Science.gov

Sample records for immunization procedures directed

  1. 26 CFR 301.7507-8 - Procedure during immunity.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 18 2013-04-01 2013-04-01 false Procedure during immunity. 301.7507-8 Section... States § 301.7507-8 Procedure during immunity. (a) Statements to be filed. As long as complete or partial immunity is claimed, a bank within section 7507(b) shall file with each income tax return a statement...

  2. 26 CFR 301.7507-8 - Procedure during immunity.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 18 2014-04-01 2014-04-01 false Procedure during immunity. 301.7507-8 Section... States § 301.7507-8 Procedure during immunity. (a) Statements to be filed. As long as complete or partial immunity is claimed, a bank within section 7507(b) shall file with each income tax return a statement...

  3. 26 CFR 301.7507-8 - Procedure during immunity.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 18 2011-04-01 2011-04-01 false Procedure during immunity. 301.7507-8 Section... States § 301.7507-8 Procedure during immunity. (a) Statements to be filed. As long as complete or partial immunity is claimed, a bank within section 7507(b) shall file with each income tax return a statement...

  4. 26 CFR 301.7507-8 - Procedure during immunity.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 18 2012-04-01 2012-04-01 false Procedure during immunity. 301.7507-8 Section... States § 301.7507-8 Procedure during immunity. (a) Statements to be filed. As long as complete or partial immunity is claimed, a bank within section 7507(b) shall file with each income tax return a statement...

  5. 26 CFR 301.7507-8 - Procedure during immunity.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... director may require. Whether or not additional statements shall be required, and the frequency thereof... States § 301.7507-8 Procedure during immunity. (a) Statements to be filed. As long as complete or partial immunity is claimed, a bank within section 7507(b) shall file with each income tax return a statement...

  6. Deriving directions through procedural task analysis.

    PubMed

    Yuen, H K; D'Amico, M

    1998-01-01

    Task analysis is one of the essential components of activity analysis. Procedural task analysis involves breaking down an activity into a sequence of steps. Directions are the sequence of steps resulting from the task analysis (i.e., the product of the task analysis). Directions become a guide for caregivers or trainers use in teaching clients a specific skill. However, occupational therapy students often have difficulty in writing directions that are clear enough for caregivers or trainers to carry out. Books on activity analysis only provide examples of directions without giving guidelines on how to perform the writing process. The purposes of this paper are to describe the process of procedural task analysis and to provide a guideline for writing steps of directions.

  7. 78 FR 18285 - Direct Final Rulemaking Procedures

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-26

    ... amendments that become effective a number of days (specified in the rule) after the date of publication of... direct final rule procedures for complex or controversial issues. ] DATES: Written comments must be... Docket ID number NHTSA-2013-0042 at any time. Follow the online instructions for submitting comments....

  8. 75 FR 29915 - Direct Final Rulemaking Procedures

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-28

    ... specified number of days after the date of publication in the Federal Register, unless FMCSA receives... proposed and final rules. FMCSA will not use the direct final rule procedures for complex or controversial...://www.regulations.gov by searching Docket ID number FMCSA 2009-0354 at any time or to the ground...

  9. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2008-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation. This may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) from prolonged immune dysregulation during exploration-class space flight has not yet been determined, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. Each of the clinical events resulting from immune dysfunction has the potential to impact mission critical objectives during exploration-class missions. To date, precious little in-flight immune data has been generated to assess this phenomenon. The majority of recent flight immune studies have been post-flight assessments, which may not accurately reflect the in-flight status of immunity as it resolves over prolonged flight. There are no procedures currently in place to monitor immune function or its effect on crew health. The objective of this Supplemental Medical Objective (SMO) is to develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. This SMO will assess immunity, latent viral reactivation and physiological stress during both short and long duration flights. Upon completion, it is expected that any clinical risks resulting from the adverse effects of space flight on the human immune system will have been determined. In addition, a flight-compatible immune monitoring strategy will have been developed with which countermeasures validation could be performed. This study will determine, to the best level allowed by current technology, the in-flight status of crewmembers' immune systems. The in-flight samples will allow a distinction between legitimate in-flight alterations and the physiological stresses of landing and readaptation which are believed to alter R+0 assessments. The overall status of the immune system during flight

  10. Validation of Procedures for Monitoring Crewmember Immune Function SDBI-1900, SMO-015 - Integrated Immune

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Nehlsen-Cannarella, Sandra; Morukov, Boris; Pierson, Duane; Sams, Clarence

    2007-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation. This may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk from prolonged immune dysregulation during space flight are not yet determined, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. Each of the clinical events resulting from immune dysfunction has the potential to impact mission critical objectives during exploration-class missions. To date, precious little in-flight immune data has been generated to assess this phenomenon. The majority of recent flight immune studies have been post-flight assessments, which may not accurately reflect the in-flight condition. There are no procedures currently in place to monitor immune function or its effect on crew health. The objective of this Supplemental Medical Objective (SMO) is to develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. This SMO will assess the clinical risks resulting from the adverse effects of space flight on the human immune system and will validate a flight-compatible immune monitoring strategy. Characterization of the clinical risk and the development of a monitoring strategy are necessary prerequisite activities prior to validating countermeasures. This study will determine, to the best level allowed by current technology, the in-flight status of crewmembers immune system. Pre-flight, in-flight and post-flight assessments of immune status, immune function, viral reactivation and physiological stress will be performed. The in-flight samples will allow a distinction between legitimate in-flight alterations and the physiological stresses of landing and readaptation which are believed to alter landing day assessments. The overall status of the immune system during flight (activation

  11. 49 CFR 389.39 - Direct final rulemaking procedures

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... PROCEDURES-FEDERAL MOTOR CARRIER SAFETY REGULATIONS Procedures for Adoption of Rules § 389.39 Direct final... change should be made to the rule. Under the direct final rule process, FMCSA does not consider...

  12. Immune adjuvants as critical guides directing immunity triggered by therapeutic cancer vaccines.

    PubMed

    Schijns, Virgil; Tartour, Eric; Michalek, Jaroslav; Stathopoulos, Apostolos; Dobrovolskienė, Neringa T; Strioga, Marius M

    2014-04-01

    Tumor growth is controlled by natural antitumor immune responses alone or by augmented immune reactivity resulting from different forms of immunotherapy, which has demonstrated clinical benefit in numerous studies, although the overall percentage of patients with durable clinical responses remains limited. This is attributed to the heterogeneity of the disease, the inclusion of late-stage patients with no other treatment options and advanced tumor-associated immunosuppression, which may be consolidated by certain types of chemotherapy. Despite variable responsiveness to distinct types of immunotherapy, therapeutic cancer vaccination has shown meaningful efficacy for a variety of cancers. A key step during cancer vaccination involves the appropriate modeling of the functional state of dendritic cells (DCs) capable of co-delivering four critical signals for proper instruction of tumor antigen-specific T cells. However, the education of DCs, either directly in situ, or ex vivo by various complex procedures, lacks standardization. Also, it is questioned whether ex vivo-prepared DC vaccines are superior to in situ-administered adjuvant-guided vaccines, although both approaches have shown success. Evaluation of these variables is further complicated by a lack of consensus in evaluating vaccination clinical study end points. We discuss the role of signals needed for the preparation of classic in situ and modern ex vivo DC vaccines capable of proper reprogramming of antitumor immune responses in patients with cancer.

  13. 49 CFR 389.39 - Direct final rulemaking procedures

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... PROCEDURES-FEDERAL MOTOR CARRIER SAFETY REGULATIONS Procedures for Adoption of Rules § 389.39 Direct final rulemaking procedures A direct final rule makes regulatory changes and states that those changes will take... adverse comment by the date specified in the direct final rule published in the Federal Register....

  14. 19 CFR 146.39 - Direct delivery procedures.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 19 Customs Duties 2 2011-04-01 2011-04-01 false Direct delivery procedures. 146.39 Section 146.39... TREASURY (CONTINUED) FOREIGN TRADE ZONES Admission of Merchandise to a Zone § 146.39 Direct delivery procedures. (a) General. This procedure is for delivery of merchandise to a zone without prior...

  15. 19 CFR 146.39 - Direct delivery procedures.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Direct delivery procedures. 146.39 Section 146.39... TREASURY (CONTINUED) FOREIGN TRADE ZONES Admission of Merchandise to a Zone § 146.39 Direct delivery procedures. (a) General. This procedure is for delivery of merchandise to a zone without prior...

  16. 24 CFR 291.210 - Direct sales procedures.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Direct sales procedures. 291.210... URBAN DEVELOPMENT HUD-OWNED PROPERTIES DISPOSITION OF HUD-ACQUIRED SINGLE FAMILY PROPERTY Sales Procedures § 291.210 Direct sales procedures. When HUD conducts the sales listed in § 291.90(c), it will...

  17. 75 FR 12720 - Direct Final Rulemaking Procedures

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-17

    ... that would become effective a specified number of days after the date of publication in the Federal... final rule procedures for complex or controversial issues. DATES: You must submit comments on or before... Number in the heading of this document by any of the following methods. Do not submit the same...

  18. Validation of Procedures for Monitoring Crewmember Immune Function - Short Duration Biological Investigation

    NASA Technical Reports Server (NTRS)

    Sams, Clarence; Crucian, Brian; Stowe, Raymond; Pierson, Duane; Mehta, Satish; Morukov, Boris; Uchakin, Peter; Nehlsen-Cannarella, Sandra

    2008-01-01

    Validation of Procedures for Monitoring Crew Member Immune Function - Short Duration Biological Investigation (Integrated Immune-SDBI) will assess the clinical risks resulting from the adverse effects of space flight on the human immune system and will validate a flightcompatible immune monitoring strategy. Immune system changes will be monitored by collecting and analyzing blood, urine and saliva samples from crewmembers before, during and after space flight.

  19. Procedures for mucosal immunization and analyses of cellular immune response to candidate HIV vaccines in murine and nonhuman primate models.

    PubMed

    Singh, Shailbala; Nehete, Pramod; Hanley, Patrick; Nehete, Bharti; Yang, Guojun; He, Hong; Anthony, Scott M; Schluns, Kimberly S; Sastry, K Jagannadha

    2014-01-01

    Sampling the mucosal tissues and analyses of immune responses are integral to vaccine-development strategies against human immunodeficiency virus (HIV), which is transmitted predominantly across the oro-genital mucosa. While immune assay development and standardization attempts employ mouse models, immunogenicity and protective efficacy that can be extrapolated to humans are realized only from experiments in nonhuman primates. Here, we describe commonly used practices for immunizations in rhesus macaques (Macaca mulatta) along with procedures for obtaining important mucosal tissues samples from macaques and mice. We also describe detailed protocols for two important assays applicable in mouse as well as primate experiments for determining antigen-specific T cells responses induced after vaccination.

  20. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Pierson, Duane; Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Sams, Clarence

    2010-01-01

    The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles, viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. To date, 18 short duration (now completed) and 8 long-duration crewmembers have completed the study. The long-duration phase of this study is ongoing. For this presentation, the final data set for the short duration subjects will be discussed.

  1. Validation of Procedures for Monitoring Crewmember Immune Function

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2009-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation, however the nature of the phenomenon as it equilibrates over longer flights has not been determined. This dysregulation may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) for exploration-class space flight is unknown, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles (RNA, intracellular, secreted), viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. This study is currently ongoing. To date, 10 short duration and 5 long-duration crewmembers have completed the study. Technically, the study is progressing well. In-flight blood samples are being collected, and returned for analysis, including functional assays that require live cells. For all in-flight samples to date, sample viability has been acceptable. Preliminary data (n = 4/7; long/short duration, respectively) indicate that distribution of most peripheral leukocyte subsets is largely unaltered during flight. Exceptions include elevated T cells, reduced B/NK cells, increased memory T cells and increased central memory CD8+ T cells. General T cell function, early blastogenesis response to mitogenic stimulation, is markedly

  2. Direct and Electronic Health Record Access to the Clinical Decision Support for Immunizations in the Minnesota Immunization Information System

    PubMed Central

    Rajamani, Sripriya; Bieringer, Aaron; Wallerius, Stephanie; Jensen, Daniel; Winden, Tamara; Muscoplat, Miriam Halstead

    2016-01-01

    Immunization information systems (IIS) are population-based and confidential computerized systems maintained by public health agencies containing individual data on immunizations from participating health care providers. IIS hold comprehensive vaccination histories given across providers and over time. An important aspect to IIS is the clinical decision support for immunizations (CDSi), consisting of vaccine forecasting algorithms to determine needed immunizations. The study objective was to analyze the CDSi presentation by IIS in Minnesota (Minnesota Immunization Information Connection [MIIC]) through direct access by IIS interface and by access through electronic health records (EHRs) to outline similarities and differences. The immunization data presented were similar across the three systems examined, but with varying ability to integrate data across MIIC and EHR, which impacts immunization data reconciliation. Study findings will lead to better understanding of immunization data display, clinical decision support, and user functionalities with the ultimate goal of promoting IIS CDSi to improve vaccination rates. PMID:28050128

  3. Cellular Immune Responses in Guinea Pigs Immunized with Cell Walls of Histoplasma capsulatum Prepared by Several Different Procedures

    PubMed Central

    Domer, Judith E.; Ichinose, H.

    1977-01-01

    Since guinea pigs immunized with water-washed cell walls of Histoplasma capsulatum developed cellular immune responses detectable with cytoplasmic substances, attempts were made to determine whether cytoplasmic contamination of the walls was responsible for the induction of the immune response. Cell walls were treated by several procedures designed to remove possible contamination, namely, extraction with lipid solvents, incubation with proteolytic enzymes, and washing with sodium dodecyl sulfate, and each of the treated preparations was compared with water-washed walls for its ability to induce cellular responses demonstrable with cytoplasmic substances. For comparison, wall glycoprotein was also used as a test antigen. Immune responses were assessed by gross and histological examinations of skin test sites and by assays for the production of migration inhibition factor. A portion of the material inducing the response detectable with cytoplasmic substances was apparently removed or altered by each of the purifying procedures. The cellular immune responses to wall glycoprotein were also altered, however, indicating that more than the mere removal of cytoplasmic substances had occurred. On the basis of the data collected from each of the cellular assays involving wall glycoprotein as the test antigen, the hypothesis is proposed that sodium dodecyl sulfate altered or removed protein from the wall and thus augmented its ability to induce a more intense immediate-type hypersensitivity, whereas incubation with Pronase altered the walls in such a way as to shift the balance toward a more intense delayed-type hypersensitivity. The latter effect was probably due to the removal of carbohydrate from the wall by glucanase or to mannosidase contaminating the Pronase preparation. Images PMID:326673

  4. Future directions in bladder cancer immunotherapy: towards adaptive immunity.

    PubMed

    Smith, Sean G; Zaharoff, David A

    2016-01-01

    The clinical management of bladder cancer has not changed significantly in several decades. In particular, intravesical bacillus Calmette-Guérin (BCG) immunotherapy has been a mainstay for high-risk nonmuscle invasive bladder cancer since the late 1970s/early 1980s. This is despite the fact that bladder cancer has the highest recurrence rates of any cancer and BCG immunotherapy has not been shown to induce a tumor-specific immune response. We and others have hypothesized that immunotherapies capable of inducing tumor-specific adaptive immunity are needed to impact bladder cancer morbidity and mortality. This article summarizes the preclinical and clinical development of bladder cancer immunotherapies with an emphasis on the last 5 years. Expected progress in the near future is also discussed.

  5. Anodal transcranial direct current stimulation enhances procedural consolidation.

    PubMed

    Tecchio, Franca; Zappasodi, Filippo; Assenza, Giovanni; Tombini, Mario; Vollaro, Stefano; Barbati, Giulia; Rossini, Paolo Maria

    2010-08-01

    The primary motor cortex (M1) area recruitment enlarges while learning a finger tapping sequence. Also M1 excitability increases during procedural consolidation. Our aim was to investigate whether increasing M1 excitability by anodal transcranial DC stimulation (AtDCS) when procedural consolidation occurs was able to induce an early consolidation improvement. Forty-seven right-handed healthy participants were trained in a nine-element serial finger tapping task (SFTT) executed with the left hand. Random series blocks were interspersed with training series blocks. Anodal or sham tDCS was administered over the right M1 after the end of the training session. After stimulation, the motor skills of both trained and a new untrained sequential series blocks were tested again. For each block, performance was estimated as the median execution time of correct series. Early consolidation of the trained series, assessed by the performance difference between the first block after and the last block before stimulation normalized by the random, was enhanced by anodal and not by sham tDCS. Stimulation did not affect random series execution. No stimulation effect was found on the on-line learning of the trained and new untrained series. Our results suggest that AtDCS applied on M1 soon after training improves early consolidation of procedural learning. Our data highlight the importance of neuromodulation procedures for understanding learning processes and support their use in the motor rehabilitation setting, focusing on the timing of the application.

  6. A design procedure and handling quality criteria for lateral directional flight control systems

    NASA Technical Reports Server (NTRS)

    Stein, G.; Henke, A. H.

    1972-01-01

    A practical design procedure for aircraft augmentation systems is described based on quadratic optimal control technology and handling-quality-oriented cost functionals. The procedure is applied to the design of a lateral-directional control system for the F4C aircraft. The design criteria, design procedure, and final control system are validated with a program of formal pilot evaluation experiments.

  7. The Procedurally Directive Approach to Teaching Controversial Issues

    ERIC Educational Resources Information Center

    Gregory, Maughn Rollins

    2014-01-01

    Recent articles on teaching controversial topics in schools have employed Michael Hand's distinction between "directive teaching," in which teachers attempt to persuade students of correct positions on topics that are not rationally controversial, and "nondirective teaching," in which teachers avoid persuading students on…

  8. 10 CFR 35.2041 - Records for procedures for administrations requiring a written directive

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 1 2014-01-01 2014-01-01 false Records for procedures for administrations requiring a written directive 35.2041 Section 35.2041 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL Records § 35.2041 Records for procedures for administrations requiring a written directive...

  9. 10 CFR 35.2041 - Records for procedures for administrations requiring a written directive

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Records for procedures for administrations requiring a written directive 35.2041 Section 35.2041 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL Records § 35.2041 Records for procedures for administrations requiring a written directive...

  10. 10 CFR 35.2041 - Records for procedures for administrations requiring a written directive

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 1 2012-01-01 2012-01-01 false Records for procedures for administrations requiring a written directive 35.2041 Section 35.2041 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL Records § 35.2041 Records for procedures for administrations requiring a written directive...

  11. MEMS reagent and sample handling procedure: Feasibility of viral antibody detection by passive immune agglutination

    NASA Technical Reports Server (NTRS)

    Bailey, G. D.; Tenoso, H. J.

    1975-01-01

    An attempt was made to develop a test requiring no preadsorption steps for the assessment of antibodies to rubella and mumps viruses using the passive immune agglutination (PIA) method. Both rubella and mumps antigens and antibodies were prepared. Direct PIA tests, using rubella antigen-coated beads, and indirect PIA tests, using rubella antibody-coated beads, were investigated. Attempts, using either method, were unsuccessful. Serum interference along with nonspecific agglutination of beads by the rubella antigen resulted in no specific response under the test conditions investigated. A new, highly sensitive approach, the enzyme immunoassay (EIA) test system, is recommended to overcome the nonspecificity. This system is a logical outgrowth of some of the solid phase work done on MEMS and represents the next generation tests system that can be directly applied to early disease detection and monitoring.

  12. Procedure for Adapting Direct Simulation Monte Carlo Meshes

    NASA Technical Reports Server (NTRS)

    Woronowicz, Michael S.; Wilmoth, Richard G.; Carlson, Ann B.; Rault, Didier F. G.

    1992-01-01

    A technique is presented for adapting computational meshes used in the G2 version of the direct simulation Monte Carlo method. The physical ideas underlying the technique are discussed, and adaptation formulas are developed for use on solutions generated from an initial mesh. The effect of statistical scatter on adaptation is addressed, and results demonstrate the ability of this technique to achieve more accurate results without increasing necessary computational resources.

  13. Minimally Invasive Procedures - Direct and Video-Assisted Forms in the Treatment of Heart Diseases

    PubMed Central

    Castro, Josué Viana; Melo, Emanuel Carvalho; Silva, Juliana Fernandes; Rebouças, Leonardo Lemos; Corrêa, Larissa Chagas; Germano, Amanda de Queiroz; Machado, João José Aquino

    2014-01-01

    Background Minimally invasive cardiovascular procedures have been progressively used in heart surgery. Objective To describe the techniques and immediate results of minimally invasive procedures in 5 years. Methods Prospective and descriptive study in which 102 patients were submitted to minimally invasive procedures in direct and video-assisted forms. Clinical and surgical variables were evaluated as well as the in hospital follow-up of the patients. Results Fourteen patients were operated through the direct form and 88 through the video-assisted form. Between minimally invasive procedures in direct form, 13 had aortic valve disease. Between minimally invasive procedures in video-assisted forms, 43 had mitral valve disease, 41 atrial septal defect and four tumors. In relation to mitral valve disease, we replaced 26 and reconstructed 17 valves. Aortic clamp, extracorporeal and procedure times were, respectively, 91,6 ± 21,8, 112,7 ± 27,9 e 247,1 ± 20,3 minutes in minimally invasive procedures in direct form. Between minimally invasive procedures in video-assisted forms, 71,6 ± 29, 99,7 ± 32,6 e 226,1 ± 42,7 minutes. Considering intensive care and hospitalization times, these were 41,1 ± 14,7 hours and 4,6 ± 2 days in minimally invasive procedures in direct and 36,8 ± 16,3 hours and 4,3 ± 1,9 days in minimally invasive procedures in video-assisted forms procedures. Conclusion Minimally invasive procedures were used in two forms - direct and video-assisted - with safety in the surgical treatment of video-assisted, atrial septal defect and tumors of the heart. These procedures seem to result in longer surgical variables. However, hospital recuperation was faster, independent of the access or pathology. PMID:24553983

  14. Using Video Modeling with Voiceover Instruction Plus Feedback to Train Staff to Implement Direct Teaching Procedures.

    PubMed

    Giannakakos, Antonia R; Vladescu, Jason C; Kisamore, April N; Reeve, Sharon A

    2016-06-01

    Direct teaching procedures are often an important part of early intensive behavioral intervention for consumers with autism spectrum disorder. In the present study, a video model with voiceover (VMVO) instruction plus feedback was evaluated to train three staff trainees to implement a most-to-least direct (MTL) teaching procedure. Probes for generalization were conducted with untrained direct teaching procedures (i.e., least-to-most, prompt delay) and with an actual consumer. The results indicated that VMVO plus feedback was effective in training the staff trainees to implement the MTL procedure. Although additional feedback was required for the staff trainees to show mastery of the untrained direct teaching procedures (i.e., least-to-most and prompt delay) and with an actual consumer, moderate to high levels of generalization were observed.

  15. The innate immune protein Nod2 binds directly to MDP, a bacterial cell wall fragment.

    PubMed

    Grimes, Catherine Leimkuhler; Ariyananda, Lushanti De Zoysa; Melnyk, James E; O'Shea, Erin K

    2012-08-22

    Mammalian Nod2 is an intracellular protein that is implicated in the innate immune response to the bacterial cell wall and is associated with the development of Crohn's disease, Blau syndrome, and gastrointestinal cancers. Nod2 is required for an immune response to muramyl dipeptide (MDP), an immunostimulatory fragment of bacterial cell wall, but it is not known whether MDP binds directly to Nod2. We report the expression and purification of human Nod2 from insect cells. Using novel MDP self-assembled monolayers (SAMs), we provide the first biochemical evidence for a direct, high-affinity interaction between Nod2 and MDP.

  16. Immunizations

    MedlinePlus

    ... Get Weight Loss Surgery? A Week of Healthy Breakfasts Shyness Immunizations KidsHealth > For Teens > Immunizations Print A A A What's in this article? Why Are Vaccinations Important? Why Do I Need Shots? Which Vaccinations Do ...

  17. 76 FR 63211 - Energy Efficiency Program: Test Procedures for Residential Water Heaters, Direct Heating...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-12

    ... Heating Equipment, and Pool Heaters AGENCY: Office of Energy Efficiency and Renewable Energy, Department... amendments to DOE's test procedures for residential water heaters, direct heating equipment, and pool heaters... heating equipment test procedures as applied to vented hearth heaters, and coverage of electric...

  18. Immunization

    MedlinePlus

    ... remembers" the germ and can fight it again. Vaccines contain germs that have been killed or weakened. When given to a healthy person, the vaccine triggers the immune system to respond and thus ...

  19. Technical note: A procedure to estimate glucose requirements of an activated immune system in steers.

    PubMed

    Kvidera, S K; Horst, E A; Abuajamieh, M; Mayorga, E J; Sanz Fernandez, M V; Baumgard, L H

    2016-11-01

    Infection and inflammation impede efficient animal productivity. The activated immune system ostensibly requires large amounts of energy and nutrients otherwise destined for synthesis of agriculturally relevant products. Accurately determining the immune system's in vivo energy needs is difficult, but a better understanding may facilitate developing nutritional strategies to maximize productivity. The study objective was to estimate immune system glucose requirements following an i.v. lipopolysaccharide (LPS) challenge. Holstein steers (148 ± 9 kg; = 15) were jugular catheterized bilaterally and assigned to 1 of 3 i.v.

  20. Cytoplasmic Actin Is an Extracellular Insect Immune Factor which Is Secreted upon Immune Challenge and Mediates Phagocytosis and Direct Killing of Bacteria, and Is a Plasmodium Antagonist

    PubMed Central

    Sandiford, Simone L.; Dong, Yuemei; Pike, Andrew; Blumberg, Benjamin J.; Bahia, Ana C.; Dimopoulos, George

    2015-01-01

    Actin is a highly versatile, abundant, and conserved protein, with functions in a variety of intracellular processes. Here, we describe a novel role for insect cytoplasmic actin as an extracellular pathogen recognition factor that mediates antibacterial defense. Insect actins are secreted from cells upon immune challenge through an exosome-independent pathway. Anopheles gambiae actin interacts with the extracellular MD2-like immune factor AgMDL1, and binds to the surfaces of bacteria, mediating their phagocytosis and direct killing. Globular and filamentous actins display distinct functions as extracellular immune factors, and mosquito actin is a Plasmodium infection antagonist. PMID:25658622

  1. Immune-Directed Support of Rich Microbial Communities in the Gut Has Ancient Roots

    PubMed Central

    Dishaw, Larry J.; Cannon, John P.; Litman, Gary W.; Parker, William

    2014-01-01

    The animal gut serves as a primary location for the complex host-microbe interplay that is essential for homeostasis and may also reflect the types of ancient selective pressures that spawned the emergence of immunity in metazoans. In this review, we present a phylogenetic survey of gut host-microbe interactions and suggest that host defense systems arose not only to protect tissue directly from pathogenic attack but also to actively support growth of specific communities of mutualists. This functional dichotomy resulted in the evolution of immune systems much more tuned for harmonious existence with microbes than previously thought, existing as dynamic but primarily cooperative entities in the present day. We further present the protochordate Ciona intestinalis as a promising model for studying gut host-bacterial dialogue. The taxonomic position, gut physiology and experimental tractability of Ciona offer unique advantages in dissecting host-microbe interplay and can complement studies in other model systems. PMID:24984114

  2. Classical Item Analysis Using Latent Variable Modeling: A Note on a Direct Evaluation Procedure

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.

    2011-01-01

    A directly applicable latent variable modeling procedure for classical item analysis is outlined. The method allows one to point and interval estimate item difficulty, item correlations, and item-total correlations for composites consisting of categorical items. The approach is readily employed in empirical research and as a by-product permits…

  3. 10 CFR 35.41 - Procedures for administrations requiring a written directive.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Procedures for administrations requiring a written directive. 35.41 Section 35.41 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL... the following items that are applicable to the licensee's use of byproduct material— (1) Verifying...

  4. 10 CFR 35.41 - Procedures for administrations requiring a written directive.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 1 2012-01-01 2012-01-01 false Procedures for administrations requiring a written directive. 35.41 Section 35.41 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL... the following items that are applicable to the licensee's use of byproduct material— (1) Verifying...

  5. 10 CFR 35.41 - Procedures for administrations requiring a written directive.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 1 2013-01-01 2013-01-01 false Procedures for administrations requiring a written directive. 35.41 Section 35.41 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL... the following items that are applicable to the licensee's use of byproduct material— (1) Verifying...

  6. 10 CFR 35.41 - Procedures for administrations requiring a written directive.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Procedures for administrations requiring a written directive. 35.41 Section 35.41 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL... the following items that are applicable to the licensee's use of byproduct material— (1) Verifying...

  7. 10 CFR 35.41 - Procedures for administrations requiring a written directive.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 1 2014-01-01 2014-01-01 false Procedures for administrations requiring a written directive. 35.41 Section 35.41 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL... the following items that are applicable to the licensee's use of byproduct material— (1) Verifying...

  8. 78 FR 63410 - Energy Conservation Program for Consumer Products: Test Procedures for Direct Heating Equipment...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-24

    ... Energy-Efficient Economy (ACEEE), American Gas Association (AGA), Air-Conditioning, Heating, and... Heating Equipment and Pool Heaters AGENCY: Office of Energy Efficiency and Renewable Energy, Department of... (DOE) proposes to revise its test procedures for direct heating equipment and pool heaters...

  9. 34 CFR 685.307 - Withdrawal procedure for schools participating in the Direct Loan Program.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 34 Education 3 2010-07-01 2010-07-01 false Withdrawal procedure for schools participating in the Direct Loan Program. 685.307 Section 685.307 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION WILLIAM D. FORD...

  10. Cavity-based linear polarizer immune to the polarization direction of an incident plane wave.

    PubMed

    Wang, Jiang; Shen, Zhongxiang; Gao, Xiang; Wu, Wen

    2016-01-15

    We herein report a linear polarizer based on a 2D array of substrate integrated waveguide cavities, which can convert an arbitrary linearly polarized (LP) incident wave into an outgoing LP wave in a specified polarization direction with constant transmittance. Two orthogonal slots etched on the front surface of the cavity are utilized to couple a wave of arbitrary polarization into the cavity, while another slot on the back side helps to couple the field out along a desired polarization direction. Microwave experiments are performed as a proof of concept. The proposed polarizer exhibits very good performance with stable transmittance as 50% and a polarization extinction ratio over 45 dB. The new polarizer is potentially useful in novel polarization-selective devices that are immune to the polarization direction of an incident plane wave.

  11. Immunization.

    ERIC Educational Resources Information Center

    Guerin, Nicole; And Others

    1986-01-01

    Contents of this double journal issue concern immunization and primary health care of children. The issue decribes vaccine storage and sterilization techniques, giving particular emphasis to the role of the cold chain, i.e., the maintenance of a specific temperature range to assure potency of vaccines as they are moved from a national storage…

  12. Reducing direct-care staff absenteeism: effects of a combined reinforcement and punishment procedure.

    PubMed

    Briggs, R M

    1990-06-01

    Absenteeism of 130 direct-care staff was reduced by 27% through a mixed consequence procedure consisting of positive reinforcement for reliable attendance and punishment (progressive discipline) for attendance abuse. Reduced rates of absenteeism were maintained over a 12-month period. A 17% reduction in overtime and an increase in annual staff turnover from 34% to 45% also occurred. Results extend the findings of mixed consequence procedures to residential facilities for persons with developmental disabilities. Development of a more powerful positive reinforcement component was discussed.

  13. Procedure for direct measurement of general quantum states using weak measurement.

    PubMed

    Lundeen, Jeff S; Bamber, Charles

    2012-02-17

    Recent work by Lundeen et al. [Nature (London) 474, 188 (2011)] directly measured the wave function by weakly measuring a variable followed by a normal (i.e., "strong") measurement of the complementary variable. We generalize this method to mixed states by considering the weak measurement of various products of these observables, thereby providing the density matrix an operational definition in terms of a procedure for its direct measurement. The method only requires measurements in two bases and can be performed in situ, determining the quantum state without destroying it.

  14. Crustacean hyperglycemic hormones directly modulate the immune response of hemocytes in shrimp Litopenaeus vannamei.

    PubMed

    Wang, Lin; Chen, Hao; Xu, Jianchao; Xu, Qingsong; Wang, Mengqiang; Zhao, Depeng; Wang, Lingling; Song, Linsheng

    2017-03-01

    A robust immune response against invading pathogens is crucial for host to survive, which depends greatly on the well balance of metabolism. Increasing evidence has indicated that some metabolic hormones, such as insulin, could modulate immune responses directly. Crustacean hyperglycemic hormone (CHH) family is a group of ecdysozoans-specific peptide hormone involved in glucose metabolism and other biological events. In the present study, two members of CHH family (designated as LvCHH I and LvCHH II) in shrimp Litopenaeus vannamei with one and two crustacean neurohormone domains respectively were chosen to investigate their putative modulatory roles in both glucose metabolism and immune response. LvCHH I and LvCHH II were both expressed in the sinus gland and lamina ganglionalis of eyestalks and were significantly induced after white spot syndrome virus (WSSV) infection. Meanwhile, significant increases of hemolymph glucose levels were observed in shrimp at 12 and 24 h after WSSV infection while the glucose inside the hemocytes decreased at 6 h and then increased at 12 h. Gain-of-function of rLvCHHs was subsequently conducted in vivo by injecting the recombinant proteins (rLvCHH I and rLvCHH II). The hemolymph glucose increased significantly from 0.5 h to 3 h after the shrimps received an injection of rLvCHH I, while it decreased at 0.5 h and increased afterward at 3 h post rLvCHH II injection. At the meantime, significant decreases of reactive oxygen species level in hemocytes were observed at 3 h and 6 h post rLvCHH I injection, while it remained unchanged in rLvCHH II injection group. rLvCHH I and rLvCHH II could bind to the cytomembrane of primary shrimp hemocytes in vitro, and the expressions of superoxide dismutase and LvRelish increased when the hemocytes were incubated with rLvCHH I for 3 h. Meanwhile, the expression of antimicrobial peptides, crustin and penaeidin-4, were also induced by rLvCHH I and rLvCHH II. These results demonstrated that

  15. Effects of FVIII immunity on hepatocyte and hematopoietic stem cell-directed gene therapy of murine hemophilia A.

    PubMed

    Lytle, Allison M; Brown, Harrison C; Paik, Na Yoon; Knight, Kristopher A; Wright, J Fraser; Spencer, H Trent; Doering, Christopher B

    2016-01-01

    Immune responses to coagulation factors VIII (FVIII) and IX (FIX) represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC) retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV)-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV) vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV.

  16. Compendium of NPL listing policies and procedures, 1982 to 1985. Directive

    SciTech Connect

    Not Available

    1991-08-01

    The compendium is a collection of NPL listing policy and procedure directives issued from 1982 to 1985. The contents include: Guidance for Establishing the National Priorities List, February 1982 (9320.1-01); Guidance for Establishing the National Priorities List, June 1982 (9320.1-02); Guidance for Proposed NPL Update No. 3, February 1984 (9320.3-04); Guidance for Updating the National Priorities List, May 1983 (9320.3-01); Instructions for Promulgating the National Priorities List Update, January 1984 (9320.3-02); National Priorities List Categorization, July 1984 (9320.1-04); NPL Information Update - Update No. 4, April 1985 (9320.3-05); Procedures for Updating the National Priorities List, May 1984, (9320.3-03); Promulgation of the National Priorities List, May 1983 (9320.1-03); RCRA/NPL Listing Policy, September 1986 (9320.1-05); and Updating the National Priorities List: Update No. 6 Proposal, September 1985 (9320.3-06).

  17. Thermoadaptation-directed evolution of chloramphenicol acetyltransferase in an error-prone thermophile using improved procedures.

    PubMed

    Kobayashi, Jyumpei; Furukawa, Megumi; Ohshiro, Takashi; Suzuki, Hirokazu

    2015-07-01

    Enhancing the thermostability of thermolabile enzymes extends their practical utility. We previously demonstrated that an error-prone thermophile derived from Geobacillus kaustophilus HTA426 can generate mutant genes encoding enzyme variants that are more thermostable than the parent enzyme. Here, we used this approach, termed as thermoadaptation-directed enzyme evolution, to increase the thermostability of the chloramphenicol acetyltransferase (CAT) of Staphylococcus aureus and successfully generated a CAT variant with an A138T replacement (CAT(A138T)). This variant was heterologously produced, and its enzymatic properties were compared with those of the wild type. We found that CAT(A138T) had substantially higher thermostability than CAT but had comparable activities, showing that the A138T replacement enhanced protein thermostability without affecting the catalytic activity. Because variants CAT(A138S) and CAT(A138V), which were generated via in vitro site-directed mutagenesis, were more thermostable than CAT, the thermostability enhancement resulting from the A138T replacement can be attributed to both the presence of a hydroxyl group and the bulk of the threonine side chain. CAT(A138T) conferred chloramphenicol resistance to G. kaustophilus cells at high temperature more efficiently than CAT. Therefore, the gene encoding CAT(A138T) may be useful as a genetic marker in Geobacillus spp. Notably, CAT(A138T) generation was achieved only by implementing improved procedures (plasmid-based mutations on solid media); previous procedures (chromosome-based mutations in liquid media) were unsuccessful. This result suggests that this improved procedure is crucial for successful thermoadaptation-directed evolution in certain cases and increases the opportunities for generating thermostable enzymes.

  18. Direct comparison of statistical damage frequency method and raster scan procedure

    NASA Astrophysics Data System (ADS)

    Batavičiūtė, G.; Ščiuka, M.; Plerpaitė, V.; Melninkaitis, A.

    2015-11-01

    Presented study addresses the nano-size defects acting as damage precursors in nanosecond laser pulse irradiation regime. Defects embedded within the surface of glass are investigated in terms of defect ensembles. Damage frequency method and raster scan procedure are directly compared on the set of two samples: uncoated fused silica substrates and SiO2 monolayer films. The extracted defect ensembles appear to be different from each other. The limitations of compared methods such as pulse-to-pulse variation of laser intensity and sample contamination induced by laser ablation were identified as the main causes of observed differences.

  19. A direct procedure for interpolation on a structured curvilinear two-dimensional grid

    NASA Technical Reports Server (NTRS)

    Zingg, David W.; Yarrow, Maurice

    1989-01-01

    A direct procedure is presented for locally bicubic interpolation on a structured, curvilinear, two-dimensional grid. The physical (Cartesian) space is transformed to a computational space in which the grid is uniform and rectangular by a generalized curvilinear coordinate transformation. Required partial derivative information is obtained by finite differences in the computational space. The partial derivatives in physical space are determined by repeated application of the chain rule for partial differentiation. A bilinear transformation is used to analytically transform the individual quadrilateral cells in physical space into unit squares. The interpolation is performed within each unit square using a piecewise bicubic spline.

  20. Development of a drift-correction procedure for a direct-reading spectrometer

    NASA Technical Reports Server (NTRS)

    Chapman, G. B., II; Gordon, W. A.

    1977-01-01

    A procedure which provides automatic correction for drifts in the radiometric sensitivity of each detector channel in a direct-reading emission spectrometer is described. Such drifts are customarily controlled by the regular analyses of standards, which provide corrections for changes in the excitational, optical, and electronic components of the instrument. This standardization procedure, however, corrects for the optical and electronic drifts. It is a step that must be taken if the time, effort, and cost of processing standards is to be minimized. This method of radiometric drift correction uses a 1,000-W tungsten-halogen reference lamp to illuminate each detector through the same optical path as that traversed during sample analysis. The responses of the detector channels to this reference light are regularly compared with channel response to the same light intensity at the time of analytical calibration in order to determine and correct for drift. Except for placing the lamp in position, the procedure is fully automated and compensates for changes in spectral intensity due to variations in lamp current. A discussion of the implementation of this drift-correction system is included.

  1. Immune-directed therapy for type 1 diabetes at the clinical level: the Immune Tolerance Network (ITN) experience.

    PubMed

    Ehlers, Mario R; Nepom, Gerald T

    2012-01-01

    Reestablishing immune tolerance in type 1 diabetes (T1D), a chronic autoimmune disease, is a major goal. The Immune Tolerance Network (ITN) has initiated eight clinical trials of immunomodulatory therapies in recent-onset T1D over the past decade. Results have been mixed in terms of clinical efficacy, but the studies have provided valuable mechanistic insight that are enhancing our understanding of the disease and guiding the design of future trials. Trials of non-Fc-binding anti-CD3 mAbs have revealed that modulation of this target leads to partial responses, and ITN's AbATE trial led to identification of a robust responder group that could be distinguished from non-responders by baseline metabolic and immunologic features. A pilot study of the combination of IL-2 and rapamycin gave the first demonstration that frequency and function of regulatory T cells (Tregs) can be enhanced in T1D subjects, although the therapy triggered the activation of effectors with transient β-cell dysfunction. Similarly, therapy with anti-thymocyte globulin led to substantial lymphocyte depletion, but also to the activation of the acute-phase response with no clinical benefit during preliminary analyses. These and other results provide mechanistic tools that can be used as biomarkers for safety and efficacy in future trials. Furthermore, our results, together with those of other organizations, notably TrialNet, delineate the roles of the major components of the immune response in T1D. This information is setting the stage for future combination therapy trials. The development of disease-relevant biomarkers will also enable the implementation of innovative trial designs, notably adaptive trials, which will increase efficiencies in terms of study duration and sample size, and which will expedite the conduct of trials in which there are uncertainties about dose response and effect size.

  2. Combined rigorous-generic direct orthorectification procedure for IRS-p6 sensors

    NASA Astrophysics Data System (ADS)

    Yousefzadeh, Meisam; Mojaradi, Barat

    2012-11-01

    The accessibility of global data, such as the digital elevation model (DEM), and the development of global visualisations allow promising new methods for minimising the distortion in the online generation of rough orthorectified products to be developed. Direct georeferencing (DG) has attracted a considerable amount of attention in the applications of pushbroom raw images in orthorectification or mono-plotting using ancillary satellite data. This study builds on recent DG studies to achieve an "orthoimage" from raw data and to determine potential mapping errors due to the DG procedure. Thus, this paper focuses on establishing a simple method for mitigating the misalignments of space-borne imageries to be used in direct orthorectification. Towards this goal, instead of image resectioning, affine transformation in different coordinate systems is employed in the orthorectification algorithm to compensate for the systematic DG errors. For a given point, the elevation corresponding to the obtained planimetric coordinate is extracted using available topographic maps and global DEMs, such as SRTM's and ASTER's DEMs. As a result, parameters no longer need to be updated, as in the conventional orthophoto generation methods. To evaluate the proposed procedures, experiments were conducted over three different IRS-p6 sensors in five datasets with different swath widths and tilt angles. The obtained results also demonstrate that the geographic coordinate system and a simple 2D affine transformation can efficiently correct misalignments.

  3. Reassessing the MADE direct-push hydraulic conductivity data using a revised calibration procedure

    NASA Astrophysics Data System (ADS)

    Bohling, Geoffrey C.; Liu, Gaisheng; Dietrich, Peter; Butler, James J.

    2016-11-01

    In earlier work, we presented a geostatistical assessment of high-resolution hydraulic conductivity (K) profiles obtained at the MADE site using direct-push (DP) methods. The profiles are derived from direct-push injection logger (DPIL) measurements that provide a relative indicator of vertical variations in K with a sample spacing of 1.5 cm. The DPIL profiles are converted to K profiles by calibrating to the results of direct-push permeameter (DPP) tests performed at selected depths in some of the profiles. Our original calibration used a linear transform that failed to adequately account for an upper limit on DPIL responses in high-K zones and noise in the DPIL data. Here we present a revised calibration procedure that accounts for the upper limit and noise, leading to DPIL K values that display a somewhat different univariate distribution and a lower lnK variance (5.9 ± 1.5) than the original calibration values (6.9 ± 1.8), although each variance estimate falls within the other's 95% confidence interval. Despite the change in the univariate distribution, the autocorrelation structure and large-scale patterns exhibited by the revised DPIL K values still agree well with those exhibited by the flowmeter data from the site. We provide the DPIL and DPP data, along with our calibrated DPIL K values, in the Supporting Information.

  4. 34 CFR 1100.24 - What are the procedures for payment of a fellowship award directly to the fellow?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 34 Education 4 2011-07-01 2011-07-01 false What are the procedures for payment of a fellowship... LEADER FELLOWSHIP PROGRAM How Does the Director Award a Fellowship? § 1100.24 What are the procedures for payment of a fellowship award directly to the fellow? (a) If the Director pays fellowship award...

  5. 34 CFR 1100.24 - What are the procedures for payment of a fellowship award directly to the fellow?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 34 Education 3 2010-07-01 2010-07-01 false What are the procedures for payment of a fellowship... LEADER FELLOWSHIP PROGRAM How Does the Director Award a Fellowship? § 1100.24 What are the procedures for payment of a fellowship award directly to the fellow? (a) If the Director pays fellowship award...

  6. The Anderson--Baird-Parker direct plating method versus the most probable number procedure for enumerating Escherichia coli in meats.

    PubMed

    Rayman, M K; Aris, B

    1981-01-01

    Comparison of the Anderson--Baird-Parker direct plating method (DP) and the North American most probable number procedure (MPN) for enumerating Escherichia coli in frozen meats revealed that the DP method is more precise and yields higher counts of E. coli than the MPN procedure. Any of three brands of membrane filters tested was suitable for use in the DP method.

  7. Directed transport of neutrophil-derived extracellular vesicles enables platelet-mediated innate immune response

    PubMed Central

    Rossaint, Jan; Kühne, Katharina; Skupski, Jennifer; Van Aken, Hugo; Looney, Mark R.; Hidalgo, Andres; Zarbock, Alexander

    2016-01-01

    The innate immune response to bacterial infections requires the interaction of neutrophils and platelets. Here, we show that a multistep reciprocal crosstalk exists between these two cell types, ultimately facilitating neutrophil influx into the lung to eliminate infections. Activated platelets adhere to intravascular neutrophils through P-selectin/P-selectin glycoprotein ligand-1 (PSGL-1)-mediated binding, a primary interaction that allows platelets glycoprotein Ibα (GPIbα)-induced generation of neutrophil-derived extracellular vesicles (EV). EV production is directed by exocytosis and allows shuttling of arachidonic acid into platelets. EVs are then specifically internalized into platelets in a Mac1-dependent fashion, and relocated into intracellular compartments enriched in cyclooxygenase1 (Cox1), an enzyme processing arachidonic acid to synthesize thromboxane A2 (TxA2). Finally, platelet-derived-TxA2 elicits a full neutrophil response by inducing the endothelial expression of ICAM-1, intravascular crawling, and extravasation. We conclude that critical substrate–enzyme pairs are compartmentalized in neutrophils and platelets during steady state limiting non-specific inflammation, but bacterial infection triggers regulated EV shuttling resulting in robust inflammation and pathogen clearance. PMID:27845343

  8. Secreted Factors from Colorectal and Prostate Cancer Cells Skew the Immune Response in Opposite Directions

    PubMed Central

    Lundholm, Marie; Hägglöf, Christina; Wikberg, Maria L.; Stattin, Pär; Egevad, Lars; Bergh, Anders; Wikström, Pernilla; Palmqvist, Richard; Edin, Sofia

    2015-01-01

    Macrophage infiltration has been associated with an improved prognosis in patients with colorectal cancer (CRC), but a poor prognosis in prostate cancer (PC) patients. In this study, the distribution and prognostic value of proinflammatory M1 macrophages (NOS2+) and immunosuppressive M2 macrophages (CD163+) was evaluated in a cohort of 234 PC patients. We found that macrophages infiltrating PC were mainly of an M2 type and correlated with a more aggressive tumor and poor patient prognosis. Furthermore, the M1/M2 ratio was significantly decreased in PC compared to CRC. Using in vitro cell culture experiments, we could show that factors secreted from CRC and PC cells induced macrophages of a proinflammatory or immunosuppressive phenotype, respectively. These macrophages differentially affected autologous T lymphocyte proliferation and activation. Consistent with this, CRC specimens were found to have higher degrees of infiltrating T-helper 1 cells and active cytotoxic T lymphocytes, while PC specimens displayed functionally inactive T cells. In conclusion, our results imply that tumour-secreted factors from cancers of different origin can drive macrophage differentiation in opposite directions and thereby regulate the organization of the anti-tumour immune response. Our findings suggest that reprogramming of macrophages could be an important tool in the development of new immunotherapeutic strategies. PMID:26503803

  9. A direct screening procedure for gravitropism mutants in Arabidopsis thaliana (L. ) Heynh

    SciTech Connect

    Bullen, B.L.; Best, T.R.; Gregg, M.M.; Barsel, S.E.; Poff, K.L. )

    1990-06-01

    In order to isolate gravitropism mutants of Arabidopsis thaliana (L.) Heynh. var Estland for the genetic dissection of the gravitropism pathway, a direct screening procedure has been developed in which mutants are selected on the basis of their gravitropic response. Variability in hypocotyl curvature was dependent on the germination time of each seed stock, resulting in the incorrect identification of several lines as gravitropism mutants when a standard protocol for the potentiation of germination was used. When the protocol was adjusted to allow for differences in germination time, these lines were eliminated from the collection. Out of the 60,000 M2 seedlings screened, 0.3 to 0.4% exhibited altered gravitropism. In approximately 40% of these mutant lines, only gravitropism by the root or the hypocotyl was altered, while the response of the other organ was unaffected. These data support the hypothesis that root and hypocotyl gravitropism are genetically separable.

  10. Can miniature pulpotomy procedure improve treatment outcomes of direct pulp capping?

    PubMed

    Asgary, Saeed; Ahmadyar, Maryam

    2012-02-01

    Dental pulp exposure is a common incident during dental treatment. If there are clinical signs of pulp vitality, it is recommended to carry out direct pulp capping (DPC) using appropriate pulp covering agents (PCA). The main objectives are maintenance of pulp vitality/healing along with the formation of a calcified bridge beneath the PCA. Our proposed hypothesis is based on consideration of biologic principles in order to achieve improved treatment outcomes of DPC for cariously exposed pulp using miniature pulpotomy procedure (MPP). MPP will result in improved treatment outcomes of DPC by improved maintenance of a clean surgical pulp wound; removal of infected dentin chips/damaged pulp tissue specially injured odontoblast cells; improved proximity/interaction of PCA to undifferentiated mesenchymal/stem cells; better control of bleeding; and creating an improved seal using PCA.

  11. A direct screening procedure for gravitropism mutants in Arabidopsis thaliana (L.) Heynh

    NASA Technical Reports Server (NTRS)

    Bullen, B. L.; Best, T. R.; Gregg, M. M.; Poff, K. L.; Barsel, S-E (Principal Investigator)

    1990-01-01

    In order to isolate gravitropism mutants of Arabidopsis thaliana (L.) Heynh. var Estland for the genetic dissection of the gravitropism pathway, a direct screening procedure has been developed in which mutants are selected on the basis of their gravitropic response. Variability in hypocotyl curvature was dependent on the germination time of each seed stock, resulting in the incorrect identification of several lines as gravitropism mutants when a standard protocol for the potentiation of germination was used. When the protocol was adjusted to allow for differences in germination time, these lines were eliminated from the collection. Out of the 60,000 M2 seedlings screened, 0.3 to 0.4% exhibited altered gravitropism. In approximately 40% of these mutant lines, only gravitropism by the root or the hypocotyl was altered, while the response of the other organ was unaffected. These data support the hypothesis that root and hypocotyl gravitropism are genetically separable.

  12. [Harmonization procedures directed toward clinical trials in laboratory medicine at the National Cancer Center Hospital].

    PubMed

    Ozeki, Mitsuru; Shioya, Kana; Furuta, Koh

    2009-09-01

    Recent advances in pharmacology and molecular sciences made it possible to develop drugs for patients with various maladies. Frustration has existed concerning the delayed provision of these drugs for routine practices in the clinical field. To correct this problem, the importance of clinical trials is increasing. Although there exists a strong demand for participation of clinical laboratories in clinical trials, an awkward attitude in clinical laboratories frustrates those performing clinical trials. We are attempting to correct this problem by introducing our experience with harmonization procedures directed toward clinical trials in laboratory medicine in general. First we described the current status of clinical trials in our hospital. Then we will show personnel in need for clinical trials. Finally we describe in detail our clinical trial procedures. We focus particularly on three aspects of participation in clinical trials: pre-analytical, analytical, and post analytical. Additionally we describe the problems and perspectives in clinical trials by giving special reference to the clinical laboratories in general through discussion with various personnel and specialists. Our goal in the field of laboratory medicine is to benefit patients through the establishment of a harmony between clinical trials and clinical laboratories.

  13. Role of laser irradiation in direct pulp capping procedures: a systematic review and meta-analysis.

    PubMed

    Javed, Fawad; Kellesarian, Sergio Varela; Abduljabbar, Tariq; Gholamiazizi, Elham; Feng, Changyong; Aldosary, Khaled; Vohra, Fahim; Romanos, Georgios E

    2017-02-01

    A variety of materials are available to treat exposed dental pulp by direct pulp capping. The healing response of the pulp is crucial to form a dentin bridge and seal off the exposed pulp. Studies have used lasers to stimulate the exposed pulp to form tertiary dentin. The aim of the present systematic review and meta-analysis was to evaluate the evidence on the effects of laser irradiation as an adjunctive therapy to stimulate healing after pulp exposure. A systematic literature search was conducted up to April 2016. A structured search using the keywords "Direct pulp capping," "Lasers," "Calcium hydroxide pulp capping," and "Resin pulp capping" was performed. Initially, 34 potentially relevant articles were identified. After removal of duplicates and screening by title, abstract, and full text when necessary, nine studies were included. Studies were assessed for bias and data were synthetized using a random-effects meta-analysis model. Six studies were clinical, and three were preclinical animal trials; the follow-up period ranged from 2 weeks to 54 months. More than two thirds of the included studies showed that laser therapy used as an adjunct for direct pulp capping was more effective in maintaining pulp vitality than conventional therapy alone. Meta-analysis showed that the success rate in the laser treatment group was significantly higher than the control group (log odds ratio = 1.737; 95 % confidence interval, 1.304-2.171). Lasers treatment of exposed pulps can improve the outcome of direct pulp capping procedures; a number of confounding factors may have influenced the outcomes of the included studies.

  14. Immune activity elevates energy expenditure of house sparrows: a link between direct and indirect costs?

    PubMed

    Martin, Lynn B; Scheuerlein, Alex; Wikelski, Martin

    2003-01-22

    The activation of an immune response is beneficial for organisms but may also have costs that affect fitness. Documented immune costs include those associated with acquisition of special nutrients, as well as immunopathology or autoimmunity. Here, we test whether an experimental induction of the immune system with a non-pathological stimulant can elevate energy turnover in passerine birds. We injected phytohaemagglutinin (PHA), a commonly used mitogen that activates the cell-mediated immune response, into the wing web of house sparrows, Passer domesticus. We then examined energetic costs resulting from this immune activity and related those costs to other physiological activities. We found that PHA injection significantly elevated resting metabolic rate (RMR) of challenged sparrows relative to saline controls. We calculated the total cost of this immune activity to be ca. 4.20 kJ per day (29% RMR), which is equivalent to the cost of production of half of an egg (8.23 kJ egg(-1)) in this species. We suggest that immune activity in wild passerines increases energy expenditure, which in turn may influence important life-history characteristics such as clutch size, timing of breeding or the scheduling of moult.

  15. Effect of Bacillus subtilis-based direct-fed microbials on immune status in broiler chickens raised on fresh or used litter

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The type of dietary direct-fed microbials (DFMs) or poultry litter could directly influence the composition of gut microbiota. Gut microbiota play an important role in shaping the developing immune system and maintaining homeostasis of the mature immune system in mammal and chickens. The present stu...

  16. Engineering self-assembled materials to study and direct immune function.

    PubMed

    Tostanoski, Lisa H; Jewell, Christopher M

    2017-04-06

    The immune system is an awe-inspiring control structure that maintains a delicate and constantly changing balance between pro-immune functions that fight infection and cancer, regulatory or suppressive functions involved in immune tolerance, and homeostatic resting states. These activities are determined by integrating signals in space and time; thus, improving control over the densities, combinations, and durations with which immune signals are delivered is a central goal to better combat infectious disease, cancer, and autoimmunity. Self-assembly presents a unique opportunity to synthesize materials with well-defined compositions and controlled physical arrangement of molecular building blocks. This review highlights strategies exploiting these capabilities to improve the understanding of how precisely-displayed cues interact with immune cells and tissues. We present work centered on fundamental properties that regulate the nature and magnitude of immune response, highlight pre-clinical and clinical applications of self-assembled technologies in vaccines, cancer, and autoimmunity, and describe some of the key manufacturing and regulatory hurdles facing these areas.

  17. Mesenchymal stem cells do not exert direct beneficial effects on CNS remyelination in the absence of the peripheral immune system.

    PubMed

    Salinas Tejedor, Laura; Berner, Gabriel; Jacobsen, Kristin; Gudi, Viktoria; Jungwirth, Nicole; Hansmann, Florian; Gingele, Stefan; Prajeeth, Chittappen K; Baumgärtner, Wolfgang; Hoffmann, Andrea; Skripuletz, Thomas; Stangel, Martin

    2015-11-01

    Remyelination is the natural repair mechanism in demyelinating disorders such as multiple sclerosis (MS) and it was proposed that it might protect from axonal loss. For unknown reasons, remyelination is often incomplete or fails in MS lesions and therapeutic treatments to enhance remyelination are not available. Recently, the transplantation of exogenous mesenchymal stem cells (MSC) has emerged as a promising tool to enhance repair processes. This included the animal model experimental autoimmune encephalomyelitis (EAE), a commonly used model for the autoimmune mechanisms of MS. However, in EAE it is not clear if the beneficial effect of MSC derives from a direct influence on brain resident cells or if this is an indirect phenomenon via modulation of the peripheral immune system. The aim of this study was to determine potential regenerative functions of MSC in the toxic cuprizone model of demyelination that allows studying direct effects on de- and remyelination without the influence of the peripheral immune system. MSC from three different species (human, murine, canine) were transplanted either intraventricularly into the cerebrospinal fluid or directly into the lesion of the corpus callosum at two time points: at the onset of oligodendrocyte progenitor cell (OPC) proliferation or the peak of OPC proliferation during cuprizone induced demyelination. Our results show that MSC did not exert any regenerative effects after cuprizone induced demyelination and oligodendrocyte loss. During remyelination, MSC did not influence the dynamics of OPC proliferation and myelin formation. In conclusion, MSC did not exert direct regenerative functions in a mouse model where peripheral immune cells and especially T lymphocytes do not play a role. We thus suggest that the peripheral immune system is required for MSC to exert their effects and this is independent from a direct influence of the central nervous system.

