

    PubMed Central

    2011-01-01

    Background Cytolytic cells of the immune system destroy pathogen-infected cells by polarised exocytosis of secretory lysosomes containing the pore-forming protein perforin. Precise delivery of this lethal hit is essential to ensuring that only the target cell is destroyed. In cytotoxic T lymphocytes (CTLs), this is accomplished by an unusual movement of the centrosome to contact the plasma membrane at the centre of the immunological synapse formed between killer and target cells. Secretory lysosomes are directed towards the centrosome along microtubules and delivered precisely to the point of target cell recognition within the immunological synapse, identified by the centrosome. We asked whether this mechanism of directing secretory lysosome release is unique to CTL or whether natural killer (NK) and invariant NKT (iNKT) cytolytic cells of the innate immune system use a similar mechanism to focus perforin-bearing lysosome release. Results NK cells were conjugated with B-cell targets lacking major histocompatibility complex class I 721.221 cells, and iNKT cells were conjugated with glycolipid-pulsed CD1-bearing targets, then prepared for thin-section electron microscopy. High-resolution electron micrographs of the immunological synapse formed between NK and iNKT cytolytic cells with their targets revealed that in both NK and iNKT cells, the centrioles could be found associated (or 'docked') with the plasma membrane within the immunological synapse. Secretory clefts were visible within the synapses formed by both NK and iNKT cells, and secretory lysosomes were polarised along microtubules leading towards the docked centrosome. The Golgi apparatus and recycling endosomes were also polarised towards the centrosome at the plasma membrane within the synapse. Conclusions These results reveal that, like CTLs of the adaptive immune system, the centrosomes of NK and iNKT cells (cytolytic cells of the innate immune system) direct secretory lysosomes to the immunological

  4. Postoperative Depression of Tumour-directed Cell-mediated Immunity in Patients with Malignant Disease

    PubMed Central

    Cochran, A. J.; Spilg, W. G. S.; Mackie, Rona M.; Thomas, Catherine E.

    1972-01-01

    Leucocytes from 46 melanoma patients, 45 breast carcinoma patients, and 95 control donors were tested by the leucocyte migration test against the supernatants of homogenates of malignant melanomas, breast carcinomas, simple breast tumours, and breasts showing simple cystic disease. By comparison with controls inhibition of migration occurred significantly more frequently when tumour patients' leucocytes were exposed to extracts of histogenetically similar tumours. Cell-mediated immunity to tumour-associated antigens was measured in 12 patients with breast carcinoma and 12 with malignant melanoma immediately before surgical operation and in the postoperative period. All patients tested before operation showed significant inhibition of migration on contact with extracts of histogenetically similar tumours. Postoperatively the degree of leucocyte migration inhibition was reduced in all patients with melanoma and breast carcinoma. Significant inhibition of leucocyte migration returned in most patients 6-22 days after operation. PMID:5077468

  5. Immune evasion by pathogenic Leptospira strains: the secretion of proteases that directly cleave complement proteins.

    PubMed

    Fraga, Tatiana Rodrigues; Courrol, Daniella Dos Santos; Castiblanco-Valencia, Mónica Marcela; Hirata, Izaura Yoshico; Vasconcellos, Sílvio Arruda; Juliano, Luiz; Barbosa, Angela Silva; Isaac, Lourdes

    2014-03-01

    Leptospirosis is an infectious disease of public health importance. To successfully colonize the host, pathogens have evolved multiple strategies to escape the complement system. Here we demonstrate that the culture supernatant of pathogenic but not saprophytic Leptospira inhibit the three complement pathways. We showed that the proteolytic activity in the supernatants of pathogenic strains targets the central complement molecule C3 and specific proteins from each pathway, such as factor B, C2, and C4b. The proteases cleaved α and β chains of C3 and work in synergy with host regulators to inactivate C3b. Proteolytic activity was inhibited by 1,10-phenanthroline, suggesting the participation of metalloproteases. A recombinant leptospiral metalloprotease from the thermolysin family cleaved C3 in serum and could be one of the proteases responsible for the supernatant activity. We conclude that pathogenic leptospiral proteases can deactivate immune effector molecules and represent potential targets to the development of new therapies in leptospirosis.

  6. Aire enforces immune tolerance by directing autoreactive T cells into the regulatory T cell lineage

    PubMed Central

    Malchow, Sven; Leventhal, Daniel S.; Lee, Victoria; Nishi, Saki; Socci, Nicholas D.; Savage, Peter A.

    2016-01-01

    SUMMARY The promiscuous expression of tissue-restricted antigens in the thymus, driven in part by Autoimmune Regulator (Aire), is critical for the protection of peripheral tissues from autoimmune attack. Aire-dependent processes are thought to promote both clonal deletion and the development of Foxp3+ regulatory T (Treg) cells, suggesting that autoimmunity associated with Aire deficiency results from two failed tolerance mechanisms. Here, examination of autoimmune lesions in Aire−/− mice revealed an unexpected third possibility. We found that the predominant conventional T cell clonotypes infiltrating target lesions express antigen receptors that were preferentially expressed by Foxp3+ Treg cells in Aire+/+ mice. Thus, Aire enforces immune tolerance by ensuring that distinct autoreactive T cell specificities differentiate into the Treg cell lineage; dysregulation of this process results in the diversion of Treg cell-biased clonotypes into pathogenic conventional T cells. PMID:27130899

  7. Aire Enforces Immune Tolerance by Directing Autoreactive T Cells into the Regulatory T Cell Lineage.

    PubMed

    Malchow, Sven; Leventhal, Daniel S; Lee, Victoria; Nishi, Saki; Socci, Nicholas D; Savage, Peter A

    2016-05-17

    The promiscuous expression of tissue-restricted antigens in the thymus, driven in part by autoimmune regulator (Aire), is critical for the protection of peripheral tissues from autoimmune attack. Aire-dependent processes are thought to promote both clonal deletion and the development of Foxp3(+) regulatory T (Treg) cells, suggesting that autoimmunity associated with Aire deficiency results from two failed tolerance mechanisms. Here, examination of autoimmune lesions in Aire(-/-) mice revealed an unexpected third possibility. We found that the predominant conventional T cell clonotypes infiltrating target lesions express antigen receptors that were preferentially expressed by Foxp3(+) Treg cells in Aire(+/+) mice. Thus, Aire enforces immune tolerance by ensuring that distinct autoreactive T cell specificities differentiate into the Treg cell lineage; dysregulation of this process results in the diversion of Treg cell-biased clonotypes into pathogenic conventional T cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Combinations of common chronic paediatric diseases deviate the immune response in diverging directions

    PubMed Central

    Nilsson, L; Kivling, A; Jalmelid, M; Magnusson, K Fälth; Faresjö, M

    2006-01-01

    The cytokine pattern of T lymphocytes has not been characterized in children with combinations of paediatric immunological disorders. We describe cytokine secretion in children with type 1 diabetes, coeliac disease and allergy and combinations of two of these diseases after stimulation with ‘disease-specific’ antigens. Peripheral blood mononuclear cells (PBMC) were collected from 68 children with type 1 diabetes, allergy or coeliac disease, two of these diseases in combination or none of these diseases. Using the enzyme-linked immunospot (ELISPOT) technique, interferon (IFN)-γ and interleukin (IL)-4 were analysed from fresh PBMC spontaneously and after in vitro stimulation with antigens associated with one or more of these diseases (insulin, gluten, birch and cat extract, β-lactoglobulin, ovalbumin and phytohaemagglutinin) in order to divide T helper (Th)1- from Th2-like lymphocytes. Stimulation with birch and cat extract caused increased IL-4 secretion in allergic children. A low IFN-γ response to insulin was found in type 1 diabetic children, whereas allergic children responded to insulin by increased IL-4 secretion. Children suffering from both type 1 diabetes (Th1-prone) and allergy (Th2-prone) reacted distinctly to general mitogen stimulation. Children suffering from two Th1-dominated diseases (type 1 diabetes and coeliac disease) showed hardly any response to either food or inhalation allergens. Our results indicate an important interplay between common immunological diseases in children. The combination of two Th1-deviated diseases is associated with a suppressed immune response, whereas a combination of Th1- and Th2-dominated diseases appears to increase the general immune response. PMID:17100762

  9. Mechanism of induction and suppression of antiviral immunity directed by virus-derived small RNAs in Drosophila.

    PubMed

    Aliyari, Roghiyh; Wu, Qingfa; Li, Hong-Wei; Wang, Xiao-Hong; Li, Feng; Green, Lance D; Han, Cliff S; Li, Wan-Xiang; Ding, Shou-Wei

    2008-10-16

    The small RNA-directed viral immunity pathway in plants and invertebrates begins with the production by Dicer nuclease of virus-derived siRNAs (viRNAs), which guide specific antiviral silencing by Argonaute protein in an RNA-induced silencing complex (RISC). Molecular identity of the viral RNA precursor of viRNAs remains a matter of debate. Using Flock house virus (FHV) infection of Drosophila as a model, we show that replication of FHV positive-strand RNA genome produces an approximately 400 bp dsRNA from its 5' terminus that serves as the major Dicer-2 substrate. ViRNAs thus generated are loaded in Argonaute-2 and methylated at their 3' ends. Notably, FHV-encoded RNAi suppressor B2 protein interacts with both viral dsRNA and RNA replicase and inhibits production of the 5'-terminal viRNAs. Our findings, therefore, provide a model in which small RNA-directed viral immunity is induced during the initiation of viral progeny (+)RNA synthesis and suppressed by B2 inside the viral RNA replication complex.

  10. Direct regulation of the NADPH oxidase RBOHD by the PRR-associated kinase BIK1 during plant immunity.

    PubMed

    Kadota, Yasuhiro; Sklenar, Jan; Derbyshire, Paul; Stransfeld, Lena; Asai, Shuta; Ntoukakis, Vardis; Jones, Jonathan Dg; Shirasu, Ken; Menke, Frank; Jones, Alexandra; Zipfel, Cyril

    2014-04-10

    The rapid production of reactive oxygen species (ROS) burst is a conserved signaling output in immunity across kingdoms. In plants, perception of pathogen-associated molecular patterns (PAMPs) by surface-localized pattern recognition receptors (PRRs) activates the NADPH oxidase RBOHD by hitherto unknown mechanisms. Here, we show that RBOHD exists in complex with the receptor kinases EFR and FLS2, which are the PRRs for bacterial EF-Tu and flagellin, respectively. The plasma-membrane-associated kinase BIK1, which is a direct substrate of the PRR complex, directly interacts with and phosphorylates RBOHD upon PAMP perception. BIK1 phosphorylates different residues than calcium-dependent protein kinases, and both PAMP-induced BIK1 activation and BIK1-mediated phosphorylation of RBOHD are calcium independent. Importantly, phosphorylation of these residues is critical for the PAMP-induced ROS burst and antibacterial immunity. Our study reveals a rapid regulatory mechanism of a plant RBOH, which occurs in parallel with and is essential for its paradigmatic calcium-based regulation.

  11. Heat shock protein vaccination and directed IL-2 therapy amplify tumor immunity rapidly following bone marrow transplantation in mice

    PubMed Central

    Newman, Robert G.; Dee, Michael J.; Malek, Thomas R.; Podack, Eckhard R.; Levy, Robert B.

    2014-01-01

    Tumor relapse is the primary cause of mortality in patients with hematologic cancers following autologous hematopoietic stem cell transplantation (HSCT). Vaccination early after HSCT can exploit both the state of lymphopenia and minimal residual disease for generating antitumor immunity. Here, multiple vaccinations using lymphoma cells engineered to secrete heat shock protein fusion gp96-Ig within 2 weeks of T cell-replete syngeneic HSCT led to cross-presentation and increased survival of lymphoma-bearing mice. To enhance vaccine efficacy, interleukin (IL)-2 was directed to predominantly memory phenotype CD8+ T lymphocytes and natural killer (NK) cells via administration bound to anti-IL-2 monoclonal antibody clone S4B6 (IL-2S4B6). Combination therapy with gp96-Ig vaccination and coordinated infusions of IL-2S4B6 resulted in marked prolongation of survival, which directly correlated with ∼500% increase in effector CD8+ T-cell numbers. Notably, this dual regimen elicited large increases in both donor CD8+ T and NK cells, but not CD4+ T lymphocytes; the former 2 populations are essential for both vaccine efficacy and protection against opportunistic infections after HSCT. Indeed, IL-2S4B6-treated HSCT recipients infected with Listeria monocytogenes exhibited decreased bacterial levels. These preclinical studies validate a new strategy particularly well suited to the post-HSCT environment, which may augment adaptive and innate immune function in patients with malignant disease receiving autologous HSCT. PMID:24687086

  12. Four-year Follow-up of a Direct Anatomical Fiber Post and Esthetic Procedures: A Case Report.

    PubMed

    Cardenas, Afm; Siqueira, Fsf; Davila-Sanchez, A; Gomes, G M; Reis, A; Gomes, J C

    2016-01-01

    Knowledge about the stability of fiber posts cemented in widened canal spaces over time is scarce in the literature. Thus, the purpose of this case report was to evaluate the performance of a direct anatomical post in a widened canal space over the course of four years. The present clinical case describes the rehabilitation of a widened canal space using a direct anatomical post (a resin composite combined with a prefabricated glass fiber post) associated with an all-ceramic crown and other restorative procedures. This technique is easy to perform and may solve some of the problems associated with the cementation of a poorly adapted fiber post in a widened canal space.

  13. AIDS: Acquired Immune Deficiency Syndrome; Information and Procedural Guidelines for Providing Services to Persons with AIDS/HIV. Revised.

    ERIC Educational Resources Information Center

    Montana State Dept. of Health and Environmental Sciences, Helena. Health Education Bureau.

    This volume consists of updated information to be inserted into a Montana AIDS Project manual on providing services to persons with acquired immune deficiency syndrome/human immunodeficiency virus (AIDS/HIV), originally published in December 1985. The updates are mainly statistics and terminology, along with the addition of several new sections.…

  14. AIDS: Acquired Immune Deficiency Syndrome, Information and Procedural Guidelines for Providing Services to Persons with AIDS/HTLV-III.

    ERIC Educational Resources Information Center

    Montana State Dept. of Health and Environmental Sciences, Helena.

    This manual presents information about the disease, Acquired Immune Deficiency Syndrome (AIDS), and guidelines for service delivery to Montana residents who have been diagnosed with AIDS or related disorders. The first section describes the disease's causes, symptoms, and transmission; risk factors; high-risk populations; prevention suggestions;…

  15. AIDS: Acquired Immune Deficiency Syndrome, Information and Procedural Guidelines for Providing Services to Persons with AIDS/HTLV-III.

    ERIC Educational Resources Information Center

    Montana State Dept. of Health and Environmental Sciences, Helena.

    This manual presents information about the disease, Acquired Immune Deficiency Syndrome (AIDS), and guidelines for service delivery to Montana residents who have been diagnosed with AIDS or related disorders. The first section describes the disease's causes, symptoms, and transmission; risk factors; high-risk populations; prevention suggestions;…

  16. AIDS: Acquired Immune Deficiency Syndrome; Information and Procedural Guidelines for Providing Services to Persons with AIDS/HIV. Revised.

    ERIC Educational Resources Information Center

    Montana State Dept. of Health and Environmental Sciences, Helena. Health Education Bureau.

    This volume consists of updated information to be inserted into a Montana AIDS Project manual on providing services to persons with acquired immune deficiency syndrome/human immunodeficiency virus (AIDS/HIV), originally published in December 1985. The updates are mainly statistics and terminology, along with the addition of several new sections.…

  17. Three-dimensional viscous-flow computations using a directionally hybrid implicit-explicit procedure

    NASA Technical Reports Server (NTRS)

    Rizk, Y. M.; Chaussee, D. S.

    1983-01-01

    A new, directionally dependent, hybrid numerical algorithm for solving the unsteady, three-dimensional Navier-Stokes equations has been developed and used to compute the viscous supersonic flow over complex configurations, which may generate local regions of embedded subsonic or streamwise separated flows or both. The new hybrid implicit-explicit algorithm is derived from the more general implicit Beam-Warming algorithm and is particularly suitable for viscous computations in which the grid spacing in the direction outward from the body is considerably smaller than the spacing in the other two directions. Numerical results obtained from both the hybrid and implicit schemes are presented and compared on the basis of numerical stability, convergence history, and computer and core memory requirements.

  18. The current status and future directions of myxoma virus, a master in immune evasion.

    PubMed

    Spiesschaert, Bart; McFadden, Grant; Hermans, Katleen; Nauwynck, Hans; Van de Walle, Gerlinde R

    2011-06-09

    Myxoma virus (MYXV) gained importance throughout the twentieth century because of the use of the highly virulent Standard Laboratory Strain (SLS) by the Australian government in the attempt to control the feral Australian population of Oryctolagus cuniculus (European rabbit) and the subsequent illegal release of MYXV in Europe. In the European rabbit, MYXV causes a disease with an exceedingly high mortality rate, named myxomatosis, which is passively transmitted by biting arthropod vectors. MYXV still has a great impact on European rabbit populations around the world. In contrast, only a single cutaneous lesion, restricted to the point of inoculation, is seen in its natural long-term host, the South-American Sylvilagus brasiliensis and the North-American S. Bachmani. Apart from being detrimental for European rabbits, however, MYXV has also become of interest in human medicine in the last two decades for two reasons. Firstly, due to the strong immune suppressing effects of certain MYXV proteins, several secreted virus-encoded immunomodulators (e.g. Serp-1) are being developed to treat systemic inflammatory syndromes such as cardiovascular disease in humans. Secondly, due to the inherent ability of MYXV to infect a broad spectrum of human cancer cells, the live virus is also being developed as an oncolytic virotherapeutic to treat human cancer. In this review, an update will be given on the current status of MYXV in rabbits as well as its potential in human medicine in the twenty-first century.

  19. Immune modulation by Bacillus subtilus-based direct-fed microbials in commercial broiler chickens

    USDA-ARS?s Scientific Manuscript database

    Direct-fed microbials (DFMs), also known as probiotics, have been successfully used to improve the balance of gut microbiota. Spores of Bacillus subtilis, have been used as DFMs for food animals and humans and our previous studies showed that dietary supplementation of broiler chickens with a B. su...

  20. Reducing Direct-Care Staff Absenteeism: Effects of a Combined Reinforcement and Punishment Procedure.

    ERIC Educational Resources Information Center

    Briggs, Renee M.

    1990-01-01

    Absenteeism of 130 direct-care staff in a residential facility for developmentally disabled persons was reduced by 27 percent through positive reinforcement for reliable attendance and punishment (progressive discipline) for attendance abuse. Reduced absenteeism was maintained for 12 months and overtime was reduced, but staff turnover increased.…

  1. Individually Guided Motivation: Goal-Setting Procedures to Develop Student Self-Direction and Prosocial Behaviors.

    ERIC Educational Resources Information Center

    Klausmeier, Herbert J.; And Others

    This paper describes research and development activities dealing with a system of individually guided motivation at a Wisconsin elementary school. Four general objectives for the project are stated. These deal with motivation for learning subject matter knowledge and skills, developing independence, assuming increasing self direction, and…

  2. Immune deficiency augments the prevalence of p53 loss of heterozygosity in spontaneous tumors but not bi-directional loss of heterozygosity in bone marrow progenitors.

    PubMed

    Shetzer, Yoav; Napchan, Yael; Kaufman, Tom; Molchadsky, Alina; Tal, Perry; Goldfinger, Naomi; Rotter, Varda

    2017-03-15

    p53 loss of heterozygosity (LOH) is a frequent event in tumors of somatic and Li-Fraumeni syndrome patients harboring p53 mutation. Here, we focused on resolving a possible crosstalk between the immune-system and p53 LOH. Previously, we reported that p53 heterozygous bone-marrow mesenchymal progenitor cells undergo p53 LOH in-vivo. Surprisingly, the loss of either the wild-type p53 allele or mutant p53 allele was detected with a three-to-one ratio in favor of losing the mutant allele. In this study, we examined whether the immune-system can affect the LOH directionality in bone marrow progenitors. We found that mesenchymal progenitor cells derived from immune-deficient mice exhibited the same preference of losing the mutant p53 allele as immune-competent matched cells, nevertheless, these animals showed a significantly shorter tumor-free survival, indicating the possible involvement of immune surveillance in this model. Surprisingly, spontaneous tumors of p53 heterozygous immune-deficient mice exhibited a significantly higher incidence of p53 LOH compared to that observed in tumors derived of p53 heterozygous immune-competent mice. These findings indicate that the immune-system may affect the p53 LOH prevalence in spontaneous tumors. Thus suggesting that the immune-system may recognize and clear cells that underwent p53 LOH, whereas in immune-compromised mice, those cells will form tumors with shorter latency. In individuals with a competent immune-system, p53 LOH independent pathways may induce malignant transformation which requires a longer tumor latency. Moreover, this data may imply that the current immunotherapy treatment aimed at abrogating the inhibition of cellular immune checkpoints may be beneficial for LFS patients.

  3. The current status and future directions of myxoma virus, a master in immune evasion

    PubMed Central

    2011-01-01

    Myxoma virus (MYXV) gained importance throughout the twentieth century because of the use of the highly virulent Standard Laboratory Strain (SLS) by the Australian government in the attempt to control the feral Australian population of Oryctolagus cuniculus (European rabbit) and the subsequent illegal release of MYXV in Europe. In the European rabbit, MYXV causes a disease with an exceedingly high mortality rate, named myxomatosis, which is passively transmitted by biting arthropod vectors. MYXV still has a great impact on European rabbit populations around the world. In contrast, only a single cutaneous lesion, restricted to the point of inoculation, is seen in its natural long-term host, the South-American Sylvilagus brasiliensis and the North-American S. Bachmani. Apart from being detrimental for European rabbits, however, MYXV has also become of interest in human medicine in the last two decades for two reasons. Firstly, due to the strong immune suppressing effects of certain MYXV proteins, several secreted virus-encoded immunomodulators (e.g. Serp-1) are being developed to treat systemic inflammatory syndromes such as cardiovascular disease in humans. Secondly, due to the inherent ability of MYXV to infect a broad spectrum of human cancer cells, the live virus is also being developed as an oncolytic virotherapeutic to treat human cancer. In this review, an update will be given on the current status of MYXV in rabbits as well as its potential in human medicine in the twenty-first century. Table of contents Abstract 1. The virus 2. History 3. Pathogenesis and disease symptoms 4. Immunomodulatory proteins of MYXV 4.1. MYXV proteins with anti-apoptotic functions 4.1.1. Inhibition of pro-apoptotic molecules 4.1.2. Inhibition by protein-protein interactions by ankyrin repeat viral proteins 4.1.3. Inhibition of apoptosis by enhancing the degradation of cellular proteins 4.1.4. Inhibition of apoptosis by blocking host Protein Kinase R (PKR) 4.2. MYXV proteins

  4. Beef, chicken and lamb fatty acid analysis--a simplified direct bimethylation procedure using freeze-dried material.

    PubMed

    Lee, M R F; Tweed, J K S; Kim, E J; Scollan, N D

    2012-12-01

    When fractionation of meat lipids is not required, procedures such as saponification can be used to extract total fatty acids, reducing reliance on toxic organic compounds. However, saponification of muscle fatty acids is laborious, and requires extended heating times, and a second methylation step to convert the extracted fatty acids to fatty acid methyl esters prior to gas chromatography. Therefore the development of a more rapid direct methylation procedure would be of merit. The use of freeze-dried material for analysis is common and allows for greater homogenisation of the sample. The present study investigated the potential of using freeze-dried muscle samples and a direct bimethylation to analyse total fatty acids of meat (beef, chicken and lamb) in comparison with a saponification procedure followed by bimethylation. Both methods compared favourably for all major fatty acids measured. There was a minor difference in relation to the C18:1 trans 10 isomer with a greater (P<0.05) recovery with saponification. However, numerically the difference was small and likely as a result of approaching the limits of isomer identification by single column gas chromatography. Differences (P<0.001) between species were found for all fatty acids measured with no interaction effects. The described technique offers a simplified, quick and reliable alternative to saponification to analyse total fatty acids from muscle samples.

  5. X-Ray Structure and Site-Directed Mutagenesis Analysis of the Escherichia coli Colicin M Immunity Protein▿ †

    PubMed Central

    Gérard, Fabien; Brooks, Mark A.; Barreteau, Hélène; Touzé, Thierry; Graille, Marc; Bouhss, Ahmed; Blanot, Didier; van Tilbeurgh, Herman; Mengin-Lecreulx, Dominique

    2011-01-01

    Colicin M (ColM), which is produced by some Escherichia coli strains to kill competitor strains from the same or related species, was recently shown to inhibit cell wall peptidoglycan biosynthesis through enzymatic degradation of its lipid II precursor. ColM-producing strains are protected from the toxin that they produce by coexpression of a specific immunity protein, named Cmi, whose mode of action still remains to be identified. We report here the resolution of the crystal structure of Cmi, which is composed of four β strands and four α helices. This rather compact structure revealed a disulfide bond between residues Cys31 and Cys107. Interestingly, these two cysteines and several other residues appeared to be conserved in the sequences of several proteins of unknown function belonging to the YebF family which exhibit 25 to 35% overall sequence similarity with Cmi. Site-directed mutagenesis was performed to assess the role of these residues in the ColM immunity-conferring activity of Cmi, which showed that the disulfide bond and residues from the C-terminal extremity of the protein were functionally essential. The involvement of DsbA oxidase in the formation of the Cmi disulfide bond is also demonstrated. PMID:21037007

  6. Enterovirus 71 can directly infect the brainstem via cranial nerves and infection can be ameliorated by passive immunization.

    PubMed

    Tan, Soon Hao; Ong, Kien Chai; Wong, Kum Thong

    2014-11-01

    Enterovirus 71 (EV71)-associated hand, foot, and mouth disease may be complicated by encephalomyelitis. We investigated EV71 brainstem infection and whether this infection could be ameliorated by passive immunization in a mouse model. Enterovirus 71 was injected into unilateral jaw/facial muscles of 2-week-old mice, and hyperimmune sera were given before or after infection. Harvested tissues were studied by light microscopy, immunohistochemistry, in situ hybridization, and viral titration. In unimmunized mice, viral antigen and RNA were detected within 24 hours after infection only in ipsilateral cranial nerves, motor trigeminal nucleus, reticular formation, and facial nucleus; viral titers were significantly higher in the brainstem than in the spinal cord samples. Mice given preinfection hyperimmune serum showed a marked reduction of ipsilateral viral antigen/RNA and viral titers in the brainstem in a dose-dependent manner. With optimum hyperimmune serum given after infection, brainstem infection was significantly reduced in a time-dependent manner. A delay in disease onset and a reduction of disease severity and mortality were also observed. Thus, EV71 can directly infect the brainstem, including the medulla, via cranial nerves, most likely by retrograde axonal transport. This may explain the sudden cardiorespiratory collapse in human patients with fatal encephalomyelitis. Moreover, our results suggest that passive immunization may still benefit EV71-infected patients who have neurologic complications.

  7. The emerging role of anti-CD25 directed therapies as both immune modulators and targeted agents in cancer.

    PubMed

    Flynn, Michael J; Hartley, John A

    2017-10-01

    CD25 (also termed IL2RA) forms one component of the high-affinity heterotrimeric interleukin 2 (IL2) receptor on activated T cells. Its affinity for IL2 and cellular function are tightly regulated and vary in different cell types. The high frequency of CD25 on the surface of many different haematological tumour cells is now well established and, apart from its prognostic significance, CD25 may be present on leukaemic stem cells and enable oncogenic signalling pathways in leukaemic cells. Additionally, high CD25 expression in activated circulating immune cells and Tregs is a factor that has already been exploited by IL2 immunotherapies for treatment of tumours and autoimmune disease. The relative clinical safety and efficacy of administering anti-CD25 radioimmunoconjugates and immunotoxins in various haematological tumour indications has been established and clinical trials of a novel CD25-directed antibody drug conjugate are underway. © 2017 John Wiley & Sons Ltd.

  8. Strength-training exercise in dysphagia rehabilitation: principles, procedures, and directions for future research.

    PubMed

    Burkhead, Lori M; Sapienza, Christine M; Rosenbek, John C

    2007-07-01

    Dysphagia rehabilitation, historically, has focused a great deal on various compensations during swallowing to prevent aspiration and/or improve safety and efficiency. Exercise, in general, has been a part of the dysphagia rehabilitation landscape. However, heightened discussions in the field regarding best practices for exercise training, particularly strengthening, raise more questions than answers. The intent of this paper is to (1) explore the overriding principles of neuromuscular plasticity with regard to strength training, (2) evaluate how current exercise-training interventions in dysphagia rehabilitation correspond to these principles, and (3) postulate directions for future study of normal and disordered swallowing and determine how to incorporate these principles into dysphagia rehabilitation.

  9. Direct and indirect costs of co-infection in the wild: Linking gastrointestinal parasite communities, host hematology, and immune function.

    PubMed

    Budischak, Sarah A; Jolles, Anna E; Ezenwa, Vanessa O

    2012-12-01

    Most animals are concurrently infected with multiple parasites, and interactions among these parasites may influence both disease dynamics and host fitness. However, the sublethal costs of parasite infections are difficult to measure and the effects of concomitant infections with multiple parasite species on individual physiology and fitness are poorly described for wild hosts. To understand the direct and indirect physiological costs of co-infection, we investigated the relationships among gastrointestinal parasite richness, species identity, and abundance and host hematological parameters, body condition, and investment in lymphocyte defenses. Using aggregate-scale parasite data from African buffalo (Syncerus caffer), we found few direct or indirect associations between infection and hematology in male hosts, and no significant associations were observed in female hosts or with respect to body condition in either sex. These results suggest that only strong physiological effects are detectable with aggregate-scale parasite data, and that hematological variables may be more sensitive to changes in condition than standard body fat condition indices. Analyses accounting for parasite species identity in female buffalo revealed that different parasites show distinct relationships with host hematology, body condition, and immune investment. However, four of six species-specific associations were obscured when parasites were considered in combination. Overall, fitness-related physiological mediators such as hematological indices may provide assessments of direct and indirect effects of parasite infection, particularly when parasite species identity and community composition are considered.

  10. Direct and indirect costs of co-infection in the wild: Linking gastrointestinal parasite communities, host hematology, and immune function☆

    PubMed Central

    Budischak, Sarah A.; Jolles, Anna E.; Ezenwa, Vanessa O.

    2012-01-01

    Most animals are concurrently infected with multiple parasites, and interactions among these parasites may influence both disease dynamics and host fitness. However, the sublethal costs of parasite infections are difficult to measure and the effects of concomitant infections with multiple parasite species on individual physiology and fitness are poorly described for wild hosts. To understand the direct and indirect physiological costs of co-infection, we investigated the relationships among gastrointestinal parasite richness, species identity, and abundance and host hematological parameters, body condition, and investment in lymphocyte defenses. Using aggregate-scale parasite data from African buffalo (Syncerus caffer), we found few direct or indirect associations between infection and hematology in male hosts, and no significant associations were observed in female hosts or with respect to body condition in either sex. These results suggest that only strong physiological effects are detectable with aggregate-scale parasite data, and that hematological variables may be more sensitive to changes in condition than standard body fat condition indices. Analyses accounting for parasite species identity in female buffalo revealed that different parasites show distinct relationships with host hematology, body condition, and immune investment. However, four of six species-specific associations were obscured when parasites were considered in combination. Overall, fitness-related physiological mediators such as hematological indices may provide assessments of direct and indirect effects of parasite infection, particularly when parasite species identity and community composition are considered. PMID:24533308

  11. Isolation of murine intrahepatic immune cells employing a modified procedure for mechanical disruption and functional characterization of the B, T and natural killer T cells obtained.

    PubMed

    Blom, K G; Qazi, M Rahman; Matos, J B Noronha; Nelson, B D; DePierre, J W; Abedi-Valugerdi, M

    2009-02-01

    Intrahepatic immune cells (IHIC) are known to play central roles in immunological responses mediated by the liver, and isolation and phenotypic characterization of these cells is therefore of considerable importance. In the present investigation, we developed a simple procedure for the mechanical disruption of mouse liver that allows efficient isolation and phenotypic characterization of IHIC. These cells are compared with the corresponding cells purified from the liver after enzymatic digestion with different concentrations of collagenase and DNase. The mechanical disruption yielded viable IHIC in considerably greater numbers than those obtained following enzymatic digestion. The IHIC isolated employing the mechanical disruption were heterogeneous in composition, consisting of both innate and adaptive immune cells, of which B, T, natural killer (NK), NK T cells, granulocytes and macrophages were the major populations (constituting 37.5%, 16.5%, 12.1%, 7.9%, 7.9% and 7.5% of the total number of cells recovered respectively). The IHIC obtained following enzymatic digestion contained markedly lower numbers of NK T cells (1.8%). The B, T and NK T cells among IHIC isolated employing mechanical disruption were found to be immunocompetent, i.e. they proliferated in vitro in response to their specific stimuli (lipopolysaccharide, concanavalin A and alpha-galactosylceramide respectively) and produced immunoglobulin M and interferon-gamma. Thus, the simple procedure for the mechanical disruption of mouse liver described here results in more efficient isolation of functionally competent IHIC for various types of investigation.

  12. CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea

    PubMed Central

    Marraffini, Luciano A.; Sontheimer, Erik J.

    2010-01-01

    Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085

  13. Interleukin-19 induces angiogenesis in the absence of hypoxia by direct and indirect immune mechanisms

    PubMed Central

    Kako, Farah; Gabunia, Khatuna; Ray, Mitali; Kelemen, Sheri E.; England, Ross N.; Kako, Bashar; Scalia, Rosario G.

    2016-01-01

    Neovascularization and inflammation are independent biological processes but are linked in response to injury. The role of inflammation-dampening cytokines in the regulation of angiogenesis remains to be clarified. The purpose of this work was to test the hypothesis that IL-19 can induce angiogenesis in the absence of tissue hypoxia and to identify potential mechanisms. Using the aortic ring model of angiogenesis, we found significantly reduced sprouting capacity in aortic rings from IL-19−/− compared with wild-type mice. Using an in vivo assay, we found that IL-19−/− mice respond to vascular endothelial growth factor (VEGF) significantly less than wild-type mice and demonstrate decreased capillary formation in Matrigel plugs. IL-19 signals through the IL-20 receptor complex, and IL-19 induces IL-20 receptor subunit expression in aortic rings and cultured human vascular smooth muscle cells, but not endothelial cells, in a peroxisome proliferator-activated receptor-γ-dependent mechanism. IL-19 activates STAT3, and IL-19 angiogenic activity in aortic rings is STAT3-dependent. Using a quantitative RT-PCR screening assay, we determined that IL-19 has direct proangiogenic effects on aortic rings by inducing angiogenic gene expression. M2 macrophages participate in angiogenesis, and IL-19 has indirect angiogenic effects, as IL-19-stimulated bone marrow-derived macrophages secrete proangiogenic factors that induce greater sprouting of aortic rings than unstimulated controls. Using a quantitative RT-PCR screen, we determined that IL-19 induces expression of angiogenic cytokines in bone marrow-derived macrophages. Together, these data suggest that IL-19 can promote angiogenesis in the absence of hypoxia by at least two distinct mechanisms: 1) direct effects on vascular cells and 2) indirect effects by stimulation of macrophages. PMID:27053520

  14. Intraoperative blood flow analysis of direct revascularization procedures in patients with moyamoya disease

    PubMed Central

    Lee, Marco; Guzman, Raphael; Bell-Stephens, Teresa; Steinberg, Gary K

    2011-01-01

    Moyamoya disease is characterized by the progressive stenosis and often occlusion of the terminal internal carotid arteries, which leads to ischemic and hemorrhagic injuries. The etiology is unknown and surgical revascularization remains the mainstay treatment. We analyzed various hemodynamic factors in 292 patients with moyamoya disease, representing 496 revascularization procedures, including vessel dimension and intraoperative blood flow, using a perivascular ultrasonic flowprobe. Mean middle cerebral artery (MCA) flow rate was 4.4±0.26 mL/min. After superficial temporal artery (STA)–MCA bypass surgery, flows at the microanastomosis were increased fivefold to a mean of 22.2±0.8 mL/min. The MCA flows were significantly lower in the pediatric (16.2±1.3 mL/min) compared with the adult (23.9±1.0 mL/min; P<0.0001) population. Increased local flow rates were associated with clinical improvement. Permanent postoperative complications were low (<5%), but very high postanastomosis MCA flow was associated with postoperative stroke (31.2±6.8 mL/min; P=0.045), hemorrhage (32.1±10.2 mL/min; P=0.045), and transient neurologic deficits (28.6±5.6 mL/min; P=0.047) compared with controls. Other flow and vessel dimension data are presented to elucidate the hemodynamic changes related to the vasculopathy and subsequent to surgical intervention. PMID:20588321

  15. A simultaneous, direct microwave/ultrasound-assisted digestion procedure for the determination of total Kjeldahl nitrogen.

    PubMed

    Domini, Claudia; Vidal, Lorena; Cravotto, Giancarlo; Canals, Antonio

    2009-04-01

    Simultaneous direct irradiation with microwaves and ultrasound was used to determine total Kjeldahl nitrogen. The method involves chemical digestion in two steps, mineralization with sulfuric acid and oxidation with H(2)O(2). The most influential variables for the microwave/ultrasound (MW/US)-assisted digestion were optimized using tryptophan as the model substance. The optimum conditions were: H(2)SO(4) volume, 10 mL; H(2)O(2) volume, 5 mL; weight of sample, 0.05 g; MW power, 500 W; US power, 50 W; digestion time, 7 min (i.e., 5 min mineralization and 2 min oxidation). A modification of the classical Kjeldahl (Hach) method and an US-assisted digestion method were used for comparison. The latter was also optimized; the optimum conditions were: H(2)SO(4) volume, 10 mL; H(2)O(2) volume, 5 mL; sonication time with H(2)SO(4), 15 min; sonication time with H(2)O(2),10 min; US power, 50 W; weight of sample, 0.05 g. Five pure amino acids and two certified reference materials (NIST standard reference materials 1547 (peach leaves), and soil, NCS DC 73322) were analyzed to assess the accuracy of our new MW/US-assisted digestion method, that was successfully applied to five real samples. The significant reduction in digestion time (being 30 min and 25 min for classical Kjeldahl and US-assisted digestion methods, respectively) and consumption of reagents show that simultaneous and direct MW/US irradiation is a powerful and promising tool for low-pressure digestion of solid and liquid samples.

  16. Checkpoint modulation--A new way to direct the immune system against renal cell carcinoma.

    PubMed

    Bedke, Jens; Kruck, Stephan; Gakis, Georgios; Stenzl, Arnulf; Goebell, Peter J

    2015-01-01

    The introduction of targeted therapies like the tyrosine kinase (TKI) and mammalian target of rapamycin (mTOR) inhibitors has improved patients' survival in general. Nevertheless the prognosis remains limited. Therapies with a new mode of action are urgently warranted, especially those who would provoke long-term responders or long-lasting complete remissions as observed with unspecific immunotherapy with the cytokines interleukin-2 and interferon-α. In the recent years a deeper understanding of the underlying immunology of T cell activation led to the development of checkpoint inhibitors, which are mainly monocloncal antibodies and which enhances the presence of the co-stimulatory signals needed for T cell activation or priming. This review discusses the clinical data and ongoing studies available for the inhibition of the PD-1 (CD279) and CTLA-4 (CD152) axis in mRCC. In addition, potential future immunological targets are discussed. This approach of T-cell activation or re-activation by immunological checkpoint inhibition holds the inherent promise to directly affect the tumor cell and thereby to potentially cure a subset of patients with mRCC.

  17. Rapid analytical procedure for neomycin determination in ointments by CE with direct UV detection.

    PubMed

    Huidobro, A L; García, A; Barbas, C

    2009-07-12

    The purpose of this study was the development of an analytical methodology for the determination of neomycin in a complex pharmaceutical preparation. The simplified methodology consisted of a primary liquid-liquid extraction, employing a mixture of chloroform and water (1.25:1, v/v) and subsequent analysis by CE applying a capillary zone electrophoresis method with a 30 cm (effective length), 50 microm (internal diameter) polyacrylamide-coated silica capillary. The background electrolyte consisted of 35 mM phosphate and 15 mM acetate buffer set at pH 4.7, under normal polarity mode and direct UV detection at 200 nm. The separation of the target analyte from the complex matrix was accomplished in less than 3 min. The analytical method was successfully validated in order to verify its proper selectivity, linearity, accuracy and precision for the goal intended and its further implementation for the quantification of the active compound in the pharmaceutical speciality for quality control.

  18. Direct methanol fuel cells: The effect of electrode fabrication procedure on MEAs structural properties and cell performance

    NASA Astrophysics Data System (ADS)

    Song, S. Q.; Liang, Z. X.; Zhou, W. J.; Sun, G. Q.; Xin, Q.; Stergiopoulos, V.; Tsiakaras, P.

    In the present paper, the effect of electrode preparation procedure on the structural properties of membrane electrode assembly (MEA) and consequently on the performance of direct methanol fuel cells (DMFCs) was investigated. Commercial PtRu black anode catalyst and Pt black cathode catalyst were characterized by XRD in their initial form and in their intermediate and final states after each step involved in catalyst-coated membrane electrode preparation procedure by a decal transfer method (DTM). XRD results demonstrated that the DTM process has a significant effect on the catalyst structural properties, especially on the particle size of Pt black cathode catalyst. It is also discussed that among all the steps involved in the electrode fabrication procedure, catalyst ink preparation and high temperature transfer process are key factors affecting the particle size of Pt black catalyst. Furthermore, it was found that the maximum power density of the single DMFC using a MEA fabricated by the DTM, when air is used as oxidant, is more than two times greater than that of the cell using conventionally prepared MEA, and more than three times greater when pure oxygen is used as oxidant. This could be attributed to the easier mass transportation due to the thinner catalyst layer and the better contact between the catalyst layer and the electrolyte membrane in the former case, even if, according to in situ CO stripping voltammetry results in the fuel cell anode environment, the surface composition of PtRu anode has been changed.

  19. Inflammatory markers and adipokines alter adipocyte-derived ASP production through direct and indirect immune interaction.

    PubMed

    Lu, H; Gauvreau, D; Tom, F-Q; Lapointe, M; Luo, X P; Cianflone, K

    2013-04-01

    Obesity and related metabolic diseases are associated with chronic low-grade inflammation, characterized by increased pro-inflammatory proteins. Several studies have demonstrated increases in acylation stimulating protein (ASP) and its precursor protein C3 in obesity, diabetes and dyslipidemia. To evaluate the effects of acute inflammatory factors and adipokines on ASP production and potential mechanisms of action, 3T3-L1 adipocytes were treated for 24 h with adipokines, cytokines, macrophage-conditioned media and direct co-culture with J774 macrophages. ASP and C3 in the media were evaluated in relation to changes in adipocyte lipid metabolism (cellular triglyceride stores). Leptin, adiponectin, IL-10, LPS and TNF-α increased ASP production (151%, 153%, 190%, 318%, 134%, P<0.05, respectively,). C5a and RANTES (Regulated and normal T cell expressed and secreted) decreased ASP production ( - 34%, - 47%, P<0.05), which was also associated with a decrease in the precursor protein C3 ( - 39% to - 51%, P<0.01), while keratinocyte chemoattractant (KC; murine IL-8 ortholog) had no effect on ASP and C3 secretion. By contrast, apelin, omentin and visfatin also decreased ASP ( - 27%, - 49%, - 22%, P<0.05), but without changes in precursor protein C3 secretion. Macrophage-conditioned media alone had little effect on C3 or ASP, while co-culture of adipocytes with macrophages markedly increased ASP and C3 production (272%, 167%, P<0.05). These in vitro results suggest various metabolic hormones and inflammatory factors can affect ASP production through increased precursor C3 production and/or by changing the rate of C3 conversion to ASP. As an adipokine, ASP could constitute a new link between adipocytes and macrophages.

  20. Countywide school-based influenza immunization: direct and indirect impact on student absenteeism.

    PubMed

    Davis, Mollie M; King, James C; Moag, Lauren; Cummings, Ginny; Magder, Laurence S

    2008-07-01

    Live attenuated influenza vaccine was given to 5319 (44%) of the 12090 students enrolled in public elementary schools in Carroll County, Maryland, during the fall of 2005. We examined the impact of this community-based intervention on countywide student absenteeism during the subsequent influenza outbreak. This study used existing, anonymous information: census data, community influenza tests, and public school absenteeism data. The intervention group was Carroll County, years 2005-2006. The control group included Carroll County, years 2001-2005, and adjacent Frederick County, years 2001-2006. Weekly student absenteeism was determined during baseline influenza-free periods and influenza outbreak periods for all of the public schools. The absolute change in absenteeism during the influenza outbreak periods over baseline in elementary schools was 0.61% for the intervention group and 1.79% for the control group. Similarly, the change in absenteeism during the influenza outbreak period over baseline for high schools was 0.32% for the intervention group and 1.80% for the control group. Although not statistically significant, trends in middle schools were similar. Countywide school-based influenza vaccination was associated with reduced absenteeism during an influenza outbreak. The data suggest not only a direct impact on elementary schools but also an indirect impact on high schools. School-based programs provide an efficient method of providing influenza vaccination to children, and protection may extend to unvaccinated community members. Additional research is needed to determine whether school-based vaccination of children reduces morbidity and mortality associated with influenza outbreaks.

  1. Human immunodeficiency virus (HIV) type 1 Vpr induces differential regulation of T cell costimulatory molecules: Direct effect of Vpr on T cell activation and immune function

    SciTech Connect

    Venkatachari, Narasimhan J.; Majumder, Biswanath; Ayyavoo, Velpandi . E-mail: velpandi@pitt.edu

    2007-02-20

    Human immunodeficiency virus type 1 (HIV-1) viral proteins disrupt the normal host cellular immune pathways thus exploiting the cellular machinery for replication, survival and to escape host immune attack. Here we evaluated the direct effects of HIV-1 Vpr-mediated immune modulation of infected T cells. Vpr specifically downregulated the expression of CD28 and increased the expression of CTLA-4, whereas no significant difference in the expression of CD25 and HLA-DR was observed. Interferon gamma (IFN-{gamma}) production in T cells was evaluated as a measure of the downstream effector functions. Results indicate that Vpr significantly inhibited IFN-{gamma} production and this may, in part, due to Vpr's ability to inhibit the nuclear translocation of NF-{kappa}B, and its transcriptional regulation. Together these results support that HIV-1 Vpr selectively dysregulates the immune functions at multiple levels and exerts its inhibitory effects in the presence of other viral proteins.

