Sample records for impaired immune response

  1. Mice Lacking Endoglin in Macrophages Show an Impaired Immune Response

    PubMed Central

    Ojeda-Fernández, Luisa; Recio-Poveda, Lucía; Aristorena, Mikel; Lastres, Pedro; Blanco, Francisco J.; Sanz-Rodríguez, Francisco; Gallardo-Vara, Eunate; de las Casas-Engel, Mateo; Corbí, Ángel; Arthur, Helen M.; Bernabeu, Carmelo; Botella, Luisa M.


    Endoglin is an auxiliary receptor for members of the TGF-β superfamily and plays an important role in the homeostasis of the vessel wall. Mutations in endoglin gene (ENG) or in the closely related TGF-β receptor type I ACVRL1/ALK1 are responsible for a rare dominant vascular dysplasia, the Hereditary Hemorrhagic Telangiectasia (HHT), or Rendu-Osler-Weber syndrome. Endoglin is also expressed in human macrophages, but its role in macrophage function remains unknown. In this work, we show that endoglin expression is triggered during the monocyte-macrophage differentiation process, both in vitro and during the in vivo differentiation of blood monocytes recruited to foci of inflammation in wild-type C57BL/6 mice. To analyze the role of endoglin in macrophages in vivo, an endoglin myeloid lineage specific knock-out mouse line (Engfl/flLysMCre) was generated. These mice show a predisposition to develop spontaneous infections by opportunistic bacteria. Engfl/flLysMCre mice also display increased survival following LPS-induced peritonitis, suggesting a delayed immune response. Phagocytic activity is impaired in peritoneal macrophages, altering one of the main functions of macrophages which contributes to the initiation of the immune response. We also observed altered expression of TGF-β1 target genes in endoglin deficient peritoneal macrophages. Overall, the altered immune activity of endoglin deficient macrophages could help to explain the higher rate of infectious diseases seen in HHT1 patients. PMID:27010826

  2. Immune adjuvants in early life: targeting the innate immune system to overcome impaired adaptive response.


    de Brito, Cyro Alves; Goldoni, Adriana Letícia; Sato, Maria Notomi


    The neonatal phase is a transitory period characterized by an absence of memory cells, favoring a slow adaptive response prone to tolerance effects and the development of Th2-type responses. However, when appropriately stimulated, neonates may achieve an immune response comparable with adult counterparts. One strategy to stimulate the immunological response of neonates or children in early infancy has been to explore natural or synthetic ligands of cell receptors to stimulate innate immunity. The use of adjuvants for activating different cell receptors may be the key to enhancing neonatal adaptive immunity. This review highlights recent advances in the emerging field of molecular adjuvants of innate immune response and their implications for the development of immunotherapies, with particular focus on the neonatal period.

  3. Adipose-Derived Mesenchymal Stem Cells Restore Impaired Mucosal Immune Responses in Aged Mice

    PubMed Central

    Aso, Kazuyoshi; Tsuruhara, Akitoshi; Takagaki, Kentaro; Oki, Katsuyuki; Ota, Megumi; Nose, Yasuhiro; Tanemura, Hideki; Urushihata, Naoki; Sasanuma, Jinichi; Sano, Masayuki; Hirano, Atsuyuki; Aso, Rio; McGhee, Jerry R.; Fujihashi, Kohtaro


    It has been shown that adipose-derived mesenchymal stem cells (AMSCs) can differentiate into adipocytes, chondrocytes and osteoblasts. Several clinical trials have shown the ability of AMSCs to regenerate these differentiated cell types. Age-associated dysregulation of the gastrointestinal (GI) immune system has been well documented. Our previous studies showed that impaired mucosal immunity in the GI tract occurs earlier during agingthan is seen in the systemic compartment. In this study, we examined the potential of AMSCs to restore the GI mucosal immune system in aged mice. Aged (>18 mo old) mice were adoptively transferred with AMSCs. Two weeks later, mice were orally immunized with ovalbumin (OVA) plus cholera toxin (CT) three times at weekly intervals. Seven days after the final immunization, when fecal extract samples and plasma were subjected to OVA- and CT-B-specific ELISA, elevated levels of mucosal secretory IgA (SIgA) and plasma IgG antibody (Ab) responses were noted in aged mouse recipients. Similar results were also seen aged mice which received AMSCs at one year of age. When cytokine production was examined, OVA-stimulated Peyer’s patch CD4+ T cells produced increased levels of IL-4. Further, CD4+ T cells from the lamina propria revealed elevated levels of IL-4 and IFN-γ production. In contrast, aged mice without AMSC transfer showed essentially no OVA- or CT-B-specific mucosal SIgA or plasma IgG Ab or cytokine responses. Of importance, fecal extracts from AMSC transferred aged mice showed neutralization activity to CT intoxication. These results suggest that AMSCs can restore impaired mucosal immunity in the GI tract of aged mice. PMID:26840058

  4. 5-Lipoxygenase deficiency impairs innate and adaptive immune responses during fungal infection.


    Secatto, Adriana; Rodrigues, Lilian Cataldi; Serezani, Carlos Henrique; Ramos, Simone Gusmão; Dias-Baruffi, Marcelo; Faccioli, Lúcia Helena; Medeiros, Alexandra I


    5-Lipoxygenase-derived products have been implicated in both the inhibition and promotion of chronic infection. Here, we sought to investigate the roles of endogenous 5-lipoxygenase products and exogenous leukotrienes during Histoplasma capsulatum infection in vivo and in vitro. 5-LO deficiency led to increased lung CFU, decreased nitric oxide production and a deficient primary immune response during active fungal infection. Moreover, H. capsulatum-infected 5-LO(-/-) mice showed an intense influx of neutrophils and an impaired ability to generate and recruit effector T cells to the lung. The fungal susceptibility of 5-LO(-/-) mice correlated with a lower rate of macrophage ingestion of IgG-H. capsulatum relative to WT macrophages. Conversely, exogenous LTB4 and LTC4 restored macrophage phagocytosis in 5-LO deficient mice. Our results demonstrate that leukotrienes are required to control chronic fungal infection by amplifying both the innate and adaptive immune response during histoplasmosis.

  5. Negative regulatory responses to metabolically triggered inflammation impair renal epithelial immunity in diabetes mellitus.


    Chen, Nelson K F; Chong, Tsung Wen; Loh, Hwai-Liang; Lim, Kiat Hon; Gan, Valerie H L; Wang, Marian; Kon, Oi Lian


    Diabetes mellitus is characterized by chronic inflammation and increased risk of infections, particularly of tissues exposed to the external environment. However, the causal molecular mechanisms that affect immune cells and their functions in diabetes are unclear. Here we show, by transcript and protein analyses, signatures of glucose-induced tissue damage, chronic inflammation, oxidative stress, and dysregulated expression of multiple inflammation- and immunity-related molecules in diabetic kidneys compared with non-diabetic controls. Abnormal signaling involving cytokines, G-protein coupled receptors, protein kinase C isoforms, mitogen-activated protein kinases, nuclear factor-κB (NFκB), and Toll-like receptors (TLR) were evident. These were accompanied by overexpression of negative regulators of NFκB, TLR, and other proinflammatory pathways, e.g., A20, SOCS1, IRAK-M, IκBα, Triad3A, Tollip, SIGIRR, and ST2L. Anti-inflammatory and immunomodulatory molecules, e.g., IL-10, IL-4, and TSLP that favor TH2 responses were strongly induced. These molecular indicators of immune dysfunction led us to detect the cryptic presence of bacteria and human cytomegalovirus in more than one third of kidneys of diabetic subjects but none in non-diabetic kidneys. Similar signaling abnormalities could be induced in primary human renal tubular epithelial (but not mesangial) cell cultures exposed to high glucose, proinflammatory cytokines and methylglyoxal, and were reversed by combined pharmacological treatment with an antioxidant and a PKC inhibitor. Our results suggest that diabetes impairs epithelial immunity as a consequence of chronic and inappropriate activation of counter-regulatory immune responses, which are otherwise physiological protective mechanisms against inflammation. The immune abnormalities and cryptic renal infections described here may contribute to progression of diabetic nephropathy.

  6. Impaired macrophage autophagy increases the immune response in obese mice by promoting proinflammatory macrophage polarization

    PubMed Central

    Liu, Kun; Zhao, Enpeng; Ilyas, Ghulam; Lalazar, Gadi; Lin, Yu; Haseeb, Muhammad; Tanaka, Kathryn E; Czaja, Mark J


    Recent evidence that excessive lipid accumulation can decrease cellular levels of autophagy and that autophagy regulates immune responsiveness suggested that impaired macrophage autophagy may promote the increased innate immune activation that underlies obesity. Primary bone marrow-derived macrophages (BMDM) and peritoneal macrophages from high-fat diet (HFD)-fed mice had decreased levels of autophagic flux indicating a generalized impairment of macrophage autophagy in obese mice. To assess the effects of decreased macrophage autophagy on inflammation, mice with a Lyz2-Cre-mediated knockout of Atg5 in macrophages were fed a HFD and treated with low-dose lipopolysaccharide (LPS). Knockout mice developed systemic and hepatic inflammation with HFD feeding and LPS. This effect was liver specific as knockout mice did not have increased adipose tissue inflammation. The mechanism by which the loss of autophagy promoted inflammation was through the regulation of macrophage polarization. BMDM and Kupffer cells from knockout mice exhibited abnormalities in polarization with both increased proinflammatory M1 and decreased anti-inflammatory M2 polarization as determined by measures of genes and proteins. The heightened hepatic inflammatory response in HFD-fed, LPS-treated knockout mice led to liver injury without affecting steatosis. These findings demonstrate that autophagy has a critical regulatory function in macrophage polarization that downregulates inflammation. Defects in macrophage autophagy may underlie inflammatory disease states such as the decrease in macrophage autophagy with obesity that leads to hepatic inflammation and the progression to liver injury. PMID:25650776

  7. Impaired macrophage autophagy increases the immune response in obese mice by promoting proinflammatory macrophage polarization.


    Liu, Kun; Zhao, Enpeng; Ilyas, Ghulam; Lalazar, Gadi; Lin, Yu; Haseeb, Muhammad; Tanaka, Kathryn E; Czaja, Mark J


    Recent evidence that excessive lipid accumulation can decrease cellular levels of autophagy and that autophagy regulates immune responsiveness suggested that impaired macrophage autophagy may promote the increased innate immune activation that underlies obesity. Primary bone marrow-derived macrophages (BMDM) and peritoneal macrophages from high-fat diet (HFD)-fed mice had decreased levels of autophagic flux indicating a generalized impairment of macrophage autophagy in obese mice. To assess the effects of decreased macrophage autophagy on inflammation, mice with a Lyz2-Cre-mediated knockout of Atg5 in macrophages were fed a HFD and treated with low-dose lipopolysaccharide (LPS). Knockout mice developed systemic and hepatic inflammation with HFD feeding and LPS. This effect was liver specific as knockout mice did not have increased adipose tissue inflammation. The mechanism by which the loss of autophagy promoted inflammation was through the regulation of macrophage polarization. BMDM and Kupffer cells from knockout mice exhibited abnormalities in polarization with both increased proinflammatory M1 and decreased anti-inflammatory M2 polarization as determined by measures of genes and proteins. The heightened hepatic inflammatory response in HFD-fed, LPS-treated knockout mice led to liver injury without affecting steatosis. These findings demonstrate that autophagy has a critical regulatory function in macrophage polarization that downregulates inflammation. Defects in macrophage autophagy may underlie inflammatory disease states such as the decrease in macrophage autophagy with obesity that leads to hepatic inflammation and the progression to liver injury.

  8. Nitric oxide synthase inhibitor, aminoguanidine reduces intracerebroventricular colchicine induced neurodegeneration, memory impairments and changes of systemic immune responses in rats.


    Sil, Susmita; Ghosh, Tusharkanti; Ghosh, Rupsa; Gupta, Pritha


    Intracerebroventricular (i.c.v.) injection of colchicine induces neurodegeneration, memory impairments and changes of some systemic immune responses in rats. Though the role of cox 2 in these colchicine induced changes have been evaluated, the influence of nitric oxide synthase (NOS) remains to be studied. The present study was designed to assess the role of NOS on the i.c.v. colchicine induced neurodegeneration, memory impairments and changes of some systemic immune responses by inhibiting its activity with aminoguanidine. In the present study the impairments of working and reference memories, neurodegeneration (chromatolysis and plaque formation) and changes of neuroinflammatory markers in the hippocampus (increased TNF α, IL 1β, ROS and nitrite) along with changes of serum inflammatory markers (TNF α, IL 1β, ROS and nitrite) and alteration of systemic immune responses (higher phagocytic activity of blood WBC and splenic PMN, higher cytotoxicity and lower leukocyte adhesion inhibition index of splenic MNC) were measured in the intracerebroventricular colchicine injected rats (ICIR). Administration of aminoguanidine (p.o. 30/50mg/kg body weight) to ICIR resulted in recovery of neuroinflammation and partial prevention of neurodegeneration which could be corroborated with the partial recovery of memory impairments in this model. The recovery of serum inflammatory markers and the systemic immune responses in ICIR was also observed after administration of aminoguanidine. Therefore, the present study shows that aminoguanidine can protect the colchicine induced neurodegeneration, memory impairments, and changes of systemic immune systemic responses in ICIR by inhibiting the iNOS.