  18. Barley MLA Immune Receptors Directly Interfere with Antagonistically Acting Transcription Factors to Initiate Disease Resistance Signaling[C][W

    PubMed Central

    Chang, Cheng; Yu, Deshui; Jiao, Jian; Jing, Shaojuan; Schulze-Lefert, Paul; Shen, Qian-Hua

    2013-01-01

    The nucleotide binding domain and Leucine-rich repeat (NLR)–containing proteins in plants and animals mediate pathogen sensing inside host cells and mount innate immune responses against microbial pathogens. The barley (Hordeum vulgare) mildew A (MLA) locus encodes coiled-coil (CC)–type NLRs mediating disease resistance against the powdery mildew pathogen Blumeria graminis. Here, we report direct interactions between MLA and two antagonistically acting transcription factors, MYB6 and WRKY1. The N-terminal CC signaling domain of MLA interacts with MYB6 to stimulate its DNA binding activity. MYB6 functions as a positive regulator of basal and MLA-mediated immunity responses to B. graminis. MYB6 DNA binding is antagonized by direct association with WRKY1 repressor, which in turn also interacts with the MLA CC domain. The activated form of full-length MLA10 receptor is needed to release MYB6 activator from WRKY1 repression and to stimulate MYB6-dependent gene expression. This implies that, while sequestered by the WRKY1 repressor in the presence of the resting immune receptor, MYB6 acts as an immediate and positive postactivation signaling component of the active state of MLA during transcriptional reprogramming for innate immune responses. PMID:23532068

  19. Immunodominant liver-specific expression suppresses transgene-directed immune responses in murine pompe disease.

    PubMed

    Zhang, Ping; Sun, Baodong; Osada, Takuya; Rodriguiz, Ramona; Yang, Xiao Yi; Luo, Xiaoyan; Kemper, Alex R; Clay, Timothy M; Koeberl, Dwight D

    2012-05-01

    Pompe disease can be treated effectively, if immune tolerance to enzyme replacement therapy (ERT) with acid α-glucosidase (GAA) is present. An adeno-associated viral (AAV) vector carrying a liver-specific regulatory cassette to drive GAA expression (AAV-LSPhGAA) established immune tolerance in GAA knockout (KO) mice, whereas ubiquitous expression with AAV-CBhGAA provoked immune responses. Therefore, we investigated the hypothesis that immune tolerance induced by hepatic-restricted expression was dominant. AAV-LSPhGAA and AAV-CBhGAA were administered singly or in combination to groups of adult GAA-KO mice, and AAV-LSPhGAA induced immune tolerance even in combination with AAV-CBhGAA. The dual vector approach to GAA expression improved biochemical correction of GAA deficiency and glycogen accumulations at 18 weeks, and improved motor function testing including wire-hang and grip-strength testing. The greatest efficacy was demonstrated by dual vector administration, when both vectors were pseudotyped as AAV8. T cells from mice injected with AAV-LSPhGAA failed to proliferate at all after an immune challenge with GAA and adjuvant, whereas mock-treated GAA-KO mice mounted vigorous T cell proliferation. Unlike AAV-LSPhGAA, AAV-CBhGAA induced selective cytokine and chemokine expression in liver and spleen after the immune challenge. AAV-CBhGAA transduced dendritic cells and expressed high-level GAA, whereas AAV-LSPhGAA failed to express GAA in dendritic cells. The level of transduction in liver was much higher after dual AAV8 vector administration at 18 weeks, in comparison with either vector alone. Dual vector administration failed to provoke antibody formation in response to GAA expression with AAV-CBhGAA; however, hepatic-restricted expression from dual vector expression did not prevent antibody formation after a strong immune challenge with GAA and adjuvant. The relevance of immune tolerance to gene therapy in Pompe disease indicates that hepatic expression might best

  20. Immunodominant Liver-Specific Expression Suppresses Transgene-Directed Immune Responses in Murine Pompe Disease

    PubMed Central

    Zhang, Ping; Sun, Baodong; Osada, Takuya; Rodriguiz, Ramona; Yang, Xiao Yi; Luo, Xiaoyan; Kemper, Alex R.; Clay, Timothy M.

    2012-01-01

    Abstract Pompe disease can be treated effectively, if immune tolerance to enzyme replacement therapy (ERT) with acid α-glucosidase (GAA) is present. An adeno-associated viral (AAV) vector carrying a liver-specific regulatory cassette to drive GAA expression (AAV-LSPhGAA) established immune tolerance in GAA knockout (KO) mice, whereas ubiquitous expression with AAV-CBhGAA provoked immune responses. Therefore, we investigated the hypothesis that immune tolerance induced by hepatic-restricted expression was dominant. AAV-LSPhGAA and AAV-CBhGAA were administered singly or in combination to groups of adult GAA-KO mice, and AAV-LSPhGAA induced immune tolerance even in combination with AAV-CBhGAA. The dual vector approach to GAA expression improved biochemical correction of GAA deficiency and glycogen accumulations at 18 weeks, and improved motor function testing including wire-hang and grip-strength testing. The greatest efficacy was demonstrated by dual vector administration, when both vectors were pseudotyped as AAV8. T cells from mice injected with AAV-LSPhGAA failed to proliferate at all after an immune challenge with GAA and adjuvant, whereas mock-treated GAA-KO mice mounted vigorous T cell proliferation. Unlike AAV-LSPhGAA, AAV-CBhGAA induced selective cytokine and chemokine expression in liver and spleen after the immune challenge. AAV-CBhGAA transduced dendritic cells and expressed high-level GAA, whereas AAV-LSPhGAA failed to express GAA in dendritic cells. The level of transduction in liver was much higher after dual AAV8 vector administration at 18 weeks, in comparison with either vector alone. Dual vector administration failed to provoke antibody formation in response to GAA expression with AAV-CBhGAA; however, hepatic-restricted expression from dual vector expression did not prevent antibody formation after a strong immune challenge with GAA and adjuvant. The relevance of immune tolerance to gene therapy in Pompe disease indicates that hepatic expression

  1. Development of a direct isolation procedure for free-living diazotrophs under controlled hypoxic conditions.

    PubMed

    Mirza, Babur S; Rodrigues, Jorge L M

    2012-08-01

    Free-living diazotrophs are diverse and ubiquitous in soil, contributing the nitrogen pool in natural ecosystems. The isolation of nitrogen-fixing microorganisms has relied on semisolid nitrogen-free medium enrichment, followed by multiple subculturing steps. These procedures limit the diversity of recovered isolates. In the current study, we investigated three different isolation strategies for free-living diazotrophs using a soil sample from the Amazon forest. The methods were (i) direct plating on solid nitrogen-free medium under a 2% O(2) concentration, (ii) enrichment in semisolid nitrogen-free medium before plating on solid nitrogen-free medium under 2% O(2), and (iii) enrichment followed by subculturing in the semisolid nitrogen-free medium before plating on nitrogen containing medium under a 21% O(2) concentration. A total of 794 isolates were differentiated by their genomic fingerprinting patterns, and strains with unique profiles were identified on the basis of sequencing of their 16S rRNA gene. Isolates belonged to four bacterial phyla: Proteobacteria, Firmicutes, Actinobacteria, and Bacteriodetes. The novel strategy of combining a solid N-free medium and hypoxic conditions showed an increase of 62.6% in the diversity of diazotrophs in comparison to that obtained by the conventional semisolid medium-based methods. All isolates grew on the nitrogen-free medium under a 2% O(2) concentration, 78% of them showed the presence of the nifH gene, and 39% tested positive for acetylene reduction activity. Our results suggest that direct plating of soil dilutions on nitrogen-free solid medium under a 2% O(2) concentration is a useful strategy for the isolation of the diverse diazotrophic communities.

  2. Immunity induced by a broad class of inorganic crystalline materials is directly controlled by their chemistry.

    PubMed

    Williams, Gareth R; Fierens, Kaat; Preston, Stephen G; Lunn, Daniel; Rysnik, Oliwia; De Prijck, Sofie; Kool, Mirjam; Buckley, Hannah C; Lambrecht, Bart N; O'Hare, Dermot; Austyn, Jonathan M

    2014-06-02

    There is currently no paradigm in immunology that enables an accurate prediction of how the immune system will respond to any given agent. Here we show that the immunological responses induced by members of a broad class of inorganic crystalline materials are controlled purely by their physicochemical properties in a highly predictable manner. We show that structurally and chemically homogeneous layered double hydroxides (LDHs) can elicit diverse human dendritic cell responses in vitro. Using a systems vaccinology approach, we find that every measured response can be modeled using a subset of just three physical and chemical properties for all compounds tested. This correlation can be reduced to a simple linear equation that enables the immunological responses stimulated by newly synthesized LDHs to be predicted in advance from these three parameters alone. We also show that mouse antigen-specific antibody responses in vivo and human macrophage responses in vitro are controlled by the same properties, suggesting they may control diverse responses at both individual component and global levels of immunity. This study demonstrates that immunity can be determined purely by chemistry and opens the possibility of rational manipulation of immunity for therapeutic purposes.

  3. Compendium of ERT surface-water and sediment sampling procedures. Directive

    SciTech Connect

    Not Available

    1991-01-01

    The Standard Operating Procedure (SOP) describes methods used for preventing or reducing cross-contamination, and provides general guidelines for sampling equipment decontamination procedures at a hazardous waste site. Preventing or minimizing cross-contamination in sampled media and in samples is important for preventing the introduction of error into sampling results and for protecting the health and safety of site personnel.

  4. 20 CFR 667.600 - What local area, State and direct recipient grievance procedures must be established?

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 20 Employees' Benefits 3 2011-04-01 2011-04-01 false What local area, State and direct recipient grievance procedures must be established? 667.600 Section 667.600 Employees' Benefits EMPLOYMENT AND... affected participants and other individuals, including youth and those who are limited-English...

  5. Human immune response directed against Plasmodium falciparum heat shock-related proteins.

    PubMed Central

    Kumar, N; Zhao, Y; Graves, P; Perez Folgar, J; Maloy, L; Zheng, H

    1990-01-01

    Heat shock-related stress proteins present in all eucaryotes and procaryotes have been shown to be immune targets in a broad range of infections. We have analyzed sera from people exposed primarily to Plasmodium falciparum for specific antibodies against two heat shock-related proteins (proteins similar to the heat shock protein with a molecular weight of 75,000 [Pfhsp] and a glucose-regulated protein with a molecular weight of 72,000 [Pfgrp]). In an immunoprecipitation analysis with metabolically labeled parasites and synthetic peptides in an enzyme-linked immunosorbent assay, specific antibodies against Pfhsp and Pfgrp were detected in the sera of these individuals. Sera from people exposed to a different human malarial parasite, Plasmodium vivax, did not react with the peptides in an enzyme-linked immunosorbent assay. Southern blot analysis with DNA isolated from P. falciparum from different geographical locations showed a conservation of genes for these stress proteins; thus, they are likely to be immune targets in various endemic areas. Lymphocytes from two tested immune donors responded in proliferation assays to purified Pfhsp and Pfgrp and purified recombinant proteins. However, a similar response was also seen in lymphocytes from nonimmune individuals and has raised questions pertaining to a generalized responsiveness of lymphocytes to some common determinants present in heat shock-related proteins in various pathogens. Images PMID:1691147

  6. Reliability of the nanopheres-DNA immunization technology to produce polyclonal antibodies directed against human neogenic proteins.

    PubMed

    Arnaoty, Ahmed; Gouilleux-Gruart, Valérie; Casteret, Sophie; Pitard, Bruno; Bigot, Yves; Lecomte, Thierry

    2013-08-01

    The molecular domestication of several DNA transposons that occurred during the evolution of the mammalian lineage, has led to the emergence of at least 43 genes, known as neogenes. To date, the limited availability of efficient commercial antibodies directed against most of their protein isoforms hampers investigation of their expression in vitro and in situ. Since immunization protocols using peptides or recombinant proteins have revealed that it is difficult to recover antibodies, we planned to produce antisera in mice using a new technique of nanopheres/DNA immunization, the ICANtibodies™ technology. Here, we investigate the possibilities of obtaining polyclonal antibodies for 24 proteins or protein domains using this immunization strategy. We successfully obtained 13 antisera that were able to detect neogenic proteins by Western blotting and ELISA in protein extracts of transiently-transfected cells and various cancer cell lines, plus another two that only detected the in ELISA and in in situ hybridizations. The features required for the production of these antibodies are analyzed and discussed, and examples are given of the advantages they offer for the study of neogenic proteins.

  7. Enveloped Viruses Disable Innate Immune Responses in Dendritic Cells by Direct Activation of TAM Receptors

    PubMed Central

    Bhattacharyya, Suchita; Zagórska, Anna; Lew, Erin D.; Shrestha, Bimmi; Rothlin, Carla V.; Naughton, John; Diamond, Michael S.; Lemke, Greg; Young, John A.T.

    2013-01-01

    SUMMARY Upon activation by the ligands Gas6 and Protein S, TAM receptor tyrosine kinases promote phagocytic clearance of apoptotic cells and downregulate immune responses initiated by Toll-like receptors and type I interferons (IFNs). Many enveloped viruses display the phospholipid phosphatidylserine on their membranes, through which they bind Gas6 and Protein S and engage TAM receptors. We find that ligand-coated viruses activate TAM receptors on dendritic cells (DCs), dampen type I IFN signaling, and thereby evade host immunity and promote infection. Upon virus challenge, TAM-deficient DCs display type I IFN responses that are elevated in comparison to wild-type cells. As a consequence, TAM-deficient DCs are relatively resistant to infection by flaviviruses and pseudotyped retroviruses, but infection can be restored with neutralizing type I IFN antibodies. Correspondingly, a TAM kinase inhibitor antagonizes the infection of wild-type DCs. Thus, TAM receptors are engaged by viruses in order to attenuate type I IFN signaling and represent potential therapeutic targets. PMID:23954153

  8. Predominant role for directly transfected dendritic cells in antigen presentation to CD8+ T cells after gene gun immunization.

    PubMed

    Porgador, A; Irvine, K R; Iwasaki, A; Barber, B H; Restifo, N P; Germain, R N

    1998-09-21

    Cutaneous gene (DNA) bombardment results in substantial expression of the encoded antigen in the epidermal layer as well as detectable expression in dendritic cells (DC) in draining lymph nodes (LNs). Under these conditions, two possible modes of DC antigen presentation to naive CD8+ T cells might exist: (a) presentation directly by gene-transfected DC trafficking to local lymph nodes, and (b) cross-presentation by untransfected DC of antigen released from or associated with transfected epidermal cells. The relative contributions of these distinct modes of antigen presentation to priming for cytotoxic T cell (CTL) responses have not been clearly established. Here we show that LN cells directly expressing the DNA-encoded antigen are rare; 24 h after five abdominal skin bombardments, the number of these cells does not exceed 50-100 cells in an individual draining LN. However, over this same time period, the total number of CD11c+ DC increases more than twofold, by an average of 20,000-30,000 DC per major draining node. This augmentation is due to gold bombardment and is independent of the presence of plasmid DNA. Most antigen-bearing cells in the LNs draining the site of DNA delivery appear to be DC and can be depleted by antibodies to an intact surface protein encoded by cotransfected DNA. This finding of predominant antigen presentation by directly transfected cells is also consistent with data from studies on cotransfection with antigen and CD86-encoding DNA, showing that priming of anti-mutant influenza nucleoprotein CTLs with a single immunization is dependent upon coexpression of the DNAs encoding nucleoprotein and B7.2 in the same cells. These observations provide insight into the relative roles of direct gene expression and cross-presentation in CD8+ T cell priming using gene gun immunization, and indicate that augmentation of direct DC gene expression may enhance such priming.

  9. Directive Management Procedures, Staffing Patterns in Education for Emotionally Disturbed Students.

    ERIC Educational Resources Information Center

    DeYoung, Michael

    A systematic procedure is outlined which gives guidance to therapists and teachers in managing seriously emotionally disturbed (SED) students (9 to 18 years old) who reside at a licensed children's institution or are attending a centralized public school facility for SED students. Among findings from a review of the literature was that intensive…

  10. Centriole polarisation to the immunological synapse directs secretion from cytolytic cells of both the innate and adaptive immune systems

    PubMed Central

    2011-01-01

    Background Cytolytic cells of the immune system destroy pathogen-infected cells by polarised exocytosis of secretory lysosomes containing the pore-forming protein perforin. Precise delivery of this lethal hit is essential to ensuring that only the target cell is destroyed. In cytotoxic T lymphocytes (CTLs), this is accomplished by an unusual movement of the centrosome to contact the plasma membrane at the centre of the immunological synapse formed between killer and target cells. Secretory lysosomes are directed towards the centrosome along microtubules and delivered precisely to the point of target cell recognition within the immunological synapse, identified by the centrosome. We asked whether this mechanism of directing secretory lysosome release is unique to CTL or whether natural killer (NK) and invariant NKT (iNKT) cytolytic cells of the innate immune system use a similar mechanism to focus perforin-bearing lysosome release. Results NK cells were conjugated with B-cell targets lacking major histocompatibility complex class I 721.221 cells, and iNKT cells were conjugated with glycolipid-pulsed CD1-bearing targets, then prepared for thin-section electron microscopy. High-resolution electron micrographs of the immunological synapse formed between NK and iNKT cytolytic cells with their targets revealed that in both NK and iNKT cells, the centrioles could be found associated (or 'docked') with the plasma membrane within the immunological synapse. Secretory clefts were visible within the synapses formed by both NK and iNKT cells, and secretory lysosomes were polarised along microtubules leading towards the docked centrosome. The Golgi apparatus and recycling endosomes were also polarised towards the centrosome at the plasma membrane within the synapse. Conclusions These results reveal that, like CTLs of the adaptive immune system, the centrosomes of NK and iNKT cells (cytolytic cells of the innate immune system) direct secretory lysosomes to the immunological

  11. Validation and scopolamine-reversal of latent learning in the water maze utilizing a revised direct platform placement procedure.

    PubMed

    Malin, David H; Schaar, Krystal L; Izygon, Jonathan J; Nghiem, Duyen M; Jabitta, Sikirat Y; Henceroth, Mallori M; Chang, Yu-Hsuan; Daggett, Jenny M; Ward, Christopher P

    2015-08-01

    The Morris water maze is routinely used to explore neurobiological mechanisms of working memory. Humans can often acquire working memory relevant to performing a task by mere sensory observation, without having to actually perform the task followed by reinforcement. This can be modeled in the water maze through direct placement of a rat on the escape platform so that it can observe the location, and then assessing the subject's performance in swimming back to the platform. However, direct placement procedures have hardly been studied for two decades, reflecting a controversy about whether direct placement resulted in sufficiently rapid and direct swims back to the platform. In the present study, utilizing revised training methods, a more comprehensive measure of trajectory directness, a more rigorous sham-trained control procedure and an optimal placement-test interval, rats swam almost directly back to the platform in under 4s, significantly more quickly and directly than sham-trained subjects. Muscarinic cholinergic mechanisms, which are inactivated by scopolamine, are essential to memory for standard learning paradigms in the water maze. This experiment determined whether this would also be true for latent learning. ANOVA revealed significant negative effects of scopolamine on both speed and accuracy of trajectory, as well as significant positive effects of direct placement training vs. sham-training. In a probe trial, placement-trained animals without scopolamine spent significantly more time and path length in the target quadrant than trained rats with scopolamine and sham-trained rats without scopolamine. Scopolamine impairments are likely due to effects on memory, since the same dose had little effect on performance with a visible platform. The revised direct placement model offers a means of further comparing the neural mechanisms of latent learning with those of standard instrumental learning.

  12. Immune evasion by pathogenic Leptospira strains: the secretion of proteases that directly cleave complement proteins.

    PubMed

    Fraga, Tatiana Rodrigues; Courrol, Daniella Dos Santos; Castiblanco-Valencia, Mónica Marcela; Hirata, Izaura Yoshico; Vasconcellos, Sílvio Arruda; Juliano, Luiz; Barbosa, Angela Silva; Isaac, Lourdes

    2014-03-01

    Leptospirosis is an infectious disease of public health importance. To successfully colonize the host, pathogens have evolved multiple strategies to escape the complement system. Here we demonstrate that the culture supernatant of pathogenic but not saprophytic Leptospira inhibit the three complement pathways. We showed that the proteolytic activity in the supernatants of pathogenic strains targets the central complement molecule C3 and specific proteins from each pathway, such as factor B, C2, and C4b. The proteases cleaved α and β chains of C3 and work in synergy with host regulators to inactivate C3b. Proteolytic activity was inhibited by 1,10-phenanthroline, suggesting the participation of metalloproteases. A recombinant leptospiral metalloprotease from the thermolysin family cleaved C3 in serum and could be one of the proteases responsible for the supernatant activity. We conclude that pathogenic leptospiral proteases can deactivate immune effector molecules and represent potential targets to the development of new therapies in leptospirosis.

  13. Postoperative Depression of Tumour-directed Cell-mediated Immunity in Patients with Malignant Disease

    PubMed Central

    Cochran, A. J.; Spilg, W. G. S.; Mackie, Rona M.; Thomas, Catherine E.

    1972-01-01

    Leucocytes from 46 melanoma patients, 45 breast carcinoma patients, and 95 control donors were tested by the leucocyte migration test against the supernatants of homogenates of malignant melanomas, breast carcinomas, simple breast tumours, and breasts showing simple cystic disease. By comparison with controls inhibition of migration occurred significantly more frequently when tumour patients' leucocytes were exposed to extracts of histogenetically similar tumours. Cell-mediated immunity to tumour-associated antigens was measured in 12 patients with breast carcinoma and 12 with malignant melanoma immediately before surgical operation and in the postoperative period. All patients tested before operation showed significant inhibition of migration on contact with extracts of histogenetically similar tumours. Postoperatively the degree of leucocyte migration inhibition was reduced in all patients with melanoma and breast carcinoma. Significant inhibition of leucocyte migration returned in most patients 6-22 days after operation. PMID:5077468

  14. Combinations of common chronic paediatric diseases deviate the immune response in diverging directions

    PubMed Central

    Nilsson, L; Kivling, A; Jalmelid, M; Magnusson, K Fälth; Faresjö, M

    2006-01-01

    The cytokine pattern of T lymphocytes has not been characterized in children with combinations of paediatric immunological disorders. We describe cytokine secretion in children with type 1 diabetes, coeliac disease and allergy and combinations of two of these diseases after stimulation with ‘disease-specific’ antigens. Peripheral blood mononuclear cells (PBMC) were collected from 68 children with type 1 diabetes, allergy or coeliac disease, two of these diseases in combination or none of these diseases. Using the enzyme-linked immunospot (ELISPOT) technique, interferon (IFN)-γ and interleukin (IL)-4 were analysed from fresh PBMC spontaneously and after in vitro stimulation with antigens associated with one or more of these diseases (insulin, gluten, birch and cat extract, β-lactoglobulin, ovalbumin and phytohaemagglutinin) in order to divide T helper (Th)1- from Th2-like lymphocytes. Stimulation with birch and cat extract caused increased IL-4 secretion in allergic children. A low IFN-γ response to insulin was found in type 1 diabetic children, whereas allergic children responded to insulin by increased IL-4 secretion. Children suffering from both type 1 diabetes (Th1-prone) and allergy (Th2-prone) reacted distinctly to general mitogen stimulation. Children suffering from two Th1-dominated diseases (type 1 diabetes and coeliac disease) showed hardly any response to either food or inhalation allergens. Our results indicate an important interplay between common immunological diseases in children. The combination of two Th1-deviated diseases is associated with a suppressed immune response, whereas a combination of Th1- and Th2-dominated diseases appears to increase the general immune response. PMID:17100762

  15. Mechanism of induction and suppression of antiviral immunity directed by virus-derived small RNAs in Drosophila.

    PubMed

    Aliyari, Roghiyh; Wu, Qingfa; Li, Hong-Wei; Wang, Xiao-Hong; Li, Feng; Green, Lance D; Han, Cliff S; Li, Wan-Xiang; Ding, Shou-Wei

    2008-10-16

    The small RNA-directed viral immunity pathway in plants and invertebrates begins with the production by Dicer nuclease of virus-derived siRNAs (viRNAs), which guide specific antiviral silencing by Argonaute protein in an RNA-induced silencing complex (RISC). Molecular identity of the viral RNA precursor of viRNAs remains a matter of debate. Using Flock house virus (FHV) infection of Drosophila as a model, we show that replication of FHV positive-strand RNA genome produces an approximately 400 bp dsRNA from its 5' terminus that serves as the major Dicer-2 substrate. ViRNAs thus generated are loaded in Argonaute-2 and methylated at their 3' ends. Notably, FHV-encoded RNAi suppressor B2 protein interacts with both viral dsRNA and RNA replicase and inhibits production of the 5'-terminal viRNAs. Our findings, therefore, provide a model in which small RNA-directed viral immunity is induced during the initiation of viral progeny (+)RNA synthesis and suppressed by B2 inside the viral RNA replication complex.

  16. Direct regulation of the NADPH oxidase RBOHD by the PRR-associated kinase BIK1 during plant immunity.

    PubMed

    Kadota, Yasuhiro; Sklenar, Jan; Derbyshire, Paul; Stransfeld, Lena; Asai, Shuta; Ntoukakis, Vardis; Jones, Jonathan Dg; Shirasu, Ken; Menke, Frank; Jones, Alexandra; Zipfel, Cyril

    2014-04-10

    The rapid production of reactive oxygen species (ROS) burst is a conserved signaling output in immunity across kingdoms. In plants, perception of pathogen-associated molecular patterns (PAMPs) by surface-localized pattern recognition receptors (PRRs) activates the NADPH oxidase RBOHD by hitherto unknown mechanisms. Here, we show that RBOHD exists in complex with the receptor kinases EFR and FLS2, which are the PRRs for bacterial EF-Tu and flagellin, respectively. The plasma-membrane-associated kinase BIK1, which is a direct substrate of the PRR complex, directly interacts with and phosphorylates RBOHD upon PAMP perception. BIK1 phosphorylates different residues than calcium-dependent protein kinases, and both PAMP-induced BIK1 activation and BIK1-mediated phosphorylation of RBOHD are calcium independent. Importantly, phosphorylation of these residues is critical for the PAMP-induced ROS burst and antibacterial immunity. Our study reveals a rapid regulatory mechanism of a plant RBOH, which occurs in parallel with and is essential for its paradigmatic calcium-based regulation.

  17. Four-year Follow-up of a Direct Anatomical Fiber Post and Esthetic Procedures: A Case Report.

    PubMed

    Cardenas, Afm; Siqueira, Fsf; Davila-Sanchez, A; Gomes, G M; Reis, A; Gomes, J C

    2016-01-01

    Knowledge about the stability of fiber posts cemented in widened canal spaces over time is scarce in the literature. Thus, the purpose of this case report was to evaluate the performance of a direct anatomical post in a widened canal space over the course of four years. The present clinical case describes the rehabilitation of a widened canal space using a direct anatomical post (a resin composite combined with a prefabricated glass fiber post) associated with an all-ceramic crown and other restorative procedures. This technique is easy to perform and may solve some of the problems associated with the cementation of a poorly adapted fiber post in a widened canal space.

  18. AIDS: Acquired Immune Deficiency Syndrome, Information and Procedural Guidelines for Providing Services to Persons with AIDS/HTLV-III.

    ERIC Educational Resources Information Center

    Montana State Dept. of Health and Environmental Sciences, Helena.

    This manual presents information about the disease, Acquired Immune Deficiency Syndrome (AIDS), and guidelines for service delivery to Montana residents who have been diagnosed with AIDS or related disorders. The first section describes the disease's causes, symptoms, and transmission; risk factors; high-risk populations; prevention suggestions;…

  19. AIDS: Acquired Immune Deficiency Syndrome; Information and Procedural Guidelines for Providing Services to Persons with AIDS/HIV. Revised.

    ERIC Educational Resources Information Center

    Montana State Dept. of Health and Environmental Sciences, Helena. Health Education Bureau.

    This volume consists of updated information to be inserted into a Montana AIDS Project manual on providing services to persons with acquired immune deficiency syndrome/human immunodeficiency virus (AIDS/HIV), originally published in December 1985. The updates are mainly statistics and terminology, along with the addition of several new sections.…

  20. The current status and future directions of myxoma virus, a master in immune evasion.

    PubMed

    Spiesschaert, Bart; McFadden, Grant; Hermans, Katleen; Nauwynck, Hans; Van de Walle, Gerlinde R

    2011-06-09

    Myxoma virus (MYXV) gained importance throughout the twentieth century because of the use of the highly virulent Standard Laboratory Strain (SLS) by the Australian government in the attempt to control the feral Australian population of Oryctolagus cuniculus (European rabbit) and the subsequent illegal release of MYXV in Europe. In the European rabbit, MYXV causes a disease with an exceedingly high mortality rate, named myxomatosis, which is passively transmitted by biting arthropod vectors. MYXV still has a great impact on European rabbit populations around the world. In contrast, only a single cutaneous lesion, restricted to the point of inoculation, is seen in its natural long-term host, the South-American Sylvilagus brasiliensis and the North-American S. Bachmani. Apart from being detrimental for European rabbits, however, MYXV has also become of interest in human medicine in the last two decades for two reasons. Firstly, due to the strong immune suppressing effects of certain MYXV proteins, several secreted virus-encoded immunomodulators (e.g. Serp-1) are being developed to treat systemic inflammatory syndromes such as cardiovascular disease in humans. Secondly, due to the inherent ability of MYXV to infect a broad spectrum of human cancer cells, the live virus is also being developed as an oncolytic virotherapeutic to treat human cancer. In this review, an update will be given on the current status of MYXV in rabbits as well as its potential in human medicine in the twenty-first century.

  1. Immune deficiency augments the prevalence of p53 loss of heterozygosity in spontaneous tumors but not bi-directional loss of heterozygosity in bone marrow progenitors.

    PubMed

    Shetzer, Yoav; Napchan, Yael; Kaufman, Tom; Molchadsky, Alina; Tal, Perry; Goldfinger, Naomi; Rotter, Varda

    2017-03-15

    p53 loss of heterozygosity (LOH) is a frequent event in tumors of somatic and Li-Fraumeni syndrome patients harboring p53 mutation. Here, we focused on resolving a possible crosstalk between the immune-system and p53 LOH. Previously, we reported that p53 heterozygous bone-marrow mesenchymal progenitor cells undergo p53 LOH in-vivo. Surprisingly, the loss of either the wild-type p53 allele or mutant p53 allele was detected with a three-to-one ratio in favor of losing the mutant allele. In this study, we examined whether the immune-system can affect the LOH directionality in bone marrow progenitors. We found that mesenchymal progenitor cells derived from immune-deficient mice exhibited the same preference of losing the mutant p53 allele as immune-competent matched cells, nevertheless, these animals showed a significantly shorter tumor-free survival, indicating the possible involvement of immune surveillance in this model. Surprisingly, spontaneous tumors of p53 heterozygous immune-deficient mice exhibited a significantly higher incidence of p53 LOH compared to that observed in tumors derived of p53 heterozygous immune-competent mice. These findings indicate that the immune-system may affect the p53 LOH prevalence in spontaneous tumors. Thus suggesting that the immune-system may recognize and clear cells that underwent p53 LOH, whereas in immune-compromised mice, those cells will form tumors with shorter latency. In individuals with a competent immune-system, p53 LOH independent pathways may induce malignant transformation which requires a longer tumor latency. Moreover, this data may imply that the current immunotherapy treatment aimed at abrogating the inhibition of cellular immune checkpoints may be beneficial for LFS patients.

  2. Immune modulation by Bacillus subtilus-based direct-fed microbials in commercial broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Direct-fed microbials (DFMs), also known as probiotics, have been successfully used to improve the balance of gut microbiota. Spores of Bacillus subtilis, have been used as DFMs for food animals and humans and our previous studies showed that dietary supplementation of broiler chickens with a B. su...

  3. Individually Guided Motivation: Goal-Setting Procedures to Develop Student Self-Direction and Prosocial Behaviors.

    ERIC Educational Resources Information Center

    Klausmeier, Herbert J.; And Others

    This paper describes research and development activities dealing with a system of individually guided motivation at a Wisconsin elementary school. Four general objectives for the project are stated. These deal with motivation for learning subject matter knowledge and skills, developing independence, assuming increasing self direction, and…

  4. Reducing Direct-Care Staff Absenteeism: Effects of a Combined Reinforcement and Punishment Procedure.

    ERIC Educational Resources Information Center

    Briggs, Renee M.

    1990-01-01

    Absenteeism of 130 direct-care staff in a residential facility for developmentally disabled persons was reduced by 27 percent through positive reinforcement for reliable attendance and punishment (progressive discipline) for attendance abuse. Reduced absenteeism was maintained for 12 months and overtime was reduced, but staff turnover increased.…

  5. X-Ray Structure and Site-Directed Mutagenesis Analysis of the Escherichia coli Colicin M Immunity Protein▿ †

    PubMed Central

    Gérard, Fabien; Brooks, Mark A.; Barreteau, Hélène; Touzé, Thierry; Graille, Marc; Bouhss, Ahmed; Blanot, Didier; van Tilbeurgh, Herman; Mengin-Lecreulx, Dominique

    2011-01-01

    Colicin M (ColM), which is produced by some Escherichia coli strains to kill competitor strains from the same or related species, was recently shown to inhibit cell wall peptidoglycan biosynthesis through enzymatic degradation of its lipid II precursor. ColM-producing strains are protected from the toxin that they produce by coexpression of a specific immunity protein, named Cmi, whose mode of action still remains to be identified. We report here the resolution of the crystal structure of Cmi, which is composed of four β strands and four α helices. This rather compact structure revealed a disulfide bond between residues Cys31 and Cys107. Interestingly, these two cysteines and several other residues appeared to be conserved in the sequences of several proteins of unknown function belonging to the YebF family which exhibit 25 to 35% overall sequence similarity with Cmi. Site-directed mutagenesis was performed to assess the role of these residues in the ColM immunity-conferring activity of Cmi, which showed that the disulfide bond and residues from the C-terminal extremity of the protein were functionally essential. The involvement of DsbA oxidase in the formation of the Cmi disulfide bond is also demonstrated. PMID:21037007

  6. Enterovirus 71 can directly infect the brainstem via cranial nerves and infection can be ameliorated by passive immunization.

    PubMed

    Tan, Soon Hao; Ong, Kien Chai; Wong, Kum Thong

    2014-11-01

    Enterovirus 71 (EV71)-associated hand, foot, and mouth disease may be complicated by encephalomyelitis. We investigated EV71 brainstem infection and whether this infection could be ameliorated by passive immunization in a mouse model. Enterovirus 71 was injected into unilateral jaw/facial muscles of 2-week-old mice, and hyperimmune sera were given before or after infection. Harvested tissues were studied by light microscopy, immunohistochemistry, in situ hybridization, and viral titration. In unimmunized mice, viral antigen and RNA were detected within 24 hours after infection only in ipsilateral cranial nerves, motor trigeminal nucleus, reticular formation, and facial nucleus; viral titers were significantly higher in the brainstem than in the spinal cord samples. Mice given preinfection hyperimmune serum showed a marked reduction of ipsilateral viral antigen/RNA and viral titers in the brainstem in a dose-dependent manner. With optimum hyperimmune serum given after infection, brainstem infection was significantly reduced in a time-dependent manner. A delay in disease onset and a reduction of disease severity and mortality were also observed. Thus, EV71 can directly infect the brainstem, including the medulla, via cranial nerves, most likely by retrograde axonal transport. This may explain the sudden cardiorespiratory collapse in human patients with fatal encephalomyelitis. Moreover, our results suggest that passive immunization may still benefit EV71-infected patients who have neurologic complications.

  7. Beef, chicken and lamb fatty acid analysis--a simplified direct bimethylation procedure using freeze-dried material.

    PubMed

    Lee, M R F; Tweed, J K S; Kim, E J; Scollan, N D

    2012-12-01

    When fractionation of meat lipids is not required, procedures such as saponification can be used to extract total fatty acids, reducing reliance on toxic organic compounds. However, saponification of muscle fatty acids is laborious, and requires extended heating times, and a second methylation step to convert the extracted fatty acids to fatty acid methyl esters prior to gas chromatography. Therefore the development of a more rapid direct methylation procedure would be of merit. The use of freeze-dried material for analysis is common and allows for greater homogenisation of the sample. The present study investigated the potential of using freeze-dried muscle samples and a direct bimethylation to analyse total fatty acids of meat (beef, chicken and lamb) in comparison with a saponification procedure followed by bimethylation. Both methods compared favourably for all major fatty acids measured. There was a minor difference in relation to the C18:1 trans 10 isomer with a greater (P<0.05) recovery with saponification. However, numerically the difference was small and likely as a result of approaching the limits of isomer identification by single column gas chromatography. Differences (P<0.001) between species were found for all fatty acids measured with no interaction effects. The described technique offers a simplified, quick and reliable alternative to saponification to analyse total fatty acids from muscle samples.

  8. Isolation of murine intrahepatic immune cells employing a modified procedure for mechanical disruption and functional characterization of the B, T and natural killer T cells obtained.

    PubMed

    Blom, K G; Qazi, M Rahman; Matos, J B Noronha; Nelson, B D; DePierre, J W; Abedi-Valugerdi, M

    2009-02-01

    Intrahepatic immune cells (IHIC) are known to play central roles in immunological responses mediated by the liver, and isolation and phenotypic characterization of these cells is therefore of considerable importance. In the present investigation, we developed a simple procedure for the mechanical disruption of mouse liver that allows efficient isolation and phenotypic characterization of IHIC. These cells are compared with the corresponding cells purified from the liver after enzymatic digestion with different concentrations of collagenase and DNase. The mechanical disruption yielded viable IHIC in considerably greater numbers than those obtained following enzymatic digestion. The IHIC isolated employing the mechanical disruption were heterogeneous in composition, consisting of both innate and adaptive immune cells, of which B, T, natural killer (NK), NK T cells, granulocytes and macrophages were the major populations (constituting 37.5%, 16.5%, 12.1%, 7.9%, 7.9% and 7.5% of the total number of cells recovered respectively). The IHIC obtained following enzymatic digestion contained markedly lower numbers of NK T cells (1.8%). The B, T and NK T cells among IHIC isolated employing mechanical disruption were found to be immunocompetent, i.e. they proliferated in vitro in response to their specific stimuli (lipopolysaccharide, concanavalin A and alpha-galactosylceramide respectively) and produced immunoglobulin M and interferon-gamma. Thus, the simple procedure for the mechanical disruption of mouse liver described here results in more efficient isolation of functionally competent IHIC for various types of investigation.

  9. Intraoperative blood flow analysis of direct revascularization procedures in patients with moyamoya disease

    PubMed Central

    Lee, Marco; Guzman, Raphael; Bell-Stephens, Teresa; Steinberg, Gary K

    2011-01-01

    Moyamoya disease is characterized by the progressive stenosis and often occlusion of the terminal internal carotid arteries, which leads to ischemic and hemorrhagic injuries. The etiology is unknown and surgical revascularization remains the mainstay treatment. We analyzed various hemodynamic factors in 292 patients with moyamoya disease, representing 496 revascularization procedures, including vessel dimension and intraoperative blood flow, using a perivascular ultrasonic flowprobe. Mean middle cerebral artery (MCA) flow rate was 4.4±0.26 mL/min. After superficial temporal artery (STA)–MCA bypass surgery, flows at the microanastomosis were increased fivefold to a mean of 22.2±0.8 mL/min. The MCA flows were significantly lower in the pediatric (16.2±1.3 mL/min) compared with the adult (23.9±1.0 mL/min; P<0.0001) population. Increased local flow rates were associated with clinical improvement. Permanent postoperative complications were low (<5%), but very high postanastomosis MCA flow was associated with postoperative stroke (31.2±6.8 mL/min; P=0.045), hemorrhage (32.1±10.2 mL/min; P=0.045), and transient neurologic deficits (28.6±5.6 mL/min; P=0.047) compared with controls. Other flow and vessel dimension data are presented to elucidate the hemodynamic changes related to the vasculopathy and subsequent to surgical intervention. PMID:20588321

  10. Checkpoint modulation--A new way to direct the immune system against renal cell carcinoma.

    PubMed

    Bedke, Jens; Kruck, Stephan; Gakis, Georgios; Stenzl, Arnulf; Goebell, Peter J

    2015-01-01

    The introduction of targeted therapies like the tyrosine kinase (TKI) and mammalian target of rapamycin (mTOR) inhibitors has improved patients' survival in general. Nevertheless the prognosis remains limited. Therapies with a new mode of action are urgently warranted, especially those who would provoke long-term responders or long-lasting complete remissions as observed with unspecific immunotherapy with the cytokines interleukin-2 and interferon-α. In the recent years a deeper understanding of the underlying immunology of T cell activation led to the development of checkpoint inhibitors, which are mainly monocloncal antibodies and which enhances the presence of the co-stimulatory signals needed for T cell activation or priming. This review discusses the clinical data and ongoing studies available for the inhibition of the PD-1 (CD279) and CTLA-4 (CD152) axis in mRCC. In addition, potential future immunological targets are discussed. This approach of T-cell activation or re-activation by immunological checkpoint inhibition holds the inherent promise to directly affect the tumor cell and thereby to potentially cure a subset of patients with mRCC.

  11. A simultaneous, direct microwave/ultrasound-assisted digestion procedure for the determination of total Kjeldahl nitrogen.

    PubMed

    Domini, Claudia; Vidal, Lorena; Cravotto, Giancarlo; Canals, Antonio

    2009-04-01

    Simultaneous direct irradiation with microwaves and ultrasound was used to determine total Kjeldahl nitrogen. The method involves chemical digestion in two steps, mineralization with sulfuric acid and oxidation with H(2)O(2). The most influential variables for the microwave/ultrasound (MW/US)-assisted digestion were optimized using tryptophan as the model substance. The optimum conditions were: H(2)SO(4) volume, 10 mL; H(2)O(2) volume, 5 mL; weight of sample, 0.05 g; MW power, 500 W; US power, 50 W; digestion time, 7 min (i.e., 5 min mineralization and 2 min oxidation). A modification of the classical Kjeldahl (Hach) method and an US-assisted digestion method were used for comparison. The latter was also optimized; the optimum conditions were: H(2)SO(4) volume, 10 mL; H(2)O(2) volume, 5 mL; sonication time with H(2)SO(4), 15 min; sonication time with H(2)O(2),10 min; US power, 50 W; weight of sample, 0.05 g. Five pure amino acids and two certified reference materials (NIST standard reference materials 1547 (peach leaves), and soil, NCS DC 73322) were analyzed to assess the accuracy of our new MW/US-assisted digestion method, that was successfully applied to five real samples. The significant reduction in digestion time (being 30 min and 25 min for classical Kjeldahl and US-assisted digestion methods, respectively) and consumption of reagents show that simultaneous and direct MW/US irradiation is a powerful and promising tool for low-pressure digestion of solid and liquid samples.

  12. Inflammatory markers and adipokines alter adipocyte-derived ASP production through direct and indirect immune interaction.

    PubMed

    Lu, H; Gauvreau, D; Tom, F-Q; Lapointe, M; Luo, X P; Cianflone, K

    2013-04-01

    Obesity and related metabolic diseases are associated with chronic low-grade inflammation, characterized by increased pro-inflammatory proteins. Several studies have demonstrated increases in acylation stimulating protein (ASP) and its precursor protein C3 in obesity, diabetes and dyslipidemia. To evaluate the effects of acute inflammatory factors and adipokines on ASP production and potential mechanisms of action, 3T3-L1 adipocytes were treated for 24 h with adipokines, cytokines, macrophage-conditioned media and direct co-culture with J774 macrophages. ASP and C3 in the media were evaluated in relation to changes in adipocyte lipid metabolism (cellular triglyceride stores). Leptin, adiponectin, IL-10, LPS and TNF-α increased ASP production (151%, 153%, 190%, 318%, 134%, P<0.05, respectively,). C5a and RANTES (Regulated and normal T cell expressed and secreted) decreased ASP production ( - 34%, - 47%, P<0.05), which was also associated with a decrease in the precursor protein C3 ( - 39% to - 51%, P<0.01), while keratinocyte chemoattractant (KC; murine IL-8 ortholog) had no effect on ASP and C3 secretion. By contrast, apelin, omentin and visfatin also decreased ASP ( - 27%, - 49%, - 22%, P<0.05), but without changes in precursor protein C3 secretion. Macrophage-conditioned media alone had little effect on C3 or ASP, while co-culture of adipocytes with macrophages markedly increased ASP and C3 production (272%, 167%, P<0.05). These in vitro results suggest various metabolic hormones and inflammatory factors can affect ASP production through increased precursor C3 production and/or by changing the rate of C3 conversion to ASP. As an adipokine, ASP could constitute a new link between adipocytes and macrophages.

  13. World Health Organization's Innovative Direct Disbursement Mechanism for Payment of Grassroots Immunization Personnel and Operations in Nigeria: 2004–2015

    PubMed Central

    Yehualashet, Yared G.; Wadda, Alieu; Agblewonu, Koffi B.; Zhema, Theophilus; Ibrahim, Al-asi A.; Corr, Alhagie; Linkins, Jennifer; Mkanda, Pascal; Vaz, Rui G.; Nsubuga, Peter; Ashogbon, Daniel

    2016-01-01

    Background. Following the 1988 World Health Assembly resolution to eradicate polio, the government of Nigeria, with support from partners, has been implementing several rounds of supplementary immunization activities (SIAs) each year. In addition to the technical requirements, the success of the polio eradication initiative depends on timely provision of adequate financial resources. Disbursement of funds for SIAs and payment of allowances to numerous vaccination personnel at the grassroots level are enormous operational challenges in a country the size of Nigeria. Upon donors' request for a transparent and effective payment mechanism, the World Health Organization (WHO), in consultation with national counterparts, created the innovative direct disbursement mechanism (DDM) in 2004. The objective of the DDM was to timely deploy operational funds at the field level and directly pay vaccination personnel allowances at the grassroots level. Methods. A detailed operational guideline for funds disbursement was developed in close consultation with central and field stakeholders. Multiyear financial resource requirements and operational budgets for every campaign were produced by an interagency-coordinated finance subcommittee. The WHO engaged a bank and an accounting firm as DDM partners to support disbursement of and accounting for the SIA funds, respectively. The 37 WHO field offices were equipped with electronic financial systems to support the DDM process, and temporary payment sites were set up to facilitate payment to vaccination personnel at the grassroots level. Coordination meetings among DDM partners were held regularly to reconcile financial records and address operational challenges. Results. Between 2004 and 2014, DDM supported 99 polio and nonpolio vaccination campaigns, disbursing more than $370 million to about 16 million beneficiaries across 280 temporary payment sites. To mitigate security risks and reduce operational costs, the WHO and DDM

  14. Controlling Salmonella infection in weanling pigs through water delivery of direct-fed microbials or organic acids; Part I. Effects on growth performance, microbial populations and immune status

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pigs (n=88) weaned at 19 ± 2 d of age were used in a 14 d study to evaluate the effects of water-delivered direct-fed microbials (DFM) or organic acids on immune status, Salmonella infection and shedding, and intestinal microbial populations following a Salmonella Typhimurium challenge. Pigs were ch...

  15. Paneth cell extrusion and release of antimicrobial products is directly controlled by immune cell-derived IFN-γ.

    PubMed

    Farin, Henner F; Karthaus, Wouter R; Kujala, Pekka; Rakhshandehroo, Maryam; Schwank, Gerald; Vries, Robert G J; Kalkhoven, Eric; Nieuwenhuis, Edward E S; Clevers, Hans

    2014-06-30

    Paneth cells (PCs) are terminally differentiated, highly specialized secretory cells located at the base of the crypts of Lieberkühn in the small intestine. Besides their antimicrobial function, PCs serve as a component of the intestinal stem cell niche. By secreting granules containing bactericidal proteins like defensins/cryptdins and lysozyme, PCs regulate the microbiome of the gut. Here we study the control of PC degranulation in primary epithelial organoids in culture. We show that PC degranulation does not directly occur upon stimulation with microbial antigens or bacteria. In contrast, the pro-inflammatory cytokine Interferon gamma (IFN-γ) induces rapid and complete loss of granules. Using live cell imaging, we show that degranulation is coupled to luminal extrusion and death of PCs. Transfer of supernatants from in vitro stimulated iNKT cells recapitulates degranulation in an IFN-γ-dependent manner. Furthermore, endogenous IFN-γ secretion induced by anti-CD3 antibody injection causes Paneth loss and release of goblet cell mucus. The identification of IFN-γ as a trigger for degranulation and extrusion of PCs establishes a novel effector mechanism by which immune responses may regulate epithelial status and the gut microbiome.

  16. Paneth cell extrusion and release of antimicrobial products is directly controlled by immune cell–derived IFN-γ

    PubMed Central

    Farin, Henner F.; Karthaus, Wouter R.; Kujala, Pekka; Rakhshandehroo, Maryam; Schwank, Gerald; Vries, Robert G.J.; Kalkhoven, Eric; Nieuwenhuis, Edward E.S.

    2014-01-01

    Paneth cells (PCs) are terminally differentiated, highly specialized secretory cells located at the base of the crypts of Lieberkühn in the small intestine. Besides their antimicrobial function, PCs serve as a component of the intestinal stem cell niche. By secreting granules containing bactericidal proteins like defensins/cryptdins and lysozyme, PCs regulate the microbiome of the gut. Here we study the control of PC degranulation in primary epithelial organoids in culture. We show that PC degranulation does not directly occur upon stimulation with microbial antigens or bacteria. In contrast, the pro-inflammatory cytokine Interferon gamma (IFN-γ) induces rapid and complete loss of granules. Using live cell imaging, we show that degranulation is coupled to luminal extrusion and death of PCs. Transfer of supernatants from in vitro stimulated iNKT cells recapitulates degranulation in an IFN-γ-dependent manner. Furthermore, endogenous IFN-γ secretion induced by anti-CD3 antibody injection causes Paneth loss and release of goblet cell mucus. The identification of IFN-γ as a trigger for degranulation and extrusion of PCs establishes a novel effector mechanism by which immune responses may regulate epithelial status and the gut microbiome. PMID:24980747

  17. Population-Level Impact of Ontario’s Infant Rotavirus Immunization Program: Evidence of Direct and Indirect Effects

    PubMed Central

    Rosella, Laura C.; Wang, Jun; Le Saux, Nicole; Crowcroft, Natasha S.; Harris, Tara; Bolotin, Shelly; Deeks, Shelley L.

    2016-01-01

    Objective To evaluate the direct and indirect population impact of rotavirus (RV) immunization on hospitalizations and emergency department (ED) visits for acute gastroenteritis (AGE) in Ontario before and after the publicly-funded RV immunization program. Methods Administrative data was used to identify ED visits and hospitalizations for all Ontarians using ICD-10 codes. We used two outcome definitions: RV-specific AGE (RV-AGE) and codes representing RV-, other viral and cause unspecified AGE (“overall AGE”). The pre-program and public program periods were August 1, 2005 to July 31, 2011; and August 1, 2011 to March 31, 2013, respectively. A negative binominal regression model that included the effect of time was used to calculate rates and rate ratios (RRs) and 95% confidence intervals (CIs) for RV-AGE and overall AGE between periods, after adjusting for age, seasonality and secular trends. Analyses were conducted for all ages combined and age stratified. Results Relative to the pre-program period, the adjusted RRs for RV-AGE and overall AGE hospitalizations in the public program period were 0.29 (95%CI: 0.22–0.39) and 0.68 (95%CI: 0.62–0.75), respectively. Significant reductions in RV-AGE hospitalizations were noted overall and for the following age bands: < 12 months, 12–23 months, 24–35 months, 3–4 years, and 5–19 years. Significant declines in overall AGE hospitalizations were observed across all age bands, including older adults > = 65 years (RR 0.80, 95%CI: 0.72–0.90). The program was associated with adjusted RRs of 0.32 (95% CI: 0.20–0.52) for RV-AGE ED visits and 0.90 (95% CI: 0.85–0.96) for overall AGE ED visits. Conclusions This large, population-based study provides evidence of the impact of RV vaccine in preventing hospitalizations and ED visits for RV-AGE and overall AGE, including herd effects. PMID:27168335

  18. A Procedure to Quantify Contributions to the Total Cross Section by Mechanisms Competing to the Direct Ionization

    NASA Astrophysics Data System (ADS)

    Kröger, C. M. Romo

    2009-03-01

    Experimental quantitative analysis by PIXE (particle induced X-ray emission) is highly dependent on the composition of the substrate. It is known that highly ionized projectiles change the effective ionization in a collision with a specific atom. Particularly, 2P vacancies on the projectile ion can be produced within the sample and these vacancies will eventually be shared with the target atoms in the substrate, modifying the X-ray yield of the target. Therefore, it is of uttermost importance to account for these second order effects in the X-ray cross section to obtain an accurate result for a PIXE analysis. In this paper, it is proposed a new procedure to estimate quantitatively the contribution to the total ionization cross section of each effect: the direct and enhancement ionizations. Following Verma et al. (Nucl. Instr. and Meth. B245 56-60, 2006), it is modeled the total ionization cross section in a substrate by an exponentially decaying term that represents the enhancement ionization contribution, and a linearly growing term that represents the induced ionization contribution. Estimation of the parameters in the model can be obtained directly from irradiation of targets with different thickness.

  19. Increasing the Rigor of Procedural Fidelity Assessment: An Empirical Comparison of Direct Observation and Permanent Product Review Methods

    ERIC Educational Resources Information Center

    Sanetti, Lisa M. Hagermoser; Collier-Meek, Melissa A.

    2014-01-01

    Although it is widely accepted that procedural fidelity data are important for making valid decisions about intervention effectiveness, there is little empirical guidance for researchers and practitioners regarding how to assess procedural fidelity. A first step in moving procedural fidelity assessment research forward is to develop a…

  20. Effect of Bacillus Subtilis-based Direct-fed Microbials on Immune Status in Broiler Chickens Raised on Fresh or Used Litter.

    PubMed

    Lee, K W; Lillehoj, H S; Jang, S I; Lee, S H; Bautista, D A; Siragusa, G R

    2013-11-01

    Type of dietary direct-fed microbials (DFMs) or poultry litter could directly influence the composition of gut microbiota. Gut microbiota plays an important role in shaping the developing immune system and maintaining the homeostasis of the mature immune system in mammal and chickens. The present study was carried out to investigate the interaction among litter, DFMs and immunity in broiler chickens exposed to a field-simulated environment. Immune status of broiler chickens was assessed by serum antibodies against Eimeria spp. and Clostridium spp. and intestinal cytokine mRNA expression. The current experimental design had a 3 ×2 factorial arrangement of treatments with three types of litter, i.e., fresh litter or used litter that was obtained from a farm with no disease outbreak (used litter) or a farm with history of a gangrenous dermatitis outbreak (GD litter), and two dietary treatments with or without DFMs. It was found that either DFM addition or type of litter significantly affected anticoccidial antibody levels of broiler chickens at d 42. In general, dietary DFMs increased the anticoccidial antibodies in the fresh-litter raised chickens, but lowered the levels in the GD-litter raised chickens. Serum antibodies against Clostridium perfringens α-toxin were significantly (p<0.05) higher in chickens raised on GD litter compared with those raised on fresh litter. Cytokine mRNA expression was significantly (p<0.05) altered by either the type of litter or DFMs. Of interest, dietary DFMs lowered interferon-γ, interleukin 1beta, and CXCLi2 cytokine mRNA expression in chickens raised on fresh litter but increased them in GD-litter raised chickens. In conclusion, dietary DFMs modulate various immune parameters of broiler chickens, but the DFM-mediated effects were dependent upon the type of litter on which chickens were raised.

  1. 34 CFR 1100.24 - What are the procedures for payment of a fellowship award directly to the fellow?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 34 Education 4 2014-07-01 2014-07-01 false What are the procedures for payment of a fellowship... NATIONAL INSTITUTE FOR LITERACY NATIONAL INSTITUTE FOR LITERACY: LITERACY LEADER FELLOWSHIP PROGRAM How Does the Director Award a Fellowship? § 1100.24 What are the procedures for payment of a...

  2. 34 CFR 1100.24 - What are the procedures for payment of a fellowship award directly to the fellow?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 34 Education 4 2013-07-01 2013-07-01 false What are the procedures for payment of a fellowship... NATIONAL INSTITUTE FOR LITERACY NATIONAL INSTITUTE FOR LITERACY: LITERACY LEADER FELLOWSHIP PROGRAM How Does the Director Award a Fellowship? § 1100.24 What are the procedures for payment of a...

  3. 34 CFR 1100.24 - What are the procedures for payment of a fellowship award directly to the fellow?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 34 Education 4 2012-07-01 2012-07-01 false What are the procedures for payment of a fellowship... NATIONAL INSTITUTE FOR LITERACY NATIONAL INSTITUTE FOR LITERACY: LITERACY LEADER FELLOWSHIP PROGRAM How Does the Director Award a Fellowship? § 1100.24 What are the procedures for payment of a...

  4. A pilot study exploring the possibility of establishing guidance levels in x-ray directed interventional procedures

    SciTech Connect

    Balter, S.; Miller, D. L.; Vano, E.; Ortiz Lopez, P.; Bernardi, G.; Cotelo, E.; Faulkner, K.; Nowotny, R.; Padovani, R.; Ramirez, A.

    2008-02-15

    This article summarizes the dosimetric results of an International Atomic Energy Agency coordinated research program to investigate the feasibility of adopting guidance levels for invasive coronary artery procedures. The main study collected clinical data from hospitals located in five countries. A total of 2265 coronary angiograms (CA) and 1844 percutaneous coronary interventions (PCI) were analyzed. Substudies evaluated the dosimetric performance of 14 fluoroscopes, skin dose maps obtained using film, the quality of CA procedures, and the complexity of PCI procedures. Kerma-area product (P{sub KA}) guidance levels of 50 and 125 Gy cm{sup 2} are suggested for CA and PCI procedures. These levels should be adjusted for the complexity of the procedures performed in a given institution.