  2. Direct tumor recognition by a human CD4+ T-cell subset potently mediates tumor growth inhibition and orchestrates anti-tumor immune responses

    PubMed Central

    Matsuzaki, Junko; Tsuji, Takemasa; Luescher, Immanuel F.; Shiku, Hiroshi; Mineno, Junichi; Okamoto, Sachiko; Old, Lloyd J.; Shrikant, Protul; Gnjatic, Sacha; Odunsi, Kunle

    2015-01-01

    Tumor antigen-specific CD4+ T cells generally orchestrate and regulate immune cells to provide immune surveillance against malignancy. However, activation of antigen-specific CD4+ T cells is restricted at local tumor sites where antigen-presenting cells (APCs) are frequently dysfunctional, which can cause rapid exhaustion of anti-tumor immune responses. Herein, we characterize anti-tumor effects of a unique human CD4+ helper T-cell subset that directly recognizes the cytoplasmic tumor antigen, NY-ESO-1, presented by MHC class II on cancer cells. Upon direct recognition of cancer cells, tumor-recognizing CD4+ T cells (TR-CD4) potently induced IFN-γ-dependent growth arrest in cancer cells. In addition, direct recognition of cancer cells triggers TR-CD4 to provide help to NY-ESO-1-specific CD8+ T cells by enhancing cytotoxic activity, and improving viability and proliferation in the absence of APCs. Notably, the TR-CD4 either alone or in collaboration with CD8+ T cells significantly inhibited tumor growth in vivo in a xenograft model. Finally, retroviral gene-engineering with T cell receptor (TCR) derived from TR-CD4 produced large numbers of functional TR-CD4. These observations provide mechanistic insights into the role of TR-CD4 in tumor immunity, and suggest that approaches to utilize TR-CD4 will augment anti-tumor immune responses for durable therapeutic efficacy in cancer patients. PMID:26447332

  3. World Health Organization's Innovative Direct Disbursement Mechanism for Payment of Grassroots Immunization Personnel and Operations in Nigeria: 2004–2015

    PubMed Central

    Yehualashet, Yared G.; Wadda, Alieu; Agblewonu, Koffi B.; Zhema, Theophilus; Ibrahim, Al-asi A.; Corr, Alhagie; Linkins, Jennifer; Mkanda, Pascal; Vaz, Rui G.; Nsubuga, Peter; Ashogbon, Daniel

    2016-01-01

    Background. Following the 1988 World Health Assembly resolution to eradicate polio, the government of Nigeria, with support from partners, has been implementing several rounds of supplementary immunization activities (SIAs) each year. In addition to the technical requirements, the success of the polio eradication initiative depends on timely provision of adequate financial resources. Disbursement of funds for SIAs and payment of allowances to numerous vaccination personnel at the grassroots level are enormous operational challenges in a country the size of Nigeria. Upon donors' request for a transparent and effective payment mechanism, the World Health Organization (WHO), in consultation with national counterparts, created the innovative direct disbursement mechanism (DDM) in 2004. The objective of the DDM was to timely deploy operational funds at the field level and directly pay vaccination personnel allowances at the grassroots level. Methods. A detailed operational guideline for funds disbursement was developed in close consultation with central and field stakeholders. Multiyear financial resource requirements and operational budgets for every campaign were produced by an interagency-coordinated finance subcommittee. The WHO engaged a bank and an accounting firm as DDM partners to support disbursement of and accounting for the SIA funds, respectively. The 37 WHO field offices were equipped with electronic financial systems to support the DDM process, and temporary payment sites were set up to facilitate payment to vaccination personnel at the grassroots level. Coordination meetings among DDM partners were held regularly to reconcile financial records and address operational challenges. Results. Between 2004 and 2014, DDM supported 99 polio and nonpolio vaccination campaigns, disbursing more than $370 million to about 16 million beneficiaries across 280 temporary payment sites. To mitigate security risks and reduce operational costs, the WHO and DDM

  4. World Health Organization's Innovative Direct Disbursement Mechanism for Payment of Grassroots Immunization Personnel and Operations in Nigeria: 2004-2015.

    PubMed

    Yehualashet, Yared G; Wadda, Alieu; Agblewonu, Koffi B; Zhema, Theophilus; Ibrahim, Al-Asi A; Corr, Alhagie; Linkins, Jennifer; Mkanda, Pascal; Vaz, Rui G; Nsubuga, Peter; Ashogbon, Daniel

    2016-05-01

    Following the 1988 World Health Assembly resolution to eradicate polio, the government of Nigeria, with support from partners, has been implementing several rounds of supplementary immunization activities (SIAs) each year. In addition to the technical requirements, the success of the polio eradication initiative depends on timely provision of adequate financial resources. Disbursement of funds for SIAs and payment of allowances to numerous vaccination personnel at the grassroots level are enormous operational challenges in a country the size of Nigeria. Upon donors' request for a transparent and effective payment mechanism, the World Health Organization (WHO), in consultation with national counterparts, created the innovative direct disbursement mechanism (DDM) in 2004. The objective of the DDM was to timely deploy operational funds at the field level and directly pay vaccination personnel allowances at the grassroots level. A detailed operational guideline for funds disbursement was developed in close consultation with central and field stakeholders. Multiyear financial resource requirements and operational budgets for every campaign were produced by an interagency-coordinated finance subcommittee. The WHO engaged a bank and an accounting firm as DDM partners to support disbursement of and accounting for the SIA funds, respectively. The 37 WHO field offices were equipped with electronic financial systems to support the DDM process, and temporary payment sites were set up to facilitate payment to vaccination personnel at the grassroots level. Coordination meetings among DDM partners were held regularly to reconcile financial records and address operational challenges. Between 2004 and 2014, DDM supported 99 polio and nonpolio vaccination campaigns, disbursing more than $370 million to about 16 million beneficiaries across 280 temporary payment sites. To mitigate security risks and reduce operational costs, the WHO and DDM partners introduced mobile payment to

  5. Paneth cell extrusion and release of antimicrobial products is directly controlled by immune cell-derived IFN-γ.

    PubMed

    Farin, Henner F; Karthaus, Wouter R; Kujala, Pekka; Rakhshandehroo, Maryam; Schwank, Gerald; Vries, Robert G J; Kalkhoven, Eric; Nieuwenhuis, Edward E S; Clevers, Hans

    2014-06-30

    Paneth cells (PCs) are terminally differentiated, highly specialized secretory cells located at the base of the crypts of Lieberkühn in the small intestine. Besides their antimicrobial function, PCs serve as a component of the intestinal stem cell niche. By secreting granules containing bactericidal proteins like defensins/cryptdins and lysozyme, PCs regulate the microbiome of the gut. Here we study the control of PC degranulation in primary epithelial organoids in culture. We show that PC degranulation does not directly occur upon stimulation with microbial antigens or bacteria. In contrast, the pro-inflammatory cytokine Interferon gamma (IFN-γ) induces rapid and complete loss of granules. Using live cell imaging, we show that degranulation is coupled to luminal extrusion and death of PCs. Transfer of supernatants from in vitro stimulated iNKT cells recapitulates degranulation in an IFN-γ-dependent manner. Furthermore, endogenous IFN-γ secretion induced by anti-CD3 antibody injection causes Paneth loss and release of goblet cell mucus. The identification of IFN-γ as a trigger for degranulation and extrusion of PCs establishes a novel effector mechanism by which immune responses may regulate epithelial status and the gut microbiome.

  6. Paneth cell extrusion and release of antimicrobial products is directly controlled by immune cell–derived IFN-γ

    PubMed Central

    Farin, Henner F.; Karthaus, Wouter R.; Kujala, Pekka; Rakhshandehroo, Maryam; Schwank, Gerald; Vries, Robert G.J.; Kalkhoven, Eric; Nieuwenhuis, Edward E.S.

    2014-01-01

    Paneth cells (PCs) are terminally differentiated, highly specialized secretory cells located at the base of the crypts of Lieberkühn in the small intestine. Besides their antimicrobial function, PCs serve as a component of the intestinal stem cell niche. By secreting granules containing bactericidal proteins like defensins/cryptdins and lysozyme, PCs regulate the microbiome of the gut. Here we study the control of PC degranulation in primary epithelial organoids in culture. We show that PC degranulation does not directly occur upon stimulation with microbial antigens or bacteria. In contrast, the pro-inflammatory cytokine Interferon gamma (IFN-γ) induces rapid and complete loss of granules. Using live cell imaging, we show that degranulation is coupled to luminal extrusion and death of PCs. Transfer of supernatants from in vitro stimulated iNKT cells recapitulates degranulation in an IFN-γ-dependent manner. Furthermore, endogenous IFN-γ secretion induced by anti-CD3 antibody injection causes Paneth loss and release of goblet cell mucus. The identification of IFN-γ as a trigger for degranulation and extrusion of PCs establishes a novel effector mechanism by which immune responses may regulate epithelial status and the gut microbiome. PMID:24980747

  7. Controlling Salmonella infection in weanling pigs through water delivery of direct-fed microbials or organic acids; Part I. Effects on growth performance, microbial populations and immune status

    USDA-ARS?s Scientific Manuscript database

    Pigs (n=88) weaned at 19 ± 2 d of age were used in a 14 d study to evaluate the effects of water-delivered direct-fed microbials (DFM) or organic acids on immune status, Salmonella infection and shedding, and intestinal microbial populations following a Salmonella Typhimurium challenge. Pigs were ch...

  8. Population-Level Impact of Ontario’s Infant Rotavirus Immunization Program: Evidence of Direct and Indirect Effects

    PubMed Central

    Rosella, Laura C.; Wang, Jun; Le Saux, Nicole; Crowcroft, Natasha S.; Harris, Tara; Bolotin, Shelly; Deeks, Shelley L.

    2016-01-01

    Objective To evaluate the direct and indirect population impact of rotavirus (RV) immunization on hospitalizations and emergency department (ED) visits for acute gastroenteritis (AGE) in Ontario before and after the publicly-funded RV immunization program. Methods Administrative data was used to identify ED visits and hospitalizations for all Ontarians using ICD-10 codes. We used two outcome definitions: RV-specific AGE (RV-AGE) and codes representing RV-, other viral and cause unspecified AGE (“overall AGE”). The pre-program and public program periods were August 1, 2005 to July 31, 2011; and August 1, 2011 to March 31, 2013, respectively. A negative binominal regression model that included the effect of time was used to calculate rates and rate ratios (RRs) and 95% confidence intervals (CIs) for RV-AGE and overall AGE between periods, after adjusting for age, seasonality and secular trends. Analyses were conducted for all ages combined and age stratified. Results Relative to the pre-program period, the adjusted RRs for RV-AGE and overall AGE hospitalizations in the public program period were 0.29 (95%CI: 0.22–0.39) and 0.68 (95%CI: 0.62–0.75), respectively. Significant reductions in RV-AGE hospitalizations were noted overall and for the following age bands: < 12 months, 12–23 months, 24–35 months, 3–4 years, and 5–19 years. Significant declines in overall AGE hospitalizations were observed across all age bands, including older adults > = 65 years (RR 0.80, 95%CI: 0.72–0.90). The program was associated with adjusted RRs of 0.32 (95% CI: 0.20–0.52) for RV-AGE ED visits and 0.90 (95% CI: 0.85–0.96) for overall AGE ED visits. Conclusions This large, population-based study provides evidence of the impact of RV vaccine in preventing hospitalizations and ED visits for RV-AGE and overall AGE, including herd effects. PMID:27168335

  9. The effects of a psychological intervention directed at optimizing immune function: study protocol for a randomized controlled trial.

    PubMed

    Schakel, Lemmy; Veldhuijzen, Dieuwke S; van Middendorp, Henriët; Prins, Corine; Joosten, Simone A; Ottenhoff, Tom H M; Visser, Leo G; Evers, Andrea W M

    2017-05-26

    Previous research has provided evidence for the link between psychological processes and psychophysiological health outcomes. Psychological interventions, such as face-to-face or online cognitive behavioral therapy (CBT) and serious games aimed at improving health, have shown promising results in promoting health outcomes. Few studies so far, however, have examined whether Internet-based CBT combined with serious gaming elements is effective in modulating health outcomes. Moreover, studies often did not incorporate psychophysiological or immunological challenges in order to gain insight into physiological responses to real-life challenges after psychological interventions. The overall aim of this study is to investigate the effects of a psychological intervention on self-reported and physiological health outcomes in response to immune and psychophysiological challenges. In a randomized controlled trial, 60 healthy men are randomly assigned to either an experimental condition, receiving guided Internet-based (e-health) CBT combined with health-related serious gaming elements for 6 weeks, or a control condition receiving no intervention. After the psychological intervention, self-reported vitality is measured, and participants are given an immunological challenge in the form of a Mycobacterium bovis Bacillus Calmette-Guérin (BCG) vaccination. One day after the vaccination, participants are asked to perform several psychophysiological tasks in order to explore the effects of the psychological intervention on participants' stress response following the immune challenge. To assess the delayed effects of vaccination on self-reported and physiological health outcomes, a follow-up visit is planned 4 weeks later. Total study duration is approximately 14 weeks. The primary outcome measure is self-reported vitality measured directly after the intervention. Secondary outcome measures include inflammatory and endocrine markers, as well as psychophysiological measures of

  10. A Procedure to Quantify Contributions to the Total Cross Section by Mechanisms Competing to the Direct Ionization

    NASA Astrophysics Data System (ADS)

    Kröger, C. M. Romo

    2009-03-01

    Experimental quantitative analysis by PIXE (particle induced X-ray emission) is highly dependent on the composition of the substrate. It is known that highly ionized projectiles change the effective ionization in a collision with a specific atom. Particularly, 2P vacancies on the projectile ion can be produced within the sample and these vacancies will eventually be shared with the target atoms in the substrate, modifying the X-ray yield of the target. Therefore, it is of uttermost importance to account for these second order effects in the X-ray cross section to obtain an accurate result for a PIXE analysis. In this paper, it is proposed a new procedure to estimate quantitatively the contribution to the total ionization cross section of each effect: the direct and enhancement ionizations. Following Verma et al. (Nucl. Instr. and Meth. B245 56-60, 2006), it is modeled the total ionization cross section in a substrate by an exponentially decaying term that represents the enhancement ionization contribution, and a linearly growing term that represents the induced ionization contribution. Estimation of the parameters in the model can be obtained directly from irradiation of targets with different thickness.

  11. Expansion of myeloid immune suppressor Gr+CD11b+ cells in tumor-bearing host directly promotes tumor angiogenesis | Center for Cancer Research

    Cancer.gov

    We demonstrate a novel tumor-promoting role of myeloid immune suppressor Gr+CD11b+ cells, which are evident in cancer patients and tumor-bearing animals. These cells constitute approximately 5% of total cells in tumors. Tumors coinjected with Gr+CD11b+ cells exhibited increased vascular density, vascular maturation, and decreased necrosis. These immune cells produce high levels of MMP9. Deletion of MMP9 in these cells completely abolishes their tumor-promoting ability. Gr+CD11b+ cells were also found to directly incorporate into tumor endothelium.

  12. Direct regulatory immune activity of lactic acid bacteria on Der p 1-pulsed dendritic cells from allergic patients.

    PubMed

    Pochard, Pierre; Hammad, Hamida; Ratajczak, Céline; Charbonnier-Hatzfeld, Anne-Sophie; Just, Nicolas; Tonnel, André-Bernard; Pestel, Joël

    2005-07-01

    Lactic acid bacteria (LAB) are suggested to play a regulatory role in the development of allergic reactions. However, their potential effects on dendritic cells (DCs) directing the immune polarization remain unclear. The immunologic effect of Lactobacillus plantarum NCIMB 8826 (LAB1) on monocyte-derived dendritic cells (MD-DCs) from patients allergic to house dust mite was evaluated. MD-DCs were stimulated for 24 hours with the related allergen Der p 1 in the presence or absence of LAB1. Cell-surface markers were assessed by means of FACS analysis, and the key polarizing cytokines IL-12 and IL-10 were quantified. The subsequent regulatory effect of pulsed MD-DCs on naive or memory T cells was evaluated by determining the T-cell cytokine profile. LAB1 induced the maturation of MD-DCs, even if pulsed with Der p 1. Interestingly, after incubation with LAB1 and Der p 1, MD-DCs produced higher amounts of IL-12 than Der p 1-pulsed DCs. Indeed, the T H 2 cytokine (IL-4 and IL-5) production observed when naive or memory autologous T cells were cocultured with Der p 1-pulsed MD-DCs was highly reduced in the presence of LAB1. Finally, in contrast to naive or memory T cells exposed once to Der p 1-pulsed DCs, T cells stimulated by MD-DCs pulsed with Der p 1 and LAB1 failed to produce T H 2 cytokines in response to a new stimulation with Der p 1-pulsed DCs. Thus in the presence of LAB1, MD-DCs from allergic patients tend to reorientate the T-cell response toward a beneficial T H 1 profile.

  13. Increasing the Rigor of Procedural Fidelity Assessment: An Empirical Comparison of Direct Observation and Permanent Product Review Methods

    ERIC Educational Resources Information Center

    Sanetti, Lisa M. Hagermoser; Collier-Meek, Melissa A.

    2014-01-01

    Although it is widely accepted that procedural fidelity data are important for making valid decisions about intervention effectiveness, there is little empirical guidance for researchers and practitioners regarding how to assess procedural fidelity. A first step in moving procedural fidelity assessment research forward is to develop a…

  14. Three p-value consistent procedures for multiple comparisons with a control in direction-mixed families.

    PubMed

    Kwong, Koon Shing; Cheung, Siu Hung; Holland, Burt; Wang, Yanhui

    2007-10-15

    In clinical studies, it is common to compare several treatments with a control. In such cases, the most popular statistical technique is the Dunnett procedure. However, the Dunnett procedure is designed to deal with particular families of inferences in which all hypotheses are either one sided or two sided. Recently, based on the minimization of average simultaneous confidence interval width, a single-step procedure was derived to handle more general inferential families that contained a mixture of one- and two-sided inferences. But that single-step procedure is unable to guarantee the condition of p-value consistency which means that when a hypothesis with a certain p-value is rejected, all other hypotheses with smaller p-values are also rejected. In this paper, we present a single-step procedure and two stepwise procedures which are p-value consistent. The two proposed stepwise procedures provide more powerful testing methods when compared with single-step procedures. The extent of their superiority is demonstrated with a simulation study of average power. Selected critical values are tabulated for the implementation of the three proposed procedures. Additional simulation studies provide evidence that the new stepwise procedures are robust to moderate changes in the underlying probability distributions, and the proposed step-up procedure is uniformly more powerful than the resampling-based Hochberg step-up approach in all considered distribution models. Finally, we provide a practical example with sample data extracted from a medical experiment.

  15. Characteristics of optical fire detector false alarm sources and qualification test procedures to prove immunity, phase 2, volume 3: Appendix 2

    NASA Astrophysics Data System (ADS)

    Goedeke, A. D.; Gross, H. G.

    1995-05-01

    This study identified possible sources of UV, IR and visible radiations that may cause an optical fire detector to false alarm and/or affect its fire detection performance. The spectral irradiances of JP-4 pan fires and a multitude of lamps, hot bodies, and other of radiation stimuli that an optical detector may be exposed to in any type of aircraft shelter, hanger, facility, or ground location, were determined. Knowing the spectral irradiances of the required fire size and distance to be detected, it was then possible to determine at what distances would the potential false alarm source have to be to equal or exceed the fire's spectral irradiances in the 185nm - 250nm and 4.4lm bands. Considering the possible distance from detector to source, candidate false alarm sources were selected for detector immunity testing. Qualification test procedures were developed and tested. It was concluded that there are many possible false alarm sources and, if located too close to a detector, and the stimuli are modulated, most optical fire detectors would alarm.

  16. Effect of Bacillus Subtilis-based Direct-fed Microbials on Immune Status in Broiler Chickens Raised on Fresh or Used Litter.

    PubMed

    Lee, K W; Lillehoj, H S; Jang, S I; Lee, S H; Bautista, D A; Siragusa, G R

    2013-11-01

    Type of dietary direct-fed microbials (DFMs) or poultry litter could directly influence the composition of gut microbiota. Gut microbiota plays an important role in shaping the developing immune system and maintaining the homeostasis of the mature immune system in mammal and chickens. The present study was carried out to investigate the interaction among litter, DFMs and immunity in broiler chickens exposed to a field-simulated environment. Immune status of broiler chickens was assessed by serum antibodies against Eimeria spp. and Clostridium spp. and intestinal cytokine mRNA expression. The current experimental design had a 3 ×2 factorial arrangement of treatments with three types of litter, i.e., fresh litter or used litter that was obtained from a farm with no disease outbreak (used litter) or a farm with history of a gangrenous dermatitis outbreak (GD litter), and two dietary treatments with or without DFMs. It was found that either DFM addition or type of litter significantly affected anticoccidial antibody levels of broiler chickens at d 42. In general, dietary DFMs increased the anticoccidial antibodies in the fresh-litter raised chickens, but lowered the levels in the GD-litter raised chickens. Serum antibodies against Clostridium perfringens α-toxin were significantly (p<0.05) higher in chickens raised on GD litter compared with those raised on fresh litter. Cytokine mRNA expression was significantly (p<0.05) altered by either the type of litter or DFMs. Of interest, dietary DFMs lowered interferon-γ, interleukin 1beta, and CXCLi2 cytokine mRNA expression in chickens raised on fresh litter but increased them in GD-litter raised chickens. In conclusion, dietary DFMs modulate various immune parameters of broiler chickens, but the DFM-mediated effects were dependent upon the type of litter on which chickens were raised.

  17. Effect of Bacillus Subtilis-based Direct-fed Microbials on Immune Status in Broiler Chickens Raised on Fresh or Used Litter

    PubMed Central

    Lee, K. W.; Lillehoj, H. S.; Jang, S. I.; Lee, S. H.; Bautista, D. A.; Siragusa, G. R.

    2013-01-01

    Type of dietary direct-fed microbials (DFMs) or poultry litter could directly influence the composition of gut microbiota. Gut microbiota plays an important role in shaping the developing immune system and maintaining the homeostasis of the mature immune system in mammal and chickens. The present study was carried out to investigate the interaction among litter, DFMs and immunity in broiler chickens exposed to a field-simulated environment. Immune status of broiler chickens was assessed by serum antibodies against Eimeria spp. and Clostridium spp. and intestinal cytokine mRNA expression. The current experimental design had a 3 ×2 factorial arrangement of treatments with three types of litter, i.e., fresh litter or used litter that was obtained from a farm with no disease outbreak (used litter) or a farm with history of a gangrenous dermatitis outbreak (GD litter), and two dietary treatments with or without DFMs. It was found that either DFM addition or type of litter significantly affected anticoccidial antibody levels of broiler chickens at d 42. In general, dietary DFMs increased the anticoccidial antibodies in the fresh-litter raised chickens, but lowered the levels in the GD-litter raised chickens. Serum antibodies against Clostridium perfringens α-toxin were significantly (p<0.05) higher in chickens raised on GD litter compared with those raised on fresh litter. Cytokine mRNA expression was significantly (p<0.05) altered by either the type of litter or DFMs. Of interest, dietary DFMs lowered interferon-γ, interleukin 1beta, and CXCLi2 cytokine mRNA expression in chickens raised on fresh litter but increased them in GD-litter raised chickens. In conclusion, dietary DFMs modulate various immune parameters of broiler chickens, but the DFM-mediated effects were dependent upon the type of litter on which chickens were raised. PMID:25049746

  18. 34 CFR 1100.24 - What are the procedures for payment of a fellowship award directly to the fellow?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 34 Education 4 2014-07-01 2014-07-01 false What are the procedures for payment of a fellowship... NATIONAL INSTITUTE FOR LITERACY NATIONAL INSTITUTE FOR LITERACY: LITERACY LEADER FELLOWSHIP PROGRAM How Does the Director Award a Fellowship? § 1100.24 What are the procedures for payment of a...

  19. 34 CFR 1100.24 - What are the procedures for payment of a fellowship award directly to the fellow?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 34 Education 4 2013-07-01 2013-07-01 false What are the procedures for payment of a fellowship... NATIONAL INSTITUTE FOR LITERACY NATIONAL INSTITUTE FOR LITERACY: LITERACY LEADER FELLOWSHIP PROGRAM How Does the Director Award a Fellowship? § 1100.24 What are the procedures for payment of a...

  20. 34 CFR 1100.24 - What are the procedures for payment of a fellowship award directly to the fellow?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 34 Education 4 2012-07-01 2012-07-01 false What are the procedures for payment of a fellowship... NATIONAL INSTITUTE FOR LITERACY NATIONAL INSTITUTE FOR LITERACY: LITERACY LEADER FELLOWSHIP PROGRAM How Does the Director Award a Fellowship? § 1100.24 What are the procedures for payment of a...

  1. A pilot study exploring the possibility of establishing guidance levels in x-ray directed interventional procedures

    SciTech Connect

    Balter, S.; Miller, D. L.; Vano, E.; Ortiz Lopez, P.; Bernardi, G.; Cotelo, E.; Faulkner, K.; Nowotny, R.; Padovani, R.; Ramirez, A.

    2008-02-15

    This article summarizes the dosimetric results of an International Atomic Energy Agency coordinated research program to investigate the feasibility of adopting guidance levels for invasive coronary artery procedures. The main study collected clinical data from hospitals located in five countries. A total of 2265 coronary angiograms (CA) and 1844 percutaneous coronary interventions (PCI) were analyzed. Substudies evaluated the dosimetric performance of 14 fluoroscopes, skin dose maps obtained using film, the quality of CA procedures, and the complexity of PCI procedures. Kerma-area product (P{sub KA}) guidance levels of 50 and 125 Gy cm{sup 2} are suggested for CA and PCI procedures. These levels should be adjusted for the complexity of the procedures performed in a given institution.

  2. Immuno-oncology and Its Opportunities for Interventional Radiologists: Immune Checkpoint Inhibition and Potential Synergies with Interventional Oncology Procedures.

    PubMed

    Hickey, Ryan M; Kulik, Laura M; Nimeiri, Halla; Kalyan, Aparna; Kircher, Sheetal; Desai, Kush; Riaz, Ahsun; Lewandowski, Robert J; Salem, Riad

    2017-09-12

    Immunotherapy, specifically the use of immune checkpoint inhibitors, offers a new approach to fighting cancer. Although the results of treatment with immune checkpoint inhibition alone have been remarkable for certain cancers, these results are not universal. Preclinical and early clinical studies indicate the potential for synergistic effects when immune checkpoint inhibition is combined with immunogenic local therapies such as ablation and embolization. This review offers an overview of immunology as it relates to immune checkpoint inhibition and the possibilities for synergy when combined with interventional radiology treatments. Copyright © 2017 SIR. Published by Elsevier Inc. All rights reserved.

  3. Induction of mucosal immune responses and protection of cattle against direct-contact challenge by intranasal delivery with foot-and-mouth disease virus antigen mediated by nanoparticles

    PubMed Central

    Pan, Li; Zhang, Zhongwang; Lv, Jianliang; Zhou, Peng; Hu, Wenfa; Fang, Yuzhen; Chen, Haotai; Liu, Xinsheng; Shao, Junjun; Zhao, Furong; Ding, Yaozhong; Lin, Tong; Chang, Huiyun; Zhang, Jie; Zhang, Yongguang; Wang, Yonglu

    2014-01-01

    The aim of this study was to enhance specific mucosal, systemic, and cell-mediated immunity and to induce earlier onset of protection against direct-contact challenge in cattle by intranasal delivery of a nanoparticle-based nasal vaccine against type A foot-and-mouth disease (FMD). In this study, two kinds of nanoparticle-based nasal vaccines against type A FMD were designed: (1) chitosan-coated poly(lactic-co-glycolic acid) (PLGA) loaded with plasmid DNA (Chi-PLGA-DNA) and (2) chitosan-trehalose and inactivated foot-and-mouth disease virus (FMDV) (Chi-Tre-Inactivated). Cattle were immunized by an intranasal route with nanoparticles and then challenged for 48 hours by direct contact with two infected donor cattle per pen. Donors were inoculated intradermally in the tongue 48 hours before challenge, with 0.2 mL cattle-passaged FMDV. Serological and mucosal antibody responses were evaluated, and virus excretion and the number of contact infections were quantified. FMDV-specific secretory immunoglobulin (Ig)A (sIgA) antibodies in nasal washes were initially detected at 4 days postvaccination (dpv) with two kinds of nanoparticles. The highest levels of sIgA expression were observed in nasal washes, at 10 dpv, from animals with Chi-PLGA-DNA nanoparticles, followed by animals immunized once by intranasal route with a double dose of Chi-Tre-Inactivated nanoparticles and animals immunized by intranasal route three times with Chi-Tre-Inactivated nanoparticles (P<0.05). FMDV-specific IgA antibodies in serum showed a similar pattern. All animals immunized by intranasal route developed low levels of detectable IgG in serum at 10 dpv. Following stimulation with FMDV, the highest levels of proliferation were observed in splenocytes harvested from Chi-PLGA-DNA-immunized animals, followed by proliferation of cells harvested from Chi-Tre-Inactivated nanoparticle-immunized animals (P<0.05). Higher protection rates were associated with the highest sIgA antibody responses induced in

  4. Induction of mucosal immune responses and protection of cattle against direct-contact challenge by intranasal delivery with foot-and-mouth disease virus antigen mediated by nanoparticles.

    PubMed

    Pan, Li; Zhang, Zhongwang; Lv, Jianliang; Zhou, Peng; Hu, Wenfa; Fang, Yuzhen; Chen, Haotai; Liu, Xinsheng; Shao, Junjun; Zhao, Furong; Ding, Yaozhong; Lin, Tong; Chang, Huiyun; Zhang, Jie; Zhang, Yongguang; Wang, Yonglu

    2014-01-01

    The aim of this study was to enhance specific mucosal, systemic, and cell-mediated immunity and to induce earlier onset of protection against direct-contact challenge in cattle by intranasal delivery of a nanoparticle-based nasal vaccine against type A foot-and-mouth disease (FMD). In this study, two kinds of nanoparticle-based nasal vaccines against type A FMD were designed: (1) chitosan-coated poly(lactic-co-glycolic acid) (PLGA) loaded with plasmid DNA (Chi-PLGA-DNA) and (2) chitosan-trehalose and inactivated foot-and-mouth disease virus (FMDV) (Chi-Tre-Inactivated). Cattle were immunized by an intranasal route with nanoparticles and then challenged for 48 hours by direct contact with two infected donor cattle per pen. Donors were inoculated intradermally in the tongue 48 hours before challenge, with 0.2 mL cattle-passaged FMDV. Serological and mucosal antibody responses were evaluated, and virus excretion and the number of contact infections were quantified. FMDV-specific secretory immunoglobulin (Ig)A (sIgA) antibodies in nasal washes were initially detected at 4 days postvaccination (dpv) with two kinds of nanoparticles. The highest levels of sIgA expression were observed in nasal washes, at 10 dpv, from animals with Chi-PLGA-DNA nanoparticles, followed by animals immunized once by intranasal route with a double dose of Chi-Tre-Inactivated nanoparticles and animals immunized by intranasal route three times with Chi-Tre-Inactivated nanoparticles (P<0.05). FMDV-specific IgA antibodies in serum showed a similar pattern. All animals immunized by intranasal route developed low levels of detectable IgG in serum at 10 dpv. Following stimulation with FMDV, the highest levels of proliferation were observed in splenocytes harvested from Chi-PLGA-DNA-immunized animals, followed by proliferation of cells harvested from Chi-Tre-Inactivated nanoparticle-immunized animals (P<0.05). Higher protection rates were associated with the highest sIgA antibody responses induced in

  5. The Effects of Direct Instruction Flashcard and Math Racetrack Procedures on Mastery of Basic Multiplication Facts by Three Elementary School Students

    ERIC Educational Resources Information Center

    Skarr, Adam; Zielinski, Katie; Ruwe, Kellen; Sharp, Hannah; Williams, Randy L.; McLaughlin, T. F.

    2014-01-01

    The purpose of this study was to determine if a typical third-grade boy and fifth-grade girl and a boy with learning disabilities could benefit from the combined use of Direct Instruction (DI) flashcard and math racetrack procedures in an after-school program. The dependent variable was accuracy and fluency of saying basic multiplication facts. A…

  6. 20 CFR 667.600 - What local area, State and direct recipient grievance procedures must be established?

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... affected participants and other individuals, including youth and those who are limited-English speaking... of services and information in languages other than English. (c) Local area procedures must provide...

  7. Promotional model: a new direction for the National Programme on Immunization (NPI) and Oral Rehydration Therapy (ORT) in Nigeria.

    PubMed

    Ekerete, P P

    2000-01-01

    The National Programme on Immunization (NPI), which was formerly known as the Expanded Program on Immunization (EPI), and Oral Rehydration Therapy (ORT) were relaunched in 1984 after the problems of vaccine supply had been corrected. The aim of the NPI was to protect children against six childhood killer diseases and ORT to rehydrate the dehydrated child caused by diarrhoea. In order to achieve these objectives, a Partner-in-Health strategy was set up to educate, convince and motivate mothers, pregnant women and the community to accept the programme. To assess the effect of the promotional strategy, the government decided to conduct a National Immunization Coverage survey. The results showed that some states were able to reach the target while some were not. The survey also reported that 32% of the reason for immunization failure was due to lack of information and that 9% was lack of motivation. It therefore became necessary to design a promotional model for effective and rapid implementation of the programme. After an evaluation of the promotional strategy set up by the government, a pilot survey was conducted from which nine promotional elements were selected. These promotional elements were regarded as sources of information and motivation. Based on these, a promotional model was set up which stated that promotion depends on consumer information which in turn depends on the extent of interaction between the consumer and the promotional elements. The implication of the model is the need for the formation of a Public Health Organisation with a Public Health Committee at all levels of government.

  8. The Gateway Reflex, which is mediated by the inflammation amplifier, directs pathogenic immune cells into the CNS.

    PubMed

    Sabharwal, Lavannya; Kamimura, Daisuke; Meng, Jie; Bando, Hidenori; Ogura, Hideki; Nakayama, Chiemi; Jiang, Jing-Jing; Kumai, Noriko; Suzuki, Hironao; Atsumi, Toru; Arima, Yasunobu; Murakami, Masaaki

    2014-12-01

    The brain-blood barrier (BBB) tightly limits immune cell migration into the central nervous system (CNS), avoiding unwanted inflammation under the normal state. However, immune cells can traverse the BBB when inflammation occurs within the CNS, suggesting a certain signal that creates a gateway that bypasses the BBB might exist. We revealed the inflammation amplifier as a mechanism of this signal, and identified dorsal vessels of the fifth lumber (L5) spinal cord as the gateway. The inflammation amplifier is driven by a simultaneous activation of NF-κB and STATs in non-immune cells, causing the production of a large amount of inflammatory chemokines to open the gateway at L5 vessels. It was found that the activation of the amplifier can be modulated by neural activation and artificially operated by electric pulses followed by establishment of new gateways, Gateway Reflex, at least in mice. Furthermore, genes required for the inflammation amplifier have been identified and are highly associated with various inflammatory diseases and disorders in the CNS. Thus, physical and/or pharmacological manipulation of the inflammation amplifier holds therapeutic value to control neuro-inflammation. © The Authors 2014. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  9. Adverse Husbandry of Maraena Whitefish Directs the Immune System to Increase Mobilization of Myeloid Cells and Proinflammatory Responses

    PubMed Central

    Korytář, Tomáš; Nipkow, Mareen; Altmann, Simone; Goldammer, Tom; Köllner, Bernd; Rebl, Alexander

    2016-01-01

    Adverse life circumstances evoke a common “conserved transcriptional response to adversity” (CTRA) in mammalian leukocytes. To investigate whether this pattern is preserved in lower vertebrates, maraena whitefish (Coregonus maraena) were exposed for 9 days to different stocking densities: ~10 kg/m3 (low density), ~33 kg/m3 (moderate), ~60 kg/m3 (elevated), and ~100 kg/m3 (high). Transcriptome profiling in the liver and kidney of individuals from each group suggested that crowding conditions activate stress-related signaling and effector pathways. Remarkably, about one-quarter of the genes differentially expressed under crowding conditions were involved in the activation of immune pathways such as acute-phase response and interleukin/TNF signaling attended by the simultaneous reduction of antiviral potency. Network analysis confirmed the complex interdigitation of immune- and stress-relevant pathways with interleukin-1 playing a central role. Antibody-based techniques revealed remarkable changes in the blood composition of whitefish and demonstrated the correlation between increasing stocking densities and elevated number of myeloid cells together with the increased phagocytic activity of peripheral blood leukocytes. In line with current studies in mammals, we conclude that crowding stress triggers in whitefish hallmarks of a CTRA, indicating that the stress-induced molecular mechanisms regulating the immune responses not only are conserved within mammals but were established earlier in evolution. PMID:28066440

  10. Measuring safety and quality to improve clinical outcomes--current activities and future directions for the Australian Cardiac Procedures Registry.

    PubMed

    Reid, Christopher M; Brennan, Angela L; Dinh, Diem T; Billah, Baki; Costolloe, Carl B; Shardey, Gilbert C; Ajani, Andrew E

    2010-10-18

    Routine monitoring of performance in the provision of cardiac services aids quality assurance and enables comparisons of performance to national and international standards. The Australasian Society of Cardiac and Thoracic Surgeons conducts a surgical registry that has grown from six hospitals participating in 2001 to 21 contributing in 2010. Variation in performance is monitored on a quarterly basis through the use of control chart methodology, and a peer-review mechanism and governance process for reporting have been established. Proposed future developments of the registry include its expansion to include interventional cardiology procedures, such as implantation of stents and cardiac devices, and a modular format, with the patient rather than the procedure being the key element of the system. An Australian Cardiac Procedures Registry will provide information to stakeholders, including consumers, clinicians, health funders and policymakers, on performance standards and quality of care of medical services affecting an ever-increasing number of Australians.

  11. Homologous RIG-I–like helicase proteins direct RNAi-mediated antiviral immunity in C. elegans by distinct mechanisms

    PubMed Central

    Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Ding, Shou-Wei; Lu, Rui

    2013-01-01

    RNAi-mediated antiviral immunity in Caenorhabditis elegans requires Dicer-related helicase 1 (DRH-1), which encodes the helicase and C-terminal domains homologous to the mammalian retinoic acid inducible gene I (RIG-I)-like helicase (RLH) family of cytosolic immune receptors. Here we show that the antiviral function of DRH-1 requires the RIG-I homologous domains as well as its worm-specific N-terminal domain. We also demonstrate that the helicase and C-terminal domains encoded by either worm DRH-2 or human RIG-I can functionally replace the corresponding domains of DRH-1 to mediate antiviral RNAi in C. elegans. Notably, substitutions in a three-residue motif of the C-terminal regulatory domain of RIG-I that physically interacts with viral double-stranded RNA abolish the antiviral activity of C-terminal regulatory domains of both RIG-I and DRH-1 in C. elegans. Genetic analysis revealed an essential role for both DRH-1 and DRH-3 in C. elegans antiviral RNAi targeting a natural viral pathogen. However, Northern blot and small RNA deep sequencing analyses indicate that DRH-1 acts to enhance production of viral primary siRNAs, whereas DRH-3 regulates antiviral RNAi by participating in the biogenesis of secondary siRNAs after Dicer-dependent production of primary siRNAs. We propose that DRH-1 facilitates the acquisition of viral double-stranded RNA by the worm dicing complex for the subsequent processing into primary siRNAs. The strong parallel for the antiviral function of RLHs in worms and mammals suggests that detection of viral double-stranded RNA may activate completely unrelated effector mechanisms or, alternatively, that the mammalian RLHs have a conserved activity to stimulate production of viral siRNAs for antiviral immunity by an RNAi effector mechanism. PMID:24043766

  12. The structural HCV genes delivered by MPG cell penetrating peptide are directed to enhance immune responses in mice model.

    PubMed

    Mehrlatifan, Saloume; Mirnurollahi, Seyyedeh Masumeh; Motevalli, Fatemeh; Rahimi, Pooneh; Soleymani, Sepehr; Bolhassani, Azam

    2016-10-01

    One of the significant problems in vaccination projects is the lack of an effective vaccine against hepatitis C virus (HCV). The goal of the current study is to evaluate and compare two DNA constructs encoding HCV core and coreE1E2 genes alone or complexed with MPG peptide as a delivery system for stimulation of antibody responses and IFN-γ secretion in Balb/c mice model. Indeed, MPG cell penetrating peptide was used to improve DNA immunization in mice. Our results demonstrated that MPG forms stable non-covalent nanoparticles with pcDNA-core and pcDNA-coreE1E2 at an N/P ratio of 10:1. The in vitro transfection efficiency of core or coreE1E2 DNA using MPG and TurboFect delivery systems was confirmed by western blot analysis. The results indicated the expression of the full-length core (∼21 kDa), and coreE1E2 (∼83 kDa) proteins using an anti-His monoclonal antibody. In addition, the expression of HCV core and coreE1E2 proteins was performed in bacteria and the purified recombinant proteins were injected to mice with Montanide 720 adjuvant. Our data showed that the immunized mice with HCV core and coreE1E2 proteins generated the mixture of sera IgG1 and IgG2a isotypes considerably higher than other groups. Furthermore, DNA constructs encoding core and coreE1E2 complexed with MPG could significantly induce IFN-γ secretion in lower concentrations than the naked core and coreE1E2 DNAs. Taken together, the DNA formulations as well as protein regimens used in this study triggered high-level IFN-γ production in mice, an important feature for the development of Th1 immune responses.

  13. Nucleolin directly mediates Epstein-Barr virus immune evasion through binding to G-quadruplexes of EBNA1 mRNA.

    PubMed

    Lista, María José; Martins, Rodrigo Prado; Billant, Olivier; Contesse, Marie-Astrid; Findakly, Sarah; Pochard, Pierre; Daskalogianni, Chrysoula; Beauvineau, Claire; Guetta, Corinne; Jamin, Christophe; Teulade-Fichou, Marie-Paule; Fåhraeus, Robin; Voisset, Cécile; Blondel, Marc

    2017-07-07

    The oncogenic Epstein-Barr virus (EBV) evades the immune system but has an Achilles heel: its genome maintenance protein EBNA1, which is essential for viral genome maintenance but highly antigenic. EBV has seemingly evolved a system in which the mRNA sequence encoding the glycine-alanine repeats (GAr) of the EBNA1 protein limits its expression to the minimal level necessary for function while minimizing immune recognition. Here, we identify nucleolin (NCL) as a host factor required for this process via a direct interaction with G-quadruplexes formed in GAr-encoding mRNA sequence. Overexpression of NCL enhances GAr-based inhibition of EBNA1 protein expression, whereas its downregulation relieves the suppression of both expression and antigen presentation. Moreover, the G-quadruplex ligand PhenDC3 prevents NCL binding to EBNA1 mRNA and reverses GAr-mediated repression of EBNA1 expression and antigen presentation. Hence the NCL-EBNA1 mRNA interaction is a relevant therapeutic target to trigger an immune response against EBV-carrying cancers.

  14. Nucleolin directly mediates Epstein-Barr virus immune evasion through binding to G-quadruplexes of EBNA1 mRNA

    PubMed Central

    Lista, María José; Martins, Rodrigo Prado; Billant, Olivier; Contesse, Marie-Astrid; Findakly, Sarah; Pochard, Pierre; Daskalogianni, Chrysoula; Beauvineau, Claire; Guetta, Corinne; Jamin, Christophe; Teulade-Fichou, Marie-Paule; Fåhraeus, Robin; Voisset, Cécile; Blondel, Marc

    2017-01-01

    The oncogenic Epstein-Barr virus (EBV) evades the immune system but has an Achilles heel: its genome maintenance protein EBNA1, which is essential for viral genome maintenance but highly antigenic. EBV has seemingly evolved a system in which the mRNA sequence encoding the glycine-alanine repeats (GAr) of the EBNA1 protein limits its expression to the minimal level necessary for function while minimizing immune recognition. Here, we identify nucleolin (NCL) as a host factor required for this process via a direct interaction with G-quadruplexes formed in GAr-encoding mRNA sequence. Overexpression of NCL enhances GAr-based inhibition of EBNA1 protein expression, whereas its downregulation relieves the suppression of both expression and antigen presentation. Moreover, the G-quadruplex ligand PhenDC3 prevents NCL binding to EBNA1 mRNA and reverses GAr-mediated repression of EBNA1 expression and antigen presentation. Hence the NCL-EBNA1 mRNA interaction is a relevant therapeutic target to trigger an immune response against EBV-carrying cancers. PMID:28685753

  15. Protective immune-response of aluminium hydroxide gel adjuvanted phage lysate of Brucella abortus S19 in mice against direct virulent challenge with B. abortus 544.

    PubMed

    Jain, Lata; Rawat, Mayank; Prajapati, Awadhesh; Tiwari, Ashok Kumar; Kumar, Bablu; Chaturvedi, V K; Saxena, H M; Ramakrishnan, Sarvanan; Kumar, Jatin; Kerketta, Priscilla

    2015-09-01

    The prophylactic efficacies of plain and alum adsorbed lysate were evaluated by direct virulent challenge in mice model. A recently isolated brucellaphage 'ϕLd' was used for generation of lysates. Twenty four h incubated Brucella abortus S19 broth cultures standardized to contain approximately 10(8) CFU/ml were found suitable for generation of lysates. Three lysate batches produced through separate cycles did not show any significant variation with respect to protein and polysaccharide contents, endotoxin level and phage counts, indicating that compositionally stable lysate preparations can be generated through an optimized production process. Three polypeptides of ∼16, 19 and 23 kDa could be identified as immuno-dominant antigens of the lysate which induced both humoral and cell-mediated immune responses in a dose dependent manner. Results of efficacy evaluation trial confirmed dose-dependent protective potencies of lysate preparation. The lysate with an antigenic dose of 0.52 μg protein and 60 μg CHO adsorbed on aluminium gel (0.1 percent aluminium concentration) exhibited the highest protective potency which was greater than that induced by standard S19 vaccine. Phage lysate methodology provides a very viable option through which an improved immunizing preparation with all desirable traits can be developed against brucellosis, and integrated with immunization programmes in a more efficient manner.

  16. Immunology-directed methods for distributed robotics: a novel immunity-based architecture for robust control and coordination

    NASA Astrophysics Data System (ADS)

    Singh, Surya P. N.; Thayer, Scott M.

    2002-02-01

    This paper presents a novel algorithmic architecture for the coordination and control of large scale distributed robot teams derived from the constructs found within the human immune system. Using this as a guide, the Immunology-derived Distributed Autonomous Robotics Architecture (IDARA) distributes tasks so that broad, all-purpose actions are refined and followed by specific and mediated responses based on each unit's utility and capability to timely address the system's perceived need(s). This method improves on initial developments in this area by including often overlooked interactions of the innate immune system resulting in a stronger first-order, general response mechanism. This allows for rapid reactions in dynamic environments, especially those lacking significant a priori information. As characterized via computer simulation of a of a self-healing mobile minefield having up to 7,500 mines and 2,750 robots, IDARA provides an efficient, communications light, and scalable architecture that yields significant operation and performance improvements for large-scale multi-robot coordination and control.

  17. Huo-Luo-Xiao-Ling Dan modulates antigen-directed immune response in adjuvant-induced inflammation

    PubMed Central

    Rajaiah, Rajesh; Lee, David Y.-W.; Ma, Zhongze; Fan, Arthur Y.; Lao, Lixing; Fong, Harry HS; Berman, Brian M.; Moudgil, Kamal D.