  9. Impaired primary immune response in type-1 diabetes: results from a controlled vaccination study.


    Eibl, Nicole; Spatz, Martin; Fischer, Gottfried F; Mayr, Wolfgang R; Samstag, Aysen; Wolf, Hermann M; Schernthaner, Guntram; Eibl, Martha M


    Patients with diabetes have an increased risk for infections, but information on their adoptive immunity is incomplete and contradictory. Twenty patients with diabetes type-1 and 20 patients with type-2 diabetes were vaccinated with T-cell-dependent primary protein antigens (hepatitis A viral antigen, HAV; diphtheria toxoid) and a T-cell-independent polysaccharide antigen (pneumococcal polysaccharide). In parallel, the proliferative response of CD4+ T-cells to the primary protein antigens keyhole limpet hemocyanin (KLH) and sperm whale myoglobin (SWM) was measured in vitro using monocyte-derived dendritic cells (MDDC) as antigen-presenting cells. Compared to healthy controls, type-1 diabetes patients mounted a significantly impaired primary antibody response to hepatitis A vaccine (median HAV antibody titer after the first vaccination, 53 IU/L in diabetic patients vs 212 IU/L in the controls, P = 0.017) and diphtheria toxoid (median serum antibodies after vaccination, patients, 0.94 IU/ml, controls, 6.38 IU/ml, P = 0.004), while the response to pneumococcal polysaccharide was normal. Type-2 diabetes patients had a comparable metabolic dysregulation but showed a normal antibody response following vaccination, demonstrating that the effect was not due to hyperglycemia. Antigen-induced interferon-gamma and interleukin-13 release was reduced in type-1 diabetes patients, localizing the impairment to the level of antigen-presenting cell-T-cell interaction. In addition, the proliferative response of CD4+ T-cells derived from type-1 diabetes patients to KLH and SWM was significantly reduced (P < or = 0.01). FACS analysis of CD80 (B7.1), CD86 (B7.2), and HLA-DR expression on MDDC could not demonstrate significant differences in the expression of these molecules between type-1 and type-2 diabetes patients and healthy controls. An association of low HAV antibody response with HLA-DR3,4 expression in the patients was shown. Our results indicate that the primary antibody

  10. Skin inflammation arising from cutaneous Treg deficiency leads to impaired viral immune responses1

    PubMed Central

    Freyschmidt, Eva-Jasmin; Mathias, Clinton B.; Diaz, Natalia; MacArthur, Daniel H.; Laouar, Amale; Manjunath, Narasimhaswamy; Hofer, Matthias D.; Wurbel, Marc-Andre; Campbell, James J.; Chatila, Talal A.; Oettgen, Hans C.


    Individuals with atopic dermatitis (AD) immunized with the small pox vaccine, vaccinia virus (VV), are susceptible to eczema vaccinatum (EV), a potentially-fatal disseminated infection. Dysfunction of FoxP3+ regulatory T cells (Treg) has been implicated in the pathogenesis of AD. To test whether Treg-deficiency predisposes to EV, we percutaneously VV-infected FoxP3-deficient (FoxP3KO) mice, which completely lack FoxP3+ Treg. These animals generated both fewer VV-specific CD8+ effector T cells and interferon-γ producing CD8+ T cells than controls, had higher viral loads and exhibited abnormal Th2 polarized responses to the virus. To focus on the consequences of Treg deficiency confined to the skin, we generated mixed CCR4KO FoxP3KO bone marrow (CCR4/FoxP3) chimeras in which skin, but not other tissues or central lymphoid organs, lack Treg. Like FoxP3KO mice, the chimeras had impaired VV-specific effector T cell responses and higher viral loads. Skin cytokine expression was significantly altered in infected chimeras compared to controls. Levels of the antiviral cytokines, type I and II interferons and IL-12, were reduced whereas expression of the proinflammatory cytokines, IL-6, IL-10, TGF-β and IL-23, was increased. Importantly, infection of CCR4/FoxP3 chimeras by a non-cutaneous route (i.p.) induced immune responses comparable to controls. Our findings implicate allergic skin inflammation resulting from local Treg deficiency in the pathogenesis of EV. PMID:20548030

  11. Skin inflammation arising from cutaneous regulatory T cell deficiency leads to impaired viral immune responses.


    Freyschmidt, Eva-Jasmin; Mathias, Clinton B; Diaz, Natalia; MacArthur, Daniel H; Laouar, Amale; Manjunath, Narasimhaswamy; Hofer, Matthias D; Wurbel, Marc-Andre; Campbell, James J; Chatila, Talal A; Oettgen, Hans C


    Individuals with atopic dermatitis immunized with the small pox vaccine, vaccinia virus (VV), are susceptible to eczema vaccinatum (EV), a potentially fatal disseminated infection. Dysfunction of Forkhead box P3 (FoxP3)-positive regulatory T cells (Treg) has been implicated in the pathogenesis of atopic dermatitis. To test whether Treg deficiency predisposes to EV, we percutaneously VV infected FoxP3-deficient (FoxP3(KO)) mice, which completely lack FoxP3(+) Treg. These animals generated both fewer VV-specific CD8(+) effector T cells and IFN-gamma-producing CD8(+) T cells than controls, had higher viral loads, and exhibited abnormal Th2-polarized responses to the virus. To focus on the consequences of Treg deficiency confined to the skin, we generated mixed CCR4(KO) FoxP3(KO) bone marrow (CCR4/FoxP3) chimeras in which skin, but not other tissues or central lymphoid organs, lack Treg. Like FoxP3(KO) mice, the chimeras had impaired VV-specific effector T cell responses and higher viral loads. Skin cytokine expression was significantly altered in infected chimeras compared with controls. Levels of the antiviral cytokines, type I and II IFNs and IL-12, were reduced, whereas expression of the proinflammatory cytokines, IL-6, IL-10, TGF-beta, and IL-23, was increased. Importantly, infection of CCR4/FoxP3 chimeras by a noncutaneous route (i.p.) induced immune responses comparable to controls. Our findings implicate allergic skin inflammation resulting from local Treg deficiency in the pathogenesis of EV.

  12. Microbial Degradation of Cellular Kinases Impairs Innate Immune Signaling and Paracrine TNFα Responses.


    Barth, Kenneth; Genco, Caroline Attardo


    The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses.

  13. Microbial Degradation of Cellular Kinases Impairs Innate Immune Signaling and Paracrine TNFα Responses

    PubMed Central

    Barth, Kenneth; Genco, Caroline Attardo


    The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses. PMID:27698456

  14. Impaired neuroendocrine and immune response to acute stress in medication-naive patients with a first episode of psychosis.


    van Venrooij, Janine A E M; Fluitman, Sjoerd B A H A; Lijmer, Jeroen G; Kavelaars, Annemieke; Heijnen, Cobi J; Westenberg, Herman G M; Kahn, René S; Gispen-de Wied, Christine C


    Little is known about how the biological stress response systems--the autonomic nervous system (ANS), the hypothalamic-pituitary-adrenal (HPA) axis, and the immune system--function during psychosis. Results of studies on the effect of stress on the immune and autonomic system in patients with schizophrenia are inconsistent. The present study investigates whether the stress response is impaired in medication-naive patients with a first episode of psychosis. Ten male patients with a first episode of psychosis and 15 controls were exposed to the stress of public speaking. Parameters of the ANS (heart rate and catecholamines), the HPA axis (plasma adrenocorticotropic hormone [ACTH] and cortisol), and the immune system (number and activity of natural killer [NK] cells) were measured. Peak responses were calculated to examine the relationship between stress-induced activation of the different systems. Subjective stress and anxiety before and during the task were assessed. Patients and controls displayed similar autonomic responses to acute stress. However, there was an impaired HPA axis response, slow onset and return of ACTH, and flattened cortisol response and a reduced increase in number NK cells and NK cell activity in patients with a first episode of psychosis. Furthermore, in patients, the relationship between the different stress response systems was weaker or absent compared with controls. These findings indicate that impairments in stress processing are associated with the endophenotype of psychosis and are not a result of illness progression or antipsychotic medication.

  15. Selection for brain size impairs innate, but not adaptive immune responses

    PubMed Central

    Kotrschal, Alexander; Kolm, Niclas; Penn, Dustin J.


    Both the brain and the immune system are energetically demanding organs, and when natural selection favours increased investment into one, then the size or performance of the other should be reduced. While comparative analyses have attempted to test this potential evolutionary trade-off, the results remain inconclusive. To test this hypothesis, we compared the tissue graft rejection (an assay for measuring innate and acquired immune responses) in guppies (Poecilia reticulata) artificially selected for large and small relative brain size. Individual scales were transplanted between pairs of fish, creating reciprocal allografts, and the rejection reaction was scored over 8 days (before acquired immunity develops). Acquired immune responses were tested two weeks later, when the same pairs of fish received a second set of allografts and were scored again. Compared with large-brained animals, small-brained animals of both sexes mounted a significantly stronger rejection response to the first allograft. The rejection response to the second set of allografts did not differ between large- and small-brained fish. Our results show that selection for large brain size reduced innate immune responses to an allograft, which supports the hypothesis that there is a selective trade-off between investing into brain size and innate immunity. PMID:26962144

  16. Human Immunodeficiency Virus-1 Inhibition of Immunoamphisomes in Dendritic Cells Impairs Early Innate and Adaptive Immune Responses

    PubMed Central

    Blanchet, Fabien P.; Moris, Arnaud; Nikolic, Damjan S.; Lehmann, Martin; Cardinaud, Sylvain; Stalder, Romaine; Garcia, Eduardo; Dinkins, Christina; Leuba, Florence; Wu, Li; Schwartz, Olivier; Deretic, Vojo; Piguet, Vincent


    SUMMARY Dendritic cells (DCs) in mucosal surfaces are early targets for human immunodeficiency virus-1 (HIV-1). DCs mount rapid and robust immune responses upon pathogen encounter. However, immune response in the early events of HIV-1 transmission appears limited, suggesting that HIV-1 evade early immune control by DCs. We report that HIV-1 induces a rapid shutdown of autophagy and immunoamphisomes in DCs. HIV-1 envelope activated the mammalian target of rapamycin pathway in DCs, leading to autophagy exhaustion. HIV-1-induced inhibition of autophagy in DC increased cell-associated HIV-1 and transfer of HIV-1 infection to CD4+ T cells. HIV-1-mediated downregulation of autophagy in DCs impaired innate and adaptive immune responses. Immunoamphisomes in DCs engulf incoming pathogens and appear to amplify pathogen degradation as well as Toll-like receptor responses and antigen presentation. The findings that HIV-1 downregulates autophagy and impedes immune functions of DCs represent a pathogenesis mechanism that can be pharmacologically countered with therapeutic and prophylactic implications. PMID:20451412

  17. Impaired cellular immune response to diphtheria and tetanus vaccines in children after thoracic transplantation.


    Urschel, Simon; Rieck, Birgit D; Birnbaum, Julia; Dalla Pozza, Robert; Rieber, Nikolaus; Januszewska, Katarzyna; Fuchs, Alexandra; West, Lori J; Netz, Heinrich; Belohradsky, Bernd H


    Safety and immunogenicity of diphtheria and tetanus booster vaccination were evaluated in 28 children after thoracic transplantation. Adverse events were documented in a patient diary. Blood was collected prior to and four wk after vaccination. Specific antibody concentrations were measured by ELISA. Lymphocytes were investigated for expression of activation markers (CD25, HLA-DR) by flow cytometry and proliferation assays with and without stimulation. Post-vaccination antibody titers were higher than prevaccination (p < 0.001), with more patients having protective antibody levels against diphtheria (p < 0.02) and tetanus (p < 0.001). There was no increased proliferation in non-stimulated or stimulated cultures after vaccination. The number of T-lymphocytes activated by the vaccination antigens was similar pre- and post-vaccination, whereas HLA-DR-expression on stimulated and non-stimulated CD4(+) T-cells increased significantly. Increase in antibodies was negatively correlated with tacrolimus dose, and impaired cellular immunity was associated with higher tacrolimus dose and steroid use. Adverse events were similar to the general population; serious adverse events and rejection did not occur. Vaccination with inactivated vaccines can be performed safely in immunosuppressed children after thoracic transplantation and induces protective antibody levels in the majority of patients. Impaired induction of specific cellular immunity is correlated with intensity of immunosuppression and may explain reduced sustainability of antibodies.

  18. Impairment of the humoral and CD4(+) T cell responses in HTLV-1-infected individuals immunized with tetanus toxoid.


    Souza, Anselmo; Santos, Silvane; Carvalho, Lucas P; Grassi, Maria Fernanda R; Carvalho, Edgar M


    T cells from HTLV-1-infected individuals have a decreased ability to proliferate after stimulation with recall antigens. This abnormality may be due to the production of regulatory cytokine or a dysfunctional antigen presentation. The aims of this study were to evaluate the antibody production and cytokine expression by lymphocytes before and after immunization with tetanus toxoid (TT) and to evaluate the immune response of monocytes after stimulation with TT and frequency of dendritic cells (DC) subsets. HTLV-1 carriers (HC) and uninfected controls (UC) with negative serology for TT were immunized with TT, and the antibody titers were determined by ELISA as well as the cell activation markers expression by monocytes. The frequencies of DC subsets were determined by flow cytometry. Following immunization, the IgG anti-TT titers and the frequency of CD4(+) T cells expressing IFN-γ, TNF-α and IL-10 in response to TT were lower in the HC than in the UC. Additionally, monocytes from HC did not exhibit increased HLA-DR expression after stimulation with TT, and presented low numbers of DC subsets, therefore, it's necessary to perform functional studies with antigen-presenting cells. Collectively, our finding suggests that HC present an impairment of the humoral and CD4(+) T cell immune responses after vaccination.