  5. The Effects of Direct Instruction Flashcard and Math Racetrack Procedures on Mastery of Basic Multiplication Facts by Three Elementary School Students

    ERIC Educational Resources Information Center

    Skarr, Adam; Zielinski, Katie; Ruwe, Kellen; Sharp, Hannah; Williams, Randy L.; McLaughlin, T. F.

    2014-01-01

    The purpose of this study was to determine if a typical third-grade boy and fifth-grade girl and a boy with learning disabilities could benefit from the combined use of Direct Instruction (DI) flashcard and math racetrack procedures in an after-school program. The dependent variable was accuracy and fluency of saying basic multiplication facts. A…

  6. Promotional model: a new direction for the National Programme on Immunization (NPI) and Oral Rehydration Therapy (ORT) in Nigeria.

    PubMed

    Ekerete, P P

    2000-01-01

    The National Programme on Immunization (NPI), which was formerly known as the Expanded Program on Immunization (EPI), and Oral Rehydration Therapy (ORT) were relaunched in 1984 after the problems of vaccine supply had been corrected. The aim of the NPI was to protect children against six childhood killer diseases and ORT to rehydrate the dehydrated child caused by diarrhoea. In order to achieve these objectives, a Partner-in-Health strategy was set up to educate, convince and motivate mothers, pregnant women and the community to accept the programme. To assess the effect of the promotional strategy, the government decided to conduct a National Immunization Coverage survey. The results showed that some states were able to reach the target while some were not. The survey also reported that 32% of the reason for immunization failure was due to lack of information and that 9% was lack of motivation. It therefore became necessary to design a promotional model for effective and rapid implementation of the programme. After an evaluation of the promotional strategy set up by the government, a pilot survey was conducted from which nine promotional elements were selected. These promotional elements were regarded as sources of information and motivation. Based on these, a promotional model was set up which stated that promotion depends on consumer information which in turn depends on the extent of interaction between the consumer and the promotional elements. The implication of the model is the need for the formation of a Public Health Organisation with a Public Health Committee at all levels of government.

  7. Adverse Husbandry of Maraena Whitefish Directs the Immune System to Increase Mobilization of Myeloid Cells and Proinflammatory Responses

    PubMed Central

    Korytář, Tomáš; Nipkow, Mareen; Altmann, Simone; Goldammer, Tom; Köllner, Bernd; Rebl, Alexander

    2016-01-01

    Adverse life circumstances evoke a common “conserved transcriptional response to adversity” (CTRA) in mammalian leukocytes. To investigate whether this pattern is preserved in lower vertebrates, maraena whitefish (Coregonus maraena) were exposed for 9 days to different stocking densities: ~10 kg/m3 (low density), ~33 kg/m3 (moderate), ~60 kg/m3 (elevated), and ~100 kg/m3 (high). Transcriptome profiling in the liver and kidney of individuals from each group suggested that crowding conditions activate stress-related signaling and effector pathways. Remarkably, about one-quarter of the genes differentially expressed under crowding conditions were involved in the activation of immune pathways such as acute-phase response and interleukin/TNF signaling attended by the simultaneous reduction of antiviral potency. Network analysis confirmed the complex interdigitation of immune- and stress-relevant pathways with interleukin-1 playing a central role. Antibody-based techniques revealed remarkable changes in the blood composition of whitefish and demonstrated the correlation between increasing stocking densities and elevated number of myeloid cells together with the increased phagocytic activity of peripheral blood leukocytes. In line with current studies in mammals, we conclude that crowding stress triggers in whitefish hallmarks of a CTRA, indicating that the stress-induced molecular mechanisms regulating the immune responses not only are conserved within mammals but were established earlier in evolution. PMID:28066440

  8. 20 CFR 667.600 - What local area, State and direct recipient grievance procedures must be established?

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... affected participants and other individuals, including youth and those who are limited-English speaking... of services and information in languages other than English. (c) Local area procedures must...

  9. Immunization: A Handbook for Schools. Vaccine-Preventable Communicable Disease Control. Second Edition.

    ERIC Educational Resources Information Center

    New York State Education Dept., Albany. Bureau of School Health Education and Services.

    This handbook was developed by the Bureau of School Health Education and Services of the New York State Education Department to provide school authorities with a guide for an effective school immunization program. It offers direction for local development of immunization policies and procedures, an overview of effective program activities, a…

  10. Homologous RIG-I–like helicase proteins direct RNAi-mediated antiviral immunity in C. elegans by distinct mechanisms

    PubMed Central

    Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Ding, Shou-Wei; Lu, Rui

    2013-01-01

    RNAi-mediated antiviral immunity in Caenorhabditis elegans requires Dicer-related helicase 1 (DRH-1), which encodes the helicase and C-terminal domains homologous to the mammalian retinoic acid inducible gene I (RIG-I)-like helicase (RLH) family of cytosolic immune receptors. Here we show that the antiviral function of DRH-1 requires the RIG-I homologous domains as well as its worm-specific N-terminal domain. We also demonstrate that the helicase and C-terminal domains encoded by either worm DRH-2 or human RIG-I can functionally replace the corresponding domains of DRH-1 to mediate antiviral RNAi in C. elegans. Notably, substitutions in a three-residue motif of the C-terminal regulatory domain of RIG-I that physically interacts with viral double-stranded RNA abolish the antiviral activity of C-terminal regulatory domains of both RIG-I and DRH-1 in C. elegans. Genetic analysis revealed an essential role for both DRH-1 and DRH-3 in C. elegans antiviral RNAi targeting a natural viral pathogen. However, Northern blot and small RNA deep sequencing analyses indicate that DRH-1 acts to enhance production of viral primary siRNAs, whereas DRH-3 regulates antiviral RNAi by participating in the biogenesis of secondary siRNAs after Dicer-dependent production of primary siRNAs. We propose that DRH-1 facilitates the acquisition of viral double-stranded RNA by the worm dicing complex for the subsequent processing into primary siRNAs. The strong parallel for the antiviral function of RLHs in worms and mammals suggests that detection of viral double-stranded RNA may activate completely unrelated effector mechanisms or, alternatively, that the mammalian RLHs have a conserved activity to stimulate production of viral siRNAs for antiviral immunity by an RNAi effector mechanism. PMID:24043766

  11. The structural HCV genes delivered by MPG cell penetrating peptide are directed to enhance immune responses in mice model.

    PubMed

    Mehrlatifan, Saloume; Mirnurollahi, Seyyedeh Masumeh; Motevalli, Fatemeh; Rahimi, Pooneh; Soleymani, Sepehr; Bolhassani, Azam

    2016-10-01

    One of the significant problems in vaccination projects is the lack of an effective vaccine against hepatitis C virus (HCV). The goal of the current study is to evaluate and compare two DNA constructs encoding HCV core and coreE1E2 genes alone or complexed with MPG peptide as a delivery system for stimulation of antibody responses and IFN-γ secretion in Balb/c mice model. Indeed, MPG cell penetrating peptide was used to improve DNA immunization in mice. Our results demonstrated that MPG forms stable non-covalent nanoparticles with pcDNA-core and pcDNA-coreE1E2 at an N/P ratio of 10:1. The in vitro transfection efficiency of core or coreE1E2 DNA using MPG and TurboFect delivery systems was confirmed by western blot analysis. The results indicated the expression of the full-length core (∼21 kDa), and coreE1E2 (∼83 kDa) proteins using an anti-His monoclonal antibody. In addition, the expression of HCV core and coreE1E2 proteins was performed in bacteria and the purified recombinant proteins were injected to mice with Montanide 720 adjuvant. Our data showed that the immunized mice with HCV core and coreE1E2 proteins generated the mixture of sera IgG1 and IgG2a isotypes considerably higher than other groups. Furthermore, DNA constructs encoding core and coreE1E2 complexed with MPG could significantly induce IFN-γ secretion in lower concentrations than the naked core and coreE1E2 DNAs. Taken together, the DNA formulations as well as protein regimens used in this study triggered high-level IFN-γ production in mice, an important feature for the development of Th1 immune responses.

  12. Protective immune-response of aluminium hydroxide gel adjuvanted phage lysate of Brucella abortus S19 in mice against direct virulent challenge with B. abortus 544.

    PubMed

    Jain, Lata; Rawat, Mayank; Prajapati, Awadhesh; Tiwari, Ashok Kumar; Kumar, Bablu; Chaturvedi, V K; Saxena, H M; Ramakrishnan, Sarvanan; Kumar, Jatin; Kerketta, Priscilla

    2015-09-01

    The prophylactic efficacies of plain and alum adsorbed lysate were evaluated by direct virulent challenge in mice model. A recently isolated brucellaphage 'ϕLd' was used for generation of lysates. Twenty four h incubated Brucella abortus S19 broth cultures standardized to contain approximately 10(8) CFU/ml were found suitable for generation of lysates. Three lysate batches produced through separate cycles did not show any significant variation with respect to protein and polysaccharide contents, endotoxin level and phage counts, indicating that compositionally stable lysate preparations can be generated through an optimized production process. Three polypeptides of ∼16, 19 and 23 kDa could be identified as immuno-dominant antigens of the lysate which induced both humoral and cell-mediated immune responses in a dose dependent manner. Results of efficacy evaluation trial confirmed dose-dependent protective potencies of lysate preparation. The lysate with an antigenic dose of 0.52 μg protein and 60 μg CHO adsorbed on aluminium gel (0.1 percent aluminium concentration) exhibited the highest protective potency which was greater than that induced by standard S19 vaccine. Phage lysate methodology provides a very viable option through which an improved immunizing preparation with all desirable traits can be developed against brucellosis, and integrated with immunization programmes in a more efficient manner.

  13. Immunology-directed methods for distributed robotics: a novel immunity-based architecture for robust control and coordination

    NASA Astrophysics Data System (ADS)

    Singh, Surya P. N.; Thayer, Scott M.

    2002-02-01

    This paper presents a novel algorithmic architecture for the coordination and control of large scale distributed robot teams derived from the constructs found within the human immune system. Using this as a guide, the Immunology-derived Distributed Autonomous Robotics Architecture (IDARA) distributes tasks so that broad, all-purpose actions are refined and followed by specific and mediated responses based on each unit's utility and capability to timely address the system's perceived need(s). This method improves on initial developments in this area by including often overlooked interactions of the innate immune system resulting in a stronger first-order, general response mechanism. This allows for rapid reactions in dynamic environments, especially those lacking significant a priori information. As characterized via computer simulation of a of a self-healing mobile minefield having up to 7,500 mines and 2,750 robots, IDARA provides an efficient, communications light, and scalable architecture that yields significant operation and performance improvements for large-scale multi-robot coordination and control.

  14. New alternating direction procedures in finite element analysis based upon EBE approximate factorizations. [element-by-element

    NASA Technical Reports Server (NTRS)

    Hughes, T. J. R.; Winget, J.; Levit, I.; Tezduyar, T. E.

    1983-01-01

    Element-by-element approximate factorization procedures are proposed for solving the large finite element equation systems which arise in computational mechanics. A variety of techniques are compared on problems of structural mechanics, heat conduction and fluid mechanics. The results obtained suggest considerable potential for the methods described.

  15. Intraclass Correlation Coefficients in Hierarchical Design Studies with Discrete Response Variables: A Note on a Direct Interval Estimation Procedure

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.

    2015-01-01

    A latent variable modeling procedure that can be used to evaluate intraclass correlation coefficients in two-level settings with discrete response variables is discussed. The approach is readily applied when the purpose is to furnish confidence intervals at prespecified confidence levels for these coefficients in setups with binary or ordinal…

  16. The Arabidopsis transcription factor BRASSINOSTEROID INSENSITIVE1-ETHYL METHANESULFONATE-SUPPRESSOR1 is a direct substrate of MITOGEN-ACTIVATED PROTEIN KINASE6 and regulates immunity.

    PubMed

    Kang, Sining; Yang, Fan; Li, Lin; Chen, Huamin; Chen, She; Zhang, Jie

    2015-03-01

    Pathogen-associated molecular patterns (PAMPs) are recognized by plant pattern recognition receptors to activate PAMP-triggered immunity (PTI). Mitogen-activated protein kinases (MAPKs), as well as other cytoplasmic kinases, integrate upstream immune signals and, in turn, dissect PTI signaling via different substrates to regulate defense responses. However, only a few direct substrates of these signaling kinases have been identified. Here, we show that PAMP perception enhances phosphorylation of BRASSINOSTEROID INSENSITIVE1-ETHYL METHANESULFONATE-SUPPRESSOR1 (BES1), a transcription factor involved in brassinosteroid (BR) signaling pathway, through pathogen-induced MAPKs in Arabidopsis (Arabidopsis thaliana). BES1 interacts with MITOGEN-ACTIVATED PROTEIN KINASE6 (MPK6) and is phosphorylated by MPK6. bes1 loss-of-function mutants display compromised resistance to bacterial pathogen Pseudomonas syringae pv tomato DC3000. BES1 S286A/S137A double mutation (BES1(SSAA)) impairs PAMP-induced phosphorylation and fails to restore bacterial resistance in bes1 mutant, indicating a positive role of BES1 phosphorylation in plant immunity. BES1 is phosphorylated by glycogen synthase kinase3 (GSK3)-like kinase BR-insensitive2 (BIN2), a negative regulator of BR signaling. BR perception inhibits BIN2 activity, allowing dephosphorylation of BES1 to regulate plant development. However, BES1(SSAA) does not affect BR-mediated plant growth, suggesting differential residue requirements for the modulation of BES1 phosphorylation in PTI and BR signaling. Our study identifies BES1 as a unique direct substrate of MPK6 in PTI signaling. This finding reveals MAPK-mediated BES1 phosphorylation as another BES1 modulation mechanism in plant cell signaling, in addition to GSK3-like kinase-mediated BES1 phosphorylation and F box protein-mediated BES1 degradation.

  17. Using Consensus Building Procedures with Expert Raters to Establish Comparison Scores of Behavior for Direct Behavior Rating

    ERIC Educational Resources Information Center

    Jaffery, Rose; Johnson, Austin H.; Bowler, Mark C.; Riley-Tillman, T. Chris; Chafouleas, Sandra M.; Harrison, Sayward E.

    2015-01-01

    To date, rater accuracy when using Direct Behavior Rating (DBR) has been evaluated by comparing DBR-derived data to scores yielded through systematic direct observation. The purpose of this study was to evaluate an alternative method for establishing comparison scores using expert-completed DBR alongside best practices in consensus building…

  18. CHOICE - Directed Study: Consequences of longterm- Confinement and Hypobaric HypOxia on Immunity in the Antarctic Concordia Environment

    NASA Technical Reports Server (NTRS)

    Sams, Clarence; Pierson, Duane; Crucian, Brian; Chouker, Alexander; Feurecker, matthias; Salem, Alexander; Stowe, Raymond; Mehta, Satish; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2010-01-01

    Concerning ground-based space physiological research, the choice of analog must carefully match the system of interest. For spaceflight-associated immune dysregulation (SAID), Antarctica winter-over has emerged as potentially the best terrestrial analog. The prolonged mission durations, extreme/dangerous environment, station-based lifestyle, isolation from outside world, disrupted circadian rhythms, and other psychological aspects make this analog extremely high fidelity for exploration-class space missions (long duration lunar, Mars). NASA, ESA and RSA are currently investigating SAID, with NASA currently operating the Integrated Immune flight study. It is desirable to have a ground analog for SAID validated, so that potential countermeasures might be validated terrestrially prior to during flight. For this presentation, NASA data collected on the winterover 2009 crewmembers, baseline through early deployment will be presented. Through early deployment (approximately 2-3 weeks at Concordia), phenotypic alterations included increased levels of memory T cells, shifts among the CD8+ T cell compartment to a more mature phenotype, and increases in constitutively activated T cells. CD8+/IFNg+ T cell percentages, and T cell blastogenesis functional responses were depressed early deployment as compared to healthy controls. In four compatible subjects, secreted T cell Th1/Th2 cytokines were measured following culture stimulation, and a Th2 shift was observed as compared to controls. Post-winter over frozen sample return will be required to determine if this shift persisted during the winter over period. Additionally, circadian rhythms remained altered compared to baseline, as determined through 5x daily cortisol measurements. Latent viral reactivation will not be determined until frozen sample return occurs.

  19. MicroRNA-33–dependent regulation of macrophage metabolism directs immune cell polarization in atherosclerosis

    PubMed Central

    Ouimet, Mireille; Ediriweera, Hasini N.; Gundra, U. Mahesh; Sheedy, Frederick J.; Ramkhelawon, Bhama; Hutchison, Susan B.; Rinehold, Kaitlyn; van Solingen, Coen; Fullerton, Morgan D.; Cecchini, Katharine; Rayner, Katey J.; Steinberg, Gregory R.; Zamore, Phillip D.; Fisher, Edward A.; Loke, P’ng; Moore, Kathryn J.

    2015-01-01

    Cellular metabolism is increasingly recognized as a controller of immune cell fate and function. MicroRNA-33 (miR-33) regulates cellular lipid metabolism and represses genes involved in cholesterol efflux, HDL biogenesis, and fatty acid oxidation. Here, we determined that miR-33–mediated disruption of the balance of aerobic glycolysis and mitochondrial oxidative phosphorylation instructs macrophage inflammatory polarization and shapes innate and adaptive immune responses. Macrophage-specific Mir33 deletion increased oxidative respiration, enhanced spare respiratory capacity, and induced an M2 macrophage polarization–associated gene profile. Furthermore, miR-33–mediated M2 polarization required miR-33 targeting of the energy sensor AMP-activated protein kinase (AMPK), but not cholesterol efflux. Notably, miR-33 inhibition increased macrophage expression of the retinoic acid–producing enzyme aldehyde dehydrogenase family 1, subfamily A2 (ALDH1A2) and retinal dehydrogenase activity both in vitro and in a mouse model. Consistent with the ability of retinoic acid to foster inducible Tregs, miR-33–depleted macrophages had an enhanced capacity to induce forkhead box P3 (FOXP3) expression in naive CD4+ T cells. Finally, treatment of hypercholesterolemic mice with miR-33 inhibitors for 8 weeks resulted in accumulation of inflammation-suppressing M2 macrophages and FOXP3+ Tregs in plaques and reduced atherosclerosis progression. Collectively, these results reveal that miR-33 regulates macrophage inflammation and demonstrate that miR-33 antagonism is atheroprotective, in part, by reducing plaque inflammation by promoting M2 macrophage polarization and Treg induction. PMID:26517695

  20. Characteristics of gastrointestinal stromal tumours, diagnostic procedure and therapeutic management and main directions of nursing practice in gastrointestinal stromal tumours

    PubMed Central

    Głuszek, Stanisław; Kozieł, Dorota

    2014-01-01

    Gastrointestinal stromal tumours (GIST) constitute a separate group of mesenchymal neoplasms of the gastrointestinal tract. They have been commonly recognized for a few years, they have created a new problem in medical practice. GIST are more often centred in the stomach. They equally affect female and male patients and occur mainly in patients older than 50 years of age. The clinical picture of the tumour is non-specific. Radical surgical treatment and molecularly targeted therapy with tyrosine kinase inhibitors are used in GIST treatment. Nursing practice with reference to GIST danger is connected with biopsychosocial interventions of perioperative, oncological and palliative procedures and involves the area of health education mainly oriented towards shaping preventive procedures which favour early disease detection and support therapy and recovery. PMID:25784835

  1. Evaluation of solution procedures for material and/or geometrically nonlinear structural analysis by the direct stiffness method.

    NASA Technical Reports Server (NTRS)

    Stricklin, J. A.; Haisler, W. E.; Von Riesemann, W. A.

    1972-01-01

    This paper presents an assessment of the solution procedures available for the analysis of inelastic and/or large deflection structural behavior. A literature survey is given which summarized the contribution of other researchers in the analysis of structural problems exhibiting material nonlinearities and combined geometric-material nonlinearities. Attention is focused at evaluating the available computation and solution techniques. Each of the solution techniques is developed from a common equation of equilibrium in terms of pseudo forces. The solution procedures are applied to circular plates and shells of revolution in an attempt to compare and evaluate each with respect to computational accuracy, economy, and efficiency. Based on the numerical studies, observations and comments are made with regard to the accuracy and economy of each solution technique.

  2. Equine immunity to parasites.

    PubMed

    Klei, T R

    2000-04-01

    Helminths are among the most significant parasites of horses in developed countries. This article examines immune responses against helminth parasites and the implications that immunologic investigations have on vaccine development, improvement of diagnostic procedures, and disease eradication.

  3. Taishan Pinus massoniana pollen polysaccharide inhibits subgroup J avian leucosis virus infection by directly blocking virus infection and improving immunity

    PubMed Central

    Yu, Cuilian; Wei, Kai; Liu, Liping; Yang, Shifa; Hu, Liping; Zhao, Peng; Meng, Xiuyan; Shao, Mingxu; Wang, Chuanwen; Zhu, Lijun; Zhang, Hao; Li, Yang; Zhu, Ruiliang

    2017-01-01

    Subgroup J avian leucosis virus (ALV-J) generally causes neoplastic diseases, immunosuppression and subsequently increases susceptibility to secondary infection in birds. The spread of ALV-J mainly depends on congenital infection and horizontal contact. Although ALV-J infection causes enormous losses yearly in the poultry industry worldwide, effective measures to control ALV-J remain lacking. In this study, we demonstrated that Taishan Pinus massoniana pollen polysaccharide (TPPPS), a natural polysaccharide extracted from Taishan Pinus massoniana pollen, can significantly inhibit ALV-J replication in vitro by blocking viral adsorption to host cells. Electron microscopy and blocking ELISA tests revealed that TPPPS possibly blocks viral adsorption to host cells by interacting with the glycoprotein 85 protein of ALV-J. Furthermore, we artificially established a congenitally ALV-J-infected chicken model to examine the anti-viral effects of TPPPS in vivo. TPPPS significantly inhibited viral shedding and viral loads in immune organs and largely eliminated the immunosuppression caused by congenital ALV-J infection. Additionally, pre-administration of TPPPS obviously reduced the size and delayed the occurrence of tumors induced by acute oncogenic ALV-J infection. This study revealed the prominent effects and feasible mechanisms of TPPPS in inhibiting ALV-J infection, thereby providing a novel prospect to control ALV-J spread. PMID:28287165

  4. The Serine Protease Pic From Enteroaggregative Escherichia coli Mediates Immune Evasion by the Direct Cleavage of Complement Proteins.

    PubMed

    Abreu, Afonso G; Fraga, Tatiana R; Granados Martínez, Adriana P; Kondo, Marcia Y; Juliano, Maria A; Juliano, Luiz; Navarro-Garcia, Fernando; Isaac, Lourdes; Barbosa, Angela S; Elias, Waldir P

    2015-07-01

    Enteroaggregative and uropathogenic Escherichia coli, Shigella flexneri 2a, and the hybrid enteroaggregative/Shiga toxin-producing E. coli strain (O104:H4) are important pathogens responsible for intestinal and urinary tract infections, as well as sepsis and hemolytic uremic syndrome. They have in common the production of a serine protease called Pic. Several biological roles for Pic have been described, including protection of E. coli DH5α from complement-mediated killing. Hereby we showed that Pic significantly reduces complement activation by all 3 pathways. Pic cleaves purified C3/C3b and other proteins from the classic and lectin pathways, such as C4 and C2. Cleavage fragments of C3, C4, and C2 were also observed with HB101(pPic1) culture supernatants, and C3 cleavage sites were mapped by fluorescence resonance energy transfer peptides. Experiments using human serum as a source of complement proteins confirmed Pic proteolytic activity on these proteins. Furthermore, Pic works synergistically with the human complement regulators factor I and factor H, promoting inactivation of C3b. In the presence of both regulators, further degradation of C3 α' chain was observed. Therefore, Pic may contribute to immune evasion of E. coli and S. flexneri, favoring invasiveness and increasing the severity of the disorders caused by these pathogens.

  5. Taishan Pinus massoniana pollen polysaccharide inhibits subgroup J avian leucosis virus infection by directly blocking virus infection and improving immunity.

    PubMed

    Yu, Cuilian; Wei, Kai; Liu, Liping; Yang, Shifa; Hu, Liping; Zhao, Peng; Meng, Xiuyan; Shao, Mingxu; Wang, Chuanwen; Zhu, Lijun; Zhang, Hao; Li, Yang; Zhu, Ruiliang

    2017-03-13

    Subgroup J avian leucosis virus (ALV-J) generally causes neoplastic diseases, immunosuppression and subsequently increases susceptibility to secondary infection in birds. The spread of ALV-J mainly depends on congenital infection and horizontal contact. Although ALV-J infection causes enormous losses yearly in the poultry industry worldwide, effective measures to control ALV-J remain lacking. In this study, we demonstrated that Taishan Pinus massoniana pollen polysaccharide (TPPPS), a natural polysaccharide extracted from Taishan Pinus massoniana pollen, can significantly inhibit ALV-J replication in vitro by blocking viral adsorption to host cells. Electron microscopy and blocking ELISA tests revealed that TPPPS possibly blocks viral adsorption to host cells by interacting with the glycoprotein 85 protein of ALV-J. Furthermore, we artificially established a congenitally ALV-J-infected chicken model to examine the anti-viral effects of TPPPS in vivo. TPPPS significantly inhibited viral shedding and viral loads in immune organs and largely eliminated the immunosuppression caused by congenital ALV-J infection. Additionally, pre-administration of TPPPS obviously reduced the size and delayed the occurrence of tumors induced by acute oncogenic ALV-J infection. This study revealed the prominent effects and feasible mechanisms of TPPPS in inhibiting ALV-J infection, thereby providing a novel prospect to control ALV-J spread.

  6. Noninvasive aortic bloodflow by Pulsed Doppler Echocardiography (PDE) compared to cardiac output by the direct Fick procedure

    NASA Technical Reports Server (NTRS)

    1980-01-01

    Left ventricular stroke volume was estimated from the systolic velocity integral in the ascending aorta by pulsed Doppler Echocardiography (PDE) and the cross sectional area of the aorta estimated by M mode echocardiography on 15 patients with coronary disease undergoing right catheterization for diagnostic purposes. Cardiac output was calculated from stroke volume and heart volume using the PDE method as well as the Fick procedure for comparison. The mean value for the cardiac output via the PDE method (4.42 L/min) was only 6% lower than for the cardiac output obtained from the Fick procedure (4.69 L/min) and the correlation between the two methods was excellent (r=0.967, p less than .01). The good agreement between the two methods demonstrates that the PDE technique offers a reliable noninvasive alternative for estimating cardiac output, requiring no active cooperation by the subject. It was concluded that the Doppler method is superior to the Fick method in that it provides beat by beat information on cardiac performance.

  7. The increase in intra-macrophage thiols induced by new pro-GSH molecules directs the Th1 skewing in ovalbumin immunized mice.

    PubMed

    Fraternale, Alessandra; Paoletti, Maria Filomena; Dominici, Sabrina; Caputo, Antonella; Castaldello, Arianna; Millo, Enrico; Brocca-Cofano, Egidio; Smietana, Michaël; Clayette, Pascal; Oiry, Joël; Benatti, Umberto; Magnani, Mauro

    2010-11-10

    In the present work, the capacity of new pro-GSH molecules to increase the intra-macrophage thiol content in vitro and in vivo as well as to shift the immune response to Th1 in ovalbumin (Ova)-sensitized mice were examined. The molecules were the N-butanoyl GSH derivative, GSH-C4, and a pro-drug of N-acetylcysteine (NAC) and beta-mercaptoethylamine (MEA), I-152. In vitro, 2h-incubation with both molecules was found to increase intra-macrophage thiol content; in vivo, Ova-sensitized mice pre-treated by intraperitoneal administration of the pro-GSH molecules showed an increase in plasma anti-Ova IgG2a and IgG2b, characterizing Th1 immune response, and a decrease in IgG1, typical of the Th2 response. Such findings were connected to a shift to a Th1 response also involving splenocyte IFN-γ production as revealed by ELISPOT assay and higher levels of IL-12 in circulation. Although immune responses are in vivo mediated both by dendritic cells and macrophages, the data reported in this paper corroborate the suggestion that the pro-GSH molecules, increasing the intra-cellular thiol pool, modulate the Th1/Th2 balance favouring Th1-type responses and may be employed as Th1-directing adjuvants in new vaccination protocols and as immunomodulators in those diseases where Th1 response patterns are compromised in favour of Th2.

  8. Cells involved in the immune response. XXXVI. The thymic antigen-specific suppressor cell in the immunized rabbit is a T cell with receptors for FcG and the antigen and it acts, via a secreted suppressor factor, directly on the immune splenic AFC B cell to inhibit antibody secretion.

    PubMed Central

    Talor, E; Jodouin, C A; Richter, M

    1988-01-01

    Following i.v. immunization of the normal outbred rabbit with sheep (SRBC) or horse (HRBC) erythrocytes, antigen-specific suppressor cells are generated in the thymus capable of inhibiting the generation of haemolytic plaques by the autologous or allogeneic splenic antibody-forming cells (AFC) in the plaque-forming cell (PFC) assay. These suppressor cells secrete an antigen-specific suppressor factor in short-term (4-24 hr) culture in vitro. The suppressor cells are not detected in the thymus prior to Day 4, exhibit peak activity between Days 5 and 11 post-immunization, and decline slowly thereafter. Suppressor cells can no longer be detected in the thymus by Day 60 postimmunization. Suppressor cells are not detected in any of the other lymphoid organs of the immunized rabbit nor in any lymphoid organ in the unimmunized rabbit. The thymic suppressor cell is a T cell with surface receptors for the antigen (SRBC or HRBC) and for FcG. On the other hand, the AFC B cells generated in the spleen of the immunized rabbit possess cell-surface receptors for only the antigen and not for FcG. Both the suppressor cells and the secreted suppressor factor act directly on the AFC B lymphocytes to inhibit the generation of antigen-specific haemolytic plaques in the PFC assay. PMID:2455684

  9. Field Test Evaluation of Conservation Retrofits of Low-Income, Single-Family Buildings in Wisconsin: Blower-Door-Directed Infiltration Reduction Procedure, Field Test Implementation and Results

    SciTech Connect

    Gettings, M.B.

    2001-05-21

    A blower-door-directed infiltration retrofit procedure was field tested on 18 homes in south central Wisconsin. The procedure, developed by the Wisconsin Energy Conservation Corporation, includes recommended retrofit techniques as well as criteria for estimating the amount of cost-effective work to be performed on a house. A recommended expenditure level and target air leakage reduction, in air changes per hour at 50 Pascal (ACH50), are determined from the initial leakage rate measured. The procedure produced an average 16% reduction in air leakage rate. For the 7 houses recommended for retrofit, 89% of the targeted reductions were accomplished with 76% of the recommended expenditures. The average cost of retrofits per house was reduced by a factor of four compared with previous programs. The average payback period for recommended retrofits was 4.4 years, based on predicted energy savings computed from achieved air leakage reductions. Although exceptions occurred, the procedure's 8 ACH50 minimum initial leakage rate for advising retrofits to be performed appeared a good choice, based on cost-effective air leakage reduction. Houses with initial rates of 7 ACH50 or below consistently required substantially higher costs to achieve significant air leakage reductions. No statistically significant average annual energy savings was detected as a result of the infiltration retrofits. Average measured savings were -27 therm per year, indicating an increase in energy use, with a 90% confidence interval of 36 therm. Measured savings for individual houses varied widely in both positive and negative directions, indicating that factors not considered affected the results. Large individual confidence intervals indicate a need to increase the accuracy of such measurements as well as understand the factors which may cause such disparity. Recommendations for the procedure include more extensive training of retrofit crews, checks for minimum air exchange rates to insure air quality

  10. Plasmacytoid Dendritic Cells Respond Directly to Apoptotic Cells by Secreting Immune Regulatory IL-10 or IFN-α

    PubMed Central

    Simpson, Joanne; Miles, Katherine; Trüb, Marta; MacMahon, Roisin; Gray, Mohini

    2016-01-01

    Plasmacytoid dendritic cells (pDCs) play a pivotal role in driving the autoimmune disease systemic lupus erythematosus, via the secretion of IFN-α in response to nuclear self-antigens complexed with autoantibodies. Apoptotic cells, generated at sites of inflammation or secondary lymphoid organs, are exposed to activated pDCs and also express the same nuclear antigens on their cell surface. Here, we show that in the absence of autoantibodies, activated pDCs directly respond to apoptotic cell-expressed chromatin complexes by secreting IL-10 and IL-6, which also induces T cells to secrete IL-10. Conversely, when activated by the viral mimetic CpG-A, apoptotic cells enhance their secretion of IFN-α. This study demonstrates that activated pDCs respond directly to apoptotic cells and may maintain tolerance via IL-10, or promote inflammation through secretion of IFN-α, depending on the inflammatory context. PMID:28018356

  11. A Unified Direct-Inverse Procedure for Two-Dimensional Boundary Layers Using Spline/Finite Difference Discretization.

    DTIC Science & Technology

    1987-02-01

    pt. 50 20 7 Potential 3b I-A 3 pt. 47 20 7 Potential 3c D 3 pt. 40 20 7 Hiemenz Fit 3d I-A 3 pt. 36 20 7 Hiemenz Fit V _ _ _ _ _ _ _ 4...the Hiemenz polynomial fit of the edge velocity for viscous flow. This case is included to test the ability of the direct and inverse methods to

  12. Preexisting Immunity and Low Expression in Primates Highlight Translational Challenges for Liver-directed AAV8-mediated Gene Therapy

    PubMed Central

    Hurlbut, Gregory D; Ziegler, Robin J; Nietupski, Jennifer B; Foley, Joseph W; Woodworth, Lisa A; Meyers, Elizabeth; Bercury, Scott D; Pande, Nilesh N; Souza, David W; Bree, Mark P; Lukason, Michael J; Marshall, John; Cheng, Seng H; Scheule, Ronald K

    2010-01-01

    Liver-directed gene therapy with adeno-associated virus (AAV) vectors effectively treats mouse models of lysosomal storage diseases (LSDs). We asked whether these results were likely to translate to patients. To understand to what extent preexisting anti-AAV8 antibodies could impede AAV8-mediated liver transduction in primates, commonly preexposed to AAV, we quantified the effects of preexisting antibodies on liver transduction and subsequent transgene expression in mouse and nonhuman primate (NHP) models. Using the highest viral dose previously reported in a clinical trial, passive transfer of NHP sera containing relatively low anti-AAV8 titers into mice blocked liver transduction, which could be partially overcome by increasing vector dose tenfold. Based on this and a survey of anti-AAV8 titers in 112 humans, we predict that high-dose systemic gene therapy would successfully transduce liver in >50% of human patients. However, although high-dose AAV8 administration to mice and monkeys with equivalent anti-AAV8 titers led to comparable liver vector copy numbers, the resulting transgene expression in primates was ~1.5-logs lower than mice. This suggests vector fate differs in these species and that strategies focused solely on overcoming preexisting vector-specific antibodies may be insufficient to achieve clinically meaningful expression levels of LSD genes using a liver-directed gene therapy approach in patients. PMID:20736932

  13. Immune System

    MedlinePlus

    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Immune System KidsHealth > For Teens > Immune System A A A ... could put us out of commission. What the Immune System Does The immune (pronounced: ih-MYOON) system, which ...

  14. A fast procedure of stress state evaluation in magnetically anisotropic steels with the help of a probe with adjustable magnetizing field direction

    NASA Astrophysics Data System (ADS)

    Chmielewski, Marek; Piotrowski, Leszek; Augustyniak, Bolesław

    2017-04-01

    The paper presents a novel approach to the stress state evaluation issue. It deals with a strongly (magnetically) anisotropic materials for which a direct interpretation of the Barkhausen effect (BE) intensity would lead to erroneous results. In such a case one has to take into account both the measured BE intensity and the orientation of the magnetisation direction relative to the magnetic easy axis. For the in plane stress distribution evaluation one has to perform at least three measurements in the non-collinear directions. The application of an apparatus with automatically changing magnetizing field direction allows to obtain the angular distribution of the BE intensity in about 30 s (with the angular step of 10°). Thanks to the dedicated post-processing software the procedure of the measurement data processing, resulting in the full information on the stress distribution (main stress components and their orientation in all the investigated points) is almost instantaneous. Apart from the measurement results the stress determination procedure requires two additional pieces of information. The first one is the calibration data obtained for at least two applied strain directions (along easy and hard magnetisation axes)— the data for the intermediate orientations are usually interpolated. The second one is the ‘reference level’ of the BE intensity angular distribution. In the case of welded plates it is obtained by averaging the results obtained at the analysed points before welding. The way of results presentation proposed in that paper is very illustrative and shows an interesting feature of the stress distribution in welded plates—namely the appearance of a ‘vortex’ structure of main stress.

  15. New procedure for direct measurements of absorbance of thin films of ultra-high absorbance UV blocks

    NASA Astrophysics Data System (ADS)

    McMillan, Norman D.; Solsvik, A.; Murphy, L.; Stevenson, A.; O'Neill, M.; Moore, J.

    2005-06-01

    A novel method for the measurement of ultra-high absorbance liquids has been devised and details are given of a new ultra absorbance instrument developed specifically for these thin liquid film measurements. The instrument specifically constructed for monitoring and measuring sunscreen products has been tested using locally produced sunscreen products. This new approach has been made possible by the development of very accurate liquid micro-dispensers and details are given of the novel procedure to carry out these measurements. Detailed description of the apparatus construction is given with photographs of the apparatus. The work described is largely based on research and quality control measurements of Parasol suncare products. Results on the reproducibility of measurements taken with the UAI for a commercial range of factor 20 sunscreen liquid are given and these have been used to validate the performance of the instrument. It is believed that the absorbance measurements described here are perhaps the largest ever reported. In addition, the photostability of this product has been monitored in aging tests. Finally, some studies have been done on two other commercially available factor 20 products that show that these are significantly worse with regards to both protection from ageing and burn.

  16. Supplementation of direct-fed microbials as an alternative to antibiotic on growth performance, immune response, cecal microbial population, and ileal morphology of broiler chickens.

    PubMed

    Salim, H M; Kang, H K; Akter, N; Kim, D W; Kim, J H; Kim, M J; Na, J C; Jong, H B; Choi, H C; Suh, O S; Kim, W K

    2013-08-01

    An experiment was conducted to investigate the supplementation of direct-fed microbials (DFM) as an alternative to antibiotics on growth performance, immune response, cecal microbial population, and ileal morphology of broiler chickens. A total of 800 one-day-old male broiler chicks (Ross × Ross) were randomly allotted to 4 dietary treatments with 4 replicate pens per treatment (50 birds/replicate pen). The 4 dietary treatments fed for 35 d were a corn-soybean meal basal diet (control); control plus 0.1% virginiamycin, as an antibiotic growth promoter (AGP); control plus 0.1% direct-fed microbials that contained Lactobacillus reuteri (DFM 1); and control plus 0.1% direct-fed microbials that contained a mixture of L. reuteri, Bacillus subtilis, and Saccharomyces cerevisiae (DFM 2). Results showed that dietary AGP and DFM supplementation significantly increased (P < 0.05) the BW gain of broilers during 0 to 21 d. The feed intake was reduced, whereas the feed conversion was improved significantly when birds were fed DFM 2 at 0 to 7 d of age. The white blood cell and monocyte levels were significantly higher in the DFM 2 group compared with the control. In addition, feeding DFM significantly (P < 0.05) increased the plasma immunoglobulin levels where a higher level was observed in DFM 2 compared with those of the other treatments. Neither DFM nor AGP treatments affected the cecal Lactobacillus and Salmonella content; however, cecal Escherichia coli content significantly decreased in broiler chickens fed DFM and AGP. The ileal villus height, and width and total thickness of muscularis externa were significantly increased when birds were fed DFM compared with AGP and control. These results indicate that the dietary supplementation of DFM increases the growth performance of birds at an early age, stimulates the immune response, decreases the number of E. coli, and improves the ileal morphology of broiler chickens. Thus, DFM that contained a mixture of several beneficial

  17. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    PubMed Central

    Dang, N.N.; Pang, S.G.; Song, H.Y.; An, L.G.; Ma, X.L.

    2014-01-01

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response. PMID:25493381

  18. New directional results and determination of absolute archaeointensity using both the classical Thellier and the multi-specimen procedures for two kilns excavated at Osterietta, Italy

    NASA Astrophysics Data System (ADS)

    Tema, Evdokia; Camps, Pierre; Ferrara, Enzo

    2014-05-01

    A detailed rock-magnetic and archaeomagnetic study has been carried out on two rescue excavation kilns discovered during the works to expand a highway at the location of Osterietta, in Northen Italy. Systematic archaeomagnetic sampling was carried out collecting 15 samples from the first kiln (OSA) and 8 samples from the second kiln (OSB), all of them oriented in situ with a magnetic compass and an inclinometer. Magnetic mineralogy measurements have been carried out in order to determine the main magnetic carrier of the samples and to check their thermal stability. Standard thermal demagnetization procedures have been used to determine the archaeomagnetic direction registered by the bricks during their last firing. Demagnetization results show a very stable characteristic remanent magnetization (ChRM). We averaged the directions for each kiln separately and calculated the statistical parameters assuming a Fisherian distribution. The archaeointensity of both kilns has also been recovered with both the classical Thellier-Thellier method and the multi-specimen procedure (MSP-DSC). During the Thellier experiments, regular partial thermoremanent magnetization checks have been performed and the effect of the anisotropy of the thermoremanent magnetization (TRM) and cooling rate upon TRM intensity acquisition have been investigated in all samples. The multi-specimen procedure was performed with a very fast-heating oven developed at Montpellier (France). The intensity results obtained from both methods have been compared and the full geomagnetic field vector determined for each kiln has been used for archaeomagnetic dating. The obtained results show that the kilns were almost contemporaneous and their last use occurred in the 1750-1850 AD time interval.

  19. Development of Procedures for Direct Extraction of Cryptosporidium DNA from Water Concentrates and for Relief of PCR Inhibitors

    PubMed Central

    Jiang, Jianlin; Alderisio, Kerri A.; Singh, Ajaib; Xiao, Lihua

    2005-01-01

    Extraction of high-quality DNA is a key step in PCR detection of Cryptosporidium and other pathogens in environmental samples. Currently, Cryptosporidium oocysts in water samples have to be purified from water concentrates before DNA is extracted. This study compared the effectiveness of six DNA extraction methods (DNA extraction with the QIAamp DNA minikit after oocyst purification with immunomagnetic separation and direct DNA extraction methods using the FastDNA SPIN kit for soil, QIAamp DNA stool minikit, UltraClean soil kit, or QIAamp DNA minikit and the traditional phenol-chloroform technique) for the detection of Cryptosporidium with oocyst-seeded samples, DNA-spiked samples, and field water samples. The study also evaluated the effects of different PCR facilitators (nonacetylated bovine serum albumin, the T4 gene 32 protein, and polyvinylpyrrolidone) and treatments (the use of GeneReleaser or ultrafiltration) for the relief from or removal of inhibitors of PCR amplification. The results of seeding and spiking studies showed that PCR inhibitors were presented in all DNA solutions extracted by the six methods. However, the effect of PCR inhibitors could be relieved significantly by the addition of 400 ng of bovine serum albumin/μl or 25 ng of T4 gene 32 protein/μl to the PCR mixture. With the inclusion of bovine serum albumin in the PCR mixture, DNA extracted with the FastDNA SPIN kit for soil without oocyst isolation resulted in PCR performance similar to that produced by the QIAamp DNA minikit after oocysts were purified by immunomagnetic separation. PMID:15746310

  20. The Kjeldahl method as a primary reference procedure for total protein in certified reference materials used in clinical chemistry. II. Selection of direct Kjeldahl analysis and its preliminary performance parameters.

    PubMed

    Vinklárková, Bára; Chromý, Vratislav; Šprongl, Luděk; Bittová, Miroslava; Rikanová, Milena; Ohnútková, Ivana; Žaludová, Lenka

    2015-01-01

    To select a Kjeldahl procedure suitable for the determination of total protein in reference materials used in laboratory medicine, we reviewed in our previous article Kjeldahl methods adopted by clinical chemistry and found an indirect two-step analysis by total Kjeldahl nitrogen corrected for its nonprotein nitrogen and a direct analysis made on isolated protein precipitates. In this article, we compare both procedures on various reference materials. An indirect Kjeldahl method gave falsely lower results than a direct analysis. Preliminary performance parameters qualify the direct Kjeldahl analysis as a suitable primary reference procedure for the certification of total protein in reference laboratories.

  1. Bad to the Bone: On In Vitro and Ex Vivo Microbial Biofilm Ability to Directly Destroy Colonized Bone Surfaces without Participation of Host Immunity or Osteoclastogenesis

    PubMed Central

    Junka, Adam; Szymczyk, Patrycja; Ziółkowski, Grzegorz; Karuga-Kuzniewska, Ewa; Smutnicka, Danuta; Bil-Lula, Iwona; Bartoszewicz, Marzenna; Mahabady, Susan; Sedghizadeh, Parish Paymon

    2017-01-01

    Bone infections are a significant public health burden associated with morbidity and mortality in patients. Microbial biofilm pathogens are the causative agents in chronic osteomyelitis. Research on the pathogenesis of osteomyelitis has focused on indirect bone destruction by host immune cells and cytokines secondary to microbial insult. Direct bone resorption by biofilm pathogens has not yet been seriously considered. In this study, common osteomyelitis pathogens (Staphylococcus aureus, Pseudomonas aeruginosa, Candida albicans, and Streptococcus mutans) were grown as biofilms in multiple in vitro and ex vivo experiments to analyze quantitative and qualitative aspects of bone destruction during infection. Pathogens were grown as single or mixed species biofilms on the following substrates: hydroxyapatite, rat jawbone, or polystyrene wells, and in various media. Biofilm growth was evaluated by scanning electron microscopy and pH levels were monitored over time. Histomorphologic and quantitative effects of biofilms on tested substrates were analyzed by microcomputed tomography and quantitative cultures. All tested biofilms demonstrated significant damage to bone. Scanning electron microscopy indicated that all strains formed mature biofilms within 7 days on all substrate surfaces regardless of media. Experimental conditions impacted pH levels, although this had no impact on biofilm growth or bone destruction. Presence of biofilm led to bone dissolution with a decrease of total volume by 20.17±2.93% upon microcomputed tomography analysis, which was statistically significant as compared to controls (p <0.05, ANOVA). Quantitative cultures indicated that media and substrate did not impact biofilm formation (Kruskall-Wallis test, post-hoc Dunne’s test; p <0.05). Overall, these results indicate that biofilms associated with osteomyelitis have the ability to directly resorb bone. These findings should lead to a more complete understanding of the etiopathogenesis of

  2. Bad to the Bone: On In Vitro and Ex Vivo Microbial Biofilm Ability to Directly Destroy Colonized Bone Surfaces without Participation of Host Immunity or Osteoclastogenesis.

    PubMed

    Junka, Adam; Szymczyk, Patrycja; Ziółkowski, Grzegorz; Karuga-Kuzniewska, Ewa; Smutnicka, Danuta; Bil-Lula, Iwona; Bartoszewicz, Marzenna; Mahabady, Susan; Sedghizadeh, Parish Paymon

    2017-01-01

    Bone infections are a significant public health burden associated with morbidity and mortality in patients. Microbial biofilm pathogens are the causative agents in chronic osteomyelitis. Research on the pathogenesis of osteomyelitis has focused on indirect bone destruction by host immune cells and cytokines secondary to microbial insult. Direct bone resorption by biofilm pathogens has not yet been seriously considered. In this study, common osteomyelitis pathogens (Staphylococcus aureus, Pseudomonas aeruginosa, Candida albicans, and Streptococcus mutans) were grown as biofilms in multiple in vitro and ex vivo experiments to analyze quantitative and qualitative aspects of bone destruction during infection. Pathogens were grown as single or mixed species biofilms on the following substrates: hydroxyapatite, rat jawbone, or polystyrene wells, and in various media. Biofilm growth was evaluated by scanning electron microscopy and pH levels were monitored over time. Histomorphologic and quantitative effects of biofilms on tested substrates were analyzed by microcomputed tomography and quantitative cultures. All tested biofilms demonstrated significant damage to bone. Scanning electron microscopy indicated that all strains formed mature biofilms within 7 days on all substrate surfaces regardless of media. Experimental conditions impacted pH levels, although this had no impact on biofilm growth or bone destruction. Presence of biofilm led to bone dissolution with a decrease of total volume by 20.17±2.93% upon microcomputed tomography analysis, which was statistically significant as compared to controls (p <0.05, ANOVA). Quantitative cultures indicated that media and substrate did not impact biofilm formation (Kruskall-Wallis test, post-hoc Dunne's test; p <0.05). Overall, these results indicate that biofilms associated with osteomyelitis have the ability to directly resorb bone. These findings should lead to a more complete understanding of the etiopathogenesis of

  3. Immune Thrombocytopenia

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Immune Thrombocytopenia? Immune thrombocytopenia (THROM-bo-si-toe-PE-ne- ... from one person to another. Types of Immune Thrombocytopenia The two types of ITP are acute (temporary ...

  4. HIV-1 Receptor Binding Site-Directed Antibodies Using a VH1-2 Gene Segment Orthologue Are Activated by Env Trimer Immunization

    PubMed Central

    Bale, Shridhar; Phad, Ganesh E.; Guenaga, Javier; Wilson, Richard; Soldemo, Martina; McKee, Krisha; Sundling, Christopher; Mascola, John; Li, Yuxing; Wyatt, Richard T.; Karlsson Hedestam, Gunilla B.

    2014-01-01

    Broadly neutralizing antibodies (bNAbs) isolated from chronically HIV-1 infected individuals reveal important information regarding how antibodies target conserved determinants of the envelope glycoprotein (Env) spike such as the primary receptor CD4 binding site (CD4bs). Many CD4bs-directed bNAbs use the same heavy (H) chain variable (V) gene segment, VH1-2*02, suggesting that activation of B cells expressing this allele is linked to the generation of this type of Ab. Here, we identify the rhesus macaque VH1.23 gene segment to be the closest macaque orthologue to the human VH1-2 gene segment, with 92% homology to VH1-2*02. Of the three amino acids in the VH1-2*02 gene segment that define a motif for VRC01-like antibodies (W50, N58, flanking the HCDR2 region, and R71), the two identified macaque VH1.23 alleles described here encode two. We demonstrate that immunization with soluble Env trimers induced CD4bs-specific VH1.23-using Abs with restricted neutralization breadth. Through alanine scanning and structural studies of one such monoclonal Ab (MAb), GE356, we demonstrate that all three HCDRs are involved in neutralization. This contrasts to the highly potent CD4bs-directed VRC01 class of bNAb, which bind Env predominantly through the HCDR2. Also unlike VRC01, GE356 was minimally modified by somatic hypermutation, its light (L) chain CDRs were of average lengths and it displayed a binding footprint proximal to the trimer axis. These results illustrate that the Env trimer immunogen used here activates B cells encoding a VH1-2 gene segment orthologue, but that the resulting Abs interact distinctly differently with the HIV-1 Env spike compared to VRC01. PMID:25166308

  5. Interventional procedure based on nanorobots propelled and steered by flagellated magnetotactic bacteria for direct targeting of tumors in the human body.

    PubMed

    Martel, Sylvain; Felfoul, Ouajdi; Mohammadi, Mahmood; Mathieu, Jean-Baptiste

    2008-01-01

    Flagellated bacteria used as bio-actuators may prove to be efficient propulsion mechanisms for future hybrid medical nanorobots when operating in the microvasculature. Here, we briefly describe a medical interventional procedure where flagellated bacteria and more specifically MC-1 Magnetotactic Bacteria (MTB) can be used to propel and steer micro-devices and nanorobots under computer control to reach remote locations in the human body. In particular, we show through experimental results the potential of using MTB-tagged robots to deliver therapeutic agents to tumors even the ones located in deep regions of the human body. We also show that such bacterial nanorobots can be tracked inside the human body for enhanced targeting under computer guidance using MRI as imaging modality. MTB can not only be guided and controlled directly towards a specific target, but we also show experimentally that these flagellated bacterial nanorobots can be propelled and steered in vivo deeply through the interstitial region of a tumor. The targeting efficacy is increased when combined with larger ferromagnetic micro-carriers being propelled by magnetic gradients generated by a MRI platform to carry and release nanorobots propelled by a single flagellated bacterium near the arteriocapillar entry. Based on the experimental data obtained and the experience gathered during several experiments conducted in vivo with this new approach, a general medical interventional procedure is briefly described here in a biomedical engineering context.

  6. Effect of formative evaluation using direct observation of procedural skills in assessment of postgraduate students of obstetrics and gynecology: Prospective study

    PubMed Central

    KUMAR, NAINA; SINGH, NAMIT KANT; RUDRA, SAMAR; PATHAK, SWANAND

    2017-01-01

    Introduction: Direct Observation of Procedural Skills (DOPS) is a way of evaluating procedural skills through observation in the workplace. The purpose of this study was to assess the role of DOPS in teaching and assessment of postgraduate students and to know the effect of repeated DOPS on improvement of the skills and confidence of the students. Methods: In both phases, significant difference was observed between the two groups on first DOPS comparison (1st phase: p=0.000; 2nd phase: p=0.002), with simulation group performing better. Comparison of sixth DOPS in the two groups revealed no difference in both phases, but significant difference on first and sixth DOPS comparison in each group (p=0.000). Results: Repeated DOPS results in improved skills and confidence of students in managing real life obstetric emergencies irrespective of the teaching modality. Conclusion: Repeated DOPS results in improved skills and confidence of students in managing real life obstetric emergencies irrespective of the teaching modality. PMID:28124015

  7. Immune Response in Thyroid Cancer: Widening the Boundaries

    PubMed Central

    Ward, Laura Sterian

    2014-01-01

    The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756

  8. Integrated Immune

    NASA Technical Reports Server (NTRS)

    Crucian, Brian; Mehta, Satish; Stowe, Raymond; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarnece

    2010-01-01

    This slide presentation reviews the program to replace several recent studies about astronaut immune systems with one comprehensive study that will include in-flight sampling. The study will address lack of in-flight data to determine the inflight status of immune systems, physiological stress, viral immunity, to determine the clinical risk related to immune dysregulation for exploration class spaceflight, and to determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

  9. Direct solid sample analysis with graphite furnace atomic absorption spectrometry—a fast and reliable screening procedure for the determination of inorganic arsenic in fish and seafood.

    PubMed

    Zmozinski, Ariane V; Llorente-Mirandes, Toni; Damin, Isabel C F; López-Sánchez, José F; Vale, Maria Goreti R; Welz, Bernhard; Silva, Márcia M

    2015-03-01

    Direct solid sample analysis with graphite furnace atomic absorption spectrometry (SS-GF AAS) was investigated initially with the intention of developing a method for the determination of total As in fish and other seafood. A mixture of 0.1% Pd+0.06% Mg+0.06% Triton X-100 was used as the chemical modifier, added in solution over the solid samples, making possible the use of pyrolysis and atomization temperatures of 1200 °C and 2400 °C, respectively. The sample mass had to be limited to 0.25 mg, as the integrated absorbance did not increase further with increasing sample mass. Nevertheless, the recovery of As from several certified reference materials was of the order of 50% lower than the certified value. Strong molecular absorption due to the phosphorus monoxide molecule (PO) was observed with high-resolution continuum source AAS (HR CS AAS), which, however, did not cause any spectral interference. A microwave-assisted digestion with HNO3/H2O2 was also investigated to solve the problem; however, the results obtained for several certified reference materials were statistically not different from those found with direct SS-GF AAS. Accurate values were obtained using inductively coupled plasma mass spectrometry (ICP-MS) to analyze the digested samples, which suggested that organic As compounds are responsible for the low recoveries. HPLC-ICP-MS was used to determine the arsenobetaine (AB) concentration. Accurate results that were not different from the certified values were obtained when the AB concentration was added to the As concentration found by SS-GF AAS for most certified reference materials (CRM) and samples, suggesting that SS-GF AAS could be used as a fast screening procedure for inorganic As determination in fish and seafood.

  10. Controlling Salmonella infection in weanling pigs through water delivery of direct-fed microbials or organic acids. Part I: effects on growth performance, microbial populations, and immune status.

    PubMed

    Walsh, M C; Rostagno, M H; Gardiner, G E; Sutton, A L; Richert, B T; Radcliffe, J S

    2012-01-01

    Pigs (n = 88) weaned at 19 ± 2 d of age were used in a 14-d study to evaluate the effects of water-delivered direct-fed microbials (DFM) or organic acids on growth, immune status, Salmonella infection and shedding, and intestinal microbial populations after intranasal inoculation of Salmonella Typhimurium (10(10) cfu/pig). Pigs were challenged with Salmonella 6 d after commencement of water treatments. Treatments were 1) control diet; 2) control diet + DFM (Enterococcus faecium, Bacillus subtilis, and Bacillus licheniformis) in drinking water at 10(9) cfu/L for each strain of bacteria; 3) control diet + an organic acid-based blend (predominantly propionic, acetic, and benzoic acid) in drinking water at 2.58 mL/L; and 4) control diet + 55 mg/kg of carbadox. Serum samples were taken on d 6, 8, 10, and 14 for determination of tumor necrosis factor α (TNFα) concentrations. Fecal samples were taken on d 0, 5, 7, and 11 for determination of Salmonella shedding and enumeration of coliforms. Pigs were euthanized on d 6, 8, 10, and 14. Intestinal and cecal tissue and digesta and mesenteric lymph nodes were sampled and analyzed for Salmonella. Duodenal, jejunal, and ileal mucosal scrapings were sampled for measurement of mucosal TNFα concentrations. Water delivery of DFM prevented a decline in ADG on d 2 to 6 postchallenge compared with the negative control (P < 0.05). Coliform counts tended to be greater (P = 0.09) in the cecum of the DFM treatment group on d 2 postinfection compared with the negative control and acid treatment groups. However, Salmonella prevalence in the feces, gastrointestinal tract, or lymph nodes was not affected by water delivery of acids or DFM. Serum and mucosal TNFα concentrations were not affected by treatment throughout the study with the exception of ileal concentrations on d 4 postchallenge, which were greater in the negative control group compared with all other treatments (P < 0.05). The in-feed antibiotic was the only treatment that

  11. The intestinal microbiome, barrier function, and immune system in inflammatory bowel disease: a tripartite pathophysiological circuit with implications for new therapeutic directions

    PubMed Central

    Vindigni, Stephen M.; Zisman, Timothy L.; Suskind, David L.; Damman, Christopher J.