    2010-01-01

    Ethnopharmacological relevance HLXL is a traditional Chinese medicine that has long been used in folk medicine for the treatment of chronic inflammatory diseases. However, the precise immunological mechanisms by which HLXL mediates its anti-inflammatory activity are not fully defined. Aim of the study To determine the effects of HLXL on antigen-specific immune parameters in adjuvant-induced inflammation model in the Lewis rat. Materials and Methods Rats were fed daily with either HLXL (2.3 g/kg) or vehicle (water) beginning 3 d before subcutaneous injection of heat-killed M. tuberculosis H37Ra (Mtb), and then continued for another 6 d. After 9 d of Mtb injection, the draining lymph node cells were tested for T cell proliferative and cytokine responses against mycobacterial heat-shock protein 65 (Bhsp65). Moreover, sera were tested for anti-Bhsp65 antibodies and nitric oxide (NO). Results HLXL-treated rats showed reduced T cell proliferative response to Bhsp65 compared to control rats. Furthermore, HLXL suppressed IL-17 response but enhanced IL-10 response without much effect on IFN-γ. HLXL treatment also reduced the levels of anti-Bhsp65 antibodies but not that of NO. Conclusions HLXL feeding modulated both the cellular and the humoral immune response to Bhsp65 favoring an anti-inflammatory milieu for suppression of adjuvant-induced inflammation. PMID:19429337

  18. Intraclass Correlation Coefficients in Hierarchical Design Studies with Discrete Response Variables: A Note on a Direct Interval Estimation Procedure

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.

    2015-01-01

    A latent variable modeling procedure that can be used to evaluate intraclass correlation coefficients in two-level settings with discrete response variables is discussed. The approach is readily applied when the purpose is to furnish confidence intervals at prespecified confidence levels for these coefficients in setups with binary or ordinal…

  19. Intraclass Correlation Coefficients in Hierarchical Design Studies with Discrete Response Variables: A Note on a Direct Interval Estimation Procedure

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.

    2015-01-01

    A latent variable modeling procedure that can be used to evaluate intraclass correlation coefficients in two-level settings with discrete response variables is discussed. The approach is readily applied when the purpose is to furnish confidence intervals at prespecified confidence levels for these coefficients in setups with binary or ordinal…

  20. New alternating direction procedures in finite element analysis based upon EBE approximate factorizations. [element-by-element

    NASA Technical Reports Server (NTRS)

    Hughes, T. J. R.; Winget, J.; Levit, I.; Tezduyar, T. E.

    1983-01-01

    Element-by-element approximate factorization procedures are proposed for solving the large finite element equation systems which arise in computational mechanics. A variety of techniques are compared on problems of structural mechanics, heat conduction and fluid mechanics. The results obtained suggest considerable potential for the methods described.

  1. Virologic, Clinical, and Immune Response Outcomes of Patients With Hepatitis C Virus-Associated Cryoglobulinemia Treated With Direct-Acting Antivirals.

    PubMed

    Bonacci, Martín; Lens, Sabela; Londoño, María-Carlota; Mariño, Zoe; Cid, Maria C; Ramos-Casals, Manuel; Sánchez-Tapias, Jose María; Forns, Xavier; Hernández-Rodríguez, José

    2017-04-01

    Cryoglobulins (circulating immune complexes of polyclonal IgG, monoclonal IgM, and rheumatoid factor) are detected in the circulation of 40% to 60% of patients with chronic hepatitis C virus infection, and cryoglobulinemic vasculitis (CV) is observed in approximately 10% of patients. We aimed to assess the clinical and immune effects of direct-acting antiviral treatment. We performed a prospective study of 64 patients with HCV infection with circulating cryoglobulins receiving direct-acting antiviral therapy at a single center in Barcelona, Spain, from January 2014 through April 2016. Patients were classified as having CV (n = 35) or asymptomatic circulating cryoglobulins (ACC, n = 29). Clinical response was considered complete if a patient's Birmingham Vasculitis Activity Score (version 3) was 0, or if all affected organs improved 12 weeks after the end of therapy. A complete immunologic response (CIR) was defined as no detection of circulating cryoglobulins and normalized levels of complement and/or rheumatoid factor. Clinical manifestations of CV included purpura (65%), weakness (70%), arthralgia (31%), myalgia (20%), peripheral neuropathy (50%), and renal involvement (20%). At baseline, patients with CV had significantly higher levels of rheumatoid factor and lower levels of C4 complement than patients with ACC, whereas cryocrits were similar between groups (3.2% vs 2.6%). Overall, 60 patients (94%) had a sustained viral response 12 weeks after therapy. Among patients with CV, the median Birmingham Vasculitis Activity Score (version 3) decreased from 9 (range, 2-31) to 3 (range, 0-12) (P < .001). Twenty-five patients with CV (71%) achieved a complete clinical response. Immune-suppressive therapy was reduced for 4 of 13 patients and withdrawn for 6 of 13. Overall, 48% of patients achieved a CIR. A low baseline cryocrit level (<2.7%) was the only factor associated with CIR (odds ratio, 9.8; 95% confidence interval, 2.2-44; P = .03). Viral eradication was

  2. Immunization: A Handbook for Schools. Vaccine-Preventable Communicable Disease Control. Second Edition.

    ERIC Educational Resources Information Center

    New York State Education Dept., Albany. Bureau of School Health Education and Services.

    This handbook was developed by the Bureau of School Health Education and Services of the New York State Education Department to provide school authorities with a guide for an effective school immunization program. It offers direction for local development of immunization policies and procedures, an overview of effective program activities, a…

  3. Immunization: A Handbook for Schools. Vaccine-Preventable Communicable Disease Control. Second Edition.

    ERIC Educational Resources Information Center

    New York State Education Dept., Albany. Bureau of School Health Education and Services.

    This handbook was developed by the Bureau of School Health Education and Services of the New York State Education Department to provide school authorities with a guide for an effective school immunization program. It offers direction for local development of immunization policies and procedures, an overview of effective program activities, a…

  4. Using Consensus Building Procedures with Expert Raters to Establish Comparison Scores of Behavior for Direct Behavior Rating

    ERIC Educational Resources Information Center

    Jaffery, Rose; Johnson, Austin H.; Bowler, Mark C.; Riley-Tillman, T. Chris; Chafouleas, Sandra M.; Harrison, Sayward E.

    2015-01-01

    To date, rater accuracy when using Direct Behavior Rating (DBR) has been evaluated by comparing DBR-derived data to scores yielded through systematic direct observation. The purpose of this study was to evaluate an alternative method for establishing comparison scores using expert-completed DBR alongside best practices in consensus building…

  5. Using Consensus Building Procedures with Expert Raters to Establish Comparison Scores of Behavior for Direct Behavior Rating

    ERIC Educational Resources Information Center

    Jaffery, Rose; Johnson, Austin H.; Bowler, Mark C.; Riley-Tillman, T. Chris; Chafouleas, Sandra M.; Harrison, Sayward E.

    2015-01-01

    To date, rater accuracy when using Direct Behavior Rating (DBR) has been evaluated by comparing DBR-derived data to scores yielded through systematic direct observation. The purpose of this study was to evaluate an alternative method for establishing comparison scores using expert-completed DBR alongside best practices in consensus building…

  6. Evaluation of solution procedures for material and/or geometrically nonlinear structural analysis by the direct stiffness method.

    NASA Technical Reports Server (NTRS)

    Stricklin, J. A.; Haisler, W. E.; Von Riesemann, W. A.

    1972-01-01

    This paper presents an assessment of the solution procedures available for the analysis of inelastic and/or large deflection structural behavior. A literature survey is given which summarized the contribution of other researchers in the analysis of structural problems exhibiting material nonlinearities and combined geometric-material nonlinearities. Attention is focused at evaluating the available computation and solution techniques. Each of the solution techniques is developed from a common equation of equilibrium in terms of pseudo forces. The solution procedures are applied to circular plates and shells of revolution in an attempt to compare and evaluate each with respect to computational accuracy, economy, and efficiency. Based on the numerical studies, observations and comments are made with regard to the accuracy and economy of each solution technique.

  7. Evaluation of solution procedures for material and/or geometrically nonlinear structural analysis by the direct stiffness method.

    NASA Technical Reports Server (NTRS)

    Stricklin, J. A.; Haisler, W. E.; Von Riesemann, W. A.

    1972-01-01

    This paper presents an assessment of the solution procedures available for the analysis of inelastic and/or large deflection structural behavior. A literature survey is given which summarized the contribution of other researchers in the analysis of structural problems exhibiting material nonlinearities and combined geometric-material nonlinearities. Attention is focused at evaluating the available computation and solution techniques. Each of the solution techniques is developed from a common equation of equilibrium in terms of pseudo forces. The solution procedures are applied to circular plates and shells of revolution in an attempt to compare and evaluate each with respect to computational accuracy, economy, and efficiency. Based on the numerical studies, observations and comments are made with regard to the accuracy and economy of each solution technique.

  8. Characteristics of gastrointestinal stromal tumours, diagnostic procedure and therapeutic management and main directions of nursing practice in gastrointestinal stromal tumours

    PubMed Central

    Głuszek, Stanisław; Kozieł, Dorota

    2014-01-01

    Gastrointestinal stromal tumours (GIST) constitute a separate group of mesenchymal neoplasms of the gastrointestinal tract. They have been commonly recognized for a few years, they have created a new problem in medical practice. GIST are more often centred in the stomach. They equally affect female and male patients and occur mainly in patients older than 50 years of age. The clinical picture of the tumour is non-specific. Radical surgical treatment and molecularly targeted therapy with tyrosine kinase inhibitors are used in GIST treatment. Nursing practice with reference to GIST danger is connected with biopsychosocial interventions of perioperative, oncological and palliative procedures and involves the area of health education mainly oriented towards shaping preventive procedures which favour early disease detection and support therapy and recovery. PMID:25784835

  9. An intervention to improve the catheter associated urinary tract infection rate in a medical intensive care unit: Direct observation of catheter insertion procedure.

    PubMed

    Galiczewski, Janet M; Shurpin, Kathleen M

    2017-06-01

    Healthcare associated infections from indwelling urinary catheters lead to increased patient morbidity and mortality. The purpose of this study was to determine if direct observation of the urinary catheter insertion procedure, as compared to the standard process, decreased catheter utilization and urinary tract infection rates. This case control study was conducted in a medical intensive care unit. During phase I, a retrospective data review was conducted on utilsiation and urinary catheter infection rates when practitioners followed the institution's standard insertion algorithm. During phase II, an intervention of direct observation was added to the standard insertion procedure. The results demonstrated no change in utilization rates, however, CAUTI rates decreased from 2.24 to 0 per 1000 catheter days. The findings from this study may promote changes in clinical practice guidelines leading to a reduction in urinary catheter utilization and infection rates and improved patient outcomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. The Arabidopsis transcription factor BRASSINOSTEROID INSENSITIVE1-ETHYL METHANESULFONATE-SUPPRESSOR1 is a direct substrate of MITOGEN-ACTIVATED PROTEIN KINASE6 and regulates immunity.

    PubMed

    Kang, Sining; Yang, Fan; Li, Lin; Chen, Huamin; Chen, She; Zhang, Jie

    2015-03-01

    Pathogen-associated molecular patterns (PAMPs) are recognized by plant pattern recognition receptors to activate PAMP-triggered immunity (PTI). Mitogen-activated protein kinases (MAPKs), as well as other cytoplasmic kinases, integrate upstream immune signals and, in turn, dissect PTI signaling via different substrates to regulate defense responses. However, only a few direct substrates of these signaling kinases have been identified. Here, we show that PAMP perception enhances phosphorylation of BRASSINOSTEROID INSENSITIVE1-ETHYL METHANESULFONATE-SUPPRESSOR1 (BES1), a transcription factor involved in brassinosteroid (BR) signaling pathway, through pathogen-induced MAPKs in Arabidopsis (Arabidopsis thaliana). BES1 interacts with MITOGEN-ACTIVATED PROTEIN KINASE6 (MPK6) and is phosphorylated by MPK6. bes1 loss-of-function mutants display compromised resistance to bacterial pathogen Pseudomonas syringae pv tomato DC3000. BES1 S286A/S137A double mutation (BES1(SSAA)) impairs PAMP-induced phosphorylation and fails to restore bacterial resistance in bes1 mutant, indicating a positive role of BES1 phosphorylation in plant immunity. BES1 is phosphorylated by glycogen synthase kinase3 (GSK3)-like kinase BR-insensitive2 (BIN2), a negative regulator of BR signaling. BR perception inhibits BIN2 activity, allowing dephosphorylation of BES1 to regulate plant development. However, BES1(SSAA) does not affect BR-mediated plant growth, suggesting differential residue requirements for the modulation of BES1 phosphorylation in PTI and BR signaling. Our study identifies BES1 as a unique direct substrate of MPK6 in PTI signaling. This finding reveals MAPK-mediated BES1 phosphorylation as another BES1 modulation mechanism in plant cell signaling, in addition to GSK3-like kinase-mediated BES1 phosphorylation and F box protein-mediated BES1 degradation.

  11. CHOICE - Directed Study: Consequences of longterm- Confinement and Hypobaric HypOxia on Immunity in the Antarctic Concordia Environment

    NASA Technical Reports Server (NTRS)

    Sams, Clarence; Pierson, Duane; Crucian, Brian; Chouker, Alexander; Feurecker, matthias; Salem, Alexander; Stowe, Raymond; Mehta, Satish; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2010-01-01

    Concerning ground-based space physiological research, the choice of analog must carefully match the system of interest. For spaceflight-associated immune dysregulation (SAID), Antarctica winter-over has emerged as potentially the best terrestrial analog. The prolonged mission durations, extreme/dangerous environment, station-based lifestyle, isolation from outside world, disrupted circadian rhythms, and other psychological aspects make this analog extremely high fidelity for exploration-class space missions (long duration lunar, Mars). NASA, ESA and RSA are currently investigating SAID, with NASA currently operating the Integrated Immune flight study. It is desirable to have a ground analog for SAID validated, so that potential countermeasures might be validated terrestrially prior to during flight. For this presentation, NASA data collected on the winterover 2009 crewmembers, baseline through early deployment will be presented. Through early deployment (approximately 2-3 weeks at Concordia), phenotypic alterations included increased levels of memory T cells, shifts among the CD8+ T cell compartment to a more mature phenotype, and increases in constitutively activated T cells. CD8+/IFNg+ T cell percentages, and T cell blastogenesis functional responses were depressed early deployment as compared to healthy controls. In four compatible subjects, secreted T cell Th1/Th2 cytokines were measured following culture stimulation, and a Th2 shift was observed as compared to controls. Post-winter over frozen sample return will be required to determine if this shift persisted during the winter over period. Additionally, circadian rhythms remained altered compared to baseline, as determined through 5x daily cortisol measurements. Latent viral reactivation will not be determined until frozen sample return occurs.

  12. MicroRNA-33–dependent regulation of macrophage metabolism directs immune cell polarization in atherosclerosis

    PubMed Central

    Ouimet, Mireille; Ediriweera, Hasini N.; Gundra, U. Mahesh; Sheedy, Frederick J.; Ramkhelawon, Bhama; Hutchison, Susan B.; Rinehold, Kaitlyn; van Solingen, Coen; Fullerton, Morgan D.; Cecchini, Katharine; Rayner, Katey J.; Steinberg, Gregory R.; Zamore, Phillip D.; Fisher, Edward A.; Loke, P’ng; Moore, Kathryn J.

    2015-01-01

    Cellular metabolism is increasingly recognized as a controller of immune cell fate and function. MicroRNA-33 (miR-33) regulates cellular lipid metabolism and represses genes involved in cholesterol efflux, HDL biogenesis, and fatty acid oxidation. Here, we determined that miR-33–mediated disruption of the balance of aerobic glycolysis and mitochondrial oxidative phosphorylation instructs macrophage inflammatory polarization and shapes innate and adaptive immune responses. Macrophage-specific Mir33 deletion increased oxidative respiration, enhanced spare respiratory capacity, and induced an M2 macrophage polarization–associated gene profile. Furthermore, miR-33–mediated M2 polarization required miR-33 targeting of the energy sensor AMP-activated protein kinase (AMPK), but not cholesterol efflux. Notably, miR-33 inhibition increased macrophage expression of the retinoic acid–producing enzyme aldehyde dehydrogenase family 1, subfamily A2 (ALDH1A2) and retinal dehydrogenase activity both in vitro and in a mouse model. Consistent with the ability of retinoic acid to foster inducible Tregs, miR-33–depleted macrophages had an enhanced capacity to induce forkhead box P3 (FOXP3) expression in naive CD4+ T cells. Finally, treatment of hypercholesterolemic mice with miR-33 inhibitors for 8 weeks resulted in accumulation of inflammation-suppressing M2 macrophages and FOXP3+ Tregs in plaques and reduced atherosclerosis progression. Collectively, these results reveal that miR-33 regulates macrophage inflammation and demonstrate that miR-33 antagonism is atheroprotective, in part, by reducing plaque inflammation by promoting M2 macrophage polarization and Treg induction. PMID:26517695

  13. Taishan Pinus massoniana pollen polysaccharide inhibits subgroup J avian leucosis virus infection by directly blocking virus infection and improving immunity

    PubMed Central

    Yu, Cuilian; Wei, Kai; Liu, Liping; Yang, Shifa; Hu, Liping; Zhao, Peng; Meng, Xiuyan; Shao, Mingxu; Wang, Chuanwen; Zhu, Lijun; Zhang, Hao; Li, Yang; Zhu, Ruiliang

    2017-01-01

    Subgroup J avian leucosis virus (ALV-J) generally causes neoplastic diseases, immunosuppression and subsequently increases susceptibility to secondary infection in birds. The spread of ALV-J mainly depends on congenital infection and horizontal contact. Although ALV-J infection causes enormous losses yearly in the poultry industry worldwide, effective measures to control ALV-J remain lacking. In this study, we demonstrated that Taishan Pinus massoniana pollen polysaccharide (TPPPS), a natural polysaccharide extracted from Taishan Pinus massoniana pollen, can significantly inhibit ALV-J replication in vitro by blocking viral adsorption to host cells. Electron microscopy and blocking ELISA tests revealed that TPPPS possibly blocks viral adsorption to host cells by interacting with the glycoprotein 85 protein of ALV-J. Furthermore, we artificially established a congenitally ALV-J-infected chicken model to examine the anti-viral effects of TPPPS in vivo. TPPPS significantly inhibited viral shedding and viral loads in immune organs and largely eliminated the immunosuppression caused by congenital ALV-J infection. Additionally, pre-administration of TPPPS obviously reduced the size and delayed the occurrence of tumors induced by acute oncogenic ALV-J infection. This study revealed the prominent effects and feasible mechanisms of TPPPS in inhibiting ALV-J infection, thereby providing a novel prospect to control ALV-J spread. PMID:28287165

  14. Taishan Pinus massoniana pollen polysaccharide inhibits subgroup J avian leucosis virus infection by directly blocking virus infection and improving immunity.

    PubMed

    Yu, Cuilian; Wei, Kai; Liu, Liping; Yang, Shifa; Hu, Liping; Zhao, Peng; Meng, Xiuyan; Shao, Mingxu; Wang, Chuanwen; Zhu, Lijun; Zhang, Hao; Li, Yang; Zhu, Ruiliang

    2017-03-13

    Subgroup J avian leucosis virus (ALV-J) generally causes neoplastic diseases, immunosuppression and subsequently increases susceptibility to secondary infection in birds. The spread of ALV-J mainly depends on congenital infection and horizontal contact. Although ALV-J infection causes enormous losses yearly in the poultry industry worldwide, effective measures to control ALV-J remain lacking. In this study, we demonstrated that Taishan Pinus massoniana pollen polysaccharide (TPPPS), a natural polysaccharide extracted from Taishan Pinus massoniana pollen, can significantly inhibit ALV-J replication in vitro by blocking viral adsorption to host cells. Electron microscopy and blocking ELISA tests revealed that TPPPS possibly blocks viral adsorption to host cells by interacting with the glycoprotein 85 protein of ALV-J. Furthermore, we artificially established a congenitally ALV-J-infected chicken model to examine the anti-viral effects of TPPPS in vivo. TPPPS significantly inhibited viral shedding and viral loads in immune organs and largely eliminated the immunosuppression caused by congenital ALV-J infection. Additionally, pre-administration of TPPPS obviously reduced the size and delayed the occurrence of tumors induced by acute oncogenic ALV-J infection. This study revealed the prominent effects and feasible mechanisms of TPPPS in inhibiting ALV-J infection, thereby providing a novel prospect to control ALV-J spread.

  15. The Serine Protease Pic From Enteroaggregative Escherichia coli Mediates Immune Evasion by the Direct Cleavage of Complement Proteins.

    PubMed

    Abreu, Afonso G; Fraga, Tatiana R; Granados Martínez, Adriana P; Kondo, Marcia Y; Juliano, Maria A; Juliano, Luiz; Navarro-Garcia, Fernando; Isaac, Lourdes; Barbosa, Angela S; Elias, Waldir P

    2015-07-01

    Enteroaggregative and uropathogenic Escherichia coli, Shigella flexneri 2a, and the hybrid enteroaggregative/Shiga toxin-producing E. coli strain (O104:H4) are important pathogens responsible for intestinal and urinary tract infections, as well as sepsis and hemolytic uremic syndrome. They have in common the production of a serine protease called Pic. Several biological roles for Pic have been described, including protection of E. coli DH5α from complement-mediated killing. Hereby we showed that Pic significantly reduces complement activation by all 3 pathways. Pic cleaves purified C3/C3b and other proteins from the classic and lectin pathways, such as C4 and C2. Cleavage fragments of C3, C4, and C2 were also observed with HB101(pPic1) culture supernatants, and C3 cleavage sites were mapped by fluorescence resonance energy transfer peptides. Experiments using human serum as a source of complement proteins confirmed Pic proteolytic activity on these proteins. Furthermore, Pic works synergistically with the human complement regulators factor I and factor H, promoting inactivation of C3b. In the presence of both regulators, further degradation of C3 α' chain was observed. Therefore, Pic may contribute to immune evasion of E. coli and S. flexneri, favoring invasiveness and increasing the severity of the disorders caused by these pathogens.

  16. Noninvasive aortic bloodflow by Pulsed Doppler Echocardiography (PDE) compared to cardiac output by the direct Fick procedure

    NASA Technical Reports Server (NTRS)

    1980-01-01

    Left ventricular stroke volume was estimated from the systolic velocity integral in the ascending aorta by pulsed Doppler Echocardiography (PDE) and the cross sectional area of the aorta estimated by M mode echocardiography on 15 patients with coronary disease undergoing right catheterization for diagnostic purposes. Cardiac output was calculated from stroke volume and heart volume using the PDE method as well as the Fick procedure for comparison. The mean value for the cardiac output via the PDE method (4.42 L/min) was only 6% lower than for the cardiac output obtained from the Fick procedure (4.69 L/min) and the correlation between the two methods was excellent (r=0.967, p less than .01). The good agreement between the two methods demonstrates that the PDE technique offers a reliable noninvasive alternative for estimating cardiac output, requiring no active cooperation by the subject. It was concluded that the Doppler method is superior to the Fick method in that it provides beat by beat information on cardiac performance.

  17. Direct procedure for the production of 211At-labeled antibodies with an epsilon-lysyl-3-(trimethylstannyl)benzamide immunoconjugate.

    PubMed

    Lindegren, Sture; Frost, Sofia; Bäck, Tom; Haglund, Elin; Elgqvist, Jörgen; Jensen, Holger

    2008-09-01

    (211)At-labeled tumor-specific antibodies have long been considered for the treatment of disseminated cancer. However, the limited availability of the nuclide and the poor efficacy of labeling procedures at clinical activity levels present major obstacles to their use. This study evaluated a procedure for the direct astatination of antibodies for the production of clinical activity levels. The monoclonal antibody trastuzumab was conjugated with the reagent N-succinimidyl-3-(trimethylstannyl)benzoate, and the immunoconjugate was labeled with astatine. Before astatination of the conjugated antibody, the nuclide was activated with N-iodosuccinimide. The labeling reaction was evaluated in terms of reaction time, volume of reaction solvent, immunoconjugate concentration, and applied activity. The quality of the astatinated antibodies was determined by in vitro analysis and biodistribution studies in nude mice. The reaction proceeded almost instantaneously, and the results indicated a low dependence on immunoconjugate concentration and applied activity. Radiochemical labeling yields were in the range of 68%-81%, and a specific radioactivity of up to 1 GBq/mg could be achieved. Stability and radiochemical purity were equal to or better than those attained with a conventional 2-step procedure. Dissociation constants for directly astatinated, conventionally astatinated, and radioiodinated trastuzumab were 1.0+/-0.06 (mean+/-SD), 0.44+/-0.06, and 0.29+/-0.02 nM, respectively. The tissue distribution in non-tumor-bearing nude mice revealed only minor differences in organ uptake relative to that obtained with the conventional method. The direct astatination procedure enables the high-yield production of astatinated antibodies with radioactivity in the amounts required for clinical applications.

  18. The increase in intra-macrophage thiols induced by new pro-GSH molecules directs the Th1 skewing in ovalbumin immunized mice.

    PubMed

    Fraternale, Alessandra; Paoletti, Maria Filomena; Dominici, Sabrina; Caputo, Antonella; Castaldello, Arianna; Millo, Enrico; Brocca-Cofano, Egidio; Smietana, Michaël; Clayette, Pascal; Oiry, Joël; Benatti, Umberto; Magnani, Mauro

    2010-11-10

    In the present work, the capacity of new pro-GSH molecules to increase the intra-macrophage thiol content in vitro and in vivo as well as to shift the immune response to Th1 in ovalbumin (Ova)-sensitized mice were examined. The molecules were the N-butanoyl GSH derivative, GSH-C4, and a pro-drug of N-acetylcysteine (NAC) and beta-mercaptoethylamine (MEA), I-152. In vitro, 2h-incubation with both molecules was found to increase intra-macrophage thiol content; in vivo, Ova-sensitized mice pre-treated by intraperitoneal administration of the pro-GSH molecules showed an increase in plasma anti-Ova IgG2a and IgG2b, characterizing Th1 immune response, and a decrease in IgG1, typical of the Th2 response. Such findings were connected to a shift to a Th1 response also involving splenocyte IFN-γ production as revealed by ELISPOT assay and higher levels of IL-12 in circulation. Although immune responses are in vivo mediated both by dendritic cells and macrophages, the data reported in this paper corroborate the suggestion that the pro-GSH molecules, increasing the intra-cellular thiol pool, modulate the Th1/Th2 balance favouring Th1-type responses and may be employed as Th1-directing adjuvants in new vaccination protocols and as immunomodulators in those diseases where Th1 response patterns are compromised in favour of Th2.

  19. Field Test Evaluation of Conservation Retrofits of Low-Income, Single-Family Buildings in Wisconsin: Blower-Door-Directed Infiltration Reduction Procedure, Field Test Implementation and Results

    SciTech Connect

    Gettings, M.B.

    2001-05-21

    A blower-door-directed infiltration retrofit procedure was field tested on 18 homes in south central Wisconsin. The procedure, developed by the Wisconsin Energy Conservation Corporation, includes recommended retrofit techniques as well as criteria for estimating the amount of cost-effective work to be performed on a house. A recommended expenditure level and target air leakage reduction, in air changes per hour at 50 Pascal (ACH50), are determined from the initial leakage rate measured. The procedure produced an average 16% reduction in air leakage rate. For the 7 houses recommended for retrofit, 89% of the targeted reductions were accomplished with 76% of the recommended expenditures. The average cost of retrofits per house was reduced by a factor of four compared with previous programs. The average payback period for recommended retrofits was 4.4 years, based on predicted energy savings computed from achieved air leakage reductions. Although exceptions occurred, the procedure's 8 ACH50 minimum initial leakage rate for advising retrofits to be performed appeared a good choice, based on cost-effective air leakage reduction. Houses with initial rates of 7 ACH50 or below consistently required substantially higher costs to achieve significant air leakage reductions. No statistically significant average annual energy savings was detected as a result of the infiltration retrofits. Average measured savings were -27 therm per year, indicating an increase in energy use, with a 90% confidence interval of 36 therm. Measured savings for individual houses varied widely in both positive and negative directions, indicating that factors not considered affected the results. Large individual confidence intervals indicate a need to increase the accuracy of such measurements as well as understand the factors which may cause such disparity. Recommendations for the procedure include more extensive training of retrofit crews, checks for minimum air exchange rates to insure air quality

  20. Plasmacytoid Dendritic Cells Respond Directly to Apoptotic Cells by Secreting Immune Regulatory IL-10 or IFN-α

    PubMed Central

    Simpson, Joanne; Miles, Katherine; Trüb, Marta; MacMahon, Roisin; Gray, Mohini

    2016-01-01

    Plasmacytoid dendritic cells (pDCs) play a pivotal role in driving the autoimmune disease systemic lupus erythematosus, via the secretion of IFN-α in response to nuclear self-antigens complexed with autoantibodies. Apoptotic cells, generated at sites of inflammation or secondary lymphoid organs, are exposed to activated pDCs and also express the same nuclear antigens on their cell surface. Here, we show that in the absence of autoantibodies, activated pDCs directly respond to apoptotic cell-expressed chromatin complexes by secreting IL-10 and IL-6, which also induces T cells to secrete IL-10. Conversely, when activated by the viral mimetic CpG-A, apoptotic cells enhance their secretion of IFN-α. This study demonstrates that activated pDCs respond directly to apoptotic cells and may maintain tolerance via IL-10, or promote inflammation through secretion of IFN-α, depending on the inflammatory context. PMID:28018356

  1. Equine immunity to parasites.

    PubMed

    Klei, T R

    2000-04-01

    Helminths are among the most significant parasites of horses in developed countries. This article examines immune responses against helminth parasites and the implications that immunologic investigations have on vaccine development, improvement of diagnostic procedures, and disease eradication.

  2. Cells involved in the immune response. XXXVI. The thymic antigen-specific suppressor cell in the immunized rabbit is a T cell with receptors for FcG and the antigen and it acts, via a secreted suppressor factor, directly on the immune splenic AFC B cell to inhibit antibody secretion.

    PubMed Central

    Talor, E; Jodouin, C A; Richter, M

    1988-01-01

    Following i.v. immunization of the normal outbred rabbit with sheep (SRBC) or horse (HRBC) erythrocytes, antigen-specific suppressor cells are generated in the thymus capable of inhibiting the generation of haemolytic plaques by the autologous or allogeneic splenic antibody-forming cells (AFC) in the plaque-forming cell (PFC) assay. These suppressor cells secrete an antigen-specific suppressor factor in short-term (4-24 hr) culture in vitro. The suppressor cells are not detected in the thymus prior to Day 4, exhibit peak activity between Days 5 and 11 post-immunization, and decline slowly thereafter. Suppressor cells can no longer be detected in the thymus by Day 60 postimmunization. Suppressor cells are not detected in any of the other lymphoid organs of the immunized rabbit nor in any lymphoid organ in the unimmunized rabbit. The thymic suppressor cell is a T cell with surface receptors for the antigen (SRBC or HRBC) and for FcG. On the other hand, the AFC B cells generated in the spleen of the immunized rabbit possess cell-surface receptors for only the antigen and not for FcG. Both the suppressor cells and the secreted suppressor factor act directly on the AFC B lymphocytes to inhibit the generation of antigen-specific haemolytic plaques in the PFC assay. PMID:2455684

  3. A Unified Direct-Inverse Procedure for Two-Dimensional Boundary Layers Using Spline/Finite Difference Discretization.

    DTIC Science & Technology

    1987-02-01

    pt. 50 20 7 Potential 3b I-A 3 pt. 47 20 7 Potential 3c D 3 pt. 40 20 7 Hiemenz Fit 3d I-A 3 pt. 36 20 7 Hiemenz Fit V _ _ _ _ _ _ _ 4...the Hiemenz polynomial fit of the edge velocity for viscous flow. This case is included to test the ability of the direct and inverse methods to

  4. Directed selection of influenza virus produces antigenic variants that match circulating human virus isolates and escape from vaccine-mediated immune protection.

    PubMed

    DeDiego, Marta L; Anderson, Christopher S; Yang, Hongmei; Holden-Wiltse, Jeanne; Fitzgerald, Theresa; Treanor, John J; Topham, David J

    2016-06-01

    Influenza vaccination does not provide 100% protection from infection, partly due to antigenic drift of the haemagglutinin (HA) protein. Low serum antibody titres increase the risk of infection. To determine whether there were additional correlates of risk, we examined the relationship between human serum immunity and antigenic variation in seasonal H3N2 influenza viruses. Seasonal H3N2 vaccine strains grown in the presence of heterogeneous human or mono-specific ferret antisera selected variants with mutations in the HA antigenic sites. Surprisingly, circulating strains infecting human subjects in the same seasons displayed mutations in the same positions, although only in one case did the change correspond to the same amino acid. Serum antibody titres were lower against both the in vitro selected and clinical isolates compared with the vaccine strains, suggesting that the mutations are relevant to vaccine failure. Antibody titres were also significantly lower in sera from infected subjects than in non-infected subjects, suggesting relatively poor responses to vaccination in the infected subjects. Collectively, the data suggest that risk from influenza infection is a result of poor response to vaccination, as well as encounter with drifted seasonal influenza virus antigenic variants. The results also show that directed selection under human immune pressure could reveal antigenic variants relevant to real-world drifted viruses, helping in annual vaccine re-formulation. © 2016 The Authors. Immunology Published by John Wiley & Sons Ltd.

  5. Effect of formative evaluation using direct observation of procedural skills in assessment of postgraduate students of obstetrics and gynecology: Prospective study.

    PubMed

    Kumar, Naina; Singh, Namit Kant; Rudra, Samar; Pathak, Swanand

    2017-01-01

    Direct Observation of Procedural Skills (DOPS) is a way of evaluating procedural skills through observation in the workplace. The purpose of this study was to assess the role of DOPS in teaching and assessment of postgraduate students and to know the effect of repeated DOPS on improvement of the skills and confidence of the students. In both phases, significant difference was observed between the two groups on first DOPS comparison (1st phase: p=0.000; 2nd phase: p=0.002), with simulation group performing better. Comparison of sixth DOPS in the two groups revealed no difference in both phases, but significant difference on first and sixth DOPS comparison in each group (p=0.000). Repeated DOPS results in improved skills and confidence of students in managing real life obstetric emergencies irrespective of the teaching modality. Repeated DOPS results in improved skills and confidence of students in managing real life obstetric emergencies irrespective of the teaching modality.

  6. New procedure for direct measurements of absorbance of thin films of ultra-high absorbance UV blocks

    NASA Astrophysics Data System (ADS)

    McMillan, Norman D.; Solsvik, A.; Murphy, L.; Stevenson, A.; O'Neill, M.; Moore, J.

    2005-06-01

    A novel method for the measurement of ultra-high absorbance liquids has been devised and details are given of a new ultra absorbance instrument developed specifically for these thin liquid film measurements. The instrument specifically constructed for monitoring and measuring sunscreen products has been tested using locally produced sunscreen products. This new approach has been made possible by the development of very accurate liquid micro-dispensers and details are given of the novel procedure to carry out these measurements. Detailed description of the apparatus construction is given with photographs of the apparatus. The work described is largely based on research and quality control measurements of Parasol suncare products. Results on the reproducibility of measurements taken with the UAI for a commercial range of factor 20 sunscreen liquid are given and these have been used to validate the performance of the instrument. It is believed that the absorbance measurements described here are perhaps the largest ever reported. In addition, the photostability of this product has been monitored in aging tests. Finally, some studies have been done on two other commercially available factor 20 products that show that these are significantly worse with regards to both protection from ageing and burn.

  7. Preexisting Immunity and Low Expression in Primates Highlight Translational Challenges for Liver-directed AAV8-mediated Gene Therapy

    PubMed Central

    Hurlbut, Gregory D; Ziegler, Robin J; Nietupski, Jennifer B; Foley, Joseph W; Woodworth, Lisa A; Meyers, Elizabeth; Bercury, Scott D; Pande, Nilesh N; Souza, David W; Bree, Mark P; Lukason, Michael J; Marshall, John; Cheng, Seng H; Scheule, Ronald K

    2010-01-01

    Liver-directed gene therapy with adeno-associated virus (AAV) vectors effectively treats mouse models of lysosomal storage diseases (LSDs). We asked whether these results were likely to translate to patients. To understand to what extent preexisting anti-AAV8 antibodies could impede AAV8-mediated liver transduction in primates, commonly preexposed to AAV, we quantified the effects of preexisting antibodies on liver transduction and subsequent transgene expression in mouse and nonhuman primate (NHP) models. Using the highest viral dose previously reported in a clinical trial, passive transfer of NHP sera containing relatively low anti-AAV8 titers into mice blocked liver transduction, which could be partially overcome by increasing vector dose tenfold. Based on this and a survey of anti-AAV8 titers in 112 humans, we predict that high-dose systemic gene therapy would successfully transduce liver in >50% of human patients. However, although high-dose AAV8 administration to mice and monkeys with equivalent anti-AAV8 titers led to comparable liver vector copy numbers, the resulting transgene expression in primates was ~1.5-logs lower than mice. This suggests vector fate differs in these species and that strategies focused solely on overcoming preexisting vector-specific antibodies may be insufficient to achieve clinically meaningful expression levels of LSD genes using a liver-directed gene therapy approach in patients. PMID:20736932

  8. A fast procedure of stress state evaluation in magnetically anisotropic steels with the help of a probe with adjustable magnetizing field direction

    NASA Astrophysics Data System (ADS)

    Chmielewski, Marek; Piotrowski, Leszek; Augustyniak, Bolesław

    2017-04-01

    The paper presents a novel approach to the stress state evaluation issue. It deals with a strongly (magnetically) anisotropic materials for which a direct interpretation of the Barkhausen effect (BE) intensity would lead to erroneous results. In such a case one has to take into account both the measured BE intensity and the orientation of the magnetisation direction relative to the magnetic easy axis. For the in plane stress distribution evaluation one has to perform at least three measurements in the non-collinear directions. The application of an apparatus with automatically changing magnetizing field direction allows to obtain the angular distribution of the BE intensity in about 30 s (with the angular step of 10°). Thanks to the dedicated post-processing software the procedure of the measurement data processing, resulting in the full information on the stress distribution (main stress components and their orientation in all the investigated points) is almost instantaneous. Apart from the measurement results the stress determination procedure requires two additional pieces of information. The first one is the calibration data obtained for at least two applied strain directions (along easy and hard magnetisation axes)— the data for the intermediate orientations are usually interpolated. The second one is the ‘reference level’ of the BE intensity angular distribution. In the case of welded plates it is obtained by averaging the results obtained at the analysed points before welding. The way of results presentation proposed in that paper is very illustrative and shows an interesting feature of the stress distribution in welded plates—namely the appearance of a ‘vortex’ structure of main stress.

  9. Differential effector functions of central and peripheral compartments of immune response system: characterization of immune responses in the spleen and mesenteric lymph nodes to directly injected sheep red blood cells.

    PubMed

    Kojima, T; Kamei, H; Kondo, T; Nakashima, I; Kato, N

    1982-05-01

    When sheep red blood cells (SRBC) were injected intraperitoneally (i.p.), intravenously (i.v.), or into the Peyer's patches, definite plaque-forming cell (PFC) and rosette-forming cell (RFC) responses were induced in the spleen but not in the mesenteric lymph nodes (MLN). When SRBC were injected directly into the spleen or MLN, stronger PFC and RFC responses were induced in the spleen or MLN, respectively, than when injected i.p. or i.v. PFC response induced in MLN by injecting SRBC into MLN with or without the polysaccharide of Klebsiella pneumoniae type 1 Kasuya strain (CPS-K) as an immunological adjuvant was weaker than that induced in the spleen by injecting the antigen into the spleen. Direct PFC (PFC of IgM type) and RFC responses induced in the spleen by injecting SRBC into MLN were rather stronger than those induced in the spleen by injecting the antigen into the spleen. In contrast, no significant responses were induced in MLN by injecting SRBC into the spleen, and no definite indirect PFC (PFC of IgG type) response was induced in the spleen by injecting the antigen into MLN. The levels of whole immunological memory as well as isolated B- or T-cell memory in the spleen and MLN of mice injected with SRBC directly into the spleen or MLN were determined by using an in vitro assay system. Definite amounts of either B- or T-cell memory were detected in the spleen of mice injected with SRBC directly into the spleen of MLN. Smaller amounts of memory were detected in MLN injected with SRBC directly into the spleen. Moreover, the amounts of whole memory detected in MLN were much less than compared with those of isolated T- and B-cell memories in MLN. Further experiments showed that in vitro expression of the memories preserved in MLN required supplement of glass non-adherent cells from normal spleen. Based on these results, we discussed the possible differential and collaborative functions of the central (spleen) and peripheral (MLN) immune response systems in

  10. Immune System

    MedlinePlus

    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Immune System KidsHealth > For Teens > Immune System A A A ... could put us out of commission. What the Immune System Does The immune (pronounced: ih-MYOON) system, which ...

  11. Group-specific auto-immune antibodies directed to granulocytes as a cause of chronic benign neutropenia in infants.

    PubMed

    Sabbe, L J; Claas, F H; Langerak, J; Claus, G; Smit, L W; de Koning, J H; Schreuder, C H; van Rood, J J

    1982-01-01

    Chronic benign neutropenia of infancy is a disease which develops a few months after birth and which is characterized by a severe selective neutropenia, accompanied by benign but persisting infections. The cause of the disease is still unknown. The sera from 5 such patients were tested for the presence of granulocyte antibodies as a possible cause of the disease. For the detection of these antibodies immunofluorescence, agglutination and granulocytotoxicity were used. All sera contained antibodies which reacted both with the neutrophils of one or both parents of the patient and a part of a panel of unrelated donors. From the reaction patterns against the panel we could identify the specificity of three sera. Two sera were directed to the neutrophil-specific antigen NA2, and the third one reacted with a hitherto not yet recognized neutrophil-specific alloantigen which we called NE1. In 4 patients we could confirm the autoimmune character of the disease by demonstrating the antibody on the patients' own granulocytes. These results suggest that autoimmunity may be the cause of many cases of benign infantile neutropenia.

  12. Evaluation of direct E-test on lower respiratory tract samples: a rapid and accurate procedure for antimicrobial susceptibility testing.

    PubMed

    Cercenado, Emilia; Cercenado, Sonia; Marín, Mercedes; Rico, María-Victoria; Vicente, Teresa; Bouza, Emilio

    2007-06-01

    We compared the direct E-test susceptibility testing (DET) on respiratory samples with a standard microbroth dilution method (MBD) after quantitative cultures. A total of 152 samples from intensive care unit patients were processed by DET onto Mueller-Hinton agar. Oxacillin, piperacillin/tazobactam, cefepime, imipenem, ciprofloxacin, and amikacin were the antimicrobials evaluated. Cultures were 102 monomicrobials and 50 polymicrobials. Overall, 93.8% of the isolates were recovered by the DET. Among the 772 microorganism-antibiotic combinations evaluated, there was a total agreement with the MBD in 96.1%. There were 8 very major errors (1.03%), 15 major (1.94%), and 7 minor (0.91%). All discrepancies but one corresponded to polymicrobial cultures, and most occurred with cefepime (8 cases, 7.07%) and imipenem (7 cases, 6.18%). Readings of DET were easy to interpret and improved with transmitted light. DET on respiratory samples is a rapid technique that provides susceptibility results in 18 to 24 h comparable with these obtained by MBD.

  13. Development of Procedures for Direct Extraction of Cryptosporidium DNA from Water Concentrates and for Relief of PCR Inhibitors

    PubMed Central

    Jiang, Jianlin; Alderisio, Kerri A.; Singh, Ajaib; Xiao, Lihua

    2005-01-01

    Extraction of high-quality DNA is a key step in PCR detection of Cryptosporidium and other pathogens in environmental samples. Currently, Cryptosporidium oocysts in water samples have to be purified from water concentrates before DNA is extracted. This study compared the effectiveness of six DNA extraction methods (DNA extraction with the QIAamp DNA minikit after oocyst purification with immunomagnetic separation and direct DNA extraction methods using the FastDNA SPIN kit for soil, QIAamp DNA stool minikit, UltraClean soil kit, or QIAamp DNA minikit and the traditional phenol-chloroform technique) for the detection of Cryptosporidium with oocyst-seeded samples, DNA-spiked samples, and field water samples. The study also evaluated the effects of different PCR facilitators (nonacetylated bovine serum albumin, the T4 gene 32 protein, and polyvinylpyrrolidone) and treatments (the use of GeneReleaser or ultrafiltration) for the relief from or removal of inhibitors of PCR amplification. The results of seeding and spiking studies showed that PCR inhibitors were presented in all DNA solutions extracted by the six methods. However, the effect of PCR inhibitors could be relieved significantly by the addition of 400 ng of bovine serum albumin/μl or 25 ng of T4 gene 32 protein/μl to the PCR mixture. With the inclusion of bovine serum albumin in the PCR mixture, DNA extracted with the FastDNA SPIN kit for soil without oocyst isolation resulted in PCR performance similar to that produced by the QIAamp DNA minikit after oocysts were purified by immunomagnetic separation. PMID:15746310

  14. Supplementation of direct-fed microbials as an alternative to antibiotic on growth performance, immune response, cecal microbial population, and ileal morphology of broiler chickens.

    PubMed

    Salim, H M; Kang, H K; Akter, N; Kim, D W; Kim, J H; Kim, M J; Na, J C; Jong, H B; Choi, H C; Suh, O S; Kim, W K

    2013-08-01

    An experiment was conducted to investigate the supplementation of direct-fed microbials (DFM) as an alternative to antibiotics on growth performance, immune response, cecal microbial population, and ileal morphology of broiler chickens. A total of 800 one-day-old male broiler chicks (Ross × Ross) were randomly allotted to 4 dietary treatments with 4 replicate pens per treatment (50 birds/replicate pen). The 4 dietary treatments fed for 35 d were a corn-soybean meal basal diet (control); control plus 0.1% virginiamycin, as an antibiotic growth promoter (AGP); control plus 0.1% direct-fed microbials that contained Lactobacillus reuteri (DFM 1); and control plus 0.1% direct-fed microbials that contained a mixture of L. reuteri, Bacillus subtilis, and Saccharomyces cerevisiae (DFM 2). Results showed that dietary AGP and DFM supplementation significantly increased (P < 0.05) the BW gain of broilers during 0 to 21 d. The feed intake was reduced, whereas the feed conversion was improved significantly when birds were fed DFM 2 at 0 to 7 d of age. The white blood cell and monocyte levels were significantly higher in the DFM 2 group compared with the control. In addition, feeding DFM significantly (P < 0.05) increased the plasma immunoglobulin levels where a higher level was observed in DFM 2 compared with those of the other treatments. Neither DFM nor AGP treatments affected the cecal Lactobacillus and Salmonella content; however, cecal Escherichia coli content significantly decreased in broiler chickens fed DFM and AGP. The ileal villus height, and width and total thickness of muscularis externa were significantly increased when birds were fed DFM compared with AGP and control. These results indicate that the dietary supplementation of DFM increases the growth performance of birds at an early age, stimulates the immune response, decreases the number of E. coli, and improves the ileal morphology of broiler chickens. Thus, DFM that contained a mixture of several beneficial

  15. Development of an in vitro Test Procedure to Determine the Direct Infrared A Protection of Sunscreens and Non-Cosmetic Samples.