  19. Protein malnutrition impairs the immune response and influences the severity of infection in a hamster model of chronic visceral leishmaniasis.


    Carrillo, Eugenia; Jimenez, Maria Angeles; Sanchez, Carmen; Cunha, Joana; Martins, Camila Marinelli; da Paixão Sevá, Anaiá; Moreno, Javier


    Leishmaniasis remains one of the world's most devastating neglected tropical diseases. It mainly affects developing countries, where it often co-exists with chronic malnutrition, one of the main risk factors for developing the disease. Few studies have been published, however, on the relationship between leishmaniasis progression and malnutrition. The present paper reports the influence of protein malnutrition on the immune response and visceral disease development in adult hamsters infected with Leishmania infantum fed either standard or low protein diets. The low protein diet induced severe malnutrition in these animals, and upon infection with L. infantum 33% had severe visceral leishmaniasis compared to only 8% of animals fed the standard diet. The infected, malnourished animals showed notable leukocyte depletion, mild specific antibody responses, impairment of lymphoproliferation, presence of parasites in blood (16.67% of the hamsters) and significant increase of the splenic parasite burden. Animals fed standard diet suffered agranulocytosis and monocytopenia, but showed stronger specific immune responses and had lower parasite loads than their malnourished counterparts. The present results show that protein malnutrition promotes visceral leishmaniasis and provide clues regarding the mechanisms underlying the impairment of the immune system.

  20. Protein Malnutrition Impairs the Immune Response and Influences the Severity of Infection in a Hamster Model of Chronic Visceral Leishmaniasis

    PubMed Central

    Carrillo, Eugenia; Jimenez, Mª Angeles; Sanchez, Carmen; Cunha, Joana; Martins, Camila Marinelli; da Paixão Sevá, Anaiá; Moreno, Javier


    Leishmaniasis remains one of the world's most devastating neglected tropical diseases. It mainly affects developing countries, where it often co-exists with chronic malnutrition, one of the main risk factors for developing the disease. Few studies have been published, however, on the relationship between leishmaniasis progression and malnutrition. The present paper reports the influence of protein malnutrition on the immune response and visceral disease development in adult hamsters infected with Leishmania infantum fed either standard or low protein diets. The low protein diet induced severe malnutrition in these animals, and upon infection with L. infantum 33% had severe visceral leishmaniasis compared to only 8% of animals fed the standard diet. The infected, malnourished animals showed notable leukocyte depletion, mild specific antibody responses, impairment of lymphoproliferation, presence of parasites in blood (16.67% of the hamsters) and significant increase of the splenic parasite burden. Animals fed standard diet suffered agranulocytosis and monocytopenia, but showed stronger specific immune responses and had lower parasite loads than their malnourished counterparts. The present results show that protein malnutrition promotes visceral leishmaniasis and provide clues regarding the mechanisms underlying the impairment of the immune system. PMID:24586759

  1. Dectin-3 Deficiency Promotes Colitis Development due to Impaired Antifungal Innate Immune Responses in the Gut

    PubMed Central

    Wang, Tingting; Pan, Deng; Zhou, Zhicheng; You, Yun; Jiang, Changying; Zhao, Xueqiang; Lin, Xin


    Interactions between commensal fungi and gut immune system are critical for establishing colonic homeostasis. Here we found that mice deficient in Dectin-3 (Clec4d-/-), a C-type lectin receptor that senses fungal infection, were more susceptible to dextran sodium sulfate (DSS)-induced colitis compared with wild-type mice. The specific fungal burden of Candida (C.) tropicalis was markedly increased in the gut after DSS treatment in Clec4d-/- mice, and supplementation with C. tropicalis aggravated colitis only in Clec4d-/- mice, but not in wild-type controls. Mechanistically, Dectin-3 deficiency impairs phagocytic and fungicidal abilities of macrophages, and C. tropicalis-induced NF-κB activation and cytokine production. The conditioned media derived from Dectin-3-deficient macrophages were defective in promoting tissue repairing in colonic epithelial cells. Finally, anti-fungal therapy was effective in treating colitis in Clec4d-/- mice. These studies identified the role of Dectin-3 and its functional interaction with commensal fungi in intestinal immune system and regulation of colonic homeostasis. PMID:27280399

  2. Impairment of humoral immune responses in mice exposed to nitrogen dioxide and ozone mixtures

    SciTech Connect

    Fujimaki, H.


    The relationship between immune defense mechanisms and environmental pollutants remains unknown because of uncertainty about the effects of combined or mixed pollutants. To investigate whether exposure to toxic gas mixtures change the effect of a single gas exposure on immune function, BALB/c mice were continuously exposed to 4.0 ppm nitrogen dioxide (NO/sub 2/), 0.8 ppm ozone (O/sub 3/), or the mixture of NO/sub 2/ plus O/sub 3/ for 3, 7, 14, and 56 days. Organ weights (lung, thymus, and spleen) and antibody responses to sheep red blood cells (SRBC), and to DNP-Ficoll were measured immediately after the exposure. Lung weights in mice exposed to O/sub 3/ or the mixture were increased significantly in all exposure periods. The weights of thymus and spleen in mice exposed for 3, 7, and 14 days to the mixture were decreased. O/sub 3/ exposure for 56 days showed significant decreases of the weights of both organs. Antibody response to SRBC in mice exposed for 3, 7, and 14 days to O/sub 3/ or the mixture was markedly suppressed, but exposure to the mixture for 56 days did not show the suppression of anti-SRBC antibody response. No differences in anti-DNP antibody response between exposed and control mice were observed, except those exposed to O/sub 3/ or the mixture for 14 days. These results suggest that mixed gas exposures variously modify the effects of a single gas exposure on antibody production in mice.

  3. Obesity Is Not Associated with Impaired Immune Response to Influenza Vaccination in HIV-Infected Persons

    PubMed Central

    Gowda, Charitha; McKittrick, Noah; Kim, Deborah; Kappes, Rosemarie A.; Lo Re, Vincent; Tebas, Pablo


    Introduction. HIV-infected individuals demonstrate lower immunogenicity to the influenza vaccine, despite immunologic and virologic control of HIV infection. Obesity has been previously shown to be associated with diminished antibody responses to other vaccines in HIV-uninfected persons. However, no studies have examined if obesity is associated with diminished protective immune response to influenza vaccination among HIV-infected persons on antiretroviral therapy (ART). Methods. We performed a retrospective analysis of immunogenicity data from a clinical trial of inactivated, trivalent influenza vaccine. The primary endpoint was the proportion of participants with seroconversion, defined as >4-fold increase in anti-hemagglutinin antibody titers after vaccination. Secondary endpoints were the proportion of participants with seroprotection (defined as antibody titers of ≥1 : 40) and geometric mean hemagglutination inhibition antibody titers. Results. Overall, 48 (27%) participants were obese (body mass index ≥ 30 kg/m2). Seroconversion rates were comparable between obese and nonobese subjects for all three vaccine strains. Further, postvaccination geometric mean titers did not differ by body mass index category. Conclusion. Obesity was not associated with diminished antibody response to influenza vaccination in a sample of healthy HIV-infected persons. PMID:26576297

  4. Obesity Is Not Associated with Impaired Immune Response to Influenza Vaccination in HIV-Infected Persons.


    Gowda, Charitha; McKittrick, Noah; Kim, Deborah; Kappes, Rosemarie A; Lo Re, Vincent; Tebas, Pablo


    Introduction. HIV-infected individuals demonstrate lower immunogenicity to the influenza vaccine, despite immunologic and virologic control of HIV infection. Obesity has been previously shown to be associated with diminished antibody responses to other vaccines in HIV-uninfected persons. However, no studies have examined if obesity is associated with diminished protective immune response to influenza vaccination among HIV-infected persons on antiretroviral therapy (ART). Methods. We performed a retrospective analysis of immunogenicity data from a clinical trial of inactivated, trivalent influenza vaccine. The primary endpoint was the proportion of participants with seroconversion, defined as >4-fold increase in anti-hemagglutinin antibody titers after vaccination. Secondary endpoints were the proportion of participants with seroprotection (defined as antibody titers of ≥1 : 40) and geometric mean hemagglutination inhibition antibody titers. Results. Overall, 48 (27%) participants were obese (body mass index ≥ 30 kg/m(2)). Seroconversion rates were comparable between obese and nonobese subjects for all three vaccine strains. Further, postvaccination geometric mean titers did not differ by body mass index category. Conclusion. Obesity was not associated with diminished antibody response to influenza vaccination in a sample of healthy HIV-infected persons.

  5. Cannabidiol reduces host immune response and prevents cognitive impairments in Wistar rats submitted to pneumococcal meningitis.


    Barichello, Tatiana; Ceretta, Renan A; Generoso, Jaqueline S; Moreira, Ana Paula; Simões, Lutiana R; Comim, Clarissa M; Quevedo, João; Vilela, Márcia Carvalho; Zuardi, Antonio Waldo; Crippa, José A; Teixeira, Antônio Lucio


    Pneumococcal meningitis is a life-threatening disease characterized by an acute infection affecting the pia matter, arachnoid and subarachnoid space. The intense inflammatory response is associated with a significant mortality rate and neurologic sequelae, such as, seizures, sensory-motor deficits and impairment of learning and memory. The aim of this study was to evaluate the effects of acute and extended administration of cannabidiol on pro-inflammatory cytokines and behavioral parameters in adult Wistar rats submitted to pneumococcal meningitis. Male Wistar rats underwent a cisterna magna tap and received either 10μl of sterile saline as a placebo or an equivalent volume of S. pneumoniae suspension. Rats subjected to meningitis were treated by intraperitoneal injection with cannabidiol (2.5, 5, or 10mg/kg once or daily for 9 days after meningitis induction) or a placebo. Six hours after meningitis induction, the rats that received one dose were killed and the hippocampus and frontal cortex were obtained to assess cytokines/chemokine and brain-derived neurotrophic factor levels. On the 10th day, the rats were submitted to the inhibitory avoidance task. After the task, the animals were killed and samples from the hippocampus and frontal cortex were obtained. The extended administration of cannabidiol at different doses reduced the TNF-α level in frontal cortex. Prolonged treatment with canabidiol, 10mg/kg, prevented memory impairment in rats with pneumococcal meningitis. Although descriptive, our results demonstrate that cannabidiol has anti-inflammatory effects in pneumococcal meningitis and prevents cognitive sequel.

  6. Immune response

    MedlinePlus Videos and Cool Tools

    The immune system includes specialized white blood cells, called lymphocytes that adapt themselves to fight specific foreign invaders. These cells develop into two groups in the bone marrow. From the bone ...

  7. Impaired cellular immune response to tetanus toxoid but not to cytomegalovirus in effectively HAART-treated HIV-infected children.


    Alsina, Laia; Noguera-Julian, Antoni; Fortuny, Clàudia


    Despite of highly active antiretroviral therapy, the response to vaccines in HIV-infected children is poor and short-lived, probably due to a defect in cellular immune responses. We compared the cellular immune response (assessed in terms of IFN-γ production) to tetanus toxoid and to cytomegalovirus in a series of 13 HIV-perinatally-infected children and adolescents with optimal immunovirological response to first line antiretroviral therapy, implemented during chronic infection. A stronger cellular response to cytomegalovirus (11 out of 13 patients) was observed, as compared to tetanus toxoid (1 out of 13; p=0.003). These results suggest that the repeated exposition to CMV, as opposed to the past exposition to TT, is able to maintain an effective antigen-specific immune response in stable HIV-infected pediatric patients and strengthen current recommendations on immunization practices in these children.

  8. T-2 toxin impairs murine immune response to respiratory reovirus and exacerbates viral bronchiolitis

    SciTech Connect

    Li Maoxiang; Harkema, Jack R.; Islam, Zahidul; Cuff, Chistopher F.; Pestka, James J. . E-mail:


    Exposure to immunosuppressive environmental contaminants is a possible contributing factor to increased occurrence of viral respiratory diseases. The objective of this study was to test the hypothesis that the trichothecene mycotoxin T-2 toxin (T-2), a frequent food contaminant, alters host resistance to lung infection by reovirus, a model respiratory virus. Balb/c mice (4 week old) were treated intraperitoneally with T-2 toxin (1.75 mg/kg bw) or saline vehicle and then intranasally instilled 2 h later with 10{sup 7} plaque forming unit (PFU) of reovirus, strain Lang (T1/L) or saline vehicle. At 10 days post-instillation (PI), both virus plaque-forming responses and reovirus L2 gene expression were 10-fold higher in lungs of T-2-treated mice compared to controls. No-effect and lowest-effect levels for T-2-induced suppression of reovirus clearance were 20 and 200 {mu}g/kg bw, respectively. Respiratory reovirus infection resulted in a mild bronchiolitis with minimal alveolitis, which was markedly exacerbated by T-2 pretreatment. Reovirus exposure induced marked increases in total cells, neutrophils and lymphocytes at 3 and 7 days PI in bronchial alveolar lavage fluid (BALF) whereas macrophages were increased only at 7 days PI. Although prior T-2 exposure attenuated total cell and macrophage counts in BALF of control and infected mice at 3 days PI, the toxin potentiated total cell, macrophage, neutrophil and lymphocyte counts in infected mice at 7 days PI. At 3 days PI, T-2 suppressed reovirus-induced IFN-{gamma} elevation in BALF, but enhanced production of IL-6 and MCP-1. T-2 pretreatment also suppressed reovirus-specific mucosal IgA responses in lung and enteric tract, but potentiated serum IgA and IgG responses. Taken together, T-2 increased lung viral burden, bronchopneumonia and pulmonary cellular infiltration in reovirus-infected mice. These effects might be attributable to reduced alveolar macrophage levels as well as modulated cytokine and mucosal Ig

  9. Cellular immune responses to HIV

    NASA Astrophysics Data System (ADS)

    McMichael, Andrew J.; Rowland-Jones, Sarah L.