    2016-01-01

    We discuss the tripartite pathophysiological circuit of inflammatory bowel disease (IBD), involving the intestinal microbiota, barrier function, and immune system. Dysfunction in each of these physiological components (dysbiosis, leaky gut, and inflammation) contributes in a mutually interdependent manner to IBD onset and exacerbation. Genetic and environmental risk factors lead to disruption of gut homeostasis: genetic risks predominantly affect the immune system, environmental risks predominantly affect the microbiota, and both affect barrier function. Multiple genetic and environmental ‘hits’ are likely necessary to establish and exacerbate disease. Most conventional IBD therapies currently target only one component of the pathophysiological circuit, inflammation; however, many patients with IBD do not respond to immune-modulating therapies. Hope lies in new classes of therapies that target the microbiota and barrier function. PMID:27366227

  12. The intestinal microbiome, barrier function, and immune system in inflammatory bowel disease: a tripartite pathophysiological circuit with implications for new therapeutic directions.

    PubMed

    Vindigni, Stephen M; Zisman, Timothy L; Suskind, David L; Damman, Christopher J

    2016-07-01

    We discuss the tripartite pathophysiological circuit of inflammatory bowel disease (IBD), involving the intestinal microbiota, barrier function, and immune system. Dysfunction in each of these physiological components (dysbiosis, leaky gut, and inflammation) contributes in a mutually interdependent manner to IBD onset and exacerbation. Genetic and environmental risk factors lead to disruption of gut homeostasis: genetic risks predominantly affect the immune system, environmental risks predominantly affect the microbiota, and both affect barrier function. Multiple genetic and environmental 'hits' are likely necessary to establish and exacerbate disease. Most conventional IBD therapies currently target only one component of the pathophysiological circuit, inflammation; however, many patients with IBD do not respond to immune-modulating therapies. Hope lies in new classes of therapies that target the microbiota and barrier function.

  13. Immunization Coverage

    MedlinePlus

    ... and afford to pay for them. World Immunization Week The last week of April each year is marked by WHO and partners as World Immunization Week. It aims to accelerate action to increase awareness ...

  14. Behavioral Immunity in Insects

    PubMed Central

    de Roode, Jacobus C.; Lefèvre, Thierry

    2012-01-01

    Parasites can dramatically reduce the fitness of their hosts, and natural selection should favor defense mechanisms that can protect hosts against disease. Much work has focused on understanding genetic and physiological immunity against parasites, but hosts can also use behaviors to avoid infection, reduce parasite growth or alleviate disease symptoms. It is increasingly recognized that such behaviors are common in insects, providing strong protection against parasites and parasitoids. We review the current evidence for behavioral immunity in insects, present a framework for investigating such behavior, and emphasize that behavioral immunity may act through indirect rather than direct fitness benefits. We also discuss the implications for host-parasite co-evolution, local adaptation, and the evolution of non-behavioral physiological immune systems. Finally, we argue that the study of behavioral immunity in insects has much to offer for investigations in vertebrates, in which this topic has traditionally been studied. PMID:26466629

  15. Transplantation Immunity. Contemporary Views.

    PubMed

    Zaretskaya, Yuliya M.

    1999-12-01

    "Transplantation immunity in Cyclosporin era" is a special chapter in science under name transplantation immunity. Nowadays, practically all the organs can be grafted: kidney, heart, lung, liver, pancreas both as organ, and as islet cells, bone marrow from relative and unrelative donors. The broad spectrum of grafted organs gave one more surprising peculiarity of transplantation immunity: it operates with different strength after transplantation of various organs. If the decreasing gradient of transplantation immunity could be composed, then it appeared to be approximately in the following order: bone marrow - skin - kidney - heart - lung. The most complicated operating activity of transplantation immunity is occurring after bone marrow transplantation, especially from unrelative donor, because in bone marrow transplantation immunological process develops in both directions. Therefore now, bone marrow is the only organ (tissue), when the complete compatibility between donor and recipient is required after its transplantation; especially in cases with unrelative donors.

  16. Maternal immune transfer in mollusc.

    PubMed

    Wang, Lingling; Yue, Feng; Song, Xiaorui; Song, Linsheng

    2015-02-01

    Maternal immunity refers to the immunity transferred from mother to offspring via egg, playing an important role in protecting the offspring at early life stages and contributing a trans-generational effect on offspring's phenotype. Because fertilization is external in most of the molluscs, oocytes and early embryos are directly exposed to pathogens in the seawater, and thus maternal immunity could provide a better protection before full maturation of their immunological systems. Several innate immune factors including pattern recognition receptors (PRRs) like lectins, and immune effectors like lysozyme, lipopolysaccharide binding protein/bacterial permeability-increasing proteins (LBP/BPI) and antioxidant enzymes have been identified as maternally derived immune factors in mollusc eggs. Among these immune factors, some maternally derived lectins and antibacterial factors have been proved to endue mollusc eggs with effective defense ability against pathogen infection, while the roles of other factors still remain untested. The physiological condition of mollusc broodstock has a profound effect on their offspring fitness. Many other factors such as nutrients, pathogens, environment conditions and pollutants could exert considerable influence on the maternal transfer of immunity. The parent molluscs which have encountered an immune stimulation endow their offspring with a trans-generational immune capability to protect them against infections effectively. The knowledge on maternal transfer of immunity and the trans-generational immune effect could provide us with an ideal management strategy of mollusc broodstock to improve the immunity of offspring and to establish a disease-resistant family for a long-term improvement of cultured stocks.

  17. SEQUENTIAL IMMUNIZATION PROCEDURE AGAINST GROUP B ARBOVIRUSES.

    DTIC Science & Technology

    neuropathology as criteria of protection. It also protects against St. Louis encephalitis virus. A combination of 17D yellow fever vaccine plus dengue ...4 virus gives protection in monkeys against a challenge of dengue 1 virus. The subcutaneous or oral administration of Langat virus to spider monkeys

  18. DOPS (Direct Observation of Procedural Skills) in undergraduate skills-lab: Does it work? Analysis of skills-performance and curricular side effects

    PubMed Central

    Profanter, Christoph; Perathoner, Alexander

    2015-01-01

    Objective: Sufficient teaching and assessing clinical skills in the undergraduate setting becomes more and more important. In a surgical skills-lab course at the Medical University of Innsbruck fourth year students were teached with DOPS (direct observation of procedural skills). We analyzed whether DOPS worked or not in this setting, which performance levels could be reached compared to tutor teaching (one tutor, 5 students) and which curricular side effects could be observed. Methods: In a prospective randomized trial in summer 2013 (April – June) four competence-level-based skills were teached in small groups during one week: surgical abdominal examination, urethral catheterization (phantom), rectal-digital examination (phantom), handling of central venous catheters. Group A was teached with DOPS, group B with a classical tutor system. Both groups underwent an OSCE (objective structured clinical examination) for assessment. 193 students were included in the study. Altogether 756 OSCE´s were carried out, 209 (27,6%) in the DOPS- and 547 (72,3%) in the tutor-group. Results: Both groups reached high performance levels. In the first month there was a statistically significant difference (p<0,05) in performance of 95% positive OSCE items in the DOPS-group versus 88% in the tutor group. In the following months the performance rates showed no difference anymore and came to 90% in both groups. In practical skills the analysis revealed a high correspondence between positive DOPS (92,4%) and OSCE (90,8%) results. Discussion: As shown by our data DOPS furnish high performance of clinical skills and work well in the undergraduate setting. Due to the high correspondence of DOPS and OSCE results DOPS should be considered as preferred assessment tool in a students skills-lab. The approximation of performance-rates within the months after initial superiority of DOPS could be explained by an interaction between DOPS and tutor system: DOPS elements seem to have improved

  19. DNA Immunization

    PubMed Central

    Wang, Shixia; Lu, Shan

    2013-01-01

    DNA immunization was discovered in early 1990s and its use has been expanded from vaccine studies to a broader range of biomedical research, such as the generation of high quality polyclonal and monoclonal antibodies as research reagents. In this unit, three common DNA immunization methods are described: needle injection, electroporation and gene gun. In addition, several common considerations related to DNA immunization are discussed. PMID:24510291

  20. Combination of interleukin-12 gene therapy, metronomic cyclophosphamide and DNA cancer vaccination directs all arms of the immune system towards tumor eradication.

    PubMed

    Denies, Sofie; Cicchelero, Laetitia; Van Audenhove, Isabel; Sanders, Niek N

    2014-08-10

    In this work a combination therapy that acts upon the immune suppressive, the innate and specific arms of the immune system is proposed. This combination therapy, which consists of intratumoral interleukin-12 (IL-12) gene therapy, human tyrosinase (hTyr) DNA vaccination and metronomic cyclophosphamide (CPX), was evaluated in a B16-F10 mouse model. The following groups were compared: (1) no treatment, (2) control vector, (3) intratumoral IL-12 gene therapy, (4) intratumoral IL-12 gene therapy+metronomic CPX, (5) intratumoral IL-12 gene therapy+metronomic CPX+hTyr DNA vaccination. Next to clinical efficacy and safety, we characterized acute effects of IL-12 and anti-tumor immune response after a second tumor challenge. All treatment groups showed increased survival and higher cure rates than control groups. Survival of non-cured mice was increased when metronomic CPX was combined with IL-12 gene therapy. Furthermore, mice that received metronomic CPX had significantly lower percentages of regulatory T cells. Addition of the hTyr DNA vaccine increased cure rate and resulted in increased survival compared to other treatment groups. We also demonstrated that the manifest necrosis within days after IL-12 gene therapy is at least partly due to IL-12 mediated activation of NK cells. All cured mice were resistant to a second challenge. A humoral memory response against the tumor cells was observed in all groups that received IL-12 gene therapy, while a cellular memory response was observed only in the vaccinated mice. In conclusion, every component of this combination treatment contributed a unique immunologic trait with associated clinical benefits.

  1. Human pathogenic Borrelia spielmanii sp. nov. resists complement-mediated killing by direct binding of immune regulators factor H and factor H-like protein 1.

    PubMed

    Herzberger, Pia; Siegel, Corinna; Skerka, Christine; Fingerle, Volker; Schulte-Spechtel, Ulrike; van Dam, Alje; Wilske, Bettina; Brade, Volker; Zipfel, Peter F; Wallich, Reinhard; Kraiczy, Peter

    2007-10-01

    Borrelia spielmanii sp. nov. has recently been shown to be a novel human pathogenic genospecies that causes Lyme disease in Europe. In order to elucidate the immune evasion mechanisms of B. spielmanii, we compared the abilities of isolates obtained from Lyme disease patients and tick isolate PC-Eq17 to escape from complement-mediated bacteriolysis. Using a growth inhibition assay, we show that four B. spielmanii isolates, including PC-Eq17, are serum resistant, whereas a single isolate, PMew, was more sensitive to complement-mediated lysis. All isolates activated complement in vitro, as demonstrated by covalent attachment of C3 fragments; however, deposition of the later activation products C6 and C5b-9 was restricted to the moderately serum-resistant isolate PMew and the serum-sensitive B. garinii isolate G1. Furthermore, serum adsorption experiments revealed that all B. spielmanii isolates acquired the host alternative pathway regulators factor H and factor H-like protein (FHL-1) from human serum. Both complement regulators retained their factor I-mediated C3b inactivation activities when bound to spirochetes. In addition, two distinct factor H and FHL-1 binding proteins, BsCRASP-1 and BsCRASP-2, were identified, which we estimated to be approximately 23 to 25 kDa in mass. A further factor H binding protein, BsCRASP-3, was found exclusively in the tick isolate, PC-Eq17. This is the first report describing an immune evasion mechanism utilized by B. spielmanii sp. nov., and it demonstrates the capture of human immune regulators to resist complement-mediated killing.

  2. Immunometabolism: Cellular Metabolism Turns Immune Regulator*

    PubMed Central

    Loftus, Róisín M.; Finlay, David K.

    2016-01-01

    Immune cells are highly dynamic in terms of their growth, proliferation, and effector functions as they respond to immunological challenges. Different immune cells can adopt distinct metabolic configurations that allow the cell to balance its requirements for energy, molecular biosynthesis, and longevity. However, in addition to facilitating immune cell responses, it is now becoming clear that cellular metabolism has direct roles in regulating immune cell function. This review article describes the distinct metabolic signatures of key immune cells, explains how these metabolic setups facilitate immune function, and discusses the emerging evidence that intracellular metabolism has an integral role in controlling immune responses. PMID:26534957

  3. Immunometabolism: Cellular Metabolism Turns Immune Regulator.

    PubMed

    Loftus, Róisín M; Finlay, David K

    2016-01-01

    Immune cells are highly dynamic in terms of their growth, proliferation, and effector functions as they respond to immunological challenges. Different immune cells can adopt distinct metabolic configurations that allow the cell to balance its requirements for energy, molecular biosynthesis, and longevity. However, in addition to facilitating immune cell responses, it is now becoming clear that cellular metabolism has direct roles in regulating immune cell function. This review article describes the distinct metabolic signatures of key immune cells, explains how these metabolic setups facilitate immune function, and discusses the emerging evidence that intracellular metabolism has an integral role in controlling immune responses.

  4. Immune System

    EPA Science Inventory

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  5. DOPS (Direct Observation of Procedural Skills) in undergraduate skills-lab: Does it work? Analysis of skills-performance and curricular side effects.

    PubMed

    Profanter, Christoph; Perathoner, Alexander

    2015-01-01

    Zielsetzung: Die suffiziente Vermittlung und Prüfung klinisch-praktischer Fertigkeiten bereits während des Medizinstudiums gewinnt zunehmend an Bedeutung. Im Rahmen des chirurgischen Pflichtpraktikums an der Medizinischen Universität Innsbruck wurde untersucht, ob das Teaching mittels DOPS im Skills-Lab Setting überhaupt funktioniert, zu welcher Performanz von klinischen Fertigkeiten DOPS (direct observation of procedural skills) im Vergleich zu einem Tutor-System (1 ärztlicher Tutor à 5 Studierende) führen und welche curricularen Side-Effects zu beobachten sind.Methoden: Im Sommersemester 2013 (Monate April – Juni) wurden im Rahmen einer prospektiv randomisierten Studie 4 kompetenzlevelbasierte Skills mittels DOPS (Gruppe A) und einem klassischen Tutor System (Gruppe B) in einwöchigen Kleingruppen-Kursen gelehrt und mittels OSCE (objective structured clinical examination) geprüft: Chirurgische Abdominaluntersuchung, Harnkatheteranlage (Phantom), rektal-digitale Untersuchung (Phantom), Handhabung zentralvenöser Katheter. In die Studie wurden 193 Studierende inkludiert. Insgesamt wurden 756 Einzel-OSCE´s durchgeführt, davon entfielen auf die DOPS-Gruppe 209 (27,6%) und auf die Tutor-Gruppe 547 (72,3%).Ergebnisse: Die Beobachtung der Performanz zeigt sehr gute Resultate in beiden Gruppen. Im ersten Monat wies die DOPS Gruppe gegenüber der Tutorgruppe einen statistisch signifikanten (p<0,05) Performanzunterschied von rund 95% versus 88% an vollständig erfüllten OSCE-Items auf. In den Folgemonaten glichen sich die Performanzen beider Gruppen weitgehend an und betrugen in beiden Gruppen rund 90%. Bei den praktischen Fertigkeiten zeigte sich eine hohe Übereinstimmung zwischen DOPS- und OSCE-Resultaten (positive Ergebnisse: DOPS 92,4%, OSCE 90,8%).Diskussion: Die Studiendaten zeigen, dass DOPS eine hohe Performanz klinischer Fertigkeiten erbringen und im studentischen Skills-Lab Setting gut funktionieren. Durch die hohe Übereinstimmung von DOPS- und

  6. Pyroshock prediction procedures

    NASA Astrophysics Data System (ADS)

    Piersol, Allan G.

    2002-05-01

    Given sufficient effort, pyroshock loads can be predicted by direct analytical procedures using Hydrocodes that analytically model the details of the pyrotechnic explosion and its interaction with adjacent structures, including nonlinear effects. However, it is more common to predict pyroshock environments using empirical procedures based upon extensive studies of past pyroshock data. Various empirical pyroshock prediction procedures are discussed, including those developed by the Jet Propulsion Laboratory, Lockheed-Martin, and Boeing.

  7. Innate immunity.

    PubMed

    Revillard, Jean-Pierre

    2002-01-01

    For more than half a century immunological research has been almost exclusively orientated towards the acquired immune response and the mechanisms of immune tolerance. Major discoveries have enabled us to better understand the functioning of the specific immune system: the structure of antibody molecules, the genetic mechanisms leading to the molecular diversity of B (BCR) and T (TCR) lymphocyte antigen receptors, the biological function of major histocompatibility complex (MHC) molecules in the presentation of peptides to alpha/beta receptor bearing T lymphocytes, the processes of positive and negative selection of lymphocytes during the course of their differentiation. The major role of specific or acquired immunity has been shown by the rapidly lethal character of severe combined immune deficiency diseases and various alterations in the mechanisms of tolerance have been proposed to explain the chronic inflammatory illnesses which are considered to be auto-immune. Natural or innate immunity has been known since the first description of an inflammatory reaction attributed to Cornelius Celsus. It entered into the scientific era at the end of the 19th century with the discovery of phagocytes by Metchnikoff and of the properties of the complement system by Bordet [1] but due to the vastness of the field and its lack of clear definition, it failed to excite the interest of researchers. The discovery of cytokines and progress in knowledge of the mechanisms of the inflammatory reaction have certainly helped to banish preconceived ideas about natural immunity, which was wrongly labelled as non-specific. This has led to the proposition of a wider role for immune functions beyond the level of the cell or the organism [2] and to a better understanding of the importance of the immediate defence mechanisms and their role in the later orientation of the acquired response.

  8. Maternal Immunization

    PubMed Central

    Chu, Helen Y.; Englund, Janet A.

    2014-01-01

    Maternal immunization has the potential to protect the pregnant woman, fetus, and infant from vaccine-preventable diseases. Maternal immunoglobulin G is actively transported across the placenta, providing passive immunity to the neonate and infant prior to the infant's ability to respond to vaccines. Currently inactivated influenza, tetanus toxoid, and acellular pertussis vaccines are recommended during pregnancy. Several other vaccines have been studied in pregnancy and found to be safe and immunogenic and to provide antibody to infants. These include pneumococcus, group B Streptococcus, Haemophilus influenzae type b, and meningococcus vaccines. Other vaccines in development for potential maternal immunization include respiratory syncytial virus, herpes simplex virus, and cytomegalovirus vaccines. PMID:24799324

  9. Effects of Bacillus subtilis-based direct-fed microbials on growth performance, immune characteristics and resistance against experimental coccidiosis in broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The present experiment was conducted to study the effects of dietary Bacillus-based direct-fed microbials (DFMs) on cytokine expression patterns, intestinal intraepithelial lymphocyte (IEL) subpopulation, splenocyte proliferation, macrophage functions and resistance against experimental coccidiosis ...

  10. Immune response

    MedlinePlus Videos and Cool Tools

    The immune system includes specialized white blood cells, called lymphocytes that adapt themselves to fight specific foreign invaders. These cells develop into two groups in the bone marrow. From the bone ...

  11. Immune tolerance induction by integrating innate and adaptive immune regulators

    PubMed Central

    Suzuki, Jun; Ricordi, Camillo; Chen, Zhibin

    2009-01-01

    A diversity of immune tolerance mechanisms have evolved to protect normal tissues from immune damage. Immune regulatory cells are critical contributors to peripheral tolerance. These regulatory cells, exemplified by the CD4+Foxp3+ regulatory T (Treg) cells and a recently identified population named myeloid-derived suppressor cells (MDSCs), regulate immune responses and limiting immune-mediated pathology. In a chronic inflammatory setting, such as allograft-directed immunity, there may be a dynamic “crosstalk” between the innate and adaptive immunomodulatory mechanisms for an integrated control of immune damage. CTLA4-B7-based interaction between the two branches may function as a molecular “bridge” to facilitate such “crosstalk”. Understanding the interplays among Treg cells, innate suppressors and pathogenic effector T (Teff) cells will be critical in the future to assist in the development of therapeutic strategies to enhance and synergize physiological immunosuppressive elements in the innate and adaptive immune system. Successful development of localized strategies of regulatory cell therapies could circumvent the requirement for very high number of cells and decrease the risks associated with systemic immunosuppression. To realize the potential of innate and adaptive immune regulators for the still-elusive goal of immune tolerance induction, adoptive cell therapies may also need to be coupled with agents enhancing endogenous tolerance mechanisms. PMID:19919733

  12. Antimicrobial effects of murine mesenchymal stromal cells directed against Toxoplasma gondii and Neospora caninum: role of immunity-related GTPases (IRGs) and guanylate-binding proteins (GBPs).

    PubMed

    Spekker, K; Leineweber, M; Degrandi, D; Ince, V; Brunder, S; Schmidt, S K; Stuhlsatz, S; Howard, J C; Schares, G; Degistirici, O; Meisel, R; Sorg, R V; Seissler, J; Hemphill, A; Pfeffer, K; Däubener, W

    2013-06-01

    Mesenchymal stromal cells (MSCs) have a multilineage differentiation potential and provide immunosuppressive and antimicrobial functions. Murine as well as human MSCs restrict the proliferation of T cells. However, species-specific differences in the underlying molecular mechanisms have been described. Here, we analyzed the antiparasitic effector mechanisms active in murine MSCs. Murine MSCs, in contrast to human MSCs, could not restrict the growth of a highly virulent strain of Toxoplasma gondii (BK) after stimulation with IFN-γ. However, the growth of a type II strain of T. gondii (ME49) was strongly inhibited by IFN-γ-activated murine MSCs. Immunity-related GTPases (IRGs) as well as guanylate-binding proteins (GBPs) contributed to this antiparasitic effect. Further analysis showed that IFN-γ-activated mMSCs also inhibit the growth of Neospora caninum, a parasite belonging to the apicomplexan group as well. Detailed studies with murine IFN-γ-activated MSC indicated an involvement in IRGs like Irga6, Irgb6 and Irgd in the inhibition of N. caninum. Additional data showed that, furthermore, GBPs like mGBP1 and mGBP2 could have played a role in the anti-N. caninum effect of murine MSCs. These data underline that MSCs, in addition to their regenerative and immunosuppressive activity, function as antiparasitic effector cells as well. However, IRGs are not present in the human genome, indicating a species-specific difference in anti-T. gondii and anti-N. caninum effect between human and murine MSCs.

  13. The immunity status of demodecosis patients.

    PubMed

    Kogan, B G; Koljadenko, V G; Golovtchenko, D Y

    1991-01-01

    49 patients with different clinical types of demodecosis were examined. There was a pronounced decrease in the T-cellular immunity state on the skin. The state of immunity was directly dependent on the degree of clinical manifestation and when the patients contracted the disease, and it correlated with data from the humoral immunity state study (CIC).

  14. Human Articular Chondrocytes Regulate Immune Response by Affecting Directly T Cell Proliferation and Indirectly Inhibiting Monocyte Differentiation to Professional Antigen-Presenting Cells

    PubMed Central

    Pereira, Rui C.; Martinelli, Daniela; Cancedda, Ranieri; Gentili, Chiara; Poggi, Alessandro

    2016-01-01

    Autologous chondrocyte implantation is the current gold standard cell therapy for cartilage lesions. However, in some instances, the heavily compromised health of the patient can either impair or limit the recovery of the autologous chondrocytes and a satisfactory outcome of the implant. Allogeneic human articular chondrocytes (hAC) could be a good alternative, but the possible immunological incompatibility between recipient and hAC donor should be considered. Herein, we report that allogeneic hAC inhibited T lymphocyte response to antigen-dependent and -independent proliferative stimuli. This effect was maximal when T cells and hAC were in contact and it was not relieved by the addition of exogenous lymphocyte growth factor interleukin (IL)-2. More important, hAC impaired the differentiation of peripheral blood monocytes induced with granulocyte monocyte colony-stimulating factor and IL-4 (Mo) to professional antigen-presenting cells, such as dendritic cells (DC). Indeed, a marked inhibition of the onset of the CD1a expression and an ineffective downregulation of CD14 antigens was observed in Mo–hAC co-cultures. Furthermore, compared to immature or mature DC, Mo from Mo–hAC co-cultures did not trigger an efficacious allo-response. The prostaglandin (PG) E2 present in the Mo–hAC co-culture conditioned media is a putative candidate of the hAC-mediated inhibition of Mo maturation. Altogether, these findings indicate that allogeneic hAC inhibit, rather than trigger, immune response and strongly suggest that an efficient chondrocyte implantation could be possible also in an allogeneic setting. PMID:27822208

  15. Development and Validation of a Fast Procedure to Analyze Amoxicillin in River Waters by Direct-Injection LC-MS/MS

    ERIC Educational Resources Information Center

    Homem, Vera; Alves, Arminda; Santos, Lu´cia

    2014-01-01

    A laboratory application with a strong component in analytical chemistry was designed for undergraduate students, in order to introduce a current problem in the environmental science field, the water contamination by antibiotics. Therefore, a simple and rapid method based on direct injection and high performance liquid chromatography-tandem mass…

  16. The Differential Effects of Direct Instruction and Procedural Facilitators on the Writing Outcomes of Fifth-Grade Students with Behavior Disorders

    ERIC Educational Resources Information Center

    Patterson, DaShaunda; Houchins, David E.; Jolivette, Kristine; Heflin, Juane; Fredrick, Laura

    2011-01-01

    Effective written expression is a necessary form of communication and one of the most difficult tasks for students with disabilities to master. Few instructional strategies for writing have been validated specifically for students with emotional and behavior disorders. This single-subject study evaluated the effect of a Direct Instruction program…

  17. Effects of Direct Instruction Plus Procedural Facilitation on the Expository Writing of Adolescents with Emotional and Behavioral Disabilities in Residential Schools

    ERIC Educational Resources Information Center

    White, Mark W.; Houchins, David E.; Viel-Ruma, Kimberly A.; Dever, Bridget V.

    2014-01-01

    This study investigated the effects of the "Expressive Writing (EW)" direct instruction curriculum on the expository writing skills of secondary grade students with serious emotional and behavioral disabilities (EBD). The "EW" program targets writing mechanics, sentence writing, and editing but does not include pre-writing…

  18. Starclose SE® hemostasis after 6F direct antegrade superficial femoral artery access distal to the femoral head for peripheral endovascular procedures in obese patients

    PubMed Central

    Spiliopoulos, Stavros; Kitrou, Panagiotis; Christeas, Nikolaos; Karnabatidis, Dimitris

    2016-01-01

    PURPOSE Direct superficial femoral artery (SFA) antegrade puncture is a valid alternative to common femoral artery (CFA) access for peripheral vascular interventions. Data investigating vascular closure device (VCD) hemostasis of distant SFA 6F access are limited. We aimed to investigate the safety and effectiveness of the Starclose SE® VCD for hemostasis, following direct 6F antegrade SFA access distal to the femoral head. METHODS This prospective, single-center study included patients who were not suitable for CFA puncture and were scheduled to undergo peripheral endovascular interventions using direct antegrade SFA 6F access, at least 2 cm below the inferior edge of femoral head. Hemostasis was obtained with the Starclose SE® VCD (Abbott Laboratories). Primary endpoints were successful hemostasis rate and periprocedural (30-day) major complication rate. Secondary endpoint was the rate of minor complications. Clinical and Doppler ultrasound follow-up was performed at discharge and at one month. RESULTS Between September 2014 and August 2015, a total of 30 patients (21 male; 70.0%) with a mean body mass index of 41.2 kg/m2 were enrolled. Mean age was 72±9 years (range, 67–88 years). Most patients suffered from critical limb ischemia (87.1%) and diabetes (61.3%). Calcifications were present in eight cases (26.6%). Reason for direct SFA puncture was obesity (100%). Successful hemostasis was achieved in 100% of the cases. No major complications were noted after one-month follow-up. Minor complications included two <5 cm hematomas (6.6%) not necessitating treatment. CONCLUSION In this prospective study, Starclose SE® VCD was safe and effective for hemostasis of antegrade direct SFA puncture. Uncomplicated hemostasis was achieved even in cases of puncturing 2 to 7 cm below the inferior edge of the femoral head. PMID:27641942

  19. Making healthier or killing enemies? Bacterial volatile-elicited plant immunity plays major role upon protection of Arabidopsis than the direct pathogen inhibition

    PubMed Central

    Sharifi, Rouhallah; Ryu, Choong-Min

    2016-01-01

    ABSTRACT Bacterial volatiles protect plants either by directly inhibiting a pathogenic fungus or by improving the defense capabilities of plants. The effect of bacterial volatiles on fungal growth was dose-dependent. A low dosage did not have a noticeable effect on Botrytis cinerea growth and development, but was sufficient to elicit induced resistance in Arabidopsis thaliana. Bacterial volatiles displayed negative effects on biofilm formation on a polystyrene surface and in in planta leaf colonization of B. cinerea. However, bacterial volatile-mediated induced resistance was the major mechanism mediating protection of plants from B. cinerea. It was responsible for more than 90% of plant protection in comparison with direct fungal inhibition. Our results broaden our knowledge of the role of bacterial volatiles in plant protection. PMID:27574539

  20. Making healthier or killing enemies? Bacterial volatile-elicited plant immunity plays major role upon protection of Arabidopsis than the direct pathogen inhibition.

    PubMed

    Sharifi, Rouhallah; Ryu, Choong-Min

    2016-01-01

    Bacterial volatiles protect plants either by directly inhibiting a pathogenic fungus or by improving the defense capabilities of plants. The effect of bacterial volatiles on fungal growth was dose-dependent. A low dosage did not have a noticeable effect on Botrytis cinerea growth and development, but was sufficient to elicit induced resistance in Arabidopsis thaliana. Bacterial volatiles displayed negative effects on biofilm formation on a polystyrene surface and in in planta leaf colonization of B. cinerea. However, bacterial volatile-mediated induced resistance was the major mechanism mediating protection of plants from B. cinerea. It was responsible for more than 90% of plant protection in comparison with direct fungal inhibition. Our results broaden our knowledge of the role of bacterial volatiles in plant protection.

  1. 28 CFR 35.178 - State immunity.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 1 2013-07-01 2013-07-01 false State immunity. 35.178 Section 35.178 Judicial Administration DEPARTMENT OF JUSTICE NONDISCRIMINATION ON THE BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES Compliance Procedures § 35.178 State immunity. A State shall not be...

  2. 28 CFR 35.178 - State immunity.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false State immunity. 35.178 Section 35.178 Judicial Administration DEPARTMENT OF JUSTICE NONDISCRIMINATION ON THE BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES Compliance Procedures § 35.178 State immunity. A State shall not be...

  3. 28 CFR 35.178 - State immunity.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 1 2012-07-01 2012-07-01 false State immunity. 35.178 Section 35.178 Judicial Administration DEPARTMENT OF JUSTICE NONDISCRIMINATION ON THE BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES Compliance Procedures § 35.178 State immunity. A State shall not be...

  4. 28 CFR 35.178 - State immunity.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 28 Judicial Administration 1 2011-07-01 2011-07-01 false State immunity. 35.178 Section 35.178 Judicial Administration DEPARTMENT OF JUSTICE NONDISCRIMINATION ON THE BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES Compliance Procedures § 35.178 State immunity. A State shall not be...

  5. [Treatment with inhibitors of new oral direct anticoagulants in patients with severe bleedings or urgent surgical procedures. The new dabigatran antidote: the place of idarucizumab in clinical practice].

    PubMed

    Boda, Zoltán

    2016-03-20

    Only vitamin K antagonists could be applied as oral anticoagulants over the past six decades. Coumarols have narrow therapeutic range, and unpredictable anticoagulant effects are resulted by multiple drug interactions. Therefore, regular routine monitoring of the international normalized ratio is necessary. There are two groups of factor-specific anticoagulants: molecules with anti-FIIa (dabigatran) and anti-FXa (rivaroxaban, apixaban and edoxaban) effect. Author summarizes the most important clinical features of the new oral anticoagulants, their indications and the possibilities of laboratory controls. Bleedings are the most important side effects of anticoagulants. This review summarizes the current published evidences for new oral anticoagulants reversal (non-specific and specific) agents, especially in cases with severe acute bleedings or urgent surgery procedures. It reports on how to use inhibitors, the recommended doses and the most important clinical results. The review focuses on idarucizumab - already approved by the U.S. Food and Drug Administration and the European Medicines Agency - which has a key role as the first specific inhibitor of dabigatran.

  6. Plant Immunity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plants are faced with defending themselves against a multitude of pathogens, including bacteria, fungi, viruses, nematodes, etc. Immunity is multi-layered and complex. Plants can induce defenses when they recognize small peptides, proteins or double-stranded RNA associated with pathogens. Recognitio...

  7. 2011: the immune hallmarks of cancer.

    PubMed

    Cavallo, Federica; De Giovanni, Carla; Nanni, Patrizia; Forni, Guido; Lollini, Pier-Luigi

    2011-03-01

    Ten years after the publication of the position paper "The hallmarks of cancer" (Hanahan and Weinberg Cell 100:57-70, 2000), it has become increasingly clear that mutated cells on their way to giving rise to a tumor have also to learn how to thrive in a chronically inflamed microenvironment, evade immune recognition, and suppress immune reactivity. Genetic and molecular definition of these three immune hallmarks of cancer offers the opportunity to learn how to deploy specific countermeasures to reverse the situation in favor of the immune system and, eventually, the patient. This new information could be channeled to address what seem to be the three major hallmarks for the immune control of cancer progression: effective procedures to activate immune reactivity; characterization of not-disposable oncoantigens; and counteraction of immune suppression.

  8. Candidate immune biomarkers for radioimmunotherapy.

    PubMed

    Levy, Antonin; Nigro, Giulia; Sansonetti, Philippe J; Deutsch, Eric

    2017-02-28

    Newly available immune checkpoint blockers (ICBs), capable to revert tumor immune tolerance, are revolutionizing the anticancer armamentarium. Recent evidence also established that ionizing radiation (IR) could produce antitumor immune responses, and may as well synergize with ICBs. Multiple radioimmunotherapy combinations are thenceforth currently assessed in early clinical trials. Past examples have highlighted the need for treatment personalization, and there is an unmet need to decipher immunological biomarkers that could allow selecting patients who could benefit from these promising but expensive associations. Recent studies have identified potential predictive and prognostic immune assays at the cellular (tumor microenvironment composition), genomic (mutational/neoantigen load), and peripheral blood levels. Within this review, we collected the available evidence regarding potential personalized immune biomarker-directed radiation therapy strategies that might be used for patient selection in the era of radioimmunotherapy.

  9. Immune Cell Regulatory Pathways Unexplored as Host-Directed Therapeutic Targets for Mycobacterium tuberculosis: An Opportunity to Apply Precision Medicine Innovations to Infectious Diseases

    PubMed Central

    Mahon, Robert N.; Hafner, Richard

    2015-01-01

    The lack of novel antimicrobial drugs in development for tuberculosis treatment has provided an impetus for the discovery of adjunctive host-directed therapies (HDTs). Several promising HDT candidates are being evaluated, but major advancement of tuberculosis HDTs will require understanding of the master or “core” cell signaling pathways that control intersecting immunologic and metabolic regulatory mechanisms, collectively described as “immunometabolism.” Core regulatory pathways conserved in all eukaryotic cells include poly (ADP-ribose) polymerases (PARPs), sirtuins, AMP-activated protein kinase (AMPK), and mechanistic target of rapamycin (mTOR) signaling. Critical interactions of these signaling pathways with each other and their roles as master regulators of immunometabolic functions will be addressed, as well as how Mycobacterium tuberculosis is already known to influence various other cell signaling pathways interacting with them. Knowledge of these essential mechanisms of cell function regulation has led to breakthrough targeted treatment advances for many diseases, most prominently in oncology. Leveraging these exciting advances in precision medicine for the development of innovative next-generation HDTs may lead to entirely new paradigms for treatment and prevention of tuberculosis and other infectious diseases. PMID:26409283

  10. State of the Art, Unresolved Issues, and Future Research Directions in the Fight against Hepatitis C Virus: Perspectives for Screening, Diagnostics of Resistances, and Immunization

    PubMed Central

    Ansaldi, Filippo

    2016-01-01

    Hepatitis C virus (HCV) still represents a major public health threat, with a dramatic burden from both epidemiological and clinical points of view. New generation of direct-acting antiviral agents (DAAs) has been recently introduced in clinical practice promising to cure HCV and to overcome the issues related to the interferon-based therapies. However, the emergence of drug resistance and the suboptimal activity of DAAs therapies against diverse HCV genotypes have been observed, determining treatment failure and hampering an effective control of HCV spread worldwide. Moreover, these treatments remain poorly accessible, particularly in low-income countries. Finally, effective screening strategy is crucial to early identifying and treating all HCV chronically infected patients. For all these reasons, even though new drugs may contribute to impacting HCV spread worldwide a preventive HCV vaccine remains a cornerstone in the road to significantly reduce the HCV spread globally, with the ultimate goal of its eradication. Advances in molecular vaccinology, together with a strong financial, political, and societal support, will enable reaching this fundamental success in the coming years. In this comprehensive review, the state of the art about these major topics in the fight against HCV and the future of research in these fields are discussed. PMID:27843956

  11. Preservation and analytical procedures for the analysis of chloro-s-triazines and their chlorodegradate products in drinking waters using direct injection liquid chromatography tandem mass spectrometry.

    PubMed

    Smith, Glynda A; Pepich, Barry V; Munch, David J

    2008-08-22

    A direct injection, liquid chromatography tandem mass spectrometry (LC-MS/MS) method has been developed for the analysis of the chloro-s-triazine herbicides and their degradates in finished drinking water. The target compounds in the method were selected based on their inclusion in a common mechanism group (CMG) because of their ability to induce a similar toxic effect through a common mechanism of toxicity. The target list includes the chloro-s-triazines (atrazine, simazine, cyanazine, and propazine) and their dealkylated degradates (desethylatrazine, desisopropylatrazine, and diaminochlorotriazine). Potential matrix effects are minimized by the use of individual isotopically enriched internal standards. Analyte stability in finished chlorinated drinking water samples is ensured through careful selection of proper dechlorinating and antimicrobial reagents and through buffering sample pH. In the absence of proper dechlorination, the target analytes were found to degrade over a short period of time, even under refrigerated storage conditions. The final method has adequate sensitivity to accurately detect all target analytes at or below 0.1 microg/L and displays sufficient precision and robustness to warrant publication as EPA Method 536.

  12. The Usefulness of Three-Dimensional Angiography with a Flat Panel Detector of Direct Conversion Type in a Transcatheter Arterial Chemoembolization Procedure for Hepatocellular Carcinoma: Initial Experience

    SciTech Connect

    Kakeda, Shingo Korogi, Yukunori; Hatakeyama, Yoshihisa; Ohnari, Norihiro; Oda, Nobuhiro; Nishino, Kazuyoshi; Miyamoto, Wataru

    2008-03-15

    The purpose of this study was to assess the usefulness of a three-dimensional (3D) angiography system using a flat panel detector of direct conversion type in treatments with subsegmental transcatheter arterial chemoembolization (TACE) for hepatocellular carcinomas (HCCs). Thirty-six consecutive patients who underwent hepatic angiography were prospectively examined. First, two radiologists evaluated the degree of visualization of the peripheral branches of the hepatic arteries on 3D digital subtraction angiography (DSA). Then the radiologists evaluated the visualization of tumor staining and feeding arteries in 25 patients (30 HCCs) who underwent subsegmental TACE. The two radiologists who performed the TACE assessed whether the additional information provided by 3D DSA was useful for treatments. In 34 (94.4%) of 36 patients, the subsegmental branches of the hepatic arteries were sufficiently visualized. The feeding arteries of HCCs were sufficiently visualized in 28 (93%) of 30 HCCs, whereas tumor stains were sufficiently visualized in 18 (60%). Maximum intensity projection images were significantly superior to volume recording images for visualization of the tumor staining and feeding arteries of HCCs. In 27 (90%) of 30 HCCs, 3D DSA provided additional useful information for subsegmental TACE. The high-quality 3D DSA with flat panel detector angiography system provided a precise vascular road map, which was useful for performing subsegmental TACE .of HCCs.

  13. Multivariate approach in the optimization procedures for the direct determination of manganese in serum samples by graphite furnace atomic absorption spectrometry.

    PubMed

    Fabrino, Henrique José Ferraz; Silveira, Josianne Nicácio; Neto, Waldomiro Borges; Goes, Alfredo Miranda; Beinner, Mark Anthony; da Silva, José Bento Borba

    2011-10-01

    A method for direct determination of manganese (Mn) in human serum by graphite furnace atomic absorption spectrometry (GFAAS) was proposed in this work. The samples were only diluted 1:4 with nitric acid 1% (v/v) and Triton(®) X-100 0.1% (v/v). The optimization of the instrumental conditions was made using multivariate approach. A factorial design (2(3)) was employed to investigate the tendency of the most intense absorbance signal. The pyrolysis and atomization temperatures and the use of modifier were available and only the parameter modifier use did not have a significant effect on the response. A Center Composed Design (CCD) presented best temperatures of 430 °C and 2568 °C for pyrolysis and atomization, respectively. The method allowed the determination of manganese with a curve varying from 0.7 to 3.3 μg/L. Recovery studies in three concentration levels (n=7 for each level) presented results from 98 ± 5 to 102 ± 7 %. The detection limit was 0.2 μg/L, the quantifying limit was 0.7 μg/L, and the characteristic mass, 1.3 ± 0.2 pg. Intra- and interassay studies showed coefficients of variation of 4.7-7.0% (n=21) and 6-8%(n=63), respectively. The method was applied for the determination of manganese in 53 samples obtaining concentrations from 3.9 to 13.7 μg/L.

  14. Immunization Schedules for Adults

    MedlinePlus

    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedules for Adults in Easy-to-read Formats ... previous immunizations. View or Print a Schedule Recommended Immunizations for Adults (19 Years and Older) by Age ...

  15. Immune System (For Parents)

    MedlinePlus

    ... Old Feeding Your 1- to 2-Year-Old Immune System KidsHealth > For Parents > Immune System A A A ... can lead to illness and infection. About the Immune System The immune system is the body's defense against ...

  16. The most common friend first immunization

    NASA Astrophysics Data System (ADS)

    Nian, Fu-Zhong; Hu, Cha-Sheng

    2016-12-01

    In this paper, a standard susceptible-infected-recovered-susceptible(SIRS) epidemic model based on the Watts-Strogatz (WS) small-world network model and the Barabsi-Albert (BA) scale-free network model is established, and a new immunization scheme — “the most common friend first immunization” is proposed, in which the most common friend’s node is described as being the first immune on the second layer protection of complex networks. The propagation situations of three different immunization schemes — random immunization, high-risk immunization, and the most common friend first immunization are studied. At the same time, the dynamic behaviors are also studied on the WS small-world and the BA scale-free network. Moreover, the analytic and simulated results indicate that the immune effect of the most common friend first immunization is better than random immunization, but slightly worse than high-risk immunization. However, high-risk immunization still has some limitations. For example, it is difficult to accurately define who a direct neighbor in the life is. Compared with the traditional immunization strategies having some shortcomings, the most common friend first immunization is effective, and it is nicely consistent with the actual situation. Project supported by the National Natural Science Foundation of China (Grant No. 61263019), the Program for International Science and Technology Cooperation Projects of Gansu Province, China (Grant No. 144WCGA166), and the Program for Longyuan Young Innovation Talents and the Doctoral Foundation of Lanzhou University of Technology, China.

  17. Direct measurement of peptide-specific CD8+ T cells using HLA-A2:Ig dimer for monitoring the in vivo immune response to a HER2/neu vaccine in breast and prostate cancer patients.

    PubMed

    Woll, Michael M; Fisher, Christine M; Ryan, Gayle B; Gurney, Jennifer M; Storrer, Catherine E; Ioannides, Constantin G; Shriver, Craig D; Moul, Judd W; McLeod, David G; Ponniah, Sathibalan; Peoples, George E

    2004-07-01

    HER2/neu is a proto-oncogene and a member of the epidermal growth factor receptor family of proteins that is overexpressed in numerous types of human cancer. We are currently conducting clinical trials with the HER2/neu E75 peptide vaccine in breast and prostate cancer patients. We have evaluated the use of HLA-A2 dimer molecule for the immunological monitoring of cancer patients receiving the E75 peptide vaccine. Peripheral blood samples from patients receiving the vaccine were stained with HLA-A2 dimers containing the vaccine peptide E75 or control peptides and analyzed by flow cytometry. We compared the HLA-A2 dimer assay to standard methods of immunologic monitoring (IFN-gamma release, lymphocyte proliferation, and cytotoxicity). The HLA-A2 dimer assay was also compared with the HLA-A2 tetramer assay. E75 peptide-specific CD8 T cells were detected directly in the peripheral blood of patients by staining with E75-HLA-A2 dimers and CD8 antibodies. T cell cultures generated by repeated stimulations using E75 peptide-pulsed dendritic cells showed increased staining with E75-peptide loaded HLA-A2 dimers. Simultaneously analysis by the dimer assay and standard immunologic assays demonstrated that the dimer-staining assay correlated well with these methods of immunologic monitoring. A direct comparison using E75-specific HLA-A2 tetramers and HLA-A2 dimers for the detection of E75-specific CD8 T cells in peripheral blood showed comparable results with the two assays. Our findings indicate that the HLA-A2 dimer is a powerful new tool for directly quantifying and monitoring immune responses of antigen-specific T cells in peptide vaccine clinical trials.

  18. Probing the tails of the ground-state energy distribution for the directed polymer in a random medium of dimension d=1,2,3 via a Monte Carlo procedure in the disorder.

    PubMed

    Monthus, Cécile; Garel, Thomas

    2006-11-01

    In order to probe with high precision the tails of the ground-state energy distribution of disordered spin systems, Körner, Katzgraber, and Hartmann have recently proposed an importance-sampling Monte Carlo Markov chain in the disorder. In this paper, we combine their Monte Carlo procedure in the disorder with exact transfer matrix calculations in each sample to measure the negative tail of ground-state energy distribution Pd(E0) for the directed polymer in a random medium of dimension d=1,2,3. In d=1, we check the validity of the algorithm by a direct comparison with the exact result, namely, the Tracy-Widom distribution. In dimensions d=2 and d=3, we measure the negative tail up to ten standard deviations, which correspond to probabilities of order Pd(E0) approximately 10(-22). Our results are in agreement with Zhang's argument, stating that the negative tail exponent eta(d) of the asymptotic behavior lnPd(E0) approximately -|E0|eta(d) as E0-->-infinity is directly related to the fluctuation exponent theta(d) [which governs the fluctuations DeltaE0(L) approximately Ltheta(d) of the ground-state energy E0 for polymers of length L] via the simple formula eta(d)=1/[1-theta(d)]. Throughout the paper, we comment on the similarities and differences with spin glasses.

  19. Pediatric Procedural Pain

    ERIC Educational Resources Information Center

    Blount, Ronald L.; Piira, Tiina; Cohen, Lindsey L.; Cheng, Patricia S.

    2006-01-01

    This article reviews the various settings in which infants, children, and adolescents experience pain during acute medical procedures and issues related to referral of children to pain management teams. In addition, self-report, reports by others, physiological monitoring, and direct observation methods of assessment of pain and related constructs…

  20. Sepsis-induced immune dysfunction: can immune therapies reduce mortality?

    PubMed Central

    Delano, Matthew J.; Ward, Peter A.

    2016-01-01

    Sepsis is a systemic inflammatory response induced by an infection, leading to organ dysfunction and mortality. Historically, sepsis-induced organ dysfunction and lethality were attributed to the interplay between inflammatory and antiinflammatory responses. With advances in intensive care management and goal-directed interventions, early sepsis mortality has diminished, only to surge later after “recovery” from acute events, prompting a search for sepsis-induced alterations in immune function. Sepsis is well known to alter innate and adaptive immune responses for sustained periods after clinical “recovery,” with immunosuppression being a prominent example of such alterations. Recent studies have centered on immune-modulatory therapy. These efforts are focused on defining and reversing the persistent immune cell dysfunction that is associated with mortality long after the acute events of sepsis have resolved. PMID:26727230

  1. Dental Procedures.

    PubMed

    Ramponi, Denise R

    2016-01-01

    Dental problems are a common complaint in emergency departments in the United States. There are a wide variety of dental issues addressed in emergency department visits such as dental caries, loose teeth, dental trauma, gingival infections, and dry socket syndrome. Review of the most common dental blocks and dental procedures will allow the practitioner the opportunity to make the patient more comfortable and reduce the amount of analgesia the patient will need upon discharge. Familiarity with the dental equipment, tooth, and mouth anatomy will help prepare the practitioner for to perform these dental procedures.

  2. Integrated Circuit Immunity

    NASA Technical Reports Server (NTRS)

    Sketoe, J. G.; Clark, Anthony

    2000-01-01

    This paper presents a DOD E3 program overview on integrated circuit immunity. The topics include: 1) EMI Immunity Testing; 2) Threshold Definition; 3) Bias Tee Function; 4) Bias Tee Calibration Set-Up; 5) EDM Test Figure; 6) EMI Immunity Levels; 7) NAND vs. and Gate Immunity; 8) TTL vs. LS Immunity Levels; 9) TP vs. OC Immunity Levels; 10) 7805 Volt Reg Immunity; and 11) Seventies Chip Set. This paper is presented in viewgraph form.

  3. Avian biological clock - Immune system relationship.

    PubMed

    Markowska, Magdalena; Majewski, Paweł M; Skwarło-Sońta, Krystyna

    2017-01-01

    Biological rhythms in birds are driven by the master clock, which includes the suprachiasmatic nucleus, the pineal gland and the retina. Light/dark cycles are the cues that synchronize the rhythmic changes in physiological processes, including immunity. This review summarizes our investigations on the bidirectional relationships between the chicken pineal gland and the immune system. We demonstrated that, in the chicken, the main pineal hormone, melatonin, regulates innate immunity, maintains the rhythmicity of immune reactions and is involved in the seasonal changes in immunity. Using thioglycollate-induced peritonitis as a model, we showed that the activated immune system regulates the pineal gland by inhibition of melatonin production at the level of the key enzyme in its biosynthetic pathway, arylalkylamine-N-acetyltransferase (AANAT). Interleukin 6 and interleukin 18 seem to be the immune mediators influencing the pineal gland, directly inhibiting Aanat gene transcription and modulating expression of the clock genes Bmal1 and Per3, which in turn regulate Aanat.

  4. Immunity, atherosclerosis and cardiovascular disease

    PubMed Central

    2013-01-01

    Atherosclerosis, the major cause of cardiovascular disease (CVD), is a chronic inflammatory condition with immune competent cells in lesions producing mainly pro-inflammatory cytokines. Dead cells and oxidized forms of low density lipoproteins (oxLDL) are abundant. The major direct cause of CVD appears to be rupture of atherosclerotic plaques. oxLDL has proinflammatory and immune-stimulatory properties, causes cell death at higher concentrations and contains inflammatory phospholipids with phosphorylcholine (PC) as an interesting epitope. Antibodies against PC (anti-PC) may be atheroprotective, one mechanism being anti-inflammatory. Bacteria and virus have been discussed, but it has been difficult to find direct evidence, and antibiotic trials have not been successful. Heat shock proteins could be one major target for atherogenic immune reactions. More direct causes of plaque rupture include pro-inflammatory cytokines, chemokines, and lipid mediators. To prove that inflammation is a cause of atherosclerosis and CVD, clinical studies with anti-inflammatory and/or immune-modulatory treatment are needed. The potential causes of immune reactions and inflammation in atherosclerosis and how inflammation can be targeted therapeutically to provide novel treatments for CVD are reviewed. PMID:23635324

  5. Did the molecules of adaptive immunity evolve from the innate immune system?

    PubMed

    Bartl, Simona; Baish, Meredith; Weissman, Irving L; Diaz, Marilyn

    2003-04-01

    The antigen receptors on cells of innate immune systems recognize broadly expressed markers on non-host cells while the receptors on lymphocytes of the adaptive immune system display a higher level of specificity. Adaptive immunity, with its exquisite specificity and immunological memory, has only been found in the jawed vertebrates, which also display innate immunity. Jawless fishes and invertebrates only have innate immunity. In the adaptive immune response, T and B-lymphocytes detect foreign agents or antigens using T cell receptors (TCR) or immunoglobulins (Ig), respectively. While Ig can bind free intact antigens, TCR only binds processed antigenic fragments that are presented on molecules encoded in the major histocompatibility complex (MHC). MHC molecules display variation through allelic polymorphism. A diverse repertoire of Ig and TCR molecules is generated by gene rearrangement and junctional diversity, processes carried out by the recombinase activating gene (RAG) products and terminal deoxynucleotidyl transferase (TdT). Thus, the molecules that define adaptive immunity are TCR, Ig, MHC molecules, RAG products and TdT. No direct predecessors of these molecules have been found in the jawless fishes or invertebrates. In contrast, the complement cascade can be activated by either adaptive or innate immune systems and contains examples of molecules that gradually evolved from non-immune functions to being part of the innate and then adaptive immune system. In this paper we examine the molecules of the adaptive immune system and speculate on the existence of direct predecessors that were part of innate immunity.

  6. Inhibition of immune complex-mediated neutrophil oxidative metabolism: a pharmacophore model for 3-phenylcoumarin derivatives using GRIND-based 3D-QSAR and 2D-QSAR procedures.

    PubMed

    Kabeya, Luciana M; da Silva, Carlos H T P; Kanashiro, Alexandre; Campos, Joaquín M; Azzolini, Ana Elisa C S; Polizello, Ana Cristina M; Pupo, Mônica T; Lucisano-Valim, Yara M

    2008-05-01

    In this study, twenty hydroxylated and acetoxylated 3-phenylcoumarin derivatives were evaluated as inhibitors of immune complex-stimulated neutrophil oxidative metabolism and possible modulators of the inflammatory tissue damage found in type III hypersensitivity reactions. By using lucigenin- and luminol-enhanced chemiluminescence assays (CL-luc and CL-lum, respectively), we found that the 6,7-dihydroxylated and 6,7-diacetoxylated 3-phenylcoumarin derivatives were the most effective inhibitors. Different structural features of the other compounds determined CL-luc and/or CL-lum inhibition. The 2D-QSAR analysis suggested the importance of hydrophobic contributions to explain these effects. In addition, a statistically significant 3D-QSAR model built applying GRIND descriptors allowed us to propose a virtual receptor site considering pharmacophoric regions and mutual distances. Furthermore, the 3-phenylcoumarins studied were not toxic to neutrophils under the assessed conditions.

  7. Instant Childhood Immunization Schedule

    MedlinePlus

    ... Recommendations Why Immunize? Vaccines: The Basics Instant Childhood Immunization Schedule Recommend on Facebook Tweet Share Compartir Get ... date. See Disclaimer for additional details. Based on Immunization Schedule for Children 0 through 6 Years of ...

  8. Immune System Quiz

    MedlinePlus

    ... Room? What Happens in the Operating Room? Quiz: Immune System KidsHealth > For Kids > Quiz: Immune System A A A How much do you know about your immune system? Find out by taking this quiz! About KidsHealth ...

  9. Immune Abnormalities in Patients with Autism.

    ERIC Educational Resources Information Center

    Warren, Reed P.; And Others

    1986-01-01

    A study of 31 autistic patients (3-28 years old) has revealed several immune-system abnormalities, including decreased numbers of T lymphocytes and an altered ratio of helper-to-suppressor T cells. Immune-system abnormalities may be directly related to underlying biologic processes of autism or an indirect reflection of the actual pathologic…

  10. Surface Environmental Surveillance Procedures Manual

    SciTech Connect

    Hanf, RW; Dirkes, RL

    1990-02-01

    This manual establishes the procedures for the collection of environmental samples and the performance of radiation surveys and other field measurements. Responsibilities are defined for those personnel directly involved in the collection of samples and the performance of field measurements.

  11. Computerized operating procedures

    SciTech Connect

    Ness, E.; Teigen, J.

    1994-12-31

    A number of observed and potential problems in the nuclear industry are related to the quality of operating procedures. Many of the problems identified in operating procedure preparation, implementation, and maintenance have a technical nature, which can be directly addressed by developing computerized procedure handling tools. The Halden Reactor Project (HRP) of the Organization for Economic Cooperation and Development has since 1985 performed research work within this field. A product of this effort is the development of a second version of the computerized operation manuals (COPMA) system. This paper summarizes the most important characteristics of the COPMA-II system and discusses some of the experiences in using a system like COPMA-II.

  12. Reasoning about procedural knowledge

    NASA Technical Reports Server (NTRS)

    Georgeff, M. P.

    1985-01-01

    A crucial aspect of automated reasoning about space operations is that knowledge of the problem domain is often procedural in nature - that is, the knowledge is often in the form of sequences of actions or procedures for achieving given goals or reacting to certain situations. In this paper a system is described that explicitly represents and reasons about procedural knowledge. The knowledge representation used is sufficiently rich to describe the effects of arbitrary sequences of tests and actions, and the inference mechanism provides a means for directly using this knowledge to reach desired operational goals. Furthermore, the representation has a declarative semantics that provides for incremental changes to the system, rich explanatory capabilities, and verifiability. The approach also provides a mechanism for reasoning about the use of this knowledge, thus enabling the system to choose effectively between alternative courses of action.

  13. Infectious Diseases and Immunizations. Matrix No. 15.

    ERIC Educational Resources Information Center

    Sever, John L.

    This paper summarizes the major advances achieved by research in the fields of infectious diseases and immunizations during the 1970s, and delineates directions for future research in these fields. (Author/MP)

  14. Mobile Energy Laboratory Procedures

    SciTech Connect

    Armstrong, P.R.; Batishko, C.R.; Dittmer, A.L.; Hadley, D.L.; Stoops, J.L.