    PubMed

    Quistorf, Jan Carlos; Kockott, Dieter; Garbe, Birgit; Heinrich, Ulrike; Tronnier, Hagen; Braun, Nicole

    2017-01-01

    Every day human skin is exposed to infrared A (IRA) radiation as part of the natural sun rays. As IRA radiation accounts for around one third of the solar radiation, it has gained great attention concerning its effects on the human body and skin. In the past few years it has been discussed controversially whether IRA radiation (of solar origin) is harmful or not. Nonetheless, there are several sunscreens on the German market that claim IRA protection for themselves. The present study seeks to find an experimental set-up and a test procedure for the determination and quantification of direct IRA protection (realized via reflection or absorption of the IRA radiation), since to our knowledge these do not yet exist. In this study we proved the usability of a set-up consisting of a light source, an IRA-transmissible filter system and a sensor unit, for the determination and quantification of the IRA protection of cosmetic and non-cosmetic samples. The applicability of the IRA emission of the light source, the spectral detector, transmissivity of the filter systems and the sample carriers could be validated. This experimental set-up can be used as an in vitro test procedure for the determination of direct IRA protection. © 2017 S. Karger AG, Basel.

  16. Application of the 2013 Wilson-Devinney Program’s Direct Distance Estimation procedure and enhanced spot modeling capability to eclipsing binaries in star clusters

    NASA Astrophysics Data System (ADS)

    Milone, Eugene F.; Schiller, Stephen J.

    2014-06-01

    A paradigm method to calibrate a range of standard candles by means of well-calibrated photometry of eclipsing binaries in star clusters is the Direct Distance Estimation (DDE) procedure, contained in the 2010 and 2013 versions of the Wilson-Devinney light-curve modeling program. In particular, we are re-examining systems previously studied in our Binaries-in-Clusters program and analyzed with earlier versions of the Wilson-Devinney program. Earlier we reported on our use of the 2010 version of this program, which incorporates the DDE procedure to estimate the distance to an eclipsing system directly, as a system parameter, and is thus dependent on the data and analysis model alone. As such, the derived distance is accorded a standard error, independent of any additional assumptions or approximations that such analyses conventionally require. Additionally we have now made use of the 2013 version, which introduces temporal evolution of spots, an important improvement for systems containing variable active regions, as is the case for the systems we are studying currently, namely HD 27130 in the Hyades and DS And in NGC 752. Our work provides some constraints on the effects of spot treatment on distance determination of active systems.

  17. [Comparison of direct immune-fluorescent assay and real-time quantitative PCR in detecting the Hantavirus].

    PubMed

    Yu, Peng-bo; Li, Shen; Wei, Jing; Ma, Chang-an; Lu, Xiao-ling; DU, Shui-quan; Guan, Lu-yuan; Zheng, Yuan; Dong, Jian-hua; Ma, Chao-feng; Wang, Jing-jun

    2013-04-01

    To compare the differences between the direct immuno-fluorescent assay (DFA) and real-time quantitative PCR in detecting the Hantavirus (HV) in rat lungs. From April to October in 2012, a total of 479 rats were caught by mouse-trap in residential or wild areas in Huxian, Jingyang, and Meixian of Shaanxi province, where haemorrhagic fever with renal syndrome (HFRS) was highly prevalent. The rats were dissected to take the two lungs, one was frozen and applied immuno-fluorescent assay to detect HV antigen while the other one was extracted its RNA and detected HV nucleic acid by real-time quantitative PCR. Then we compared the positive rate of the two methods. Out of the 479 rats, 105 were caught from residential areas and the other 374 were caught from wild areas. Among the 105 rats caught from residential areas, no HV were detected out neither by DFA nor by real-time quantitative PCR. Among the 374 wild rats, 13.1% (49/374) were detected HV positive by DFA and 14.7% (55/374) were detected HV positive by real-time quantitative PCR. The difference showed no statistical significance (χ(2) = 0.402, P = 0.526). When detecting each lung sample, the HV positive rate was 10.2% (49/479) under the detection by DFA while the HV positive rate was 11.5% (55/479) under the detection by real-time quantitative PCR. The difference had no statistical significance (χ(2) = 1.286, P = 0.257) and the consistency coefficient was 68.2% under the paired chi-square test analysis, which showed high consistency (u = 11.759, P < 0.05). The sensitivity of real-time quantitative PCR to detect HV was 77.6% (38/49) comparing with DFA as standard, and the specificity was 96.1% (413/430). Out of the 9 suspected HV positive sample detected by DFA, 6 were confirmed positive by real-time quantitative PCR and 3 were denied. Compared with the DFA, real-time quantitative PCR could also be used to detect the infection of HV in rats, and the result might be more stable.

  18. New directional results and determination of absolute archaeointensity using both the classical Thellier and the multi-specimen procedures for two kilns excavated at Osterietta, Italy

    NASA Astrophysics Data System (ADS)

    Tema, Evdokia; Camps, Pierre; Ferrara, Enzo

    2014-05-01

    A detailed rock-magnetic and archaeomagnetic study has been carried out on two rescue excavation kilns discovered during the works to expand a highway at the location of Osterietta, in Northen Italy. Systematic archaeomagnetic sampling was carried out collecting 15 samples from the first kiln (OSA) and 8 samples from the second kiln (OSB), all of them oriented in situ with a magnetic compass and an inclinometer. Magnetic mineralogy measurements have been carried out in order to determine the main magnetic carrier of the samples and to check their thermal stability. Standard thermal demagnetization procedures have been used to determine the archaeomagnetic direction registered by the bricks during their last firing. Demagnetization results show a very stable characteristic remanent magnetization (ChRM). We averaged the directions for each kiln separately and calculated the statistical parameters assuming a Fisherian distribution. The archaeointensity of both kilns has also been recovered with both the classical Thellier-Thellier method and the multi-specimen procedure (MSP-DSC). During the Thellier experiments, regular partial thermoremanent magnetization checks have been performed and the effect of the anisotropy of the thermoremanent magnetization (TRM) and cooling rate upon TRM intensity acquisition have been investigated in all samples. The multi-specimen procedure was performed with a very fast-heating oven developed at Montpellier (France). The intensity results obtained from both methods have been compared and the full geomagnetic field vector determined for each kiln has been used for archaeomagnetic dating. The obtained results show that the kilns were almost contemporaneous and their last use occurred in the 1750-1850 AD time interval.

  19. The effect of formative evaluation using "direct observation of procedural skills" (DOPS) method on the extent of learning practical skills among nursing students in the ICU.

    PubMed

    Roghieh, Nazari; Fateme, Hajihosseini; Hamid, Sharifnia; Hamid, Hojjati

    2013-07-01

    Learning of clinical skills in the intensive care unit (ICU) is important for nursing students. Direct observation of procedural skills (DOPS)" is a modified objective method in the field of medical sciences, and we conducted this study with the aim of investigating the effect of evaluation using DOPS method on learning practical skills among nursing students in the ICU. This semi-experimental study was conducted on 39 nursing students of the 7(th) semester (20 in the intervention group and 19 in the control group). First, the control group students spent their apprenticeship by the routine assessment method. The intervention group underwent formative evaluation using DOPS method in addition to the routine one. At the beginning and end of the period, skill levels of both groups in performing two optional procedures (arterial blood sampling and endotracheal suctioning) were evaluated using checklists, and each student's skill score was calculated in a range of 0-20. Period initiation and termination scores were considered as pre- and post-test values, respectively. The results showed no significant difference in pre-test scores between the two groups (P > 0.05), whereas the mean difference of post-test scores was significant for both procedures between the two groups (P < 0.001). Difference between the mean values of pre- and post-test scores of the two procedures for both intervention and control groups was significant (P < 0.001). Our findings indicate that DOPS formative assessment, more than the routine approach, increases arterial blood sampling and endotracheal suctioning skills in the ICU. Therefore, it is recommended that this method be used in other wards as well as for other skills.

  20. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    PubMed Central

    Dang, N.N.; Pang, S.G.; Song, H.Y.; An, L.G.; Ma, X.L.

    2014-01-01

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response. PMID:25493381

  1. The Kjeldahl method as a primary reference procedure for total protein in certified reference materials used in clinical chemistry. II. Selection of direct Kjeldahl analysis and its preliminary performance parameters.

    PubMed

    Vinklárková, Bára; Chromý, Vratislav; Šprongl, Luděk; Bittová, Miroslava; Rikanová, Milena; Ohnútková, Ivana; Žaludová, Lenka

    2015-01-01

    To select a Kjeldahl procedure suitable for the determination of total protein in reference materials used in laboratory medicine, we reviewed in our previous article Kjeldahl methods adopted by clinical chemistry and found an indirect two-step analysis by total Kjeldahl nitrogen corrected for its nonprotein nitrogen and a direct analysis made on isolated protein precipitates. In this article, we compare both procedures on various reference materials. An indirect Kjeldahl method gave falsely lower results than a direct analysis. Preliminary performance parameters qualify the direct Kjeldahl analysis as a suitable primary reference procedure for the certification of total protein in reference laboratories.

  2. Bad to the Bone: On In Vitro and Ex Vivo Microbial Biofilm Ability to Directly Destroy Colonized Bone Surfaces without Participation of Host Immunity or Osteoclastogenesis

    PubMed Central

    Junka, Adam; Szymczyk, Patrycja; Ziółkowski, Grzegorz; Karuga-Kuzniewska, Ewa; Smutnicka, Danuta; Bil-Lula, Iwona; Bartoszewicz, Marzenna; Mahabady, Susan; Sedghizadeh, Parish Paymon

    2017-01-01

    Bone infections are a significant public health burden associated with morbidity and mortality in patients. Microbial biofilm pathogens are the causative agents in chronic osteomyelitis. Research on the pathogenesis of osteomyelitis has focused on indirect bone destruction by host immune cells and cytokines secondary to microbial insult. Direct bone resorption by biofilm pathogens has not yet been seriously considered. In this study, common osteomyelitis pathogens (Staphylococcus aureus, Pseudomonas aeruginosa, Candida albicans, and Streptococcus mutans) were grown as biofilms in multiple in vitro and ex vivo experiments to analyze quantitative and qualitative aspects of bone destruction during infection. Pathogens were grown as single or mixed species biofilms on the following substrates: hydroxyapatite, rat jawbone, or polystyrene wells, and in various media. Biofilm growth was evaluated by scanning electron microscopy and pH levels were monitored over time. Histomorphologic and quantitative effects of biofilms on tested substrates were analyzed by microcomputed tomography and quantitative cultures. All tested biofilms demonstrated significant damage to bone. Scanning electron microscopy indicated that all strains formed mature biofilms within 7 days on all substrate surfaces regardless of media. Experimental conditions impacted pH levels, although this had no impact on biofilm growth or bone destruction. Presence of biofilm led to bone dissolution with a decrease of total volume by 20.17±2.93% upon microcomputed tomography analysis, which was statistically significant as compared to controls (p <0.05, ANOVA). Quantitative cultures indicated that media and substrate did not impact biofilm formation (Kruskall-Wallis test, post-hoc Dunne’s test; p <0.05). Overall, these results indicate that biofilms associated with osteomyelitis have the ability to directly resorb bone. These findings should lead to a more complete understanding of the etiopathogenesis of

  3. Bad to the Bone: On In Vitro and Ex Vivo Microbial Biofilm Ability to Directly Destroy Colonized Bone Surfaces without Participation of Host Immunity or Osteoclastogenesis.

    PubMed

    Junka, Adam; Szymczyk, Patrycja; Ziółkowski, Grzegorz; Karuga-Kuzniewska, Ewa; Smutnicka, Danuta; Bil-Lula, Iwona; Bartoszewicz, Marzenna; Mahabady, Susan; Sedghizadeh, Parish Paymon

    2017-01-01

    Bone infections are a significant public health burden associated with morbidity and mortality in patients. Microbial biofilm pathogens are the causative agents in chronic osteomyelitis. Research on the pathogenesis of osteomyelitis has focused on indirect bone destruction by host immune cells and cytokines secondary to microbial insult. Direct bone resorption by biofilm pathogens has not yet been seriously considered. In this study, common osteomyelitis pathogens (Staphylococcus aureus, Pseudomonas aeruginosa, Candida albicans, and Streptococcus mutans) were grown as biofilms in multiple in vitro and ex vivo experiments to analyze quantitative and qualitative aspects of bone destruction during infection. Pathogens were grown as single or mixed species biofilms on the following substrates: hydroxyapatite, rat jawbone, or polystyrene wells, and in various media. Biofilm growth was evaluated by scanning electron microscopy and pH levels were monitored over time. Histomorphologic and quantitative effects of biofilms on tested substrates were analyzed by microcomputed tomography and quantitative cultures. All tested biofilms demonstrated significant damage to bone. Scanning electron microscopy indicated that all strains formed mature biofilms within 7 days on all substrate surfaces regardless of media. Experimental conditions impacted pH levels, although this had no impact on biofilm growth or bone destruction. Presence of biofilm led to bone dissolution with a decrease of total volume by 20.17±2.93% upon microcomputed tomography analysis, which was statistically significant as compared to controls (p <0.05, ANOVA). Quantitative cultures indicated that media and substrate did not impact biofilm formation (Kruskall-Wallis test, post-hoc Dunne's test; p <0.05). Overall, these results indicate that biofilms associated with osteomyelitis have the ability to directly resorb bone. These findings should lead to a more complete understanding of the etiopathogenesis of

  4. Effect of formative evaluation using direct observation of procedural skills in assessment of postgraduate students of obstetrics and gynecology: Prospective study

    PubMed Central

    KUMAR, NAINA; SINGH, NAMIT KANT; RUDRA, SAMAR; PATHAK, SWANAND

    2017-01-01

    Introduction: Direct Observation of Procedural Skills (DOPS) is a way of evaluating procedural skills through observation in the workplace. The purpose of this study was to assess the role of DOPS in teaching and assessment of postgraduate students and to know the effect of repeated DOPS on improvement of the skills and confidence of the students. Methods: In both phases, significant difference was observed between the two groups on first DOPS comparison (1st phase: p=0.000; 2nd phase: p=0.002), with simulation group performing better. Comparison of sixth DOPS in the two groups revealed no difference in both phases, but significant difference on first and sixth DOPS comparison in each group (p=0.000). Results: Repeated DOPS results in improved skills and confidence of students in managing real life obstetric emergencies irrespective of the teaching modality. Conclusion: Repeated DOPS results in improved skills and confidence of students in managing real life obstetric emergencies irrespective of the teaching modality. PMID:28124015

  5. Interventional procedure based on nanorobots propelled and steered by flagellated magnetotactic bacteria for direct targeting of tumors in the human body.

    PubMed

    Martel, Sylvain; Felfoul, Ouajdi; Mohammadi, Mahmood; Mathieu, Jean-Baptiste

    2008-01-01

    Flagellated bacteria used as bio-actuators may prove to be efficient propulsion mechanisms for future hybrid medical nanorobots when operating in the microvasculature. Here, we briefly describe a medical interventional procedure where flagellated bacteria and more specifically MC-1 Magnetotactic Bacteria (MTB) can be used to propel and steer micro-devices and nanorobots under computer control to reach remote locations in the human body. In particular, we show through experimental results the potential of using MTB-tagged robots to deliver therapeutic agents to tumors even the ones located in deep regions of the human body. We also show that such bacterial nanorobots can be tracked inside the human body for enhanced targeting under computer guidance using MRI as imaging modality. MTB can not only be guided and controlled directly towards a specific target, but we also show experimentally that these flagellated bacterial nanorobots can be propelled and steered in vivo deeply through the interstitial region of a tumor. The targeting efficacy is increased when combined with larger ferromagnetic micro-carriers being propelled by magnetic gradients generated by a MRI platform to carry and release nanorobots propelled by a single flagellated bacterium near the arteriocapillar entry. Based on the experimental data obtained and the experience gathered during several experiments conducted in vivo with this new approach, a general medical interventional procedure is briefly described here in a biomedical engineering context.

  6. An Interferon Regulated MicroRNA Provides Broad Cell-Intrinsic Antiviral Immunity through Multihit Host-Directed Targeting of the Sterol Pathway.

    PubMed

    Robertson, Kevin A; Hsieh, Wei Yuan; Forster, Thorsten; Blanc, Mathieu; Lu, Hongjin; Crick, Peter J; Yutuc, Eylan; Watterson, Steven; Martin, Kimberly; Griffiths, Samantha J; Enright, Anton J; Yamamoto, Mami; Pradeepa, Madapura M; Lennox, Kimberly A; Behlke, Mark A; Talbot, Simon; Haas, Jürgen; Dölken, Lars; Griffiths, William J; Wang, Yuqin; Angulo, Ana; Ghazal, Peter

    2016-03-01

    In invertebrates, small interfering RNAs are at the vanguard of cell-autonomous antiviral immunity. In contrast, antiviral mechanisms initiated by interferon (IFN) signaling predominate in mammals. Whilst mammalian IFN-induced miRNA are known to inhibit specific viruses, it is not known whether host-directed microRNAs, downstream of IFN-signaling, have a role in mediating broad antiviral resistance. By performing an integrative, systematic, global analysis of RNA turnover utilizing 4-thiouridine labeling of newly transcribed RNA and pri/pre-miRNA in IFN-activated macrophages, we identify a new post-transcriptional viral defense mechanism mediated by miR-342-5p. On the basis of ChIP and site-directed promoter mutagenesis experiments, we find the synthesis of miR-342-5p is coupled to the antiviral IFN response via the IFN-induced transcription factor, IRF1. Strikingly, we find miR-342-5p targets mevalonate-sterol biosynthesis using a multihit mechanism suppressing the pathway at different functional levels: transcriptionally via SREBF2, post-transcriptionally via miR-33, and enzymatically via IDI1 and SC4MOL. Mass spectrometry-based lipidomics and enzymatic assays demonstrate the targeting mechanisms reduce intermediate sterol pathway metabolites and total cholesterol in macrophages. These results reveal a previously unrecognized mechanism by which IFN regulates the sterol pathway. The sterol pathway is known to be an integral part of the macrophage IFN antiviral response, and we show that miR-342-5p exerts broad antiviral effects against multiple, unrelated pathogenic viruses such Cytomegalovirus and Influenza A (H1N1). Metabolic rescue experiments confirm the specificity of these effects and demonstrate that unrelated viruses have differential mevalonate and sterol pathway requirements for their replication. This study, therefore, advances the general concept of broad antiviral defense through multihit targeting of a single host pathway.

  7. HIV-1 Receptor Binding Site-Directed Antibodies Using a VH1-2 Gene Segment Orthologue Are Activated by Env Trimer Immunization

    PubMed Central

    Bale, Shridhar; Phad, Ganesh E.; Guenaga, Javier; Wilson, Richard; Soldemo, Martina; McKee, Krisha; Sundling, Christopher; Mascola, John; Li, Yuxing; Wyatt, Richard T.; Karlsson Hedestam, Gunilla B.

    2014-01-01

    Broadly neutralizing antibodies (bNAbs) isolated from chronically HIV-1 infected individuals reveal important information regarding how antibodies target conserved determinants of the envelope glycoprotein (Env) spike such as the primary receptor CD4 binding site (CD4bs). Many CD4bs-directed bNAbs use the same heavy (H) chain variable (V) gene segment, VH1-2*02, suggesting that activation of B cells expressing this allele is linked to the generation of this type of Ab. Here, we identify the rhesus macaque VH1.23 gene segment to be the closest macaque orthologue to the human VH1-2 gene segment, with 92% homology to VH1-2*02. Of the three amino acids in the VH1-2*02 gene segment that define a motif for VRC01-like antibodies (W50, N58, flanking the HCDR2 region, and R71), the two identified macaque VH1.23 alleles described here encode two. We demonstrate that immunization with soluble Env trimers induced CD4bs-specific VH1.23-using Abs with restricted neutralization breadth. Through alanine scanning and structural studies of one such monoclonal Ab (MAb), GE356, we demonstrate that all three HCDRs are involved in neutralization. This contrasts to the highly potent CD4bs-directed VRC01 class of bNAb, which bind Env predominantly through the HCDR2. Also unlike VRC01, GE356 was minimally modified by somatic hypermutation, its light (L) chain CDRs were of average lengths and it displayed a binding footprint proximal to the trimer axis. These results illustrate that the Env trimer immunogen used here activates B cells encoding a VH1-2 gene segment orthologue, but that the resulting Abs interact distinctly differently with the HIV-1 Env spike compared to VRC01. PMID:25166308

  8. Direct Engagement of TLR4 in Invariant NKT Cells Regulates Immune Diseases by Differential IL-4 and IFN-γ Production in Mice

    PubMed Central

    Kim, Hye Young; Oh, Sae Jin; Chung, Doo Hyun

    2012-01-01

    During interaction with APCs, invariant (i) NKT cells are thought to be indirectly activated by TLR4-dependently activated APCs. However, whether TLR4 directly activates iNKT cells is unknown. Therefore, the expression and function of TLR4 in iNKT cells were investigated. Flow cytometric and confocal microscopic analysis revealed TLR4 expression on the surface and in the endosome of iNKT cells. Upon LPS stimulation, iNKT cells enhanced IFN-γ production, but reduced IL-4 production, in the presence of TCR signals, depending on TLR4, MyD88, TRIF, and the endosome. However, enhanced TLR4-mediated IFN-γ production by iNKT cells did not affect IL-12 production or CD1d expression by DCs. Adoptive transfer of WT, but not TLR4-deficient, iNKT cells promoted antibody-induced arthritis in CD1d−/− mice, suggesting that endogenous TLR4 ligands modulate iNKT cell function in arthritis. Furthermore, LPS-pretreated WT, but not TLR4-deficient, iNKT cells suppressed pulmonary fibrosis, but worsened hypersensitivity pneumonitis more than untreated WT iNKT cells, indicating that exogenous TLR4 ligands regulate iNKT cell functions in pulmonary diseases. Taken together, we propose a novel direct activation pathway of iNKT cells in the presence of TCR signals via endogenous or exogenous ligand-mediated engagement of TLR4 in iNKT cells, which regulates immune diseases by altering IFN-γ and IL-4 production. PMID:23028952

  9. Immune Thrombocytopenia

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Immune Thrombocytopenia? Immune thrombocytopenia (THROM-bo-si-toe-PE-ne- ... from one person to another. Types of Immune Thrombocytopenia The two types of ITP are acute (temporary ...

  10. Integrated Immune

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarnece

    2010-01-01

    This slide presentation reviews the program to replace several recent studies about astronaut immune systems with one comprehensive study that will include in-flight sampling. The study will address lack of in-flight data to determine the inflight status of immune systems, physiological stress, viral immunity, to determine the clinical risk related to immune dysregulation for exploration class spaceflight, and to determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

  11. Direct solid sample analysis with graphite furnace atomic absorption spectrometry—a fast and reliable screening procedure for the determination of inorganic arsenic in fish and seafood.

    PubMed

    Zmozinski, Ariane V; Llorente-Mirandes, Toni; Damin, Isabel C F; López-Sánchez, José F; Vale, Maria Goreti R; Welz, Bernhard; Silva, Márcia M

    2015-03-01

    Direct solid sample analysis with graphite furnace atomic absorption spectrometry (SS-GF AAS) was investigated initially with the intention of developing a method for the determination of total As in fish and other seafood. A mixture of 0.1% Pd+0.06% Mg+0.06% Triton X-100 was used as the chemical modifier, added in solution over the solid samples, making possible the use of pyrolysis and atomization temperatures of 1200 °C and 2400 °C, respectively. The sample mass had to be limited to 0.25 mg, as the integrated absorbance did not increase further with increasing sample mass. Nevertheless, the recovery of As from several certified reference materials was of the order of 50% lower than the certified value. Strong molecular absorption due to the phosphorus monoxide molecule (PO) was observed with high-resolution continuum source AAS (HR CS AAS), which, however, did not cause any spectral interference. A microwave-assisted digestion with HNO3/H2O2 was also investigated to solve the problem; however, the results obtained for several certified reference materials were statistically not different from those found with direct SS-GF AAS. Accurate values were obtained using inductively coupled plasma mass spectrometry (ICP-MS) to analyze the digested samples, which suggested that organic As compounds are responsible for the low recoveries. HPLC-ICP-MS was used to determine the arsenobetaine (AB) concentration. Accurate results that were not different from the certified values were obtained when the AB concentration was added to the As concentration found by SS-GF AAS for most certified reference materials (CRM) and samples, suggesting that SS-GF AAS could be used as a fast screening procedure for inorganic As determination in fish and seafood.

  12. Immune Response in Thyroid Cancer: Widening the Boundaries

    PubMed Central

    Ward, Laura Sterian

    2014-01-01

    The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756

  13. Initiation of adaptive immune responses by transcutaneous immunization.

    PubMed

    Warger, Tobias; Schild, Hansjörg; Rechtsteiner, Gerd

    2007-03-15

    The development of new, effective, easy-to-use and lower-cost vaccination approaches for the combat against malignant and infectious diseases is a pre-eminent need: cancer is a leading cause of morbidity in the Western World; there are numerous pathogenic diseases for which we still have no protective or therapeutic cure; and the financial limitations of developing countries to fight these diseases. In this mini-review we focus on transcutaneous immunization (TCI), a relatively new route for antigen delivery. TCI protocols appear to be particularly promising by gaining access to skin resident APC, which are highly efficient for the initiation of humoral and/or cellular immune responses. Consisting of an adjuvant as a stimulus in combination with an antigen which defines the target, TCI offers a most attractive immunization strategy to mount highly specific full-blown adaptive immune responses. As a topically applicable cell-free adjuvant/antigen mixture, TCI might be suitable to improve patient compliance, as well as feasible economically for the use in Third World countries. In addition, this non-invasive procedure might increase the safety of vaccinations by eliminating the risk of infections related to the recycling and improper disposal of needles. The dissection of antigen and adjuvant is important because it allows "free" combinations in contrast to classical immunizations which are based on application of the pathogen of interest. The most relevant ways and means to find new, effective pathogenic target antigens are "reverse vaccinology" and the direct peptide-epitope identification from MHC molecules with mass-spectrometry. Due to these efficient approaches the variety of antigenic epitopes for potential protective/therapeutic use is perpetually expanding. The most studied adjuvants in TCI approaches are cholera toxin (CT) and its less toxic relative, the heat-labile enterotoxin (LT). Both CT and LT can serve as antigen as well. In contrast to these large

  14. A procedure for calculating the swelling of water level and protective means to prevent it from entering into the turbine flow path with the back flow of steam from direct-contact heaters

    NASA Astrophysics Data System (ADS)

    Sukhorukov, Yu. G.; Ermolov, V. F.; Trifonov, N. N.

    2008-02-01

    A procedure is proposed for calculating the swelling of the level of water on the saturation line when an abrupt drop of pressure occurs. A calculated study of the swelling of water level is carried out for different designs of direct-contact heaters. A comparison between the calculated and experimental data is given. The procedure can be used for calculating the swelling of water level in the apparatuses of turbine units at thermal and nuclear power stations and at boiler houses.

  15. Combining directed acyclic graphs and the change-in-estimate procedure as a novel approach to adjustment-variable selection in epidemiology

    PubMed Central

    2012-01-01

    Background Directed acyclic graphs (DAGs) are an effective means of presenting expert-knowledge assumptions when selecting adjustment variables in epidemiology, whereas the change-in-estimate procedure is a common statistics-based approach. As DAGs imply specific empirical relationships which can be explored by the change-in-estimate procedure, it should be possible to combine the two approaches. This paper proposes such an approach which aims to produce well-adjusted estimates for a given research question, based on plausible DAGs consistent with the data at hand, combining prior knowledge and standard regression methods. Methods Based on the relationships laid out in a DAG, researchers can predict how a collapsible estimator (e.g. risk ratio or risk difference) for an effect of interest should change when adjusted on different variable sets. Implied and observed patterns can then be compared to detect inconsistencies and so guide adjustment-variable selection. Results The proposed approach involves i. drawing up a set of plausible background-knowledge DAGs; ii. starting with one of these DAGs as a working DAG, identifying a minimal variable set, S, sufficient to control for bias on the effect of interest; iii. estimating a collapsible estimator adjusted on S, then adjusted on S plus each variable not in S in turn (“add-one pattern”) and then adjusted on the variables in S minus each of these variables in turn (“minus-one pattern”); iv. checking the observed add-one and minus-one patterns against the pattern implied by the working DAG and the other prior DAGs; v. reviewing the DAGs, if needed; and vi. presenting the initial and all final DAGs with estimates. Conclusion This approach to adjustment-variable selection combines background-knowledge and statistics-based approaches using methods already common in epidemiology and communicates assumptions and uncertainties in a standardized graphical format. It is probably best suited to areas where there is

  16. Controlling Salmonella infection in weanling pigs through water delivery of direct-fed microbials or organic acids. Part I: effects on growth performance, microbial populations, and immune status.

    PubMed

    Walsh, M C; Rostagno, M H; Gardiner, G E; Sutton, A L; Richert, B T; Radcliffe, J S

    2012-01-01

    Pigs (n = 88) weaned at 19 ± 2 d of age were used in a 14-d study to evaluate the effects of water-delivered direct-fed microbials (DFM) or organic acids on growth, immune status, Salmonella infection and shedding, and intestinal microbial populations after intranasal inoculation of Salmonella Typhimurium (10(10) cfu/pig). Pigs were challenged with Salmonella 6 d after commencement of water treatments. Treatments were 1) control diet; 2) control diet + DFM (Enterococcus faecium, Bacillus subtilis, and Bacillus licheniformis) in drinking water at 10(9) cfu/L for each strain of bacteria; 3) control diet + an organic acid-based blend (predominantly propionic, acetic, and benzoic acid) in drinking water at 2.58 mL/L; and 4) control diet + 55 mg/kg of carbadox. Serum samples were taken on d 6, 8, 10, and 14 for determination of tumor necrosis factor α (TNFα) concentrations. Fecal samples were taken on d 0, 5, 7, and 11 for determination of Salmonella shedding and enumeration of coliforms. Pigs were euthanized on d 6, 8, 10, and 14. Intestinal and cecal tissue and digesta and mesenteric lymph nodes were sampled and analyzed for Salmonella. Duodenal, jejunal, and ileal mucosal scrapings were sampled for measurement of mucosal TNFα concentrations. Water delivery of DFM prevented a decline in ADG on d 2 to 6 postchallenge compared with the negative control (P < 0.05). Coliform counts tended to be greater (P = 0.09) in the cecum of the DFM treatment group on d 2 postinfection compared with the negative control and acid treatment groups. However, Salmonella prevalence in the feces, gastrointestinal tract, or lymph nodes was not affected by water delivery of acids or DFM. Serum and mucosal TNFα concentrations were not affected by treatment throughout the study with the exception of ileal concentrations on d 4 postchallenge, which were greater in the negative control group compared with all other treatments (P < 0.05). The in-feed antibiotic was the only treatment that

  17. The intestinal microbiome, barrier function, and immune system in inflammatory bowel disease: a tripartite pathophysiological circuit with implications for new therapeutic directions.

    PubMed

    Vindigni, Stephen M; Zisman, Timothy L; Suskind, David L; Damman, Christopher J

    2016-07-01

    We discuss the tripartite pathophysiological circuit of inflammatory bowel disease (IBD), involving the intestinal microbiota, barrier function, and immune system. Dysfunction in each of these physiological components (dysbiosis, leaky gut, and inflammation) contributes in a mutually interdependent manner to IBD onset and exacerbation. Genetic and environmental risk factors lead to disruption of gut homeostasis: genetic risks predominantly affect the immune system, environmental risks predominantly affect the microbiota, and both affect barrier function. Multiple genetic and environmental 'hits' are likely necessary to establish and exacerbate disease. Most conventional IBD therapies currently target only one component of the pathophysiological circuit, inflammation; however, many patients with IBD do not respond to immune-modulating therapies. Hope lies in new classes of therapies that target the microbiota and barrier function.

  18. The intestinal microbiome, barrier function, and immune system in inflammatory bowel disease: a tripartite pathophysiological circuit with implications for new therapeutic directions

    PubMed Central

    Vindigni, Stephen M.; Zisman, Timothy L.; Suskind, David L.; Damman, Christopher J.

    2016-01-01

    We discuss the tripartite pathophysiological circuit of inflammatory bowel disease (IBD), involving the intestinal microbiota, barrier function, and immune system. Dysfunction in each of these physiological components (dysbiosis, leaky gut, and inflammation) contributes in a mutually interdependent manner to IBD onset and exacerbation. Genetic and environmental risk factors lead to disruption of gut homeostasis: genetic risks predominantly affect the immune system, environmental risks predominantly affect the microbiota, and both affect barrier function. Multiple genetic and environmental ‘hits’ are likely necessary to establish and exacerbate disease. Most conventional IBD therapies currently target only one component of the pathophysiological circuit, inflammation; however, many patients with IBD do not respond to immune-modulating therapies. Hope lies in new classes of therapies that target the microbiota and barrier function. PMID:27366227

  19. Immune challenge by intraperitoneal administration of lipopolysaccharide directs gene expression in distinct blood-brain barrier cells toward enhanced prostaglandin E(2) signaling.

    PubMed

    Vasilache, Ana Maria; Qian, Hong; Blomqvist, Anders

    2015-08-01

    The cells constituting the blood-brain barrier are critical for the transduction of peripheral immune signals to the brain, but hitherto no comprehensive analysis of the signaling events that occur in these cells in response to a peripheral inflammatory stimulus has been performed. Here, we examined the inflammatory transcriptome in blood-brain barrier cells, including endothelial cells, pericytes, and perivascular macrophages, which were isolated by fluorescent-activated cell sorting, from non-immune-challenged mice and from mice stimulated by bacterial wall lipopolysaccharide. We show that endothelial cells and perivascular macrophages display distinct transcription profiles for inflammatory signaling and respond in distinct and often opposing ways to the immune stimulus. Thus, endothelial cells show induced PGE2 synthesis and transport with attenuation of PGE2 catabolism, increased expression of cytokine receptors and down-stream signaling molecules, and downregulation of adhesion molecules. In contrast, perivascular macrophages show downregulation of the synthesis of prostanoids other than PGE2 and of prostaglandin catabolism, but upregulation of interleukin-6 synthesis. Pericytes were largely unresponsive to the immune stimulation, with the exception of downregulation of proteins involved in pericyte-endothelial cell communication. While the endothelial cells account for most of the immune-induced gene expression changes in the blood-brain barrier, the response of the endothelial cells occurs in a concerted manner with that of the perivascular cells to elevate intracerebral levels of PGE2, hence emphasizing the critical role of PGE2 in immune-induced signal transduction across the blood-brain barrier. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Immunization Coverage

    MedlinePlus

    ... vaccination strategies and operational plans to address immunization gaps and reach every person with lifesaving vaccines. WHO ... Assembly in 2018, 2020 and 2022 on the achievements against the GVAP goals and targets. World Immunization ...

  1. Immunizations - diabetes

    MedlinePlus

    ... this page: //medlineplus.gov/ency/patientinstructions/000331.htm Immunizations - diabetes To use the sharing features on this page, please enable JavaScript. Immunizations (vaccines or vaccinations) help protect you from some ...

  2. Childhood Immunization

    MedlinePlus

    ... lowest levels in history, thanks to years of immunization. Children must get at least some vaccines before ... child provide protection for many years, adults need immunizations too. Centers for Disease Control and Prevention

  3. Pharmacy immunization partnerships: a rural model.

    PubMed

    Rosenbluth, S A; Madhavan, S S; Borker, R D; Maine, L L

    2001-01-01

    To describe the Pharmacy Immunization Project, a pharmacy/county health department (CHD) partnership model for immunizing infants and adults in rural areas, and to develop service procedures and disseminate lessons learned for adapting the model to different settings. Independent community pharmacies in five contiguous rural counties in West Virginia. Participating pharmacies varied markedly in space, prescription volume, and population of service areas. Childhood and adult immunization service. Pharmacists partnered with nurses from CHDs to offer year-round immunizations at times when other providers were typically closed. Working under standing orders of the CHD medical directors, nurses also conducted routine well-baby examinations in the pharmacy. Promotions involved direct mailing, posters, fliers, direct communication, and ads in newspapers, radio, and TV. Pharmacists' and CHDs' continued willingness to participate, use of the service by local citizens, and feedback from participants and other health care providers and the West Virginia Immunization Program (WVIP). All sites except one continued their participation through the life of the project. The one exception was a pharmacy with few infant patients, which discontinued participation during year 4 of the project. Remaining sites were used and well accepted by the community. The WVIP remains a loyal supporter, and no problems arose with local health care providers. The model appears adaptable to urban as well as rural practice and to chain as well as independent practice in states not authorizing pharmacists to administer vaccines, for pharmacists who for other reasons prefer not to administer, and for those who prefer to offer adult immunization on a seasonal basis. From the CHD perspective, the partnership model is useful in establishing "satellite" locations to target hard-to-reach patients. Recommendations regarding agreements and responsibilities are available, as are lessons learned during project

  4. Behavioral Immunity in Insects

    PubMed Central

    de Roode, Jacobus C.; Lefèvre, Thierry

    2012-01-01

    Parasites can dramatically reduce the fitness of their hosts, and natural selection should favor defense mechanisms that can protect hosts against disease. Much work has focused on understanding genetic and physiological immunity against parasites, but hosts can also use behaviors to avoid infection, reduce parasite growth or alleviate disease symptoms. It is increasingly recognized that such behaviors are common in insects, providing strong protection against parasites and parasitoids. We review the current evidence for behavioral immunity in insects, present a framework for investigating such behavior, and emphasize that behavioral immunity may act through indirect rather than direct fitness benefits. We also discuss the implications for host-parasite co-evolution, local adaptation, and the evolution of non-behavioral physiological immune systems. Finally, we argue that the study of behavioral immunity in insects has much to offer for investigations in vertebrates, in which this topic has traditionally been studied. PMID:26466629

  5. Transplantation Immunity. Contemporary Views.

    PubMed

    Zaretskaya, Yuliya M.

    1999-12-01

    "Transplantation immunity in Cyclosporin era" is a special chapter in science under name transplantation immunity. Nowadays, practically all the organs can be grafted: kidney, heart, lung, liver, pancreas both as organ, and as islet cells, bone marrow from relative and unrelative donors. The broad spectrum of grafted organs gave one more surprising peculiarity of transplantation immunity: it operates with different strength after transplantation of various organs. If the decreasing gradient of transplantation immunity could be composed, then it appeared to be approximately in the following order: bone marrow - skin - kidney - heart - lung. The most complicated operating activity of transplantation immunity is occurring after bone marrow transplantation, especially from unrelative donor, because in bone marrow transplantation immunological process develops in both directions. Therefore now, bone marrow is the only organ (tissue), when the complete compatibility between donor and recipient is required after its transplantation; especially in cases with unrelative donors.

  6. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    PubMed

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  7. SEQUENTIAL IMMUNIZATION PROCEDURE AGAINST GROUP B ARBOVIRUSES.

    DTIC Science & Technology

    neuropathology as criteria of protection. It also protects against St. Louis encephalitis virus. A combination of 17D yellow fever vaccine plus dengue ...4 virus gives protection in monkeys against a challenge of dengue 1 virus. The subcutaneous or oral administration of Langat virus to spider monkeys

  8. DOPS (Direct Observation of Procedural Skills) in undergraduate skills-lab: Does it work? Analysis of skills-performance and curricular side effects

    PubMed Central

    Profanter, Christoph; Perathoner, Alexander

    2015-01-01

    Objective: Sufficient teaching and assessing clinical skills in the undergraduate setting becomes more and more important. In a surgical skills-lab course at the Medical University of Innsbruck fourth year students were teached with DOPS (direct observation of procedural skills). We analyzed whether DOPS worked or not in this setting, which performance levels could be reached compared to tutor teaching (one tutor, 5 students) and which curricular side effects could be observed. Methods: In a prospective randomized trial in summer 2013 (April – June) four competence-level-based skills were teached in small groups during one week: surgical abdominal examination, urethral catheterization (phantom), rectal-digital examination (phantom), handling of central venous catheters. Group A was teached with DOPS, group B with a classical tutor system. Both groups underwent an OSCE (objective structured clinical examination) for assessment. 193 students were included in the study. Altogether 756 OSCE´s were carried out, 209 (27,6%) in the DOPS- and 547 (72,3%) in the tutor-group. Results: Both groups reached high performance levels. In the first month there was a statistically significant difference (p<0,05) in performance of 95% positive OSCE items in the DOPS-group versus 88% in the tutor group. In the following months the performance rates showed no difference anymore and came to 90% in both groups. In practical skills the analysis revealed a high correspondence between positive DOPS (92,4%) and OSCE (90,8%) results. Discussion: As shown by our data DOPS furnish high performance of clinical skills and work well in the undergraduate setting. Due to the high correspondence of DOPS and OSCE results DOPS should be considered as preferred assessment tool in a students skills-lab. The approximation of performance-rates within the months after initial superiority of DOPS could be explained by an interaction between DOPS and tutor system: DOPS elements seem to have improved

  9. DOPS (Direct Observation of Procedural Skills) in undergraduate skills-lab: Does it work? Analysis of skills-performance and curricular side effects.

    PubMed

    Profanter, Christoph; Perathoner, Alexander

    2015-01-01

    Sufficient teaching and assessing clinical skills in the undergraduate setting becomes more and more important. In a surgical skills-lab course at the Medical University of Innsbruck fourth year students were teached with DOPS (direct observation of procedural skills). We analyzed whether DOPS worked or not in this setting, which performance levels could be reached compared to tutor teaching (one tutor, 5 students) and which curricular side effects could be observed. In a prospective randomized trial in summer 2013 (April - June) four competence-level-based skills were teached in small groups during one week: surgical abdominal examination, urethral catheterization (phantom), rectal-digital examination (phantom), handling of central venous catheters. Group A was teached with DOPS, group B with a classical tutor system. Both groups underwent an OSCE (objective structured clinical examination) for assessment. 193 students were included in the study. Altogether 756 OSCE´s were carried out, 209 (27,6%) in the DOPS- and 547 (72,3%) in the tutor-group. Both groups reached high performance levels. In the first month there was a statistically significant difference (p<0,05) in performance of 95% positive OSCE items in the DOPS-group versus 88% in the tutor group. In the following months the performance rates showed no difference anymore and came to 90% in both groups. In practical skills the analysis revealed a high correspondence between positive DOPS (92,4%) and OSCE (90,8%) results. As shown by our data DOPS furnish high performance of clinical skills and work well in the undergraduate setting. Due to the high correspondence of DOPS and OSCE results DOPS should be considered as preferred assessment tool in a students skills-lab. The approximation of performance-rates within the months after initial superiority of DOPS could be explained by an interaction between DOPS and tutor system: DOPS elements seem to have improved tutoring and performance rates as well. DOPS in

  10. Maternal immune transfer in mollusc.

    PubMed

    Wang, Lingling; Yue, Feng; Song, Xiaorui; Song, Linsheng

    2015-02-01

    Maternal immunity refers to the immunity transferred from mother to offspring via egg, playing an important role in protecting the offspring at early life stages and contributing a trans-generational effect on offspring's phenotype. Because fertilization is external in most of the molluscs, oocytes and early embryos are directly exposed to pathogens in the seawater, and thus maternal immunity could provide a better protection before full maturation of their immunological systems. Several innate immune factors including pattern recognition receptors (PRRs) like lectins, and immune effectors like lysozyme, lipopolysaccharide binding protein/bacterial permeability-increasing proteins (LBP/BPI) and antioxidant enzymes have been identified as maternally derived immune factors in mollusc eggs. Among these immune factors, some maternally derived lectins and antibacterial factors have been proved to endue mollusc eggs with effective defense ability against pathogen infection, while the roles of other factors still remain untested. The physiological condition of mollusc broodstock has a profound effect on their offspring fitness. Many other factors such as nutrients, pathogens, environment conditions and pollutants could exert considerable influence on the maternal transfer of immunity. The parent molluscs which have encountered an immune stimulation endow their offspring with a trans-generational immune capability to protect them against infections effectively. The knowledge on maternal transfer of immunity and the trans-generational immune effect could provide us with an ideal management strategy of mollusc broodstock to improve the immunity of offspring and to establish a disease-resistant family for a long-term improvement of cultured stocks.

  11. Persistence of long-lived plasma cells and humoral immunity in individuals responding to CD19-directed CAR T-cell therapy

    PubMed Central

    Bhoj, Vijay G.; Arhontoulis, Dimitrios; Wertheim, Gerald; Capobianchi, James; Callahan, Colleen A.; Ellebrecht, Christoph T.; Obstfeld, Amrom E.; Lacey, Simon F.; Melenhorst, Jan J.; Nazimuddin, Farzana; Hwang, Wei-Ting; Maude, Shannon L.; Wasik, Mariusz A.; Bagg, Adam; Schuster, Stephen; Feldman, Michael D.; Porter, David L.; Grupp, Stephen A.; June, Carl H.