    The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.

  10. Perinatal Exposure to a Low Dose of Bisphenol A Impaired Systemic Cellular Immune Response and Predisposes Young Rats to Intestinal Parasitic Infection

    PubMed Central

    Ménard, Sandrine; Guzylack-Piriou, Laurence; Lencina, Corinne; Leveque, Mathilde; Naturel, Manon; Sekkal, Soraya; Harkat, Cherryl; Gaultier, Eric; Olier, Maïwenn; Garcia-Villar, Raphael; Theodorou, Vassilia; Houdeau, Eric


    Perinatal exposure to the food contaminant bisphenol A (BPA) in rats induces long lasting adverse effects on intestinal immune homeostasis. This study was aimed at examining the immune response to dietary antigens and the clearance of parasites in young rats at the end of perinatal exposure to a low dose of BPA. Female rats were fed with BPA [5 µg/kg of body weight/day] or vehicle from gestational day 15 to pup weaning. Juvenile female offspring (day (D)25) were used to analyze immune cell populations, humoral and cellular responses after oral tolerance or immunization protocol to ovalbumin (OVA), and susceptibility to infection by the intestinal nematode Nippostrongylus brasiliensis (N. brasiliensis). Anti-OVA IgG titers following either oral tolerance or immunization were not affected after BPA perinatal exposure, while a sharp decrease in OVA-induced IFNγ secretion occurred in spleen and mesenteric lymph nodes (MLN) of OVA-immunized rats. These results are consistent with a decreased number of helper T cells, regulatory T cells and dendritic cells in spleen and MLN of BPA-exposed rats. The lack of cellular response to antigens questioned the ability of BPA-exposed rats to clear intestinal infections. A 1.5-fold increase in N. brasiliensis living larvae was observed in the intestine of BPA-exposed rats compared to controls due to an inappropriate Th1/Th2 cytokine production in infected jejunal tissues. These results show that perinatal BPA exposure impairs cellular response to food antigens, and increases susceptibility to intestinal parasitic infection in the juveniles. This emphasized the maturing immune system during perinatal period highly sensitive to low dose exposure to BPA, altering innate and adaptative immune response capacities in early life. PMID:25415191

  11. Absorption of PCB126 by upper airways impairs G protein-coupled receptor-mediated immune response

    NASA Astrophysics Data System (ADS)

    Shimada, Ana Lúcia B.; Cruz, Wesley S.; Loiola, Rodrigo A.; Drewes, Carine C.; Dörr, Fabiane; Figueiredo, Natália G.; Pinto, Ernani; Farsky, Sandra H. P.


    PCB126 is a dioxin-like polychlorinated biphenyl (PCB) environmental pollutant with a significant impact on human health, as it bioaccumulates and causes severe toxicity. PCB126-induced immune toxicity has been described, although the mechanisms have not been fully elucidated. In this study, an in vivo protocol of PCB126 intoxication into male Wistar rats by intranasal route was used, which has not yet been described. The intoxication was characterised by PCB126 accumulation in the lungs and liver, and enhanced aryl hydrocarbon receptor expression in the liver, lungs, kidneys, and adipose tissues. Moreover, an innate immune deficiency was characterised by impairment of adhesion receptors on blood leukocytes and by reduced blood neutrophil locomotion and oxidative burst activation elicited by ex vivo G protein-coupled receptor (GPCR) activation. Specificity of PCB126 actions on the GPCR pathway was shown by normal burst oxidative activation evoked by Toll-like receptor 4 and protein kinase C direct activation. Moreover, in vivo PCB180 intoxication did not alter adhesion receptors on blood leukocytes either blood neutrophil locomotion, and only partially reduced the GPCR-induced burst oxidative activation on neutrophils. Therefore, a novel mechanism of in vivo PCB126 toxicity is described which impairs a pivotal inflammatory pathway to the host defence against infections.

  12. Leptin Regulation of Immune Responses.


    Naylor, Caitlin; Petri, William A


    Leptin is a regulatory hormone with multiple roles in the immune system. We favor the concept that leptin signaling 'licenses' various immune cells to engage in immune responses and/or to differentiate. Leptin is an inflammatory molecule that is capable of activating both adaptive and innate immunity. It can also 'enhance' immune functions, including inflammatory cytokine production in macrophages, granulocyte chemotaxis, and increased Th17 proliferation. Leptin can also 'inhibit' cells; CD4(+) T cells are inhibited from differentiating into regulatory T cells in the presence of elevated leptin, while NK cells can exhibit impaired cytotoxicity under the same circumstances. Consequently, understanding the effect of leptin signaling is important to appreciate various aspects of immune dysregulation observed in malnutrition, obesity, and autoimmunity.

  13. No change in impaired cellular immune response of HIV-negative homosexuals after 15 years of HIV epidemic in Eastern/Central European region.


    Barabás, E; González, R; Nagy, K; Várkonyi, V; Horváth, A


    Impaired cell-mediated immune reactivity to polyclonal mitogens was determined in HIV-negative homosexual men (HIV-MSM). Results were compared to those we reported in a complex clinical and immunological investigation in the same risk groups 15 years ago, before the onset of the AIDS epidemic in Hungary. Cellular immune reactivity to polyclonal mitogens was studied in 74 HIV-infected or HIV-uninfected homosexual men and heterosexual controls. Lymphocytes in whole-blood cultures were stimulated with various doses of phytohaemagglutinin (PHA), concanavalin-A (Con-A), and pokeweed mitogen (PWM) in a blast transformation assay. A significant difference (p = .0002) in lymphocyte proliferation between HIV-MSM vs. heterosexuals using PWM in both concentrations was found. Proliferative capacity was similar in HIV- MSM and HIV infected males with CD4+ > 500/microl. Con-A and PHA showed a less expressed proliferative response. Decreased lymphocyte reactivity to PWM, similar to the one in early HIV infection, could be observed in HIV-MSM. This HIV-independent mild immunodeficiency in MSM is a sign of an increased susceptibility and predisposes to subsequent HIV infection. It seems, however, that MSM's impaired immune response observed over a period of 15 years is an immunodeficiency not changed by the emerging HIV/AIDS epidemic. Our study provides an explanation why the incidence of new HIV cases in homo-/bisexual individuals is still high (> 70%), and it indicates that it remains high in Hungary.

  14. Divergent Annexin A1 expression in periphery and gut is associated with systemic immune activation and impaired gut immune response during SIV infection.


    Sena, Angela A S; Glavan, Tiffany; Jiang, Guochun; Sankaran-Walters, Sumathi; Grishina, Irina; Dandekar, Satya; Goulart, Luiz R


    HIV-1 disease progression is paradoxically characterized by systemic chronic immune activation and gut mucosal immune dysfunction, which is not fully defined. Annexin A1 (ANXA1), an inflammation modulator, is a potential link between systemic inflammation and gut immune dysfunction during the simian immunodeficiency virus (SIV) infection. Gene expression of ANXA1 and cytokines were assessed in therapy-naïve rhesus macaques during early and chronic stages of SIV infection and compared with SIV-negative controls. ANXA1 expression was suppressed in the gut but systemically increased during early infection. Conversely, ANXA1 expression increased in both compartments during chronic infection. ANXA1 expression in peripheral blood was positively correlated with HLA-DR+CD4+ and CD8+ T-cell frequencies, and negatively associated with the expression of pro-inflammatory cytokines and CCR5. In contrast, the gut mucosa presented an anergic cytokine profile in relation to ANXA1 expression. In vitro stimulations with ANXA1 peptide resulted in decreased inflammatory response in PBMC but increased activation of gut lymphocytes. Our findings suggest that ANXA1 signaling is dysfunctional in SIV infection, and may contribute to chronic inflammation in periphery and with immune dysfunction in the gut mucosa. Thus, ANXA1 signaling may be a novel therapeutic target for the resolution of immune dysfunction in HIV infection.

  15. Divergent Annexin A1 expression in periphery and gut is associated with systemic immune activation and impaired gut immune response during SIV infection

    PubMed Central

    Sena, Angela A. S.; Glavan, Tiffany; Jiang, Guochun; Sankaran-Walters, Sumathi; Grishina, Irina; Dandekar, Satya; Goulart, Luiz R.


    HIV-1 disease progression is paradoxically characterized by systemic chronic immune activation and gut mucosal immune dysfunction, which is not fully defined. Annexin A1 (ANXA1), an inflammation modulator, is a potential link between systemic inflammation and gut immune dysfunction during the simian immunodeficiency virus (SIV) infection. Gene expression of ANXA1 and cytokines were assessed in therapy-naïve rhesus macaques during early and chronic stages of SIV infection and compared with SIV-negative controls. ANXA1 expression was suppressed in the gut but systemically increased during early infection. Conversely, ANXA1 expression increased in both compartments during chronic infection. ANXA1 expression in peripheral blood was positively correlated with HLA-DR+CD4+ and CD8+ T-cell frequencies, and negatively associated with the expression of pro-inflammatory cytokines and CCR5. In contrast, the gut mucosa presented an anergic cytokine profile in relation to ANXA1 expression. In vitro stimulations with ANXA1 peptide resulted in decreased inflammatory response in PBMC but increased activation of gut lymphocytes. Our findings suggest that ANXA1 signaling is dysfunctional in SIV infection, and may contribute to chronic inflammation in periphery and with immune dysfunction in the gut mucosa. Thus, ANXA1 signaling may be a novel therapeutic target for the resolution of immune dysfunction in HIV infection. PMID:27484833

  16. Impaired T Cell-dependent Humoral Immune Response Associated with Juvenile-onset Recurrent Respiratory Papillomatosis Progression

    PubMed Central

    Wu, Xunyao; Wang, Guoliang; Chen, Xi; Zhang, Jie; Zhao, Jing; Wang, Jun; Xiao, Yang; Tai, Jun; Wang, Shengcai; Wang, Guixiang; Wang, Hua; Bai, Lina; Gui, Jingang; Ni, Xin


    Whether humoral immunity plays a role in HPV type 6 or 11 virus-mediated Juvenile-onset Recurrent Respiratory Papillomatosis (JORRP) remains unknown. In the present study, serum total IgG level in 44 JORRP patients was significantly decreased compared with that in 40 healthy controls. Moreover, expanded CD3−CD19+ B cells with down-regulation of CD23, CD40, HLA-DR and up-regulation of CD86 expression were found in the peripheral blood of JORRP patients. Flow cytometry analysis of B-cell compartment showed that the frequency of both CD19+CD27hi plasma cells and CD19+CD27+ memory B cells were decreased in JORRP patients. Importantly, although the proportion of circulating CXCR5+PD1hi Tfh cells was not changed, the function of Tfh cells were greatly impaired with reduced ability of IL-21 secretion to promote B cell maturation. Association analysis by the Kaplan-Meier method revealed that IL-21 secreting Tfh cell was positively correlated to the CD27+ B cell subset frequency, the serum IgG level and the frequency of recurrence in JORRP patients, but negatively correlated to the percentage of IgD+CD27− B cell. We concluded that a reduced IL-21 secretion by Tfh cells may limit B cell maturation and antibody production in JORRP patients and Tfh cell-derived IL-21 might be associated with JORRP outcome in clinic. PMID:27821867

  17. Immune Responses in Neonates

    PubMed Central

    Basha, Saleem; Surendran, Naveen; Pichichero, Michael


    Neonates have little immunological memory and a developing immune system, which increases their vulnerability to infectious agents. Recent advances in understanding of neonatal immunity indicate that both innate and adaptive responses are dependent on precursor frequency of lymphocytes, antigenic dose and mode of exposure. Studies in neonatal mouse models and human umbilical cord blood cells demonstrate the capability of neonatal immune cells to produce immune responses similar to adults in some aspects but not others. This review focuses mainly on the developmental and functional mechanisms of the human neonatal immune system. In particular, the mechanism of innate and adaptive immunity and the role of neutrophils, antigen presenting cells, differences in subclasses of T lymphocytes (Th1, Th2, Tregs) and B cells are discussed. In addition, we have included the recent developments in neonatal mouse immune system. Understanding neonatal immunity is essential to development of therapeutic vaccines to combat newly emerging infectious agents. PMID:25088080

  18. Mammary gene expression profiles during an intramammary challenge reveal potential mechanisms linking negative energy balance with impaired immune response

    PubMed Central

    Moyes, Kasey M.; Drackley, James K.; Morin, Dawn E.; Rodriguez-Zas, Sandra L.; Everts, Robin E.; Lewin, Harris A.