    1993-09-01

    Pacific Northwest Laboratory (PNL) has been tasked to plan and implement a framework for measuring and analyzing the efficiency of on-site energy conversion, distribution, and end-use application on federal facilities as part of its overall technical support to the US Department of Energy (DOE) Federal Energy Management Program (FEMP). The Mobile Energy Laboratory (MEL) Procedures establish guidelines for specific activities performed by PNL staff. PNL provided sophisticated energy monitoring, auditing, and analysis equipment for on-site evaluation of energy use efficiency. Specially trained engineers and technicians were provided to conduct tests in a safe and efficient manner with the assistance of host facility staff and contractors. Reports were produced to describe test procedures, results, and suggested courses of action. These reports may be used to justify changes in operating procedures, maintenance efforts, system designs, or energy-using equipment. The MEL capabilities can subsequently be used to assess the results of energy conservation projects. These procedures recognize the need for centralized NM administration, test procedure development, operator training, and technical oversight. This need is evidenced by increasing requests fbr MEL use and the economies available by having trained, full-time MEL operators and near continuous MEL operation. DOE will assign new equipment and upgrade existing equipment as new capabilities are developed. The equipment and trained technicians will be made available to federal agencies that provide funding for the direct costs associated with MEL use.

  15. Autophagy, Immunity, and Microbial Adaptations

    PubMed Central

    Deretic, Vojo; Levine, Beth

    2009-01-01

    Autophagy adjusts cellular biomass and function in response to diverse stimuli, including infection. Autophagy plays specific roles in shaping immune system development, fueling host innate and adaptive immune responses, and directly controlling intracellular microbes as a cell-autonomous innate defense. As an evolutionary counterpoint, intracellular pathogens have evolved to block autophagic microbicidal defense and subvert host autophagic responses for their survival or growth. The ability of eukaryotic pathogens to deploy their own autophagic machinery may also contribute to microbial pathogenesis. Thus, a complex interplay between autophagy and microbial adaptations against autophagy governs the net outcome of host-microbe encounters. PMID:19527881

  16. The birth of innate immunity.

    PubMed

    Gallo, Richard L

    2013-08-01

    Modern immunology has seen an apparent revolution with the recognition that human immune defense is not only the responsibility of bone marrow-derived leucocytes, but also dependent on a coordinated network of many cell types including epithelial cells, fibroblasts and neural elements. This classic paper by Alexander Fleming and V.D. Allison (British J of Exp Path, 111, 1922, 252) was largely forgotten for 75 years and describes the discovery that epithelia produce a protein with direct antimicrobial activity. Thus, this paper represents the birth of the field now referred to as innate immunity and first describes an antimicrobial protein (AMP).

  17. Procedural knowledge

    NASA Technical Reports Server (NTRS)

    Georgeff, Michael P.; Lansky, Amy L.

    1986-01-01

    Much of commonsense knowledge about the real world is in the form of procedures or sequences of actions for achieving particular goals. In this paper, a formalism is presented for representing such knowledge using the notion of process. A declarative semantics for the representation is given, which allows a user to state facts about the effects of doing things in the problem domain of interest. An operational semantics is also provided, which shows how this knowledge can be used to achieve particular goals or to form intentions regarding their achievement. Given both semantics, the formalism additionally serves as an executable specification language suitable for constructing complex systems. A system based on this formalism is described, and examples involving control of an autonomous robot and fault diagnosis for NASA's Space Shuttle are provided.

  18. Sensitive, direct procedures for simultaneous determinations of iron and copper in serum, with use of 2-(5-nitro-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol (nitro-PAPS) as ligand.

    PubMed

    Yamashita, S; Abe, A; Noma, A

    1992-07-01

    We developed a direct, simple, and sensitive procedure for the simultaneous colorimetric assay of iron and copper in serum, using sodium dodecyl sulfate-ascorbic acid to dissociate iron and copper from transferrin and ceruloplasmin, respectively. We also use a new water-soluble reagent, 2-(5-nitro-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol disodium salt (nitro-PAPS) and thioglycolic acid to eliminate interference from copper in the measurement of iron. Within- and between-run precisions of the present method were 2.5-2.8% for iron and 1.8-4.6% for copper. The proposed method is susceptible to interference by hemoglobin and lipemia, especially for the iron assay. Linear-regression analyses of results of the proposed method with those of the bathophenanthroline method for iron and of the atomic absorption spectroscopic method for copper correlated well (r = 0.996, Sy/x = 0.73 and r = 0.959, Sy/x = 1.11, respectively).

  19. Immunization for Women

    MedlinePlus

    ... nfid.org/#sthash.eZ72dCSP.dpuf Diseases & Vaccines Overview Immunization Schedules Talk to you doctor about your immunization ... years Immunization Schedule for Children, 7-18 years Immunization News July 8, 2016 HPV-related cancers on ...

  20. Intradermal naked plasmid DNA immunization: mechanisms of action.

    PubMed

    Elnekave, Mazal; Furmanov, Karina; Hovav, Avi-Hai

    2011-08-01

    Plasmid DNA is a promising vaccine modality that is regularly examined in prime-boost immunization regimens. Recent advances in skin immunity increased our understanding of the sophisticated cutaneous immune network, which revived scientific interest in delivering vaccines to the skin. Intradermal administration of plasmid DNA via needle injection is a simple and inexpensive procedure that exposes the plasmid and its encoded antigen to the dermal immune surveillance system. This triggers unique mechanisms for eliciting local and systemic immunity that can confer protection against pathogens and tumors. Understanding the mechanisms of intradermal plasmid DNA immunization is essential for enhancing and modulating its immunogenicity. With regard to vaccination, this is of greater importance as this routine injection technique is highly desirable for worldwide immunization. This article will focus on the current understanding of the mechanisms involved in antigen expression and presentation during primary and secondary syringe and needle intradermal plasmid DNA immunization.

  1. Epigenetic Control of Immunity

    PubMed Central

    Busslinger, Meinrad; Tarakhovsky, Alexander

    2014-01-01

    Immunity relies on the heterogeneity of immune cells and their ability to respond to pathogen challenges. In the adaptive immune system, lymphocytes display a highly diverse antigen receptor repertoire that matches the vast diversity of pathogens. In the innate immune system, the cell's heterogeneity and phenotypic plasticity enable flexible responses to changes in tissue homeostasis caused by infection or damage. The immune responses are calibrated by the graded activity of immune cells that can vary from yeast-like proliferation to lifetime dormancy. This article describes key epigenetic processes that contribute to the function of immune cells during health and disease. PMID:24890513

  2. Integrated Immune Experiment

    NASA Technical Reports Server (NTRS)

    Crucian, Brian

    2009-01-01

    This viewgraph presentation reviews NASA's Integrated Immune Experiment. The objectives include: 1) Address significant lack of data regarding immune status during flight; 2) Replace several recent immune studies with one comprehensive study that will include in-flight sampling; 3) Determine the in-flight status of immunity, physiological stress, viral immunity/reactivation; 4) Determine the clinical risk related to immune dysregulation for exploration class spaceflight; and 5) Determine the appropriate monitoring strategy for spaceflight-associated immune dysfunction, that could be used for the evaluation of countermeasures.

  3. Understanding Herd Immunity.

    PubMed

    Metcalf, C J E; Ferrari, M; Graham, A L; Grenfell, B T

    2015-12-01

    Individual immunity is a powerful force affecting host health and pathogen evolution. Importantly, the effects of individual immunity also scale up to affect pathogen transmission dynamics and the success of vaccination campaigns for entire host populations. Population-scale immunity is often termed 'herd immunity'. Here we outline how individual immunity maps to population outcomes and discuss implications for control of infectious diseases. Particular immunological characteristics may be more or less likely to result in a population level signature of herd immunity; we detail this and also discuss other population-level outcomes that might emerge from individual-level immunity.

  4. In vivo imaging of immune cell trafficking in cancer.

    PubMed

    Ottobrini, Luisa; Martelli, Cristina; Trabattoni, Daria Lucia; Clerici, Mario; Lucignani, Giovanni

    2011-05-01

    Tumour establishment, progression and regression can be studied in vivo using an array of imaging techniques ranging from MRI to nuclear-based and optical techniques that highlight the intrinsic behaviour of different cell populations in the physiological context. Clinical in vivo imaging techniques and preclinical specific approaches have been used to study, both at the macroscopic and microscopic level, tumour cells, their proliferation, metastasisation, death and interaction with the environment and with the immune system. Fluorescent, radioactive or paramagnetic markers were used in direct protocols to label the specific cell population and reporter genes were used for genetic, indirect labelling protocols to track the fate of a given cell subpopulation in vivo. Different protocols have been proposed to in vivo study the interaction between immune cells and tumours by different imaging techniques (intravital and whole-body imaging). In particular in this review we report several examples dealing with dendritic cells, T lymphocytes and macrophages specifically labelled for different imaging procedures both for the study of their physiological function and in the context of anti-neoplastic immunotherapies in the attempt to exploit imaging-derived information to improve and optimise anti-neoplastic immune-based treatments.

  5. The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

    DTIC Science & Technology

    2006-07-06

    caused by penicillin -resistant Streptococcus pneumoniae in rabbits. Antimicrob. Agents Chemother. 46: 1760- 1765. Takeuchi, O., Hoshino, K., and...2006 2. REPORT TYPE 3. DATES COVERED 00-00-2006 to 00-00-2006 4. TITLE AND SUBTITLE The host immune response to Streptococcus pneumoniae ...host immune response to Streptococcus pneumoniae : bridging innate and adaptive immunity Katherine Shi-Hui Lee Thesis directed by: Clifford M

  6. Platelet serotonin modulates immune functions.

    PubMed

    Mauler, M; Bode, C; Duerschmied, D

    2016-01-01

    This short review addresses immune functions of platelet serotonin. Platelets transport serotonin at a high concentration in dense granules and release it upon activation. Besides haemostatic, vasotonic and developmental modulation, serotonin also influences a variety of immune functions (mediated by different serotonin receptors). First, platelet serotonergic effects are directed against invading pathogens via activation and proliferation of lymphocytes, modulation of cytokine release, and recruitment of neutrophils to sites of acute inflammation by induction of selectin expression on endothelial cells. Second, serotonin levels are elevated in autoimmune diseases, such as asthma or rheumatoid arthritis, and during tissue regeneration after ischemia of myocardium or brain. Specific antagonism of serotonin receptors appears to improve survival after myocardial infarction or sepsis and to attenuate asthmatic attacks in animal models. It will be of great clinical relevance if these findings can be translated into human applications. In conclusion, targeting immune modulatory effects of platelet serotonin may provide novel therapeutic options for common health problems.

  7. 32 CFR 242.5 - Admission procedures.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... HEALTH SCIENCES § 242.5 Admission procedures. (a) Application—(1) Civilians. Civilians seeking admission to the School of Medicine shall make direct application following instructions published in...

  8. Immune Response to Giardia duodenalis

    PubMed Central

    Faubert, Gaétan

    2000-01-01

    The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490

  9. Epigenetic regulation of immune checkpoints: another target for cancer immunotherapy?

    PubMed

    Ali, Mahmoud A; Matboli, Marwa; Tarek, Marwa; Reda, Maged; Kamal, Kamal M; Nouh, Mahmoud; Ashry, Ahmed M; El-Bab, Ahmed Fath; Mesalam, Hend A; Shafei, Ayman El-Sayed; Abdel-Rahman, Omar

    2017-01-01

    Epigenetic changes in oncogenes and tumor-suppressor genes contribute to carcinogenesis. Understanding the epigenetic and genetic components of tumor immune evasion is crucial. Few cancer genetic mutations have been linked to direct correlations with immune evasion. Studies on the epigenetic modulation of the immune checkpoints have revealed a critical interaction between epigenetic and immune modulation. Epigenetic modifiers can activate many silenced genes. Some of them are immune checkpoints regulators that turn on immune responses and others turn them off resulting in immune evasion. Many forms of epigenetic inheritance mechanisms may play a role in regulation of immune checkpoints including: covalent modifications, noncoding RNA and histone modifications. In this review, we will show how the potential interaction between epigenetic and immune modulation may lead to new approaches for specific epigenome/immunome-targeted therapies for cancer.

  10. Molecular structure of the immunity gene and immunity protein of the bacteriocinogenic plasmid Clo DF13.

    PubMed Central

    van den Elzen, P J; Gaastra, W; Spelt, C E; de Graaf, F K; Veltkamp, E; Nijkamp, H J

    1980-01-01

    The nucleotide sequence of the Clo DF13 DNA region comprising the immunity gene has been determined. We also elucidated the aminoacid sequence of the 40 N-terminal and 7 C-terminal aminoacids of the purified immunity protein. From analysis of the data obtained we were able to locate the immunity gene between 11.7 and 14.5% on the Clo DF13 map, and to determine the complete aminoacid sequence of the immunity protein. It was observed that the Clo DF13 immunity gene encodes an 85 aminoacid protein and is transcribed in the same direction as the cloacin gene. These experimental data support our model, presented elsewhere, which implicates that the cloacin and immunity genes of Clo DF13 are coordinately transcribed from the cloacin promoter. We also present DNA sequence data indicating that an extra ribosome binding site precedes the immunity gene on the polycistronic mRNA. This ribosome binding site might explain the fact that in cloacinogenic cells more immunity protein than cloacin is synthesized. The comparison of the complete aminoacid sequence of the Clo DF13 immunity protein, with the aminoacid sequence data of the purified, comparable Col E3 immunity protein revealed that both proteins have extensive homologies in primary and secondary structure, although they are exchangeable only to a low extent in vivo and in vitro. It was also observed that a lysine residue was modified in immunity protein isolated from excreted bacteriocin complexes. Images PMID:6253914

  11. Conditioning of the immune response.

    PubMed

    Ader, R; Cohen, N

    1991-10-01

    Experimental studies in humans and experimental animals document the acquisition and extinction of classically conditioned alterations of different parameters of humoral- and cell-mediated immune responses. Although the aversive effects of cyclophosphamide in a taste aversion learning paradigm has been the most frequently used model, conditioned immunomodulatory effects are not confined to this conditioning procedure, and they are not limited to cyclophosphamide or, for that matter, the use of immunomodulating drugs as unconditioned stimuli. Conditioned changes in immunologic reactivity have also been found to modulate the progression of spontaneously-developing or experimentally-induced pathophysiological processes in experimental animals. The available data on the immunoregulatory effects of conditioning indicate that the immune system, like other systems operating in the interests of homeostasis, is integrated with other physiological processes and is therefore influenced by and capable of influencing the brain.

  12. Engineering vaccines and niches for immune modulation.

    PubMed

    Purwada, Alberto; Roy, Krishnendu; Singh, Ankur

    2014-04-01

    Controlled modulation of immune response, especially the balance between immunostimulatory and immunosuppressive responses, is critical for a variety of clinical applications, including immunotherapies against cancer and infectious diseases, treatment of autoimmune disorders, transplant surgeries, regenerative medicine, prosthetic implants, etc. Our ability to precisely modify both innate and adaptive immune responses could provide new therapeutic directions in a variety of diseases. In the context of vaccines and immunotherapies, the interplay between antigen-presenting cells (e.g. dendritic cells and macrophages), B cells, T helper and killer subtypes, and regulatory T- and B-cell responses is critical for generating effective immunity against cancer, infectious diseases and autoimmune diseases. In recent years, immunoengineering has emerged as a new field that uses quantitative engineering tools to understand molecular-, cellular- and system-level interactions of the immune system and to develop design-driven approaches to control and modulate immune responses. Biomaterials are an integral part of this engineering toolbox and can exploit the intrinsic biological and mechanical cues of the immune system to directly modulate and train immune cells and direct their response to a particular phenotype. A large body of literature exists on strategies to evade or suppress the immune response in implants, transplantation and regenerative medicine. This review specifically focuses on the use of biomaterials for immunostimulation and controlled modulation, especially in the context of vaccines and immunotherapies against cancer, infectious diseases and autoimmune disorders. Bioengineering smart systems that can simultaneously deliver multiple bioactive agents in a controlled manner or can work as a niche for in situ priming and modulation of the immune system could significantly enhance the efficacy of next-generation immunotherapeutics. In this review, we describe our

  13. Vaccination to gain humoral immune memory

    PubMed Central

    Sarkander, Jana; Hojyo, Shintaro; Tokoyoda, Koji

    2016-01-01

    The concept of immune memory forms the biological basis for vaccination programs. Despite advancements in the field of immune memory and vaccination, most current vaccines are evaluated by magnitude of antigen-specific antibody titers in serum or mucosa after vaccination. It has been shown, however, that antibody-mediated humoral immune memory is established regardless of the magnitude and duration of immune reactions, suggesting that assessment of vaccine efficacy should be performed for several years after vaccination. This long-term investigation is disadvantageous for prevalent and pandemic infections. Long-lived memory plasma cells and memory helper T cells which contribute to humoral immune memory are generated in the bone marrow after migration of memory cell precursors through bloodstream. Thus, it may be a novel evaluation strategy to assess the precursors of memory cells in the blood in the early phase of the immune reaction(s). We here review recent advances on the generation and maintenance of immune memory cells involved in humoral immunity and introduce a current concept of direct and short-term assessment of humoral immune memory formation upon vaccination as a correlate of protection. PMID:28090322

  14. 46 CFR 272.14 - Survey procedures.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 8 2012-10-01 2012-10-01 false Survey procedures. 272.14 Section 272.14 Shipping... OPERATORS REQUIREMENTS AND PROCEDURES FOR CONDUCTING CONDITION SURVEYS AND ADMINISTERING MAINTENANCE AND... Survey procedures. (a) Prior to survey. Unless otherwise directed by MARAD, the Operator of a...

  15. 46 CFR 272.14 - Survey procedures.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Survey procedures. 272.14 Section 272.14 Shipping... OPERATORS REQUIREMENTS AND PROCEDURES FOR CONDUCTING CONDITION SURVEYS AND ADMINISTERING MAINTENANCE AND... Survey procedures. (a) Prior to survey. Unless otherwise directed by MARAD, the Operator of a...

  16. 46 CFR 272.14 - Survey procedures.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 8 2011-10-01 2011-10-01 false Survey procedures. 272.14 Section 272.14 Shipping... OPERATORS REQUIREMENTS AND PROCEDURES FOR CONDUCTING CONDITION SURVEYS AND ADMINISTERING MAINTENANCE AND... Survey procedures. (a) Prior to survey. Unless otherwise directed by MARAD, the Operator of a...

  17. 46 CFR 272.14 - Survey procedures.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 8 2013-10-01 2013-10-01 false Survey procedures. 272.14 Section 272.14 Shipping... OPERATORS REQUIREMENTS AND PROCEDURES FOR CONDUCTING CONDITION SURVEYS AND ADMINISTERING MAINTENANCE AND... Survey procedures. (a) Prior to survey. Unless otherwise directed by MARAD, the Operator of a...

  18. 46 CFR 272.14 - Survey procedures.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 8 2014-10-01 2014-10-01 false Survey procedures. 272.14 Section 272.14 Shipping... OPERATORS REQUIREMENTS AND PROCEDURES FOR CONDUCTING CONDITION SURVEYS AND ADMINISTERING MAINTENANCE AND... Survey procedures. (a) Prior to survey. Unless otherwise directed by MARAD, the Operator of a...

  19. Imbalanced immune homeostasis in immune thrombocytopenia.

    PubMed

    Yazdanbakhsh, Karina

    2016-04-01

    Immune thrombocytopenia (ITP) is an autoimmune bleeding disorder resulting from low platelet counts caused by inadequate production as well as increased destruction by autoimmune mechanisms. As with other autoimmune disorders, chronic ITP is characterized by perturbations of immune homeostasis with hyperactivated effector cells as well as defective regulatory arm of the adaptive immune system, which will be reviewed here. Interestingly, some ITP treatments are associated with restoring the regulatory imbalance, although it remains unclear whether the immune system is redirected to a state of tolerance once treatment is discontinued. Understanding the mechanisms that result in breakdown of immune homeostasis in ITP will help to identify novel pathways for restoring tolerance and inhibiting effector cell responses. This information can then be translated into developing therapies for averting autoimmunity not only in ITP but also many autoimmune disorders.

  20. Imbalanced immune homeostasis in immune thrombocytopenia

    PubMed Central

    Yazdanbakhsh, Karina

    2017-01-01

    Immune thrombocytopenia (ITP) is an autoimmune bleeding disorder resulting from low platelet counts caused by inadequate production as well as increased destruction by autoimmune mechanisms. As with other autoimmune disorders, chronic ITP is characterized by perturbations of immune homeostasis with hyperactivated effector cells as well as defective regulatory arm of the adaptive immune system, which will be reviewed here. Interestingly, some ITP treatments are associated with restoring the regulatory imbalance, although it remains unclear whether the immune system is redirected to a state of tolerance once treatment is discontinued. Understanding the mechanisms that result in breakdown of immune homeostasis in ITP will help to identify novel pathways for restoring tolerance and inhibiting effector cell responses. This information can then be translated into developing therapies for averting autoimmunity not only in ITP but also many autoimmune disorders. PMID:27312156

  1. The innate immune system and transplantation.

    PubMed

    Farrar, Conrad A; Kupiec-Weglinski, Jerzy W; Sacks, Steven H

    2013-10-01

    The sensitive and broadly reactive character of the innate immune system makes it liable to activation by stress factors other than infection. Thermal and metabolic stresses experienced during the transplantation procedure are sufficient to trigger the innate immune response and also augment adaptive immunity in the presence of foreign antigen on the donor organ. The resulting inflammatory and immune reactions combine to form a potent effector response that can lead to graft rejection. Here we examine the evidence that the complement and toll-like receptor systems are central to these pathways of injury and present a formidable barrier to transplantation. We review extensive information about the effector mechanisms that are mediated by these pathways, and bring together what is known about the damage-associated molecular patterns that initiate this sequence of events. Finally, we refer to two ongoing therapeutic trials that are evaluating the validity of these concepts in man.

  2. Immune Responses in Neonates

    PubMed Central

    Basha, Saleem; Surendran, Naveen; Pichichero, Michael

    2015-01-01

    Neonates have little immunological memory and a developing immune system, which increases their vulnerability to infectious agents. Recent advances in understanding of neonatal immunity indicate that both innate and adaptive responses are dependent on precursor frequency of lymphocytes, antigenic dose and mode of exposure. Studies in neonatal mouse models and human umbilical cord blood cells demonstrate the capability of neonatal immune cells to produce immune responses similar to adults in some aspects but not others. This review focuses mainly on the developmental and functional mechanisms of the human neonatal immune system. In particular, the mechanism of innate and adaptive immunity and the role of neutrophils, antigen presenting cells, differences in subclasses of T lymphocytes (Th1, Th2, Tregs) and B cells are discussed. In addition, we have included the recent developments in neonatal mouse immune system. Understanding neonatal immunity is essential to development of therapeutic vaccines to combat newly emerging infectious agents. PMID:25088080

  3. Aging changes in immunity

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/004008.htm Aging changes in immunity To use the sharing features ... cells and antibodies that destroy these harmful substances. AGING CHANGES AND THEIR EFFECTS ON THE IMMUNE SYSTEM ...

  4. Immunity to cancer

    SciTech Connect

    Reif, A.E.; Mitchell, M.S.

    1985-01-01

    This book contains five sections, each containing several papers. The section titles are: Identification and Characterization of Tumor Antigens; Immune Responses to Tumor Antigens; Regulation of the Immune Response to Tumor Cells, Immunotherapy and Biomodulators, and Immunotherapy and Immunoprophylaxis.

  5. Immune System and Disorders

    MedlinePlus

    Your immune system is a complex network of cells, tissues, and organs that work together to defend against germs. It ... t, to find and destroy them. If your immune system cannot do its job, the results can be ...

  6. [Immune system and tumors].

    PubMed

    Terme, Magali; Tanchot, Corinne

    2017-02-01

    Despite having been much debated, it is now well established that the immune system plays an essential role in the fight against cancer. In this article, we will highlight the implication of the immune system in the control of tumor growth and describe the major components of the immune system involved in the antitumoral immune response. The immune system, while exerting pressure on tumor cells, also will play a pro-tumoral role by sculpting the immunogenicity of tumors cells as they develop. Finally, we will illustrate the numerous mechanisms of immune suppression that take place within the tumoral microenvironment which allow tumor cells to escape control from the immune system. The increasingly precise knowledge of the brakes to an effective antitumor immune response allows the development of immunotherapy strategies more and more innovating and promising of hope.

  7. Immune Reconstitution after Allogeneic Hematopoietic Stem Cell Transplantation

    PubMed Central

    Ogonek, Justyna; Kralj Juric, Mateja; Ghimire, Sakhila; Varanasi, Pavankumar Reddy; Holler, Ernst; Greinix, Hildegard; Weissinger, Eva

    2016-01-01

    The timely reconstitution and regain of function of a donor-derived immune system is of utmost importance for the recovery and long-term survival of patients after allogeneic hematopoietic stem cell transplantation (HSCT). Of note, new developments such as umbilical cord blood or haploidentical grafts were associated with prolonged immunodeficiency due to delayed immune reconstitution, raising the need for better understanding and enhancing the process of immune reconstitution and finding strategies to further optimize these transplant procedures. Immune reconstitution post-HSCT occurs in several phases, innate immunity being the first to regain function. The slow T cell reconstitution is regarded as primarily responsible for deleterious infections with latent viruses or fungi, occurrence of graft-versus-host disease, and relapse. Here we aim to summarize the major steps of the adaptive immune reconstitution and will discuss the importance of immune balance in patients after HSCT. PMID:27909435

  8. Measuring the immune system: a comprehensive approach for the analysis of immune functions in humans.

    PubMed

    Claus, Maren; Dychus, Nicole; Ebel, Melanie; Damaschke, Jürgen; Maydych, Viktoriya; Wolf, Oliver T; Kleinsorge, Thomas; Watzl, Carsten

    2016-10-01

    The immune system is essential to provide protection from infections and cancer. Disturbances in immune function can therefore directly affect the health of the affected individual. Many extrinsic and intrinsic factors such as exposure to chemicals, stress, nutrition and age have been reported to influence the immune system. These influences can affect various components of the immune system, and we are just beginning to understand the causalities of these changes. To investigate such disturbances, it is therefore essential to analyze the different components of the immune system in a comprehensive fashion. Here, we demonstrate such an approach which provides information about total number of leukocytes, detailed quantitative and qualitative changes in the composition of lymphocyte subsets, cytokine levels in serum and functional properties of T cells, NK cells and monocytes. Using samples from a cohort of 24 healthy volunteers, we demonstrate the feasibility of our approach to detect changes in immune functions.

  9. Specified assurance level sampling procedure

    SciTech Connect

    Willner, O.

    1980-11-01

    In the nuclear industry design specifications for certain quality characteristics require that the final product be inspected by a sampling plan which can demonstrate product conformance to stated assurance levels. The Specified Assurance Level (SAL) Sampling Procedure has been developed to permit the direct selection of attribute sampling plans which can meet commonly used assurance levels. The SAL procedure contains sampling plans which yield the minimum sample size at stated assurance levels. The SAL procedure also provides sampling plans with acceptance numbers ranging from 0 to 10, thus, making available to the user a wide choice of plans all designed to comply with a stated assurance level.

  10. Your Child's Immunization Record

    MedlinePlus

    Your Child’s Immunization Record It’s important to keep up-to-date records of all your child’s immunizations, beginning at birth and continuing through ... receives a vaccination by filling in the date. Record of Immunizations Date Given: Where Given: Reaction: Hepatitis ...

  11. The Immune System Game

    ERIC Educational Resources Information Center

    Work, Kirsten A.; Gibbs, Melissa A.; Friedman, Erich J.

    2015-01-01

    We describe a card game that helps introductory biology students understand the basics of the immune response to pathogens. Students simulate the steps of the immune response with cards that represent the pathogens and the cells and molecules mobilized by the immune system. In the process, they learn the similarities and differences between the…

  12. Immune System Quiz

    MedlinePlus

    ... los dientes Video: Getting an X-ray Quiz: Immune System KidsHealth > For Kids > Quiz: Immune System Print A A A How much do you know about your immune system? Find out by taking this quiz! About KidsHealth ...

  13. Immune Disorder HSCT Protocol

    ClinicalTrials.gov

    2016-11-01

    Immune Deficiency Disorders; Severe Combined Immunodeficiency; Chronic Granulomatous Disease; X-linked Agammaglobulinemia; Wiskott-Aldrich Syndrome; Hyper-IgM; DiGeorge Syndrome; Chediak-Higashi Syndrome; Common Variable Immune Deficiency; Immune Dysregulatory Disorders; Hemophagocytic Lymphohistiocytosis; IPEX; Autoimmune Lymphoproliferative Syndrome; X-linked Lymphoproliferative Syndrome

  14. Engineering synthetic vaccines using cues from natural immunity

    PubMed Central

    Irvine, Darrell J.; Swartz, Melody A.; Szeto, Gregory L.

    2014-01-01

    Vaccines aim to protect against or treat diseases through manipulation of the immune response, promoting either immunity or tolerance. The former generate antibodies and T-cells poised to protect against future pathogen encounter or attack diseased cells such as tumors; the latter, which are far less developed, block pathogenic autoreactive T-cells and autoantibodies that target self tissue. Enormous challenges remain, however, as a consequence of our incomplete understanding of human immunity. A rapidly growing field of research is the design of synthetic materials in vaccines to 1) target organs, tissues, cells, or intracellular compartments; 2) co-deliver immunomodulatory signals that control the quality of the immune response; or 3) directly act as immune regulators, and there exists great potential for well-defined materials to further our understanding of immunity. Here we describe recent advances in the design of synthetic materials to direct immune responses, highlighting successes and challenges in prophylactic, therapeutic, and tolerance-inducing vaccines. PMID:24150416

  15. Immunization in vitro and production of monoclonal antibodies specific to insoluble and weakly immunogenic proteins.

    PubMed Central

    Van Ness, J; Laemmli, U K; Pettijohn, D E

    1984-01-01

    A procedure is described for immunizing in vitro and stimulating proliferation of specific B-cell lymphocytes. The method is applicable to production of monoclonal antibodies against proteins that are soluble only in denaturing solvents. An induction period is described in which antigen is presented to the B-cell population in the absence of serum. Also, antigen is coupled to mitogenic silica, which allows the effective presentation of both soluble and insoluble antigens. The results indicate hybridomas can be obtained that secrete IgMs directed against highly conserved or weakly immunogenic antigens. Images PMID:6083563

  16. Effect of cellular mobility on immune response

    NASA Astrophysics Data System (ADS)

    Pandey, R. B.; Mannion, R.; Ruskin, H. J.

    2000-08-01

    Mobility of cell types in our HIV immune response model is subject to an intrinsic mobility and an explicit directed mobility, which is governed by Pmob. We investigate how restricting the explicit mobility, while maintaining the innate mobility of a viral-infected cell, affects the model's results. We find that increasing the explicit mobility of the immune system cells leads to viral dominance for certain levels of viral mutation. We conclude that increasing immune system cellular mobility indirectly increases the virus’ inherent mobility.

  17. CRISPR-Cas immunity in prokaryotes.

    PubMed

    Marraffini, Luciano A

    2015-10-01

    Prokaryotic organisms are threatened by a large array of viruses and have developed numerous defence strategies. Among these, only clustered, regularly interspaced short palindromic repeat (CRISPR)-Cas systems provide adaptive immunity against foreign elements. Upon viral injection, a small sequence of the viral genome, known as a spacer, is integrated into the CRISPR locus to immunize the host cell. Spacers are transcribed into small RNA guides that direct the cleavage of the viral DNA by Cas nucleases. Immunization through spacer acquisition enables a unique form of evolution whereby a population not only rapidly acquires resistance to its predators but also passes this resistance mechanism vertically to its progeny.

  18. How phototherapy affects the immune system

    NASA Astrophysics Data System (ADS)

    Dyson, Mary

    2008-03-01

    The immune system is a complex group of cells, tissues and organs that recognize and attack foreign substances, pathogenic organisms and cancer cells. It also responds to injury by producing inflammation. The immune system has peripheral components that include skin-associated lymphoid tissues (SALT) and mucosa-associated lymphoid tissues (MALT), located where pathogens and other harmful substances gain access to the body. Phototherapy, delivered at appropriate treatment parameters, exerts direct actions on the cellular elements of the peripheral part of the immune system since it is readily accessible to photons.

  19. Boosting Tumor-Specific Immunity Using PDT

    PubMed Central

    Maeding, Nicole; Verwanger, Thomas; Krammer, Barbara

    2016-01-01

    Photodynamic therapy (PDT) is a cancer treatment with a long-standing history. It employs the application of nontoxic components, namely a light-sensitive photosensitizer and visible light, to generate reactive oxygen species (ROS). These ROS lead to tumor cell destruction, which is accompanied by the induction of an acute inflammatory response. This inflammatory process sends a danger signal to the innate immune system, which results in activation of specific cell types and release of additional inflammatory mediators. Activation of the innate immune response is necessary for subsequent induction of the adaptive arm of the immune system. This includes the priming of tumor-specific cytotoxic T lymphocytes (CTL) that have the capability to directly recognize and kill cells which display an altered self. The past decades have brought increasing appreciation for the importance of the generation of an adaptive immune response for long-term tumor control and induction of immune memory to combat recurrent disease. This has led to considerable effort to elucidate the immune effects PDT treatment elicits. In this review we deal with the progress which has been made during the past 20 years in uncovering the role of PDT in the induction of the tumor-specific immune response, with special emphasis on adaptive immunity. PMID:27782066

  20. Innate Immunity and BK Virus: Prospective Strategies.

    PubMed

    Kariminik, Ashraf; Yaghobi, Ramin; Dabiri, Shahriar

    2016-03-01

    Recent information demonstrated that BK virus reactivation is a dominant complication after kidney transplantation, which occurs because of immunosuppression. BK virus reactivation is the main reason of transplanted kidney losing. Immune response against BK virus is the major inhibitor of the virus reactivation. Therefore, improving our knowledge regarding the main parameters that fight against BK viruses can shed light on to direct new treatment strategies to suppress BK infection. Innate immunity consists of numerous cell systems and also soluble molecules, which not only suppress virus replication, but also activate adaptive immunity to eradicate the infection. Additionally, it appears that immune responses against reactivated BK virus are the main reasons for induction of BK virus-associated nephropathy (BKAN). Thus, improving our knowledge regarding the parameters and detailed mechanisms of innate immunity and also the status of innate immunity of the patients with BK virus reactivation and its complications can introduce new prospective strategies to either prevent or as therapy of the complication. Therefore, this review was aimed to collate the most recent data regarding the roles played by innate immunity against BK virus and also the status of innate immunity in the patients with reactivation BK virus and BKAN.

  1. Immune responses in space flight

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.

    1998-01-01

    Space flight has been shown to have profound effects on immunological parameters of humans, monkeys and rodents. These studies have been carried out by a number of different laboratories. Among the parameters affected are leukocyte blastogenesis, natural killer cell activity, leukocyte subset distribution, cytokine production - including interferons and interleukins, and macrophage maturation and activity. These changes start to occur only after a few days space flight, and some changes continue throughout long-term space flight. Antibody responses have received only very limited study, and total antibody levels have been shown to be increased after long-term space flight. Several factors could be involved in inducing these changes. These factors could include microgravity, lack of load-bearing, stress, acceleration forces, and radiation. The mechanism(s) for space flight-induced changes in immune responses remain(s) to be established. Certainly, there can be direct effects of microgravity, or other factors, on cells that play a fundamental role in immune responses. However, it is now clear that there are interactions between the immune system and other physiological systems that could play a major role. For example, changes occurring in calcium use in the musculoskeletal system induced by microgravity or lack of use could have great impact on the immune system. Most of the changes in immune responses have been observed using samples taken immediately after return from space flight. However, there have been two recent studies that have used in-flight testing. Delayed-type hypersensitivity responses to common recall antigens of astronauts and cosmonauts have been shown to be decreased when tested during space flights. Additionally, natural killer cell and blastogenic activities are inhibited in samples taken from rats during space flight. Therefore, it is now clear that events occurring during space flight itself can affect immune responses. The biological

  2. Kidney and innate immunity.

    PubMed

    Wang, Ying-Hui; Zhang, Yu-Gen

    2017-03-01

    Innate immune system is an important modulator of the inflammatory response during infection and tissue injury/repair. The kidney as a vital organ with high energy demand plays a key role in regulating the disease related metabolic process. Increasing research interest has focused on the immune pathogenesis of many kidney diseases. However, innate immune cells such as dendritic cells, macrophages, NK cells and a few innate lymphocytes, as well as the complement system are essential for renal immune homeostasis and ensure a coordinated balance between tissue injury and regeneration. The innate immune response provides the first line of host defense initiated by several classes of pattern recognition receptors (PRRs), such as membrane-bound Toll-like receptors (TLRs) and nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs), together with inflammasomes responsible for early innate immune response. Although the innate immune system is well studied, the research on the detailed relationship between innate immunity and kidney is still very limited. In this review, we will focus on the innate immune sensing system in renal immune homeostasis, as well as the corresponding pathogenesis of many kidney diseases. The pivotal roles of innate immunity in renal injury and regeneration with special emphasis on kidney disease related immunoregulatory mechanism are also discussed.

  3. Chapter 2: Innate Immunity

    PubMed Central

    Turvey, Stuart E.; Broide, David H.

    2009-01-01

    Recent years have witnessed an explosion of interest in the innate immune system. Questions about how the innate immune system senses infection and empowers a protective immune response are being answered at the molecular level. These basic science discoveries are being translated into a more complete understanding of the central role innate immunity plays in the pathogenesis of many human infectious and inflammatory diseases. It is particularly exciting that we are already seeing a return on these scientific investments with the emergence of novel therapies to harness the power of the innate immune system. In this review we explore the defining characteristics of the innate immune system, and through more detailed examples, we highlight recent breakthroughs that have advanced our understanding of the role of innate immunity in human health and disease. PMID:19932920

  4. Regulations and Procedures Manual

    SciTech Connect

    Young, Lydia J.

    2011-07-25

    The purpose of the Regulations and Procedures Manual (RPM) is to provide LBNL personnel with a reference to University and Lawrence Berkeley National Laboratory (LBNL or Laboratory) policies and regulations by outlining normal practices and answering most policy questions that arise in the day-to-day operations of Laboratory organizations. Much of the information in this manual has been condensed from detail provided in LBNL procedure manuals, Department of Energy (DOE) directives, and Contract DE-AC02-05CH11231. This manual is not intended, however, to replace any of those documents. RPM sections on personnel apply only to employees who are not represented by unions. Personnel policies pertaining to employees represented by unions may be found in their labor agreements. Questions concerning policy interpretation should be directed to the LBNL organization responsible for the particular policy. A link to the Managers Responsible for RPM Sections is available on the RPM home page. If it is not clear which organization is responsible for a policy, please contact Requirements Manager Lydia Young or the RPM Editor.

  5. Regulations and Procedures Manual

    SciTech Connect

    Young, Lydia

    2010-09-30

    The purpose of the Regulations and Procedures Manual (RPM) is to provide Laboratory personnel with a reference to University and Lawrence Berkeley National Laboratory policies and regulations by outlining the normal practices and answering most policy questions that arise in the day-to-day operations of Laboratory departments. Much of the information in this manual has been condensed from detail provided in Laboratory procedure manuals, Department of Energy (DOE) directives, and Contract DE-AC02-05CH11231. This manual is not intended, however, to replace any of those documents. The sections on personnel apply only to employees who are not represented by unions. Personnel policies pertaining to employees represented by unions may be found in their labor agreements. Questions concerning policy interpretation should be directed to the department responsible for the particular policy. A link to the Managers Responsible for RPM Sections is available on the RPM home page. If it is not clear which department should be called, please contact the Associate Laboratory Director of Operations.

  6. Mass Cytometry of the Human Mucosal Immune System Identifies Tissue- and Disease-Associated Immune Subsets.

    PubMed

    van Unen, Vincent; Li, Na; Molendijk, Ilse; Temurhan, Mine; Höllt, Thomas; van der Meulen-de Jong, Andrea E; Verspaget, Hein W; Mearin, M Luisa; Mulder, Chris J; van Bergen, Jeroen; Lelieveldt, Boudewijn P F; Koning, Frits

    2016-05-17

    Inflammatory intestinal diseases are characterized by abnormal immune responses and affect distinct locations of the gastrointestinal tract. Although the role of several immune subsets in driving intestinal pathology has been studied, a system-wide approach that simultaneously interrogates all major lineages on a single-cell basis is lacking. We used high-dimensional mass cytometry to generate a system-wide view of the human mucosal immune system in health and disease. We distinguished 142 immune subsets and through computational applications found distinct immune subsets in peripheral blood mononuclear cells and intestinal biopsies that distinguished patients from controls. In addition, mucosal lymphoid malignancies were readily detected as well as precursors from which these likely derived. These findings indicate that an integrated high-dimensional analysis of the entire immune system can identify immune subsets associated with the pathogenesis of complex intestinal disorders. This might have implications for diagnostic procedures, immune-monitoring, and treatment of intestinal diseases and mucosal malignancies.

  7. Measuring polio immunity to plan immunization activities.

    PubMed

    Voorman, Arend; Lyons, Hil M

    2016-11-21

    The Global Polio Eradication Initiative is closer than ever to achieving a polio-free world. Immunization activities must still be carried out in non-endemic countries to maintain population immunity at levels which will stop poliovirus from spreading if it is re-introduced from still-infected areas. In areas where there is no active transmission of poliovirus, programs must rely on surrogate indicators of population immunity to determine the appropriate immunization activities, typically caregiver-reported vaccination history obtained from non-polio acute flaccid paralysis patients identified through polio surveillance. We used regression models to examine the relationship between polio vaccination campaigns and caregiver-reported polio vaccination history. We find that in many countries, vaccination campaigns have a surprisingly weak impact on these commonly used indicators. We conclude that alternative criteria and data, such as routine immunization indicators from vaccination records or household surveys, should be considered for planning polio vaccination campaigns, and that validation of such surrogate indicators is necessary if they are to be used as the basis for program planning and risk assessment. We recommend that the GPEI and similar organizations consider or continue devoting additional resources to rigorously study population immunity and campaign effectiveness in at-risk countries.

  8. Innate immune control and regulation of influenza virus infections

    PubMed Central

    McGill, Jodi; Heusel, Jonathan W.; Legge, Kevin L.

    2009-01-01

    Adaptive immune responses are critical for the control and clearance of influenza A virus (IAV) infection. However, in recent years, it has become increasingly apparent that innate immune cells, including natural killer cells, alveolar macrophages (aMφ), and dendritic cells (DC) are essential following IAV infection in the direct control of viral replication or in the induction and regulation of virus-specific adaptive immune responses. This review will discuss the role of these innate immune cells following IAV infection, with a particular focus on DC and their ability to induce and regulate the adaptive IAV-specific immune response. PMID:19643736

  9. Immune-mediated mechanisms influencing the efficacy of anticancer therapies.

    PubMed

    Coffelt, Seth B; de Visser, Karin E

    2015-04-01

    Conventional anticancer therapies, such as chemotherapy, radiotherapy, and targeted therapy, are designed to kill cancer cells. However, the efficacy of anticancer therapies is not only determined by their direct effects on cancer cells but also by off-target effects within the host immune system. Cytotoxic treatment regimens elicit several changes in immune-related parameters including the composition, phenotype, and function of immune cells. Here we discuss the impact of innate and adaptive immune cells on the success of anticancer therapy. In this context we examine the opportunities to exploit host immune responses to boost tumor clearing, and highlight the challenges facing the treatment of advanced metastatic disease.

  10. Prenatal Alcohol Exposure and the Developing Immune System.

    PubMed

    Gauthier, Theresa W

    2015-01-01

    Evidence from research in humans and animals suggest that ingesting alcohol during pregnancy can disrupt the fetal immune system and result in an increased risk of infections and disease in newborns that may persist throughout life. Alcohol may have indirect effects on the immune system by increasing the risk of premature birth, which itself is a risk factor for immune-related problems. Animal studies suggest that alcohol exposure directly disrupts the developing immune system. A comprehensive knowledge of the mechanisms underlying alcohol's effects on the developing immune system only will become clear once researchers establish improved methods for identifying newborns exposed to alcohol in utero.

  11. How do plants achieve immunity? Defence without specialized immune cells.

    PubMed

    Spoel, Steven H; Dong, Xinnian

    2012-01-25

    Vertebrates have evolved a sophisticated adaptive immune system that relies on an almost infinite diversity of antigen receptors that are clonally expressed by specialized immune cells that roam the circulatory system. These immune cells provide vertebrates with extraordinary antigen-specific immune capacity and memory, while minimizing self-reactivity. Plants, however, lack specialized mobile immune cells. Instead, every plant cell is thought to be capable of launching an effective immune response. So how do plants achieve specific, self-tolerant immunity and establish immune memory? Recent developments point towards a multilayered plant innate immune system comprised of self-surveillance, systemic signalling and chromosomal changes that together establish effective immunity.

  12. Do Advance Directives Direct?

    PubMed

    Shapiro, Susan P

    2015-06-01

    Resolution of long-standing debates about the role and impact of advance directives - living wills and powers of attorney for health care - has been hampered by a dearth of appropriate data, in particular data that compare the process and outcomes of end-of-life decision making on behalf of patients with and without advance directives. Drawing on a large ethnographic study of patients in two intensive care units in a large urban teaching hospital, this article compares aspects of the medical decision-making process and outcomes by advance-directive status. Controlling for demographic characteristics and severity of illness, the study finds few significant differences between patients without advance directives and those who claim to have them. Surprisingly, these few differences hold only for those whose directives are in their hospital chart. There are no significant differences between those with no directive and those claiming to have a copy at home or elsewhere. The article considers the implications if directives seemingly must be in hand to show even modest effects. Do advance directives direct? The intensive care unit data provide far more support for the growing body of literature that casts doubt on their impact than studies that promote the use of them.

  13. Biomimetic and synthetic interfaces to tune immune responses (Review)

    PubMed Central

    Garapaty, Anusha; Champion, Julie A.

    2015-01-01

    Organisms depend upon complex intercellular communication to initiate, maintain, or suppress immune responses during infection or disease. Communication occurs not only between different types of immune cells, but also between immune cells and nonimmune cells or pathogenic entities. It can occur directly at the cell–cell contact interface, or indirectly through secreted signals that bind cell surface molecules. Though secreted signals can be soluble, they can also be particulate in nature and direct communication at the cell–particle interface. Secreted extracellular vesicles are an example of native particulate communication, while viruses are examples of foreign particulates. Inspired by communication at natural immunological interfaces, biomimetic materials and designer molecules have been developed to mimic and direct the type of immune response. This review describes the ways in which native, biomimetic, and designer materials can mediate immune responses. Examples include extracellular vesicles, particles that mimic immune cells or pathogens, and hybrid designer molecules with multiple signaling functions, engineered to target and bind immune cell surface molecules. Interactions between these materials and immune cells are leading to increased understanding of natural immune communication and function, as well as development of immune therapeutics for the treatment of infection, cancer, and autoimmune disease. PMID:26178262

  14. Human immune system variation

    PubMed Central

    Brodin, Petter; Davis, Mark M.

    2017-01-01

    The human immune system is highly variable between individuals but relatively stable over time within a given person. Recent conceptual and technological advances have enabled systems immunology analyses, which reveal the composition of immune cells and proteins in populations of healthy individuals. The range of variation and some specific influences that shape an individual’s immune system is now becoming clearer. Human immune systems vary as a consequence of heritable and non-heritable influences, but symbiotic and pathogenic microbes and other non-heritable influences explain most of this variation. Understanding when and how such influences shape the human immune system is key for defining metrics of immunological health and understanding the risk of immune-mediated and infectious diseases. PMID:27916977

  15. Immune Regulation of Cancer

    PubMed Central

    Disis, Mary L.

    2010-01-01

    Innate and adaptive immune system cells play a major role in regulating the growth of cancer. Although it is commonly thought that an immune response localized to the tumor will inhibit cancer growth, it is clear that some types of inflammation induced in a tumor may also lead to cancer proliferation, invasion, and dissemination. Recent evidence suggests, however, that some patients with cancer can mount an antitumor immune response that has the potential to control or eliminate cancer. Indeed, a so-called “immune response” signature has been described in malignancy that is associated with improved outcomes in several tumor types. Moreover, the presence of specific subsets of T cells, which have the capability to penetrate tumor stroma and infiltrate deep into the parenchyma, identifies patients with an improved prognosis. Immune-based therapies have the potential to modulate the tumor microenvironment by eliciting immune system cells that will initiate acute inflammation that leads to tissue destruction. PMID:20516428

  16. Immunizations: vaccinations in general.

    PubMed

    Wiley, Catherine C

    2015-06-01

    The childhood immunization schedule is complex and nuanced. Although serious adverse reactions to immunizations are uncommon, clinicians must be well-versed in these reactions as well as the contraindications and precautions to each vaccine. • Conjugate vaccine technology links polysaccharide antigens to carrier proteins, triggering T-cell-dependent immunity to polysaccharides, thereby strengthening immune memory. • On the basis of some research evidence and consensus, live vaccines are generally contraindicated in immunocompromised patients and in pregnancy. Most live vaccines can be administered to household contacts of immunocompromised patients. • On the basis of some research and consensus, modified administration of meningococcal, pneumococcal, and less commonly, other vaccines may be indicated to protect immunocompromised patients. • On the basis of disease epidemiology and consensus, international travelers should be up-to-date with all routine immunizations; depending on destination, additional vaccines or immune globulin may be required.

  17. Neural circuitry and immunity.

    PubMed

    Pavlov, Valentin A; Tracey, Kevin J

    2015-12-01

    Research during the last decade has significantly advanced our understanding of the molecular mechanisms at the interface between the nervous system and the immune system. Insight into bidirectional neuro-immune communication has characterized the nervous system as an important partner of the immune system in the regulation of inflammation. Neuronal pathways, including the vagus nerve-based inflammatory reflex, are physiological regulators of immune function and inflammation. In parallel, neuronal function is altered in conditions characterized by immune dysregulation and inflammation. Here, we review these regulatory mechanisms and describe the neural circuitry modulating immunity. Understanding these mechanisms reveals possibilities to use targeted neuromodulation as a therapeutic approach for inflammatory and autoimmune disorders. These findings and current clinical exploration of neuromodulation in the treatment of inflammatory diseases define the emerging field of Bioelectronic Medicine.

  18. Origins of adaptive immunity.

    PubMed

    Liongue, Clifford; John, Liza B; Ward, Alister

    2011-01-01

    Adaptive immunity, involving distinctive antibody- and cell-mediated responses to specific antigens based on "memory" of previous exposure, is a hallmark of higher vertebrates. It has been argued that adaptive immunity arose rapidly, as articulated in the "big bang theory" surrounding its origins, which stresses the importance of coincident whole-genome duplications. Through a close examination of the key molecules and molecular processes underpinning adaptive immunity, this review suggests a less-extreme model, in which adaptive immunity emerged as part of longer evolutionary journey. Clearly, whole-genome duplications provided additional raw genetic materials that were vital to the emergence of adaptive immunity, but a variety of other genetic events were also required to generate some of the key molecules, whereas others were preexisting and simply co-opted into adaptive immunity.

  19. Bariatric Surgery Procedures

    MedlinePlus

    ... Center Access to Care Toolkit EHB Access Toolkit Bariatric Surgery Procedures Bariatric surgical procedures cause weight loss by ... minimally invasive techniques (laparoscopic surgery). The most common bariatric surgery procedures are gastric bypass, sleeve gastrectomy, adjustable gastric ...

  20. Innate Immunity in Disease

    PubMed Central

    Elliott, David E.; Siddique, Sana S.; Weinstock, Joel V.

    2014-01-01

    Cells can innately recognize generic products of viruses, bacteria, fungi, or injured tissue by engagement of pattern recognition receptors. Innate immune cells rapidly respond to this engagement in order to control commensals, thwart pathogens and/or prompt repair. Insufficient or excessive activation of the innate immune response results in disease. This review focuses on pattern recognition receptors and cells of the innate immune system important for intestinal function. Our improving knowledge pertaining to this important aspect of our immune response is opening potential important new therapeutic opportunities for the treatment of disease. PMID:24632348

  1. Improving immunization strategies

    NASA Astrophysics Data System (ADS)

    Gallos, Lazaros K.; Liljeros, Fredrik; Argyrakis, Panos; Bunde, Armin; Havlin, Shlomo

    2007-04-01

    We introduce an immunization method where the percentage of required vaccinations for immunity are close to the optimal value of a targeted immunization scheme of highest degree nodes. Our strategy retains the advantage of being purely local, without the need for knowledge on the global network structure or identification of the highest degree nodes. The method consists of selecting a random node and asking for a neighbor that has more links than himself or more than a given threshold and immunizing him. We compare this method to other efficient strategies on three real social networks and on a scale-free network model and find it to be significantly more effective.

  2. Nanoparticles and direct immunosuppression

    PubMed Central

    Ngobili, Terrika A

    2016-01-01

    Targeting the immune system with nanomaterials is an intensely active area of research. Specifically, the capability to induce immunosuppression is a promising complement for drug delivery and regenerative medicine therapies. Many novel strategies for immunosuppression rely on nanoparticles as delivery vehicles for small-molecule immunosuppressive compounds. As a consequence, efforts in understanding the mechanisms in which nanoparticles directly interact with the immune system have been overshadowed. The immunological activity of nanoparticles is dependent on the physiochemical properties of the nanoparticles and its subsequent cellular internalization. As the underlying factors for these reactions are elucidated, more nanoparticles may be engineered and evaluated for inducing immunosuppression and complementing immunosuppressive drugs. This review will briefly summarize the state-of-the-art and developments in understanding how nanoparticles induce immunosuppressive responses, compare the inherent properties of nanomaterials which induce these immunological reactions, and comment on the potential for using nanomaterials to modulate and control the immune system. PMID:27229901

  3. Oral innate immunity in HIV infection in HAART era.

    PubMed

    Nittayananta, Wipawee; Tao, Renchuan; Jiang, Lanlan; Peng, Yuanyuan; Huang, Yuxiao

    2016-01-01

    Oral innate immunity, an important component in host defense and immune surveillance in the oral cavity, plays a crucial role in the regulation of oral health. As part of the innate immune system, epithelial cells lining oral mucosal surfaces not only provide a physical barrier but also produce different antimicrobial peptides, including human β-defensins (hBDs), secretory leukocyte protease inhibitor (SLPI), and various cytokines. These innate immune mediators help in maintaining oral homeostasis. When they are impaired either by local or systemic causes, various oral infections and malignancies may be developed. Human immunodeficiency virus (HIV) infection and other co-infections appear to have both direct and indirect effects on systemic and local innate immunity leading to the development of oral opportunistic infections and malignancies. Highly active antiretroviral therapy (HAART), the standard treatment of HIV infection, contributed to a global reduction of HIV-associated oral lesions. However, prolonged use of HAART may lead to adverse effects on the oral innate immunity resulting in the relapse of oral lesions. This review article focused on the roles of oral innate immunity in HIV infection in HAART era. The following five key questions were addressed: (i) What are the roles of oral innate immunity in health and disease?, (ii) What are the effects of HIV infection on oral innate immunity?, (iii) What are the roles of oral innate immunity against other co-infections?, (iv) What are the effects of HAART on oral innate immunity?, and (v) Is oral innate immunity enhanced by HAART?

  4. Immunity and Immunopathology in the Tuberculous Granuloma.

    PubMed

    Pagán, Antonio J; Ramakrishnan, Lalita

    2014-11-06

    Granulomas, organized aggregates of immune cells, are a defining feature of tuberculosis (TB). Granuloma formation is implicated in the pathogenesis of a variety of inflammatory disorders. However, the tuberculous granuloma has been assigned the role of a host protective structure which "walls-off" mycobacteria. Work conducted over the past decade has provided a more nuanced view of its role in pathogenesis. On the one hand, pathogenic mycobacteria accelerate and exploit granuloma formation for their expansion and dissemination by manipulating host immune responses to turn leukocyte recruitment and cell death pathways in their favor. On the other hand, granuloma macrophages can preserve granuloma integrity by exerting a microbicidal immune response, thus preventing an even more rampant expansion of infection in the extracellular milieu. Even this host-beneficial immune response required to maintain the bacteria intracellular must be tempered, as an overly vigorous immune response can also cause granuloma breakdown, thereby directly supporting bacterial growth extracellularly. This review will discuss how mycobacteria manipulate inflammatory responses to drive granuloma formation and will consider the roles of the granuloma in pathogenesis and protective immunity, drawing from clinical studies of TB in humans and from animal models--rodents, zebrafish, and nonhuman primates. A deeper understanding of TB pathogenesis and immunity in the granuloma could suggest therapeutic approaches to abrogate the host-detrimental aspects of granuloma formation to convert it into the host-beneficial structure that it has been thought to be for nearly a century.

  5. Targeted immune therapy of ovarian cancer.

    PubMed

    Knutson, Keith L; Karyampudi, Lavakumar; Lamichhane, Purushottam; Preston, Claudia

    2015-03-01

    Clinical outcomes, such as recurrence-free survival and overall survival, in ovarian cancer are quite variable, independent of common characteristics such as stage, response to therapy, and grade. This disparity in outcomes warrants further exploration and therapeutic targeting into the interaction between the tumor and host. One compelling host characteristic that contributes both to the initiation and progression of ovarian cancer is the immune system. Hundreds of studies have confirmed a prominent role for the immune system in modifying the clinical course of the disease. Recent studies also show that anti-tumor immunity is often negated by immune regulatory cells present in the tumor microenvironment. Regulatory immune cells also directly enhance the pathogenesis through the release of various cytokines and chemokines, which together form an integrated pathological network. Thus, in the future, research into immunotherapy targeting ovarian cancer will probably become increasingly focused on combination approaches that simultaneously augment immunity while preventing local immune suppression. In this article, we summarize important immunological targets that influence ovarian cancer outcome as well as include an update on newer immunotherapeutic strategies.