    2016-01-01

    The mechanisms underlying the maintenance of long-lasting humoral immunity are not well understood. Studies in mice indicate that plasma cells (PCs) can survive up to a lifetime, even in the absence of regeneration by B cells, implying the presence of long-lived PCs as a mechanism for long-lasting immunity. Evidence from humans treated with anti-CD20, which depletes circulating B cells, also suggests B-cell–independent long-term survival of some PCs. On the other hand, antibody responses may be sustained solely by short-lived PCs with repopulation from clonally related memory B cells. To explore PC longevity and humoral immunity in humans, we investigated the fate of PCs and their antibodies in adult and pediatric patients who received chimeric antigen receptor–based adoptive T-cell immunotherapy targeting CD19 to treat B-cell lineage malignancies (CTL019). Treatment with CTL019 is frequently associated with B-cell aplasia that can persist for years. Serum antibody titers to vaccine-related antigens were measured, and quantitative assessment of B cells and PCs in blood and bone marrow was performed at various time points before and after CTL019 therapy. While total serum immunoglobulin concentrations decline following CTL019-induced B-cell aplasia, several vaccine/pathogen-specific serum immunoglobulin G and A (IgG and IgA) titers remain relatively stable for at least 6 and 12 months posttreatment, respectively. Analysis of bone marrow biopsies after CTL019 revealed 8 patients with persistence of antibody-secreting PCs at least 25 months post-CTL019 infusion despite absence of CD19+CD20+ B cells. These results provide strong evidence for the existence of memory B-cell–independent, long-lived PCs in humans that contribute to long-lasting humoral immunity. PMID:27166358

  12. Nucleic Acid Immunity.

    PubMed

    Hartmann, G

    2017-01-01

    Organisms throughout biology need to maintain the integrity of their genome. From bacteria to vertebrates, life has established sophisticated mechanisms to detect and eliminate foreign genetic material or to restrict its function and replication. Tremendous progress has been made in the understanding of these mechanisms which keep foreign or unwanted nucleic acids from viruses or phages in check. Mechanisms reach from restriction-modification systems and CRISPR/Cas in bacteria and archaea to RNA interference and immune sensing of nucleic acids, altogether integral parts of a system which is now appreciated as nucleic acid immunity. With inherited receptors and acquired sequence information, nucleic acid immunity comprises innate and adaptive components. Effector functions include diverse nuclease systems, intrinsic activities to directly restrict the function of foreign nucleic acids (e.g., PKR, ADAR1, IFIT1), and extrinsic pathways to alert the immune system and to elicit cytotoxic immune responses. These effects act in concert to restrict viral replication and to eliminate virus-infected cells. The principles of nucleic acid immunity are highly relevant for human disease. Besides its essential contribution to antiviral defense and restriction of endogenous retroelements, dysregulation of nucleic acid immunity can also lead to erroneous detection and response to self nucleic acids then causing sterile inflammation and autoimmunity. Even mechanisms of nucleic acid immunity which are not established in vertebrates are relevant for human disease when they are present in pathogens such as bacteria, parasites, or helminths or in pathogen-transmitting organisms such as insects. This review aims to provide an overview of the diverse mechanisms of nucleic acid immunity which mostly have been looked at separately in the past and to integrate them under the framework nucleic acid immunity as a basic principle of life, the understanding of which has great potential to

  13. DNA Immunization

    PubMed Central

    Wang, Shixia; Lu, Shan

    2013-01-01

    DNA immunization was discovered in early 1990s and its use has been expanded from vaccine studies to a broader range of biomedical research, such as the generation of high quality polyclonal and monoclonal antibodies as research reagents. In this unit, three common DNA immunization methods are described: needle injection, electroporation and gene gun. In addition, several common considerations related to DNA immunization are discussed. PMID:24510291

  14. Combination of interleukin-12 gene therapy, metronomic cyclophosphamide and DNA cancer vaccination directs all arms of the immune system towards tumor eradication.

    PubMed

    Denies, Sofie; Cicchelero, Laetitia; Van Audenhove, Isabel; Sanders, Niek N

    2014-08-10

    In this work a combination therapy that acts upon the immune suppressive, the innate and specific arms of the immune system is proposed. This combination therapy, which consists of intratumoral interleukin-12 (IL-12) gene therapy, human tyrosinase (hTyr) DNA vaccination and metronomic cyclophosphamide (CPX), was evaluated in a B16-F10 mouse model. The following groups were compared: (1) no treatment, (2) control vector, (3) intratumoral IL-12 gene therapy, (4) intratumoral IL-12 gene therapy+metronomic CPX, (5) intratumoral IL-12 gene therapy+metronomic CPX+hTyr DNA vaccination. Next to clinical efficacy and safety, we characterized acute effects of IL-12 and anti-tumor immune response after a second tumor challenge. All treatment groups showed increased survival and higher cure rates than control groups. Survival of non-cured mice was increased when metronomic CPX was combined with IL-12 gene therapy. Furthermore, mice that received metronomic CPX had significantly lower percentages of regulatory T cells. Addition of the hTyr DNA vaccine increased cure rate and resulted in increased survival compared to other treatment groups. We also demonstrated that the manifest necrosis within days after IL-12 gene therapy is at least partly due to IL-12 mediated activation of NK cells. All cured mice were resistant to a second challenge. A humoral memory response against the tumor cells was observed in all groups that received IL-12 gene therapy, while a cellular memory response was observed only in the vaccinated mice. In conclusion, every component of this combination treatment contributed a unique immunologic trait with associated clinical benefits.

  15. Human pathogenic Borrelia spielmanii sp. nov. resists complement-mediated killing by direct binding of immune regulators factor H and factor H-like protein 1.

    PubMed

    Herzberger, Pia; Siegel, Corinna; Skerka, Christine; Fingerle, Volker; Schulte-Spechtel, Ulrike; van Dam, Alje; Wilske, Bettina; Brade, Volker; Zipfel, Peter F; Wallich, Reinhard; Kraiczy, Peter

    2007-10-01

    Borrelia spielmanii sp. nov. has recently been shown to be a novel human pathogenic genospecies that causes Lyme disease in Europe. In order to elucidate the immune evasion mechanisms of B. spielmanii, we compared the abilities of isolates obtained from Lyme disease patients and tick isolate PC-Eq17 to escape from complement-mediated bacteriolysis. Using a growth inhibition assay, we show that four B. spielmanii isolates, including PC-Eq17, are serum resistant, whereas a single isolate, PMew, was more sensitive to complement-mediated lysis. All isolates activated complement in vitro, as demonstrated by covalent attachment of C3 fragments; however, deposition of the later activation products C6 and C5b-9 was restricted to the moderately serum-resistant isolate PMew and the serum-sensitive B. garinii isolate G1. Furthermore, serum adsorption experiments revealed that all B. spielmanii isolates acquired the host alternative pathway regulators factor H and factor H-like protein (FHL-1) from human serum. Both complement regulators retained their factor I-mediated C3b inactivation activities when bound to spirochetes. In addition, two distinct factor H and FHL-1 binding proteins, BsCRASP-1 and BsCRASP-2, were identified, which we estimated to be approximately 23 to 25 kDa in mass. A further factor H binding protein, BsCRASP-3, was found exclusively in the tick isolate, PC-Eq17. This is the first report describing an immune evasion mechanism utilized by B. spielmanii sp. nov., and it demonstrates the capture of human immune regulators to resist complement-mediated killing.

  16. Immune System

    EPA Science Inventory

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  17. Immune System

    EPA Science Inventory

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  18. Immunity in Chagas’ Disease.

    DTIC Science & Technology

    This is the final report on the immunity in Chagas ’ disease contract and it summarizes the results of a diversity of studies directed toward...antibody test for Chagas ’ disease. Also mentioned are the facts that the cell membranes of live trypomastigotes are not immunoreactive with the...humoral immune response of an infected host and that suppression of parasitemias in chronic Chagas ’ disease is probably a function of the cell immune system of the host. (Author)

  19. Immunometabolism: Cellular Metabolism Turns Immune Regulator.

    PubMed

    Loftus, Róisín M; Finlay, David K

    2016-01-01

    Immune cells are highly dynamic in terms of their growth, proliferation, and effector functions as they respond to immunological challenges. Different immune cells can adopt distinct metabolic configurations that allow the cell to balance its requirements for energy, molecular biosynthesis, and longevity. However, in addition to facilitating immune cell responses, it is now becoming clear that cellular metabolism has direct roles in regulating immune cell function. This review article describes the distinct metabolic signatures of key immune cells, explains how these metabolic setups facilitate immune function, and discusses the emerging evidence that intracellular metabolism has an integral role in controlling immune responses.

  20. Immunometabolism: Cellular Metabolism Turns Immune Regulator*

    PubMed Central

    Loftus, Róisín M.; Finlay, David K.

    2016-01-01

    Immune cells are highly dynamic in terms of their growth, proliferation, and effector functions as they respond to immunological challenges. Different immune cells can adopt distinct metabolic configurations that allow the cell to balance its requirements for energy, molecular biosynthesis, and longevity. However, in addition to facilitating immune cell responses, it is now becoming clear that cellular metabolism has direct roles in regulating immune cell function. This review article describes the distinct metabolic signatures of key immune cells, explains how these metabolic setups facilitate immune function, and discusses the emerging evidence that intracellular metabolism has an integral role in controlling immune responses. PMID:26534957

  1. Cross-reactive gut-directed immune response against Salmonella enterica serovar Paratyphi A and B in typhoid fever and after oral Ty21a typhoid vaccination.

    PubMed

    Pakkanen, Sari H; Kantele, Jussi M; Kantele, Anu

    2012-09-14

    There are no vaccines against paratyphoid fever in clinical use. The disease has become more wide-spread and there is a growing problem of antibiotic resistance among the strains. Previous reports suggest that the oral live Salmonella Typhi Ty21a-vaccine confers protection against paratyphoid B fever. Data on efficacy against paratyphoid A fever are somewhat contentious. The present study investigated the immunological basis for such efficacy reports at a single-cell level: plasmablasts (identified as antibody-secreting cells, ASC) were studied for secretion of antibodies cross-reactive with Salmonella Paratyphi in the circulation of patients with enteric fever and of volunteers vaccinated with Ty21a. Thirty volunteers immunized with Ty21a and five patients with enteric fever were investigated for Salmonella Typhi and Salmonella Paratyphi A/B/C-specific circulating plasmablasts. PBMC were sorted by their expression of homing receptors (HR) for the intestine (α4β7), peripheral lymph node (l-selectin) and skin (CLA) and typhoid- and paratyphoid-specific plasmablasts were enumerated with ELISPOT. Before vaccination, no cross-reactive ASC were found in the volunteers. In addition to the Salmonella Typhi-specific response, a significant cross-reactive immune response was mounted against Salmonella Paratyphi A and B both in the patients and the vaccinees. The magnitude of the response increased in the order Salmonella Paratyphi A (median 30 ASC/10(6) PBMC)→Salmonella Paratyphi B (median 81)→Salmonella Typhi (median 301) in the vaccinees. Both in patients and in vaccinees, the homing receptor (HR) selection favored homing to the gut, indicating a humoral intestinal immune response. These immunological data provide evidence consistent with previous reports describing certain levels of cross-protective efficacy of Ty21a against paratyphoid fever. Controlled studies are needed to evaluate cross-protective efficacy. In the current situation where paratyphoid fever is

  2. Pyroshock prediction procedures

    NASA Astrophysics Data System (ADS)

    Piersol, Allan G.

    2002-05-01

    Given sufficient effort, pyroshock loads can be predicted by direct analytical procedures using Hydrocodes that analytically model the details of the pyrotechnic explosion and its interaction with adjacent structures, including nonlinear effects. However, it is more common to predict pyroshock environments using empirical procedures based upon extensive studies of past pyroshock data. Various empirical pyroshock prediction procedures are discussed, including those developed by the Jet Propulsion Laboratory, Lockheed-Martin, and Boeing.

  3. Role of host- and pathogen-associated lipids in directing the immune response in mycobacterial infections, with emphasis on Mycobacterium avium subsp. paratuberculosis.

    PubMed

    Thirunavukkarasu, Shyamala; de Silva, Kumudika; Plain, Karren M; J Whittington, Richard

    2016-01-01

    Mycobacteria have a complex cell wall with a high lipid content that confers unique advantages for bacterial survival in the hostile host environment, leading to long-term infection. There is a wealth of evidence suggesting the role cell wall-associated lipid antigens play at the host-pathogen interface by contributing to bacterial virulence. One pathway that pathogenic mycobacteria use to subvert host immune pathways to their advantage is host cholesterol/lipid homeostasis. This review focuses on the possible role of pathogen- and host-associated lipids in the survival and persistence of pathogenic mycobacteria with emphasis on Mycobacterium avium subsp. paratuberculosis. We draw upon literature in diverse areas of infectious and metabolic diseases and explain a mechanism by which mycobacterial-induced changes in the host cellular energy state could account for phenomena that are a hallmark of chronic mycobacterial diseases.

  4. Effects of Bacillus subtilis-based direct-fed microbials on growth performance, immune characteristics and resistance against experimental coccidiosis in broiler chickens

    USDA-ARS?s Scientific Manuscript database

    The present experiment was conducted to study the effects of dietary Bacillus-based direct-fed microbials (DFMs) on cytokine expression patterns, intestinal intraepithelial lymphocyte (IEL) subpopulation, splenocyte proliferation, macrophage functions and resistance against experimental coccidiosis ...

  5. Innate immunity.

    PubMed

    Revillard, Jean-Pierre

    2002-01-01

    For more than half a century immunological research has been almost exclusively orientated towards the acquired immune response and the mechanisms of immune tolerance. Major discoveries have enabled us to better understand the functioning of the specific immune system: the structure of antibody molecules, the genetic mechanisms leading to the molecular diversity of B (BCR) and T (TCR) lymphocyte antigen receptors, the biological function of major histocompatibility complex (MHC) molecules in the presentation of peptides to alpha/beta receptor bearing T lymphocytes, the processes of positive and negative selection of lymphocytes during the course of their differentiation. The major role of specific or acquired immunity has been shown by the rapidly lethal character of severe combined immune deficiency diseases and various alterations in the mechanisms of tolerance have been proposed to explain the chronic inflammatory illnesses which are considered to be auto-immune. Natural or innate immunity has been known since the first description of an inflammatory reaction attributed to Cornelius Celsus. It entered into the scientific era at the end of the 19th century with the discovery of phagocytes by Metchnikoff and of the properties of the complement system by Bordet [1] but due to the vastness of the field and its lack of clear definition, it failed to excite the interest of researchers. The discovery of cytokines and progress in knowledge of the mechanisms of the inflammatory reaction have certainly helped to banish preconceived ideas about natural immunity, which was wrongly labelled as non-specific. This has led to the proposition of a wider role for immune functions beyond the level of the cell or the organism [2] and to a better understanding of the importance of the immediate defence mechanisms and their role in the later orientation of the acquired response.

  6. Maternal Immunization

    PubMed Central

    Chu, Helen Y.; Englund, Janet A.

    2014-01-01

    Maternal immunization has the potential to protect the pregnant woman, fetus, and infant from vaccine-preventable diseases. Maternal immunoglobulin G is actively transported across the placenta, providing passive immunity to the neonate and infant prior to the infant's ability to respond to vaccines. Currently inactivated influenza, tetanus toxoid, and acellular pertussis vaccines are recommended during pregnancy. Several other vaccines have been studied in pregnancy and found to be safe and immunogenic and to provide antibody to infants. These include pneumococcus, group B Streptococcus, Haemophilus influenzae type b, and meningococcus vaccines. Other vaccines in development for potential maternal immunization include respiratory syncytial virus, herpes simplex virus, and cytomegalovirus vaccines. PMID:24799324

  7. Genetically Modified Live Attenuated Leishmania donovani Parasites Induce Innate Immunity through Classical Activation of Macrophages That Direct the Th1 Response in Mice

    PubMed Central

    Bhattacharya, Parna; Dey, Ranadhir; Dagur, Pradeep K.; Kruhlak, Michael; Ismail, Nevien; Debrabant, Alain; Joshi, Amritanshu B.; Akue, Adovi; Kukuruga, Mark; Takeda, Kazuyo; Selvapandiyan, Angamuthu; McCoy, John Philip

    2015-01-01

    Visceral leishmaniasis (VL) causes significant mortality and there is no effective vaccine. Previously, we have shown that genetically modified Leishmania donovani parasites, here described as live attenuated parasites, induce a host protective adaptive immune response in various animal models. In this study, we demonstrate an innate immune response upon infection with live attenuated parasites in macrophages from BALB/c mice both in vitro and in vivo. In vitro infection of macrophages with live attenuated parasites (compared to that with wild-type [WT] L. donovani parasites) induced significantly higher production of proinflammatory cytokines (tumor necrosis factor alpha [TNF-α], interleukin-12 [IL-12], gamma interferon [IFN-γ], and IL-6), chemokines (monocyte chemoattractant protein 1/CCL-2, macrophage inflammatory protein 1α/CCL-3, and IP-10), reactive oxygen species (ROS), and nitric oxide, while concomitantly reducing anti-inflammatory cytokine IL-10 and arginase-1 activities, suggesting a dominant classically activated/M1 macrophage response. The classically activated response in turn helps in presenting antigen to T cells, as observed with robust CD4+ T cell activation in vitro. Similarly, parasitized splenic macrophages from live attenuated parasite-infected mice also demonstrated induction of an M1 macrophage phenotype, indicated by upregulation of IL-1β, TNF-α, IL-12, and inducible nitric oxide synthase 2 and downregulation of genes associated with the M2 phenotype, i.e., the IL-10, YM1, Arg-1, and MRC-1 genes, compared to WT L. donovani-infected mice. Furthermore, an ex vivo antigen presentation assay showed macrophages from live attenuated parasite-infected mice induced higher IFN-γ and IL-2 but significantly less IL-10 production by ovalbumin-specific CD4+ T cells, resulting in proliferation of Th1 cells. These data suggest that infection with live attenuated parasites promotes a state of classical activation (M1 dominant) in macrophages that

  8. Genetically Modified Live Attenuated Leishmania donovani Parasites Induce Innate Immunity through Classical Activation of Macrophages That Direct the Th1 Response in Mice.

    PubMed

    Bhattacharya, Parna; Dey, Ranadhir; Dagur, Pradeep K; Kruhlak, Michael; Ismail, Nevien; Debrabant, Alain; Joshi, Amritanshu B; Akue, Adovi; Kukuruga, Mark; Takeda, Kazuyo; Selvapandiyan, Angamuthu; McCoy, John Philip; Nakhasi, Hira L

    2015-10-01

    Visceral leishmaniasis (VL) causes significant mortality and there is no effective vaccine. Previously, we have shown that genetically modified Leishmania donovani parasites, here described as live attenuated parasites, induce a host protective adaptive immune response in various animal models. In this study, we demonstrate an innate immune response upon infection with live attenuated parasites in macrophages from BALB/c mice both in vitro and in vivo. In vitro infection of macrophages with live attenuated parasites (compared to that with wild-type [WT] L. donovani parasites) induced significantly higher production of proinflammatory cytokines (tumor necrosis factor alpha [TNF-α], interleukin-12 [IL-12], gamma interferon [IFN-γ], and IL-6), chemokines (monocyte chemoattractant protein 1/CCL-2, macrophage inflammatory protein 1α/CCL-3, and IP-10), reactive oxygen species (ROS), and nitric oxide, while concomitantly reducing anti-inflammatory cytokine IL-10 and arginase-1 activities, suggesting a dominant classically activated/M1 macrophage response. The classically activated response in turn helps in presenting antigen to T cells, as observed with robust CD4(+) T cell activation in vitro. Similarly, parasitized splenic macrophages from live attenuated parasite-infected mice also demonstrated induction of an M1 macrophage phenotype, indicated by upregulation of IL-1β, TNF-α, IL-12, and inducible nitric oxide synthase 2 and downregulation of genes associated with the M2 phenotype, i.e., the IL-10, YM1, Arg-1, and MRC-1 genes, compared to WT L. donovani-infected mice. Furthermore, an ex vivo antigen presentation assay showed macrophages from live attenuated parasite-infected mice induced higher IFN-γ and IL-2 but significantly less IL-10 production by ovalbumin-specific CD4(+) T cells, resulting in proliferation of Th1 cells. These data suggest that infection with live attenuated parasites promotes a state of classical activation (M1 dominant) in macrophages that

  9. Immune tolerance induction by integrating innate and adaptive immune regulators

    PubMed Central

    Suzuki, Jun; Ricordi, Camillo; Chen, Zhibin

    2009-01-01

    A diversity of immune tolerance mechanisms have evolved to protect normal tissues from immune damage. Immune regulatory cells are critical contributors to peripheral tolerance. These regulatory cells, exemplified by the CD4+Foxp3+ regulatory T (Treg) cells and a recently identified population named myeloid-derived suppressor cells (MDSCs), regulate immune responses and limiting immune-mediated pathology. In a chronic inflammatory setting, such as allograft-directed immunity, there may be a dynamic “crosstalk” between the innate and adaptive immunomodulatory mechanisms for an integrated control of immune damage. CTLA4-B7-based interaction between the two branches may function as a molecular “bridge” to facilitate such “crosstalk”. Understanding the interplays among Treg cells, innate suppressors and pathogenic effector T (Teff) cells will be critical in the future to assist in the development of therapeutic strategies to enhance and synergize physiological immunosuppressive elements in the innate and adaptive immune system. Successful development of localized strategies of regulatory cell therapies could circumvent the requirement for very high number of cells and decrease the risks associated with systemic immunosuppression. To realize the potential of innate and adaptive immune regulators for the still-elusive goal of immune tolerance induction, adoptive cell therapies may also need to be coupled with agents enhancing endogenous tolerance mechanisms. PMID:19919733

  10. Antimicrobial effects of murine mesenchymal stromal cells directed against Toxoplasma gondii and Neospora caninum: role of immunity-related GTPases (IRGs) and guanylate-binding proteins (GBPs).

    PubMed

    Spekker, K; Leineweber, M; Degrandi, D; Ince, V; Brunder, S; Schmidt, S K; Stuhlsatz, S; Howard, J C; Schares, G; Degistirici, O; Meisel, R; Sorg, R V; Seissler, J; Hemphill, A; Pfeffer, K; Däubener, W

    2013-06-01

    Mesenchymal stromal cells (MSCs) have a multilineage differentiation potential and provide immunosuppressive and antimicrobial functions. Murine as well as human MSCs restrict the proliferation of T cells. However, species-specific differences in the underlying molecular mechanisms have been described. Here, we analyzed the antiparasitic effector mechanisms active in murine MSCs. Murine MSCs, in contrast to human MSCs, could not restrict the growth of a highly virulent strain of Toxoplasma gondii (BK) after stimulation with IFN-γ. However, the growth of a type II strain of T. gondii (ME49) was strongly inhibited by IFN-γ-activated murine MSCs. Immunity-related GTPases (IRGs) as well as guanylate-binding proteins (GBPs) contributed to this antiparasitic effect. Further analysis showed that IFN-γ-activated mMSCs also inhibit the growth of Neospora caninum, a parasite belonging to the apicomplexan group as well. Detailed studies with murine IFN-γ-activated MSC indicated an involvement in IRGs like Irga6, Irgb6 and Irgd in the inhibition of N. caninum. Additional data showed that, furthermore, GBPs like mGBP1 and mGBP2 could have played a role in the anti-N. caninum effect of murine MSCs. These data underline that MSCs, in addition to their regenerative and immunosuppressive activity, function as antiparasitic effector cells as well. However, IRGs are not present in the human genome, indicating a species-specific difference in anti-T. gondii and anti-N. caninum effect between human and murine MSCs.

  11. The intersection of immune-directed and molecularly targeted therapy in advanced melanoma: where we have been, are, and will be.

    PubMed

    Sullivan, Ryan J; Lorusso, Patricia M; Flaherty, Keith T

    2013-10-01

    In three years, four drugs have gained regulatory approval for the treatment of metastatic and unresectable melanoma, with at least seven other drugs having recently completed, currently in, or soon to be in phase III clinical testing. This amazing achievement has been made following a remarkable increase of knowledge in molecular biology and immunology that led to the identification of high-valued therapeutic targets and the clinical development of agents that effectively engage and inhibit these targets. The discovery of either effective molecularly targeted therapies or immunotherapies would have led to dramatic improvements to the standard-of-care treatment of melanoma. However, through parallel efforts that have showcased the efficacy of small-molecule BRAF and MAP-ERK kinase (MEK) inhibitors, as well as the immune checkpoint inhibitors, namely ipilimumab and the anti-PD1/PDL1 antibodies (lambrolizumab, nivolumab, MPDL3280), an opportunity exists to transform the treatment of melanoma specifically and cancer generally by exploring rational combinations of molecularly targeted therapies, immunotherapies, and molecular targeted therapies with immunotherapies. This overview presents the historical context to this therapeutic revolution, reviews the benefits and limitations of current therapies, and provides a look ahead at where the field is headed. ©2013 AACR.

  12. The intersection of immune-directed and molecularly targeted therapy in advanced melanoma: Where we have been, are, and will be

    PubMed Central

    Sullivan, Ryan J.; LoRusso, Patricia M.; Flaherty, Keith T.

    2013-01-01

    In three years, four drugs have gained regulatory approval for the treatment of metastatic and unresectable melanoma with at least seven other drugs having recently completed, currently in, or soon to be in phase III clinical testing. This amazing achievement has been made following a remarkable increase of knowledge in molecular biology and immunology that led to the identification of high-valued therapeutic targets and the clinical development of agents that effectively engage and inhibit these targets. The discovery of either effective molecularly targeted therapies or immunotherapies would have led to dramatic improvements to the standard of care treatment of melanoma. However, through parallel efforts that have showcased the efficacy of small molecule BRAF and MEK inhibitors as well as the immune checkpoint inhibitors, namely ipilimumab and the anti-PD1/PDL1 antibodies (lambrolizumab, nivolumab, MPDL3280), an opportunity exists to transform the treatment of melanoma specifically and cancer generally by exploring rational combinations of molecularly targeted therapies, immunotherapies, and molecular targeted therapies with immunotherapies. This overview presents the historical context to this therapeutic revolution, reviews the benefits and limitations of current therapies, and provides a look ahead at where the field is headed. PMID:24089441

  13. A Toxoplasma dense granule protein, GRA24, modulates the early immune response to infection by promoting a direct and sustained host p38 MAPK activation

    PubMed Central

    Braun, Laurence; Brenier-Pinchart, Marie-Pierre; Yogavel, Manickam; Curt-Varesano, Aurélie; Curt-Bertini, Rose-Laurence; Hussain, Tahir; Kieffer-Jaquinod, Sylvie; Coute, Yohann; Pelloux, Hervé; Tardieux, Isabelle; Sharma, Amit; Belrhali, Hassan

    2013-01-01

    Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan parasite that resides inside a parasitophorous vacuole. During infection, Toxoplasma actively remodels the transcriptome of its hosting cells with profound and coupled impact on the host immune response. We report that Toxoplasma secretes GRA24, a novel dense granule protein which traffics from the vacuole to the host cell nucleus. Once released into the host cell, GRA24 has the unique ability to trigger prolonged autophosphorylation and nuclear translocation of the host cell p38α MAP kinase. This noncanonical kinetics of p38α activation correlates with the up-regulation of the transcription factors Egr-1 and c-Fos and the correlated synthesis of key proinflammatory cytokines, including interleukin-12 and the chemokine MCP-1, both known to control early parasite replication in vivo. Remarkably, the GRA24–p38α complex is defined by peculiar structural features and uncovers a new regulatory signaling path distinct from the MAPK signaling cascade and otherwise commonly activated by stress-related stimuli or various intracellular microbes. PMID:24043761

  14. Development and Validation of a Fast Procedure to Analyze Amoxicillin in River Waters by Direct-Injection LC-MS/MS

    ERIC Educational Resources Information Center

    Homem, Vera; Alves, Arminda; Santos, Lu´cia

    2014-01-01

    A laboratory application with a strong component in analytical chemistry was designed for undergraduate students, in order to introduce a current problem in the environmental science field, the water contamination by antibiotics. Therefore, a simple and rapid method based on direct injection and high performance liquid chromatography-tandem mass…

  15. Development and Validation of a Fast Procedure to Analyze Amoxicillin in River Waters by Direct-Injection LC-MS/MS

    ERIC Educational Resources Information Center

    Homem, Vera; Alves, Arminda; Santos, Lu´cia

    2014-01-01

    A laboratory application with a strong component in analytical chemistry was designed for undergraduate students, in order to introduce a current problem in the environmental science field, the water contamination by antibiotics. Therefore, a simple and rapid method based on direct injection and high performance liquid chromatography-tandem mass…

  16. The Differential Effects of Direct Instruction and Procedural Facilitators on the Writing Outcomes of Fifth-Grade Students with Behavior Disorders

    ERIC Educational Resources Information Center

    Patterson, DaShaunda; Houchins, David E.; Jolivette, Kristine; Heflin, Juane; Fredrick, Laura

    2011-01-01

    Effective written expression is a necessary form of communication and one of the most difficult tasks for students with disabilities to master. Few instructional strategies for writing have been validated specifically for students with emotional and behavior disorders. This single-subject study evaluated the effect of a Direct Instruction program…

  17. Effects of Direct Instruction Plus Procedural Facilitation on the Expository Writing of Adolescents with Emotional and Behavioral Disabilities in Residential Schools

    ERIC Educational Resources Information Center

    White, Mark W.; Houchins, David E.; Viel-Ruma, Kimberly A.; Dever, Bridget V.

    2014-01-01

    This study investigated the effects of the "Expressive Writing (EW)" direct instruction curriculum on the expository writing skills of secondary grade students with serious emotional and behavioral disabilities (EBD). The "EW" program targets writing mechanics, sentence writing, and editing but does not include pre-writing…

  18. Starclose SE® hemostasis after 6F direct antegrade superficial femoral artery access distal to the femoral head for peripheral endovascular procedures in obese patients

    PubMed Central

    Spiliopoulos, Stavros; Kitrou, Panagiotis; Christeas, Nikolaos; Karnabatidis, Dimitris

    2016-01-01

    PURPOSE Direct superficial femoral artery (SFA) antegrade puncture is a valid alternative to common femoral artery (CFA) access for peripheral vascular interventions. Data investigating vascular closure device (VCD) hemostasis of distant SFA 6F access are limited. We aimed to investigate the safety and effectiveness of the Starclose SE® VCD for hemostasis, following direct 6F antegrade SFA access distal to the femoral head. METHODS This prospective, single-center study included patients who were not suitable for CFA puncture and were scheduled to undergo peripheral endovascular interventions using direct antegrade SFA 6F access, at least 2 cm below the inferior edge of femoral head. Hemostasis was obtained with the Starclose SE® VCD (Abbott Laboratories). Primary endpoints were successful hemostasis rate and periprocedural (30-day) major complication rate. Secondary endpoint was the rate of minor complications. Clinical and Doppler ultrasound follow-up was performed at discharge and at one month. RESULTS Between September 2014 and August 2015, a total of 30 patients (21 male; 70.0%) with a mean body mass index of 41.2 kg/m2 were enrolled. Mean age was 72±9 years (range, 67–88 years). Most patients suffered from critical limb ischemia (87.1%) and diabetes (61.3%). Calcifications were present in eight cases (26.6%). Reason for direct SFA puncture was obesity (100%). Successful hemostasis was achieved in 100% of the cases. No major complications were noted after one-month follow-up. Minor complications included two <5 cm hematomas (6.6%) not necessitating treatment. CONCLUSION In this prospective study, Starclose SE® VCD was safe and effective for hemostasis of antegrade direct SFA puncture. Uncomplicated hemostasis was achieved even in cases of puncturing 2 to 7 cm below the inferior edge of the femoral head. PMID:27641942

  19. Starclose SE® hemostasis after 6F direct antegrade superficial femoral artery access distal to the femoral head for peripheral endovascular procedures in obese patients.

    PubMed

    Spiliopoulos, Stavros; Kitrou, Panagiotis; Christeas, Nikolaos; Karnabatidis, Dimitris

    2016-01-01

    Direct superficial femoral artery (SFA) antegrade puncture is a valid alternative to common femoral artery (CFA) access for peripheral vascular interventions. Data investigating vascular closure device (VCD) hemostasis of distant SFA 6F access are limited. We aimed to investigate the safety and effectiveness of the Starclose SE® VCD for hemostasis, following direct 6F antegrade SFA access distal to the femoral head. This prospective, single-center study included patients who were not suitable for CFA puncture and were scheduled to undergo peripheral endovascular interventions using direct antegrade SFA 6F access, at least 2 cm below the inferior edge of femoral head. Hemostasis was obtained with the Starclose SE® VCD (Abbott Laboratories). Primary endpoints were successful hemostasis rate and periprocedural (30-day) major complication rate. Secondary endpoint was the rate of minor complications. Clinical and Doppler ultrasound follow-up was performed at discharge and at one month. Between September 2014 and August 2015, a total of 30 patients (21 male; 70.0%) with a mean body mass index of 41.2 kg/m2 were enrolled. Mean age was 72±9 years (range, 67-88 years). Most patients suffered from critical limb ischemia (87.1%) and diabetes (61.3%). Calcifications were present in eight cases (26.6%). Reason for direct SFA puncture was obesity (100%). Successful hemostasis was achieved in 100% of the cases. No major complications were noted after one-month follow-up. Minor complications included two <5 cm hematomas (6.6%) not necessitating treatment. In this prospective study, Starclose SE® VCD was safe and effective for hemostasis of antegrade direct SFA puncture. Uncomplicated hemostasis was achieved even in cases of puncturing 2 to 7 cm below the inferior edge of the femoral head.

  20. Human Articular Chondrocytes Regulate Immune Response by Affecting Directly T Cell Proliferation and Indirectly Inhibiting Monocyte Differentiation to Professional Antigen-Presenting Cells

    PubMed Central

    Pereira, Rui C.; Martinelli, Daniela; Cancedda, Ranieri; Gentili, Chiara; Poggi, Alessandro

    2016-01-01

    Autologous chondrocyte implantation is the current gold standard cell therapy for cartilage lesions. However, in some instances, the heavily compromised health of the patient can either impair or limit the recovery of the autologous chondrocytes and a satisfactory outcome of the implant. Allogeneic human articular chondrocytes (hAC) could be a good alternative, but the possible immunological incompatibility between recipient and hAC donor should be considered. Herein, we report that allogeneic hAC inhibited T lymphocyte response to antigen-dependent and -independent proliferative stimuli. This effect was maximal when T cells and hAC were in contact and it was not relieved by the addition of exogenous lymphocyte growth factor interleukin (IL)-2. More important, hAC impaired the differentiation of peripheral blood monocytes induced with granulocyte monocyte colony-stimulating factor and IL-4 (Mo) to professional antigen-presenting cells, such as dendritic cells (DC). Indeed, a marked inhibition of the onset of the CD1a expression and an ineffective downregulation of CD14 antigens was observed in Mo–hAC co-cultures. Furthermore, compared to immature or mature DC, Mo from Mo–hAC co-cultures did not trigger an efficacious allo-response. The prostaglandin (PG) E2 present in the Mo–hAC co-culture conditioned media is a putative candidate of the hAC-mediated inhibition of Mo maturation. Altogether, these findings indicate that allogeneic hAC inhibit, rather than trigger, immune response and strongly suggest that an efficient chondrocyte implantation could be possible also in an allogeneic setting. PMID:27822208

  1. Making healthier or killing enemies? Bacterial volatile-elicited plant immunity plays major role upon protection of Arabidopsis than the direct pathogen inhibition

    PubMed Central

    Sharifi, Rouhallah; Ryu, Choong-Min

    2016-01-01

    ABSTRACT Bacterial volatiles protect plants either by directly inhibiting a pathogenic fungus or by improving the defense capabilities of plants. The effect of bacterial volatiles on fungal growth was dose-dependent. A low dosage did not have a noticeable effect on Botrytis cinerea growth and development, but was sufficient to elicit induced resistance in Arabidopsis thaliana. Bacterial volatiles displayed negative effects on biofilm formation on a polystyrene surface and in in planta leaf colonization of B. cinerea. However, bacterial volatile-mediated induced resistance was the major mechanism mediating protection of plants from B. cinerea. It was responsible for more than 90% of plant protection in comparison with direct fungal inhibition. Our results broaden our knowledge of the role of bacterial volatiles in plant protection. PMID:27574539

  2. Making healthier or killing enemies? Bacterial volatile-elicited plant immunity plays major role upon protection of Arabidopsis than the direct pathogen inhibition.

    PubMed

    Sharifi, Rouhallah; Ryu, Choong-Min

    2016-01-01

    Bacterial volatiles protect plants either by directly inhibiting a pathogenic fungus or by improving the defense capabilities of plants. The effect of bacterial volatiles on fungal growth was dose-dependent. A low dosage did not have a noticeable effect on Botrytis cinerea growth and development, but was sufficient to elicit induced resistance in Arabidopsis thaliana. Bacterial volatiles displayed negative effects on biofilm formation on a polystyrene surface and in in planta leaf colonization of B. cinerea. However, bacterial volatile-mediated induced resistance was the major mechanism mediating protection of plants from B. cinerea. It was responsible for more than 90% of plant protection in comparison with direct fungal inhibition. Our results broaden our knowledge of the role of bacterial volatiles in plant protection.

  3. The immunity status of demodecosis patients.

    PubMed

    Kogan, B G; Koljadenko, V G; Golovtchenko, D Y

    1991-01-01

    49 patients with different clinical types of demodecosis were examined. There was a pronounced decrease in the T-cellular immunity state on the skin. The state of immunity was directly dependent on the degree of clinical manifestation and when the patients contracted the disease, and it correlated with data from the humoral immunity state study (CIC).

  4. Innate immunity in rice

    PubMed Central

    Chen, Xuewei; Ronald, Pamela C.

    2011-01-01

    Advances in studies of rice innate immunity have led to the identification and characterization of host sensors encoding receptor kinases that perceive conserved microbial signatures. The non-RD domain, a newly recognized hallmark of these receptor kinases is highly expanded in rice (Oryza sativa) compared with Arabidopsis (Arabidopsis thaliana). Researchers have also identified a diverse array of microbial effectors from bacterial and fungal pathogens that triggers immune responses upon perception. These include both, effectors that indirectly target host Nucleotide binding site/Leucine rice repeat (NBS-LRR) proteins and transcription activator-like (TAL) effectors that directly bind promoters of host genes. Here we review the recognition and signaling events that govern rice innate immunity. PMID:21602092

  5. The Effects of Direct-fed Microbial Supplementation, as an Alternative to Antibiotics, on Growth Performance, Intestinal Immune Status, and Epithelial Barrier Gene Expression in Broiler Chickens.

    PubMed

    Gadde, U; Oh, S T; Lee, Y S; Davis, E; Zimmerman, N; Rehberger, T; Lillehoj, Hyun S

    2017-04-18

    The objective of this study was to investigate the effects of Bacillus subtilis-based probiotic supplementation in broiler chicken diets on growth performance, feed efficiency, intestinal cytokine, and tight junction (TJ) protein mRNA expression. Zero-day-old broiler chicks (n = 140) were randomly assigned to one of five dietary treatments: basal diet (CON); basal diet supplemented with either antibiotic bacitracin methylene disalicylate (BMD); or probiotics, namely, B. subtilis strain 1781 (PB1), a combination of B. subtilis strain 1104 + strain 747 (PB2), or B. subtilis strain 1781 + strain 747 (PB3). Body weight and feed intake were measured at 14 days of age, and the feed conversion ratio (FCR) was calculated. At 14 days of age, ileal samples were collected and used for intestinal cytokine, TJ protein, and mucin gene expression analysis using qRT-PCR. The chickens supplemented with antibiotic (BMD) and B. subtilis strain 1781 alone (PB1) had significantly higher body weights compared to controls of the same age. Dietary supplementation with antibiotic (BMD) or probiotics (PB1, PB2, PB3) significantly improved the feed efficiency as evidenced by decreased FCR compared to controls. No differences were observed in the expression of IL1β, IL17F, IFNγ, and MUC2 gene among the different treatment groups. However, elevated expression of IL6 (BMD, PB1, PB2), IL8 (PB2), and TNFSF15 (PB1, PB2, PB3) compared to controls was observed in the ileum. IL2 and IL10 expression was upregulated in chicks in the PB2 and PB3 groups, and IL4 was elevated in the PB1 group. IL13 was elevated in all probiotic-fed groups (PB1, PB2, PB3). Probiotic supplementation was also shown to significantly increase the expression of TJ proteins JAM2, ZO1 (PB2, PB3), and occludin (PB1, PB2). Taken together, B. subtilis supplementation altered intestinal immune activity and influenced gut barrier integrity through increased tight junction gene expression.

  6. A real-time comparison between direct control, sequential pattern recognition control and simultaneous pattern recognition control using a Fitts' law style assessment procedure.

    PubMed

    Wurth, Sophie M; Hargrove, Levi J

    2014-05-30

    Pattern recognition (PR) based strategies for the control of myoelectric upper limb prostheses are generally evaluated through offline classification accuracy, which is an admittedly useful metric, but insufficient to discuss functional performance in real time. Existing functional tests are extensive to set up and most fail to provide a challenging, objective framework to assess the strategy performance in real time. Nine able-bodied and two amputee subjects gave informed consent and participated in the local Institutional Review Board approved study. We designed a two-dimensional target acquisition task, based on the principles of Fitts' law for human motor control. Subjects were prompted to steer a cursor from the screen center of into a series of subsequently appearing targets of different difficulties. Three cursor control systems were tested, corresponding to three electromyography-based prosthetic control strategies: 1) amplitude-based direct control (the clinical standard of care), 2) sequential PR control, and 3) simultaneous PR control, allowing for a concurrent activation of two degrees of freedom (DOF). We computed throughput (bits/second), path efficiency (%), reaction time (second), and overshoot (%)) and used general linear models to assess significant differences between the strategies for each metric. We validated the proposed methodology by achieving very high coefficients of determination for Fitts' law. Both PR strategies significantly outperformed direct control in two-DOF targets and were more intuitive to operate. In one-DOF targets, the simultaneous approach was the least precise. The direct control was efficient in one-DOF targets but cumbersome to operate in two-DOF targets through a switch-depended sequential cursor control. We designed a test, capable of comprehensively describing prosthetic control strategies in real time. When implemented on control subjects, the test was able to capture statistically significant differences (p < 0

  7. [Treatment with inhibitors of new oral direct anticoagulants in patients with severe bleedings or urgent surgical procedures. The new dabigatran antidote: the place of idarucizumab in clinical practice].

    PubMed

    Boda, Zoltán

    2016-03-20

    Only vitamin K antagonists could be applied as oral anticoagulants over the past six decades. Coumarols have narrow therapeutic range, and unpredictable anticoagulant effects are resulted by multiple drug interactions. Therefore, regular routine monitoring of the international normalized ratio is necessary. There are two groups of factor-specific anticoagulants: molecules with anti-FIIa (dabigatran) and anti-FXa (rivaroxaban, apixaban and edoxaban) effect. Author summarizes the most important clinical features of the new oral anticoagulants, their indications and the possibilities of laboratory controls. Bleedings are the most important side effects of anticoagulants. This review summarizes the current published evidences for new oral anticoagulants reversal (non-specific and specific) agents, especially in cases with severe acute bleedings or urgent surgery procedures. It reports on how to use inhibitors, the recommended doses and the most important clinical results. The review focuses on idarucizumab - already approved by the U.S. Food and Drug Administration and the European Medicines Agency - which has a key role as the first specific inhibitor of dabigatran.

  8. Viruses, chemotherapy and immunity.

    PubMed

    Koziel, M J; Walker, B D

    1992-01-01

    An increasing number of antiviral agents are presently in various stages of development and testing, and an increasing number have recently been licensed for use in humans. These drugs have been used extensively to treat viral infections in immunocompromised individuals, and these studies indicate that for many antiviral agents the response to therapy is highly dependent on the integrity of the underlying host immune response. In particular, the response to zidovudine, acyclovir and ganciclovir in persons with HIV-1 infection is highly dependent upon CD4 number, which can be considered a surrogate marker for the state of host immune function in these subjects. Responses to interferons likewise can be shown to depend on the host immune response, with responses due to both direct antiviral effects of this agent as well as immunomodulatory effects mediated through interferon-induced upregulation of HLA molecule expression. The interdependence of host immunity with antiviral efficacy is underscored by the increased antiviral drug resistance in persons with advanced degrees of chronic immunosuppression, related to the higher level of viral replication and viraemia which occurs in the absence of an effective host immune response. Further definition of the precise mechanisms of these interactions should facilitate the rational design of antiviral agents and immunomodulatory therapies to improve treatment of viral infections.

  9. Plant Immunity

    USDA-ARS?s Scientific Manuscript database

    Plants are faced with defending themselves against a multitude of pathogens, including bacteria, fungi, viruses, nematodes, etc. Immunity is multi-layered and complex. Plants can induce defenses when they recognize small peptides, proteins or double-stranded RNA associated with pathogens. Recognitio...

  10. State of the Art, Unresolved Issues, and Future Research Directions in the Fight against Hepatitis C Virus: Perspectives for Screening, Diagnostics of Resistances, and Immunization

    PubMed Central

    Ansaldi, Filippo

    2016-01-01

    Hepatitis C virus (HCV) still represents a major public health threat, with a dramatic burden from both epidemiological and clinical points of view. New generation of direct-acting antiviral agents (DAAs) has been recently introduced in clinical practice promising to cure HCV and to overcome the issues related to the interferon-based therapies. However, the emergence of drug resistance and the suboptimal activity of DAAs therapies against diverse HCV genotypes have been observed, determining treatment failure and hampering an effective control of HCV spread worldwide. Moreover, these treatments remain poorly accessible, particularly in low-income countries. Finally, effective screening strategy is crucial to early identifying and treating all HCV chronically infected patients. For all these reasons, even though new drugs may contribute to impacting HCV spread worldwide a preventive HCV vaccine remains a cornerstone in the road to significantly reduce the HCV spread globally, with the ultimate goal of its eradication. Advances in molecular vaccinology, together with a strong financial, political, and societal support, will enable reaching this fundamental success in the coming years. In this comprehensive review, the state of the art about these major topics in the fight against HCV and the future of research in these fields are discussed. PMID:27843956

  11. Immune Cell Regulatory Pathways Unexplored as Host-Directed Therapeutic Targets for Mycobacterium tuberculosis: An Opportunity to Apply Precision Medicine Innovations to Infectious Diseases

    PubMed Central

    Mahon, Robert N.; Hafner, Richard

    2015-01-01

    The lack of novel antimicrobial drugs in development for tuberculosis treatment has provided an impetus for the discovery of adjunctive host-directed therapies (HDTs). Several promising HDT candidates are being evaluated, but major advancement of tuberculosis HDTs will require understanding of the master or “core” cell signaling pathways that control intersecting immunologic and metabolic regulatory mechanisms, collectively described as “immunometabolism.” Core regulatory pathways conserved in all eukaryotic cells include poly (ADP-ribose) polymerases (PARPs), sirtuins, AMP-activated protein kinase (AMPK), and mechanistic target of rapamycin (mTOR) signaling. Critical interactions of these signaling pathways with each other and their roles as master regulators of immunometabolic functions will be addressed, as well as how Mycobacterium tuberculosis is already known to influence various other cell signaling pathways interacting with them. Knowledge of these essential mechanisms of cell function regulation has led to breakthrough targeted treatment advances for many diseases, most prominently in oncology. Leveraging these exciting advances in precision medicine for the development of innovative next-generation HDTs may lead to entirely new paradigms for treatment and prevention of tuberculosis and other infectious diseases. PMID:26409283

  12. 28 CFR 35.178 - State immunity.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 1 2013-07-01 2013-07-01 false State immunity. 35.178 Section 35.178 Judicial Administration DEPARTMENT OF JUSTICE NONDISCRIMINATION ON THE BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES Compliance Procedures § 35.178 State immunity. A State shall not be...

  13. 28 CFR 35.178 - State immunity.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false State immunity. 35.178 Section 35.178 Judicial Administration DEPARTMENT OF JUSTICE NONDISCRIMINATION ON THE BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES Compliance Procedures § 35.178 State immunity. A State shall not be...

  14. 28 CFR 35.178 - State immunity.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 1 2012-07-01 2012-07-01 false State immunity. 35.178 Section 35.178 Judicial Administration DEPARTMENT OF JUSTICE NONDISCRIMINATION ON THE BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES Compliance Procedures § 35.178 State immunity. A State shall not be...

  15. 28 CFR 35.178 - State immunity.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 28 Judicial Administration 1 2011-07-01 2011-07-01 false State immunity. 35.178 Section 35.178 Judicial Administration DEPARTMENT OF JUSTICE NONDISCRIMINATION ON THE BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES Compliance Procedures § 35.178 State immunity. A State shall not be...