    Our objective was to compare mammary tissue gene expression profiles during a Streptococcus uberis (S. uberis) mastitis challenge between lactating cows subjected to dietary-induced negative energy balance (NEB; n = 5) and cows fed ad libitum to maintain positive energy balance (PEB; n = 5) to better understand the mechanisms associated with NEB and risk of mastitis during the transition period. The NEB cows were feed-restricted to 60% of calculated net energy for lactation requirements for 7 days, and cows assigned to PEB were fed the same diet for ad libitum intake. Five days after feed restriction, one rear mammary quarter of each cow was inoculated with 5,000 cfu of S. uberis (O140J). At 20 h postinoculation, S. uberis-infected mammary quarters from all cows were biopsied for RNA extraction. Negative energy balance resulted in 287 differentially expressed genes (DEG; false discovery rate ≤ 0.05), with 86 DEG upregulated and 201 DEG downregulated in NEB vs. PEB. Canonical pathways most affected by NEB were IL-8 signaling (10 genes), glucocorticoid receptor signaling (13), and NRF2-mediated oxidative stress response (10). Among the genes differentially expressed by NEB, cell growth and proliferation (48) and cellular development (36) were the most enriched functions. Regarding immune response, HLA-A was upregulated due to NEB, whereas the majority of genes involved in immune response were downregulated (e.g., AKT1, IRAK1, MAPK9, and TRAF6). This study provided new avenues for investigation into the mechanisms relating NEB and susceptibility to mastitis in lactating dairy cows. PMID:20103698

  19. Mammary gene expression profiles during an intramammary challenge reveal potential mechanisms linking negative energy balance with impaired immune response.


    Moyes, Kasey M; Drackley, James K; Morin, Dawn E; Rodriguez-Zas, Sandra L; Everts, Robin E; Lewin, Harris A; Loor, Juan J


    Our objective was to compare mammary tissue gene expression profiles during a Streptococcus uberis (S. uberis) mastitis challenge between lactating cows subjected to dietary-induced negative energy balance (NEB; n = 5) and cows fed ad libitum to maintain positive energy balance (PEB; n = 5) to better understand the mechanisms associated with NEB and risk of mastitis during the transition period. The NEB cows were feed-restricted to 60% of calculated net energy for lactation requirements for 7 days, and cows assigned to PEB were fed the same diet for ad libitum intake. Five days after feed restriction, one rear mammary quarter of each cow was inoculated with 5,000 cfu of S. uberis (O140J). At 20 h postinoculation, S. uberis-infected mammary quarters from all cows were biopsied for RNA extraction. Negative energy balance resulted in 287 differentially expressed genes (DEG; false discovery rate ≤ 0.05), with 86 DEG upregulated and 201 DEG downregulated in NEB vs. PEB. Canonical pathways most affected by NEB were IL-8 signaling (10 genes), glucocorticoid receptor signaling (13), and NRF2-mediated oxidative stress response (10). Among the genes differentially expressed by NEB, cell growth and proliferation (48) and cellular development (36) were the most enriched functions. Regarding immune response, HLA-A was upregulated due to NEB, whereas the majority of genes involved in immune response were downregulated (e.g., AKT1, IRAK1, MAPK9, and TRAF6). This study provided new avenues for investigation into the mechanisms relating NEB and susceptibility to mastitis in lactating dairy cows.

  20. Impaired mucosal antibody response to cholera toxin in vitamin A-deficient rats immunized with oral cholera vaccine.

    PubMed Central

    Wiedermann, U; Hanson, L A; Holmgren, J; Kahu, H; Dahlgren, U I


    To investigate the importance of vitamin A in the ability to respond to oral antigen administration, rats were fed a vitamin A-free diet. The animals were immunized perorally three times with a mixture of cholera toxin (CT) and a commercial cholera vaccine. The total immunoglobulin A (IgA) concentration as well as the specific IgA anti-CT antibody levels in serum and bile was significantly lower in the vitamin A-deficient animals than in the paired fed controls (animals that were fed a normal commercial diet in an amount equal to the amount the deficient animals consumed), while the levels of total and specific anti-CT IgG were not affected to the same extent by the vitamin A deficiency. The number of IgA anti-CT antibody-producing cells in the mesenteric lymph nodes after immunization was also significantly lower in the vitamin A-deficient rats than in the control rats. Supplementation of the diet with retinyl palmitate restored the ability to mount an IgA antibody response to the antigen, since the level of specific IgA anti-CT antibodies in relation to the total IgA concentration was as high in the vitamin A-supplemented group as in the paired fed control group. Restricted diet intake by itself did not affect the ability to respond adequately to the antigen since there was no difference in IgA anti-CT antibody level between paired fed rats and those being fed ad libitum. Assessment of transforming growth factor beta in cell cultures revealed no difference between vitamin A-deficient and paired fed animals. In summary, vitamin A deficiency resulted in a decreased number of IgA-producing cells, decreased IgA production, and a reduced ability to respond with IgA antibodies to the oral cholera vaccine. PMID:8359917

  1. Prenatal vitamin A deficiency impairs adaptive immune responses to pentavalent rotavirus vaccine (RotaTeq®) in a neonatal gnotobiotic pig model.


    Kandasamy, Sukumar; Chattha, Kuldeep S; Vlasova, Anastasia N; Saif, Linda J


    Vitamin A deficiency (VAD) is associated with increased childhood mortality and morbidity in impoverished Asian and African countries, but the impact of VAD on rotavirus (RV) vaccine or infection is poorly understood. We assessed effects of gestational and dietary induced pre- and post-natal VAD and vitamin A supplementation on immune responses to a pentavalent rotavirus vaccine, RotaTeq(®) in a neonatal gnotobiotic pig model. Vaccine efficacy was assessed against virulent G1P[8] human rotavirus (HRV) challenge. VAD and vitamin A sufficient (VAS) piglets were derived from dietary VAD and VAS sows, respectively. VAD piglets had significantly lower levels of hepatic vitamin A compared to that of VAS piglets. RotaTeq(®)-vaccinated VAD piglets had 350-fold higher fecal virus shedding titers compared to vaccinated VAS piglets post-challenge. Only 25% of vaccinated non-vitamin A supplemented VAD piglets were protected against diarrhea compared with 100% protection rate in vaccinated non-supplemented VAS piglets post-challenge. Intestinal HRV specific immune responses were compromised in VAD piglets. Vaccinated VAD piglets had significantly lower ileal HRV IgG antibody secreting cell (ASC) responses (pre-challenge) and duodenal HRV IgA ASC responses (post-challenge) compared to vaccinated VAS piglets. Also, intestinal HRV IgA antibody titers were 11-fold lower in vaccinated VAD compared to vaccinated VAS piglets post-challenge. Persistently elevated levels of IL-8, a pro-inflammatory mediator, and lower IL-10 responses (anti-inflammatory) in vaccinated VAD compared to VAS piglets suggest more severe inflammatory responses in VAD piglets post-challenge. Moreover higher IFN-γ responses pre-challenge were observed in VAD compared to VAS piglets. The impaired vaccine-specific intestinal antibody responses and decreased immunoregulatory cytokine responses coincided with reduced protective efficacy of the RV vaccine against virulent HRV challenge in VAD piglets. In

  2. Immune responses to metastases

    SciTech Connect

    Herberman, R.B.; Wiltrout, R.H.; Gorelik, E.


    The authors present the changes in the immune system in tumor-bearing hosts that may influence the development of progression of metastases. Included are mononuclear cell infiltration of metastases; alterations in natural resistance mediated by natural killer cells and macrophages; development of specific immunity mediated by T-lymphocytes or antibodies; modulation of tumor-associated antigen expression; and the down-regulation of the immune response to the tumor by several suppressor mechanisms; the augmentation of the immune response and its potential for therapeutic application; includes the prophylaxis of metastases formation by NK cells; the therapy of metastases by augmentation NK-, macrophage-, or T-lymphocyte-mediated responses by biological response modifiers; and the transfer of anticancer activity by cytoxic T-lymphocytes or immunoconjugates of monoclonal antibodies with specificity for tumors.

  3. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    PubMed Central

    Dang, N.N.; Pang, S.G.; Song, H.Y.; An, L.G.; Ma, X.L.


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response. PMID:25493381

  4. Exercise boosts immune response.


    Sander, Ruth


    Ageing is associated with a decline in normal functioning of the immune system described as 'immunosenescence'. This contributes to poorer vaccine response and increased incidence of infection and malignancy seen in older people. Regular exercise can enhance vaccination response, increase T-cells and boost the function of the natural killer cells in the immune system. Exercise also lowers levels of the inflammatory cytokines that cause the 'inflamm-ageing' that is thought to play a role in conditions including cardiovascular disease; type 2 diabetes; Alzheimer's disease; osteoporosis and some cancers.

  5. Immune responses in space flight

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.


    significance of space flight-induced changes in immune parameters remains to be established; however, as duration of flights increases, the potential for difficulties due to impaired immune responses also increases.

  6. Mutant huntingtin impairs immune cell migration in Huntington disease

    PubMed Central

    Kwan, Wanda; Träger, Ulrike; Davalos, Dimitrios; Chou, Austin; Bouchard, Jill; Andre, Ralph; Miller, Aaron; Weiss, Andreas; Giorgini, Flaviano; Cheah, Christine; Möller, Thomas; Stella, Nephi; Akassoglou, Katerina; Tabrizi, Sarah J.; Muchowski, Paul J.


    In Huntington disease (HD), immune cells are activated before symptoms arise; however, it is unclear how the expression of mutant huntingtin (htt) compromises the normal functions of immune cells. Here we report that primary microglia from early postnatal HD mice were profoundly impaired in their migration to chemotactic stimuli, and expression of a mutant htt fragment in microglial cell lines was sufficient to reproduce these deficits. Microglia expressing mutant htt had a retarded response to a laser-induced brain injury in vivo. Leukocyte recruitment was defective upon induction of peritonitis in HD mice at early disease stages and was normalized upon genetic deletion of mutant htt in immune cells. Migration was also strongly impaired in peripheral immune cells from pre-manifest human HD patients. Defective actin remodeling in immune cells expressing mutant htt likely contributed to their migration deficit. Our results suggest that these functional changes may contribute to immune dysfunction and neurodegeneration in HD, and may have implications for other polyglutamine expansion diseases in which mutant proteins are ubiquitously expressed. PMID:23160193

  7. Selenium and immune responses

    SciTech Connect

    Kiremidjian-Schumacher, L.; Stotzky, G.


    Selenium (Se) affects all components of the immune system, i.e., the development and expression of nonspecific, humoral, and cell-mediated responses. In general, a deficiency in Se appears to result in immunosuppression, whereas supplementation with low doses of Se appears to result in augmentation and/or restoration of immunologic functions. A deficiency of Se has been shown to inhibit (1) resistance to microbial and viral infections, (2) neutrophil function, (3) antibody production, (4) proliferation of T and B lymphocytes in response to mitogens, and (5) cytodestruction by T lymphocytes and NK cells. Supplementation with Se has been shown to stimulate (1) the function of neutrophils, (2) production of antibodies, (3) proliferation of T and B lymphocytes in response to mitogens, (4) production of lymphokines, (5) NK cell-mediated cytodestruction, (6) delayed-type hypersensitivity reactions and allograft rejection, and (7) the ability of a host to reject transplanted malignant tumors. The mechanism(s) whereby Se affects the immune system is speculative. The effects of Se on the function of glutathione peroxidase and on the cellular levels of reduced glutathione and H/sub 2/Se, as well as the ability of Se to interact with cell membranes, probably represent only a few of many regulatory mechanisms. The manipulation of cellular levels of Se may be significant for the maintenance of general health and for the control of immunodeficiency disorders and the chemoprevention of cancer.

  8. Psychological stress exacerbates primary vaginal herpes simplex virus type 1 (HSV-1) infection by impairing both innate and adaptive immune responses.


    Ashcraft, Kathleen A; Bonneau, Robert H


    Chronic psychological stress is generally immunosuppressive and contributes to an increase in herpes simplex virus (HSV) pathogenicity. We have previously shown that mice experiencing stress at the time of intranasal HSV infection have increased levels of infectious virus in their nasal cavity, as compared to control mice that were not subjected to stress. We have extended our studies to determine the effects of stress at another clinically-relevant mucosal site by examining the immune response to and pathogenesis of vaginal HSV infection. Mice experiencing psychological stress during vaginal HSV infection exhibited an increase in both vaginal viral titers and the pathology associated with this HSV infection. We demonstrate that these observations result from the failure of both the innate and HSV-specific adaptive immune responses. At 2 days post-infection, NK cell numbers were significantly decreased in mice experiencing restraint stress. Studies examining the adaptive immune response revealed a decrease in the number of HSV-specific CD8(+) T cells in not only the vaginal tissue itself but also the draining iliac lymph nodes (ILN). Furthermore, the number of functional cells, in terms of both their degranulation and interferon-gamma production, in the ILN of stressed mice was decreased as compared to non-stressed mice. We conclude that psychological stress, through its suppression of both innate and adaptive immune responses, may be an important factor in the ability to control vaginal HSV infection.

  9. Peroral ciprofloxacin therapy impairs the generation of a protective immune response in a mouse model for Salmonella enterica serovar Typhimurium diarrhea, while parenteral ceftriaxone therapy does not.