  6. Targeted Immune Therapy of Ovarian Cancer

    PubMed Central

    Knutson, Keith L.; Karyampudi, Lavakumar; Lamichhane, Purushottam; Preston, Claudia

    2014-01-01

    Clinical outcomes, such as recurrence free survival and overall survival, in ovarian cancer are quite variable, independent of common characteristics such as stage, response to therapy and grade. This disparity in outcomes warrants further exploration and therapeutic targeting into the interaction between the tumor and host. One compelling host characteristic that contributes both to the initiation and progression of ovarian cancer is the immune system. Hundreds of studies have confirmed a prominent role for the immune system in modifying the clinical course of the disease. Recent studies also show that anti-tumor immunity is often negated by immune regulatory cells present in the tumor microenvironment. Regulatory immune cells also directly enhance the pathogenesis through the release of various cytokines and chemokines, which together form an integrated pathologic network. Thus, in the future, research into immunotherapy targeting ovarian cancer will probably become increasingly focused on combination approaches that simultaneously augment immunity while preventing local immune suppression. In this article, we summarize important immunological targets that influence ovarian cancer outcome as well as include an update on newer immunotherapeutic strategies. PMID:25544369

  7. [Chronobiology and immunity].

    PubMed

    Kwiatkowski, F; Lévi, F

    2005-06-01

    At all times, cycles have focused men's attention and fashioned his life. Today, thanks to genetic, one can find tracks of circadian rhythms programming until cell's DNA, and this in a very amazing and similar manner from amoebas to mammals. A particular rhythm interests the researcher in oncology: the circadian rhythm of melatonin. It stands at the junction of several domains: somatic, immune and psychic, through the many receptors found on leukocytes, through the links between this hormone production and the one of many cytokines but also with activity, life habits and "stress". On an other hand, antioxydant action of melatonin gives a serious argument concerning its possible role in cancer aetiology. As for them, studies on sleep confirm the large ubiquity of biological cycles, for instance thanks to the observation of the impact of particular genetic mutations on advance or delayed sleep syndrome. Because of the great diversity of cyclic phenomena, the study of chronobiology cannot be undertaken today without a wide interdisciplinary collaboration. During the 13th congress of the "Association Francaise de Chronobiologie Medicale", this study has been continued mainly in three different directions of research: fundamental, applied and transverse. Many original experimental results have been presented and new ways of multidisciplinary research specified. The important scientific fecundity of this very convivial annual congress never lacks to satisfy its participants: it continues to favour the onset of new projects, enabling to avoid major shelves thanks to the constructive criticism of each domain specialists.

  8. Recombinant Poxvirus and the Tumor Microenvironment: Oncolysis, Immune Regulation and Immunization

    PubMed Central

    Sharp, Daniel W.; Lattime, Edmund C.

    2016-01-01

    Oncolytic viruses (OVs) are being extensively studied for their potential roles in the development of cancer therapy regimens. In addition to their direct lytic effects, OVs can initiate and drive systemic antitumor immunity indirectly via release of tumor antigen, as well as by encoding and delivering immunostimulatory molecules. This combination makes them an effective platform for the development of immunotherapeutic strategies beyond their primary lytic function. Engineering the viruses to also express tumor-associated antigens (TAAs) allows them to simultaneously serve as therapeutic vaccines, targeting and amplifying an immune response to TAAs. Our group and others have shown that vaccinating intratumorally with a poxvirus that encodes TAAs, in addition to immune stimulatory molecules, can modulate the tumor microenvironment, overcome immune inhibitory pathways, and drive both local and systemic tumor specific immune responses. PMID:28191451

  9. [Platelet transfusion role in neonatal immune thrombocytopenia].

    PubMed

    Petermann, R

    2016-11-01

    Neonatal immune thrombocytopenia represent less than 5% of cases of early thrombocytopenia (early-onset<72hours post-delivery). As in adults, thrombocytopenia in neonates is defined as a platelet count less than 150G/L. They are either auto- or allo-immune. Thrombocytopenia resulting from transplacental passage of maternal antibodies directed to platelet membrane glycoproteins can be severe. The major complication of severe thrombocytopenia is bleeding and particularly intra-cranial haemorrhage and neurologic sequelea following. However, auto- and allo-immune thrombocytopenia have very different characteristics including the treatment management. In fact, this treatment is based on platelet transfusion associated or not to intravenous immunoglobulin administration. The purpose of this article is to remind platelet transfusion's place in neonatal immune thrombocytopenia in terms of recently published French guidelines and international practices.

  10. Targeting immune checkpoints in malignant glioma

    PubMed Central

    Li, Tete; Liu, Yong-Jun; Chen, Wei; Chen, Jingtao

    2017-01-01

    Malignant glioma is the most common and a highly aggressive cancer in the central nervous system (CNS). Cancer immunotherapy, strategies to boost the bodys anti-cancer immune responses instead of directly targeting tumor cells, recently achieved great success in treating several human solid tumors. Although once considered immune privileged and devoid of normal immunological functions, CNS is now considered a promising target for cancer immunotherapy, featuring the recent progresses in neurobiology and neuroimmunology and a highly immunosuppressive state in malignant glioma. In this review, we focus on immune checkpoint inhibitors, specifically, antagonizing monoclonal antibodies for programmed cell death protein-1 (PD-1), cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4), and indoleamine 2,3-dioxygenase (IDO). We discuss advances in the working mechanisms of these immune checkpoint molecules, their status in malignant glioma, and current preclinical and clinical trials targeting these molecules in malignant glioma. PMID:27756892

  11. The Immune System in the Pathogenesis of Ovarian Cancer

    PubMed Central

    Charbonneau, Bridget; Goode, Ellen L.; Kalli, Kimberly R.; Knutson, Keith L.; DeRycke, Melissa S.

    2014-01-01

    Clinical outcomes in ovarian cancer are heterogeneous even when considering common features such as stage, response to therapy, and grade. This disparity in outcomes warrants further exploration into tumor and host characteristics. One compelling host characteristic is the immune response to ovarian cancer. While several studies have confirmed a prominent role for the immune system in modifying the clinical course of the disease, recent genetic and protein analyses also suggest a role in disease incidence. Recent studies also show that anti-tumor immunity is often negated by immune suppressive cells present in the tumor microenvironment. These suppressive immune cells also directly enhance the pathogenesis through the release of various cytokines and chemokines, which together form an integrated pathologic network. Thus, future research into immunotherapy targeting ovarian cancer will likely become increasingly focused on combination approaches that simultaneously augment immunity while preventing local immune suppression or by disrupting critical cytokine networks. PMID:23582060

  12. Designing Flight Deck Procedures

    NASA Technical Reports Server (NTRS)

    Degani, Asaf; Wiener, Earl

    2005-01-01

    Three reports address the design of flight-deck procedures and various aspects of human interaction with cockpit systems that have direct impact on flight safety. One report, On the Typography of Flight- Deck Documentation, discusses basic research about typography and the kind of information needed by designers of flight deck documentation. Flight crews reading poorly designed documentation may easily overlook a crucial item on the checklist. The report surveys and summarizes the available literature regarding the design and typographical aspects of printed material. It focuses on typographical factors such as proper typefaces, character height, use of lower- and upper-case characters, line length, and spacing. Graphical aspects such as layout, color coding, fonts, and character contrast are discussed; and several cockpit conditions such as lighting levels and glare are addressed, as well as usage factors such as angular alignment, paper quality, and colors. Most of the insights and recommendations discussed in this report are transferable to paperless cockpit systems of the future and computer-based procedure displays (e.g., "electronic flight bag") in aerospace systems and similar systems that are used in other industries such as medical, nuclear systems, maritime operations, and military systems.

  13. Interactions between mesenchymal stem cells and the immune system.

    PubMed

    Li, Na; Hua, Jinlian

    2017-02-18

    In addition to being multi-potent, mesenchymal stem cells (MSCs) possess immunomodulatory functions that have been investigated as potential treatments in various immune disorders. MSCs can robustly interact with cells of the innate and adaptive immune systems, either through direct cell-cell contact or through their secretome. In this review, we discuss current findings regarding the interplay between MSCs and different immune cell subsets. We also draw attention to the mechanisms involved.

  14. Immunizations. Position Statement. Revised

    ERIC Educational Resources Information Center

    Bobo, Nichole; Garrett, Jennifer; Teskey, Carmen; Duncan, Kay; Strasser, Kathy; Burrows-Mezu, Alicia L.

    2015-01-01

    It is the position of the National Association of School Nurses (NASN) that immunizations are essential to primary prevention of disease from infancy through adulthood. Promotion of immunizations by the registered professional school nurse (hereinafter referred to as school nurse) is central to the public health focus of school nursing practice…

  15. Coping and Immune Function

    DTIC Science & Technology

    1988-07-01

    immunization, and a single session of inescapable shock. The results are superimposable on thoce shown in Figure 1. The fact that we can obtain our...effect with a single session of shock following a single immunization with KLH makes exploration of factors such as antigen-stress timing much simpler. We

  16. Immune interventions in stroke

    PubMed Central

    Fu, Ying; Liu, Qiang; Anrather, Josef

    2016-01-01

    Inflammatory and immune responses in the brain can shape the clinical presentation and outcome of stroke. Approaches for effective management of acute stroke are sparse and many measures for brain protection fail, but our ability to modulate the immune system and modify the disease progression of multiple sclerosis is increasing. As a result, immune interventions are currently being explored as therapeutic interventions in acute stroke. In this Review, we compare the immunological features of acute stroke with those of multiple sclerosis, identify unique immunological features of stroke, and consider the evidence for immune interventions. In acute stroke, microglia activation and cell death products trigger an inflammatory cascade that damages vessels and the parenchyma within minutes to hours of the ischaemia or haemorrhage. Immune interventions that restrict brain inflammation, vascular permeability and tissue oedema must be administered rapidly to reduce acute immune-mediated destruction and to avoid subsequent immunosuppression. Preliminary results suggest that the use of drugs that modify disease in multiple sclerosis might accomplish these goals in ischaemic and haemorrhagic stroke. Further elucidation of the immune mechanisms involved in stroke is likely to lead to successful immune interventions. PMID:26303850

  17. Innate immunity and adjuvants

    PubMed Central

    Akira, Shizuo

    2011-01-01

    Innate immunity was for a long time considered to be non-specific because the major function of this system is to digest pathogens and present antigens to the cells involved in acquired immunity. However, recent studies have shown that innate immunity is not non-specific, but is instead sufficiently specific to discriminate self from pathogens through evolutionarily conserved receptors, designated Toll-like receptors (TLRs). Indeed, innate immunity has a crucial role in early host defence against invading pathogens. Furthermore, TLRs were found to act as adjuvant receptors that create a bridge between innate and adaptive immunity, and to have important roles in the induction of adaptive immunity. This paradigm shift is now changing our thinking on the pathogenesis and treatment of infectious, immune and allergic diseases, as well as cancers. Besides TLRs, recent findings have revealed the presence of a cytosolic detector system for invading pathogens. I will review the mechanisms of pathogen recognition by TLRs and cytoplasmic receptors, and then discuss the roles of these receptors in the development of adaptive immunity in response to viral infection. PMID:21893536

  18. HETEROLOGOUS IMMUNITY BETWEEN VIRUSES

    PubMed Central

    Welsh, Raymond M.; Che, Jenny; Brehm, Michael A.; Selin, Liisa K.

    2010-01-01

    Summary Immune memory responses to previously encountered pathogens can sometimes alter the immune response to and the course of infection of an unrelated pathogen by a process known as heterologous immunity. This response can lead to enhanced or diminished protective immunity and altered immunopathology. Here we discuss the nature of T-cell cross-reactivity and describe matrices of epitopes from different viruses eliciting cross-reactive CD8+ T-cell responses. We examine the parameters of heterologous immunity mediated by these cross-reactive T cells during viral infections in mice and humans. We show that heterologous immunity can disrupt T-cell memory pools, alter the complexity of the T-cell repertoire, change patterns of T-cell immunodominance, lead to the selection of viral epitope-escape variants, alter the pathogenesis of viral infections, and, by virtue of the private specificity of T-cell repertoires within individuals, contribute to dramatic variations in viral disease. We propose that heterologous immunity is an important factor in resistance to and variations of human viral infections and that issues of heterologous immunity should be considered in the design of vaccines. PMID:20536568

  19. Immunizations: Active vs. Passive

    MedlinePlus

    ... a certain type of wild animal bites a child. Passive immunizations for hepatitis A (gamma globulin) may be helpful ... A is common. They are typically given before children or adults leave on their ... active vaccination is preferable. Keep in mind that passive immunizations ...

  20. Immunity and Nutrition.

    ERIC Educational Resources Information Center

    Dupin, Henri; Guerin, Nicole

    1990-01-01

    The three articles in this issue of a periodical focussed on various aspects of the life and health of children in the tropics concern: (1) immune defenses; (2) interactions between nutrition disorders and infection; and (3) immunity and vaccination. The science of immunology has progressed rapidly in recent years. A brief review of present…

  1. Swine immune system

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Probably no area of veterinary medicine has seen a greater explosion in knowledge then the immune system and its implications in disease and vaccination. In this chapter on the Swine Immune System for the 10th Edition of Diseases of Swine we expand on the information provided in past editions by in...

  2. The genetics of immunity.

    PubMed

    Lazzaro, Brian P; Schneider, David S

    2014-06-17

    In this commentary, Brian P. Lazzaro and David S. Schneider examine the topic of the Genetics of Immunity as explored in this month's issues of GENETICS and G3: Genes|Genomes|Genetics. These inaugural articles are part of a joint Genetics of Immunity collection (ongoing) in the GSA journals.

  3. Immune System 101

    MedlinePlus

    ... Infectious Diseases - The Immune System Related Topics on AIDS.gov CD4 Count Viral Load Cancer Opportunistic Infections ... Immune Response (video) Last revised: 08/22/2011 AIDS.gov HIV/AIDS Basics • Federal Resources • Using New ...

  4. Neural circuitry and immunity

    PubMed Central

    Pavlov, Valentin A.; Tracey, Kevin J.

    2015-01-01

    Research during the last decade has significantly advanced our understanding of the molecular mechanisms at the interface between the nervous system and the immune system. Insight into bidirectional neuroimmune communication has characterized the nervous system as an important partner of the immune system in the regulation of inflammation. Neuronal pathways, including the vagus nerve-based inflammatory reflex are physiological regulators of immune function and inflammation. In parallel, neuronal function is altered in conditions characterized by immune dysregulation and inflammation. Here, we review these regulatory mechanisms and describe the neural circuitry modulating immunity. Understanding these mechanisms reveals possibilities to use targeted neuromodulation as a therapeutic approach for inflammatory and autoimmune disorders. These findings and current clinical exploration of neuromodulation in the treatment of inflammatory diseases defines the emerging field of Bioelectronic Medicine. PMID:26512000

  5. Pertussis immunization: an update

    PubMed Central

    Morgan, Lon G

    1997-01-01

    A segment of chiropractic has historically opposed the practice of immunization. This opposition has been based on historical and philosophical precedent, but with little support from the scientific literature. Pertussis immunization has successfully controlled a disease with a prior history of high childhood morbidity. An evaluation of the literature fails to find supporting evidence that whole-cell pertussis vaccine causes SIDS, asthma, or encephalopathy. Countries who discontinued pertussis immunization experienced a return of the disease, and in every case pertussis immunization has been reinstated. The recent successful clinical trials and subsequent approval of an acellular pertussis vaccine should reduce the local reactions and discomfort sometimes experienced with the whole-cell product. In view of the considerable scientific evidence for the desirability and efficacy of pertussis immunization, chiropractic should encourage patient participation in this worthwhile public health service.

  6. Cytokines in Drosophila immunity.

    PubMed

    Vanha-Aho, Leena-Maija; Valanne, Susanna; Rämet, Mika

    2016-02-01

    Cytokines are a large and diverse group of small proteins that can affect many biological processes, but most commonly cytokines are known as mediators of the immune response. In the event of an infection, cytokines are produced in response to an immune stimulus, and they function as key regulators of the immune response. Cytokines come in many shapes and sizes, and although they vary greatly in structure, their functions have been well conserved in evolution. The immune signaling pathways that respond to cytokines are remarkably conserved from fly to man. Therefore, Drosophila melanogaster, provides an excellent platform for studying the biology and function of cytokines. In this review, we will describe the cytokines and cytokine-like molecules found in the fly and discuss their roles in host immunity.

  7. Exosomes and their roles in immune regulation and cancer.

    PubMed

    Greening, David W; Gopal, Shashi K; Xu, Rong; Simpson, Richard J; Chen, Weisan

    2015-04-01

    Exosomes, a subset of extracellular vesicles (EVs), function as a mode of intercellular communication and molecular transfer. Exosomes facilitate the direct extracellular transfer of proteins, lipids, and miRNA/mRNA/DNAs between cells in vitro and in vivo. The immunological activities of exosomes affect immunoregulation mechanisms including modulating antigen presentation, immune activation, immune suppression, immune surveillance, and intercellular communication. Besides immune cells, cancer cells secrete immunologically active exosomes that influence both physiological and pathological processes. The observation that exosomes isolated from immune cells such as dendritic cells (DCs) modulate the immune response has enforced the way these membranous vesicles are being considered as potential immunotherapeutic reagents. Indeed, tumour- and immune cell-derived exosomes have been shown to carry tumour antigens and promote immunity, leading to eradication of established tumours by CD8(+) T cells and CD4(+) T cells, as well as directly suppressing tumour growth and resistance to malignant tumour development. Further understanding of these areas of exosome biology, and especially of molecular mechanisms involved in immune cell targeting, interaction and manipulation, is likely to provide significant insights into immunorecognition and therapeutic intervention. Here, we review the emerging roles of exosomes in immune regulation and the therapeutic potential in cancer.

  8. 18 CFR 385.1509 - District court procedures (Rule 1509).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... procedures (Rule 1509). 385.1509 Section 385.1509 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY PROCEDURAL RULES RULES OF PRACTICE AND PROCEDURE Procedures for... order is issued under paragraph (a) of this section, the General Counsel, unless otherwise directed...

  9. 18 CFR 385.1509 - District court procedures (Rule 1509).

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... procedures (Rule 1509). 385.1509 Section 385.1509 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY PROCEDURAL RULES RULES OF PRACTICE AND PROCEDURE Procedures for... order is issued under paragraph (a) of this section, the General Counsel, unless otherwise directed...

  10. Royal Decree: Gene Expression in Trans-Generationally Immune Primed Bumblebee Workers Mimics a Primary Immune Response.

    PubMed

    Barribeau, Seth M; Schmid-Hempel, Paul; Sadd, Ben M

    2016-01-01

    Invertebrates lack the cellular and physiological machinery of the adaptive immune system, but show specificity in their immune response and immune priming. Functionally, immune priming is comparable to immune memory in vertebrates. Individuals that have survived exposure to a given parasite are better protected against subsequent exposures. Protection may be cross-reactive, but demonstrations of persistent and specific protection in invertebrates are increasing. This immune priming can cross generations ("trans-generational" immune priming), preparing offspring for the prevailing parasite environment. While these phenomena gain increasing support, the mechanistic foundations underlying such immune priming, both within and across generations, remain largely unknown. Using a transcriptomic approach, we show that exposing bumblebee queens with an injection of heat-killed bacteria, known to induce trans-generational immune priming, alters daughter (worker) gene expression. Daughters, even when unexposed themselves, constitutively express a core set of the genes induced upon direct bacterial exposure, including high expression of antimicrobial peptides, a beta-glucan receptor protein implicated in bacterial recognition and the induction of the toll signaling pathway, and slit-3 which is important in honeybee immunity. Maternal exposure results in a distinct upregulation of their daughters' immune system, with a signature overlapping with the induced individual response to a direct exposure. This will mediate mother-offspring protection, but also associated costs related to reconfiguration of constitutive immune expression. Moreover, identification of conserved immune pathways in memory-like responses has important implications for our understanding of the innate immune system, including the innate components in vertebrates, which share many of these pathways.

  11. Diagnostic procedures in immunodermatology.

    PubMed

    Cormane, R H; Asghar, S S

    1976-07-01

    Most immunologic diseases are caused by the derailment of the humoral or cellular pathways of the immunologic defense system. This derailment results from numerous factors such as the inability of the patient to remove the pathogen; the consumption, defect, or deficiency in any component of these pathways, and the overproduction of any of the components. To diagnose these immunologic disorders one has to detect the pathogen and the reactions caused by it and to determine the cause of its nonclearance. The immunofluorescence techniques has been invaluable in detecting both the antigen that causes the disease and the reactions initiated by the antigen, such as the production of antibodies and the activation of the complement system. The immunoperoxidase technique has also been used for these purposes in certain instances. For detecting the circulating immune complexes which occur as intermediates in the chain of reactions initiated by the antigen, various physiochemical and biologic techniques have been used. However, none of these tests seems to be totally reliable for determining whether circulating immune complexes are present. The consumption of complement was detected by hemolytic estimations and radial immunodiffusion or rocket electrphoresis. These techniques were also useful in detecting the hereditary deficiencies in immunoglobulins and components of classical and alternative pathways of complement activation. Since these techniques cannot be used to estimate IgE, the radioallergosorbent test was used to measure such levels in the atopic patients. Cellular hypersensitivity was detected with skin tests together with methods which assess the ability of lymphocytes to produce mediators in response to antigen. Many of these mediator assays, however, are not suitable for this purpose. A satisfactory substitute appears to be to determine the factor in antigen-stimulated, lymphocyte culture supernatants which activates macrophages to take up radiolabeled colloidal

  12. Approaches Mediating Oxytocin Regulation of the Immune System

    PubMed Central

    Li, Tong; Wang, Ping; Wang, Stephani C.; Wang, Yu-Feng

    2017-01-01

    The hypothalamic neuroendocrine system is mainly composed of the neural structures regulating hormone secretion from the pituitary gland and has been considered as the higher regulatory center of the immune system. Recently, the hypothalamo-neurohypophysial system (HNS) emerged as an important component of neuroendocrine–immune network, wherein the oxytocin (OT)-secreting system (OSS) plays an essential role. The OSS, consisting of OT neurons in the supraoptic nucleus, paraventricular nucleus, their several accessory nuclei and associated structures, can integrate neural, endocrine, metabolic, and immune information and plays a pivotal role in the development and functions of the immune system. The OSS can promote the development of thymus and bone marrow, perform immune surveillance, strengthen immune defense, and maintain immune homeostasis. Correspondingly, OT can inhibit inflammation, exert antibiotic-like effect, promote wound healing and regeneration, and suppress stress-associated immune disorders. In this process, the OSS can release OT to act on immune system directly by activating OT receptors or through modulating activities of other hypothalamic–pituitary–immune axes and autonomic nervous system indirectly. However, our understandings of the role of the OSS in neuroendocrine regulation of immune system are largely incomplete, particularly its relationship with other hypothalamic–pituitary–immune axes and the vasopressin-secreting system that coexists with the OSS in the HNS. In addition, it remains unclear about the relationship between the OSS and peripherally produced OT in immune regulation, particularly intrathymic OT that is known to elicit central immunological self-tolerance of T-cells to hypophysial hormones. In this work, we provide a brief review of current knowledge of the features of OSS regulation of the immune system and of potential approaches that mediate OSS coordination of the activities of entire neuroendocrine–immune

  13. Approaches Mediating Oxytocin Regulation of the Immune System.

    PubMed

    Li, Tong; Wang, Ping; Wang, Stephani C; Wang, Yu-Feng

    2016-01-01

    The hypothalamic neuroendocrine system is mainly composed of the neural structures regulating hormone secretion from the pituitary gland and has been considered as the higher regulatory center of the immune system. Recently, the hypothalamo-neurohypophysial system (HNS) emerged as an important component of neuroendocrine-immune network, wherein the oxytocin (OT)-secreting system (OSS) plays an essential role. The OSS, consisting of OT neurons in the supraoptic nucleus, paraventricular nucleus, their several accessory nuclei and associated structures, can integrate neural, endocrine, metabolic, and immune information and plays a pivotal role in the development and functions of the immune system. The OSS can promote the development of thymus and bone marrow, perform immune surveillance, strengthen immune defense, and maintain immune homeostasis. Correspondingly, OT can inhibit inflammation, exert antibiotic-like effect, promote wound healing and regeneration, and suppress stress-associated immune disorders. In this process, the OSS can release OT to act on immune system directly by activating OT receptors or through modulating activities of other hypothalamic-pituitary-immune axes and autonomic nervous system indirectly. However, our understandings of the role of the OSS in neuroendocrine regulation of immune system are largely incomplete, particularly its relationship with other hypothalamic-pituitary-immune axes and the vasopressin-secreting system that coexists with the OSS in the HNS. In addition, it remains unclear about the relationship between the OSS and peripherally produced OT in immune regulation, particularly intrathymic OT that is known to elicit central immunological self-tolerance of T-cells to hypophysial hormones. In this work, we provide a brief review of current knowledge of the features of OSS regulation of the immune system and of potential approaches that mediate OSS coordination of the activities of entire neuroendocrine-immune network.

  14. Recommended Immunizations for Adults 50+

    MedlinePlus

    ... page please turn Javascript on. Health Screenings and Immunizations Recommended Immunizations For Adults 50+ The content in this section ... out more, visit How Vaccines Prevent Disease . Vaccines, Vaccinations, and Immunizations Understanding the difference between vaccines, vaccinations, ...

  15. Preexisting antitumor immunity augments the antitumor effects of chemotherapy.

    PubMed

    Zhang, Lingbing; Feng, Dongdong; Yu, Lynda X; Tsung, Kangla; Norton, Jeffrey A

    2013-06-01

    Efficacy of cancer chemotherapy is generally believed to be the result of direct drug killing of tumor cells. However, increased tumor cell killing does not always lead to improved efficacy. Herein, we demonstrate that the status of antitumor immunity at the time of chemotherapy treatment is a critical factor affecting the therapeutic outcome in that tumor-bearing mice that possess preexisting antitumor immunity respond to chemotherapy much better than those that do not. Enhancing antitumor immunity before or at the time of chemotherapy-induced antigen release increases subsequent response to chemotherapy significantly. By in vitro and in vivo measurements of antitumor immunity, we found a close correlation between the intensity of antitumor immunity activated by chemotherapy and the efficacy of treatment. Immune intervention with interleukin-12 during the early phase of chemotherapy-induced immune activation greatly amplifies the antitumor response, often resulting in complete tumor eradication not only at the chemo-treated local site, but also systemically. These findings provide additional evidence for an immune-mediated antitumor response to chemotherapy. Further, our results show that timely immune modification of chemotherapy-activated antitumor immunity can result in enhanced antitumor-immune response and complete tumor eradication.

  16. Arabinoxylans, gut microbiota and immunity.

    PubMed

    Mendis, Mihiri; Leclerc, Estelle; Simsek, Senay

    2016-03-30

    Arabinoxylan (AX) is a non-starch polysaccharide found in many cereal grains and is considered as a dietary fiber. Despite their general structure, there is structural heterogeneity among AX originating from different botanical sources. Furthermore, the extraction procedure and hydrolysis by xylolytic enzymes can further render differences to theses AX. The aim of this review was to address the effects of AX on the gut bacteria and their immunomodulatory properties. Given the complex structure of AX, we also aimed to discuss how the structural heterogeneity of AX affects its role in bacterial growth and immunomodulation. The existing literature indicates the role of fine structural details of AX on its potential as polysaccharides that can impact the gut associated microbial growth and immune system.

  17. 45 CFR 1225.8 - Precomplaint procedure.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... SERVICE VOLUNTEER DISCRIMINATION COMPLAINT PROCEDURE Processing Individual Complaints of Discrimination... days of the alleged discrimination to attempt to resolve them. The process for notifying the... direct their allegations to the EO Director for assignment to an appropriate Counselor. (2)...

  18. 32 CFR 716.11 - Procedures.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Applicable to the Marine Corps § 716.11 Procedures. (a) Action. Commanding officers will direct immediate... case will be referred to the Commandant of the Marine Corps (Code MSPA-1) for determination. (2)...

  19. 12 CFR 211.9 - Investment procedures.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Investment procedures. 211.9 Section 211.9... Investment procedures. (a) General provisions. 5 Direct and indirect investments shall be made in accordance... investments in excess of the limitations therein based on capital and surplus. (1) Minimum capital...

  20. Student Loan Collection Procedures. Revised Edition.

    ERIC Educational Resources Information Center

    McAlvey, Warren C.; Price, Anne J.

    Guidelines for loan collection staff who award/service college student loans are presented. Attention is directed to sound collection procedures, three specific loan programs, suing a defaulted borrower, the Family Educational Rights and Privacy Act and the use of credit bureaus, and student loan borrower bankruptcy. Loan collection procedures for…

  1. Pattern Recognition Receptors in Innate Immunity, Host Defense, and Immunopathology

    ERIC Educational Resources Information Center

    Suresh, Rahul; Mosser, David M.

    2013-01-01

    Infection by pathogenic microbes initiates a set of complex interactions between the pathogen and the host mediated by pattern recognition receptors. Innate immune responses play direct roles in host defense during the early stages of infection, and they also exert a profound influence on the generation of the adaptive immune responses that ensue.…

  2. 31 CFR 357.23 - Judicial proceedings-sovereign immunity.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Judicial proceedings-sovereign immunity. 357.23 Section 357.23 Money and Finance: Treasury Regulations Relating to Money and Finance... Securities System (Legacy Treasury Direct) § 357.23 Judicial proceedings—sovereign immunity. (a)...

  3. Immunity to Francisella

    PubMed Central

    Cowley, Siobhán C.; Elkins, Karen L.

    2011-01-01

    In recent years, studies on the intracellular pathogen Francisella tularensis have greatly intensified, generating a wealth of new information on the interaction of this organism with the immune system. Here we review the basic elements of the innate and adaptive immune responses that contribute to protective immunity against Francisella species, with special emphasis on new data that has emerged in the last 5 years. Most studies have utilized the mouse model of infection, although there has been an expansion of work on human cells and other new animal models. In mice, basic immune parameters that operate in defense against other intracellular pathogen infections, such as interferon gamma, TNF-α, and reactive nitrogen intermediates, are central for control of Francisella infection. However, new important immune mediators have been revealed, including IL-17A, Toll-like receptor 2, and the inflammasome. Further, a variety of cell types in addition to macrophages are now recognized to support Francisella growth, including epithelial cells and dendritic cells. CD4+ and CD8+ T cells are clearly important for control of primary infection and vaccine-induced protection, but new T cell subpopulations and the mechanisms employed by T cells are only beginning to be defined. A significant role for B cells and specific antibodies has been established, although their contribution varies greatly between bacterial strains of lower and higher virulence. Overall, recent data profile a pathogen that is adept at subverting host immune responses, but susceptible to many elements of the immune system's antimicrobial arsenal. PMID:21687418

  4. Immunity in urogenital protozoa.

    PubMed

    Malla, N; Goyal, K; Dhanda, R S; Yadav, M

    2014-09-01

    Innate and adaptive immunity play a significant role in urogenital infections. Innate immunity is provided by the epithelial cells and mucus lining along with acidic pH, which forms a strong physical barrier against the pathogens in female reproductive tract. Cells of innate immune system, antimicrobial peptides, cytokines, chemokines and adaptive immunity in the reproductive tract are evolved during infection, and a pro-inflammatory response is generated to fight against the invading pathogen Trichomonas vaginalis, a primary urogenital protozoa, the etiological agent of human trichomoniasis, a curable sexually transmitted infection. The involvement of the urogenital tract by other protozoal infections such as P. falciparum, Trypanosoma, Leishmania, Toxoplasma, Entamoeba histolytica and Acanthamoeba infection is rarely reported. Trichomonas induce pro-inflammatory and immunosuppressive responses in infected subjects. Multifactorial pathogenic mechanisms including parasite adherence, cysteine proteases, lipophosphoglycan, free radical, cytokine generation and Toll-like receptors appear to interplay with the induction of local and systemic immune responses that ultimately determine the outcome of the infection. However, the involvement of urogenital pathogen-specific immune mechanisms and effect of normal local resident flora on the outcome (symptomatic vs. asymptomatic) of infection are poorly understood. Moreover, immune interactions in trichomoniasis subjects co-infected with bacterial and viral pathogens need to be elucidated.

  5. Immunizations for foreign travel.

    PubMed Central

    Hill, D. R.

    1992-01-01

    One of the most important aspects of preparing travelers for destinations throughout the world is providing them with immunizations. Before administering any vaccines, however, a careful health and immunization history and travel itinerary should be obtained in order to determine vaccine indications and contraindications. There are three categories of immunizations for foreign travel. The first category includes immunizations which are routinely recommended whether or not the individual is traveling. Many travelers are due for primary vaccination or boosting against tetanus-diphtheria, measles-mumps-rubella, pneumococcal pneumonia, and influenza, for example, and the pre-travel visit is an ideal time to administer these. The second category are immunizations which might be required by a country as a condition for entry; these are yellow fever and cholera. The final category contains immunizations which are recommended because there is a risk of acquiring a particular disease during travel. Typhoid fever, meningococcal disease, rabies, and hepatitis are some examples. Travelers who are pregnant or who are infected with the human immunodeficiency virus require special consideration. Provision of appropriate immunizations for foreign travel is an important aspect of preventing illness in travelers. PMID:1337807

  6. Analysing immune cell migration.

    PubMed

    Beltman, Joost B; Marée, Athanasius F M; de Boer, Rob J

    2009-11-01

    The visualization of the dynamic behaviour of and interactions between immune cells using time-lapse video microscopy has an important role in modern immunology. To draw robust conclusions, quantification of such cell migration is required. However, imaging experiments are associated with various artefacts that can affect the estimated positions of the immune cells under analysis, which form the basis of any subsequent analysis. Here, we describe potential artefacts that could affect the interpretation of data sets on immune cell migration. We propose how these errors can be recognized and corrected, and suggest ways to prevent the data analysis itself leading to biased results.

  7. Innate Immunity to Adenovirus

    PubMed Central

    Hendrickx, Rodinde; Stichling, Nicole; Koelen, Jorien; Kuryk, Lukasz; Lipiec, Agnieszka

    2014-01-01

    Abstract Human adenoviruses are the most widely used vectors in gene medicine, with applications ranging from oncolytic therapies to vaccinations, but adenovirus vectors are not without side effects. In addition, natural adenoviruses pose severe risks for immunocompromised people, yet infections are usually mild and self-limiting in immunocompetent individuals. Here we describe how adenoviruses are recognized by the host innate defense system during entry and replication in immune and nonimmune cells. Innate defense protects the host and represents a major barrier to using adenoviruses as therapeutic interventions in humans. Innate response against adenoviruses involves intrinsic factors present at constant levels, and innate factors mounted by the host cell upon viral challenge. These factors exert antiviral effects by directly binding to viruses or viral components, or shield the virus, for example, soluble factors, such as blood clotting components, the complement system, preexisting immunoglobulins, or defensins. In addition, Toll-like receptors and lectins in the plasma membrane and endosomes are intrinsic factors against adenoviruses. Important innate factors restricting adenovirus in the cytosol are tripartite motif-containing proteins, nucleotide-binding oligomerization domain-like inflammatory receptors, and DNA sensors triggering interferon, such as DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 and cyclic guanosine monophosphate–adenosine monophosphate synthase. Adenovirus tunes the function of antiviral autophagy, and counters innate defense by virtue of its early proteins E1A, E1B, E3, and E4 and two virus-associated noncoding RNAs VA-I and VA-II. We conclude by discussing strategies to engineer adenovirus vectors with attenuated innate responses and enhanced delivery features. PMID:24512150

  8. Immune dysfunction in uremia—an update.

    PubMed

    Cohen, Gerald; Hörl, Walter H

    2012-10-24

    Kidney dysfunction leads to disturbed renal metabolic activities and to impaired glomerular filtration, resulting in the retention of toxic solutes affecting all organs of the body. Cardiovascular disease (CVD) and infections are the main causes for the increased occurrence of morbidity and mortality among patients with chronic kidney disease (CKD). Both complications are directly or indirectly linked to a compromised immune defense. The specific coordinated roles of polymorphonuclear leukocytes (PMNLs), monocytes/macrophages, lymphocytes and antigen-presenting cells (APCs) in maintaining an efficient immune response are affected. Their normal response can be impaired, giving rise to infectious diseases or pre-activated/primed, leading to inflammation and consequently to CVD. Whereas the coordinated removal via apoptosis of activated immune cells is crucial for the resolution of inflammation, inappropriately high apoptotic rates lead to a diminished immune response. In uremia, the balance between pro- and anti-inflammatory and between pro- and anti-apoptotic factors is disturbed. This review summarizes the interrelated parameters interfering with the immune response in uremia, with a special focus on the non-specific immune response and the role of uremic toxins.

  9. Programmed death 1 immune checkpoint inhibitors.

    PubMed

    Trivedi, Meghna S; Hoffner, Brianna; Winkelmann, Jennifer L; Abbott, Maura E; Hamid, Omid; Carvajal, Richard D

    2015-12-01

    Programmed death 1 (PD-1) is an immune checkpoint that provides inhibitory signals to the immune system in order to modulate the activity of T cells in peripheral tissues and maintain self-tolerance in the setting of infection and inflammation. In cancer, the immune checkpoints are exploited so that the tumor cells are able to evade the immune system. Immune checkpoint inhibitors are a type of cancer immunotherapy that targets pathways such as PD-1 in order to reinvigorate and enhance the immune response against tumor cells. The US Food and Drug Administration (FDA) has approved 2 PD-1 inhibitors, nivolumab and pembrolizumab, and several others are under investigation. Although PD-1 inhibitors have demonstrated activity in many different types of malignancies, FDA approval has been granted only in melanoma and in non-small cell lung cancer (NSCLC). Identifying biomarkers that can predict response to PD-1 inhibitors is critical to maximizing the benefit of these agents. Future directions for PD-1 inhibitors include investigation of combination therapies, use in malignancies other than melanoma and NSCLC, and refinement of biomarkers.

  10. 14 CFR 171.103 - Requests for IFR procedure.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...) NAVIGATIONAL FACILITIES NON-FEDERAL NAVIGATION FACILITIES Simplified Directional Facility (SDF) § 171.103 Requests for IFR procedure. (a) Each person who requests an IFR procedure based on an SDF that he owns...

  11. Computerized procedures system

    DOEpatents

    Lipner, Melvin H.; Mundy, Roger A.; Franusich, Michael D.

    2010-10-12

    An online data driven computerized procedures system that guides an operator through a complex process facility's operating procedures. The system monitors plant data, processes the data and then, based upon this processing, presents the status of the current procedure step and/or substep to the operator. The system supports multiple users and a single procedure definition supports several interface formats that can be tailored to the individual user. Layered security controls access privileges and revisions are version controlled. The procedures run on a server that is platform independent of the user workstations that the server interfaces with and the user interface supports diverse procedural views.

  12. Designing Flightdeck Procedures

    NASA Technical Reports Server (NTRS)

    Barshi, Immanuel; Mauro, Robert; Degani, Asaf; Loukopoulou, Loukia

    2016-01-01

    The primary goal of this document is to provide guidance on how to design, implement, and evaluate flight deck procedures. It provides a process for developing procedures that meet clear and specific requirements. This document provides a brief overview of: 1) the requirements for procedures, 2) a process for the design of procedures, and 3) a process for the design of checklists. The brief overview is followed by amplified procedures that follow the above steps and provide details for the proper design, implementation and evaluation of good flight deck procedures and checklists.

  13. Barriers to adult immunization and solutions: Personalized approaches

    PubMed Central

    Alici, Devrim Emel; Sayiner, Abdullah; Unal, Serhat

    2017-01-01

    ABSTRACT Immunization is an important component of preventive healthcare services aiming to prevent and eventually eradicate infectious diseases by immunizing people before they become infected. Although immunization is an integral part of children's healthcare, this fact is underrated, even ignored in adults. In Turkey, adult immunization is available only for certain high risk groups such as health care professionals and populations aged > 65 y and under certain conditions including pregnancy, military service, travel-pilgrimage, and employment procedures. The fact that diseases such as pneumococcal pneumonia, influenza, rubeola, varicella, hepatitis A, and tetanus, which could be associated with severe complications in adults, are vaccine-preventable indicates the importance of adult immunization. In addition to the healthcare providers' knowledge about immunization, effective policies of related professional associations and the management of this issue by regulatory authorities, people's awareness in protecting their own health is of utmost importance in achieving the targeted level of adult immunization. This article focuses on the characteristics of the individuals as one of the 3 main cornerstones (individual, healthcare providers, regulatory authorities and supporting organizations) of immunization practices and discusses barriers to adult immunization and recommends solutions. PMID:27669411

  14. Mucosal immunity and probiotics in fish.

    PubMed

    Lazado, Carlo C; Caipang, Christopher Marlowe A

    2014-07-01

    Teleost mucosal immunity has become the subject of unprecedented research studies in recent years because of its diversity and defining characteristics. Its immune repertoire is governed by the mucosa-associated lymphoid tissues (MALT) which are divided into gut-associated lymphoid tissues (GALT), skin-associated lymphoid tissues (SALT), and gill-associated lymphoid tissues (GIALT). The direct contact with its immediate environment makes the mucosal surfaces of fish susceptible to a wide variety of pathogens. The inherent immunocompetent cells and factors in the mucosal surfaces together with the commensal microbiota have pivotal role against pathogens. Immunomodulation is a popular prophylactic strategy in teleost and probiotics possess this beneficial feature. Most of the studies on the immunomodulatory properties of probiotics in fish mainly discussed their impacts on systemic immunity. In contrast, few of these studies discussed the immunomodulatory features of probiotics in mucosal surfaces and are concentrated on the influences in the gut. Significant attention should be devoted in understanding the relationship of mucosal immunity and probiotics as the present knowledge is limited and are mostly based on extrapolations of studies in humans and terrestrial vertebrates. In the course of the advancement of mucosal immunity and probiotics, new perspectives in probiotics research, e.g., probiogenomics have emerged. This review affirms the relevance of probiotics in the mucosal immunity of fish by revisiting and bridging the current knowledge on teleost mucosal immunity, mucosal microbiota and immunomodulation of mucosal surfaces by probiotics. Expanding the knowledge of immunomodulatory properties of probiotics especially on mucosal immunity is essential in advancing the use of probiotics as a sustainable and viable strategy for successful fish husbandry.

  15. Human neutrophils in auto-immunity.

    PubMed

    Thieblemont, Nathalie; Wright, Helen L; Edwards, Steven W; Witko-Sarsat, Véronique

    2016-04-01

    Human neutrophils have great capacity to cause tissue damage in inflammatory diseases via their inappropriate activation to release reactive oxygen species (ROS), proteases and other tissue-damaging molecules. Furthermore, activated neutrophils can release a wide variety of cytokines and chemokines that can regulate almost every element of the immune system. In addition to these important immuno-regulatory processes, activated neutrophils can also release, expose or generate neoepitopes that have the potential to break immune tolerance and result in the generation of autoantibodies, that characterise a number of human auto-immune diseases. For example, in vasculitis, anti-neutrophil cytoplasmic antibodies (ANCA) that are directed against proteinase 3 or myeloperoxidase are neutrophil-derived autoantigens and activated neutrophils are the main effector cells of vascular damage. In other auto-immune diseases, these neutrophil-derived neoepitopes may arise from a number of processes that include release of granule enzymes and ROS, changes in the properties of components of their plasma membrane as a result of activation or apoptosis, and via the release of Neutrophil Extracellular Traps (NETs). NETs are extracellular structures that contain chromatin that is decorated with granule enzymes (including citrullinated proteins) that can act as neo-epitopes to generate auto-immunity. This review therefore describes the processes that can result in neutrophil-mediated auto-immunity, and the role of neutrophils in the molecular pathologies of auto-immune diseases such as vasculitis, rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE). We discuss the potential role of NETs in these processes and some of the debate in the literature regarding the role of this phenomenon in microbial killing, cell death and auto-immunity.

  16. Immune System (For Parents)

    MedlinePlus

    ... teens. Environmental allergies (to dust mites, for example), seasonal allergies (such as hay fever), drug allergies (reactions to ... For Parents MORE ON THIS TOPIC Definition: ... Allergies Activity: Immune System Word! Autoimmunity HIV and AIDS ...

  17. Antiviral immunity in crustaceans.

    PubMed

    Liu, Haipeng; Söderhäll, Kenneth; Jiravanichpaisal, Pikul

    2009-08-01

    Viral diseases of shrimp have caused negative effects on the economy in several countries in Asia, South America and America, where they have numerous shrimp culture industries. The studies on the immunity of shrimp and other crustaceans have mainly focused on general aspects of immunity and as a consequence little is known about the antiviral responses in crustaceans. The aim of this review is to update recent knowledge of innate immunity against viral infections in crustaceans. Several antiviral molecules have been isolated and characterized recently from decapods. Characterization and identification of these molecules might provide a promising strategy for protection and treatment of these viral diseases. In addition dsRNA-induced antiviral immunity is also included.

  18. Immunization Against Infectious Disease

    ERIC Educational Resources Information Center

    Mortimer, Edward A., Jr.

    1978-01-01

    The success of present and future immunization programs is endangered by public and physician complacency and by complex legal and ethical problems related to informed consent and responsibility for rare, vaccine-related injury. (BB)

  19. Immunization Against Rabies

    PubMed Central

    McWilliam, R. S.; Penistan, J. L.

    1967-01-01

    The methods used for both pre-exposure and post-exposure immunization against rabies were studied. In pre-exposure immunization duck embryo vaccine should be used. In post-exposure immunization either duck embryo or Semple-type vaccine appears to be effective in stimulating antibody production. Both vaccines may cause neurological sequelae. A dose of vaccine should be given 20-50 days after completion of the primary course of vaccination. Immune serum should be used in all severe exposures especially of the head and neck, and in individuals in whom the commencement of vaccination has been unduly delayed. In individuals who have been previously vaccinated reinforcing doses have been found to be effective even as long as 20 years after the primary vaccination. A tissue culture vaccine has been developed and is about to undergo field trials. PMID:6066820

  20. Antiviral immunity in amphibians.

    PubMed

    Chen, Guangchun; Robert, Jacques

    2011-11-01

    Although a variety of virus species can infect amphibians, diseases caused by ranaviruses ([RVs]; Iridoviridae) have become prominent, and are a major concern for biodiversity, agriculture and international trade. The relatively recent and rapid increase in prevalence of RV infections, the wide range of host species infected by RVs, the variability in host resistance among population of the same species and among different developmental stages, all suggest an important involvement of the amphibian immune system. Nevertheless, the roles of the immune system in the etiology of viral diseases in amphibians are still poorly investigated. We review here the current knowledge of antiviral immunity in amphibians, focusing on model species such as the frog Xenopus and the salamander (Ambystoma tigrinum), and on recent progress in generating tools to better understand how host immune defenses control RV infections, pathogenicity, and transmission.

  1. Exercise and immunity

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/007165.htm Exercise and immunity To use the sharing features on ... take a daily walk or follow a simple exercise routine a few times a week. Exercise helps ...

  2. FastStats: Immunization

    MedlinePlus

    ... this? Submit What's this? Submit Button NCHS Home Immunization Recommend on Facebook Tweet Share Compartir Data are ... Percent of children 19-35 months old receiving vaccinations for: Diphtheria, Tetanus, Pertussis (4+ doses DTP, DT, ...

  3. Your Child's Immunizations

    MedlinePlus

    ... Hepatitis B vaccine (HepB) Hib vaccine Human papillomavirus (HPV) vaccine Influenza vaccine Measles, mumps, and rubella vaccine (MMR) ... to Shots Who Needs a Flu Shot? Immunizations HPV Vaccine 5 Tips for Surviving Shots The Flu Vaccine ...

  4. Immune responses to metastases

    SciTech Connect

    Herberman, R.B.; Wiltrout, R.H.; Gorelik, E.

    1987-01-01

    The authors present the changes in the immune system in tumor-bearing hosts that may influence the development of progression of metastases. Included are mononuclear cell infiltration of metastases; alterations in natural resistance mediated by natural killer cells and macrophages; development of specific immunity mediated by T-lymphocytes or antibodies; modulation of tumor-associated antigen expression; and the down-regulation of the immune response to the tumor by several suppressor mechanisms; the augmentation of the immune response and its potential for therapeutic application; includes the prophylaxis of metastases formation by NK cells; the therapy of metastases by augmentation NK-, macrophage-, or T-lymphocyte-mediated responses by biological response modifiers; and the transfer of anticancer activity by cytoxic T-lymphocytes or immunoconjugates of monoclonal antibodies with specificity for tumors.

  5. Immune Gamma Globulin Therapeutic Indications in Immune Deficiency and Autoimmunity.

    PubMed

    Yang, Luanna; Wu, Eveline Y; Tarrant, Teresa K

    2016-07-01

    Immune gamma globulin (IgG) has a long history in the treatment of both primary immune deficiency and autoimmune disorders. Disease indications continue to expand and new-generation products increase the versatility of delivery. This review encompasses a historical perspective as well as current and future implications of human immune globulin for the treatment of immune-mediated illness.

  6. The immune system

    PubMed Central

    2016-01-01

    All organisms are connected in a complex web of relationships. Although many of these are benign, not all are, and everything alive devotes significant resources to identifying and neutralizing threats from other species. From bacteria through to primates, the presence of some kind of effective immune system has gone hand in hand with evolutionary success. This article focuses on mammalian immunity, the challenges that it faces, the mechanisms by which these are addressed, and the consequences that arise when it malfunctions. PMID:27784777

  7. Immune Therapy for Sarcomas.

    PubMed

    Anderson, Peter M

    2017-01-01

    Absolute lymphocyte count (ALC) recovery rapidly occurring at 14 days after start of chemotherapy for osteosarcoma and Ewing sarcoma is a good prognostic factor. Conversely, lymphopenia is associated with significantly decreased sarcoma survival. Clearly, the immune system can contribute towards better survival from sarcoma. This chapter will describe treatment and host factors that influence immune function and how effective local control and systemic interventions of sarcoma therapy can cause inflammation and/or immune suppression but are currently the standard of care. Preclinical and clinical efforts to enhance immune function against sarcoma will be reviewed. Interventions to enhance immune function against sarcoma have included regional therapy (surgery, cryoablation, radiofrequency ablation, electroporation, and radiotherapy), cytokines, macrophage activators (mifamurtide), vaccines, natural killer (NK) cells, T cell receptor (TCR) and chimeric antigen receptor (CAR) T cells, and efforts to decrease inflammation. The latter is particularly important because of new knowledge about factors influencing expression of checkpoint inhibitory molecules, PD1 and CTLA-4, in the tumor microenvironment. Since these molecules can now be blocked using anti-PD1 and anti-CTLA-4 antibodies, how to translate this knowledge into more effective immune therapies in the future as well as how to augment effectiveness of current interventions (e.g., radiotherapy) is a challenge. Barriers to implementing this knowledge include cost of agents that release immune checkpoint blockade and coordination of cost-effective outpatient sarcoma treatment. Information on how to research clinical trial eligibility criteria and how to access current immune therapy trials against sarcoma are shared, too.

  8. Auto-immune disease.

    PubMed

    Panayi, G S

    1976-02-01

    Auto-immune disease may result from the interaction of the genetic load of the individual, modification of self-tissue antigens by environmental agents such as virus or drugs and abnormalities of the immunological system itself such as the loss of controlling or suppressor T cells with age. In the majority of people the outcome is tolerance, maintenance of normal tissue architecture and function. In the unfortunate few the outcome is auto-immune disease, that is, failure to recognize "self".

  9. Alternative Refractive Surgery Procedures

    MedlinePlus

    ... LASIK Alternative Refractive Surgery Procedures Laser Surgery Recovery Alternative Refractive Surgery Procedures Dec. 12, 2015 Today's refractive ... that releases controlled amounts of radio frequency (RF) energy, instead of a laser, to apply heat to ...

  10. Cosmetic Procedure Questions

    MedlinePlus

    ... Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose Veins Vitiligo Wrinkles Treatments and Procedures Ambulatory ... Stretch Marks Sun-damaged Skin Unwanted Hair Unwanted Tattoos Varicose Veins Vitiligo Wrinkles Treatments and Procedures Ambulatory ...

  11. Inborn Errors in Immunity

    PubMed Central

    Lionakis, M.S.; Hajishengallis, G.

    2015-01-01

    In recent years, the study of genetic defects arising from inborn errors in immunity has resulted in the discovery of new genes involved in the function of the immune system and in the elucidation of the roles of known genes whose importance was previously unappreciated. With the recent explosion in the field of genomics and the increasing number of genetic defects identified, the study of naturally occurring mutations has become a powerful tool for gaining mechanistic insight into the functions of the human immune system. In this concise perspective, we discuss emerging evidence that inborn errors in immunity constitute real-life models that are indispensable both for the in-depth understanding of human biology and for obtaining critical insights into common diseases, such as those affecting oral health. In the field of oral mucosal immunity, through the study of patients with select gene disruptions, the interleukin-17 (IL-17) pathway has emerged as a critical element in oral immune surveillance and susceptibility to inflammatory disease, with disruptions in the IL-17 axis now strongly linked to mucosal fungal susceptibility, whereas overactivation of the same pathways is linked to inflammatory periodontitis. PMID:25900229

  12. Military Healthcare Battlefield Immunity.

    PubMed

    Kelly, J C

    2012-12-01

    The combatant soldier on the battlefield remains protected from any claim in negligence by the doctrine of combat immunity for any negligent act or omission they may make when fighting. In other words, the combatant soldier does not owe a fellow soldier a duty of care on the battlefield, as the duty of care is non-justiciable. However, the non-combatant Military Healthcare Professional, although sometimes operating in the same hostile circumstances as the fighting soldier, is unlikely to benefit from combat immunity for any clinical negligence on the battlefield. This is because they continue to owe their patient a duty of care, although this has not been tested in the courts. This paper considers if any military healthcare professional could ever benefit from combat immunity, which is unlikely due to their non-combatant status. Instead, this paper suggests that a modified form of immunity; namely, Military Healthcare Battlefield Immunity could be a new, unique and viable doctrine, however, this could only be granted in rare circumstances and to a much lesser degree than combat immunity.

  13. Adipose-immune interactions during obesity and caloric restriction: reciprocal mechanisms regulating immunity and health span

    PubMed Central

    Dixit, Vishwa Deep

    2008-01-01

    Increasing evidence suggests a tight coupling of metabolic and immune systems. This cross-talk mediated by neuroendocrine peptides as well as numerous cytokines and chemokines is believed to be responsible for integrating energy balance to immune function. These neuroendocrine-immune interactions are heightened during the state of chronic positive energy balance, as seen during obesity, and negative energy balance caused by caloric restriction (CR). Emerging evidence suggests that obesity may be associated with an immunodeficient state and chronic inflammation, which contribute to an increased risk of premature death. The direct interactions between expanded leukocyte populations within the adipose tissue during obesity and an increased number of adipocytes within an aging lymphoid microenvironment may constitute an important adaptive or pathological response as a result of change in energy balance. In stark contrast to obesity, CR causes negative energy balance and robustly prolongs a healthy lifespan in all of the species studied to date. Therefore, the endogenous neuroendocrine-metabolic sensors elevated or suppressed as a result of changes in energy balance may offer an important mechanism in understanding the antiaging and potential immune-enhancing nature of CR. Ghrelin, one such sensor of negative energy balance, is reduced during obesity and increased by CR. Ghrelin also regulates immune function by reducing proinflammatory cytokines and promotes thymopoiesis during aging and thus, may be a new CR mimetic target. The identification of immune effects and molecular pathways used by such orexigenic metabolic factors could offer potentially novel approaches to enhance immunity and increase healthy lifespan. PMID:18579754

  14. Immunity to Cryptococcus neoformans and C. gattii during cryptococcosis.

    PubMed

    Gibson, Josie F; Johnston, Simon A

    2015-05-01

    The vast majority of infection with cryptococcal species occurs with Cryptococcus neoformans in the severely immunocompromised. A significant exception to this is the infections of those with apparently normal immune systems by Cryptococcus gattii. Susceptibility to cryptococcosis can be broadly categorised as a defect in adaptive immune responses, especially in T cell immunity. However, innate immune cells such as macrophages play a key role and are likely the primary effector cell in the killing and ultimate clearance of cryptococcal infection. In this review we discuss the current state of our understanding of how the immune system responds to cryptococcal infection in health and disease, with reference to the work communicated at the 9th International Conference on Cryptococcus and Cryptococcosis (ICCC9). We have focussed on cell mediated responses, particularly early in infection, but with the aim of presenting a broad overview of our understanding of immunity to cryptococcal infection, highlighting some recent advances and offering some perspectives on future directions.

  15. APOBEC3 Proteins in Viral Immunity

    PubMed Central

    Stavrou, Spyridon; Ross, Susan R.

    2015-01-01

    Apolipoprotein B Editing Complex (APOBEC3) family members are cytidine deaminases that play important roles in intrinsic responses to infection by retroviruses and have also been implicated in the control of other viruses such as parvoviruses, herpesviruses, papillomaviruses, hepatitis B virus and retrotransposons. While their direct effect on modification of viral DNA has been clearly demonstrated, whether they play additional roles in innate and adaptive immunity to viruses is less clear. Here we review the data regarding the various steps in the innate and adaptive immune response to virus infection in which APOBEC3 proteins have been implicated. PMID:26546688

  16. Cytokines and immune surveillance in humans

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1993-01-01

    Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. Among the parameters shown, by us and others, to be affected is the production of interferons. Interferons are a family of cytokines that are antiviral and play a major role in regulating immune responses that control resistance to infection. Alterations in interferon and other cytokine production and activity could result in changes in immunity and a possible compromise of host defenses against both opportunistic and external infections. The purpose of the present study is to further explore the effects of space flight on cytokines and cytokine-directed immunological function.

  17. Immune complexes inhibit interleukin-1 secretion and inflammasome activation

    PubMed Central

    Janczy, John R.; Ciraci, Ceren; Haasken, Stefanie; Iwakura, Yoichiro; Olivier, Alicia K.; Cassel, Suzanne L.; Sutterwala, Fayyaz S.