  16. Preservation and analytical procedures for the analysis of chloro-s-triazines and their chlorodegradate products in drinking waters using direct injection liquid chromatography tandem mass spectrometry.

    PubMed

    Smith, Glynda A; Pepich, Barry V; Munch, David J

    2008-08-22

    A direct injection, liquid chromatography tandem mass spectrometry (LC-MS/MS) method has been developed for the analysis of the chloro-s-triazine herbicides and their degradates in finished drinking water. The target compounds in the method were selected based on their inclusion in a common mechanism group (CMG) because of their ability to induce a similar toxic effect through a common mechanism of toxicity. The target list includes the chloro-s-triazines (atrazine, simazine, cyanazine, and propazine) and their dealkylated degradates (desethylatrazine, desisopropylatrazine, and diaminochlorotriazine). Potential matrix effects are minimized by the use of individual isotopically enriched internal standards. Analyte stability in finished chlorinated drinking water samples is ensured through careful selection of proper dechlorinating and antimicrobial reagents and through buffering sample pH. In the absence of proper dechlorination, the target analytes were found to degrade over a short period of time, even under refrigerated storage conditions. The final method has adequate sensitivity to accurately detect all target analytes at or below 0.1 microg/L and displays sufficient precision and robustness to warrant publication as EPA Method 536.

  17. The Usefulness of Three-Dimensional Angiography with a Flat Panel Detector of Direct Conversion Type in a Transcatheter Arterial Chemoembolization Procedure for Hepatocellular Carcinoma: Initial Experience

    SciTech Connect

    Kakeda, Shingo Korogi, Yukunori; Hatakeyama, Yoshihisa; Ohnari, Norihiro; Oda, Nobuhiro; Nishino, Kazuyoshi; Miyamoto, Wataru

    2008-03-15

    The purpose of this study was to assess the usefulness of a three-dimensional (3D) angiography system using a flat panel detector of direct conversion type in treatments with subsegmental transcatheter arterial chemoembolization (TACE) for hepatocellular carcinomas (HCCs). Thirty-six consecutive patients who underwent hepatic angiography were prospectively examined. First, two radiologists evaluated the degree of visualization of the peripheral branches of the hepatic arteries on 3D digital subtraction angiography (DSA). Then the radiologists evaluated the visualization of tumor staining and feeding arteries in 25 patients (30 HCCs) who underwent subsegmental TACE. The two radiologists who performed the TACE assessed whether the additional information provided by 3D DSA was useful for treatments. In 34 (94.4%) of 36 patients, the subsegmental branches of the hepatic arteries were sufficiently visualized. The feeding arteries of HCCs were sufficiently visualized in 28 (93%) of 30 HCCs, whereas tumor stains were sufficiently visualized in 18 (60%). Maximum intensity projection images were significantly superior to volume recording images for visualization of the tumor staining and feeding arteries of HCCs. In 27 (90%) of 30 HCCs, 3D DSA provided additional useful information for subsegmental TACE. The high-quality 3D DSA with flat panel detector angiography system provided a precise vascular road map, which was useful for performing subsegmental TACE .of HCCs.

  18. The usefulness of three-dimensional angiography with a flat panel detector of direct conversion type in a transcatheter arterial chemoembolization procedure for hepatocellular carcinoma: initial experience.

    PubMed

    Kakeda, Shingo; Korogi, Yukunori; Hatakeyama, Yoshihisa; Ohnari, Norihiro; Oda, Nobuhiro; Nishino, Kazuyoshi; Miyamoto, Wataru

    2008-01-01

    The purpose of this study was to assess the usefulness of a three-dimensional (3D) angiography system using a flat panel detector of direct conversion type in treatments with subsegmental transcatheter arterial chemoembolization (TACE) for hepatocellular carcinomas (HCCs). Thirty-six consecutive patients who underwent hepatic angiography were prospectively examined. First, two radiologists evaluated the degree of visualization of the peripheral branches of the hepatic arteries on 3D digital subtraction angiography (DSA). Then the radiologists evaluated the visualization of tumor staining and feeding arteries in 25 patients (30 HCCs) who underwent subsegmental TACE. The two radiologists who performed the TACE assessed whether the additional information provided by 3D DSA was useful for treatments. In 34 (94.4%) of 36 patients, the subsegmental branches of the hepatic arteries were sufficiently visualized. The feeding arteries of HCCs were sufficiently visualized in 28 (93%) of 30 HCCs, whereas tumor stains were sufficiently visualized in 18 (60%). Maximum intensity projection images were significantly superior to volume recording images for visualization of the tumor staining and feeding arteries of HCCs. In 27 (90%) of 30 HCCs, 3D DSA provided additional useful information for subsegmental TACE. The high-quality 3D DSA with flat panel detector angiography system provided a precise vascular road map, which was useful for performing subsegmental TACE of HCCs.

  19. Multivariate approach in the optimization procedures for the direct determination of manganese in serum samples by graphite furnace atomic absorption spectrometry.

    PubMed

    Fabrino, Henrique José Ferraz; Silveira, Josianne Nicácio; Neto, Waldomiro Borges; Goes, Alfredo Miranda; Beinner, Mark Anthony; da Silva, José Bento Borba

    2011-10-01

    A method for direct determination of manganese (Mn) in human serum by graphite furnace atomic absorption spectrometry (GFAAS) was proposed in this work. The samples were only diluted 1:4 with nitric acid 1% (v/v) and Triton(®) X-100 0.1% (v/v). The optimization of the instrumental conditions was made using multivariate approach. A factorial design (2(3)) was employed to investigate the tendency of the most intense absorbance signal. The pyrolysis and atomization temperatures and the use of modifier were available and only the parameter modifier use did not have a significant effect on the response. A Center Composed Design (CCD) presented best temperatures of 430 °C and 2568 °C for pyrolysis and atomization, respectively. The method allowed the determination of manganese with a curve varying from 0.7 to 3.3 μg/L. Recovery studies in three concentration levels (n=7 for each level) presented results from 98 ± 5 to 102 ± 7 %. The detection limit was 0.2 μg/L, the quantifying limit was 0.7 μg/L, and the characteristic mass, 1.3 ± 0.2 pg. Intra- and interassay studies showed coefficients of variation of 4.7-7.0% (n=21) and 6-8%(n=63), respectively. The method was applied for the determination of manganese in 53 samples obtaining concentrations from 3.9 to 13.7 μg/L.

  20. Vaccines (immunizations) - overview

    MedlinePlus

    Vaccinations; Immunizations; Immunize; Vaccine shots; Prevention - vaccine ... component) of the vaccine. VACCINE SCHEDULE The recommended vaccination (immunization) schedule is updated every 12 months by ...

  1. Candidate immune biomarkers for radioimmunotherapy.

    PubMed

    Levy, Antonin; Nigro, Giulia; Sansonetti, Philippe J; Deutsch, Eric

    2017-02-28

    Newly available immune checkpoint blockers (ICBs), capable to revert tumor immune tolerance, are revolutionizing the anticancer armamentarium. Recent evidence also established that ionizing radiation (IR) could produce antitumor immune responses, and may as well synergize with ICBs. Multiple radioimmunotherapy combinations are thenceforth currently assessed in early clinical trials. Past examples have highlighted the need for treatment personalization, and there is an unmet need to decipher immunological biomarkers that could allow selecting patients who could benefit from these promising but expensive associations. Recent studies have identified potential predictive and prognostic immune assays at the cellular (tumor microenvironment composition), genomic (mutational/neoantigen load), and peripheral blood levels. Within this review, we collected the available evidence regarding potential personalized immune biomarker-directed radiation therapy strategies that might be used for patient selection in the era of radioimmunotherapy.

  2. 2011: the immune hallmarks of cancer.

    PubMed

    Cavallo, Federica; De Giovanni, Carla; Nanni, Patrizia; Forni, Guido; Lollini, Pier-Luigi

    2011-03-01

    Ten years after the publication of the position paper "The hallmarks of cancer" (Hanahan and Weinberg Cell 100:57-70, 2000), it has become increasingly clear that mutated cells on their way to giving rise to a tumor have also to learn how to thrive in a chronically inflamed microenvironment, evade immune recognition, and suppress immune reactivity. Genetic and molecular definition of these three immune hallmarks of cancer offers the opportunity to learn how to deploy specific countermeasures to reverse the situation in favor of the immune system and, eventually, the patient. This new information could be channeled to address what seem to be the three major hallmarks for the immune control of cancer progression: effective procedures to activate immune reactivity; characterization of not-disposable oncoantigens; and counteraction of immune suppression.

  3. Immunization with a soluble CD4-gp120 complex preferentially induces neutralizing anti-human immunodeficiency virus type 1 antibodies directed to conformation-dependent epitopes of gp120.

    PubMed

    Kang, C Y; Hariharan, K; Nara, P L; Sodroski, J; Moore, J P

    1994-09-01

    Preservation of the conformation of recombinant gp120 in an adjuvant, enabling it to elicit conformation-dependent, epitope-specific, broadly neutralizing antibodies, may be critical for the development of any gp120-based human immunodeficiency virus type 1 (HIV-1) vaccine. It was hypothesized that recombinant gp120 complexed with recombinant CD4 could stabilize the conformation-dependent neutralizing epitopes and effectively deliver them to the immune system. Therefore, a soluble CD4-gp120 complex in Syntex adjuvant formulation was tested with mice for its ability to induce neutralizing anti-gp120 antibody responses. Seventeen monoclonal antibodies (MAbs) were generated and characterized. Immunochemical studies, neutralization assays, and mapping studies with gp120 mutants indicated that the 17 MAbs fell into three groups. Four of them were directed to what is probably a conformational epitope involving the C1 domain and did not possess virus-neutralizing activities. Another four MAbs bound to V3 peptide 302-321 and exhibited cross-reactive gp120 binding and relatively weak virus-neutralizing activities. These MAbs were very sensitive to amino acid substitutions, not only in the V3 regions but also in the base of the V1/V2 loop, implying a conformational constraint on the epitope. The last group of nine MAbs recognized conformation-dependent epitopes near the CD4 binding site of gp120 and inhibited the gp120-soluble CD4 interaction. Four of these nine MAbs showed broadly neutralizing activities against multiple laboratory-adapted strains of HIV-1, three of them neutralized only HIVIIIB, and the two lower-affinity MAbs did not neutralize any strain tested. Collectively, the results from this study indicate that immunization with the CD4-gp120 complex can elicit antibodies to conformationally sensitive gp120 epitopes, with some of the antibodies having broadly neutralizing activities. We suggest that immunization with CD4-gp120 complexes may be worth evaluating

  4. [Adult immunization].

    PubMed

    Beytout, Jean

    2003-01-01

    Adults receive several vaccinations related to occupational health. Travellers or immunocompromised people who are exposed to infections need some other vaccinations, too. People older than 65 receive influenza vaccine every year. Tetanus and poliomyelitis immunity should be maintained with a decennial injection following adult immunisation schedule but the application of this vaccine remains rather erratic. Diphtheria valence included in a recently licensed combined vaccine could be done together. Maintenance of immunity against "childhood infectious diseases" preventable with vaccinations is a new challenge; measles, rubella and pertussis occur now quite often in adults: the risk of complications is higher in these ages. Adults may even become the source of the contamination of youngers: many infants affected with whooping cough have contracted the disease from their own parents. The immunisation against these diseases should be prosecuted in adults. Related with the development of more efficacious new vaccines, the indications of pneumococcus, meningococcus or varicella vaccines should be defined in some populations of adults. Immunization policy of adults should be revised in order to continue the vaccination program of childhood. Some infections that may affect adults should be prevented by improving vaccine application. A real adult immunisation schedule and recommendations for populations at risk of preventable infections should be set up and their application reinforced.

  5. Immune System (For Parents)

    MedlinePlus

    ... Old Feeding Your 1- to 2-Year-Old Immune System KidsHealth > For Parents > Immune System A A A ... can lead to illness and infection. About the Immune System The immune system is the body's defense against ...

  6. Immunization Schedules for Adults

    MedlinePlus

    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedules for Adults in Easy-to-read Formats ... previous immunizations. View or Print a Schedule Recommended Immunizations for Adults (19 Years and Older) by Age ...

  7. Direct measurement of peptide-specific CD8+ T cells using HLA-A2:Ig dimer for monitoring the in vivo immune response to a HER2/neu vaccine in breast and prostate cancer patients.

    PubMed

    Woll, Michael M; Fisher, Christine M; Ryan, Gayle B; Gurney, Jennifer M; Storrer, Catherine E; Ioannides, Constantin G; Shriver, Craig D; Moul, Judd W; McLeod, David G; Ponniah, Sathibalan; Peoples, George E

    2004-07-01

    HER2/neu is a proto-oncogene and a member of the epidermal growth factor receptor family of proteins that is overexpressed in numerous types of human cancer. We are currently conducting clinical trials with the HER2/neu E75 peptide vaccine in breast and prostate cancer patients. We have evaluated the use of HLA-A2 dimer molecule for the immunological monitoring of cancer patients receiving the E75 peptide vaccine. Peripheral blood samples from patients receiving the vaccine were stained with HLA-A2 dimers containing the vaccine peptide E75 or control peptides and analyzed by flow cytometry. We compared the HLA-A2 dimer assay to standard methods of immunologic monitoring (IFN-gamma release, lymphocyte proliferation, and cytotoxicity). The HLA-A2 dimer assay was also compared with the HLA-A2 tetramer assay. E75 peptide-specific CD8 T cells were detected directly in the peripheral blood of patients by staining with E75-HLA-A2 dimers and CD8 antibodies. T cell cultures generated by repeated stimulations using E75 peptide-pulsed dendritic cells showed increased staining with E75-peptide loaded HLA-A2 dimers. Simultaneously analysis by the dimer assay and standard immunologic assays demonstrated that the dimer-staining assay correlated well with these methods of immunologic monitoring. A direct comparison using E75-specific HLA-A2 tetramers and HLA-A2 dimers for the detection of E75-specific CD8 T cells in peripheral blood showed comparable results with the two assays. Our findings indicate that the HLA-A2 dimer is a powerful new tool for directly quantifying and monitoring immune responses of antigen-specific T cells in peptide vaccine clinical trials.

  8. The most common friend first immunization

    NASA Astrophysics Data System (ADS)

    Nian, Fu-Zhong; Hu, Cha-Sheng

    2016-12-01

    In this paper, a standard susceptible-infected-recovered-susceptible(SIRS) epidemic model based on the Watts-Strogatz (WS) small-world network model and the Barabsi-Albert (BA) scale-free network model is established, and a new immunization scheme — “the most common friend first immunization” is proposed, in which the most common friend’s node is described as being the first immune on the second layer protection of complex networks. The propagation situations of three different immunization schemes — random immunization, high-risk immunization, and the most common friend first immunization are studied. At the same time, the dynamic behaviors are also studied on the WS small-world and the BA scale-free network. Moreover, the analytic and simulated results indicate that the immune effect of the most common friend first immunization is better than random immunization, but slightly worse than high-risk immunization. However, high-risk immunization still has some limitations. For example, it is difficult to accurately define who a direct neighbor in the life is. Compared with the traditional immunization strategies having some shortcomings, the most common friend first immunization is effective, and it is nicely consistent with the actual situation. Project supported by the National Natural Science Foundation of China (Grant No. 61263019), the Program for International Science and Technology Cooperation Projects of Gansu Province, China (Grant No. 144WCGA166), and the Program for Longyuan Young Innovation Talents and the Doctoral Foundation of Lanzhou University of Technology, China.

  9. Probing the tails of the ground-state energy distribution for the directed polymer in a random medium of dimension d=1,2,3 via a Monte Carlo procedure in the disorder.

    PubMed

    Monthus, Cécile; Garel, Thomas

    2006-11-01

    In order to probe with high precision the tails of the ground-state energy distribution of disordered spin systems, Körner, Katzgraber, and Hartmann have recently proposed an importance-sampling Monte Carlo Markov chain in the disorder. In this paper, we combine their Monte Carlo procedure in the disorder with exact transfer matrix calculations in each sample to measure the negative tail of ground-state energy distribution Pd(E0) for the directed polymer in a random medium of dimension d=1,2,3. In d=1, we check the validity of the algorithm by a direct comparison with the exact result, namely, the Tracy-Widom distribution. In dimensions d=2 and d=3, we measure the negative tail up to ten standard deviations, which correspond to probabilities of order Pd(E0) approximately 10(-22). Our results are in agreement with Zhang's argument, stating that the negative tail exponent eta(d) of the asymptotic behavior lnPd(E0) approximately -|E0|eta(d) as E0-->-infinity is directly related to the fluctuation exponent theta(d) [which governs the fluctuations DeltaE0(L) approximately Ltheta(d) of the ground-state energy E0 for polymers of length L] via the simple formula eta(d)=1/[1-theta(d)]. Throughout the paper, we comment on the similarities and differences with spin glasses.

  10. ANTIBLASTIC IMMUNITY

    PubMed Central

    Dochez, A. R.; Avery, O. T.

    1916-01-01

    1. Antipneumococcus serum possesses the power of inhibiting for a certain period of time the multiplication of pneumococci. 2. It also has the capacity of inhibiting the proteolytic and glycolytc functions of pneumococci. 3. This power is acquired for the first time or appears in increased amounts in human serum at the time of crisis in lobar pneumonia. 4. The retardation of bacterial growth is thought to be dependent upon the inhibition of metabolic function due to the presence of anti-enzymotic substances in antipneumococcus serum. To this phenomenon we have applied the term antiblastic immunity. PMID:19867971

  11. Policies and procedures related to testing for weak D phenotypes and administration of Rh immune globulin: results and recommendations related to supplemental questions in the Comprehensive Transfusion Medicine survey of the College of American Pathologists.

    PubMed

    Sandler, S Gerald; Roseff, Susan D; Domen, Ronald E; Shaz, Beth; Gottschall, Jerome L

    2014-05-01

    Advances in RHD genotyping offer an opportunity to update policies and practices for testing weak D phenotypes and administration of Rh immune globulin to postpartum women. To repeat questions from a 1999 College of American Pathologists proficiency test survey, to evaluate current practices for testing for weak D and administration of Rh immune globulin, and to determine whether there is an opportunity to begin integrating RHD genotyping in laboratory practice. The College of American Pathologists Transfusion Medicine Resource Committee sent questions from the 1999 survey to laboratories that participated in the 2012 proficiency test survey. The results of the 2012 survey were compared with those from 1999. Results from published RHD genotyping studies were analyzed to determine if RHD genotyping could improve current policies and practices for serological Rh typing. More than 3100 survey participants responded to the 2012 questions. The most significant finding was a decrease in the number of transfusion services performing a serological weak D test on patients as a strategy to manage those with a weak D as Rh negative (from 58.2% to 19.8%, P < .001). Data from RHD genotyping studies indicate that approximately 95% of women with a serological weak D could be managed safely and more logically as Rh positive. Selective integration of RHD genotyping policies and practices could improve the accuracy of Rh typing results, reduce unnecessary administration of Rh immune globulin in women with a weak D, and decrease transfusion of Rh-negative red blood cells in most recipients with a serological weak D phenotype.

  12. Pediatric Procedural Pain

    ERIC Educational Resources Information Center

    Blount, Ronald L.; Piira, Tiina; Cohen, Lindsey L.; Cheng, Patricia S.

    2006-01-01

    This article reviews the various settings in which infants, children, and adolescents experience pain during acute medical procedures and issues related to referral of children to pain management teams. In addition, self-report, reports by others, physiological monitoring, and direct observation methods of assessment of pain and related constructs…

  13. Dental Procedures.

    PubMed

    Ramponi, Denise R

    2016-01-01

    Dental problems are a common complaint in emergency departments in the United States. There are a wide variety of dental issues addressed in emergency department visits such as dental caries, loose teeth, dental trauma, gingival infections, and dry socket syndrome. Review of the most common dental blocks and dental procedures will allow the practitioner the opportunity to make the patient more comfortable and reduce the amount of analgesia the patient will need upon discharge. Familiarity with the dental equipment, tooth, and mouth anatomy will help prepare the practitioner for to perform these dental procedures.

  14. Innate Immunity and Breast Milk

    PubMed Central

    Cacho, Nicole Theresa; Lawrence, Robert M.

    2017-01-01

    Human milk is a dynamic source of nutrients and bioactive factors; unique in providing for the human infant’s optimal growth and development. The growing infant’s immune system has a number of developmental immune deficiencies placing the infant at increased risk of infection. This review focuses on how human milk directly contributes to the infant’s innate immunity. Remarkable new findings clarify the multifunctional nature of human milk bioactive components. New research techniques have expanded our understanding of the potential for human milk’s effect on the infant that will never be possible with milk formulas. Human milk microbiome directly shapes the infant’s intestinal microbiome, while the human milk oligosaccharides drive the growth of these microbes within the gut. New techniques such as genomics, metabolomics, proteomics, and glycomics are being used to describe this symbiotic relationship. An expanded role for antimicrobial proteins/peptides within human milk in innate immune protection is described. The unique milieu of enhanced immune protection with diminished inflammation results from a complex interaction of anti-inflammatory and antioxidative factors provided by human milk to the intestine. New data support the concept of mucosal-associated lymphoid tissue and its contribution to the cellular content of human milk. Human milk stem cells (hMSCs) have recently been discovered. Their direct role in the infant for repair and regeneration is being investigated. The existence of these hMSCs could prove to be an easily harvested source of multilineage stem cells for the study of cancer and tissue regeneration. As the infant’s gastrointestinal tract and immune system develop, there is a comparable transition in human milk over time to provide fewer immune factors and more calories and nutrients for growth. Each of these new findings opens the door to future studies of human milk and its effect on the innate immune system and the developing

  15. Pain and immunity.

    PubMed

    Guillot, Xavier; Semerano, Luca; Decker, Patrice; Falgarone, Géraldine; Boissier, Marie-Christophe

    2012-05-01

    Chronic neuropathic and inflammatory pain is a major public health problem. Nociceptors undergo sensitization, first in peripheral tissues then in the central nervous sytem, via neuroimmune interactions linking neurons, glial cells (microglia and astrocytes), and immune cells. These interactions may either exacerbate or attenuate the pain and inflammation, which normally reach a state of equilibrium. With more powerful or longer lasting stimuli, specific profiles of microglial and, subsequently, astrocytic activation in the dorsal horn play a key role in neuronal plasticity and transition to chronic pain. Recent insights into the interactions between the nervous system and the immune system suggest a large number of potential therapeutic targets that could be influenced either by targeted inhibition or by directing the neuroimmune response toward the antiinflammatory and analgesic end of its spectrum. Copyright © 2011. Published by Elsevier SAS.

  16. Grievance Procedures.

    ERIC Educational Resources Information Center

    Eisenhower, R. Warren

    Because grievances are unavoidable, it is essential for organizations, such as the schools, to utilize an efficient, effective procedure to handle friction between employers and employees. Through successive steps, representatives of labor and management attempt to resolve the grievance, first with meetings of lower level representatives (such as…

  17. Sepsis-induced immune dysfunction: can immune therapies reduce mortality?

    PubMed Central

    Delano, Matthew J.; Ward, Peter A.

    2016-01-01

    Sepsis is a systemic inflammatory response induced by an infection, leading to organ dysfunction and mortality. Historically, sepsis-induced organ dysfunction and lethality were attributed to the interplay between inflammatory and antiinflammatory responses. With advances in intensive care management and goal-directed interventions, early sepsis mortality has diminished, only to surge later after “recovery” from acute events, prompting a search for sepsis-induced alterations in immune function. Sepsis is well known to alter innate and adaptive immune responses for sustained periods after clinical “recovery,” with immunosuppression being a prominent example of such alterations. Recent studies have centered on immune-modulatory therapy. These efforts are focused on defining and reversing the persistent immune cell dysfunction that is associated with mortality long after the acute events of sepsis have resolved. PMID:26727230

  18. Integrated Circuit Immunity

    NASA Technical Reports Server (NTRS)

    Sketoe, J. G.; Clark, Anthony

    2000-01-01

    This paper presents a DOD E3 program overview on integrated circuit immunity. The topics include: 1) EMI Immunity Testing; 2) Threshold Definition; 3) Bias Tee Function; 4) Bias Tee Calibration Set-Up; 5) EDM Test Figure; 6) EMI Immunity Levels; 7) NAND vs. and Gate Immunity; 8) TTL vs. LS Immunity Levels; 9) TP vs. OC Immunity Levels; 10) 7805 Volt Reg Immunity; and 11) Seventies Chip Set. This paper is presented in viewgraph form.

  19. Avian biological clock - Immune system relationship.

    PubMed

    Markowska, Magdalena; Majewski, Paweł M; Skwarło-Sońta, Krystyna

    2017-01-01

    Biological rhythms in birds are driven by the master clock, which includes the suprachiasmatic nucleus, the pineal gland and the retina. Light/dark cycles are the cues that synchronize the rhythmic changes in physiological processes, including immunity. This review summarizes our investigations on the bidirectional relationships between the chicken pineal gland and the immune system. We demonstrated that, in the chicken, the main pineal hormone, melatonin, regulates innate immunity, maintains the rhythmicity of immune reactions and is involved in the seasonal changes in immunity. Using thioglycollate-induced peritonitis as a model, we showed that the activated immune system regulates the pineal gland by inhibition of melatonin production at the level of the key enzyme in its biosynthetic pathway, arylalkylamine-N-acetyltransferase (AANAT). Interleukin 6 and interleukin 18 seem to be the immune mediators influencing the pineal gland, directly inhibiting Aanat gene transcription and modulating expression of the clock genes Bmal1 and Per3, which in turn regulate Aanat.

  20. Inhibition of immune complex-mediated neutrophil oxidative metabolism: a pharmacophore model for 3-phenylcoumarin derivatives using GRIND-based 3D-QSAR and 2D-QSAR procedures.

    PubMed

    Kabeya, Luciana M; da Silva, Carlos H T P; Kanashiro, Alexandre; Campos, Joaquín M; Azzolini, Ana Elisa C S; Polizello, Ana Cristina M; Pupo, Mônica T; Lucisano-Valim, Yara M

    2008-05-01

    In this study, twenty hydroxylated and acetoxylated 3-phenylcoumarin derivatives were evaluated as inhibitors of immune complex-stimulated neutrophil oxidative metabolism and possible modulators of the inflammatory tissue damage found in type III hypersensitivity reactions. By using lucigenin- and luminol-enhanced chemiluminescence assays (CL-luc and CL-lum, respectively), we found that the 6,7-dihydroxylated and 6,7-diacetoxylated 3-phenylcoumarin derivatives were the most effective inhibitors. Different structural features of the other compounds determined CL-luc and/or CL-lum inhibition. The 2D-QSAR analysis suggested the importance of hydrophobic contributions to explain these effects. In addition, a statistically significant 3D-QSAR model built applying GRIND descriptors allowed us to propose a virtual receptor site considering pharmacophoric regions and mutual distances. Furthermore, the 3-phenylcoumarins studied were not toxic to neutrophils under the assessed conditions.

  1. Immune response

    MedlinePlus

    ... include the body's complement system and substances called interferon and interleukin-1 (which causes fever). If an ... the blood, such as antibodies, complement proteins, and interferon. Some of these directly attack foreign substances in ...

  2. Immunity, atherosclerosis and cardiovascular disease

    PubMed Central

    2013-01-01

    Atherosclerosis, the major cause of cardiovascular disease (CVD), is a chronic inflammatory condition with immune competent cells in lesions producing mainly pro-inflammatory cytokines. Dead cells and oxidized forms of low density lipoproteins (oxLDL) are abundant. The major direct cause of CVD appears to be rupture of atherosclerotic plaques. oxLDL has proinflammatory and immune-stimulatory properties, causes cell death at higher concentrations and contains inflammatory phospholipids with phosphorylcholine (PC) as an interesting epitope. Antibodies against PC (anti-PC) may be atheroprotective, one mechanism being anti-inflammatory. Bacteria and virus have been discussed, but it has been difficult to find direct evidence, and antibiotic trials have not been successful. Heat shock proteins could be one major target for atherogenic immune reactions. More direct causes of plaque rupture include pro-inflammatory cytokines, chemokines, and lipid mediators. To prove that inflammation is a cause of atherosclerosis and CVD, clinical studies with anti-inflammatory and/or immune-modulatory treatment are needed. The potential causes of immune reactions and inflammation in atherosclerosis and how inflammation can be targeted therapeutically to provide novel treatments for CVD are reviewed. PMID:23635324

  3. Immune System 101

    MedlinePlus

    ... Immune System 101 Subscribe Translate Text Size Print Immune System 101 How Does Your Immune System Work? Your immune system works because your body ... tactics to destroy it. Major Players of the Immune System Lymph nodes (also called "lymph glands"): These small, ...

  4. Virus-like particle (VLP) lymphatic trafficking and immune response generation after immunization by different routes.

    PubMed

    Cubas, Rafael; Zhang, Sheng; Kwon, Sunkuk; Sevick-Muraca, Eva M; Li, Min; Chen, Changyi; Yao, Qizhi

    2009-01-01

    Virus-like particles (VLPs) have gained increasing interest for their use as vaccines due to their repetitive antigenic structure that is capable of efficiently activating the immune system. The efficacy of VLP immunization may lie in its ability to traffic into draining lymph nodes while activating antigen-presenting cells to initiate the orchestration of signals required for the development of a robust immune response. Currently, there is no comprehensive study showing the correlation of different VLP vaccination routes to immune outcome. In this study, we took an optical imaging approach to directly visualize the trafficking of simian-human immunodeficiency (SHIV) VLPs after immunization by commonly used routes and analyzed the corresponding humoral and cellular immune responses generated. We found that VLPs can easily enter the subcapsular sinus of draining lymph nodes with quantitative differences in the number of lymph node involvement depending on the immunization route used. Intradermal immunization led to the largest level of lymph node involvement for the longest period of time, which correlated with the strongest humoral and cellular immune responses. Flow cytometry analysis from extracted splenocytes showed that intradermal immunization led to the largest population of germinal center and activated B cells, which translated into higher antibody levels and antigen-specific cytotoxic T lymphocyte responses. Our results indicate that VLPs traffic into lymph nodes upon immunization and can be directly visualized by optical imaging techniques. Intradermal immunization showed improved responses and might be a preferable delivery route to use for viral and cancer immunotherapeutic studies involving VLPs.

  5. Did the molecules of adaptive immunity evolve from the innate immune system?

    PubMed

    Bartl, Simona; Baish, Meredith; Weissman, Irving L; Diaz, Marilyn

    2003-04-01

    The antigen receptors on cells of innate immune systems recognize broadly expressed markers on non-host cells while the receptors on lymphocytes of the adaptive immune system display a higher level of specificity. Adaptive immunity, with its exquisite specificity and immunological memory, has only been found in the jawed vertebrates, which also display innate immunity. Jawless fishes and invertebrates only have innate immunity. In the adaptive immune response, T and B-lymphocytes detect foreign agents or antigens using T cell receptors (TCR) or immunoglobulins (Ig), respectively. While Ig can bind free intact antigens, TCR only binds processed antigenic fragments that are presented on molecules encoded in the major histocompatibility complex (MHC). MHC molecules display variation through allelic polymorphism. A diverse repertoire of Ig and TCR molecules is generated by gene rearrangement and junctional diversity, processes carried out by the recombinase activating gene (RAG) products and terminal deoxynucleotidyl transferase (TdT). Thus, the molecules that define adaptive immunity are TCR, Ig, MHC molecules, RAG products and TdT. No direct predecessors of these molecules have been found in the jawless fishes or invertebrates. In contrast, the complement cascade can be activated by either adaptive or innate immune systems and contains examples of molecules that gradually evolved from non-immune functions to being part of the innate and then adaptive immune system. In this paper we examine the molecules of the adaptive immune system and speculate on the existence of direct predecessors that were part of innate immunity.

  6. Surface Environmental Surveillance Procedures Manual

    SciTech Connect

    Hanf, RW; Dirkes, RL

    1990-02-01

    This manual establishes the procedures for the collection of environmental samples and the performance of radiation surveys and other field measurements. Responsibilities are defined for those personnel directly involved in the collection of samples and the performance of field measurements.

  7. Immune System Quiz

    MedlinePlus

    ... Room? What Happens in the Operating Room? Quiz: Immune System KidsHealth > For Kids > Quiz: Immune System A A A How much do you know about your immune system? Find out by taking this quiz! About KidsHealth ...

  8. Instant Childhood Immunization Schedule

    MedlinePlus

    ... Recommendations Why Immunize? Vaccines: The Basics Instant Childhood Immunization Schedule Recommend on Facebook Tweet Share Compartir Get ... date. See Disclaimer for additional details. Based on Immunization Schedule for Children 0 through 6 Years of ...

  9. Immune Abnormalities in Patients with Autism.

    ERIC Educational Resources Information Center

    Warren, Reed P.; And Others

    1986-01-01

    A study of 31 autistic patients (3-28 years old) has revealed several immune-system abnormalities, including decreased numbers of T lymphocytes and an altered ratio of helper-to-suppressor T cells. Immune-system abnormalities may be directly related to underlying biologic processes of autism or an indirect reflection of the actual pathologic…

  10. Immune Abnormalities in Patients with Autism.

    ERIC Educational Resources Information Center

    Warren, Reed P.; And Others

    1986-01-01

    A study of 31 autistic patients (3-28 years old) has revealed several immune-system abnormalities, including decreased numbers of T lymphocytes and an altered ratio of helper-to-suppressor T cells. Immune-system abnormalities may be directly related to underlying biologic processes of autism or an indirect reflection of the actual pathologic…

  11. Reasoning about procedural knowledge

    NASA Technical Reports Server (NTRS)

    Georgeff, M. P.

    1985-01-01

    A crucial aspect of automated reasoning about space operations is that knowledge of the problem domain is often procedural in nature - that is, the knowledge is often in the form of sequences of actions or procedures for achieving given goals or reacting to certain situations. In this paper a system is described that explicitly represents and reasons about procedural knowledge. The knowledge representation used is sufficiently rich to describe the effects of arbitrary sequences of tests and actions, and the inference mechanism provides a means for directly using this knowledge to reach desired operational goals. Furthermore, the representation has a declarative semantics that provides for incremental changes to the system, rich explanatory capabilities, and verifiability. The approach also provides a mechanism for reasoning about the use of this knowledge, thus enabling the system to choose effectively between alternative courses of action.

  12. Computerized operating procedures

    SciTech Connect

    Ness, E.; Teigen, J.

    1994-12-31

    A number of observed and potential problems in the nuclear industry are related to the quality of operating procedures. Many of the problems identified in operating procedure preparation, implementation, and maintenance have a technical nature, which can be directly addressed by developing computerized procedure handling tools. The Halden Reactor Project (HRP) of the Organization for Economic Cooperation and Development has since 1985 performed research work within this field. A product of this effort is the development of a second version of the computerized operation manuals (COPMA) system. This paper summarizes the most important characteristics of the COPMA-II system and discusses some of the experiences in using a system like COPMA-II.

  13. [Costing nuclear medicine diagnostic procedures].

    PubMed

    Markou, Pavlos

    2005-01-01

    To the Editor: Referring to a recent special report about the cost analysis of twenty-nine nuclear medicine procedures, I would like to clarify some basic aspects for determining costs of nuclear medicine procedure with various costing methodologies. Activity Based Costing (ABC) method, is a new approach in imaging services costing that can provide the most accurate cost data, but is difficult to perform in nuclear medicine diagnostic procedures. That is because ABC requires determining and analyzing all direct and indirect costs of each procedure, according all its activities. Traditional costing methods, like those for estimating incomes and expenses per procedure or fixed and variable costs per procedure, which are widely used in break-even point analysis and the method of ratio-of-costs-to-charges per procedure may be easily performed in nuclear medicine departments, to evaluate the variability and differences between costs and reimbursement - charges.

  14. Aviation Safety Reporting System: Process and Procedures

    NASA Technical Reports Server (NTRS)

    Connell, Linda J.

    1997-01-01

    The Aviation Safety Reporting System (ASRS) was established in 1976 under an agreement between the Federal Aviation Administration (FAA) and the National Aeronautics and Space Administration (NASA). This cooperative safety program invites pilots, air traffic controllers, flight attendants, maintenance personnel, and others to voluntarily report to NASA any aviation incident or safety hazard. The FAA provides most of the program funding. NASA administers the program, sets its policies in consultation with the FAA and aviation community, and receives the reports submitted to the program. The FAA offers those who use the ASRS program two important reporting guarantees: confidentiality and limited immunity. Reports sent to ASRS are held in strict confidence. More than 350,000 reports have been submitted since the program's beginning without a single reporter's identity being revealed. ASRS removes all personal names and other potentially identifying information before entering reports into its database. This system is a very successful, proof-of-concept for gathering safety data in order to provide timely information about safety issues. The ASRS information is crucial to aviation safety efforts both nationally and internationally. It can be utilized as the first step in safety by providing the direction and content to informed policies, procedures, and research, especially human factors. The ASRS process and procedures will be presented as one model of safety reporting feedback systems.

  15. Sensitive, direct procedures for simultaneous determinations of iron and copper in serum, with use of 2-(5-nitro-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol (nitro-PAPS) as ligand.

    PubMed

    Yamashita, S; Abe, A; Noma, A

    1992-07-01

    We developed a direct, simple, and sensitive procedure for the simultaneous colorimetric assay of iron and copper in serum, using sodium dodecyl sulfate-ascorbic acid to dissociate iron and copper from transferrin and ceruloplasmin, respectively. We also use a new water-soluble reagent, 2-(5-nitro-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol disodium salt (nitro-PAPS) and thioglycolic acid to eliminate interference from copper in the measurement of iron. Within- and between-run precisions of the present method were 2.5-2.8% for iron and 1.8-4.6% for copper. The proposed method is susceptible to interference by hemoglobin and lipemia, especially for the iron assay. Linear-regression analyses of results of the proposed method with those of the bathophenanthroline method for iron and of the atomic absorption spectroscopic method for copper correlated well (r = 0.996, Sy/x = 0.73 and r = 0.959, Sy/x = 1.11, respectively).

  16. Procedural knowledge

    NASA Technical Reports Server (NTRS)

    Georgeff, Michael P.; Lansky, Amy L.

    1986-01-01

    Much of commonsense knowledge about the real world is in the form of procedures or sequences of actions for achieving particular goals. In this paper, a formalism is presented for representing such knowledge using the notion of process. A declarative semantics for the representation is given, which allows a user to state facts about the effects of doing things in the problem domain of interest. An operational semantics is also provided, which shows how this knowledge can be used to achieve particular goals or to form intentions regarding their achievement. Given both semantics, the formalism additionally serves as an executable specification language suitable for constructing complex systems. A system based on this formalism is described, and examples involving control of an autonomous robot and fault diagnosis for NASA's Space Shuttle are provided.

  17. Mobile Energy Laboratory Procedures

    SciTech Connect

    Armstrong, P.R.; Batishko, C.R.; Dittmer, A.L.; Hadley, D.L.; Stoops, J.L.

    1993-09-01

    Pacific Northwest Laboratory (PNL) has been tasked to plan and implement a framework for measuring and analyzing the efficiency of on-site energy conversion, distribution, and end-use application on federal facilities as part of its overall technical support to the US Department of Energy (DOE) Federal Energy Management Program (FEMP). The Mobile Energy Laboratory (MEL) Procedures establish guidelines for specific activities performed by PNL staff. PNL provided sophisticated energy monitoring, auditing, and analysis equipment for on-site evaluation of energy use efficiency. Specially trained engineers and technicians were provided to conduct tests in a safe and efficient manner with the assistance of host facility staff and contractors. Reports were produced to describe test procedures, results, and suggested courses of action. These reports may be used to justify changes in operating procedures, maintenance efforts, system designs, or energy-using equipment. The MEL capabilities can subsequently be used to assess the results of energy conservation projects. These procedures recognize the need for centralized NM administration, test procedure development, operator training, and technical oversight. This need is evidenced by increasing requests fbr MEL use and the economies available by having trained, full-time MEL operators and near continuous MEL operation. DOE will assign new equipment and upgrade existing equipment as new capabilities are developed. The equipment and trained technicians will be made available to federal agencies that provide funding for the direct costs associated with MEL use.

  18. Infectious Diseases and Immunizations. Matrix No. 15.

    ERIC Educational Resources Information Center

    Sever, John L.

    This paper summarizes the major advances achieved by research in the fields of infectious diseases and immunizations during the 1970s, and delineates directions for future research in these fields. (Author/MP)

  19. Role of molecular mimicry and polyclonal cell activation in the induction of pathogenic β2-glycoprotein I-directed immune response in Balb/c mice upon hyperimmunization with tetanus toxoid.

    PubMed

    Stojanović, Marijana; Petrušić, Vladimir; Zivković, Irena; Inić-Kanada, Aleksandra; Stojićević, Ivana; Marinković, Emilija; Dimitrijević, Ljiljana

    2013-05-01

    It is known that tetanus toxoid (TTd)-hyperimmunization induces increased titer of sera β2-glycoprotein I (β2GPI)-specific antibodies (Abs) in Balb/c mice. The concentrations of such induced anti-β2GPI Abs as well as their pathogenic potential are strongly influenced by the context of TTd application. β2GPI-specific immune response is established as a part of TTd-specific immune response by molecular mimicry mechanism due to structural homology between TTd and β2GPI. This finding is supported by the following facts: (1) cross-reactive Abs that recognize both TTd and β2GPI epitopes are present in Balb/c mice sera; (2) anti-TTd Abs secretion in splenic cultures is induced after β2GPI stimulation and vice versa. However, analyses of (1) IL-10 production following in vitro stimulation of immunized Balb/c mice splenocytes by TTd, β2GPI or glutaraldehyde-treated β2GPI and (2) specific impact of ConA and agonists of TLR2, TLR4, and TLR9 on anti-TTd and autoreactive Abs secretion strongly imply that these two branches of the TTd-induced immune response do not use identical cell populations and are regulated in a different way. Results presented in this paper describe that structural homology between foreign and self-antigens could focus mounted autoreactive immune response toward specific self-structure, but the context of antigen application, including a history of previous immune stimulations and adjuvants applied together with the antigen, are the main factors which determine the outcome of the induced immune response.

  20. The birth of innate immunity.

    PubMed

    Gallo, Richard L

    2013-08-01

    Modern immunology has seen an apparent revolution with the recognition that human immune defense is not only the responsibility of bone marrow-derived leucocytes, but also dependent on a coordinated network of many cell types including epithelial cells, fibroblasts and neural elements. This classic paper by Alexander Fleming and V.D. Allison (British J of Exp Path, 111, 1922, 252) was largely forgotten for 75 years and describes the discovery that epithelia produce a protein with direct antimicrobial activity. Thus, this paper represents the birth of the field now referred to as innate immunity and first describes an antimicrobial protein (AMP).

  1. Innate Immunity against Leishmania Infections

    PubMed Central

    Gurung, Prajwal; Kanneganti, Thirumala-Devi

    2015-01-01

    Leishmaniasis is a major health problem that affects more than 300 million people throughout the world. The morbidity associated with the disease causes serious economic burden in Leishmania endemic regions. Despite the morbidity and economic burden associated with Leishmaniasis, this disease rarely gets noticed and is still categorized under neglected tropical diseases. The lack of research combined with the ability of Leishmania to evade immune recognition has rendered our efforts to design therapeutic treatments or vaccines challenging. Herein, we review the literature on Leishmania from innate immune perspective and discuss potential problems as well as solutions and future directions that could aid in identifying novel therapeutic targets to eliminate this parasite. PMID:26249747

  2. Autophagy, Immunity, and Microbial Adaptations

    PubMed Central

    Deretic, Vojo; Levine, Beth

    2009-01-01

    Autophagy adjusts cellular biomass and function in response to diverse stimuli, including infection. Autophagy plays specific roles in shaping immune system development, fueling host innate and adaptive immune responses, and directly controlling intracellular microbes as a cell-autonomous innate defense. As an evolutionary counterpoint, intracellular pathogens have evolved to block autophagic microbicidal defense and subvert host autophagic responses for their survival or growth. The ability of eukaryotic pathogens to deploy their own autophagic machinery may also contribute to microbial pathogenesis. Thus, a complex interplay between autophagy and microbial adaptations against autophagy governs the net outcome of host-microbe encounters. PMID:19527881

  3. Exosomes and tumor-mediated immune suppression

    PubMed Central

    2016-01-01

    Tumor-derived exosomes (TEX) are harbingers of tumor-induced immune suppression: they carry immunosuppressive molecules and factors known to interfere with immune cell functions. By delivering suppressive cargos consisting of proteins similar to those in parent tumor cells to immune cells, TEX directly or indirectly influence the development, maturation, and antitumor activities of immune cells. TEX also deliver genomic DNA, mRNA, and microRNAs to immune cells, thereby reprogramming functions of responder cells to promote tumor progression. TEX carrying tumor-associated antigens can interfere with antitumor immunotherapies. TEX also have the potential to serve as noninvasive biomarkers of tumor progression. In the tumor microenvironment, TEX may be involved in operating numerous signaling pathways responsible for the downregulation of antitumor immunity. PMID:26927673

  4. Immunity in Fish

    USDA-ARS?s Scientific Manuscript database

    The fish immune system has evolved with both non-specific (innate immunity) and acquired immune functions (humoral and cell mediated immunity) to eliminate invading foreign living and non-living agents. Fish possess a unique physical barrier (mucus and skin) that acts as the first line of defense a...

  5. Our Immune System

    MedlinePlus

    Our Immune System A story for children with primary immunodeficiency diseases Written by Sara LeBien IMMUNE DEFICIENCY FOUNDATION A note ... who are immune deficient to better understand their immune system. What is a “ B-cell, ” a “ T-cell, ” ...

  6. Your Child's Immunizations

    MedlinePlus

    ... Your 1- to 2-Year-Old Your Child's Immunizations KidsHealth > For Parents > Your Child's Immunizations Print A A A en español Las vacunas ... But in both cases, the protection is temporary. Immunization (vaccination) is a way of creating immunity to ...

  7. Immunization for Women

    MedlinePlus

    ... nfid.org/#sthash.eZ72dCSP.dpuf Diseases & Vaccines Overview Immunization Schedules Talk to you doctor about your immunization ... years Immunization Schedule for Children, 7-18 years Immunization News July 8, 2016 HPV-related cancers on ...

  8. Integrated Immune Experiment

    NASA Technical Reports Server (NTRS)

    Crucian, Brian

    2009-01-01

    This viewgraph presentation reviews NASA's Integrated Immune Experiment. The objectives include: 1) Address significant lack of data regarding immune status during flight; 2) Replace several recent immune studies with one comprehensive study that will include in-flight sampling; 3) Determine the in-flight status of immunity, physiological stress, viral immunity/reactivation; 4) Determine the clinical risk related to immune dysregulation for exploration class spaceflight; and 5) Determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

  9. Understanding Herd Immunity.

    PubMed

    Metcalf, C J E; Ferrari, M; Graham, A L; Grenfell, B T

    2015-12-01

    Individual immunity is a powerful force affecting host health and pathogen evolution. Importantly, the effects of individual immunity also scale up to affect pathogen transmission dynamics and the success of vaccination campaigns for entire host populations. Population-scale immunity is often termed 'herd immunity'. Here we outline how individual immunity maps to population outcomes and discuss implications for control of infectious diseases. Particular immunological characteristics may be more or less likely to result in a population level signature of herd immunity; we detail this and also discuss other population-level outcomes that might emerge from individual-level immunity.