    Endt, Kathrin; Maier, Lisa; Käppeli, Rina; Barthel, Manja; Misselwitz, Benjamin; Kremer, Marcus; Hardt, Wolf-Dietrich


    Nontyphoidal Salmonella (NTS) species cause self-limiting diarrhea and sometimes severe disease. Antibiotic treatment is considered only in severe cases and immune-compromised patients. The beneficial effects of antibiotic therapy and the consequences for adaptive immune responses are not well understood. We used a mouse model for Salmonella diarrhea to assess the effects of per os treatment with ciprofloxacin (15 mg/kg of body weight intragastrically 2 times/day, 5 days) or parenteral ceftriaxone (50 mg/kg intraperitoneally, 5 days), two common drugs used in human patients. The therapeutic and adverse effects were assessed with respect to generation of a protective adaptive immune response, fecal pathogen excretion, and the emergence of nonsymptomatic excreters. In the mouse model, both therapies reduced disease severity and reduced the level of fecal shedding. In line with clinical data, in most animals, a rebound of pathogen gut colonization/fecal shedding was observed 2 to 12 days after the end of the treatment. Yet, levels of pathogen shedding and frequency of appearance of nonsymptomatic excreters did not differ from those for untreated controls. Moreover, mice treated intraperitoneally with ceftriaxone developed an adaptive immunity protecting the mice from enteropathy in wild-type Salmonella enterica serovar Typhimurium challenge infections. In contrast, the mice treated intragastrically with ciprofloxacin were not protected. Thus, antibiotic treatment regimens can disrupt the adaptive immune response, but treatment regimens may be optimized in order to preserve the generation of protective immunity. It might be of interest to determine whether this also pertains to human patients. In this case, the mouse model might be a tool for further mechanistic studies.

  10. Human immune responses in cryptosporidiosis

    PubMed Central

    Borad, Anoli; Ward, Honorine


    Immune responses play a critical role in protection from, and resolution of, cryptosporidiosis. However, the nature of these responses, particularly in humans, is not completely understood. Both innate and adaptive immune responses are important. Innate immune responses may be mediated by Toll-like receptor pathways, antimicrobial peptides, prostaglandins, mannose-binding lectin, cytokines and chemokines. Cell-mediated responses, particularly those involving CD4+ T cells and IFN-γ play a dominant role. Mucosal antibody responses may also be involved. Proteins mediating attachment and invasion may serve as putative protective antigens. Further knowledge of human immune responses in cryptosporidiosis is essential in order to develop targeted prophylactic and therapeutic interventions. This review focuses on recent advances and future prospects in the understanding of human immune responses to Cryptosporidium infection. PMID:20210556

  11. Remune. Immune Response.


    Lai, Derhsing; Jones, Taff


    The Immune Response Corp (IRC) is developing Remune, a potential HIV therapeutic vaccine. Remune is based on the Salk Immunogen, which is derived from an HIV isolate which has been inactivated by chemical depletion of glycoprotein 120 (gp120). Preliminary data suggested that Remune, in combination with antiviral drug therapy, results in undetectable levels of HIV. Phase III trials commenced in May 1997 and it was initially expected that registration filings would be made in 1999. However, following interim analysis of the 2500-patient, multicenter, double-blind, pivotal phase III study (study 806) in May 1999, an independent panel recommended concluding the clinical endpoint trial and IRC and licensee, Agouron, decided to pursue alternative regulatory strategies, including initiating two additional phase III surrogate marker trials. Despite this, Agouron gave IRC notice of termination of its continued development in July 2001. In August 2001, IRC informed Agouron that, due to the total number of endpoints to date falling short of that previously assumed by Agouron, it did not intend to continue Agouron's Study 202 of Remune. In July 2001, licensee Trinity Medical Group filed an NDA with the governing health authorities in Thailand for Remune. The Thai FDA certified Immune Response's Remune manufacturing facility as being in compliance with GMP standards, following an on site inspection by Thai officials in November 2001 that was performed as a requirement of Trinity's Thai NDA. As a result of this certification, Trinity expected that a "timely determination" could be made by the Thai FDA. Rhĵne-Poulenc Rorer discontinued its part in the development of Remune, with all manufacturing, marketing and distribution rights reverting to IRC. After Agouron returned rights to Remune in July 2001, IRC heldfull rights in the US, Europe and Japan, while collaborating with its partners Trinity Medical Group and Roemmers Laboratory in the Southeast Asian and Latin American

  12. Ubiquitin signaling in immune responses

    PubMed Central

    Hu, Hongbo; Sun, Shao-Cong


    Ubiquitination has emerged as a crucial mechanism that regulates signal transduction in diverse biological processes, including different aspects of immune functions. Ubiquitination regulates pattern-recognition receptor signaling that mediates both innate immune responses and dendritic cell maturation required for initiation of adaptive immune responses. Ubiquitination also regulates the development, activation, and differentiation of T cells, thereby maintaining efficient adaptive immune responses to pathogens and immunological tolerance to self-tissues. Like phosphorylation, ubiquitination is a reversible reaction tightly controlled by the opposing actions of ubiquitin ligases and deubiquitinases. Deregulated ubiquitination events are associated with immunological disorders, including autoimmune and inflammatory diseases. PMID:27012466

  13. Impaired primary antibody response in experimental nephrotic syndrome.

    PubMed Central

    Garin, E H; Sausville, P J; Richard, G A


    The primary antibody response to sheep red blood cells (SRBC) is reduced in rats with aminonucleoside of puromycin (AP) nephrosis, as measured by haemagglutination and IgM antibody forming spleen cells (AFC). Since rats immunized 1 day after AP administration had a normal antibody response, these studies suggest that the impaired immune response in nephrotic rats is not due to a direct effect of AP but that it is secondary to the nephrotic state. PMID:6347472

  14. Impairment of the cellular immune response in acute murine toxoplasmosis: regulation of interleukin 2 production and macrophage-mediated inhibitory effects.

    PubMed Central

    Haque, S; Khan, I; Haque, A; Kasper, L


    Depression of the cellular immune response to Toxoplasma gondii has been reported in both mice and humans. The present study was undertaken to determine the kinetics and mechanism of the observed downregulation of interleukin 2 (IL-2) production during experimental murine toxoplasmosis. For these investigations, the cell-mediated immune response to the wild type (PTg) was compared with that to the less-virulent mutant parasite (PTgB), which is deficient in the major surface antigen, p30 (SAG-1). Spleen cells from infected A/J mice failed to proliferate in response to Toxoplasma antigens during the first week of infection. Both PTg- and PTgB-infected A/J mice exhibited a significant reduction in the concanavalin A (Con A)-induced lymphoproliferative response. Further, the response of splenocytes from mice infected with the wild-type parasite was significantly diminished compared with that of mice infected with PTgB. The lymphoproliferative response to Con A reached its nadir at day 7 and remained below control levels for at least 14 days postinfection. By day 21 postinfection, the response to Con A and to Toxoplasma antigens was restored to the level observed prior to day 7. Con A-stimulated culture supernatants of spleen cells from mice on day 7 postinfection contained significantly less IL-2 than normal mice. There was no significant difference in the numbers of binding sites or capacity of high-affinity IL-2 receptors between infected and normal mouse splenocytes as determined by Scatchard analysis. Exogenous IL-2 at different concentrations failed to restore the proliferative response of lymphocytes from infected mice to Con A. Adherent macrophages from 7-day-infected mice were able to suppress IL-2 production by normal splenocytes following stimulation with Con A. The inhibitory activity mediated by infected cells was reversed by the antibody to IL-10 but not transforming growth factor beta. There were insignificant levels of nitric oxide production in both

  15. Immune Responses in Parasitic Diseases

    DTIC Science & Technology


    RESPONSES IN PARASITIC DISEASES Final Scientific Report Daniel J. Stechschulte, M.D. Herbert B. Lindsley, M.D. September 1982 (July 1974 - December 1979...REPORT & PERIOD COVERED IMMUNE RESPONSES IN PARASITIC DISEASES Final Report July 1977 - Dec. 1979 6. PERFORMING ORG. REPORT NUMBER S 4 7. AUTNIOR(a) 6...DAMD 17-74-C-4136 AD_______________ IMMUNE RESPONSES IN PARASITIC DISEASES Final Scientific Report Daniel J. Stechschulte, M.D. Herbert B. Lindsley

  16. Impaired T-bet-pSTAT1α and perforin-mediated immune responses in the tumoral region of lung adenocarcinoma

    PubMed Central

    Andreev, Katerina; Denis Iulian Trufa, I; Siegemund, Raphaela; Rieker, Ralf; Hartmann, Arndt; Schmidt, Joachim; Sirbu, Horia; Finotto, Susetta


    Background: In spite of modern therapies for non-small-cell lung cancer (NSCLC), prognosis for many patients is still poor and survival rates are low. Immunotherapy is the possibility to improve the lung immune response surrounding the tumour. However, this approach requires detailed understanding of the local immune-responses of NSCLC patients. Methods: We analysed samples from three different regions within the lungs of NSCLC patients, whereas we distinguished between patients suffering from adenocarcinoma and squamous cell carcinoma. Expression of type 1 T helper (Th1)/type 1 cytotoxic (Tc1) factors was assessed by quantitative real-time PCR, western blot analyses or immunohistochemistry. Cytotoxic cell activity of CD8+ T cells was determined via co-culture with autologous tumour cells and apoptosis assay. Results: We found decreased levels of the transcription factor T-box expressed in T cells (T-bet or Tbx21) and of the downstream activated IFN-γ-dependent pSTAT1α isoform in the lung tumour areas of patients with NSCLC as compared with tumour-free control regions. In these patients, reduced T-bet and pSTAT1α levels were found associated with increased immunosuppressive markers like cytotoxic T lymphocyte-associated protein 4, programmed cell death 1 and with a suppression of the Th1 cell cytokine production and Tc1 cell activity. Conclusions: These findings confirm a central role of T-bet in targeted immunotherapy for patients with NSCLC. PMID:26348446

  17. Immune responses to improving welfare.


    Berghman, L R


    The relationship between animal welfare and the immune status of an animal has a complex nature. Indeed, the intuitive notion that "increased vigilance of the immune system is by definition better" because it is expected to better keep the animal healthy, does not hold up under scrutiny. This is mostly due to the fact that the immune system consists of 2 distinct branches, the innate and the adaptive immune system. While they are intimately intertwined and synergistic in the living organism, they are profoundly different in their costs, both in terms of performance and wellbeing. In contrast to the adaptive immune system, the action of the innate immune system has a high metabolic cost as well as undesirable behavioral consequences. When a pathogen breaches the first line of defense (often a mucosal barrier), that organism's molecular signature is recognized by resident macrophages. The macrophages respond by releasing a cocktail of pro-inflammatory cytokines (including interleukin-1 and -6) that signal the brain via multiple pathways (humoral as well as neural) of the ongoing peripheral innate immune response. The behavioral response to the release of proinflammatory cytokines, known as "sickness behavior," includes nearly all the behavioral aspects that are symptomatic for clinical depression in humans. Hence, undesired innate immune activity, such as chronic inflammation, needs to be avoided by the industry. From an immunological standpoint, one of the most pressing poultry industry needs is the refinement of our current veterinary vaccine arsenal. The response to a vaccine, especially to a live attenuated vaccine, is often a combination of innate and adaptive immune activities, and the desired immunogenicity comes at the price of high reactogenicity. The morbidity, albeit limited and transient, caused by live vaccines against respiratory diseases and coccidiosis are good examples. Thankfully, the advent of various post-genomics technologies, such as DNA

  18. Impaired toll like receptor-7 and 9 induced immune activation in chronic spinal cord injured patients contributes to immune dysfunction

    PubMed Central

    Gungor, Bilgi; Kahraman, Tamer; Gursel, Mayda; Yilmaz, Bilge


    Reduced immune activation or immunosuppression is seen in patients withneurological diseases. Urinary and respiratory infections mainly manifested as septicemia and pneumonia are the most frequent complications following spinal cord injuries and they account for the majority of deaths. The underlying reason of these losses is believed to arise due to impaired immune responses to pathogens. Here, we hypothesized that susceptibility to infections of chronic spinal cord injured (SCI) patients might be due to impairment in recognition of pathogen associated molecular patterns and subsequently declining innate and adaptive immune responses that lead to immune dysfunction. We tested our hypothesis on healthy and chronic SCI patients with a level of injury above T-6. Donor PBMCs were isolated and stimulated with different toll like receptor ligands and T-cell inducers aiming to investigate whether chronic SCI patients display differential immune activation to multiple innate and adaptive immune cell stimulants. We demonstrate that SCI patients' B-cell and plasmacytoid dendritic cells retain their functionality in response to TLR7 and TLR9 ligand stimulation as they secreted similar levels of IL6 and IFNα. The immune dysfunction is not probably due to impaired T-cell function, since neither CD4+ T-cell dependent IFNγ producing cell number nor IL10 producing regulatory T-cells resulted different outcomes in response to PMA-Ionomycin and PHA-LPS stimulation, respectively. We showed that TLR7 dependent IFNγ and IP10 levels and TLR9 mediated APC function reduced substantially in SCI patients compared to healthy subjects. More importantly, IP10 producing monocytes were significantly fewer compared to healthy subjects in response to TLR7 and TLR9 stimulation of SCI PBMCs. When taken together this work implicated that these defects could contribute to persistent complications due to increased susceptibility to infections of chronic SCI patients. PMID:28170444

  19. Significant Impairment in Immune Recovery Following Cancer Treatment

    PubMed Central

    Kang, Duck-Hee; Weaver, Michael T.; Park, Na-Jin; Smith, Barbara; McArdle, Traci; Carpenter, John