    2014-01-01

    Immunoglobulin G (IgG) immune complexes have been shown to modify immune responses driven by antigen presenting cells in either a pro- or anti-inflammatory direction depending upon the context of stimulation. However, the ability of immune complexes to modulate the inflammasome-dependent innate immune response is unknown. Here we show that IgG immune complexes suppress IL-1α and IL-1β secretion through inhibition of inflammasome activation. The mechanism by which this inhibition occurs is via immune complex ligation of activating Fcγ receptors (FcγR), resulting in prevention of both activation and assembly of the inflammasome complex in response to NLRP3, NLRC4, or AIM2 agonists. In vivo, administration of antigen in the form of an immune complex during priming of the immune response inhibited resultant adaptive immune responses in a NLRP3 dependent model of allergic airway disease. Our data reveal an unexpected mechanism regulating CD4+ T cell differentiation, whereby immune complexes suppress inflammasome activation and the generation of IL-1α and IL-1β from antigen presenting cells, which are critical for the antigen-driven differentiation of CD4+ T cells. PMID:25320279

  18. Immune complexes inhibit IL-1 secretion and inflammasome activation.

    PubMed

    Janczy, John R; Ciraci, Ceren; Haasken, Stefanie; Iwakura, Yoichiro; Olivier, Alicia K; Cassel, Suzanne L; Sutterwala, Fayyaz S

    2014-11-15

    IgG immune complexes have been shown to modify immune responses driven by APCs in either a pro- or anti-inflammatory direction depending upon the context of stimulation. However, the ability of immune complexes to modulate the inflammasome-dependent innate immune response is unknown. In this study, we show that IgG immune complexes suppress IL-1α and IL-1β secretion through inhibition of inflammasome activation. The mechanism by which this inhibition occurs is via immune complex ligation of activating FcγRs, resulting in prevention of both activation and assembly of the inflammasome complex in response to nucleotide-binding domain leucine-rich repeat (NLR) P3, NLRC4, or AIM2 agonists. In vivo, administration of Ag in the form of an immune complex during priming of the immune response inhibited resultant adaptive immune responses in an NLRP3-dependent model of allergic airway disease. Our data reveal an unexpected mechanism regulating CD4(+) T cell differentiation, by which immune complexes suppress inflammasome activation and the generation of IL-1α and IL-1β from APCs, which are critical for the Ag-driven differentiation of CD4(+) T cells.

  19. Adaptive immunity in the liver

    PubMed Central

    Shuai, Zongwen; Leung, Miranda WY; He, Xiaosong; Zhang, Weici; Yang, Guoxiang; Leung, Patrick SC; Eric Gershwin, M

    2016-01-01

    The anatomical architecture of the human liver and the diversity of its immune components endow the liver with its physiological function of immune competence. Adaptive immunity is a major arm of the immune system that is organized in a highly specialized and systematic manner, thus providing long-lasting protection with immunological memory. Adaptive immunity consists of humoral immunity and cellular immunity. Cellular immunity is known to have a crucial role in controlling infection, cancer and autoimmune disorders in the liver. In this article, we will focus on hepatic virus infections, hepatocellular carcinoma and autoimmune disorders as examples to illustrate the current understanding of the contribution of T cells to cellular immunity in these maladies. Cellular immune suppression is primarily responsible for chronic viral infections and cancer. However, an uncontrolled auto-reactive immune response accounts for autoimmunity. Consequently, these immune abnormalities are ascribed to the quantitative and functional changes in adaptive immune cells and their subsets, innate immunocytes, chemokines, cytokines and various surface receptors on immune cells. A greater understanding of the complex orchestration of the hepatic adaptive immune regulators during homeostasis and immune competence are much needed to identify relevant targets for clinical intervention to treat immunological disorders in the liver. PMID:26996069

  20. Chronic stress and environmental enrichment as opposite factors affecting the immune response in Japanese quail (Coturnix coturnix japonica).

    PubMed

    Nazar, F N; Marin, R H

    2011-03-01

    Procedures in the commercial production of animals involve stressful situations which lessen the animal's welfare. This study on Japanese quail evaluated whether an environmental enrichment manipulation can affect avian immune responses and if combined with a chronic stressor exposure can help to counteract the negative effects of stress on the immune system. Potential gender effects were also considered. After hatch, half of the birds were housed in non-enriched boxes and half were housed in environmentally enriched boxes. From day 33 to 42 of age, all birds within half of the non-enriched and enriched boxes remained undisturbed while the other half were daily exposed to a 15 min restraint stressor (chronic stressor). The inflammatory response (lymphoproliferation after phytohemagglutinin-p), percentage of lymphocytes, heterophil/lymphocyte (H/L) ratio and primary antibody response against sheep red blood cells were assessed. The chronic stressor application and the enrichment procedure, respectively, either increased or reduced the four immunological parameters evaluated and always in opposite directions. Males consistently showed lower antibody titres than females and presented the highest H/L ratio in response to the stressor when reared in the non-enriched environment. The findings indicate that submitting these animals to an enriched environment can be effectively used to improve their immune response and to reduce the detrimental effects of a stressor exposure.

  1. Inflammation and breast cancer. Balancing immune response: crosstalk between adaptive and innate immune cells during breast cancer progression

    PubMed Central

    DeNardo, David G; Coussens, Lisa M

    2007-01-01

    Recent insights into the molecular and cellular mechanisms underlying cancer development have revealed that immune cells functionally regulate epithelial cancer development and progression. Moreover, accumulated clinical and experimental data indicate that the outcome of an immune response toward an evolving breast neoplasm is largely determined by the type of immune response elicited. Acute tumor-directed immune responses involving cytolytic T lymphocytes appear to protect against tumor development, whereas immune responses involving chronic activation of humoral immunity, infiltration by Th2 cells, and protumor-polarized innate inflammatory cells result in the promotion of tumor development and disease progression. Herein we review this body of literature and summarize important new findings revealing the paradoxical role of innate and adaptive leukocytes as regulators of breast carcinogenesis. PMID:17705880

  2. Crew procedures development techniques

    NASA Technical Reports Server (NTRS)

    Arbet, J. D.; Benbow, R. L.; Hawk, M. L.; Mangiaracina, A. A.; Mcgavern, J. L.; Spangler, M. C.

    1975-01-01

    The study developed requirements, designed, developed, checked out and demonstrated the Procedures Generation Program (PGP). The PGP is a digital computer program which provides a computerized means of developing flight crew procedures based on crew action in the shuttle procedures simulator. In addition, it provides a real time display of procedures, difference procedures, performance data and performance evaluation data. Reconstruction of displays is possible post-run. Data may be copied, stored on magnetic tape and transferred to the document processor for editing and documentation distribution.

  3. The discontinuity theory of immunity

    PubMed Central

    Pradeu, Thomas; Vivier, Eric

    2017-01-01

    Some biological systems detect the rate of change in a stimulus rather than the stimulus itself only. We suggest that the immune system works in this way. According to the discontinuity theory of immunity, the immune system responds to sudden changes in antigenic stimulation and is rendered tolerant by slow or continuous stimulation. This basic principle, which is supported by recent data on immune checkpoints in viral infections, cancers, and allergies, can be seen as a unifying framework for diverse immune responses.

  4. 32 CFR 159.6 - Procedures.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... procedures shall: 9 Available at http://www.dtic.mil/whs/directives/corres/html/231101.htm. 10 Available at http://www.dtic.mil/whs/directives/corres/pdf/520008r.pdf. 11 Available at http://www.dtic.mil/whs... response to hostile acts or demonstrated hostile intent. 12 Available at...

  5. 32 CFR 159.6 - Procedures.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... procedures shall: 9 Available at http://www.dtic.mil/whs/directives/corres/html/231101.htm. 10 Available at http://www.dtic.mil/whs/directives/corres/pdf/520008r.pdf. 11 Available at http://www.dtic.mil/whs... response to hostile acts or demonstrated hostile intent. 12 Available at...

  6. 28 CFR 550.31 - Procedures.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Urine Surveillance § 550.31 Procedures. (a) Staff of the same sex as the inmate tested shall directly supervise the giving of the urine sample. If an inmate is unwilling to provide a urine sample within two... time need be allowed for an inmate who directly and specifically refuses to provide a urine sample....

  7. 28 CFR 550.31 - Procedures.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Urine Surveillance § 550.31 Procedures. (a) Staff of the same sex as the inmate tested shall directly supervise the giving of the urine sample. If an inmate is unwilling to provide a urine sample within two... time need be allowed for an inmate who directly and specifically refuses to provide a urine sample....

  8. 28 CFR 550.31 - Procedures.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Urine Surveillance § 550.31 Procedures. (a) Staff of the same sex as the inmate tested shall directly supervise the giving of the urine sample. If an inmate is unwilling to provide a urine sample within two... time need be allowed for an inmate who directly and specifically refuses to provide a urine sample....

  9. 28 CFR 550.31 - Procedures.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Urine Surveillance § 550.31 Procedures. (a) Staff of the same sex as the inmate tested shall directly supervise the giving of the urine sample. If an inmate is unwilling to provide a urine sample within two... time need be allowed for an inmate who directly and specifically refuses to provide a urine sample....

  10. Effects of microgravity on the immune system

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald; Taylor, Gerald R.

    1991-01-01

    Changes in resistance to bacterial and viral infections in Apollo crew members has stimulated interest in the study of immunity and space flight. Results of studies from several laboratories in both humans and rodents have indicated alterations after space flight that include the following immunological parameters: thymus size, lymphocyte blastogenesis, interferon and interleukin production, natural killer cell activity, cytotoxic T-cell activity, leukocyte subset population distribution, response of bone marrow cells to colony stimulating factors, and delayed hypersensitivity skin test reactivity. The interactions of the immune system with other physiological systems, including muscle, bone, and the nervous system, may play a major role in the development of these immunological parameters during and after flight. There may also be direct effects of space flight on immune responses.

  11. The humoral immune system of anadromous fish.

    PubMed

    Zwollo, Patty

    2017-01-03

    The immune system of anadromous fish is extremely complex, a direct consequence of their diadromous nature. Hormone levels fluctuate widely throughout their life cycle, as fish move between fresh and salt water. This poses major challenges to the physiology of anadromous fish, including adaptation to very different saline environments, distinct pathogen fingerprints, and different environmental stressors. Elevated cortisol and sex hormone levels inhibit B lymphopoiesis and IgM(+) antibody responses, while catecholamines, growth hormones and thyroid hormones are generally stimulatory and enhance the humoral immune response. Immunological memory in the form of long-lived plasma cells likely plays important roles in health and survival during the life cycle of anadromous fishes. This review discusses some of the complex immune-endocrine pathways in anadromous fish, focusing on essential roles for B lineage cells in the successful completion of their life cycle. A discussion is included on potential differences in immuno-competence between wild and hatchery-raised fish.

  12. Innate and Adaptive Immunity in Atherosclerosis

    PubMed Central

    Packard, René R. S.; Lichtman, Andrew H.; Libby, Peter

    2010-01-01

    Atherosclerosis, a chronic inflammatory disorder, involves both the innate and adaptive arms of the immune response that mediate the initiation, progression, and ultimate thrombotic complications of atherosclerosis. Most fatal thromboses, which may manifest as acute myocardial infarction or ischemic stroke, result from frank rupture or superficial erosion of the fibrous cap overlying the atheroma, processes that occur in inflammatorily active, rupture-prone plaques. Appreciation of the inflammatory character of atherosclerosis has led to the application of C-reactive protein as a biomarker of cardiovascular risk, and the characterization of the anti-inflammatory and immunomodulatory actions of the statin class of drugs. An improved understanding of the pathobiology of atherosclerosis and further studies of its immune mechanisms provide avenues for the development of future strategies directed toward better risk stratification of patients as well as the identification of novel anti-inflammatory therapies. This review retraces leukocyte subsets involved in innate and adaptive immunity and their contributions to atherogenesis. PMID:19449008

  13. Plant immunity to necrotrophs.

    PubMed

    Mengiste, Tesfaye

    2012-01-01

    Plants inhabit environments crowded with infectious microbes that pose constant threats to their survival. Necrotrophic pathogens are notorious for their aggressive and wide-ranging virulence strategies that promote host cell death and acquire nutrients for growth and reproduction from dead cells. This lifestyle constitutes the axis of their pathogenesis and virulence strategies and marks contrasting immune responses to biotrophic pathogens. The diversity of virulence strategies in necrotrophic species corresponds to multifaceted host immune response mechanisms. When effective, the plant immune system disarms the infectious necrotroph of its pathogenic arsenal or attenuates its effect, restricting further ingress and disease symptom development. Simply inherited resistance traits confer protection against host-specific necrotrophs (HSNs), whereas resistance to broad host-range necrotrophs (BHNs) is complex. Components of host genetic networks, as well as the molecular and cellular processes that mediate host immune responses to necrotrophs, are being identified. In this review, recent advances in our understanding of plant immune responses to necrotrophs and comparison with responses to biotrophic pathogens are summarized, highlighting common and contrasting mechanisms.

  14. Adaptive Immunity to Fungi

    PubMed Central

    Verma, Akash; Wüthrich, Marcel; Deepe, George; Klein, Bruce

    2015-01-01

    Life-threatening fungal infections have risen sharply in recent years, owing to the advances and intensity of medical care that may blunt immunity in patients. This emerging crisis has created the growing need to clarify immune defense mechanisms against fungi with the ultimate goal of therapeutic intervention. We describe recent insights in understanding the mammalian immune defenses that are deployed against pathogenic fungi. We focus on adaptive immunity to the major medically important fungi and emphasize three elements that coordinate the response: (1) dendritic cells and subsets that are mobilized against fungi in various anatomical compartments; (2) fungal molecular patterns and their corresponding receptors that signal responses and shape the differentiation of T-cell subsets and B cells; and, ultimately (3) the effector and regulatory mechanisms that eliminate these invaders while constraining collateral damage to vital tissue. These insights create a foundation for the development of new, immune-based strategies for prevention or enhanced clearance of systemic fungal diseases. PMID:25377140

  15. Filoviral immune evasion mechanisms.

    PubMed

    Ramanan, Parameshwaran; Shabman, Reed S; Brown, Craig S; Amarasinghe, Gaya K; Basler, Christopher F; Leung, Daisy W

    2011-09-01

    The Filoviridae family of viruses, which includes the genera Ebolavirus (EBOV) and Marburgvirus (MARV), causes severe and often times lethal hemorrhagic fever in humans. Filoviral infections are associated with ineffective innate antiviral responses as a result of virally encoded immune antagonists, which render the host incapable of mounting effective innate or adaptive immune responses. The Type I interferon (IFN) response is critical for establishing an antiviral state in the host cell and subsequent activation of the adaptive immune responses. Several filoviral encoded components target Type I IFN responses, and this innate immune suppression is important for viral replication and pathogenesis. For example, EBOV VP35 inhibits the phosphorylation of IRF-3/7 by the TBK-1/IKKε kinases in addition to sequestering viral RNA from detection by RIG-I like receptors. MARV VP40 inhibits STAT1/2 phosphorylation by inhibiting the JAK family kinases. EBOV VP24 inhibits nuclear translocation of activated STAT1 by karyopherin-α. The examples also represent distinct mechanisms utilized by filoviral proteins in order to counter immune responses, which results in limited IFN-α/β production and downstream signaling.

  16. Immunity to fish rhabdoviruses

    USGS Publications Warehouse

    Purcell, Maureen K.; Laing, Kerry J.; Winton, James R.

    2012-01-01

    Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN) system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M) protein to mediate host-cell shutoff and the non-virion (NV) protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.

  17. Aging, immunity, and cancer.

    PubMed

    Fulop, Tamas; Larbi, Anis; Kotb, Rami; de Angelis, Flavia; Pawelec, Graham

    2011-06-01

    Age is the most important risk factor for tumorigenesis. More than 60% of new cancers and more than 70% of cancer deaths occur in elderly subjects >65 years. The immune system plays an important role in the battle of the host against cancer development. Deleterious alterations occur to the immune response with aging, termed immunosenescence. It is tempting to speculate that this waning immune response contributes to the higher incidence of cancer, but robust data on this important topic are few and far between. This review is devoted to discussing state of the art knowledge on the relationship between immunosenescence and cancer. Emerging understanding of the aging process at the molecular level is viewed from the perspective of this increased tumorigenesis. We also consider some of the most recent means to intervene in the modulation of immunosenescence to increase the ability of the immune system to fight against tumors. Future research will unravel new aspects of the immune response against tumors which will be modulable to decrease the burden of cancer in elderly individuals.

  18. Immunization of preterm infants

    PubMed Central

    Gagneur, Arnaud; Pinquier, Didier; Quach, Caroline

    2015-01-01

    Vaccinations of premature infants are often delayed despite being at an increased risk of contracting vaccine preventable diseases. This article reviews the current knowledge on the immune response to widely used vaccines, on the protection derived from routine immunization and on vaccine safety and tolerability in a population of preterm infants. Available data evaluating the immune response of preterm infants support early immunization without correction for gestational age. For a number of antigens, the antibody response to initial doses of vaccines may be lower than that of term infants, but protective concentrations are often achieved and memory successfully induced. Vaccines are immunogenic, safe and well tolerated in preterm infants. Preterm infants should be vaccinated using the same schedules as those usually recommended for full-term infants, with the exception of the hepatitis B vaccine, where additional doses should be administered in infants receiving the first dose during the first days of life if they weighed less than 2000 g because of a documented reduced immune response. PMID:26291883

  19. Elevation of serum IgE level and peripheral eosinophil count during T lymphocyte-directed gene therapy for ADA deficiency: implication of Tc2-like cells after gene transduction procedure.

    PubMed

    Kawamura, N; Ariga, T; Ohtsu, M; Yamada, M; Tame, A; Furuta, H; Kobayashi, I; Okano, M; Yanagihara, Y; Sakiyama, Y

    1998-11-01

    We have successfully carried out T-cell-directed gene therapy for a boy with severe combined immunodeficiency due to adenosine deaminase deficiency (ADA SCID) and unexpectedly found an elevation of serum IgE level and peripheral eosinophil count during the course. More than 90% of transduced cells cultured for 7-11 days before infusion into the patient were positive for CD8 and expressed Th2-type cytokine genes such as IL-4, IL-5 and IL-13. Furthermore, CD4(+) T-depleted PBMC (peripheral blood mononuclear cells) from the patient synthesized IgE in vitro by stimulation with IL-4. Collectively, these results suggested that Tc2-like cells in the transduced cells have distinct immunological functions to help IgE synthesis and activate eosinophils.

  20. Mutanome directed cancer immunotherapy.

    PubMed

    Vormehr, Mathias; Diken, Mustafa; Boegel, Sebastian; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

    2016-04-01

    Somatic mutations are important drivers of cancer development. Accumulating evidence suggests that a significant subset of mutations result in neo-epitopes recognized by autologous T cells and thus may constitute the Achilles' heel of tumor cells. T cells directed against mutations have been shown to have a key role in clinical efficacy of potent cancer immunotherapy modalities, such as adoptive transfer of autologous tumor infiltrating lymphocytes and immune checkpoint inhibitors. Whereas these findings strengthen the idea of a prominent role of neo-epitopes in tumor rejection, the systematic therapeutic exploitation of mutations was hampered until recently by the uniqueness of the repertoire of mutations ('the mutanome') in every patient's tumor. This review highlights insights into immune recognition of neo-epitopes and novel concepts for comprehensive identification and immunotherapeutic exploitation of individual mutations.

  1. Pericytes: brain-immune interface modulators

    PubMed Central

    Hurtado-Alvarado, Gabriela; Cabañas-Morales, Adrian M.; Gómez-Gónzalez, Beatriz

    2014-01-01

    The premise that the central nervous system is immune-privileged arose from the fact that direct contact between immune and nervous cells is hindered by the blood–brain barrier. However, the blood–brain barrier also comprises the interface between the immune and nervous systems by secreting chemo-attractant molecules and by modulating immune cell entry into the brain. The majority of published studies on the blood–brain barrier focus on endothelial cells (ECs), which are a critical component, but not the only one; other cellular components include astroglia, microglia, and pericytes. Pericytes are poorly studied in comparison with astrocytes or ECs; they are mesenchymal cells that can modify their ultrastructure and gene expression in response to changes in the central nervous system microenvironment. Pericytes have a unique synergistic relationship with brain ECs in the regulation of capillary permeability through secretion of cytokines, chemokines, nitric oxide, matrix metalloproteinases, and by means of capillary contraction. Those pericyte manifestations are related to changes in blood–brain barrier permeability by an increase in endocytosis-mediated transport and by tight junction disruption. In addition, recent reports demonstrate that pericytes control the migration of leukocytes in response to inflammatory mediators by up-regulating the expression of adhesion molecules and releasing chemo-attractants; however, under physiological conditions they appear to be immune-suppressors. Better understanding of the immune properties of pericytes and their participation in the effects of brain infections, neurodegenerative diseases, and sleep loss will be achieved by analyzing pericyte ultrastructure, capillary coverage, and protein expression. That knowledge may provide a mechanism by which pericytes participate in the maintenance of the proper function of the brain-immune interface. PMID:24454281

  2. Immune Response in Human Cerebral Cavernous Malformations

    PubMed Central

    Shi, Changbin; Shenkar, Robert; Du, Hongyan; Duckworth, Edward; Raja, Harish; Batjer, H. Hunt; Awad, Issam A.

    2009-01-01

    Background and Purpose Preliminary observations suggesting the presence of B and plasma cells and oligoclonality of immunoglobulin (Ig) G in cerebral cavernous malformations (CCMs) have motivated a systematic study correlating the infiltration of the immune cells with clinical activity and antigen-triggered immune response in surgically excised lesions. Methods Infiltration of plasma, B, T and HLA-DR expressing cells and macrophages within 23 excised CCMs was related to clinical activity. Relative amounts of Ig isotypes were determined. IgG clonality of mRNA from CCMs was assessed by spectratyping, cloning and sequencing. Results Infiltration of the immune cells ranged widely within CCM lesions and cells were generally co-expressed with each other. Immune cell infiltration did not associate with recent bleeding and lesion growth. Significantly more B lymphocytes in CCM lesions were associated with venous anomaly. More T cells were present in solitary lesions. More T cells and less macrophages were present in CCMs from younger subjects. IgG isotype was present in all CCM lesions. Most lesions also expressed IgM and IgA, with IgM predominance over IgA correlating with recent CCM growth. Oligoclonality was shown in IgG mRNA from CCMs, but not from peripheral blood lymphocytes, with only eight CDR3 sequences observed among 134 clones from two CCM lesions. Conclusions An antigen-directed oligoclonal IgG immune response is present within CCM lesions regardless of recent clinical activity. Apparent differences in immune response in younger patients and in lesions with recent growth will need confirmation in other series. The pathogenicity of oligoclonal immune response will require systematic hypothesis testing in recently available CCM murine models. PMID:19286587

  3. TSLP and immune homeostasis.

    PubMed

    Hanabuchi, Shino; Watanabe, Norihiko; Liu, Yong-Jun

    2012-03-01

    In an immune system, dendritic cells (DCs) are professional antigen-presenting cells (APCs) as well as powerful sensors of danger signals. When DCs receive signals from infection and tissue stress, they immediately activate and instruct the initiation of appropriate immune responses to T cells. However, it has remained unclear how the tissue microenvironment in a steady state shapes the function of DCs. Recent many works on thymic stromal lymphopoietin (TSLP), an epithelial cell-derived cytokine that has the strong ability to activate DCs, provide evidence that TSLP mediates crosstalk between epithelial cells and DCs, involving in DC-mediated immune homeostasis. Here, we review recent progress made on how TSLP expressed within the thymus and peripheral lymphoid and non-lymphoid tissues regulates DC-mediated T-cell development in the thymus and T-cell homeostasis in the periphery.

  4. Telomeres and immune competency.

    PubMed

    Weng, Nan-ping

    2012-08-01

    Telomeres are essential for the integrity of chromosomes and for cellular replication. Attrition of telomeres occurs during DNA replication owing to the inability of conventional DNA polymerase to replicate chromosomal termini and the insufficient compensation for telomere loss by telomerase, an enzyme that synthesizes telomeric DNA. A number of genetic defects have been described in humans and in animal models that cause accelerated telomere attrition, in turn leading to severe phenotypes of hematopoietic and other proliferating cells. Telomere length, most frequently measured as an average value in heterogeneous peripheral blood leukocyte populations in humans, has been associated with a wide range of health conditions and diseases of immune and non-immune cells. Here, I review recent studies of telomere length dynamics with particular relevance to immune function.

  5. Immunizations, immunology, and autism.

    PubMed

    Chez, Michael G; Chin, Kathleen; Hung, Paul C

    2004-09-01

    Public fears of rising rates of children being diagnosed with autistic spectrum disorders has led to a fear that immunizations, specifically the measles-mumps-varicella vaccine (MMR), may trigger autism. This article reviews theories of immunization as a risk factor for autism, including thimerosal exposure. We also review theories of autoimmunity as a predisposing genetic risk in autistic patients. We summarize from multiple population-based studies and extensive review committee reports that neither immunization nor thimerosal exposure has been conclusively linked to autism. Current treatments for autoimmunity in autism are reviewed and summarized as being only anecdotally effective, with no controlled studies to conclusively determine effectiveness. The goal of this article is to allow child neurologists to effectively counsel parents of autistic patients about vaccination risks and treatment options in presumed cases of autoimmune dysfunction.

  6. Immune Therapies for Neuroblastoma

    PubMed Central

    Navid, Fariba; Armstrong, Michael; Barfield, Raymond C.

    2009-01-01

    Neuroblastoma, a solid tumor arising from developing cells of the sympathetic nervous system, is the most common extracranial tumor in children. The prognosis for high-risk neuroblastoma remains poor with conventional treatment, and new approaches are therefore being explored to treat this disease. One such alternative therapy that holds promise is immune therapy. We review here the recent advances in 4 types of immune therapy – cytokine, vaccine, antibody, and cellular therapy – to treat neuroblastoma. We present preclinical research and clinical trials on several promising candidates such as IL-12, dendritic cell vaccines, anti-GD2 antibodies, and allogeneic hematopoietic stem cell transplant. An optimal treatment plan for neuroblastoma will most likely involve multimodal approaches and combinations of immune therapies. PMID:19342881

  7. Acupuncture and immune modulation.

    PubMed

    Kim, Sun Kwang; Bae, Hyunsu

    2010-10-28

    Acupuncture is probably the most popular alternative therapy practiced in the United States, Europe and many Asian countries. It has been applied clinically for more than 5 thousand years according to the ancient oriental medical theory. A great deal of acupuncture research has been achieved, with particular efforts toward understanding the pain control effects. In addition to the analgesic effect of acupuncture, an increasing number of studies have demonstrated that acupuncture treatment can control autonomic nerve system functions such as blood pressure regulation, sphincter Oddi relaxation, and immune modulation. Although only a limited number of controlled studies have assessed the efficacy of acupuncture, increasing clinical evidences support that EA treatment is effective for various immunological diseases including allergic disorders, infections, autoimmune diseases and immunodifficiency-syndromes. This review will address the mechanism of acupuncture in modulating various immune responses and the relationship between acupuncture mediated immune regulation and neurological involvement.

  8. Functions of innate immune cells and commensal bacteria in gut homeostasis.

    PubMed

    Kayama, Hisako; Takeda, Kiyoshi

    2016-02-01

    The intestinal immune system remains unresponsive to beneficial microbes and dietary antigens while activating pro-inflammatory responses against pathogens for host defence. In intestinal mucosa, abnormal activation of innate immunity, which directs adaptive immune responses, causes the onset and/or progression of inflammatory bowel diseases. Thus, innate immunity is finely regulated in the gut. Multiple innate immune cell subsets have been identified in both murine and human intestinal lamina propria. Some innate immune cells play a key role in the maintenance of gut homeostasis by preventing inappropriate adaptive immune responses while others are associated with the pathogenesis of intestinal inflammation through development of Th1 and Th17 cells. In addition, intestinal microbiota and their metabolites contribute to the regulation of innate/adaptive immune responses. Accordingly, perturbation of microbiota composition can trigger intestinal inflammation by driving inappropriate immune responses.

  9. Inflammatory bowel disease related innate immunity and adaptive immunity.

    PubMed

    Huang, Yuan; Chen, Zhonge

    2016-01-01

    Inflammatory bowel disease (IBD) is a chronic nonspecific intestinal inflammatory disease, including ulcerative colitis (UC) and Crohn's disease (CD). Its pathogenesis remains not yet clear. Current researchers believe that after environmental factors act on individuals with genetic susceptibility, an abnormal intestinal immune response is launched under stimulation of intestinal flora. However, previous studies only focused on adaptive immunity in the pathogenesis of IBD. Currently, roles of innate immune response in the pathogenesis of intestinal inflammation have also drawn much attention. In this study, IBD related innate immunity and adaptive immunity were explained, especially the immune mechanisms in the pathogenesis of IBD.

  10. Immune Mechanisms of Chronic Rhinosinusitis

    PubMed Central

    2016-01-01

    Chronic rhinosinusitis (CRS) is a common inflammatory disease that results in a significant decrease in patient quality of life and a large economic burden. However, the lack of population-based epidemiologic studies and robust model systems has made it difficult to fully elucidate the key inflammatory pathways that drive the chronic inflammatory responses observed in CRS. This review will highlight the wide variety of factors that likely contribute to CRS disease pathogenesis. Defects in the innate immune function of the airway epithelium, including decreases in barrier function, mucociliary clearance, and production of antimicrobial peptides, all likely play a role in the initial inflammatory response. Subsequent recruitment and activation of eosinophils, mast cells, and innate lymphoid cells (ILCs) further contributes to the chronic inflammatory response and directly activates adaptive immune cells, including T and B cells. However, development of new tools and model systems is still needed to further understand the chronicity of this inflammatory response and which specific factors are necessary or sufficient to drive CRS pathogenesis. Such studies will be critical for the development of improved therapeutic strategies aimed at treating this highly prevalent and costly disease. PMID:26677109

  11. The transfer of analytical procedures.

    PubMed

    Ermer, J; Limberger, M; Lis, K; Wätzig, H

    2013-11-01

    Analytical method transfers are certainly among the most discussed topics in the GMP regulated sector. However, they are surprisingly little regulated in detail. General information is provided by USP, WHO, and ISPE in particular. Most recently, the EU emphasized the importance of analytical transfer by including it in their draft of the revised GMP Guideline. In this article, an overview and comparison of these guidelines is provided. The key to success for method transfers is the excellent communication between sending and receiving unit. In order to facilitate this communication, procedures, flow charts and checklists for responsibilities, success factors, transfer categories, the transfer plan and report, strategies in case of failed transfers, tables with acceptance limits are provided here, together with a comprehensive glossary. Potential pitfalls are described such that they can be avoided. In order to assure an efficient and sustainable transfer of analytical procedures, a practically relevant and scientifically sound evaluation with corresponding acceptance criteria is crucial. Various strategies and statistical tools such as significance tests, absolute acceptance criteria, and equivalence tests are thoroughly descibed and compared in detail giving examples. Significance tests should be avoided. The success criterion is not statistical significance, but rather analytical relevance. Depending on a risk assessment of the analytical procedure in question, statistical equivalence tests are recommended, because they include both, a practically relevant acceptance limit and a direct control of the statistical risks. However, for lower risk procedures, a simple comparison of the transfer performance parameters to absolute limits is also regarded as sufficient.

  12. Quercetin, Inflammation and Immunity

    PubMed Central

    Li, Yao; Yao, Jiaying; Han, Chunyan; Yang, Jiaxin; Chaudhry, Maria Tabassum; Wang, Shengnan; Liu, Hongnan; Yin, Yulong

    2016-01-01

    In vitro and some animal models have shown that quercetin, a polyphenol derived from plants, has a wide range of biological actions including anti-carcinogenic, anti-inflammatory and antiviral activities; as well as attenuating lipid peroxidation, platelet aggregation and capillary permeability. This review focuses on the physicochemical properties, dietary sources, absorption, bioavailability and metabolism of quercetin, especially main effects of quercetin on inflammation and immune function. According to the results obtained both in vitro and in vivo, good perspectives have been opened for quercetin. Nevertheless, further studies are needed to better characterize the mechanisms of action underlying the beneficial effects of quercetin on inflammation and immunity. PMID:26999194

  13. Quercetin, Inflammation and Immunity.

    PubMed

    Li, Yao; Yao, Jiaying; Han, Chunyan; Yang, Jiaxin; Chaudhry, Maria Tabassum; Wang, Shengnan; Liu, Hongnan; Yin, Yulong

    2016-03-15

    In vitro and some animal models have shown that quercetin, a polyphenol derived from plants, has a wide range of biological actions including anti-carcinogenic, anti-inflammatory and antiviral activities; as well as attenuating lipid peroxidation, platelet aggregation and capillary permeability. This review focuses on the physicochemical properties, dietary sources, absorption, bioavailability and metabolism of quercetin, especially main effects of quercetin on inflammation and immune function. According to the results obtained both in vitro and in vivo, good perspectives have been opened for quercetin. Nevertheless, further studies are needed to better characterize the mechanisms of action underlying the beneficial effects of quercetin on inflammation and immunity.

  14. Vaccines and Immunization Practice.

    PubMed

    Hogue, Michael D; Meador, Anna E

    2016-03-01

    Vaccines are among most cost-effective public health strategies. Despite effective vaccines for many bacterial and viral illnesses, tens of thousands of adults and hundreds of children die each year in the United States from vaccine-preventable diseases. Underutilization of vaccines requires rethinking the approach to incorporating vaccines into practice. Arguably, immunizations could be a part all health care encounters. Shared responsibility is paramount if deaths are to be reduced. This article reviews the available vaccines in the US market, as well as practice recommendations of the Centers for Disease Control and Prevention's Advisory Committee on Immunization Practices.

  15. Exercise boosts immune response.

    PubMed

    Sander, Ruth

    2012-06-29

    Ageing is associated with a decline in normal functioning of the immune system described as 'immunosenescence'. This contributes to poorer vaccine response and increased incidence of infection and malignancy seen in older people. Regular exercise can enhance vaccination response, increase T-cells and boost the function of the natural killer cells in the immune system. Exercise also lowers levels of the inflammatory cytokines that cause the 'inflamm-ageing' that is thought to play a role in conditions including cardiovascular disease; type 2 diabetes; Alzheimer's disease; osteoporosis and some cancers.

  16. Mammalian glycosylation in immunity.

    PubMed

    Marth, Jamey D; Grewal, Prabhjit K

    2008-11-01

    Glycosylation produces a diverse and abundant repertoire of glycans, which are collectively known as the glycome. Glycans are one of the four fundamental macromolecular components of all cells, and are highly regulated in the immune system. Their diversity reflects their multiple biological functions that encompass ligands for proteinaceous receptors known as lectins. Since the discovery that selectins and their glycan ligands are important for the regulation of leukocyte trafficking, it has been shown that additional features of the vertebrate immune system are also controlled by endogenous cellular glycosylation. This Review focuses on the emerging immunological roles of the mammalian glycome.

  17. Lassa Fever Immune Plasma.

    DTIC Science & Technology

    1979-08-01

    1974. 5. Frame, J. D. Surveillance of Lassa Fever amohg missionaries stationed in West Africa . Bull. WVHO 52: 593-59a, 1975 6. Monath, T.- P. Lassa ...A883 049 COLUMBIA UNIV NEW YORK DIV OF TROPIAL MEDIC.NE F/S 6/5 LASSA FEVER IMMUNE PLASMA U) AUG 79 J D FRAME DAMD17-79-C-9024 UNCLASSIFIED...NL’mmmEmmEmmEE.inuuuuwi LLVIL j~~AD’ LEVEL REPORT NO. 1I 0) LASSA FEVER IMMUNE PLASMA Annual Summary Report John 0. Frame, M.D. i Division of Tropical

  18. Immunotherapy comes of age: Immune aging & checkpoint inhibitors.

    PubMed

    Elias, Rawad; Karantanos, Theodoros; Sira, Elizabeth; Hartshorn, Kevan L

    2017-02-17

    Immune checkpoint inhibitors (ICIs) are based on the understanding that there are multilayered checks and balances which can be manipulated to unleash already existing, but paralyzed, immune responses to cancer. These agents are safer and more efficacious than classic cytotoxic drugs making them a very attractive therapeutic option, especially in older adults. Current available data do not suggest significant age-associated differences in the clinical profile of ICIs. It must be noted, however, that there is still relatively little information on the use of ICIs in adults over 75years of age and aging is associated with a decline in the immune system or "immunosenescence" which theoretically can reduce the efficacy of these immune based therapies. In this paper, we review the mechanism of action of ICIs, current clinical data on their use in older adults, and age-associated immune changes that might have a direct impact on their activity in this population. We chose to focus on mainly adaptive cellular immunity, and especially on components of the immune system that are implicated directly in the immune checkpoint process.

  19. Candidate CDTI procedures study

    NASA Technical Reports Server (NTRS)

    Ace, R. E.

    1981-01-01

    A concept with potential for increasing airspace capacity by involving the pilot in the separation control loop is discussed. Some candidate options are presented. Both enroute and terminal area procedures are considered and, in many cases, a technologically advanced Air Traffic Control structure is assumed. Minimum display characteristics recommended for each of the described procedures are presented. Recommended sequencing of the operational testing of each of the candidate procedures is presented.

  20. Natural selection on immune responsiveness in blue tits Parus caeruleus.

    PubMed

    Råberg, Lars; Stjernman, Martin

    2003-07-01

    What is the form of natural selection on immune responsiveness? For a population at evolutionary equilibrium, there are two different scenarios. First, it is generally assumed that immune defense has both benefits and costs. If variation in immune responsiveness is due to variation in how individuals trade off these costs and benefits, one would expect immune responsiveness to be subject to stabilizing selection. Second, it is well known that an individual's immune responsiveness is often dependent on its overall condition. If immune responsiveness is condition-dependent, one would expect immune responsiveness to be under positive directional selection. We would therefore expect that the form of natural selection on immune responsiveness depends on the relative magnitude of these two sources of variation: variation in how individuals trade off the costs and benefits of defense, and variation in condition. We measured primary and secondary antibody responsiveness to diphtheria-tetanus vaccine in blue tits during winter and investigated the relationship between responsiveness and survival to the following breeding season. We use responsiveness to these antigens as measures of an individual's ability or propensity to mount an antibody response in case of an infection. Interestingly, different measures of responsiveness were subject to different selective regimes: primary responsiveness to diphtheria was subject to stabilizing selection, whereas secondary responsiveness to tetanus was subject to positive directional selection. In contrast, there was no significant selection on primary responsiveness to tetanus or secondary responsiveness to diphtheria. The finding of stabilizing selection on a measure of responsiveness is evidence that immune defense can incur fitness costs; a central but little-tested assumption of theories of the ecology and evolution of immunological defense. The finding of directional selection on a measure of responsiveness is consistent with the

  1. Procedural pediatric dermatology.

    PubMed

    Metz, Brandie J

    2013-04-01

    Due to many factors, including parental anxiety, a child's inability to understand the necessity of a procedure and a child's unwillingness to cooperate, it can be much more challenging to perform dermatologic procedures in children. This article reviews pre-procedural preparation of patients and parents, techniques for minimizing injection-related pain and optimal timing of surgical intervention. The risks and benefits of general anesthesia in the setting of pediatric dermatologic procedures are discussed. Additionally, the surgical approach to a few specific types of birthmarks is addressed.

  2. Modified arthroscopic Brostrom procedure.

    PubMed

    Lui, Tun Hing

    2015-09-01

    The open modified Brostrom anatomic repair technique is widely accepted as the reference standard for lateral ankle stabilization. However, there is high incidence of intra-articular pathologies associated with chronic lateral ankle instability which may not be addressed by an isolated open Brostrom procedure. Arthroscopic Brostrom procedure with suture anchor has been described for anatomic repair of chronic lateral ankle instability and management of intra-articular lesions. However, the complication rates seemed to be higher than open Brostrom procedure. Modification of the arthroscopic Brostrom procedure with the use of bone tunnel may reduce the risk of certain complications.

  3. Channelling, a new immunization strategy.

    PubMed

    Gacharna Romero, M G; Silva Pizano, E; Avendano Lamo, J

    1985-01-01

    In 1981, with PAHO/WHO technical assistance, the Ministry of Health, Colombia, designed what is known as the channelling strategy, aimed at improving immunization coverage. This name was given because the strategy is designed to establish communication channels through direct action aimed at promoting health. Health workers and community leaders or guides conduct household visits to identify unvaccinated children or those with incomplete vaccination schedules and "channel" them to health centers or health posts. The channelling strategy developed in Colombia was briefly mentioned in the case study on the Colombian Vaccination Crusade of 1984. It is now being employed for ORT and other PHC components in the Colombian Child Survival and Development Plan, 1985-1987. In the meantime, other countries have adopted the channelling strategy, which is described in this article.

  4. Homing of immune cells: role in homeostasis and intestinal inflammation.

    PubMed

    Hart, Ailsa L; Ng, Siew C; Mann, Elizabeth; Al-Hassi, Hafid Omar; Bernardo, David; Knight, Stella C

    2010-11-01

    Rather like a satellite navigation system directing a vehicle to a particular destination defined by post-code, immune cells have homing molecules or "immune post-codes" enabling them to be recruited to specific organs, such as the intestine or skin. An efficient system would be designed such that the site of entry of an antigen influences the homing of effector T cells back to the appropriate organ. For example, to mount an immune response against an intestinal pathogen, T cells with a propensity to home to the gut to clear the infection would be induced. In health, there is such a sophisticated and finely tuned system in operation, enabling an appropriate balance of immune activity in different anatomical compartments. In disease states such as inflammatory bowel disease (IBD), which is characterized by intestinal inflammation and often an inflammatory process involving other organs such as skin, joints, liver, and eye, there is accumulating evidence that there is malfunction of this immune cell trafficking system. The clinical importance of dysregulated immune cell trafficking in IBD is reflected in recently proven efficacious therapies that target trafficking pathways such as natalizumab, an α4 integrin antibody, and Traficet-EN, a chemokine receptor-9 (CCR9) antagonist. Here we review the mechanisms involved in the homing of immune cells to different tissues, in particular the intestine, and focus on alterations in immune cell homing pathways in IBD. Unraveling the mechanisms underlying the immune post-code system would assist in achieving the goal of tissue-specific immunotherapy.

  5. Antimicrobial anxiety: the impact of stress on antimicrobial immunity

    PubMed Central

    Radek, Katherine A.

    2010-01-01

    Leukocytes and epithelial cells are fundamental to antimicrobial immunity. Their antimicrobial responses are an evolutionarily conserved component of the innate immune system and are influenced by the host’s response to external stimuli. The efficacy of host defense via antimicrobial responses derives from the ability of AMPs to rapidly identify and eradicate foreign microbes and activate proinflammatory pathways, and from the capacity of later innate and adaptive immune responses to amplify protection through distinct biochemical mechanisms. Recent advances in neuroimmunology have identified a direct link between the neuroendocrine and immune systems, where environmental stimuli are generally believed to promote a transient effect on the immune system in response to environmental challenges and are presumably brought back to baseline levels via neuroendocrine pathways. Stress is an environmental stimulus that flares from a variety of circumstances and has become engrained in human society. Small bouts of stress are believed to enhance the host’s immune response; however, prolonged periods of stress can be detrimental through excess production of neuroendocrine-derived mediators that dampen immune responses to invasive pathogens. Elucidation of the mechanisms behind stress-induced immune modulation of antimicrobial responses will ultimately lead to the development of more effective therapeutic interventions for pathologic conditions. It is the intent of this review to broaden the existing paradigm of how stress-related molecules dampen immune responses through suppression of antimicrobial mechanisms, and to emphasize that bacteria can use these factors to enhance microbial pathogenesis during stress. PMID:20442225

  6. Multielement trace determination in SiC powders: assessment of interlaboratory comparisons aimed at the validation and standardization of analytical procedures with direct solid sampling based on ETV ICP OES and DC arc OES.

    PubMed

    Matschat, Ralf; Hassler, Jürgen; Traub, Heike; Dette, Angelika

    2005-12-01

    The members of the committee NMP 264 "Chemical analysis of non-oxidic raw and basic materials" of the German Standards Institute (DIN) have organized two interlaboratory comparisons for multielement determination of trace elements in silicon carbide (SiC) powders via direct solid sampling methods. One of the interlaboratory comparisons was based on the application of inductively coupled plasma optical emission spectrometry with electrothermal vaporization (ETV ICP OES), and the other on the application of optical emission spectrometry with direct current arc (DC arc OES). The interlaboratory comparisons were organized and performed in the framework of the development of two standards related to "the determination of mass fractions of metallic impurities in powders and grain sizes of ceramic raw and basic materials" by both methods. SiC powders were used as typical examples of this category of material. The aim of the interlaboratory comparisons was to determine the repeatability and reproducibility of both analytical methods to be standardized. This was an important contribution to the practical applicability of both draft standards. Eight laboratories participated in the interlaboratory comparison with ETV ICP OES and nine in the interlaboratory comparison with DC arc OES. Ten analytes were investigated by ETV ICP OES and eleven by DC arc OES. Six different SiC powders were used for the calibration. The mass fractions of their relevant trace elements were determined after wet chemical digestion. All participants followed the analytical requirements described in the draft standards. In the calculation process, three of the calibration materials were used successively as analytical samples. This was managed in the following manner: the material that had just been used as the analytical sample was excluded from the calibration, so the five other materials were used to establish the calibration plot. The results from the interlaboratory comparisons were summarized and

  7. Structured programming: Principles, notation, procedure

    NASA Technical Reports Server (NTRS)

    JOST

    1978-01-01

    Structured programs are best represented using a notation which gives a clear representation of the block encapsulation. In this report, a set of symbols which can be used until binding directives are republished is suggested. Structured programming also allows a new method of procedure for design and testing. Programs can be designed top down, that is, they can start at the highest program plane and can penetrate to the lowest plane by step-wise refinements. The testing methodology also is adapted to this procedure. First, the highest program plane is tested, and the programs which are not yet finished in the next lower plane are represented by so-called dummies. They are gradually replaced by the real programs.

  8. Right ventricular systolic pressure measurements in combination with harvest of lung and immune tissue samples in mice.

    PubMed

    Chen, Wen-Chi; Park, Sung-Hyun; Hoffman, Carol; Philip, Cecil; Robinson, Linda; West, James; Grunig, Gabriele

    2013-01-16

    The function of the right heart is to pump blood through the lungs, thus linking right heart physiology and pulmonary vascular physiology. Inflammation is a common modifier of heart and lung function, by elaborating cellular infiltration, production of cytokines and growth factors, and by initiating remodeling processes. Compared to the left ventricle, the right ventricle is a low-pressure pump that operates in a relatively narrow zone of pressure changes. Increased pulmonary artery pressures are associated with increased pressure in the lung vascular bed and pulmonary hypertension. Pulmonary hypertension is often associated with inflammatory lung diseases, for example chronic obstructive pulmonary disease, or autoimmune diseases. Because pulmonary hypertension confers a bad prognosis for quality of life and life expectancy, much research is directed towards understanding the mechanisms that might be targets for pharmaceutical intervention. The main challenge for the development of effective management tools for pulmonary hypertension remains the complexity of the simultaneous understanding of molecular and cellular changes in the right heart, the lungs and the immune system. Here, we present a procedural workflow for the rapid and precise measurement of pressure changes in the right heart of mice and the simultaneous harvest of samples from heart, lungs and immune tissues. The method is based on the direct catheterization of the right ventricle via the jugular vein in close-chested mice, first developed in the late 1990s as surrogate measure of pressures in the pulmonary artery. The organized team-approach facilitates a very rapid right heart catheterization technique. This makes it possible to perform the measurements in mice that spontaneously breathe room air. The organization of the work-flow in distinct work-areas reduces time delay and opens the possibility to simultaneously perform physiology experiments and harvest immune, heart and lung tissues. The

  9. Parent Knowledge and Attitudes About School-Based Hepatitis B Immunization Programs.

    ERIC Educational Resources Information Center

    Middleman, Amy B.; Guajardo, Andrea D.; Sunwoo, Edward; Sansaricq, Kim M.

    2002-01-01

    Surveyed parents of students in the Houston Independent School District to determine preferences regarding immunization clinic site and preferred consent procedures for a Hepatitis B immunization program. Results indicated a significant lack of parent knowledge regarding the Hepatitis B virus. Demographic variables influenced parents' knowledge…

  10. Immune anticipation of mating in Drosophila: Turandot M promotes immunity against sexually transmitted fungal infections.

    PubMed

    Zhong, Weihao; McClure, Colin D; Evans, Cara R; Mlynski, David T; Immonen, Elina; Ritchie, Michael G; Priest, Nicholas K

    2013-12-22

    Although it is well known that mating increases the risk of infection, we do not know how females mitigate the fitness costs of sexually transmitted infections (STIs). It has recently been shown that female fruitflies, Drosophila melanogaster, specifically upregulate two members of the Turandot family of immune and stress response genes, Turandot M and Turandot C (TotM and TotC), when they hear male courtship song. Here, we use the Gal4/UAS RNAi gene knockdown system to test whether the expression of these genes provides fitness benefits for females infected with the entomopathogenic fungus, Metarhizium robertsii under sexual transmission. As a control, we also examined the immunity conferred by Dorsal-related immunity factor (Dif), a central component of the Toll signalling pathway thought to provide immunity against fungal infections. We show that TotM, but not TotC or Dif, provides survival benefits to females following STIs, but not after direct topical infections. We also show that though the expression of TotM provides fecundity benefits for healthy females, it comes at a cost to their survival, which helps to explain why TotM is not constitutively expressed. Together, these results show that the anticipatory expression of TotM promotes specific immunity against fungal STIs and suggest that immune anticipation is more common than currently appreciated.

  11. Immune anticipation of mating in Drosophila: Turandot M promotes immunity against sexually transmitted fungal infections

    PubMed Central

    Zhong, Weihao; McClure, Colin D.; Evans, Cara R.; Mlynski, David T.; Immonen, Elina; Ritchie, Michael G.; Priest, Nicholas K.

    2013-01-01

    Although it is well known that mating increases the risk of infection, we do not know how females mitigate the fitness costs of sexually transmitted infections (STIs). It has recently been shown that female fruitflies, Drosophila melanogaster, specifically upregulate two members of the Turandot family of immune and stress response genes, Turandot M and Turandot C (TotM and TotC), when they hear male courtship song. Here, we use the Gal4/UAS RNAi gene knockdown system to test whether the expression of these genes provides fitness benefits for females infected with the entomopathogenic fungus, Metarhizium robertsii under sexual transmission. As a control, we also examined the immunity conferred by Dorsal-related immunity factor (Dif), a central component of the Toll signalling pathway thought to provide immunity against fungal infections. We show that TotM, but not TotC or Dif, provides survival benefits to females following STIs, but not after direct topical infections. We also show that though the expression of TotM provides fecundity benefits for healthy females, it comes at a cost to their survival, which helps to explain why TotM is not constitutively expressed. Together, these results show that the anticipatory expression of TotM promotes specific immunity against fungal STIs and suggest that immune anticipation is more common than currently appreciated. PMID:24174107

  12. Imprime PGG-Mediated Anti-Cancer Immune Activation Requires Immune Complex Formation

    PubMed Central

    Qiu, Xiaohong; Ottoson, Nadine R.; Walsh, Richard M.; Gorden, Keith B; Harrison, Ben; Maimonis, Peter J.; Leonardo, Steven M.; Ertelt, Kathleen E.; Danielson, Michael E.; Michel, Kyle S.; Nelson, Mariana; Graff, Jeremy R.; Patchen, Myra L.; Bose, Nandita

    2016-01-01

    Imprime PGG (Imprime), an intravenously-administered, soluble β-glucan, has shown compelling efficacy in multiple phase 2 clinical trials with tumor targeting or anti-angiogenic antibodies. Mechanistically, Imprime acts as pathogen-associated molecular pattern (PAMP) directly activating innate immune effector cells, triggering a coordinated anti-cancer immune response. Herein, using whole blood from healthy human subjects, we show that Imprime-induced anti-cancer functionality is dependent on immune complex formation with naturally-occurring, anti-β glucan antibodies (ABA). The formation of Imprime-ABA complexes activates complement, primarily via the classical complement pathway, and is opsonized by iC3b. Immune complex binding depends upon Complement Receptor 3 and Fcg Receptor IIa, eliciting phenotypic activation of, and enhanced chemokine production by, neutrophils and monocytes, enabling these effector cells to kill antibody-opsonized tumor cells via the generation of reactive oxygen species and antibody-dependent cellular phagocytosis. Importantly, these innate immune cell changes were not evident in subjects with low ABA levels but could be rescued with exogenous ABA supplementation. Together, these data indicate that pre-existing ABA are essential for Imprime-mediated anti-cancer immune activation and suggest that pre-treatment ABA levels may provide a plausible patient selection biomarker to delineate patients most likely to benefit from Imprime-based therapy. PMID:27812183

  13. Directional excitation without breaking reciprocity

    NASA Astrophysics Data System (ADS)

    Ramezani, Hamidreza; Dubois, Marc; Wang, Yuan; Shen, Y. Ron; Zhang, Xiang

    2016-09-01

    We propose a mechanism for directional excitation without breaking reciprocity. This is achieved by embedding an impedance matched parity-time symmetric potential in a three-port system. The amplitude distribution within the gain and loss regions is strongly influenced by the direction of the incoming field. Consequently, the excitation of the third port is contingent on the direction of incidence while transmission in the main channel is immune. Our design improves the four-port directional coupler scheme, as there is no need to implement an anechoic termination to one of the ports.

  14. Bed rest and immunity

    NASA Astrophysics Data System (ADS)

    Sonnenfeld, Gerald; Aviles, Hernan; Butel, Janet S.; Shearer, William T.; Niesel, David; Pandya, Utpal; Allen, Christopher; Ochs, Hans D.; Blancher, Antoine; Abbal, Michel

    2007-02-01

    Space flight has been shown to result in altered immune responses. The current study was designed to investigate this possibility by using the bed rest model of some space flight conditions. A large number of women are included as subjects in the study. The hypothesis being tested is: 60 days head-down tilt bed rest of humans will affect the immune system and resistance to infection. Blood, urine and saliva samples will be obtained from bed rest subjects prior to, at intervals during, and after completion of 60 days of head-down tilt bed rest. Leukocyte blastogenesis, cytokine production and virus reactivation will be assessed. The ability of the subjects to respond appropriately to immunization with the neoantigen bacteriophage φX-174 will also be determined. Bed rest is being carried out at MEDES, Toulouse France, and the University of Texas Medical Branch, Galveston, TX. The studies to be carried out in France will also allow assessment of the effects of muscle/bone exercise and nutritional countermeasures on the immune system in addition to the effects of bed rest.

  15. Increasing Immunization Compliance

    ERIC Educational Resources Information Center

    Toole, Kimberly; Perry, Cynthia S.

    2004-01-01

    School nurses often have the responsibility to ensure that students meet all immunization requirements for school entry and school attendance. In large inner-city school districts, many obstacles exist which make this task daunting and often result in lengthy absences and exclusions for students. It is critical that school nurses find creative and…

  16. Neurologic complications of immunizations.

    PubMed

    Rutledge, S L; Snead, O C

    1986-12-01

    Although there does appear to be at least a temporal relationship between pertussis immunization and serious acute neurologic illness, data to suggest that children with stable preexisting neurologic disease or positive family history of neurologic disease are at increased risk for complications of pertussis immunizations are inconclusive. Furthermore, there are no firm statistical data concerning the incidence of pertussis vaccine-related encephalopathy. Rather, the literature on pertussis vaccine complications is replete with anecdotal reports and retrospective studies with a number of questionable conclusions drawn from this inadequate data base. Unfortunately, these conclusions have been sensationalized and exploited with litigious fervor to the point that the practice of pertussis immunization is being questioned in the United States. A number of points should be reiterated: pertussis is a dangerous and deadly disease, as seen in the epidemic in Great Britain; pertussis immunization is effective in protecting against the disease; and there is no conclusive proof that the incidence of complications from pertussis vaccination of children with seizure disorders or other preexisting stable neurologic abnormalities is higher, because appropriate studies have not been done to define such a risk. We would do well to keep these facts in mind in order to avoid a disaster similar to the pertussis epidemic in Great Britain. Pertussis vaccination should be given to all children except those with allergic hypersensitivity, a progressive neurologic disorder, or an adverse reaction to a previous pertussis dose.

  17. Lipids and immune function.

    PubMed

    Vitale, J J; Broitman, S A

    1981-09-01

    There is in vitro and in vivo evidence to suggest that dietary lipids play a role in modulating immune function. A review of the current literature on the interrelationships among dietary lipids, blood cholesterol levels, immunosuppression, and tumorigenesis makes for a very strong argument that (a) immunosuppression may be causally related to lymphoproliferative disorders, as well as to tumorigenesis and (b) diets high in polyunsaturated fat, relative to diets high in saturated fat, are more immunosuppressive and are better promotors of tumorigenesis. The effects of dietary fat on immune function seem to be mediated though its component parts, the unsaturated fatty acids, specially linoleic, linolenic, and arachidonic. It is not clear how these components affect immune function. Several studies suggest that one effect is mediated by altering the lipid component of the cell membrane and thus its fluidity; the more fluid the membrane, the less responsive it is. Thus, fluidity of both immune cells and those to be destroyed or protected may be affected. The effects of saturated as well as unsaturated fatty acids may be mediated by modulating serum lipoprotein levels, prostaglandin metabolism, and cholesterol concentrations and metabolism.

  18. Photodynamic immune modulation (PIM)

    NASA Astrophysics Data System (ADS)

    North, John R.; Hunt, David W. C.; Simkin, Guillermo O.; Ratkay, Leslie G.; Chan, Agnes H.; Lui, Harvey; Levy, Julia G.

    1999-09-01

    Photodynamic Therapy (PDT) is accepted for treatment of superficial and lumen-occluding tumors in regions accessible to activating light and is now known to be effective in closure of choroidal neovasculature in Age Related Macular Degeneration. PDT utilizes light absorbing drugs (photosensitizers) that generate the localized formation of reactive oxygen species after light exposure. In a number of systems, PDT has immunomodulatory effects; Photodynamic Immune Modulation (PIM). Using low- intensity photodynamic regimens applied over a large body surface area, progression of mouse autoimmune disease could be inhibited. Further, this treatment strongly inhibited the immunologically- medicated contact hypersensitivity response to topically applied chemical haptens. Immune modulation appears to result from selective targeting of activated T lymphocytes and reduction in immunostimulation by antigen presenting cells. Psoriasis, an immune-mediated skin condition, exhibits heightened epidermal cell proliferation, epidermal layer thickening and plaque formation at different body sites. In a recent clinical trial, approximately one-third of patients with psoriasis and arthritis symptoms (psoriatic arthritis) displayed a significant clinical improvement in several psoriasis-related parameters after four weekly whole-body PIM treatments with verteporfin. The safety profile was favorable. The capacity of PIM to influence other human immune disorders including rheumatoid arthritis is under extensive evaluation.