  10. Epigenetic Control of Immunity

    PubMed Central

    Busslinger, Meinrad; Tarakhovsky, Alexander

    2014-01-01

    Immunity relies on the heterogeneity of immune cells and their ability to respond to pathogen challenges. In the adaptive immune system, lymphocytes display a highly diverse antigen receptor repertoire that matches the vast diversity of pathogens. In the innate immune system, the cell's heterogeneity and phenotypic plasticity enable flexible responses to changes in tissue homeostasis caused by infection or damage. The immune responses are calibrated by the graded activity of immune cells that can vary from yeast-like proliferation to lifetime dormancy. This article describes key epigenetic processes that contribute to the function of immune cells during health and disease. PMID:24890513

  11. Expanded civil judicial referral procedures

    SciTech Connect

    Not Available

    1986-08-28

    The directive provides guidance on procedures for civil judicial referrals to the Department of Justice. The memorandum expands the current direct referral program, indicates that Headquarters should not establish mandatory requirements for pre-referral negotiations, mandates use of hold action cases only for strategic or tactical reasons and offers guidance on the preparation of bankruptcy cases.

  12. Intradermal naked plasmid DNA immunization: mechanisms of action.

    PubMed

    Elnekave, Mazal; Furmanov, Karina; Hovav, Avi-Hai

    2011-08-01

    Plasmid DNA is a promising vaccine modality that is regularly examined in prime-boost immunization regimens. Recent advances in skin immunity increased our understanding of the sophisticated cutaneous immune network, which revived scientific interest in delivering vaccines to the skin. Intradermal administration of plasmid DNA via needle injection is a simple and inexpensive procedure that exposes the plasmid and its encoded antigen to the dermal immune surveillance system. This triggers unique mechanisms for eliciting local and systemic immunity that can confer protection against pathogens and tumors. Understanding the mechanisms of intradermal plasmid DNA immunization is essential for enhancing and modulating its immunogenicity. With regard to vaccination, this is of greater importance as this routine injection technique is highly desirable for worldwide immunization. This article will focus on the current understanding of the mechanisms involved in antigen expression and presentation during primary and secondary syringe and needle intradermal plasmid DNA immunization.

  13. In vitro methods for detection of circulating immune complexes

    SciTech Connect

    Blackstock, R.

    1981-01-01

    The possible pathologic consequences of the presence of circulating immune complexes in certain disease states has caused considerable attention to be given to the development of laboratory procedures capable of quantitatively measuring the presence of immune complexes in serum. Many assays are available which utilize differing properties of immune complexes for their detection. Examples of assays which depend on different biologic properties of circulating immune complexes are presented and discussed. Included are the Raji cell assay, Clq binding assay, inhibition of rheumatoid agglutination, and nephelometric assays for determination of circulating immune complexes.

  14. Platelet serotonin modulates immune functions.

    PubMed

    Mauler, M; Bode, C; Duerschmied, D

    2016-01-01

    This short review addresses immune functions of platelet serotonin. Platelets transport serotonin at a high concentration in dense granules and release it upon activation. Besides haemostatic, vasotonic and developmental modulation, serotonin also influences a variety of immune functions (mediated by different serotonin receptors). First, platelet serotonergic effects are directed against invading pathogens via activation and proliferation of lymphocytes, modulation of cytokine release, and recruitment of neutrophils to sites of acute inflammation by induction of selectin expression on endothelial cells. Second, serotonin levels are elevated in autoimmune diseases, such as asthma or rheumatoid arthritis, and during tissue regeneration after ischemia of myocardium or brain. Specific antagonism of serotonin receptors appears to improve survival after myocardial infarction or sepsis and to attenuate asthmatic attacks in animal models. It will be of great clinical relevance if these findings can be translated into human applications. In conclusion, targeting immune modulatory effects of platelet serotonin may provide novel therapeutic options for common health problems.

  15. In vivo imaging of immune cell trafficking in cancer.

    PubMed

    Ottobrini, Luisa; Martelli, Cristina; Trabattoni, Daria Lucia; Clerici, Mario; Lucignani, Giovanni

    2011-05-01

    Tumour establishment, progression and regression can be studied in vivo using an array of imaging techniques ranging from MRI to nuclear-based and optical techniques that highlight the intrinsic behaviour of different cell populations in the physiological context. Clinical in vivo imaging techniques and preclinical specific approaches have been used to study, both at the macroscopic and microscopic level, tumour cells, their proliferation, metastasisation, death and interaction with the environment and with the immune system. Fluorescent, radioactive or paramagnetic markers were used in direct protocols to label the specific cell population and reporter genes were used for genetic, indirect labelling protocols to track the fate of a given cell subpopulation in vivo. Different protocols have been proposed to in vivo study the interaction between immune cells and tumours by different imaging techniques (intravital and whole-body imaging). In particular in this review we report several examples dealing with dendritic cells, T lymphocytes and macrophages specifically labelled for different imaging procedures both for the study of their physiological function and in the context of anti-neoplastic immunotherapies in the attempt to exploit imaging-derived information to improve and optimise anti-neoplastic immune-based treatments.

  16. Human Lung Immunity against Mycobacterium tuberculosis

    PubMed Central

    Schwander, Stephan; Dheda, Keertan

    2011-01-01

    The study of human pulmonary immunity against Mycobacterium tuberculosis (M.tb) provides a unique window into the biological interactions between the human host and M.tb within the broncho-alveolar microenvironment, the site of natural infection. Studies of bronchoalveolar cells (BACs) and lung tissue evaluate innate, adaptive, and regulatory immune mechanisms that collectively contribute to immunological protection or its failure. In aerogenically M.tb–exposed healthy persons lung immune responses reflect early host pathogen interactions that may contribute to sterilization, the development of latent M.tb infection, or progression to active disease. Studies in these persons may allow the identification of biomarkers of protective immunity before the initiation of inflammatory and disease-associated immunopathological changes. In healthy close contacts of patients with tuberculosis (TB) and during active pulmonary TB, immune responses are compartmentalized to the lungs and characterized by an exuberant helper T-cell type 1 response, which as suggested by recent evidence is counteracted by local suppressive immune mechanisms. Here we discuss how exploring human lung immunity may provide insights into disease progression and mechanisms of failure of immunological protection at the site of the initial host–pathogen interaction. These findings may also aid in the identification of new biomarkers of protective immunity that are urgently needed for the development of new and the improvement of current TB vaccines, adjuvant immunotherapies, and diagnostic technologies. To facilitate further work in this area, methodological and procedural approaches for bronchoalveolar lavage studies and their limitations are also discussed. PMID:21075901

  17. Immune Response to Giardia duodenalis

    PubMed Central

    Faubert, Gaétan

    2000-01-01

    The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490

  18. Epigenetic regulation of immune checkpoints: another target for cancer immunotherapy?

    PubMed

    Ali, Mahmoud A; Matboli, Marwa; Tarek, Marwa; Reda, Maged; Kamal, Kamal M; Nouh, Mahmoud; Ashry, Ahmed M; El-Bab, Ahmed Fath; Mesalam, Hend A; Shafei, Ayman El-Sayed; Abdel-Rahman, Omar

    2017-01-01

    Epigenetic changes in oncogenes and tumor-suppressor genes contribute to carcinogenesis. Understanding the epigenetic and genetic components of tumor immune evasion is crucial. Few cancer genetic mutations have been linked to direct correlations with immune evasion. Studies on the epigenetic modulation of the immune checkpoints have revealed a critical interaction between epigenetic and immune modulation. Epigenetic modifiers can activate many silenced genes. Some of them are immune checkpoints regulators that turn on immune responses and others turn them off resulting in immune evasion. Many forms of epigenetic inheritance mechanisms may play a role in regulation of immune checkpoints including: covalent modifications, noncoding RNA and histone modifications. In this review, we will show how the potential interaction between epigenetic and immune modulation may lead to new approaches for specific epigenome/immunome-targeted therapies for cancer.

  19. Molecular structure of the immunity gene and immunity protein of the bacteriocinogenic plasmid Clo DF13.

    PubMed Central

    van den Elzen, P J; Gaastra, W; Spelt, C E; de Graaf, F K; Veltkamp, E; Nijkamp, H J

    1980-01-01

    The nucleotide sequence of the Clo DF13 DNA region comprising the immunity gene has been determined. We also elucidated the aminoacid sequence of the 40 N-terminal and 7 C-terminal aminoacids of the purified immunity protein. From analysis of the data obtained we were able to locate the immunity gene between 11.7 and 14.5% on the Clo DF13 map, and to determine the complete aminoacid sequence of the immunity protein. It was observed that the Clo DF13 immunity gene encodes an 85 aminoacid protein and is transcribed in the same direction as the cloacin gene. These experimental data support our model, presented elsewhere, which implicates that the cloacin and immunity genes of Clo DF13 are coordinately transcribed from the cloacin promoter. We also present DNA sequence data indicating that an extra ribosome binding site precedes the immunity gene on the polycistronic mRNA. This ribosome binding site might explain the fact that in cloacinogenic cells more immunity protein than cloacin is synthesized. The comparison of the complete aminoacid sequence of the Clo DF13 immunity protein, with the aminoacid sequence data of the purified, comparable Col E3 immunity protein revealed that both proteins have extensive homologies in primary and secondary structure, although they are exchangeable only to a low extent in vivo and in vitro. It was also observed that a lysine residue was modified in immunity protein isolated from excreted bacteriocin complexes. Images PMID:6253914

  20. Engineering vaccines and niches for immune modulation.

    PubMed

    Purwada, Alberto; Roy, Krishnendu; Singh, Ankur

    2014-04-01

    Controlled modulation of immune response, especially the balance between immunostimulatory and immunosuppressive responses, is critical for a variety of clinical applications, including immunotherapies against cancer and infectious diseases, treatment of autoimmune disorders, transplant surgeries, regenerative medicine, prosthetic implants, etc. Our ability to precisely modify both innate and adaptive immune responses could provide new therapeutic directions in a variety of diseases. In the context of vaccines and immunotherapies, the interplay between antigen-presenting cells (e.g. dendritic cells and macrophages), B cells, T helper and killer subtypes, and regulatory T- and B-cell responses is critical for generating effective immunity against cancer, infectious diseases and autoimmune diseases. In recent years, immunoengineering has emerged as a new field that uses quantitative engineering tools to understand molecular-, cellular- and system-level interactions of the immune system and to develop design-driven approaches to control and modulate immune responses. Biomaterials are an integral part of this engineering toolbox and can exploit the intrinsic biological and mechanical cues of the immune system to directly modulate and train immune cells and direct their response to a particular phenotype. A large body of literature exists on strategies to evade or suppress the immune response in implants, transplantation and regenerative medicine. This review specifically focuses on the use of biomaterials for immunostimulation and controlled modulation, especially in the context of vaccines and immunotherapies against cancer, infectious diseases and autoimmune disorders. Bioengineering smart systems that can simultaneously deliver multiple bioactive agents in a controlled manner or can work as a niche for in situ priming and modulation of the immune system could significantly enhance the efficacy of next-generation immunotherapeutics. In this review, we describe our

  1. The Influence of Parent Preprocedural Anxiety on Child Procedural Pain: Mediation by Child Procedural Anxiety

    PubMed Central

    Bearden, Donald J.; Feinstein, Amanda

    2012-01-01

    Objective Data suggest parents’ preprocedural anxiety is related to children's acute procedural anxiety and pain. This study examined the temporal relations among these constructs to determine whether children's anxiety mediates the relation between parents' anticipatory anxiety and children's procedural pain. Methods A total of 90 preschoolers receiving immunizations, their parents, and the nurses rated children's procedural anxiety and pain. Parents provided ratings of their own preprocedural anxiety. Results Bootstrapping analyses revealed that children's procedural anxiety mediated the relation between parents' preprocedural anxiety and children's procedural pain according to parents' report and nurses’ report but not children's self-report of anxiety and pain. Conclusions Analyses suggest that children's procedural anxiety mediates the relation between parents' anticipatory anxiety and children's procedural pain. Thus, targeting parents’ preprocedural anxiety might be beneficial to the parents as well as the children undergoing a distressing medical procedure. PMID:22623729

  2. The influence of parent preprocedural anxiety on child procedural pain: mediation by child procedural anxiety.

    PubMed

    Bearden, Donald J; Feinstein, Amanda; Cohen, Lindsey L

    2012-07-01

    Data suggest parents' preprocedural anxiety is related to children's acute procedural anxiety and pain. This study examined the temporal relations among these constructs to determine whether children's anxiety mediates the relation between parents' anticipatory anxiety and children's procedural pain. A total of 90 preschoolers receiving immunizations, their parents, and the nurses rated children's procedural anxiety and pain. Parents provided ratings of their own preprocedural anxiety. Bootstrapping analyses revealed that children's procedural anxiety mediated the relation between parents' preprocedural anxiety and children's procedural pain according to parents' report and nurses' report but not children's self-report of anxiety and pain. Analyses suggest that children's procedural anxiety mediates the relation between parents' anticipatory anxiety and children's procedural pain. Thus, targeting parents' preprocedural anxiety might be beneficial to the parents as well as the children undergoing a distressing medical procedure.

  3. Conditioning of the immune response.

    PubMed

    Ader, R; Cohen, N

    1991-10-01

    Experimental studies in humans and experimental animals document the acquisition and extinction of classically conditioned alterations of different parameters of humoral- and cell-mediated immune responses. Although the aversive effects of cyclophosphamide in a taste aversion learning paradigm has been the most frequently used model, conditioned immunomodulatory effects are not confined to this conditioning procedure, and they are not limited to cyclophosphamide or, for that matter, the use of immunomodulating drugs as unconditioned stimuli. Conditioned changes in immunologic reactivity have also been found to modulate the progression of spontaneously-developing or experimentally-induced pathophysiological processes in experimental animals. The available data on the immunoregulatory effects of conditioning indicate that the immune system, like other systems operating in the interests of homeostasis, is integrated with other physiological processes and is therefore influenced by and capable of influencing the brain.

  4. Vaccination to gain humoral immune memory

    PubMed Central

    Sarkander, Jana; Hojyo, Shintaro; Tokoyoda, Koji

    2016-01-01

    The concept of immune memory forms the biological basis for vaccination programs. Despite advancements in the field of immune memory and vaccination, most current vaccines are evaluated by magnitude of antigen-specific antibody titers in serum or mucosa after vaccination. It has been shown, however, that antibody-mediated humoral immune memory is established regardless of the magnitude and duration of immune reactions, suggesting that assessment of vaccine efficacy should be performed for several years after vaccination. This long-term investigation is disadvantageous for prevalent and pandemic infections. Long-lived memory plasma cells and memory helper T cells which contribute to humoral immune memory are generated in the bone marrow after migration of memory cell precursors through bloodstream. Thus, it may be a novel evaluation strategy to assess the precursors of memory cells in the blood in the early phase of the immune reaction(s). We here review recent advances on the generation and maintenance of immune memory cells involved in humoral immunity and introduce a current concept of direct and short-term assessment of humoral immune memory formation upon vaccination as a correlate of protection. PMID:28090322

  5. Vaccination to gain humoral immune memory.

    PubMed

    Sarkander, Jana; Hojyo, Shintaro; Tokoyoda, Koji

    2016-12-01

    The concept of immune memory forms the biological basis for vaccination programs. Despite advancements in the field of immune memory and vaccination, most current vaccines are evaluated by magnitude of antigen-specific antibody titers in serum or mucosa after vaccination. It has been shown, however, that antibody-mediated humoral immune memory is established regardless of the magnitude and duration of immune reactions, suggesting that assessment of vaccine efficacy should be performed for several years after vaccination. This long-term investigation is disadvantageous for prevalent and pandemic infections. Long-lived memory plasma cells and memory helper T cells which contribute to humoral immune memory are generated in the bone marrow after migration of memory cell precursors through bloodstream. Thus, it may be a novel evaluation strategy to assess the precursors of memory cells in the blood in the early phase of the immune reaction(s). We here review recent advances on the generation and maintenance of immune memory cells involved in humoral immunity and introduce a current concept of direct and short-term assessment of humoral immune memory formation upon vaccination as a correlate of protection.

  6. Transituational Immunization and Therapy of Learned Helplessness in the Rat

    ERIC Educational Resources Information Center

    Maier, Steven F.; Williams, Jon L.

    1977-01-01

    These experiments are addressed specifically to the question of whether transituational transfer of immunizing and therapeutic effects will occur when these procedures involve responses and settings which are very different from those used in final testing. (Author/RK)

  7. 46 CFR 272.14 - Survey procedures.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 8 2011-10-01 2011-10-01 false Survey procedures. 272.14 Section 272.14 Shipping... OPERATORS REQUIREMENTS AND PROCEDURES FOR CONDUCTING CONDITION SURVEYS AND ADMINISTERING MAINTENANCE AND... Survey procedures. (a) Prior to survey. Unless otherwise directed by MARAD, the Operator of a...

  8. 46 CFR 272.14 - Survey procedures.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 8 2013-10-01 2013-10-01 false Survey procedures. 272.14 Section 272.14 Shipping... OPERATORS REQUIREMENTS AND PROCEDURES FOR CONDUCTING CONDITION SURVEYS AND ADMINISTERING MAINTENANCE AND... Survey procedures. (a) Prior to survey. Unless otherwise directed by MARAD, the Operator of a...

  9. 46 CFR 272.14 - Survey procedures.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 8 2012-10-01 2012-10-01 false Survey procedures. 272.14 Section 272.14 Shipping... OPERATORS REQUIREMENTS AND PROCEDURES FOR CONDUCTING CONDITION SURVEYS AND ADMINISTERING MAINTENANCE AND... Survey procedures. (a) Prior to survey. Unless otherwise directed by MARAD, the Operator of a...

  10. 46 CFR 272.14 - Survey procedures.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 8 2014-10-01 2014-10-01 false Survey procedures. 272.14 Section 272.14 Shipping... OPERATORS REQUIREMENTS AND PROCEDURES FOR CONDUCTING CONDITION SURVEYS AND ADMINISTERING MAINTENANCE AND... Survey procedures. (a) Prior to survey. Unless otherwise directed by MARAD, the Operator of a...

  11. 46 CFR 272.14 - Survey procedures.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Survey procedures. 272.14 Section 272.14 Shipping... OPERATORS REQUIREMENTS AND PROCEDURES FOR CONDUCTING CONDITION SURVEYS AND ADMINISTERING MAINTENANCE AND... Survey procedures. (a) Prior to survey. Unless otherwise directed by MARAD, the Operator of a...

  12. Imbalanced immune homeostasis in immune thrombocytopenia.

    PubMed

    Yazdanbakhsh, Karina

    2016-04-01

    Immune thrombocytopenia (ITP) is an autoimmune bleeding disorder resulting from low platelet counts caused by inadequate production as well as increased destruction by autoimmune mechanisms. As with other autoimmune disorders, chronic ITP is characterized by perturbations of immune homeostasis with hyperactivated effector cells as well as defective regulatory arm of the adaptive immune system, which will be reviewed here. Interestingly, some ITP treatments are associated with restoring the regulatory imbalance, although it remains unclear whether the immune system is redirected to a state of tolerance once treatment is discontinued. Understanding the mechanisms that result in breakdown of immune homeostasis in ITP will help to identify novel pathways for restoring tolerance and inhibiting effector cell responses. This information can then be translated into developing therapies for averting autoimmunity not only in ITP but also many autoimmune disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Immunizations: Active vs. Passive

    MedlinePlus

    ... a few weeks before the antibodies are worn down and removed from the bloodstream. By contrast, active immunizations can produce antibodies that last a lifetime. Last Updated 11/21/2015 Source Immunizations & Infectious Diseases: An Informed Parent's ...

  14. Immune System and Disorders

    MedlinePlus

    Your immune system is a complex network of cells, tissues, and organs that work together to defend against germs. It ... t, to find and destroy them. If your immune system cannot do its job, the results can be ...

  15. [Immune system and tumors].

    PubMed

    Terme, Magali; Tanchot, Corinne

    2017-02-01

    Despite having been much debated, it is now well established that the immune system plays an essential role in the fight against cancer. In this article, we will highlight the implication of the immune system in the control of tumor growth and describe the major components of the immune system involved in the antitumoral immune response. The immune system, while exerting pressure on tumor cells, also will play a pro-tumoral role by sculpting the immunogenicity of tumors cells as they develop. Finally, we will illustrate the numerous mechanisms of immune suppression that take place within the tumoral microenvironment which allow tumor cells to escape control from the immune system. The increasingly precise knowledge of the brakes to an effective antitumor immune response allows the development of immunotherapy strategies more and more innovating and promising of hope.

  16. Immunity to cancer

    SciTech Connect

    Reif, A.E.; Mitchell, M.S.

    1985-01-01

    This book contains five sections, each containing several papers. The section titles are: Identification and Characterization of Tumor Antigens; Immune Responses to Tumor Antigens; Regulation of the Immune Response to Tumor Cells, Immunotherapy and Biomodulators, and Immunotherapy and Immunoprophylaxis.

  17. Immune Responses in Neonates

    PubMed Central

    Basha, Saleem; Surendran, Naveen; Pichichero, Michael

    2015-01-01

    Neonates have little immunological memory and a developing immune system, which increases their vulnerability to infectious agents. Recent advances in understanding of neonatal immunity indicate that both innate and adaptive responses are dependent on precursor frequency of lymphocytes, antigenic dose and mode of exposure. Studies in neonatal mouse models and human umbilical cord blood cells demonstrate the capability of neonatal immune cells to produce immune responses similar to adults in some aspects but not others. This review focuses mainly on the developmental and functional mechanisms of the human neonatal immune system. In particular, the mechanism of innate and adaptive immunity and the role of neutrophils, antigen presenting cells, differences in subclasses of T lymphocytes (Th1, Th2, Tregs) and B cells are discussed. In addition, we have included the recent developments in neonatal mouse immune system. Understanding neonatal immunity is essential to development of therapeutic vaccines to combat newly emerging infectious agents. PMID:25088080

  18. Immunity by equilibrium.

    PubMed

    Eberl, Gérard

    2016-08-01

    The classical model of immunity posits that the immune system reacts to pathogens and injury and restores homeostasis. Indeed, a century of research has uncovered the means and mechanisms by which the immune system recognizes danger and regulates its own activity. However, this classical model does not fully explain complex phenomena, such as tolerance, allergy, the increased prevalence of inflammatory pathologies in industrialized nations and immunity to multiple infections. In this Essay, I propose a model of immunity that is based on equilibrium, in which the healthy immune system is always active and in a state of dynamic equilibrium between antagonistic types of response. This equilibrium is regulated both by the internal milieu and by the microbial environment. As a result, alteration of the internal milieu or microbial environment leads to immune disequilibrium, which determines tolerance, protective immunity and inflammatory pathology.

  19. CD4 T Cell Memory and Antibody Responses Directed against the Pneumococcal Histidine Triad Proteins PhtD and PhtE following Nasopharyngeal Colonization and Immunization and Their Role in Protection against Pneumococcal Colonization in Mice

    PubMed Central

    Khan, M. N.

    2013-01-01

    The present study was undertaken to understand the role of vaccine candidates PhtD and PhtE in pneumococcal nasopharyngeal (NP) colonization, their ability to induce CD4 T cell memory and antibody responses following primary NP colonization, and their contribution to protection against secondary pneumococcal colonization in mice. The study was also aimed at understanding the potential of immunization with PhtD and PhtE in eliciting qualitative CD4 T cell memory responses and protection against pneumococcal NP colonization in mice. PhtD and PhtE isogenic mutants in a TIGR4 background (TIGR4 ΔPhtD and TIGR4 ΔPhtE) were constructed and found to have a significantly reduced colonization density over time in the nasopharynges of mice compared to those of mice colonized with wild-type TIGR4. Mice with primary colonization by wild-type TIGR4, TIGR4 ΔPhtD, or TIGR4 ΔPhtE were protected against secondary colonization by wild-type TIGR4; nonetheless, the clearance of secondary colonization was slower in mice with primary colonization by either TIGR4 ΔPhtD or TIGR4 ΔPhtE than in mice with primary colonization by wild-type TIGR4. Colonization was found to be an immunizing event for PhtD and PhtE antigens (antibody response); however, we failed to detect any antigen (PhtD or PhtE)-specific CD4 T cell responses in any of the colonized groups of mice. Intranasal immunization with either PhtD or PhtE protein generated robust serum antibody and CD4 Th1-biased immune memory and conferred protection against pneumococcal colonization in mice. We conclude that PhtD and PhtE show promise as components in next-generation pneumococcal vaccine formulations. PMID:23897609

  20. Specified assurance level sampling procedure

    SciTech Connect

    Willner, O.

    1980-11-01

    In the nuclear industry design specifications for certain quality characteristics require that the final product be inspected by a sampling plan which can demonstrate product conformance to stated assurance levels. The Specified Assurance Level (SAL) Sampling Procedure has been developed to permit the direct selection of attribute sampling plans which can meet commonly used assurance levels. The SAL procedure contains sampling plans which yield the minimum sample size at stated assurance levels. The SAL procedure also provides sampling plans with acceptance numbers ranging from 0 to 10, thus, making available to the user a wide choice of plans all designed to comply with a stated assurance level.

  1. Development of immunity in early life.

    PubMed

    Goenka, Anu; Kollmann, Tobias R

    2015-06-01

    The immune system in early life goes through rapid and radical changes. Early life is also the period with the highest risk of infections. The foetal immune system is programmed to coexist with foreign antigenic influences in utero, and postnatally to rapidly develop a functional system capable of distinguishing helpful microbes from harmful pathogens. Both host genetics and environmental influences shape this dramatic transition and direct the trajectory of the developing immune system into early childhood and beyond. Given the malleability of the immune system in early life, interventions aimed at modulating this trajectory thus have the potential to translate into considerable reductions in infectious disease burden with immediate as well as long-lasting benefit. However, an improved understanding of the underlying molecular drivers of early life immunity is prerequisite to optimise such interventions and transform the window of early life vulnerability into one of opportunity. Copyright © 2015 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  2. The Lymphatic System: Integral Roles in Immunity

    PubMed Central

    Randolph, Gwendalyn J.; Ivanov, Stoyan; Zinselmeyer, Bernd H.; Scallan, Joshua P.

    2017-01-01

    The lymphatic vasculature is not considered a formal part of the immune system, but it is critical to immunity. One of its major roles is in the coordination of the trafficking of antigen and immune cells. However, other roles in immunity are emerging. Lymphatic endothelial cells, for example, directly present antigen or express factors that greatly influence the local environment. We cover these topics herein and discuss how other properties of the lymphatic vasculature, such as mechanisms of lymphatic contraction (which immunologists traditionally do not take into account), are nonetheless integral in the immune system. Much is yet unknown, and this nascent subject is ripe for exploration. We argue that to consider the impact of lymphatic biology in any given immunological interaction is a key step toward integrating immunology with organ physiology and ultimately many complex pathologies. PMID:27860528

  3. The innate immune system and transplantation.

    PubMed

    Farrar, Conrad A; Kupiec-Weglinski, Jerzy W; Sacks, Steven H

    2013-10-01

    The sensitive and broadly reactive character of the innate immune system makes it liable to activation by stress factors other than infection. Thermal and metabolic stresses experienced during the transplantation procedure are sufficient to trigger the innate immune response and also augment adaptive immunity in the presence of foreign antigen on the donor organ. The resulting inflammatory and immune reactions combine to form a potent effector response that can lead to graft rejection. Here we examine the evidence that the complement and toll-like receptor systems are central to these pathways of injury and present a formidable barrier to transplantation. We review extensive information about the effector mechanisms that are mediated by these pathways, and bring together what is known about the damage-associated molecular patterns that initiate this sequence of events. Finally, we refer to two ongoing therapeutic trials that are evaluating the validity of these concepts in man.

  4. Measuring the immune system: a comprehensive approach for the analysis of immune functions in humans.

    PubMed

    Claus, Maren; Dychus, Nicole; Ebel, Melanie; Damaschke, Jürgen; Maydych, Viktoriya; Wolf, Oliver T; Kleinsorge, Thomas; Watzl, Carsten

    2016-10-01

    The immune system is essential to provide protection from infections and cancer. Disturbances in immune function can therefore directly affect the health of the affected individual. Many extrinsic and intrinsic factors such as exposure to chemicals, stress, nutrition and age have been reported to influence the immune system. These influences can affect various components of the immune system, and we are just beginning to understand the causalities of these changes. To investigate such disturbances, it is therefore essential to analyze the different components of the immune system in a comprehensive fashion. Here, we demonstrate such an approach which provides information about total number of leukocytes, detailed quantitative and qualitative changes in the composition of lymphocyte subsets, cytokine levels in serum and functional properties of T cells, NK cells and monocytes. Using samples from a cohort of 24 healthy volunteers, we demonstrate the feasibility of our approach to detect changes in immune functions.

  5. Immune Reconstitution after Allogeneic Hematopoietic Stem Cell Transplantation

    PubMed Central

    Ogonek, Justyna; Kralj Juric, Mateja; Ghimire, Sakhila; Varanasi, Pavankumar Reddy; Holler, Ernst; Greinix, Hildegard; Weissinger, Eva

    2016-01-01

    The timely reconstitution and regain of function of a donor-derived immune system is of utmost importance for the recovery and long-term survival of patients after allogeneic hematopoietic stem cell transplantation (HSCT). Of note, new developments such as umbilical cord blood or haploidentical grafts were associated with prolonged immunodeficiency due to delayed immune reconstitution, raising the need for better understanding and enhancing the process of immune reconstitution and finding strategies to further optimize these transplant procedures. Immune reconstitution post-HSCT occurs in several phases, innate immunity being the first to regain function. The slow T cell reconstitution is regarded as primarily responsible for deleterious infections with latent viruses or fungi, occurrence of graft-versus-host disease, and relapse. Here we aim to summarize the major steps of the adaptive immune reconstitution and will discuss the importance of immune balance in patients after HSCT. PMID:27909435

  6. Your Child's Immunization Record

    MedlinePlus

    Your Child’s Immunization Record It’s important to keep up-to-date records of all your child’s immunizations, beginning at birth and continuing through ... receives a vaccination by filling in the date. Record of Immunizations Date Given: Where Given: Reaction: Hepatitis ...

  7. Immune System Quiz

    MedlinePlus

    ... A Real Lifesaver Kids Talk About: Coaches Quiz: Immune System KidsHealth > For Kids > Quiz: Immune System Print A A A How much do you know about your immune system? Find out by taking this quiz! About KidsHealth ...

  8. The Immune System Game

    ERIC Educational Resources Information Center

    Work, Kirsten A.; Gibbs, Melissa A.; Friedman, Erich J.

    2015-01-01

    We describe a card game that helps introductory biology students understand the basics of the immune response to pathogens. Students simulate the steps of the immune response with cards that represent the pathogens and the cells and molecules mobilized by the immune system. In the process, they learn the similarities and differences between the…

  9. Immune Disorder HSCT Protocol

    ClinicalTrials.gov

    2016-11-01

    Immune Deficiency Disorders; Severe Combined Immunodeficiency; Chronic Granulomatous Disease; X-linked Agammaglobulinemia; Wiskott-Aldrich Syndrome; Hyper-IgM; DiGeorge Syndrome; Chediak-Higashi Syndrome; Common Variable Immune Deficiency; Immune Dysregulatory Disorders; Hemophagocytic Lymphohistiocytosis; IPEX; Autoimmune Lymphoproliferative Syndrome; X-linked Lymphoproliferative Syndrome

  10. The Immune System Game

    ERIC Educational Resources Information Center

    Work, Kirsten A.; Gibbs, Melissa A.; Friedman, Erich J.

    2015-01-01

    We describe a card game that helps introductory biology students understand the basics of the immune response to pathogens. Students simulate the steps of the immune response with cards that represent the pathogens and the cells and molecules mobilized by the immune system. In the process, they learn the similarities and differences between the…

  11. Engineering synthetic vaccines using cues from natural immunity

    PubMed Central

    Irvine, Darrell J.; Swartz, Melody A.; Szeto, Gregory L.

    2014-01-01

    Vaccines aim to protect against or treat diseases through manipulation of the immune response, promoting either immunity or tolerance. The former generate antibodies and T-cells poised to protect against future pathogen encounter or attack diseased cells such as tumors; the latter, which are far less developed, block pathogenic autoreactive T-cells and autoantibodies that target self tissue. Enormous challenges remain, however, as a consequence of our incomplete understanding of human immunity. A rapidly growing field of research is the design of synthetic materials in vaccines to 1) target organs, tissues, cells, or intracellular compartments; 2) co-deliver immunomodulatory signals that control the quality of the immune response; or 3) directly act as immune regulators, and there exists great potential for well-defined materials to further our understanding of immunity. Here we describe recent advances in the design of synthetic materials to direct immune responses, highlighting successes and challenges in prophylactic, therapeutic, and tolerance-inducing vaccines. PMID:24150416

  12. Do Advance Directives Direct?

    PubMed

    Shapiro, Susan P

    2015-06-01

    Resolution of long-standing debates about the role and impact of advance directives - living wills and powers of attorney for health care - has been hampered by a dearth of appropriate data, in particular data that compare the process and outcomes of end-of-life decision making on behalf of patients with and without advance directives. Drawing on a large ethnographic study of patients in two intensive care units in a large urban teaching hospital, this article compares aspects of the medical decision-making process and outcomes by advance-directive status. Controlling for demographic characteristics and severity of illness, the study finds few significant differences between patients without advance directives and those who claim to have them. Surprisingly, these few differences hold only for those whose directives are in their hospital chart. There are no significant differences between those with no directive and those claiming to have a copy at home or elsewhere. The article considers the implications if directives seemingly must be in hand to show even modest effects. Do advance directives direct? The intensive care unit data provide far more support for the growing body of literature that casts doubt on their impact than studies that promote the use of them.

  13. Regulations and Procedures Manual

    SciTech Connect

    Young, Lydia J.

    2011-07-25

    The purpose of the Regulations and Procedures Manual (RPM) is to provide LBNL personnel with a reference to University and Lawrence Berkeley National Laboratory (LBNL or Laboratory) policies and regulations by outlining normal practices and answering most policy questions that arise in the day-to-day operations of Laboratory organizations. Much of the information in this manual has been condensed from detail provided in LBNL procedure manuals, Department of Energy (DOE) directives, and Contract DE-AC02-05CH11231. This manual is not intended, however, to replace any of those documents. RPM sections on personnel apply only to employees who are not represented by unions. Personnel policies pertaining to employees represented by unions may be found in their labor agreements. Questions concerning policy interpretation should be directed to the LBNL organization responsible for the particular policy. A link to the Managers Responsible for RPM Sections is available on the RPM home page. If it is not clear which organization is responsible for a policy, please contact Requirements Manager Lydia Young or the RPM Editor.

  14. Regulations and Procedures Manual

    SciTech Connect

    Young, Lydia

    2010-09-30

    The purpose of the Regulations and Procedures Manual (RPM) is to provide Laboratory personnel with a reference to University and Lawrence Berkeley National Laboratory policies and regulations by outlining the normal practices and answering most policy questions that arise in the day-to-day operations of Laboratory departments. Much of the information in this manual has been condensed from detail provided in Laboratory procedure manuals, Department of Energy (DOE) directives, and Contract DE-AC02-05CH11231. This manual is not intended, however, to replace any of those documents. The sections on personnel apply only to employees who are not represented by unions. Personnel policies pertaining to employees represented by unions may be found in their labor agreements. Questions concerning policy interpretation should be directed to the department responsible for the particular policy. A link to the Managers Responsible for RPM Sections is available on the RPM home page. If it is not clear which department should be called, please contact the Associate Laboratory Director of Operations.

  15. Receptor signaling clusters in the immune synapse

    SciTech Connect

    Dustin, Michael L.; Groves, Jay T.

    2012-02-23

    Signaling processes between various immune cells involve large-scale spatial reorganization of receptors and signaling molecules within the cell-cell junction. These structures, now collectively referred to as immune synapses, interleave physical and mechanical processes with the cascades of chemical reactions that constitute signal transduction systems. Molecular level clustering, spatial exclusion, and long-range directed transport are all emerging as key regulatory mechanisms. The study of these processes is drawing researchers from physical sciences to join the effort and represents a rapidly growing branch of biophysical chemistry. Furthermore, recent advances in physical and quantitative analyses of signaling within the immune synapses are reviewed here.

  16. How phototherapy affects the immune system

    NASA Astrophysics Data System (ADS)

    Dyson, Mary

    2008-03-01

    The immune system is a complex group of cells, tissues and organs that recognize and attack foreign substances, pathogenic organisms and cancer cells. It also responds to injury by producing inflammation. The immune system has peripheral components that include skin-associated lymphoid tissues (SALT) and mucosa-associated lymphoid tissues (MALT), located where pathogens and other harmful substances gain access to the body. Phototherapy, delivered at appropriate treatment parameters, exerts direct actions on the cellular elements of the peripheral part of the immune system since it is readily accessible to photons.

  17. CRISPR-Cas immunity in prokaryotes.

    PubMed

    Marraffini, Luciano A

    2015-10-01

    Prokaryotic organisms are threatened by a large array of viruses and have developed numerous defence strategies. Among these, only clustered, regularly interspaced short palindromic repeat (CRISPR)-Cas systems provide adaptive immunity against foreign elements. Upon viral injection, a small sequence of the viral genome, known as a spacer, is integrated into the CRISPR locus to immunize the host cell. Spacers are transcribed into small RNA guides that direct the cleavage of the viral DNA by Cas nucleases. Immunization through spacer acquisition enables a unique form of evolution whereby a population not only rapidly acquires resistance to its predators but also passes this resistance mechanism vertically to its progeny.

  18. Effect of cellular mobility on immune response

    NASA Astrophysics Data System (ADS)

    Pandey, R. B.; Mannion, R.; Ruskin, H. J.

    2000-08-01

    Mobility of cell types in our HIV immune response model is subject to an intrinsic mobility and an explicit directed mobility, which is governed by Pmob. We investigate how restricting the explicit mobility, while maintaining the innate mobility of a viral-infected cell, affects the model's results. We find that increasing the explicit mobility of the immune system cells leads to viral dominance for certain levels of viral mutation. We conclude that increasing immune system cellular mobility indirectly increases the virus’ inherent mobility.

  19. Routine immunization: an essential but wobbly platform.

    PubMed

    Steinglass, Robert

    2013-11-01

    Despite their vital role, routine immunization programs are taken for granted. Coverage levels are poor in some countries and have stagnated in others, while addition of new vaccines is an additional stressor. We need to strengthen: (1) policy processes, (2) monitoring and evaluation, (3) human resources, (4) regular delivery and supply systems, (5) local political commitment and ownership, (6) involvement of civil society and communities, and (7) sustainable financing. Rebalancing immunization direction and investment is needed.

  20. Immune Response in Hepatitis B Virus Infection

    PubMed Central

    Tan, Anthony; Koh, Sarene; Bertoletti, Antonio

    2015-01-01

    Hepatitis B virus (HBV) can replicate within hepatocytes without causing direct cell damage. The host immune response is, therefore, not only essential to control the spread of virus infection, but it is also responsible for the inflammatory events causing liver pathologies. In this review, we discuss how HBV deals with host immunity and how we can harness it to achieve virus control and suppress liver damage. PMID:26134480

  1. Boosting Tumor-Specific Immunity Using PDT

    PubMed Central

    Maeding, Nicole; Verwanger, Thomas; Krammer, Barbara

    2016-01-01

    Photodynamic therapy (PDT) is a cancer treatment with a long-standing history. It employs the application of nontoxic components, namely a light-sensitive photosensitizer and visible light, to generate reactive oxygen species (ROS). These ROS lead to tumor cell destruction, which is accompanied by the induction of an acute inflammatory response. This inflammatory process sends a danger signal to the innate immune system, which results in activation of specific cell types and release of additional inflammatory mediators. Activation of the innate immune response is necessary for subsequent induction of the adaptive arm of the immune system. This includes the priming of tumor-specific cytotoxic T lymphocytes (CTL) that have the capability to directly recognize and kill cells which display an altered self. The past decades have brought increasing appreciation for the importance of the generation of an adaptive immune response for long-term tumor control and induction of immune memory to combat recurrent disease. This has led to considerable effort to elucidate the immune effects PDT treatment elicits. In this review we deal with the progress which has been made during the past 20 years in uncovering the role of PDT in the induction of the tumor-specific immune response, with special emphasis on adaptive immunity. PMID:27782066

  2. Innate Immunity and BK Virus: Prospective Strategies.

    PubMed

    Kariminik, Ashraf; Yaghobi, Ramin; Dabiri, Shahriar

    2016-03-01

    Recent information demonstrated that BK virus reactivation is a dominant complication after kidney transplantation, which occurs because of immunosuppression. BK virus reactivation is the main reason of transplanted kidney losing. Immune response against BK virus is the major inhibitor of the virus reactivation. Therefore, improving our knowledge regarding the main parameters that fight against BK viruses can shed light on to direct new treatment strategies to suppress BK infection. Innate immunity consists of numerous cell systems and also soluble molecules, which not only suppress virus replication, but also activate adaptive immunity to eradicate the infection. Additionally, it appears that immune responses against reactivated BK virus are the main reasons for induction of BK virus-associated nephropathy (BKAN). Thus, improving our knowledge regarding the parameters and detailed mechanisms of innate immunity and also the status of innate immunity of the patients with BK virus reactivation and its complications can introduce new prospective strategies to either prevent or as therapy of the complication. Therefore, this review was aimed to collate the most recent data regarding the roles played by innate immunity against BK virus and also the status of innate immunity in the patients with reactivation BK virus and BKAN.

  3. Immunization in vitro and production of monoclonal antibodies specific to insoluble and weakly immunogenic proteins.

    PubMed Central

    Van Ness, J; Laemmli, U K; Pettijohn, D E

    1984-01-01

    A procedure is described for immunizing in vitro and stimulating proliferation of specific B-cell lymphocytes. The method is applicable to production of monoclonal antibodies against proteins that are soluble only in denaturing solvents. An induction period is described in which antigen is presented to the B-cell population in the absence of serum. Also, antigen is coupled to mitogenic silica, which allows the effective presentation of both soluble and insoluble antigens. The results indicate hybridomas can be obtained that secrete IgMs directed against highly conserved or weakly immunogenic antigens. Images PMID:6083563

  4. Immune responses in space flight

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.

    1998-01-01

    Space flight has been shown to have profound effects on immunological parameters of humans, monkeys and rodents. These studies have been carried out by a number of different laboratories. Among the parameters affected are leukocyte blastogenesis, natural killer cell activity, leukocyte subset distribution, cytokine production - including interferons and interleukins, and macrophage maturation and activity. These changes start to occur only after a few days space flight, and some changes continue throughout long-term space flight. Antibody responses have received only very limited study, and total antibody levels have been shown to be increased after long-term space flight. Several factors could be involved in inducing these changes. These factors could include microgravity, lack of load-bearing, stress, acceleration forces, and radiation. The mechanism(s) for space flight-induced changes in immune responses remain(s) to be established. Certainly, there can be direct effects of microgravity, or other factors, on cells that play a fundamental role in immune responses. However, it is now clear that there are interactions between the immune system and other physiological systems that could play a major role. For example, changes occurring in calcium use in the musculoskeletal system induced by microgravity or lack of use could have great impact on the immune system. Most of the changes in immune responses have been observed using samples taken immediately after return from space flight. However, there have been two recent studies that have used in-flight testing. Delayed-type hypersensitivity responses to common recall antigens of astronauts and cosmonauts have been shown to be decreased when tested during space flights. Additionally, natural killer cell and blastogenic activities are inhibited in samples taken from rats during space flight. Therefore, it is now clear that events occurring during space flight itself can affect immune responses. The biological

  5. Immune responses in space flight

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.

    1998-01-01

    Space flight has been shown to have profound effects on immunological parameters of humans, monkeys and rodents. These studies have been carried out by a number of different laboratories. Among the parameters affected are leukocyte blastogenesis, natural killer cell activity, leukocyte subset distribution, cytokine production - including interferons and interleukins, and macrophage maturation and activity. These changes start to occur only after a few days space flight, and some changes continue throughout long-term space flight. Antibody responses have received only very limited study, and total antibody levels have been shown to be increased after long-term space flight. Several factors could be involved in inducing these changes. These factors could include microgravity, lack of load-bearing, stress, acceleration forces, and radiation. The mechanism(s) for space flight-induced changes in immune responses remain(s) to be established. Certainly, there can be direct effects of microgravity, or other factors, on cells that play a fundamental role in immune responses. However, it is now clear that there are interactions between the immune system and other physiological systems that could play a major role. For example, changes occurring in calcium use in the musculoskeletal system induced by microgravity or lack of use could have great impact on the immune system. Most of the changes in immune responses have been observed using samples taken immediately after return from space flight. However, there have been two recent studies that have used in-flight testing. Delayed-type hypersensitivity responses to common recall antigens of astronauts and cosmonauts have been shown to be decreased when tested during space flights. Additionally, natural killer cell and blastogenic activities are inhibited in samples taken from rats during space flight. Therefore, it is now clear that events occurring during space flight itself can affect immune responses. The biological

  6. Kidney and innate immunity.

    PubMed

    Wang, Ying-Hui; Zhang, Yu-Gen

    2017-03-01

    Innate immune system is an important modulator of the inflammatory response during infection and tissue injury/repair. The kidney as a vital organ with high energy demand plays a key role in regulating the disease related metabolic process. Increasing research interest has focused on the immune pathogenesis of many kidney diseases. However, innate immune cells such as dendritic cells, macrophages, NK cells and a few innate lymphocytes, as well as the complement system are essential for renal immune homeostasis and ensure a coordinated balance between tissue injury and regeneration. The innate immune response provides the first line of host defense initiated by several classes of pattern recognition receptors (PRRs), such as membrane-bound Toll-like receptors (TLRs) and nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs), together with inflammasomes responsible for early innate immune response. Although the innate immune system is well studied, the research on the detailed relationship between innate immunity and kidney is still very limited. In this review, we will focus on the innate immune sensing system in renal immune homeostasis, as well as the corresponding pathogenesis of many kidney diseases. The pivotal roles of innate immunity in renal injury and regeneration with special emphasis on kidney disease related immunoregulatory mechanism are also discussed.

  7. Chapter 2: Innate Immunity

    PubMed Central

    Turvey, Stuart E.; Broide, David H.