    Background Although immunosuppression from cancer adjuvant therapy has been documented, how these suppressed immune responses recover to baseline values after completion of cancer adjuvant therapy has not been studied systematically. Objectives To examine the probability of immune recovery following cancer adjuvant therapy and the potential impact of cancer adjuvant therapy type and cancer stage on immune recovery in newly diagnosed breast cancer patients. Method In a repeated-measures design, immune responses were measured 4 times in 80 early stage breast cancer patients: prior to, and at 2, 6, and 12 months from the beginning of cancer adjuvant therapy. Natural killer cell activity (NKCA), lymphokine-activated killer cell activity, lymphocyte proliferation, CD subsets (CD4, CD8, and CD56), and cytokines (IFN-γ, IL-2, IL-4, IL-6, and IL-1α) were selected for their relevance to breast cancer. Immune recovery was defined by the level of immune response reaching to and above baseline levels. Data were analyzed using a multivariate generalized linear mixed model approach. Results Delayed immune recovery to pretreatment baseline levels continued to the 12-month time point in all parameters. The percentages of immune recovery ranged from 6% to 76% of the patients, varying among immune parameters. Overall, immune recovery was poorer for IFN-γ, IL-2, IL-4, lymphocyte proliferation and NKCA than for CD subsets and IL-6. The type of cancer adjuvant therapy, not cancer stage, showed selective influence on immune recovery. Chemotherapy or chemo- and radiotherapy combination significantly delayed IL-2 recovery, whereas radiotherapy significantly delayed IL-4 recovery. Discussion Immune recovery following breast cancer adjuvant therapy is delayed significantly for an extended time period in numerous immune parameters. The type of cancer adjuvant therapy has selective influence on immune recovery. Future investigations are warranted to elucidate the time course of immune

  20. Cutting edge: impairment of dendritic cells and adaptive immunity by Ebola and Lassa viruses.


    Mahanty, Siddhartha; Hutchinson, Karen; Agarwal, Sudhanshu; McRae, Michael; Rollin, Pierre E; Pulendran, Bali


    Acute infection of humans with Ebola and Lassa viruses, two principal etiologic agents of hemorrhagic fevers, often results in a paradoxical pattern of immune responses: early infection, characterized by an outpouring of inflammatory mediators such as TNF-alpha, IL-1 beta, and IL-6, vs late stage infections, which are associated with poor immune responses. The mechanisms underlying these diverse outcomes are poorly understood. In particular, the role played by cells of the innate immune system, such as dendritic cells (DC), is not known. In this study, we show that Ebola and Lassa viruses infect human monocyte-derived DC and impair their function. Monocyte-derived DC exposed to either virus fail to secrete proinflammatory cytokines, do not up-regulate costimulatory molecules, and are poor stimulators of T cells. These data represent the first evidence for a mechanism by which Ebola and Lassa viruses target DC to impair adaptive immunity.

  1. Dysbiosis-induced IL-33 contributes to impaired antiviral immunity in the genital mucosa.


    Oh, Ji Eun; Kim, Byoung-Chan; Chang, Dong-Ho; Kwon, Meehyang; Lee, Sun Young; Kang, Dukjin; Kim, Jin Young; Hwang, Inhwa; Yu, Je-Wook; Nakae, Susumu; Lee, Heung Kyu


    Commensal microbiota are well known to play an important role in antiviral immunity by providing immune inductive signals; however, the consequence of dysbiosis on antiviral immunity remains unclear. We demonstrate that dysbiosis caused by oral antibiotic treatment directly impairs antiviral immunity following viral infection of the vaginal mucosa. Antibiotic-treated mice succumbed to mucosal herpes simplex virus type 2 infection more rapidly than water-fed mice, and also showed delayed viral clearance at the site of infection. However, innate immune responses, including type I IFN and proinflammatory cytokine production at infection sites, as well as induction of virus-specific CD4 and CD8 T-cell responses in draining lymph nodes, were not impaired in antibiotic-treated mice. By screening the factors controlling antiviral immunity, we found that IL-33, an alarmin released in response to tissue damage, was secreted from vaginal epithelium after the depletion of commensal microbiota. This cytokine suppresses local antiviral immunity by blocking the migration of effector T cells to the vaginal tissue, thereby inhibiting the production of IFN-γ, a critical cytokine for antiviral defense, at local infection sites. These findings provide insight into the mechanisms of homeostasis maintained by commensal bacteria, and reveal a deleterious consequence of dysbiosis in antiviral immune defense.

  2. Capture-related stressors impair immune system function in sablefish

    USGS Publications Warehouse

    Lupes, S.C.; Davis, M.W.; Olla, B.L.; Schreck, C.B.


    The sablefish Anoplopoma fimbria is a valuable North Pacific Ocean species that, when not targeted in various commercial fisheries, is often a part of discarded bycatch. Predictions of the survival of discarded fish are dependent on understanding how a fish responds to stressful conditions. Our objective was to describe the immunological health of sablefish exposed to capture stressors. In laboratory experiments designed to simulate the capture process, we subjected sablefish to various stressors that might influence survival: towing in a net, hooking, elevated seawater and air temperatures, and air exposure time. After stress was imposed, the in vitro mitogen-stimulated proliferation of sablefish leukocytes was used to evaluate the function of the immune system in an assay we validated for this species. The results demonstrated that regardless of fishing gear type, exposure to elevated seawater temperature, or time in air, the leukocytes from stressed sablefish exhibited significantly diminished proliferative responses to the T-cell mitogen, concanavalin A, or the B-cell mitogen, lipopolysaccharide. There was no difference in the immunological responses associated with seawater or air temperature. The duration and severity of the capture stressors applied in our study were harsh enough to induce significantly elevated levels of plasma cortisol and glucose, but there was no difference in the magnitude of levels among stressor treatments. These data suggest that immunological suppression occurs in sablefish subjected to capture-related stressors. The functional impairment of the immune system after capture presents a potential reason why delayed mortality is possible in discarded sablefish. Further studies are needed to determine whether delayed mortality in discarded sablefish can be caused by increased susceptibility to infectious agents resulting from stressor-mediated immunosuppression.

  3. Immune Response to Giardia duodenalis

    PubMed Central

    Faubert, Gaétan


    The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490

  4. Immune responses to improving welfare

    PubMed Central

    Berghman, L. R.


    The relationship between animal welfare and the immune status of an animal has a complex nature. Indeed, the intuitive notion that “increased vigilance of the immune system is by definition better” because it is expected to better keep the animal healthy, does not hold up under scrutiny. This is mostly due to the fact that the immune system consists of 2 distinct branches, the innate and the adaptive immune system. While they are intimately intertwined and synergistic in the living organism, they are profoundly different in their costs, both in terms of performance and wellbeing. In contrast to the adaptive immune system, the action of the innate immune system has a high metabolic cost as well as undesirable behavioral consequences. When a pathogen breaches the first line of defense (often a mucosal barrier), that organism's molecular signature is recognized by resident macrophages. The macrophages respond by releasing a cocktail of pro-inflammatory cytokines (including interleukin-1 and -6) that signal the brain via multiple pathways (humoral as well as neural) of the ongoing peripheral innate immune response. The behavioral response to the release of proinflammatory cytokines, known as “sickness behavior,” includes nearly all the behavioral aspects that are symptomatic for clinical depression in humans. Hence, undesired innate immune activity, such as chronic inflammation, needs to be avoided by the industry. From an immunological standpoint, one of the most pressing poultry industry needs is the refinement of our current veterinary vaccine arsenal. The response to a vaccine, especially to a live attenuated vaccine, is often a combination of innate and adaptive immune activities, and the desired immunogenicity comes at the price of high reactogenicity. The morbidity, albeit limited and transient, caused by live vaccines against respiratory diseases and coccidiosis are good examples. Thankfully, the advent of various post-genomics technologies, such as DNA

  5. Candesartan Ameliorates Impaired Fear Extinction Induced by Innate Immune Activation

    PubMed Central

    Quiñones, María M.; Maldonado, Lizette; Velazquez, Bethzaly; Porter, James T.


    Patients with post-traumatic stress disorder (PTSD) tend to show signs of a relatively increased inflammatory state suggesting that activation of the immune system may contribute to the development of PTSD. In the present study, we tested whether activation of the innate immune system can disrupt acquisition or recall of auditory fear extinction using an animal model of PTSD. Male adolescent rats received auditory fear conditioning in context A. The next day, an intraperitoneal injection of lipopolysaccharide (LPS; 100 μg/kg) prior to auditory fear extinction in context B impaired acquisition and recall of extinction. LPS (100 μg/kg) given after extinction training did not impair extinction recall suggesting that LPS did not affect consolidation of extinction. In contrast to cued fear extinction, contextual fear extinction was not affected by prior injection of LPS (100 μg/kg). Although LPS also reduced locomotion, we could dissociate the effects of LPS on extinction and locomotion by using a lower dose of LPS (50 μg/kg) which impaired locomotion without affecting extinction. In addition, 15 hrs after an injection of 250 μg/kg LPS in adult rats, extinction learning and recall were impaired without affecting locomotion. A sub-chronic treatment with candesartan, an angiotensin II type 1 receptor blocker, prevented the LPS-induced impairment of extinction in adult rats. Our results demonstrate that activation of the innate immune system can disrupt auditory fear extinction in adolescent and adult animals. These findings also provide direction for clinical studies of novel treatments that modulate the innate immune system for stress-related disorders like PTSD. PMID:26520214

  6. Candesartan ameliorates impaired fear extinction induced by innate immune activation.


    Quiñones, María M; Maldonado, Lizette; Velazquez, Bethzaly; Porter, James T


    Patients with post-traumatic stress disorder (PTSD) tend to show signs of a relatively increased inflammatory state suggesting that activation of the immune system may contribute to the development of PTSD. In the present study, we tested whether activation of the innate immune system can disrupt acquisition or recall of auditory fear extinction using an animal model of PTSD. Male adolescent rats received auditory fear conditioning in context A. The next day, an intraperitoneal injection of lipopolysaccharide (LPS; 100 μg/kg) prior to auditory fear extinction in context B impaired acquisition and recall of extinction. LPS (100 μg/kg) given after extinction training did not impair extinction recall suggesting that LPS did not affect consolidation of extinction. In contrast to cued fear extinction, contextual fear extinction was not affected by prior injection of LPS (100 μg/kg). Although LPS also reduced locomotion, we could dissociate the effects of LPS on extinction and locomotion by using a lower dose of LPS (50 μg/kg) which impaired locomotion without affecting extinction. In addition, 15 h after an injection of 250 μg/kg LPS in adult rats, extinction learning and recall were impaired without affecting locomotion. A sub-chronic treatment with candesartan, an angiotensin II type 1 receptor blocker, prevented the LPS-induced impairment of extinction in adult rats. Our results demonstrate that activation of the innate immune system can disrupt auditory fear extinction in adolescent and adult animals. These findings also provide direction for clinical studies of novel treatments that modulate the innate immune system for stress-related disorders like PTSD.

  7. Decreasing the frequency of energy supplementation from daily to three times weekly impairs growth and humoral immune response of preconditioning beef steers.


    Artioli, L F A; Moriel, P; Poore, M H; Marques, R S; Cooke, R F


    We evaluated the effects of frequency of energy supplementation on growth and measurements of innate and humoral immune responses of preconditioning beef steers following vaccination. Angus steers ( = 24; 221 ± 6.3 kg; 177 ± 4 d of age) were weaned on d -7 and kept in a single drylot pen with free access to tall fescue hay and concentrate DMI at 0.5% of BW (50:50 mix of soyhulls and corn gluten pellets; DM basis) from d -7 to 0. On d 0, steers were stratified by BW and age and randomly assigned to 1 of 8 feedlot pens (3 steers/pen). Treatments were randomly assigned to pens (4 pens/treatment) and consisted of steers provided daily free access to ground tall fescue hay and similar weekly concentrate DMI (1% of BW times 7 d), which was divided and offered either daily (S7) or 3 times weekly (S3; Monday, Wednesday, and Friday) from d 0 to 42. Individual BW was measured before feeding on d 0 and 42, after 12 h of feed and water withdrawal. Steers were vaccinated against infectious bovine rhinotracheitis, bovine viral diarrhea virus (BVDV), and clostridium on d 7 and 21. Blood samples were collected from the jugular vein on d -7 and 4 h after concentrate supplementation on d 0, 7, 8, 9, 10, 14, 21, 22, 23, 24, 28, 35, and 42. Steers offered concentrate daily had greater ( ≤ 0.02) BW on d 42, overall ADG, and total DMI, but similar ( = 0.14) G:F, than S3 steers. On days that S7 and S3 steers were offered concentrate, total DMI was greater and hay DMI was less for S3 vs. S7 steers ( ≤ 0.05). On days that only S7 steers were supplemented, hay DMI was greater, but total DMI was less for S3 vs. S7 steers ( ≤ 0.05). Mean CP and NEg intake were greater ( ≤ 0.03) for S7 vs. S3 steers. Plasma cortisol concentrations on d 7 and 28, and mean plasma haptoglobin concentrations, but not liver mRNA expression of haptoglobin ( = 0.75), were greater for S3 vs. S7 steers ( ≤ 0.03). Plasma IGF-1 concentrations on d 0 and urea nitrogen on d 1 and 3, relative to vaccination

  8. [Immune response to influenza vaccination].


    Alvarez, I; Corral, J; Arranz, A; Foruria, A; Landa, V; Lejarza, J R; Marijuán, L; Martínez, J M


    The present study investigated the level of immunity of the population against three strains of the influenza virus (A Chile/1/83 -A Philippines/2/82 and B URSS/100/83) before and three months after vaccination, and the immune response to whole virus vaccine as compared with fragmented virus vaccine. A high percentage of the population had titers greater than or equal to 1/10 before vaccination for the Chile (54%) and Philippines (65.7%) strains, while titers against the URSS strain were lower (25.4%). There was a definitive increase in antibody titer in the vaccinated population, although it was lower than expected. The overall response to both vaccines, with protecting titers greater than or equal to 1/40 after vaccination was 65.2% for the Chile strain, 74.6% for the Philippines strain, and 15% for the URSS strain. No differences in the overall immune response were found between the groups vaccinated with whole and fragmented virus.