  19. Immunity to brucellosis.

    PubMed

    Skendros, P; Boura, P

    2013-04-01

    Resistance to intracellular bacterial pathogens such as Brucella spp. relies on cell-mediated immunity, which involves activation of the bactericidal mechanisms of antigen-presenting cells (macrophages and dendritic cells) and the subsequent expansion of antigen-specific CD4+ and CD8+ T-cell clones. Brucella antigens induce the production of T helper type 1 (Th1) cytokines, and an adequate Th1 immune response is critical for the clearance of Brucella infection. Studies on experimental and human brucellosis indicate that interferon-gamma (IFNgamma) is the principal cytokine active against Brucella infection. On the other hand, Brucella has evolutionarily developed diverse evasion strategies to avoid the host's innate and adaptive immunity in order to establish an intracellular niche for long-term parasitism. Disturbances of the Thl response and anergy have been described in patients with chronic brucellosis, and are associated with poor outcome. Accordingly, chronic brucellosis represents a challenge for the study of immune mechanisms against Brucella and the development of novel therapeutic or vaccination approaches.

  20. Auto immune hepatitis.

    PubMed

    van Gerven, Nicole Mf; de Boer, Ynto S; Mulder, Chris Jj; van Nieuwkerk, Carin Mj; Bouma, Gerd

    2016-05-21

    To provide an update of the latest trends in epidemiology, clinical course, diagnostics, complications and treatment of auto immune hepatitis (AIH). A search of the MEDLINE database was performed using the search terms: "auto immune hepatitis", "clinical presentation", "symptoms", "signs", "diagnosis", "auto antibodies", "laboratory values", "serology", "histopathology", "histology", "genetics", "HLA genes", "non-HLA genes", "environment", "epidemiology", "prevalence", "incidence", "demographics", "complications", "HCC", "PBC", "PSC", "corticosteroid", "therapy", "treatment", "alternative treatment". English-language full-text articles and abstracts were considered. Articles included reviews, meta-analysis, prospective retrospective studies. No publication date restrictions were applied. AIH is an immune meditated progressive inflammatory liver disease that predominantly affects middle-aged females but may affect people of all ages. The clinical spectrum of AIH is wide, ranging from absent or mild symptoms to fulminant hepatic failure. The aetiology of AIH is still unknown, but is believed to occur as the consequence of an aberrant immune response towards an un-known trigger in a genetically susceptible host. In the absence of a gold standard, diagnosis is based on the combination of clinical, biochemical and histopathological criteria. Immunosuppressive treatment has been the cornerstone of treatment since the earliest description of the disease in 1950 by Waldenström. Such treatment is often successful at inducing remission and generally leads to normal life expectancy. Nevertheless, there remain significant areas of unmet aetiological a clinical needs including fundamental insight in disease pathogenesis, optimal therapy, duration of treatment and treatment alternatives in those patients unresponsive to standard treatment regimens.

  1. Safeguards management inspection procedures

    SciTech Connect

    Barth, M.J.; Dunn, D.R.

    1984-08-01

    The objective of this inspection module is to independently assess the contributions of licensee management to overall safeguards systems performance. The inspector accomplishes this objective by comparing the licensee's safeguards management to both the 10 CFR, parts 70 and 73, requirements and to generally accepted management practices. The vehicle by which this comparison is to be made consists of assessment questions and key issues which point the inspector to areas of primary concern to the NRC and which raise additional issues for the purpose of exposing management ineffectiveness. Further insight into management effectiveness is obtained through those assessment questions specifically directed toward the licensee's safeguards system performance. If the quality of the safeguards is poor, then the inspector should strongly suspect that management's role is ineffective and should attempt to determine management's influence (or lack thereof) on the underlying safeguards deficiencies. (The converse is not necessarily true, however.) The assessment questions in essence provide an opportunity for the inspector to identify, to single out, and to probe further, questionable management practices. Specific issues, circumstances, and concerns which point to questionable or inappropriate practices should be explicitly identified and referenced against the CFR and the assessment questions. The inspection report should also explain why the inspector feels certain management practices are poor, counter to the CFR, and/or point to ineffecive management. Concurrent with documenting the inspection results, the inspector should provide recommendations for alleviating observed management practices that are detrimental to effective safeguards. The recommendations could include: specific changes in the practices of the licensee, followup procedures on the part of NRC, and proposed license changes.

  2. Oral innate immunity in HIV infection in HAART era

    PubMed Central

    Nittayananta, Wipawee; Tao, Renchuan; Jiang, Lanlan; Peng, Yuanyuan; Huang, Yuxiao

    2015-01-01

    Oral innate immunity, an important component in host defense and immune surveillance in the oral cavity, plays a crucial role in the regulation of oral health. As part of the innate immune system, epithelial cells lining oral mucosal surfaces provide not only a physical barrier but also produce different antimicrobial peptides, including human β-defensins (hBDs), secretory leukocyte protease inhibitor (SLPI), and various cytokines. These innate immune mediators help in maintaining oral homeostasis. When they are impaired either by local or systemic causes, various oral infections and malignancies may be developed. Human immunodeficiency virus (HIV) infection and other co-infections appear to have both direct and indirect effects on systemic and local innate immunity leading to the development of oral opportunistic infections and malignancies. Highly active antiretroviral therapy (HAART), the standard treatment of HIV infection contributed to a global reduction of HIV-associated oral lesions. However, prolonged treatment by HAART may lead to adverse effects on the oral innate immunity resulting in the relapse of oral lesions. This review article focused on the roles of oral innate immunity in HIV infection in HAART era. The following five key questions were addressed: 1) What are the roles of oral innate immunity in health and disease?, 2) What are the effects of HIV infection on oral innate immunity?, 3) What are the roles of oral innate immunity against other co-infections?, 4) What are the effects of HAART on oral innate immunity?, and 5) Is oral innate immunity enhanced by HAART? PMID:25639844

  3. 32 CFR 989.37 - Procedures for analysis abroad.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 32 National Defense 6 2011-07-01 2011-07-01 false Procedures for analysis abroad. 989.37 Section... PROTECTION ENVIRONMENTAL IMPACT ANALYSIS PROCESS (EIAP) § 989.37 Procedures for analysis abroad. Procedures for analysis of environmental actions abroad are contained in 32 CFR part 187. That directive...

  4. 32 CFR 989.37 - Procedures for analysis abroad.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... PROTECTION ENVIRONMENTAL IMPACT ANALYSIS PROCESS (EIAP) § 989.37 Procedures for analysis abroad. Procedures for analysis of environmental actions abroad are contained in 32 CFR Part 187. That directive provides... 32 National Defense 6 2010-07-01 2010-07-01 false Procedures for analysis abroad. 989.37...

  5. Increasing immunization coverage.

    PubMed

    Hammer, Lawrence D; Curry, Edward S; Harlor, Allen D; Laughlin, James J; Leeds, Andrea J; Lessin, Herschel R; Rodgers, Chadwick T; Granado-Villar, Deise C; Brown, Jeffrey M; Cotton, William H; Gaines, Beverly Marie Madry; Gambon, Thresia B; Gitterman, Benjamin A; Gorski, Peter A; Kraft, Colleen A; Marino, Ronald Vincent; Paz-Soldan, Gonzalo J; Zind, Barbara

    2010-06-01

    In 1977, the American Academy of Pediatrics issued a statement calling for universal immunization of all children for whom vaccines are not contraindicated. In 1995, the policy statement "Implementation of the Immunization Policy" was published by the American Academy of Pediatrics, followed in 2003 with publication of the first version of this statement, "Increasing Immunization Coverage." Since 2003, there have continued to be improvements in immunization coverage, with progress toward meeting the goals set forth in Healthy People 2010. Data from the 2007 National Immunization Survey showed that 90% of children 19 to 35 months of age have received recommended doses of each of the following vaccines: inactivated poliovirus (IPV), measles-mumps-rubella (MMR), varicella-zoster virus (VZB), hepatitis B virus (HBV), and Haemophilus influenzae type b (Hib). For diphtheria and tetanus and acellular pertussis (DTaP) vaccine, 84.5% have received the recommended 4 doses by 35 months of age. Nevertheless, the Healthy People 2010 goal of at least 80% coverage for the full series (at least 4 doses of DTaP, 3 doses of IPV, 1 dose of MMR, 3 doses of Hib, 3 doses of HBV, and 1 dose of varicella-zoster virus vaccine) has not yet been met, and immunization coverage of adolescents continues to lag behind the goals set forth in Healthy People 2010. Despite these encouraging data, a vast number of new challenges that threaten continued success toward the goal of universal immunization coverage have emerged. These challenges include an increase in new vaccines and new vaccine combinations as well as a significant number of vaccines currently under development; a dramatic increase in the acquisition cost of vaccines, coupled with a lack of adequate payment to practitioners to buy and administer vaccines; unanticipated manufacturing and delivery problems that have caused significant shortages of various vaccine products; and the rise of a public antivaccination movement that uses the

  6. Objective procedures for lineament enhancement and extraction

    USGS Publications Warehouse

    Moore, G.K.; Waltz, F.A.

    1983-01-01

    A longterm research goal at EROS Data Center is to develop automated, objective procedures for lineament mapping. In support of this goal, a five-step digital convolution procedure has been used to produce directionally enhanced images, which contain few artifacts and little noise. The main limitation of this procedure is that little enhancement of lineaments occurs in dissected terrain, in shadowed areas, and in flat areas with a uniform land cover. The directional enhancement procedure can be modified to extract edge and line segments from an image. Any of various decision rules can then be used to connect the line segments and to produce a final lineament map. The result is an interpretive map, but one that is based on an objective extraction of lineament components by digital processing. -from Authors

  7. Evolutionary responses of innate Immunity to adaptive immunity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Innate immunity is present in all metazoans, whereas the evolutionarily more novel adaptive immunity is limited to jawed fishes and their descendants (gnathostomes). We observe that the organisms that possess adaptive immunity lack diversity in their innate pattern recognition receptors (PRRs), rais...

  8. Procedural Learning and Dyslexia

    ERIC Educational Resources Information Center

    Nicolson, R. I.; Fawcett, A. J.; Brookes, R. L.; Needle, J.

    2010-01-01

    Three major "neural systems", specialized for different types of information processing, are the sensory, declarative, and procedural systems. It has been proposed ("Trends Neurosci.",30(4), 135-141) that dyslexia may be attributable to impaired function in the procedural system together with intact declarative function. We provide a brief…

  9. Enucleation Procedure Manual.

    ERIC Educational Resources Information Center

    Davis, Kevin; Poston, George

    This manual provides information on the enucleation procedure (removal of the eyes for organ banks). An introductory section focuses on the anatomy of the eye and defines each of the parts. Diagrams of the eye are provided. A list of enucleation materials follows. Other sections present outlines of (1) a sterile procedure; (2) preparation for eye…

  10. Connectionist Learning Procedures.

    ERIC Educational Resources Information Center

    Hinton, Geoffrey E.

    A major goal of research on networks of neuron-like processing units is to discover efficient learning procedures that allow these networks to construct complex internal representations of their environment. The learning procedures must be capable of modifying the connection strengths in such a way that internal units which are not part of the…

  11. ACTIVE IMMUNITY PRODUCED BY SO CALLED BALANCED OR NEUTRAL MIXTURES OF DIPHTHERIA TOXIN AND ANTITOXIN.

    PubMed

    Smith, T

    1909-03-01

    The foregoing and earlier data taken together demonstrate that an active immunity lasting several years can be produced in guinea-pigs, by the injection of toxin-antitoxin mixtures which have no recognizable harmful effect either immediate or remote. They also show, what might have been anticipated, that under the same conditions mixtures which produce local lesions and which, therefore, contain an excess of toxin produce a much higher degree of immunity than the neutral mixtures, and that an excess of antitoxin reduces the possibility of producing an active immunity, and may extinguish it altogether. There is, therefore, a certain definite relation between the components of the mixture and the degree of immunity producible. Furthermore, toxin-antitoxin mixtures do not change materially within five days at room temperature. They are apparently more efficacious at the end of forty-eight hours than immediately after preparation. The experiments finally prove that a relatively high degree of active immunity can be induced by a harmless procedure, whereas the use of toxin alone leading to very severe local lesions is incapable of producing more than an insignificant protection. The method, therefore, invites further tests in regard to its ultimate applicability to the human being. Unless the subcutis of the guinea-pig reacts to toxin-antitoxin mixtures in a manner peculiar to itself, a practical, easily controlled method for active immunization can be worked out which should afford a larger protection than the serum alone and avoid the complications associated with horse serum. That proportion of toxin and antitoxin which would produce the highest desirable immunity consistent with the least discomfort would have to be carefully worked out for the human subject. From the nature of the immunity induced it is obvious, however, that such a method of immunization cannot take the place of a large dose of antitoxin in exposed individuals who must be protected at once. It

  12. Electrical screening procedure for solid ionic conductors

    NASA Technical Reports Server (NTRS)

    Kautz, H. E.; Singer, J.; Fielder, W. L.; Fordyce, J. S.

    1973-01-01

    An electrical screening method has been developed for preliminary evaluation of polycrystalline specimens of candidates for use as solid ionic conductive electrolytes in batteries. The procedure measures dielectric loss and capacitance, from which are calculated an ac conductivity attributed provisionally to ions and an activation energy for that conductivity. Electronic conductivity is directly measured. The screening procedure applied to sodium beta-alumina yielded acceptable values for conductivity and activation energy.

  13. Effective immunization of lambs against enterotoxaemia.

    PubMed

    Cameron, C M

    1980-12-01

    In contrast to adult sheep, 2- to 3-month-old lambs do not respond well to a single injection of Clostridium perfringens Type D oil adjuvant epsilon toxoid. This unresponsiveness can be overcome, however, by administering 2 injections of oil adjuvant vaccine or one injection of oil adjuvant followed 4 weeks later by an injection of alum-precipitated toxoid. The latter procedure evokes protective antitoxin levels which persist for 8 months, and a booster injection of alum-precipitated toxoid given at this stage results in an immunity which lasts for at least 1 year.

  14. Innate immune memory in plants.

    PubMed

    Reimer-Michalski, Eva-Maria; Conrath, Uwe

    2016-08-01

    The plant innate immune system comprises local and systemic immune responses. Systemic plant immunity develops after foliar infection by microbial pathogens, upon root colonization by certain microbes, or in response to physical injury. The systemic plant immune response to localized foliar infection is associated with elevated levels of pattern-recognition receptors, accumulation of dormant signaling enzymes, and alterations in chromatin state. Together, these systemic responses provide a memory to the initial infection by priming the remote leaves for enhanced defense and immunity to reinfection. The plant innate immune system thus builds immunological memory by utilizing mechanisms and components that are similar to those employed in the trained innate immune response of jawed vertebrates. Therefore, there seems to be conservation, or convergence, in the evolution of innate immune memory in plants and vertebrates.

  15. Overview of the Immune System

    MedlinePlus

    ... in the bone marrow is the precursor to innate immune cells—neutrophils, eosinophils, basophils, mast cells, monocytes, ... common lymphoid progenitor and share features of both innate and adaptive immune cells, as they provide immediate ...

  16. Bridging innate and adaptive immunity.

    PubMed

    Paul, William E

    2011-12-09

    The Nobel Prize in Physiology or Medicine for 2011 to Jules Hoffmann, Bruce Beutler, and the late Ralph Steinman recognizes accomplishments in understanding and unifying the two strands of immunology, the evolutionarily ancient innate immune response and modern adaptive immunity.

  17. Stress, age, and immune function: toward a lifespan approach.

    PubMed

    Graham, Jennifer E; Christian, Lisa M; Kiecolt-Glaser, Janice K

    2006-08-01

    Both aging processes and psychological stress affect the immune system: Each can dysregulate immune function with a potentially substantial impact on physical health. Worse, the effects of stress and age are interactive. Psychological stress can both mimic and exacerbate the effects of aging, with older adults often showing greater immunological impairment to stress than younger adults. In addition, stressful experiences very early in life can alter the responsiveness of the nervous system and immune system. We review the unique impact of aging and stress on immune function, followed by evidence of interactions between age and stress. Further, we suggest that prenatal or early life stress may increase the likelihood of maladaptive immune responses to stress in late life. An understanding of the interactive effects of stress and age is critical to efforts to determine underlying mechanisms, clarify the directionality of effects, and develop effective interventions in early and late life.

  18. Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease

    NASA Astrophysics Data System (ADS)

    Sun, Jun; Earl, David J.; Deem, Michael W.

    2005-09-01

    The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self-antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely, gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system’s search for antibodies, a balance has evolved between binding affinity and specificity.

  19. Stress, Age, and Immune Function: Toward a Lifespan Approach

    PubMed Central

    Graham, Jennifer E.; Christian, Lisa M.; Kiecolt-Glaser, Janice K.

    2009-01-01

    Both aging processes and psychological stress affect the immune system: Each can dysregulate immune function with a potentially substantial impact on physical health. Worse, the effects of stress and age are interactive. Psychological stress can both mimic and exacerbate the effects of aging, with older adults often showing greater immunological impairment to stress than younger adults. In addition, stressful experiences very early in life can alter the responsiveness of the nervous system and immune system. We review the unique impact of aging and stress on immune function, followed by evidence of interactions between age and stress. Further, we suggest that prenatal or early life stress may increase the likelihood of maladaptive immune responses to stress in late life. An understanding of the interactive effects of stress and age is critical to efforts to determine underlying mechanisms, clarify the directionality of effects, and develop effective interventions in early and late life. PMID:16715331

  20. miRNA-124 in Immune System and Immune Disorders

    PubMed Central

    Qin, Zhen; Wang, Peng-Yuan; Su, Ding-Feng; Liu, Xia

    2016-01-01

    In recent years, miR-124 has emerged as a critical modulator of immunity and inflammation. Here, we summarize studies on the function and mechanism of miR-124 in the immune system and immunity-related diseases. They indicated that miR-124 exerts a crucial role in the development of immune system, regulation of immune responses, and inflammatory disorders. It is evident that miR-124 may serve as an informative diagnostic biomarker and therapeutic target in the future. PMID:27757114

  1. Adaptive immune resistance: How cancer protects from immune attack

    PubMed Central

    Ribas, Antoni

    2015-01-01

    Adaptive immune resistance is a process where the cancer changes its phenotype in response to a cytotoxic or pro-inflammatory immune response, thereby evading it. This adaptive process is triggered by the specific recognition of cancer cells by T cells, which leads to the production of immune-activating cytokines. Cancers then hijack mechanisms developed to limit inflammatory and immune responses and protect themselves from the T cell attack. Inhibiting adaptive immune resistance is the mechanistic basis of responses to PD-1 or PD-L1 blocking antibodies, and may be of relevance for the development of other cancer immunotherapy strategies. PMID:26272491

  2. Direct Field Acoustic Testing

    NASA Technical Reports Server (NTRS)

    Larkin, Paul; Goldstein, Bob

    2008-01-01

    This paper presents an update to the methods and procedures used in Direct Field Acoustic Testing (DFAT). The paper will discuss some of the recent techniques and developments that are currently being used and the future publication of a reference standard. Acoustic testing using commercial sound system components is becoming a popular and cost effective way of generating a required acoustic test environment both in and out of a reverberant chamber. This paper will present the DFAT test method, the usual setup and procedure and the development and use of a closed-loop, narrow-band control system. Narrow-band control of the acoustic PSD allows all standard techniques and procedures currently used in random control to be applied to acoustics and some examples are given. The paper will conclude with a summary of the development of a standard practice guideline that is hoped to be available in the first quarter of next year.

  3. Minimally invasive procedures

    PubMed Central

    Baltayiannis, Nikolaos; Michail, Chandrinos; Lazaridis, George; Anagnostopoulos, Dimitrios; Baka, Sofia; Mpoukovinas, Ioannis; Karavasilis, Vasilis; Lampaki, Sofia; Papaiwannou, Antonis; Karavergou, Anastasia; Kioumis, Ioannis; Pitsiou, Georgia; Katsikogiannis, Nikolaos; Tsakiridis, Kosmas; Rapti, Aggeliki; Trakada, Georgia; Zissimopoulos, Athanasios; Zarogoulidis, Konstantinos

    2015-01-01

    Minimally invasive procedures, which include laparoscopic surgery, use state-of-the-art technology to reduce the damage to human tissue when performing surgery. Minimally invasive procedures require small “ports” from which the surgeon inserts thin tubes called trocars. Carbon dioxide gas may be used to inflate the area, creating a space between the internal organs and the skin. Then a miniature camera (usually a laparoscope or endoscope) is placed through one of the trocars so the surgical team can view the procedure as a magnified image on video monitors in the operating room. Specialized equipment is inserted through the trocars based on the type of surgery. There are some advanced minimally invasive surgical procedures that can be performed almost exclusively through a single point of entry—meaning only one small incision, like the “uniport” video-assisted thoracoscopic surgery (VATS). Not only do these procedures usually provide equivalent outcomes to traditional “open” surgery (which sometimes require a large incision), but minimally invasive procedures (using small incisions) may offer significant benefits as well: (I) faster recovery; (II) the patient remains for less days hospitalized; (III) less scarring and (IV) less pain. In our current mini review we will present the minimally invasive procedures for thoracic surgery. PMID:25861610

  4. Immunization strategies against henipaviruses.

    PubMed

    Broder, Christopher C; Geisbert, Thomas W; Xu, Kai; Nikolov, Dimitar B; Wang, Lin-Fa; Middleton, Deborah; Pallister, Jackie; Bossart, Katharine N

    2012-01-01

    Hendra virus and Nipah virus are recently discovered and closely related emerging viruses that now comprise the genus henipavirus within the sub-family Paramyxoviridae and are distinguished by their broad species tropism and in addition to bats can infect and cause fatal disease in a wide variety of mammalian hosts including humans. The high mortality associated with human and animal henipavirus infections has highlighted the importance and necessity of developing effective immunization strategies. The development of suitable animal models of henipavirus infection and pathogenesis has been critical for testing the efficacy of potential therapeutic approaches. Several henipavirus challenge models have been used and recent successes in both active and passive immunization strategies against henipaviruses have been reported which have all targeted the viral envelope glycoproteins.

  5. Epigenetics meets immune checkpoints.

    PubMed

    Covre, Alessia; Coral, Sandra; Di Giacomo, Anna Maria; Taverna, Pietro; Azab, Mohammad; Maio, Michele

    2015-06-01

    Epigenetic alterations play a pivotal role in cancer development and progression. Pharmacologic reversion of such alterations is feasible, and second generation "epigenetic drugs" are in development and have been demonstrated to possess significant immunomodulatory properties. This knowledge, together with the availability of new and highly effective immunotherapeutic agents including immune checkpoint(s) blocking monoclonal antibodies, allows us to plan for highly innovative proof-of-principle combination studies that will likely open the path to more effective anticancer therapies.

  6. Single Nutrients and Immunity

    DTIC Science & Technology

    1982-02-01

    control group, cot- vitamin C deficiencies, humoral immune re- ton- topped marmosets fed a large dietary ex- sponses do not differ appreciably from...vac- duction of interferon. They commented (61) cine (75). that "the literature in this field is bedeviled The long-term feeding of cotton- topped by...repletion: a marked numbers were also found in the lungs. sub- rebound to higher serum lgG values then maxillary glands, and lymph nodes (310). occurred over

  7. Research in Plague Immunity

    DTIC Science & Technology

    1976-06-01

    Purified Antigen of Brucella melitensis Prior to Injection of Rev. I Vaccine or with Both Injected Concomitantly. J. Infect. Dis. September 1976 issue...with observa- tion on the structure of the-bacterial cells and its relationships to infection and immunity, J. Immunol. 72:282-298, 1954. Chen, T. H...a vaccine prepared with killed virulent whole organisms. J. Immunol. 87:64-71, 1961. Chen, T.H. The antigenic structure of Pasteurella pestis and its

  8. Lassa Fever Immune Plasma.

    DTIC Science & Technology

    1986-05-01

    the period 246 Lassa Fever Immune Plasma (LFIP) units were obtained by plasmapheresis , 106 were forwarded to USAMRIID. During the whole life of the...Fever in Plasmapheresis #20 - the inception of the Contract LV has been isolated from 139 of 213 LF patients and another 71 presumptive LF cases have...During the year plasmapheresis at Curran Lutheran Hospital (CLH) and Phebe Hospital (PH) resulted in the collection of 246 units of Lassa Fever

  9. Immunity to amoeba.

    PubMed

    Nowak, Barbara; Valdenegro-Vega, Victoria; Crosbie, Philip; Bridle, Andrew

    2014-04-01

    Amoebic infections in fish are most likely underestimated and sometimes overlooked due to the challenges associated with their diagnosis. Amoebic diseases reported in fish affect either gills or internal organs or may be systemic. Host response ranges from hyperplastic response in gill infections to inflammation (including granuloma formation) in internal organs. This review focuses on the immune response of Atlantic salmon to Neoparamoeba perurans, the causative agent of Amoebic Gill Disease (AGD).

  10. Lassa Fever Immune Plasma.

    DTIC Science & Technology

    1983-08-01

    Lassa fever , a new virus disease of man from West Africa . Clinical... Lassa fever in missionaries stationed in West Africa . Bull. W.H.O. 52: 593-598 (1975). 5. Clayton, A.J. Lassa immune serum. Bull. W.H.O. 55: 435-439...1977). 6. Leifer, E., Gocke, D.J., & Bourne, H. Lassa fever , a new virus disease of man from West Africa . II. Report of a laboratory acquired

  11. Engineering synthetic vaccines using cues from natural immunity

    NASA Astrophysics Data System (ADS)

    Irvine, Darrell J.; Swartz, Melody A.; Szeto, Gregory L.

    2013-11-01

    Vaccines aim to protect against or treat diseases through manipulation of the immune response, promoting either immunity or tolerance. In the former case, vaccines generate antibodies and T cells poised to protect against future pathogen encounter or attack diseased cells such as tumours; in the latter case, which is far less developed, vaccines block pathogenic autoreactive T cells and autoantibodies that target self tissue. Enormous challenges remain, however, as a consequence of our incomplete understanding of human immunity. A rapidly growing field of research is the design of vaccines based on synthetic materials to target organs, tissues, cells or intracellular compartments; to co-deliver immunomodulatory signals that control the quality of the immune response; or to act directly as immune regulators. There exists great potential for well-defined materials to further our understanding of immunity. Here we describe recent advances in the design of synthetic materials to direct immune responses, highlighting successes and challenges in prophylactic, therapeutic and tolerance-inducing vaccines.

  12. [The superoxide theory of pathogenesis and therapy of immune disorders].

    PubMed

    Lebedev, V V

    2004-01-01

    On the basis of the understanding that there are common development mechanisms for the inflammatory and immune reactions it was established that the activity of the oxidant-antioxidant system (OAS) correlates not only with a severity of the inflammatory reaction but also with a degree of immune disorders. Such disorders were studied in patients with endogenous uveitis and with cancer of the esophagus or uterine cervix, i.e. those nosological forms, which are normally accompanied by OAS decompensation, which comprised a lower activity of primary antioxidants (superoxides of dismutase, catalase, lactoferrin, ceruloplasmin etc.) in patients with pronounced immune disorders. Moreover, a lower content of secondary antioxidants, like vitamin A, ascorbic acid and tocopherol, was registered in the blood of patients with immune disorders. The suppression of the antioxidant system was concomitant with an essentially increased level of lipid peroxidation in all patients. Besides, it was noted that there were intensifying signs of immune disorders primarily observed during irradiation chemotherapy. In this context, a clear-cut correlation was established, in monitoring the body immune status, between degrees of free-radical formation and lipid peroxidation, on the one hand, and an activity of detoxication-system antioxidants, on the other hand,. The OAS correction by direct or indirect-action antioxidants normally improves the clinical course of immune impairments. The indirect-action antioxidants, e.g. synthetic regulatory peptide "Imunofan", induce the increasing activity of primary endogenous antioxidants. An activation of the detoxication antioxidant system, brings about, in such cases, a lower content of inflammation mediators, a recovery of cell-immunity indices and lower parameters of body auto-sensitization. Finally, the antioxidant system in patients with chronic inflammatory or oncological disorders, when recovered, ensures the correction of cell immunity and cuts

  13. Bateman's principle and immunity.

    PubMed Central

    Rolff, Jens

    2002-01-01

    The immunocompetence handicap hypothesis (ICHH) of Folstad and Karter has inspired a large number of studies that have tried to understand the causal basis of parasite-mediated sexual selection. Even though this hypothesis is based on the double function of testosterone, a hormone restricted to vertebrates, studies of invertebrates have tended to provide central support for specific predictions of the ICHH. I propose an alternative hypothesis that explains many of the findings without relying on testosterone or other biochemical feedback loops. This alternative is based on Bateman's principle, that males gain fitness by increasing their mating success whilst females increase fitness through longevity because their reproductive effort is much higher. Consequently, I predict that females should invest more in immunity than males. The extent of this dimorphism is determined by the mating system and the genetic correlation between males and females in immune traits. In support of my arguments, I mainly use studies on insects that share innate immunity with vertebrates and have the advantage that they are easier to study. PMID:11958720

  14. Why parents refuse immunization?

    PubMed

    Kajetanowicz, Andrzej; Kajetanowicz, Aleksandra

    Rates of child immunization are falling in many countries, leading to the increase of morbidity and mortality from diseases controlled by vaccinations. The simplified model of the natural history of immunization follows a sequence of fear of the disease before vaccination, followed by acceptance of the vaccination until plateau, where the population forgets the morbidity and mortality of pre-immunization. Historical factors including withdrawals of vaccines, and publications regarding the true or falsified dangers of vaccines still resonate with parents. Building on these historical factors, unscientific sources such as naturopaths, homeopaths, chiropractors, celebrities and lay-people with anecdotal evidence and even scientific sources such as some universities and some medical doctors push their views on anti-vaccination, which proves to make the decision to vaccinate more difficult on parents. The main reason that parents refuse vaccination is a desire to protect their children. These parents believe that vaccination is harmful, or that not vaccinated children are healthier than vaccinated children. Scientific data often will lose with pseudoscientific, false or anecdotal data that have higher sensational and emotional impact on parents. With so many sources giving so many factors which sometimes contradict themselves, it is indeed difficult for a parent to make a clear decision for their child.

  15. Cystatins in Immune System

    PubMed Central

    Magister, Špela; Kos, Janko

    2013-01-01

    Cystatins comprise a large superfamily of related proteins with diverse biological activities. They were initially characterised as inhibitors of lysosomal cysteine proteases, however, in recent years some alternative functions for cystatins have been proposed. Cystatins possessing inhibitory function are members of three families, family I (stefins), family II (cystatins) and family III (kininogens). Stefin A is often linked to neoplastic changes in epithelium while another family I cystatin, stefin B is supposed to have a specific role in neuredegenerative diseases. Cystatin C, a typical type II cystatin, is expressed in a variety of human tissues and cells. On the other hand, expression of other type II cystatins is more specific. Cystatin F is an endo/lysosome targeted protease inhibitor, selectively expressed in immune cells, suggesting its role in processes related to immune response. Our recent work points on its role in regulation of dendritic cell maturation and in natural killer cells functional inactivation that may enhance tumor survival. Cystatin E/M expression is mainly restricted to the epithelia of the skin which emphasizes its prominent role in cutaneous biology. Here, we review the current knowledge on type I (stefins A and B) and type II cystatins (cystatins C, F and E/M) in pathologies, with particular emphasis on their suppressive vs. promotional function in the tumorigenesis and metastasis. We proposed that an imbalance between cathepsins and cystatins may attenuate immune cell functions and facilitate tumor cell invasion. PMID:23386904

  16. Linear ubiquitination in immunity.

    PubMed

    Shimizu, Yutaka; Taraborrelli, Lucia; Walczak, Henning

    2015-07-01

    Linear ubiquitination is a post-translational protein modification recently discovered to be crucial for innate and adaptive immune signaling. The function of linear ubiquitin chains is regulated at multiple levels: generation, recognition, and removal. These chains are generated by the linear ubiquitin chain assembly complex (LUBAC), the only known ubiquitin E3 capable of forming the linear ubiquitin linkage de novo. LUBAC is not only relevant for activation of nuclear factor-κB (NF-κB) and mitogen-activated protein kinases (MAPKs) in various signaling pathways, but importantly, it also regulates cell death downstream of immune receptors capable of inducing this response. Recognition of the linear ubiquitin linkage is specifically mediated by certain ubiquitin receptors, which is crucial for translation into the intended signaling outputs. LUBAC deficiency results in attenuated gene activation and increased cell death, causing pathologic conditions in both, mice, and humans. Removal of ubiquitin chains is mediated by deubiquitinases (DUBs). Two of them, OTULIN and CYLD, are constitutively associated with LUBAC. Here, we review the current knowledge on linear ubiquitination in immune signaling pathways and the biochemical mechanisms as to how linear polyubiquitin exerts its functions distinctly from those of other ubiquitin linkage types.

  17. New insights into innate immune control of systemic candidiasis.

    PubMed

    Lionakis, Michail S

    2014-08-01

    Systemic infection caused by Candida species is the fourth leading cause of nosocomial bloodstream infection in modern hospitals and carries high morbidity and mortality despite antifungal therapy. A recent surge of immunological studies in the mouse models of systemic candidiasis and the parallel discovery and phenotypic characterization of inherited genetic disorders in antifungal immune factors that are associated with enhanced susceptibility or resistance to the infection have provided new insights into the cellular and molecular basis of protective innate immune responses against Candida. In this review, the new developments in our understanding of how the mammalian immune system responds to systemic Candida challenge are synthesized and important future research directions are highlighted.

  18. Brucella evasion of adaptive immunity.

    PubMed

    Martirosyan, Anna; Gorvel, Jean-Pierre

    2013-02-01

    The complex immune system of mammals is the result of evolutionary forces that include battles against pathogens, as sensing and defeating intruders is a prerequisite to host survival. On the other hand, microorganisms have evolved multiple mechanisms to evade both arms of immunity: the innate and the adaptive immune systems. The successful pathogenic intracellular bacterium Brucella is not an exception to the rule: Brucella displays mechanisms that allow evasion of immune surveillance in order to establish persistent infections in mammals. In this review, we highlight some key mechanisms that pathogenic Brucella use to evade the adaptive immune system.

  19. Immune-endocrine interactions in marsupials and monotremes.

    PubMed

    Peel, E; Belov, K

    2017-01-27

    Interactions between the immune and endocrine systems are not well studied in marsupials and monotremes. One exception to this is the phenomenon of semelparity, which is well covered in the literature as this is an unusual reproductive strategy amongst mammals and is only observed in some dasyurid and didelphid marsupials. Thymus involution provides a direct link between the endocrine and immune systems and warrants further study in marsupials and monotremes. The thymus is a primary immune tissue which is essential for overall immune function. Whilst the organ is large in juvenile animals, it begins to involute around puberty due to the suppressive effects of sex steroids. Thymus involution has a significant effect on the immune system, as it signals the onset of immune aging and decline in function. The output of naïve T lymphocytes by the thymus decreases, increasing susceptibility of aged individuals to infection and cancers. Understanding the links between the immune and endocrine system in marsupials and monotremes may shed light on diseases such as devil facial tumour disease (DFTD) which threatens the future of the Tasmanian devil. We hypothesise that changes in sex hormones around puberty may drive changes in the immune system, such as thymus involution, which may make devils more susceptible to DFTD as they age. In addition, the Schwann cell origin of DFTD may enable tumours to respond to sex hormones, as occurs in similar cancers in humans.

  20. The Mucosal Immune System and Its Regulation by Autophagy

    PubMed Central

    Kabat, Agnieszka M.; Pott, Johanna; Maloy, Kevin J.

    2016-01-01

    The gastrointestinal tract presents a unique challenge to the mucosal immune system, which has to constantly monitor the vast surface for the presence of pathogens, while at the same time maintaining tolerance to beneficial or innocuous antigens. In the intestinal mucosa, specialized innate and adaptive immune components participate in directing appropriate immune responses toward these diverse challenges. Recent studies provide compelling evidence that the process of autophagy influences several aspects of mucosal immune responses. Initially described as a “self-eating” survival pathway that enables nutrient recycling during starvation, autophagy has now been connected to multiple cellular responses, including several aspects of immunity. Initial links between autophagy and host immunity came from the observations that autophagy can target intracellular bacteria for degradation. However, subsequent studies indicated that autophagy plays a much broader role in immune responses, as it can impact antigen processing, thymic selection, lymphocyte homeostasis, and the regulation of immunoglobulin and cytokine secretion. In this review, we provide a comprehensive overview of mucosal immune cells and discuss how autophagy influences many aspects of their physiology and function. We focus on cell type-specific roles of autophagy in the gut, with a particular emphasis on the effects of autophagy on the intestinal T cell compartment. We also provide a perspective on how manipulation of autophagy may potentially be used to treat mucosal inflammatory disorders. PMID:27446072

  1. Invited essay: Cognitive influences on the psychological immune system.

    PubMed

    Rachman, S J

    2016-12-01

    The construct of the psychological immune system is described and analysed. The direct and indirect cognitive influences on the system are discussed, and the implications of adding a cognitive construal to the influential model of a behavioural immune system are considered. The psychological immune system has two main properties: defensive and healing. It encompasses a good amount of health-related phenomena that is outside the scope of the behavioural model or the biological immune system. Evidence pertaining to the psychological immune system includes meta-analyses of the associations between psychological variables such as positive affect/wellbeing and diseases and mortality, and associations between wellbeing and positive health. The results of long-term prospective studies are consistent with the conclusions drawn from the meta-analyses. Laboratory investigations of the effects of psychological variables on the biological immune system show that negative affect can slow wound-healing, and positive affect can enhance resistance to infections, for example in experiments involving the introduction of the rhinovirus and the influenza A virus. A number of problems concerning the assessment of the functioning of the psychological immune system are considered, and the need to develop techniques for determining when the system is active or not, is emphasized. This problem is particularly challenging when trying to assess the effects of the psychological immune system during a prolonged psychological intervention, such as a course of resilience training.

  2. Canalith Repositioning Procedure

    MedlinePlus

    ... repositioning procedure can help relieve benign paroxysmal positional vertigo (BPPV), a condition in which you have brief, but intense, episodes of dizziness that occur when you move your head. Vertigo ...

  3. Lithotripsy procedure (image)

    MedlinePlus

    Extracorporeal shock wave lithotripsy (ESWL) is a procedure used to shatter simple stones in the kidney or upper urinary tract. Ultrasonic waves are passed through the body until they strike the dense stones. Pulses of ...

  4. Dynamic alarm response procedures

    SciTech Connect

    Martin, J.; Gordon, P.; Fitch, K.

    2006-07-01

    The Dynamic Alarm Response Procedure (DARP) system provides a robust, Web-based alternative to existing hard-copy alarm response procedures. This paperless system improves performance by eliminating time wasted looking up paper procedures by number, looking up plant process values and equipment and component status at graphical display or panels, and maintenance of the procedures. Because it is a Web-based system, it is platform independent. DARP's can be served from any Web server that supports CGI scripting, such as Apache{sup R}, IIS{sup R}, TclHTTPD, and others. DARP pages can be viewed in any Web browser that supports Javascript and Scalable Vector Graphics (SVG), such as Netscape{sup R}, Microsoft Internet Explorer{sup R}, Mozilla Firefox{sup R}, Opera{sup R}, and others. (authors)

  5. Short Nuss bar procedure

    PubMed Central

    2016-01-01

    The Nuss procedure is now the preferred operation for surgical correction of pectus excavatum (PE). It is a minimally invasive technique, whereby one to three curved metal bars are inserted behind the sternum in order to push it into a normal position. The bars are left in situ for three years and then removed. This procedure significantly improves quality of life and, in most cases, also improves cardiac performance. Previously, the modified Ravitch procedure was used with resection of cartilage and the use of posterior support. This article details the new modified Nuss procedure, which requires the use of shorter bars than specified by the original technique. This technique facilitates the operation as the bar may be guided manually through the chest wall and no additional stabilizing sutures are necessary. PMID:27747185

  6. Cytotoxic Killing and Immune Evasion by Repair

    NASA Astrophysics Data System (ADS)

    Chan, Cliburn; George, Andrew J. T.; Stark, Jaroslav

    2007-07-01

    The interaction between the immune system and pathogens is a complex one, with pathogens constantly developing new ways of evading destruction by the immune system. The immune system's task is made even harder when the pathogen in question is an intra-cellular one (such as a virus or certain bacteria) and it is necessary to kill the infected host cell in order to eliminate the pathogen. This causes damage to the host, and such killing therefore needs to be carefully controlled, particularly in tissues with poor regenerative potential, or those involved in the immune response itself. Host cells therefore possess repair mechanisms which can counteract killing by immune cells. These in turn can be subverted by pathogens which up-regulate the resistance of infected cells to killing. In this paper, we explore the hypothesis that this repair process plays an important role in determining the efficacy of evasion and escape from immune control. We model a situation where cytotoxic T lymphocytes (CTL) and natural killer (NK) cells kill pathogen-infected and tumour cells by directed secretion of preformed granules containing perforin and granzymes. Resistance to such killing can be conferred by the expression of serine protease inhibitors (serpins). These are utilized by several virally infected and tumour cells, as well as playing a role in the protection of host bystander, immune and immuneprivileged cells. We build a simple stochastic model of cytotoxic killing, where serpins can neutralize granzymes stoichiometrically by forming an irreversible complex, and the survival of the cell is determined by the balance between serpin depletion and replenishment, which in its simplest form is equivalent to the well known shot noise process. We use existing analytical results for this process, and additional simulations to analyse the effects of repair on cytotoxic killing. We then extend the model to the case of a replicating target cell population, which gives a branching process

  7. Direct Interaction between Autonomic Nerves and the Immune System

    DTIC Science & Technology

    1987-11-15

    enhancement, propranolol for beta-adrenergic blockade, and phentolamine for alpha- adrenergic blockade. Cholinergic agents were not examined due to the...Table III), The alpha blocker phentolamine also caused partial inhibition of the agonist response, and in the case of NE, was additive with propranolol...effect which was blocked by propranolol (beta blocker) but not phentolamine (alpha blocker). "Further analysis showed that beta2-stimulation with

  8. Pathogenesis and immunity in murine salmonellosis.

    PubMed Central

    Hsu, H S

    1989-01-01

    Salmonella is traditionally described as a facultative intracellular parasite, and host macrophages are regarded as the primary effector cells in both native and acquired immunity in mouse typhoid. This concept has not been unanimously accepted in the literature. Based on cell culture experiments and electron microscopic examinations of infected tissues, we observed that virulent Salmonella typhimurium is killed within polymorphs and macrophages of guinea pigs and mice. In a systemic disease, the organism propagates primarily in the extracellular locations of sinusoids and tissue lesions and within hepatocytes. Hence, it is more likely to be an extracellular pathogen and its virulence is directly related to its antiphagocytic property. The conspicuous absence of macrophages in the primary lesions of murine salmonellosis disputes the likelihood of their significant role in native resistance to the disease. Acquired cellular immunity is expressed as an enhanced antibacterial activity of macrophages facilitated by cytophilic antibodies rather than as an altered antibacterial action of immune macrophages. It is proposed that acquired immunity in murine salmonellosis is a synergistic manifestation of the innate capacity of polymorphs and macrophages to destroy ingested salmonellae, the activated antibacterial functions of macrophages mediated by cytophilic antibodies, the opsonic and agglutinating actions of antiserum, and the accelerated inflammation associated with delayed hypersensitivity to bacterial antigens. Unlike live attenuated vaccines, nonviable vaccines offer a significant, though not a solid, protection against subsequent challenges. Images PMID:2687679

  9. Adaptive immune cells temper initial innate responses

    PubMed Central

    Kim, Kwang Dong; Zhao, Jie; Auh, Sogyong; Yang, Xuanming; Du, Peishuang; Tang, Hong; Fu, Yang-Xin

    2008-01-01

    Toll-like receptors (TLRs) recognize conserved microbial structures called pathogen-associated molecular patterns. Signaling from TLRs leads to upregulation of co-stimulatory molecules for better priming of T cells and secretion of inflammatory cytokines by innate immune cells1–4. Lymphocytedeficient hosts often die of acute infection, presumably owing to their lack of an adaptive immune response to effectively clear pathogens. However, we show here that an unleashed innate immune response due to the absence of residential T cells can also be a direct cause of death. Viral infection or administration of poly(I:C), a ligand for TLR3, led to cytokine storm in T-cell- or lymphocyte-deficient mice in a fashion dependent on NK cells and tumor necrosis factor. We have further shown, through the depletion of CD4+ and CD8+ cells in wild-type mice and the transfer of T lymphocytes into Rag-1–deficient mice, respectively, that T cells are both necessary and sufficient to temper the early innate response. In addition to the effects of natural regulatory T cells, close contact of resting CD4+CD25−Foxp3− or CD8+ T cells with innate cells could also suppress the cytokine surge by various innate cells in an antigen-independent fashion. Therefore, adaptive immune cells have an unexpected role in tempering initial innate responses. PMID:17891146

  10. Adaptive immune cells temper initial innate responses.

    PubMed

    Kim, Kwang Dong; Zhao, Jie; Auh, Sogyong; Yang, Xuanming; Du, Peishuang; Tang, Hong; Fu, Yang-Xin

    2007-10-01

    Toll-like receptors (TLRs) recognize conserved microbial structures called pathogen-associated molecular patterns. Signaling from TLRs leads to upregulation of co-stimulatory molecules for better priming of T cells and secretion of inflammatory cytokines by innate immune cells. Lymphocyte-deficient hosts often die of acute infection, presumably owing to their lack of an adaptive immune response to effectively clear pathogens. However, we show here that an unleashed innate immune response due to the absence of residential T cells can also be a direct cause of death. Viral infection or administration of poly(I:C), a ligand for TLR3, led to cytokine storm in T-cell- or lymphocyte-deficient mice in a fashion dependent on NK cells and tumor necrosis factor. We have further shown, through the depletion of CD4+ and CD8+ cells in wild-type mice and the transfer of T lymphocytes into Rag-1-deficient mice, respectively, that T cells are both necessary and sufficient to temper the early innate response. In addition to the effects of natural regulatory T cells, close contact of resting CD4+CD25-Foxp3- or CD8+ T cells with innate cells could also suppress the cytokine surge by various innate cells in an antigen-independent fashion. Therefore, adaptive immune cells have an unexpected role in tempering initial innate responses.

  11. Cellular immune reactions in the lung.

    PubMed

    Hasenberg, Mike; Stegemann-Koniszewski, Sabine; Gunzer, Matthias

    2013-01-01

    The lung constantly interacts with the environment through thousands of liters of air that are inhaled daily. This continually transports toxic chemicals and particles or pathogenic microorganisms deep into the respiratory system, posing a challenge to physicochemical barriers and the local immune system. Thus, complex structures and mechanisms have evolved to recognize and fend off environmental dangers while at the same time allowing efficient gas exchange. Here we review our current knowledge regarding cellular mechanisms of the immune system in context with the highly specialized anatomical features of the airways and especially the alveolar compartment. The focus is on fungal and viral infections, merging anatomical aspects well known to pulmonologists with fundamental immunological concepts. We discuss the specialized morphological constraints of immune cells compressed under a continuous layer of the surfactant lining within alveoli as well as the importance of functional polarization of respiratory tract epithelia. Furthermore, we summarize the different types of innate and adaptive immune cells and their relative contribution to lung homeostasis with respect to localization. Finally, we provide a list of currently unresolved questions with high relevance for the field that might serve as food for thought regarding future research directions.

  12. Immune system alterations in amyotrophic lateral sclerosis.

    PubMed

    Hovden, H; Frederiksen, J L; Pedersen, S W

    2013-11-01

    Amyotrophic lateral sclerosis is a disease of which the underlying cause and pathogenesis are unknown. Cumulatative data clearly indicates an active participation by the immune system in the disease. An increasingly recognized theory suggests a non-cell autonomous mechanism, meaning that multiple cells working together are necessary for the pathogenesis of the disease. Observed immune system alterations could indicate an active participation in this mechanism. Damaged motor neurons are able to activate microglia, astrocytes and the complement system, which further can influence each other and contribute to neurodegeneration. Infiltrating peripheral immune cells appears to correlate with disease progression, but their significance and composition is unclear. The deleterious effects of this collaborating system of cells appear to outweigh the protective aspects, and revealing this interplay might give more insight into the disease. Markers from the classical complement pathway are elevated where its initiator C1q appears to derive primarily from motor neurons. Activated microglia and astrocytes are found in close proximity to dying motor neurons. Their activation status and proliferation seemingly increases with disease progression. Infiltrating monocytes, macrophages and T cells are associated with these areas, although with mixed reports regarding T cell composition. This literature review will provide evidence supporting the immune system as an important part of ALS disease mechanism and present a hypothesis to direct the way for further studies.

  13. Innate immune responses to hepatitis C virus.

    PubMed

    Schoggins, John W; Rice, Charles M

    2013-01-01

    The innate immune response provides the first line of defense against invading viral pathogens. Incoming viruses are sensed by dedicated host factors that, when triggered, initiate multiple signal transduction pathways. Activation of these pathways leads to the induction of highly orchestrated transcriptional programs designed to limit virus replication and spread. In recent years, our understanding of innate immune responses targeting hepatitis C virus (HCV) has increased substantially, largely due to the development of new systems and methodologies to study HCV-host interactions in vitro and in vivo. However, significant gaps still remain. Here, we aim to provide a comprehensive view of the innate immune response to HCV, focusing primarily on knowledge gained from cell culture models of HCV infection, as well as data from human patients infected with HCV. While some paradigms of the host response to HCV revealed in cell culture translate to human infection in vivo, others are less clear. Further insight into the similarities and differences in these systems will not only reveal directions for future studies on HCV immunity, but may also guide the development of novel strategies to control HCV and other viral infections.

  14. JASMONATE-TRIGGERED PLANT IMMUNITY

    PubMed Central

    Campos, Marcelo L.; Kang, Jin-Ho; Howe, Gregg A.

    2014-01-01

    The plant hormone jasmonate (JA) exerts direct control over the production of chemical defense compounds that confer resistance to a remarkable spectrum of plant-associated organisms, ranging from microbial pathogens to vertebrate herbivores. The underlying mechanism of JA-triggered immunity (JATI) can be conceptualized as a multi-stage signal transduction cascade involving: i) pattern recognition receptors (PRRs) that couple the perception of danger signals to rapid synthesis of bioactive JA; ii) an evolutionarily conserved JA signaling module that links fluctuating JA levels to changes in the abundance of transcriptional repressor proteins; and iii) activation (de-repression) of transcription factors that orchestrate the expression of myriad chemical and morphological defense traits. Multiple negative feedback loops act in concert to restrain the duration and amplitude of defense responses, presumably to mitigate potential fitness costs of JATI. The convergence of diverse plant- and non-plant-derived signals on the core JA module indicates that JATI is a general response to perceived danger. However, the modular structure of JATI may accommodate attacker-specific defense responses through evolutionary innovation of PRRs (inputs) and defense traits (outputs). The efficacy of JATI as a defense strategy is highlighted by its capacity to shape natural populations of plant attackers, as well as the propensity of plant-associated organisms to subvert or otherwise manipulate JA signaling. As both a cellular hub for integrating informational cues from the environment and a common target of pathogen effectors, the core JA module provides a focal point for understanding immune system networks and the evolution of chemical diversity in the plant kingdom. PMID:24973116

  15. [The EXIT procedure].

    PubMed

    Lehmann, S; Blödow, A; Flügel, W; Renner-Lützkendorf, H; Isbruch, A; Siegling, F; Untch, M; Strauß, J; Bloching, M B

    2013-08-01

    The ex utero intrapartum treatment (EXIT) procedure is used for unborn fetuses in cases of predictable complications of postpartum airway obstruction. Indications for the EXIT procedure are fetal neck tumors, obstruction of the trachea, hiatus hernia of the diaphragm and congenital high airway obstruction syndrome (CHAOS). Large cervical tumors prevent normal delivery of a fetus due to reclination of the head with airway obstruction. Therefore, a primary caesarean section or the EXIT procedure has to be considered. The EXIT procedure has time limitations as the blood supply by the placenta only lasts for 30-60 min. Airway protection has to be ensured during parturition.This article reports the case of an unborn fetus with a large cervical teratoma where an obstruction of the cervical airway was detected and monitored by ultrasound and magnetic resonance imaging (MRI) during pregnancy. The EXIT procedure was therefore used and successfully accomplished. The features of the interdisciplinary aspects of the EXIT procedure are described with the special aspects of each medical discipline.

  16. Heat and immunity: an experimental heat wave alters immune functions in three-spined sticklebacks (Gasterosteus aculeatus).

    PubMed

    Dittmar, Janine; Janssen, Hannah; Kuske, Andra; Kurtz, Joachim; Scharsack, Jörn P

    2014-07-01

    Global climate change is predicted to lead to increased temperatures and more extreme climatic events. This may influence host-parasite interactions, immunity and therefore the impact of infectious diseases on ecosystems. However, little is known about the effects of rising temperatures on immune defence, in particular in ectothermic animals, where the immune system is directly exposed to external temperature change. Fish are ideal models for studying the effect of temperature on immunity, because they are poikilothermic, but possess a complete vertebrate immune system with both innate and adaptive immunity. We used three-spined sticklebacks ( Gasterosteus aculeatus) originating from a stream and a pond, whereby the latter supposedly were adapted to higher temperature variation. We studied the effect of increasing and decreasing temperatures and a simulated heat wave with subsequent recovery on body condition and immune parameters. We hypothesized that the immune system might be less active at low temperatures, but will be even more suppressed at temperatures towards the upper tolerable temperature range. Contrary to our expectation, we found innate and adaptive immune activity to be highest at a temperature as low as 13 °C. Exposure to a simulated heat wave induced long-lasting immune disorders, in particular in a stickleback population that might be less adapted to temperature variation in its natural environment. The results show that the activity of the immune system of an ectothermic animal species is temperature dependent and suggest that heat waves associated with global warming may immunocompromise host species, thereby potentially facilitating the spread of infectious diseases.

  17. Adaptation in the innate immune system and heterologous innate immunity.

    PubMed

    Martin, Stefan F

    2014-11-01

    The innate immune system recognizes deviation from homeostasis caused by infectious or non-infectious assaults. The threshold for its activation seems to be established by a calibration process that includes sensing of microbial molecular patterns from commensal bacteria and of endogenous signals. It is becoming increasingly clear that adaptive features, a hallmark of the adaptive immune system, can also be identified in the innate immune system. Such adaptations can result in the manifestation of a primed state of immune and tissue cells with a decreased activation threshold. This keeps the system poised to react quickly. Moreover, the fact that the innate immune system recognizes a wide variety of danger signals via pattern recognition receptors that often activate the same signaling pathways allows for heterologous innate immune stimulation. This implies that, for example, the innate immune response to an infection can be modified by co-infections or other innate stimuli. This "design feature" of the innate immune system has many implications for our understanding of individual susceptibility to diseases or responsiveness to therapies and vaccinations. In this article, adaptive features of the innate immune system as well as heterologous innate immunity and their implications are discussed.

  18. Coverage and costs of childhood immunizations in Cameroon.

    PubMed Central

    Waters, Hugh R.; Dougherty, Leanne; Tegang, Simon-Pierre; Tran, Nhan; Wiysonge, Charles Shey; Long, Kanya; Wolfe, Nathan D.; Burke, Donald S.

    2004-01-01

    the household's socioeconomic status--particularly the mother's level of education--on immunization rates suggest that the effectiveness of the Cameroon programme could be increased by promoting immunization and directing such programmes towards households with limited resources. PMID:15628204

  19. Immune modulation of resistance artery remodelling.

    PubMed

    Schiffrin, Ernesto L

    2012-01-01

    Low-grade inflammation plays a role in cardiovascular disease. The innate and the adaptive immune responses participate in mechanisms that contribute to inflammatory responses. It has been increasingly appreciated that different subsets of lymphocytes and the cytokines they produce modulate the vascular remodelling that occurs in cardiovascular disease. Effector T cells such as T-helper (Th) 1 (interferon-γ-producing) and Th2 lymphocytes (that produce interleukin-4), as well as Th17 (that produce interleukin-17), and T suppressor lymphocytes including regulatory T cells (Treg), which express the transcription factor forkhead box P3 (Foxp3), are involved in the remodelling of small arteries that occurs under the action of angiotensin II, deoxycorticosterone-salt and aldosterone-salt, as well as in models of hypertension such as the Dahl-salt-sensitive rat. The mechanism whereby the immune system is activated is unclear, but it has been suggested that neo-antigens may be generated by the elevation of blood pressure or other stimuli, leading to the activation of the immune response. Activated Th1 may contribute to vascular remodelling directly on blood vessels via effects of the cytokines produced or indirectly by actions on the kidney. The protective effect of Treg may be mediated similarly directly or via renal effects. These data offer promise for the discovery of new therapeutic targets to ameliorate vascular remodelling, which could lead to improved outcome in cardiovascular disease in humans.

  20. Modulation of HIV-1 immunity by adjuvants

    PubMed Central

    Moody, M. Anthony

    2014-01-01

    Purpose of review To summarize the role of adjuvants in eliciting desirable antibody responses against HIV-1 with particular emphasis on both historical context and recent developments. Recent findings Increased understanding of the role of pattern recognition receptors such as Toll-like receptors in recruiting and directing the immune system has increased the variety of adjuvant formulations being tested in animal models and humans. Across all vaccine platforms, adjuvant formulations have been shown to enhance desirable immune responses such as higher antibody titers and increased functional activity. Although no vaccine formulation has yet succeeded in eliciting broad neutralizing antibodies against HIV-1, the ability of adjuvants to direct the immune response to immunogens suggests they will be critically important in any successful HIV-1 vaccine. Summary The parallel development of adjuvants along with better HIV-1 immunogens will be needed for a successful AIDS vaccine. Additional comparative testing will be required to determine the optimal adjuvant and immunogen regimen that can elicit antibody responses capable of blocking HIV-1 transmission. PMID:24670321