    2009-01-01

    Recent years have witnessed an explosion of interest in the innate immune system. Questions about how the innate immune system senses infection and empowers a protective immune response are being answered at the molecular level. These basic science discoveries are being translated into a more complete understanding of the central role innate immunity plays in the pathogenesis of many human infectious and inflammatory diseases. It is particularly exciting that we are already seeing a return on these scientific investments with the emergence of novel therapies to harness the power of the innate immune system. In this review we explore the defining characteristics of the innate immune system, and through more detailed examples, we highlight recent breakthroughs that have advanced our understanding of the role of innate immunity in human health and disease. PMID:19932920

  8. Measuring polio immunity to plan immunization activities.

    PubMed

    Voorman, Arend; Lyons, Hil M

    2016-11-21

    The Global Polio Eradication Initiative is closer than ever to achieving a polio-free world. Immunization activities must still be carried out in non-endemic countries to maintain population immunity at levels which will stop poliovirus from spreading if it is re-introduced from still-infected areas. In areas where there is no active transmission of poliovirus, programs must rely on surrogate indicators of population immunity to determine the appropriate immunization activities, typically caregiver-reported vaccination history obtained from non-polio acute flaccid paralysis patients identified through polio surveillance. We used regression models to examine the relationship between polio vaccination campaigns and caregiver-reported polio vaccination history. We find that in many countries, vaccination campaigns have a surprisingly weak impact on these commonly used indicators. We conclude that alternative criteria and data, such as routine immunization indicators from vaccination records or household surveys, should be considered for planning polio vaccination campaigns, and that validation of such surrogate indicators is necessary if they are to be used as the basis for program planning and risk assessment. We recommend that the GPEI and similar organizations consider or continue devoting additional resources to rigorously study population immunity and campaign effectiveness in at-risk countries.

  9. Mass Cytometry of the Human Mucosal Immune System Identifies Tissue- and Disease-Associated Immune Subsets.

    PubMed

    van Unen, Vincent; Li, Na; Molendijk, Ilse; Temurhan, Mine; Höllt, Thomas; van der Meulen-de Jong, Andrea E; Verspaget, Hein W; Mearin, M Luisa; Mulder, Chris J; van Bergen, Jeroen; Lelieveldt, Boudewijn P F; Koning, Frits

    2016-05-17

    Inflammatory intestinal diseases are characterized by abnormal immune responses and affect distinct locations of the gastrointestinal tract. Although the role of several immune subsets in driving intestinal pathology has been studied, a system-wide approach that simultaneously interrogates all major lineages on a single-cell basis is lacking. We used high-dimensional mass cytometry to generate a system-wide view of the human mucosal immune system in health and disease. We distinguished 142 immune subsets and through computational applications found distinct immune subsets in peripheral blood mononuclear cells and intestinal biopsies that distinguished patients from controls. In addition, mucosal lymphoid malignancies were readily detected as well as precursors from which these likely derived. These findings indicate that an integrated high-dimensional analysis of the entire immune system can identify immune subsets associated with the pathogenesis of complex intestinal disorders. This might have implications for diagnostic procedures, immune-monitoring, and treatment of intestinal diseases and mucosal malignancies.

  10. Prenatal Alcohol Exposure and the Developing Immune System

    PubMed Central

    Gauthier, Theresa W.

    2015-01-01

    Evidence from research in humans and animals suggest that ingesting alcohol during pregnancy can disrupt the fetal immune system and result in an increased risk of infections and disease in newborns that may persist throughout life. Alcohol may have indirect effects on the immune system by increasing the risk of premature birth, which itself is a risk factor for immune-related problems. Animal studies suggest that alcohol exposure directly disrupts the developing immune system. A comprehensive knowledge of the mechanisms underlying alcohol’s effects on the developing immune system only will become clear once researchers establish improved methods for identifying newborns exposed to alcohol in utero. PMID:26695750

  11. Innate immune control and regulation of influenza virus infections

    PubMed Central

    McGill, Jodi; Heusel, Jonathan W.; Legge, Kevin L.

    2009-01-01

    Adaptive immune responses are critical for the control and clearance of influenza A virus (IAV) infection. However, in recent years, it has become increasingly apparent that innate immune cells, including natural killer cells, alveolar macrophages (aMφ), and dendritic cells (DC) are essential following IAV infection in the direct control of viral replication or in the induction and regulation of virus-specific adaptive immune responses. This review will discuss the role of these innate immune cells following IAV infection, with a particular focus on DC and their ability to induce and regulate the adaptive IAV-specific immune response. PMID:19643736

  12. Immune-mediated mechanisms influencing the efficacy of anticancer therapies.

    PubMed

    Coffelt, Seth B; de Visser, Karin E

    2015-04-01

    Conventional anticancer therapies, such as chemotherapy, radiotherapy, and targeted therapy, are designed to kill cancer cells. However, the efficacy of anticancer therapies is not only determined by their direct effects on cancer cells but also by off-target effects within the host immune system. Cytotoxic treatment regimens elicit several changes in immune-related parameters including the composition, phenotype, and function of immune cells. Here we discuss the impact of innate and adaptive immune cells on the success of anticancer therapy. In this context we examine the opportunities to exploit host immune responses to boost tumor clearing, and highlight the challenges facing the treatment of advanced metastatic disease.

  13. Prenatal Alcohol Exposure and the Developing Immune System.

    PubMed

    Gauthier, Theresa W

    2015-01-01

    Evidence from research in humans and animals suggest that ingesting alcohol during pregnancy can disrupt the fetal immune system and result in an increased risk of infections and disease in newborns that may persist throughout life. Alcohol may have indirect effects on the immune system by increasing the risk of premature birth, which itself is a risk factor for immune-related problems. Animal studies suggest that alcohol exposure directly disrupts the developing immune system. A comprehensive knowledge of the mechanisms underlying alcohol's effects on the developing immune system only will become clear once researchers establish improved methods for identifying newborns exposed to alcohol in utero.

  14. How do plants achieve immunity? Defence without specialized immune cells.

    PubMed

    Spoel, Steven H; Dong, Xinnian

    2012-01-25

    Vertebrates have evolved a sophisticated adaptive immune system that relies on an almost infinite diversity of antigen receptors that are clonally expressed by specialized immune cells that roam the circulatory system. These immune cells provide vertebrates with extraordinary antigen-specific immune capacity and memory, while minimizing self-reactivity. Plants, however, lack specialized mobile immune cells. Instead, every plant cell is thought to be capable of launching an effective immune response. So how do plants achieve specific, self-tolerant immunity and establish immune memory? Recent developments point towards a multilayered plant innate immune system comprised of self-surveillance, systemic signalling and chromosomal changes that together establish effective immunity.

  15. Eosinophils in mucosal immune responses

    PubMed Central

    Travers, J; Rothenberg, M E

    2015-01-01

    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  16. Simultaneous Immunization against Tuberculosis

    PubMed Central

    Tchilian, Elma Z.; Ronan, Edward O.; de Lara, Catherine; Lee, Lian Ni; Franken, Kees L. M. C.; Vordermeier, Martin H.; Ottenhoff, Tom H. M.; Beverley, Peter C. L.

    2011-01-01

    Background BCG, the only licensed vaccine against tuberculosis, provides some protection against disseminated disease in infants but has little effect on prevention of adult pulmonary disease. Newer parenteral immunization prime boost regimes may provide improved protection in experimental animal models but are unproven in man so that there remains a need for new and improved immunization strategies. Methods and Findings Mice were immunized parenterally, intranasally or simultaneously by both routes with BCG or recombinant mycobacterial antigens plus appropriate adjuvants. They were challenged with Mycobacterium tuberculosis (Mtb) and the kinetics of Mtb growth in the lungs measured. We show that simultaneous immunization (SIM) of mice by the intranasal and parenteral routes is highly effective in increasing protection over parenteral BCG administration alone. Intranasal immunization induces local pulmonary immunity capable of inhibiting the growth of Mtb in the early phase (the first week) of infection, while parenteral immunization has a later effect on Mtb growth. Importantly, these two effects are additive and do not depend on priming and boosting the immune response. The best SIM regimes reduce lung Mtb load by up to 2 logs more than BCG given by either route alone. Conclusions These data establish SIM as a novel and highly effective immunization strategy for Mtb that could be carried out at a single clinic visit. The efficacy of SIM does not depend on priming and boosting an immune response, but SIM is complementary to prime boost strategies and might be combined with them. PMID:22110657

  17. Nanoparticles and direct immunosuppression

    PubMed Central

    Ngobili, Terrika A

    2016-01-01

    Targeting the immune system with nanomaterials is an intensely active area of research. Specifically, the capability to induce immunosuppression is a promising complement for drug delivery and regenerative medicine therapies. Many novel strategies for immunosuppression rely on nanoparticles as delivery vehicles for small-molecule immunosuppressive compounds. As a consequence, efforts in understanding the mechanisms in which nanoparticles directly interact with the immune system have been overshadowed. The immunological activity of nanoparticles is dependent on the physiochemical properties of the nanoparticles and its subsequent cellular internalization. As the underlying factors for these reactions are elucidated, more nanoparticles may be engineered and evaluated for inducing immunosuppression and complementing immunosuppressive drugs. This review will briefly summarize the state-of-the-art and developments in understanding how nanoparticles induce immunosuppressive responses, compare the inherent properties of nanomaterials which induce these immunological reactions, and comment on the potential for using nanomaterials to modulate and control the immune system. PMID:27229901

  18. Origins of adaptive immunity.

    PubMed

    Liongue, Clifford; John, Liza B; Ward, Alister

    2011-01-01

    Adaptive immunity, involving distinctive antibody- and cell-mediated responses to specific antigens based on "memory" of previous exposure, is a hallmark of higher vertebrates. It has been argued that adaptive immunity arose rapidly, as articulated in the "big bang theory" surrounding its origins, which stresses the importance of coincident whole-genome duplications. Through a close examination of the key molecules and molecular processes underpinning adaptive immunity, this review suggests a less-extreme model, in which adaptive immunity emerged as part of longer evolutionary journey. Clearly, whole-genome duplications provided additional raw genetic materials that were vital to the emergence of adaptive immunity, but a variety of other genetic events were also required to generate some of the key molecules, whereas others were preexisting and simply co-opted into adaptive immunity.

  19. Neural circuitry and immunity.

    PubMed

    Pavlov, Valentin A; Tracey, Kevin J

    2015-12-01

    Research during the last decade has significantly advanced our understanding of the molecular mechanisms at the interface between the nervous system and the immune system. Insight into bidirectional neuro-immune communication has characterized the nervous system as an important partner of the immune system in the regulation of inflammation. Neuronal pathways, including the vagus nerve-based inflammatory reflex, are physiological regulators of immune function and inflammation. In parallel, neuronal function is altered in conditions characterized by immune dysregulation and inflammation. Here, we review these regulatory mechanisms and describe the neural circuitry modulating immunity. Understanding these mechanisms reveals possibilities to use targeted neuromodulation as a therapeutic approach for inflammatory and autoimmune disorders. These findings and current clinical exploration of neuromodulation in the treatment of inflammatory diseases define the emerging field of Bioelectronic Medicine.

  20. Immunizations: vaccinations in general.

    PubMed

    Wiley, Catherine C

    2015-06-01

    The childhood immunization schedule is complex and nuanced. Although serious adverse reactions to immunizations are uncommon, clinicians must be well-versed in these reactions as well as the contraindications and precautions to each vaccine. • Conjugate vaccine technology links polysaccharide antigens to carrier proteins, triggering T-cell-dependent immunity to polysaccharides, thereby strengthening immune memory. • On the basis of some research evidence and consensus, live vaccines are generally contraindicated in immunocompromised patients and in pregnancy. Most live vaccines can be administered to household contacts of immunocompromised patients. • On the basis of some research and consensus, modified administration of meningococcal, pneumococcal, and less commonly, other vaccines may be indicated to protect immunocompromised patients. • On the basis of disease epidemiology and consensus, international travelers should be up-to-date with all routine immunizations; depending on destination, additional vaccines or immune globulin may be required.

  1. Human immune system variation

    PubMed Central

    Brodin, Petter; Davis, Mark M.

    2017-01-01

    The human immune system is highly variable between individuals but relatively stable over time within a given person. Recent conceptual and technological advances have enabled systems immunology analyses, which reveal the composition of immune cells and proteins in populations of healthy individuals. The range of variation and some specific influences that shape an individual’s immune system is now becoming clearer. Human immune systems vary as a consequence of heritable and non-heritable influences, but symbiotic and pathogenic microbes and other non-heritable influences explain most of this variation. Understanding when and how such influences shape the human immune system is key for defining metrics of immunological health and understanding the risk of immune-mediated and infectious diseases. PMID:27916977

  2. Immunization of complex networks

    NASA Astrophysics Data System (ADS)

    Pastor-Satorras, Romualdo; Vespignani, Alessandro

    2002-03-01

    Complex networks such as the sexual partnership web or the Internet often show a high degree of redundancy and heterogeneity in their connectivity properties. This peculiar connectivity provides an ideal environment for the spreading of infective agents. Here we show that the random uniform immunization of individuals does not lead to the eradication of infections in all complex networks. Namely, networks with scale-free properties do not acquire global immunity from major epidemic outbreaks even in the presence of unrealistically high densities of randomly immunized individuals. The absence of any critical immunization threshold is due to the unbounded connectivity fluctuations of scale-free networks. Successful immunization strategies can be developed only by taking into account the inhomogeneous connectivity properties of scale-free networks. In particular, targeted immunization schemes, based on the nodes' connectivity hierarchy, sharply lower the network's vulnerability to epidemic attacks.

  3. Immune Regulation of Cancer

    PubMed Central

    Disis, Mary L.

    2010-01-01

    Innate and adaptive immune system cells play a major role in regulating the growth of cancer. Although it is commonly thought that an immune response localized to the tumor will inhibit cancer growth, it is clear that some types of inflammation induced in a tumor may also lead to cancer proliferation, invasion, and dissemination. Recent evidence suggests, however, that some patients with cancer can mount an antitumor immune response that has the potential to control or eliminate cancer. Indeed, a so-called “immune response” signature has been described in malignancy that is associated with improved outcomes in several tumor types. Moreover, the presence of specific subsets of T cells, which have the capability to penetrate tumor stroma and infiltrate deep into the parenchyma, identifies patients with an improved prognosis. Immune-based therapies have the potential to modulate the tumor microenvironment by eliciting immune system cells that will initiate acute inflammation that leads to tissue destruction. PMID:20516428

  4. Biomimetic and synthetic interfaces to tune immune responses (Review)

    PubMed Central

    Garapaty, Anusha; Champion, Julie A.

    2015-01-01

    Organisms depend upon complex intercellular communication to initiate, maintain, or suppress immune responses during infection or disease. Communication occurs not only between different types of immune cells, but also between immune cells and nonimmune cells or pathogenic entities. It can occur directly at the cell–cell contact interface, or indirectly through secreted signals that bind cell surface molecules. Though secreted signals can be soluble, they can also be particulate in nature and direct communication at the cell–particle interface. Secreted extracellular vesicles are an example of native particulate communication, while viruses are examples of foreign particulates. Inspired by communication at natural immunological interfaces, biomimetic materials and designer molecules have been developed to mimic and direct the type of immune response. This review describes the ways in which native, biomimetic, and designer materials can mediate immune responses. Examples include extracellular vesicles, particles that mimic immune cells or pathogens, and hybrid designer molecules with multiple signaling functions, engineered to target and bind immune cell surface molecules. Interactions between these materials and immune cells are leading to increased understanding of natural immune communication and function, as well as development of immune therapeutics for the treatment of infection, cancer, and autoimmune disease. PMID:26178262

  5. Immunization and military medicine.

    PubMed

    Benenson, A S

    1984-01-01

    This lecture, a memorial to Joseph E. Smadel, reviews the involvement of the military in the development and use of immunizing materials. Smallpox and smallpox immunization in the military and the development and present status of immunization against typhoid, cholera, yellow fever, typhus, tetanus, diphtheria, plague, influenza, adenovirus, meningitis, rubella, and malaria are reviewed. Dr. Smadel's personal contributions to the significant achievements of the military program to civilian practice are emphasized.

  6. Stories of love and hate: innate immunity and host-microbe crosstalk in the intestine.

    PubMed

    Rosenstiel, Philip

    2013-03-01

    Recent advances in molecular techniques have enabled a deep view into the structure and function of the host's immune system and the stably associated commensal intestinal flora. This review outlines selected aspects of the interplay of innate immune recognition and effectors that shape the ecological niches for the intestinal microbiota. Several studies have demonstrated a pivotal role of innate immune receptor pathways (NOD-like receptors and Toll-like receptors) for the maintenance of microbial communities in the gut. Genetic deficiencies in these pathways have been associated with increased susceptibility to inflammation that in animal models can be transmitted via direct contact or by stool transplantation in the absence of abundant pathogens. The genetic architecture of the human host shapes the diversity and function of its stably associated intestinal microflora. Innate immune receptors such as NOD2 or the inflammasome component NOD-like receptor, pyrin-domain containing 6 play a major role in licensing the microbiota under physiological conditions. Understanding the symbiotic interplay in the intestinal tract should help develop procedures and therapeutic interventions aiming at the identification and restoration of disturbed microbiota states. Indeed, these states may be the missing trigger factor for the manifestation of a multitude of civilization disorders including inflammatory bowel disease and gastrointestinal cancer.

  7. Lipid antigens in immunity

    PubMed Central

    Dowds, C. Marie; Kornell, Sabin-Christin

    2014-01-01

    Lipids are not only a central part of human metabolism but also play diverse and critical roles in the immune system. As such, they can act as ligands of lipid-activated nuclear receptors, control inflammatory signaling through bioactive lipids such as prostaglandins, leukotrienes, lipoxins, resolvins, and protectins, and modulate immunity as intracellular phospholipid- or sphingolipid-derived signaling mediators. In addition, lipids can serve as antigens and regulate immunity through the activation of lipid-reactive T cells, which is the topic of this review. We will provide an overview of the mechanisms of lipid antigen presentation, the biology of lipid-reactive T cells, and their contribution to immunity. PMID:23999493

  8. Innate Immunity in Disease

    PubMed Central

    Elliott, David E.; Siddique, Sana S.; Weinstock, Joel V.

    2014-01-01

    Cells can innately recognize generic products of viruses, bacteria, fungi, or injured tissue by engagement of pattern recognition receptors. Innate immune cells rapidly respond to this engagement in order to control commensals, thwart pathogens and/or prompt repair. Insufficient or excessive activation of the innate immune response results in disease. This review focuses on pattern recognition receptors and cells of the innate immune system important for intestinal function. Our improving knowledge pertaining to this important aspect of our immune response is opening potential important new therapeutic opportunities for the treatment of disease. PMID:24632348

  9. Improving immunization strategies

    NASA Astrophysics Data System (ADS)

    Gallos, Lazaros K.; Liljeros, Fredrik; Argyrakis, Panos; Bunde, Armin; Havlin, Shlomo

    2007-04-01

    We introduce an immunization method where the percentage of required vaccinations for immunity are close to the optimal value of a targeted immunization scheme of highest degree nodes. Our strategy retains the advantage of being purely local, without the need for knowledge on the global network structure or identification of the highest degree nodes. The method consists of selecting a random node and asking for a neighbor that has more links than himself or more than a given threshold and immunizing him. We compare this method to other efficient strategies on three real social networks and on a scale-free network model and find it to be significantly more effective.

  10. Designing Flight Deck Procedures

    NASA Technical Reports Server (NTRS)

    Degani, Asaf; Wiener, Earl

    2005-01-01

    Three reports address the design of flight-deck procedures and various aspects of human interaction with cockpit systems that have direct impact on flight safety. One report, On the Typography of Flight- Deck Documentation, discusses basic research about typography and the kind of information needed by designers of flight deck documentation. Flight crews reading poorly designed documentation may easily overlook a crucial item on the checklist. The report surveys and summarizes the available literature regarding the design and typographical aspects of printed material. It focuses on typographical factors such as proper typefaces, character height, use of lower- and upper-case characters, line length, and spacing. Graphical aspects such as layout, color coding, fonts, and character contrast are discussed; and several cockpit conditions such as lighting levels and glare are addressed, as well as usage factors such as angular alignment, paper quality, and colors. Most of the insights and recommendations discussed in this report are transferable to paperless cockpit systems of the future and computer-based procedure displays (e.g., "electronic flight bag") in aerospace systems and similar systems that are used in other industries such as medical, nuclear systems, maritime operations, and military systems.

  11. [Chronobiology and immunity].

    PubMed

    Kwiatkowski, F; Lévi, F

    2005-06-01

    At all times, cycles have focused men's attention and fashioned his life. Today, thanks to genetic, one can find tracks of circadian rhythms programming until cell's DNA, and this in a very amazing and similar manner from amoebas to mammals. A particular rhythm interests the researcher in oncology: the circadian rhythm of melatonin. It stands at the junction of several domains: somatic, immune and psychic, through the many receptors found on leukocytes, through the links between this hormone production and the one of many cytokines but also with activity, life habits and "stress". On an other hand, antioxydant action of melatonin gives a serious argument concerning its possible role in cancer aetiology. As for them, studies on sleep confirm the large ubiquity of biological cycles, for instance thanks to the observation of the impact of particular genetic mutations on advance or delayed sleep syndrome. Because of the great diversity of cyclic phenomena, the study of chronobiology cannot be undertaken today without a wide interdisciplinary collaboration. During the 13th congress of the "Association Francaise de Chronobiologie Medicale", this study has been continued mainly in three different directions of research: fundamental, applied and transverse. Many original experimental results have been presented and new ways of multidisciplinary research specified. The important scientific fecundity of this very convivial annual congress never lacks to satisfy its participants: it continues to favour the onset of new projects, enabling to avoid major shelves thanks to the constructive criticism of each domain specialists.

  12. Targeted Immune Therapy of Ovarian Cancer

    PubMed Central

    Knutson, Keith L.; Karyampudi, Lavakumar; Lamichhane, Purushottam; Preston, Claudia

    2014-01-01

    Clinical outcomes, such as recurrence free survival and overall survival, in ovarian cancer are quite variable, independent of common characteristics such as stage, response to therapy and grade. This disparity in outcomes warrants further exploration and therapeutic targeting into the interaction between the tumor and host. One compelling host characteristic that contributes both to the initiation and progression of ovarian cancer is the immune system. Hundreds of studies have confirmed a prominent role for the immune system in modifying the clinical course of the disease. Recent studies also show that anti-tumor immunity is often negated by immune regulatory cells present in the tumor microenvironment. Regulatory immune cells also directly enhance the pathogenesis through the release of various cytokines and chemokines, which together form an integrated pathologic network. Thus, in the future, research into immunotherapy targeting ovarian cancer will probably become increasingly focused on combination approaches that simultaneously augment immunity while preventing local immune suppression. In this article, we summarize important immunological targets that influence ovarian cancer outcome as well as include an update on newer immunotherapeutic strategies. PMID:25544369

  13. Immunity and Immunopathology in the Tuberculous Granuloma.

    PubMed

    Pagán, Antonio J; Ramakrishnan, Lalita

    2014-11-06

    Granulomas, organized aggregates of immune cells, are a defining feature of tuberculosis (TB). Granuloma formation is implicated in the pathogenesis of a variety of inflammatory disorders. However, the tuberculous granuloma has been assigned the role of a host protective structure which "walls-off" mycobacteria. Work conducted over the past decade has provided a more nuanced view of its role in pathogenesis. On the one hand, pathogenic mycobacteria accelerate and exploit granuloma formation for their expansion and dissemination by manipulating host immune responses to turn leukocyte recruitment and cell death pathways in their favor. On the other hand, granuloma macrophages can preserve granuloma integrity by exerting a microbicidal immune response, thus preventing an even more rampant expansion of infection in the extracellular milieu. Even this host-beneficial immune response required to maintain the bacteria intracellular must be tempered, as an overly vigorous immune response can also cause granuloma breakdown, thereby directly supporting bacterial growth extracellularly. This review will discuss how mycobacteria manipulate inflammatory responses to drive granuloma formation and will consider the roles of the granuloma in pathogenesis and protective immunity, drawing from clinical studies of TB in humans and from animal models--rodents, zebrafish, and nonhuman primates. A deeper understanding of TB pathogenesis and immunity in the granuloma could suggest therapeutic approaches to abrogate the host-detrimental aspects of granuloma formation to convert it into the host-beneficial structure that it has been thought to be for nearly a century.

  14. Targeted immune therapy of ovarian cancer.

    PubMed

    Knutson, Keith L; Karyampudi, Lavakumar; Lamichhane, Purushottam; Preston, Claudia

    2015-03-01

    Clinical outcomes, such as recurrence-free survival and overall survival, in ovarian cancer are quite variable, independent of common characteristics such as stage, response to therapy, and grade. This disparity in outcomes warrants further exploration and therapeutic targeting into the interaction between the tumor and host. One compelling host characteristic that contributes both to the initiation and progression of ovarian cancer is the immune system. Hundreds of studies have confirmed a prominent role for the immune system in modifying the clinical course of the disease. Recent studies also show that anti-tumor immunity is often negated by immune regulatory cells present in the tumor microenvironment. Regulatory immune cells also directly enhance the pathogenesis through the release of various cytokines and chemokines, which together form an integrated pathological network. Thus, in the future, research into immunotherapy targeting ovarian cancer will probably become increasingly focused on combination approaches that simultaneously augment immunity while preventing local immune suppression. In this article, we summarize important immunological targets that influence ovarian cancer outcome as well as include an update on newer immunotherapeutic strategies.

  15. Natural immunity to rotavirus infection in children.

    PubMed

    Malik, Jyoti; Bhan, Maharaj K; Ray, Pratima

    2008-08-01

    Annual deaths in infants and young children due to rotavirus (RV) infection are around 100,000 in India and about 600,000 globally. Development of a vaccine for this disease is a high priority. The protective mechanisms for RV diarrhea in human are not fully understood, but it is known that children develop natural immunity against RV. Early exposure to RV results in most severe episode of diarrhea and subsequent infections are milder or asymptomatic. Of the immune responses measured during natural infection, RV-specific antibodies have been well documented, whereas data on cellular immunity in humans are sparse. It is generally thought that two outer capsid proteins VP4 and VP7 play a critical role in protective immunity by stimulating production of neutralizing antibodies. While serotype- specific protection mediated by antibodies directed against the outer capsid proteins may be a mechanism of protection, such a correlate for protection has been difficult to demonstrate in humans during clinical trials. Increasing evidences suggest that viral proteins that lack a capacity of eliciting neutralizing antibody response also induce protective immunity. Limited efforts have focused on the role of non-structural proteins in protective immunity. This review describes current understanding of antibody responses in children with focus on responses specific to viral antigens with their possible role in protective immunity. We have also briefly reviewed the responses elicited to non-antibody effectors during RV infection in human subjects.

  16. Oral innate immunity in HIV infection in HAART era.

    PubMed

    Nittayananta, Wipawee; Tao, Renchuan; Jiang, Lanlan; Peng, Yuanyuan; Huang, Yuxiao

    2016-01-01

    Oral innate immunity, an important component in host defense and immune surveillance in the oral cavity, plays a crucial role in the regulation of oral health. As part of the innate immune system, epithelial cells lining oral mucosal surfaces not only provide a physical barrier but also produce different antimicrobial peptides, including human β-defensins (hBDs), secretory leukocyte protease inhibitor (SLPI), and various cytokines. These innate immune mediators help in maintaining oral homeostasis. When they are impaired either by local or systemic causes, various oral infections and malignancies may be developed. Human immunodeficiency virus (HIV) infection and other co-infections appear to have both direct and indirect effects on systemic and local innate immunity leading to the development of oral opportunistic infections and malignancies. Highly active antiretroviral therapy (HAART), the standard treatment of HIV infection, contributed to a global reduction of HIV-associated oral lesions. However, prolonged use of HAART may lead to adverse effects on the oral innate immunity resulting in the relapse of oral lesions. This review article focused on the roles of oral innate immunity in HIV infection in HAART era. The following five key questions were addressed: (i) What are the roles of oral innate immunity in health and disease?, (ii) What are the effects of HIV infection on oral innate immunity?, (iii) What are the roles of oral innate immunity against other co-infections?, (iv) What are the effects of HAART on oral innate immunity?, and (v) Is oral innate immunity enhanced by HAART?

  17. Recombinant Poxvirus and the Tumor Microenvironment: Oncolysis, Immune Regulation and Immunization

    PubMed Central

    Sharp, Daniel W.; Lattime, Edmund C.

    2016-01-01

    Oncolytic viruses (OVs) are being extensively studied for their potential roles in the development of cancer therapy regimens. In addition to their direct lytic effects, OVs can initiate and drive systemic antitumor immunity indirectly via release of tumor antigen, as well as by encoding and delivering immunostimulatory molecules. This combination makes them an effective platform for the development of immunotherapeutic strategies beyond their primary lytic function. Engineering the viruses to also express tumor-associated antigens (TAAs) allows them to simultaneously serve as therapeutic vaccines, targeting and amplifying an immune response to TAAs. Our group and others have shown that vaccinating intratumorally with a poxvirus that encodes TAAs, in addition to immune stimulatory molecules, can modulate the tumor microenvironment, overcome immune inhibitory pathways, and drive both local and systemic tumor specific immune responses. PMID:28191451

  18. Targeting immune checkpoints in malignant glioma

    PubMed Central

    Li, Tete; Liu, Yong-Jun; Chen, Wei; Chen, Jingtao

    2017-01-01

    Malignant glioma is the most common and a highly aggressive cancer in the central nervous system (CNS). Cancer immunotherapy, strategies to boost the bodys anti-cancer immune responses instead of directly targeting tumor cells, recently achieved great success in treating several human solid tumors. Although once considered immune privileged and devoid of normal immunological functions, CNS is now considered a promising target for cancer immunotherapy, featuring the recent progresses in neurobiology and neuroimmunology and a highly immunosuppressive state in malignant glioma. In this review, we focus on immune checkpoint inhibitors, specifically, antagonizing monoclonal antibodies for programmed cell death protein-1 (PD-1), cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4), and indoleamine 2,3-dioxygenase (IDO). We discuss advances in the working mechanisms of these immune checkpoint molecules, their status in malignant glioma, and current preclinical and clinical trials targeting these molecules in malignant glioma. PMID:27756892

  19. [Platelet transfusion role in neonatal immune thrombocytopenia].

    PubMed

    Petermann, R

    2016-11-01

    Neonatal immune thrombocytopenia represent less than 5% of cases of early thrombocytopenia (early-onset<72hours post-delivery). As in adults, thrombocytopenia in neonates is defined as a platelet count less than 150G/L. They are either auto- or allo-immune. Thrombocytopenia resulting from transplacental passage of maternal antibodies directed to platelet membrane glycoproteins can be severe. The major complication of severe thrombocytopenia is bleeding and particularly intra-cranial haemorrhage and neurologic sequelea following. However, auto- and allo-immune thrombocytopenia have very different characteristics including the treatment management. In fact, this treatment is based on platelet transfusion associated or not to intravenous immunoglobulin administration. The purpose of this article is to remind platelet transfusion's place in neonatal immune thrombocytopenia in terms of recently published French guidelines and international practices.

  20. Maternal benefits of immunization during pregnancy.

    PubMed

    Swamy, Geeta K; Beigi, Richard H

    2015-11-25

    The US Centers for Disease Control & Prevention currently recommend routine immunization to prevent 17 vaccine-preventable diseases that occur in infants, children, adolescents, or adults. Pregnant women are at particularly high risk for morbidity and mortality related to several vaccine-preventable diseases. Furthermore, such illnesses are also associated with adverse pregnancy outcomes such as spontaneous abortion, congenital anomalies, preterm birth, and low birthweight. In addition to directly preventing maternal infection, vaccination during pregnancy may offer fetal and infant benefit through passive immunization. Several vaccines aimed at providing passive immunity to neonates are either currently recommended or in development. This article specifically addresses maternal benefits of maternal immunization following (1) vaccines recommended for all pregnant women; (2) vaccines recommended for pregnant women with particular risk factors; and (3) novel vaccines currently under development that primarily aim to at reduce infant morbidity and mortality. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. The Immune System in the Pathogenesis of Ovarian Cancer

    PubMed Central

    Charbonneau, Bridget; Goode, Ellen L.; Kalli, Kimberly R.; Knutson, Keith L.; DeRycke, Melissa S.

    2014-01-01

    Clinical outcomes in ovarian cancer are heterogeneous even when considering common features such as stage, response to therapy, and grade. This disparity in outcomes warrants further exploration into tumor and host characteristics. One compelling host characteristic is the immune response to ovarian cancer. While several studies have confirmed a prominent role for the immune system in modifying the clinical course of the disease, recent genetic and protein analyses also suggest a role in disease incidence. Recent studies also show that anti-tumor immunity is often negated by immune suppressive cells present in the tumor microenvironment. These suppressive immune cells also directly enhance the pathogenesis through the release of various cytokines and chemokines, which together form an integrated pathologic network. Thus, future research into immunotherapy targeting ovarian cancer will likely become increasingly focused on combination approaches that simultaneously augment immunity while preventing local immune suppression or by disrupting critical cytokine networks. PMID:23582060

  2. Immune response to biologic scaffold materials.

    PubMed

    Badylak, Stephen F; Gilbert, Thomas W

    2008-04-01

    Biologic scaffold materials composed of mammalian extracellular matrix are commonly used in regenerative medicine and in surgical procedures for the reconstruction of numerous tissue and organs. These biologic materials are typically allogeneic or xenogeneic in origin and are derived from tissues such as small intestine, urinary bladder, dermis, and pericardium. The innate and acquired host immune response to these biologic materials and the effect of the immune response upon downstream remodeling events has been largely unexplored. Variables that affect the host response include manufacturing processes, the rate of scaffold degradation, and the presence of cross species antigens. This manuscript provides an overview of studies that have evaluated the immune response to biologic scaffold materials and variables that affect this response.

  3. Swine immune system

    USDA-ARS?s Scientific Manuscript database

    Probably no area of veterinary medicine has seen a greater explosion in knowledge then the immune system and its implications in disease and vaccination. In this chapter on the Swine Immune System for the 10th Edition of Diseases of Swine we expand on the information provided in past editions by in...

  4. Immune Dysfunction in Cirrhosis

    PubMed Central

    Noor, Mohd Talha; Manoria, Piyush

    2017-01-01

    Abstract Cirrhosis due to any etiology disrupts the homeostatic role of liver in the body. Cirrhosis-associated immune dysfunction leads to alterations in both innate and acquired immunity, due to defects in the local immunity of liver as well as in systemic immunity. Cirrhosis-associated immune dysfunction is a dynamic phenomenon, comprised of both increased systemic inflammation and immunodeficiency, and is responsible for 30% mortality. It also plays an important role in acute as well as chronic decompensation. Immune paralysis can accompany it, which is characterized by increase in anti-inflammatory cytokines and suppression of proinflammatory cytokines. There is also presence of increased gut permeability, reduced gut motility and altered gut flora, all of which leads to increased bacterial translocation. This increased bacterial translocation and consequent endotoxemia leads to increased blood stream bacterial infections that cause systemic inflammatory response syndrome, sepsis, multiorgan failure and death. The gut microbiota of cirrhotic patients has more pathogenic microbes than that of non-cirrhotic individuals, and this disturbs the homeostasis and favors gut translocation. Prompt diagnosis and treatment of such infections are necessary for better survival. We have reviewed the various mechanisms of immune dysfunction and its consequences in cirrhosis. Recognizing the exact pathophysiology of immune dysfunction will help treating clinicians in avoiding its complications in their patients and can lead to newer therapeutic interventions and reducing the morbidity and mortality rates. PMID:28507927

  5. Immunity and skin cancer

    SciTech Connect

    Smith, E.B.; Brysk, M.M.

    1981-01-01

    Observations in humans and animal studies support the theory that immunologic surveillance plays an important role in limiting the development of skin malignancies. These immune responses undergo progressive diminution with age. In addition, other factors, such as bereavement, poor nutrition, and acute and chronic exposure to ultraviolet light, can further diminish immune mechanisms.

  6. Immune interventions in stroke

    PubMed Central

    Fu, Ying; Liu, Qiang; Anrather, Josef

    2016-01-01

    Inflammatory and immune responses in the brain can shape the clinical presentation and outcome of stroke. Approaches for effective management of acute stroke are sparse and many measures for brain protection fail, but our ability to modulate the immune system and modify the disease progression of multiple sclerosis is increasing. As a result, immune interventions are currently being explored as therapeutic interventions in acute stroke. In this Review, we compare the immunological features of acute stroke with those of multiple sclerosis, identify unique immunological features of stroke, and consider the evidence for immune interventions. In acute stroke, microglia activation and cell death products trigger an inflammatory cascade that damages vessels and the parenchyma within minutes to hours of the ischaemia or haemorrhage. Immune interventions that restrict brain inflammation, vascular permeability and tissue oedema must be administered rapidly to reduce acute immune-mediated destruction and to avoid subsequent immunosuppression. Preliminary results suggest that the use of drugs that modify disease in multiple sclerosis might accomplish these goals in ischaemic and haemorrhagic stroke. Further elucidation of the immune mechanisms involved in stroke is likely to lead to successful immune interventions. PMID:26303850

  7. Coping and Immune Function

    DTIC Science & Technology

    1988-07-01

    immunization, and a single session of inescapable shock. The results are superimposable on thoce shown in Figure 1. The fact that we can obtain our...effect with a single session of shock following a single immunization with KLH makes exploration of factors such as antigen-stress timing much simpler. We

  8. HETEROLOGOUS IMMUNITY BETWEEN VIRUSES

    PubMed Central

    Welsh, Raymond M.; Che, Jenny; Brehm, Michael A.; Selin, Liisa K.

    2010-01-01

    Summary Immune memory responses to previously encountered pathogens can sometimes alter the immune response to and the course of infection of an unrelated pathogen by a process known as heterologous immunity. This response can lead to enhanced or diminished protective immunity and altered immunopathology. Here we discuss the nature of T-cell cross-reactivity and describe matrices of epitopes from different viruses eliciting cross-reactive CD8+ T-cell responses. We examine the parameters of heterologous immunity mediated by these cross-reactive T cells during viral infections in mice and humans. We show that heterologous immunity can disrupt T-cell memory pools, alter the complexity of the T-cell repertoire, change patterns of T-cell immunodominance, lead to the selection of viral epitope-escape variants, alter the pathogenesis of viral infections, and, by virtue of the private specificity of T-cell repertoires within individuals, contribute to dramatic variations in viral disease. We propose that heterologous immunity is an important factor in resistance to and variations of human viral infections and that issues of heterologous immunity should be considered in the design of vaccines. PMID:20536568

  9. The genetics of immunity.

    PubMed

    Lazzaro, Brian P; Schneider, David S

    2014-06-17

    In this commentary, Brian P. Lazzaro and David S. Schneider examine the topic of the Genetics of Immunity as explored in this month's issues of GENETICS and G3: Genes|Genomes|Genetics. These inaugural articles are part of a joint Genetics of Immunity collection (ongoing) in the GSA journals.

  10. Innate immunity and adjuvants

    PubMed Central

    Akira, Shizuo

    2011-01-01

    Innate immunity was for a long time considered to be non-specific because the major function of this system is to digest pathogens and present antigens to the cells involved in acquired immunity. However, recent studies have shown that innate immunity is not non-specific, but is instead sufficiently specific to discriminate self from pathogens through evolutionarily conserved receptors, designated Toll-like receptors (TLRs). Indeed, innate immunity has a crucial role in early host defence against invading pathogens. Furthermore, TLRs were found to act as adjuvant receptors that create a bridge between innate and adaptive immunity, and to have important roles in the induction of adaptive immunity. This paradigm shift is now changing our thinking on the pathogenesis and treatment of infectious, immune and allergic diseases, as well as cancers. Besides TLRs, recent findings have revealed the presence of a cytosolic detector system for invading pathogens. I will review the mechanisms of pathogen recognition by TLRs and cytoplasmic receptors, and then discuss the roles of these receptors in the development of adaptive immunity in response to viral infection. PMID:21893536

  11. Innate immunity and adjuvants.

    PubMed

    Akira, Shizuo

    2011-10-12

    Innate immunity was for a long time considered to be non-specific because the major function of this system is to digest pathogens and present antigens to the cells involved in acquired immunity. However, recent studies have shown that innate immunity is not non-specific, but is instead sufficiently specific to discriminate self from pathogens through evolutionarily conserved receptors, designated Toll-like receptors (TLRs). Indeed, innate immunity has a crucial role in early host defence against invading pathogens. Furthermore, TLRs were found to act as adjuvant receptors that create a bridge between innate and adaptive immunity, and to have important roles in the induction of adaptive immunity. This paradigm shift is now changing our thinking on the pathogenesis and treatment of infectious, immune and allergic diseases, as well as cancers. Besides TLRs, recent findings have revealed the presence of a cytosolic detector system for invading pathogens. I will review the mechanisms of pathogen recognition by TLRs and cytoplasmic receptors, and then discuss the roles of these receptors in the development of adaptive immunity in response to viral infection.

  12. Immunity and Nutrition.

    ERIC Educational Resources Information Center

    Dupin, Henri; Guerin, Nicole

    1990-01-01

    The three articles in this issue of a periodical focussed on various aspects of the life and health of children in the tropics concern: (1) immune defenses; (2) interactions between nutrition disorders and infection; and (3) immunity and vaccination. The science of immunology has progressed rapidly in recent years. A brief review of present…

  13. Immunity and Nutrition.

    ERIC Educational Resources Information Center

    Dupin, Henri; Guerin, Nicole

    1990-01-01

    The three articles in this issue of a periodical focussed on various aspects of the life and health of children in the tropics concern: (1) immune defenses; (2) interactions between nutrition disorders and infection; and (3) immunity and vaccination. The science of immunology has progressed rapidly in recent years. A brief review of present…

  14. Immunizations. Position Statement. Revised

    ERIC Educational Resources Information Center

    Bobo, Nichole; Garrett, Jennifer; Teskey, Carmen; Duncan, Kay; Strasser, Kathy; Burrows-Mezu, Alicia L.

    2015-01-01

    It is the position of the National Association of School Nurses (NASN) that immunizations are essential to primary prevention of disease from infancy through adulthood. Promotion of immunizations by the registered professional school nurse (hereinafter referred to as school nurse) is central to the public health focus of school nursing practice…

  15. Nutrition and immunity in ruminants

    USDA-ARS?s Scientific Manuscript database

    The immune system can be generally separated into three broad components; natural immunity, innate immunity, and acquired immunity, all of which must be fully developed and functioning properly to provide adequate immunological protection. Natural and innate immunity are typically grouped together u...

  16. Diagnostic procedures in immunodermatology.

    PubMed

    Cormane, R H; Asghar, S S

    1976-07-01

    Most immunologic diseases are caused by the derailment of the humoral or cellular pathways of the immunologic defense system. This derailment results from numerous factors such as the inability of the patient to remove the pathogen; the consumption, defect, or deficiency in any component of these pathways, and the overproduction of any of the components. To diagnose these immunologic disorders one has to detect the pathogen and the reactions caused by it and to determine the cause of its nonclearance. The immunofluorescence techniques has been invaluable in detecting both the antigen that causes the disease and the reactions initiated by the antigen, such as the production of antibodies and the activation of the complement system. The immunoperoxidase technique has also been used for these purposes in certain instances. For detecting the circulating immune complexes which occur as intermediates in the chain of reactions initiated by the antigen, various physiochemical and biologic techniques have been used. However, none of these tests seems to be totally reliable for determining whether circulating immune complexes are present. The consumption of complement was detected by hemolytic estimations and radial immunodiffusion or rocket electrphoresis. These techniques were also useful in detecting the hereditary deficiencies in immunoglobulins and components of classical and alternative pathways of complement activation. Since these techniques cannot be used to estimate IgE, the radioallergosorbent test was used to measure such levels in the atopic patients. Cellular hypersensitivity was detected with skin tests together with methods which assess the ability of lymphocytes to produce mediators in response to antigen. Many of these mediator assays, however, are not suitable for this purpose. A satisfactory substitute appears to be to determine the factor in antigen-stimulated, lymphocyte culture supernatants which activates macrophages to take up radiolabeled colloidal

  17. Interactions between mesenchymal stem cells and the immune system.

    PubMed

    Li, Na; Hua, Jinlian

    2017-02-18

    In addition to being multi-potent, mesenchymal stem cells (MSCs) possess immunomodulatory functions that have been investigated as potential treatments in various immune disorders. MSCs can robustly interact with cells of the innate and adaptive immune systems, either through direct cell-cell contact or through their secretome. In this review, we discuss current findings regarding the interplay between MSCs and different immune cell subsets. We also draw attention to the mechanisms involved.

  18. Cytokines in Drosophila immunity.

    PubMed

    Vanha-Aho, Leena-Maija; Valanne, Susanna; Rämet, Mika

    2016-02-01

    Cytokines are a large and diverse group of small proteins that can affect many biological processes, but most commonly cytokines are known as mediators of the immune response. In the event of an infection, cytokines are produced in response to an immune stimulus, and they function as key regulators of the immune response. Cytokines come in many shapes and sizes, and although they vary greatly in structure, their functions have been well conserved in evolution. The immune signaling pathways that respond to cytokines are remarkably conserved from fly to man. Therefore, Drosophila melanogaster, provides an excellent platform for studying the biology and function of cytokines. In this review, we will describe the cytokines and cytokine-like molecules found in the fly and discuss their roles in host immunity. Copyright © 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  19. Pertussis immunization: an update

    PubMed Central

    Morgan, Lon G

    1997-01-01

    A segment of chiropractic has historically opposed the practice of immunization. This opposition has been based on historical and philosophical precedent, but with little support from the scientific literature. Pertussis immunization has successfully controlled a disease with a prior history of high childhood morbidity. An evaluation of the literature fails to find supporting evidence that whole-cell pertussis vaccine causes SIDS, asthma, or encephalopathy. Countries who discontinued pertussis immunization experienced a return of the disease, and in every case pertussis immunization has been reinstated. The recent successful clinical trials and subsequent approval of an acellular pertussis vaccine should reduce the local reactions and discomfort sometimes experienced with the whole-cell product. In view of the considerable scientific evidence for the desirability and efficacy of pertussis immunization, chiropractic should encourage patient participation in this worthwhile public health service.

  20. Neural circuitry and immunity

    PubMed Central

    Pavlov, Valentin A.; Tracey, Kevin J.

    2015-01-01

    Research during the last decade has significantly advanced our understanding of the molecular mechanisms at the interface between the nervous system and the immune system. Insight into bidirectional neuroimmune communication has characterized the nervous system as an important partner of the immune system in the regulation of inflammation. Neuronal pathways, including the vagus nerve-based inflammatory reflex are physiological regulators of immune function and inflammation. In parallel, neuronal function is altered in conditions characterized by immune dysregulation and inflammation. Here, we review these regulatory mechanisms and describe the neural circuitry modulating immunity. Understanding these mechanisms reveals possibilities to use targeted neuromodulation as a therapeutic approach for inflammatory and autoimmune disorders. These findings and current clinical exploration of neuromodulation in the treatment of inflammatory diseases defines the emerging field of Bioelectronic Medicine. PMID:26512000