  9. Early impairment of CD8+ T cells immune response against Epstein-Barr virus (EBV) antigens associated with high level of circulating mononuclear EBV DNA load in HIV infection.


    Legoff, Jérôme; Amiel, Corinne; Calisonni, Olivier; Fromentin, Delphine; Rajoely, Bakoliarisoa; Abuaf, Nisen; Tartour, Eric; Rozenbaum, Willy; Bélec, Laurent; Nicolas, Jean-Claude


    Immunodeficiency related to HIV may increase the incidence of EBV-associated lymphomas, by altering EBV-specific immune control and consequently favoring EBV reactivation. The aim of the present study was to assess the relationship between the decrease of EBV-specific cellular immunity and the increase of EBV reactivation in a prospective cohort of 72 unselected HIV-infected individuals. EBV-specific immunity was evaluated by a highly sensitive IFN-gamma ELISPOT assay using 22 peptides mimicking latent and lytic antigens, and circulating mononuclear (PBMC) EBV DNA load was quantified by real-time quantitative PCR. The mean circulating cell-associated EBV DNA load was higher in HIV-infected patients (639 copies/10(6) PBMC) than in healthy controls (21, n = 14) ( P = 0.005) and was higher in patients with CD4(+) T-cell count below 350/microL than that in patients harboring higher CD4(+) T-cell count (1112 vs. 389, P = 0.003). The mean intensity of EBV-specific cellular responses was lower in HIV-infected patients than in controls ( P = 0.001), even in patients with CD4(+) T-cell count above 350/-microL ( P = 0.007). The number of EBV peptides recognized was lower in HIV-infected patients than in controls (frequency: 0.44 vs. 0.67; P = 0.02), indicating reduced polyclonality in HIV-infected patients. The polyclonality was 1.5-fold lower in HIV-infected patients with CD4(+) T-cell count below 350/-microL ( P =0.007). For EBV load >1000 copies/10(6) PBMC, the levels of cell-associated EBV DNA and those of EBV-specific cellular immunity, either in intensity or in polyclonality, or both, were inversely correlated. These findings demonstrate early impairment of the EBV-specific cellular immune control with progressive increase of EBV reactivation in the course of HIV infection. These observations likely provide a basis for appreciating the risk to develop non-Hodgkin's lymphomas in HIV-infected individuals.

  10. Conditioning of the immune response.


    Ader, R; Cohen, N


    Experimental studies in humans and experimental animals document the acquisition and extinction of classically conditioned alterations of different parameters of humoral- and cell-mediated immune responses. Although the aversive effects of cyclophosphamide in a taste aversion learning paradigm has been the most frequently used model, conditioned immunomodulatory effects are not confined to this conditioning procedure, and they are not limited to cyclophosphamide or, for that matter, the use of immunomodulating drugs as unconditioned stimuli. Conditioned changes in immunologic reactivity have also been found to modulate the progression of spontaneously-developing or experimentally-induced pathophysiological processes in experimental animals. The available data on the immunoregulatory effects of conditioning indicate that the immune system, like other systems operating in the interests of homeostasis, is integrated with other physiological processes and is therefore influenced by and capable of influencing the brain.

  11. Immune responses to bioengineered organs

    PubMed Central

    Ochando, Jordi; Charron, Dominique; Baptista, Pedro M.; Uygun, Basak E.


    Purpose of review Organ donation in the United States registered 9079 deceased organ donors in 2015. This high percentage of donations allowed organ transplantation in 29 851 recipients. Despite increasing numbers of transplants performed in comparison with previous years, the numbers of patients that are in need for a transplant increase every year at a higher rate. This reveals that the discrepancy between the demand and availability of organs remains fundamental problem in organ transplantation. Recent findings Development of bioengineered organs represents a promising approach to increase the pool of organs for transplantation. The technology involves obtaining complex three-dimensional scaffolds that support cellular activity and functional remodeling though tissue recellularization protocols using progenitor cells. This innovative approach integrates cross-thematic approaches from specific areas of transplant immunology, tissue engineering and stem cell biology, to potentially manufacture an unlimited source of donor organs for transplantation. Summary Although bioengineered organs are thought to escape immune recognition, the potential immune reactivity toward each of its components has not been studied in detail. Here, we summarize the host immune response toward different progenitor cells and discuss the potential implications of using nonself biological scaffolds to develop bioengineered organs. PMID:27926545


    PubMed Central

    Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.


    1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that

  13. A genetic inference on cancer immune responsiveness

    PubMed Central

    Wang, Ena; Uccellini, Lorenzo; Marincola, Francesco M.


    A cancer immune signature implicating good prognosis and responsiveness to immunotherapy was described that is observed also in other aspects of immune-mediated, tissue-specific destruction (TSD). Its determinism remains, however, elusive. Based on limited but unique clinical observations, we propose a multifactorial genetic model of human cancer immune responsiveness. PMID:22754772

  14. Tilapia show immunization response against Ich

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...

  15. Does allergy impair innate immunity? Leads and lessons from atopic dermatitis.


    Mrabet-Dahbi, S; Maurer, M


    Host defence responses against invading pathogens are well-balanced, inflammatory processes of the innate and adaptive immune system. Impaired development or abnormal function of either system can result in failure to control pathogens and to clear infections. Infections have been claimed to modulate the onset and course of allergic diseases. This so-called hygiene hypothesis is still an active area of research. In contrast, the effects of allergies on infections and pathogen-directed immune responses are less well understood. Here, we have reviewed the existing evidence that allergies result in impaired innate immunity and we discuss recent observations that may explain why and how innate immunity is dysfunctional in allergic patients. With a focus on atopic dermatitis as a model of allergic disease, we speculate that one of the key features of allergic conditions, namely Th2 polarization, leads to several independent inhibitory effects on host defence and consequently to a higher risk of infections in allergic patients. A better understanding of impaired host defence and its mechanisms in allergic subjects will help to improve the management of these diseases.

  16. Impaired cell mediated immunity in haemophilia in the absence of infection with human immunodeficiency virus.

    PubMed Central

    Madhok, R; Gracie, A; Lowe, G D; Burnett, A; Froebel, K; Follett, E; Forbes, C D


    The cell mediated immune response was evaluated in vivo in 29 patients with clinically severe haemophilia by means of the dinitrochlorobenzene skin test. All patients had a response below the median normal value, and in 19 the response was on or below the lower limit of the normal range. There was no difference in skin response between patients positive and negative for the human immunodeficiency virus (HIV; formerly known as human T cell lymphotropic virus III or lymphadenopathy associated virus). In the whole group, and in seronegative patients (n = 17), there was an inverse relation between exposure to clotting factor and skin response. In seropositive patients (n = 12) no such association was apparent. This study shows that clotting factor concentrate impairs the cell mediated immune response to a new antigen in the absence of infection with HIV. PMID:3094762

  17. Impairment of immunity to Candida and Mycobacterium in humans with bi-allelic RORC mutations*

    PubMed Central

    Halwani, Rabih; Ma, Cindy S.; Wong, Natalie; Soudais, Claire; Henderson, Lauren A.; Marzouqa, Hiyam; Shamma, Jamal; Gonzalez, Marcela; Martinez-Barricarte, Rubén; Okada, Chizuru; Avery, Danielle T.; Latorre, Daniela; Deswarte, Caroline; Jabot-Hanin, Fabienne; Torrado, Egidio; Fountain, Jeffrey; Belkadi, Aziz; Itan, Yuval; Boisson, Bertrand; Migaud, Mélanie; Arlehamn, Cecilia S. Lindestam; Sette, Alessandro; Breton, Sylvain; McCluskey, James; Rossjohn, Jamie; de Villartay, Jean-Pierre; Moshous, Despina; Hambleton, Sophie; Latour, Sylvain; Arkwright, Peter D.; Picard, Capucine; Lantz, Olivier; Engelhard, Dan; Kobayashi, Masao; Abel, Laurent; Casanova, Jean-Laurent


    Human inborn errors of immunity mediated by the cytokines interleukin (IL)-17A/F underlie mucocutaneous candidiasis, whereas inborn errors of interferon (IFN)-γ immunity underlie mycobacterial disease. We report the discovery of bi-allelic RORC loss-of-function mutations in seven individuals from three kindreds of different ethnic origins with both candidiasis and mycobacteriosis. The lack of functional RORγ and RORγT isoforms resulted in the absence of IL-17A/F-producing T cells in these individuals, probably accounting for their chronic candidiasis. Unexpectedly, leukocytes from RORγ- and RORγT-deficient individuals also displayed an impaired IFN-γ response to Mycobacterium. This principally reflected profoundly defective IFN-γ production by circulating γδ T cells and CD4+CCR6+ CXCR3+ αβ T cells. In humans, both mucocutaneous immunity to Candida and systemic immunity to Mycobacterium require RORγ, or RORγT, or both. PMID:26160376

  18. Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight

    PubMed Central

    Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila


    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

  19. Innate immune responses of Drosophila melanogaster are altered by spaceflight.


    Marcu, Oana; Lera, Matthew P; Sanchez, Max E; Levic, Edina; Higgins, Laura A; Shmygelska, Alena; Fahlen, Thomas F; Nichol, Helen; Bhattacharya, Sharmila


    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways.

  20. Spaceflight and immune responses of Rhesus monkeys

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald


    Evidence from both human and rodent studies indicates that alterations in immunological parameters occur after space flight. The objective of this project is to determine the effects of space flight on immune responses of Rhesus monkeys. The expected significance of the work is a determination of the range of immunological functions of the Rhesus monkey, a primate similar in many ways to man, affected by space flight. Changes in immune responses that could yield alterations in resistance to infection may be determined as well as the duration of alterations in immune responses. Additional information on the nature of cellular interactions for the generation of immune responses may also be obtained.

  1. Noninvasive imaging of immune responses

    PubMed Central

    Rashidian, Mohammad; Keliher, Edmund J.; Bilate, Angelina M.; Duarte, Joao N.; Wojtkiewicz, Gregory R.; Jacobsen, Johanne Tracey; Cragnolini, Juanjo; Swee, Lee Kim; Victora, Gabriel D.; Weissleder, Ralph; Ploegh, Hidde L.


    At their margins, tumors often contain neutrophils, dendritic cells, and activated macrophages, which express class II MHC and CD11b products. The interplay between stromal cells, tumor cells, and migratory cells such as lymphocytes creates opportunities for noninvasive imaging of immune responses. We developed alpaca-derived antibody fragments specific for mouse class II MHC and CD11b products, expressed on the surface of a variety of myeloid cells. We validated these reagents by flow cytometry and two-photon microscopy to obtain images at cellular resolution. To enable noninvasive imaging of the targeted cell populations, we developed a method to site-specifically label VHHs [the variable domain (VH) of a camelid heavy-chain only antibody] with 18F or 64Cu. Radiolabeled VHHs rapidly cleared the circulation (t1/2 ≈ 20 min) and clearly visualized lymphoid organs. We used VHHs to explore the possibility of imaging inflammation in both xenogeneic and syngeneic tumor models, which resulted in detection of tumors with remarkable specificity. We also imaged the infiltration of myeloid cells upon injection of complete Freund’s adjuvant. Both anti-class II MHC and anti-CD11b VHHs detected inflammation with excellent specificity. Given the ease of manufacture and labeling of VHHs, we believe that this method could transform the manner in which antitumor responses and/or infectious events may be tracked. PMID:25902531

  2. Antigen processing and immune regulation in the response to tumours.


    Reeves, Emma; James, Edward


    The MHC class I and II antigen processing and presentation pathways display peptides to circulating CD8(+) cytotoxic and CD4(+) helper T cells respectively to enable pathogens and transformed cells to be identified. Once detected, T cells become activated and either directly kill the infected / transformed cells (CD8(+) cytotoxic T lymphocytes) or orchestrate the activation of the adaptive immune response (CD4(+) T cells). The immune surveillance of transformed/tumour cells drives alteration of the antigen processing and presentation pathways to evade detection and hence the immune response. Evasion of the immune response is a significant event tumour development and considered one of the hallmarks of cancer. To avoid immune recognition, tumours employ a multitude of strategies with most resulting in a down-regulation of the MHC class I expression at the cell surface, significantly impairing the ability of CD8(+) cytotoxic T lymphocytes to recognize the tumour. Alteration of the expression of key players in antigen processing not only affects MHC class I expression but also significantly alters the repertoire of peptides being presented. These modified peptide repertoires may serve to further reduce the presentation of tumour-specific/associated antigenic epitopes to aid immune evasion and tumour progression. Here we review the modifications to the antigen processing and presentation pathway in tumours and how it affects the anti-tumour immune response, considering the role of tumour-infiltrating cell populations and highlighting possible future therapeutic targets.

  3. Hypothalamic neurohormones and immune responses

    PubMed Central

    Quintanar, J. Luis; Guzmán-Soto, Irene


    The aim of this review is to provide a comprehensive examination of the current literature describing the neural-immune interactions, with emphasis on the most recent findings of the effects of neurohormones on immune system. Particularly, the role of hypothalamic hormones such as Thyrotropin-releasing hormone (TRH), Corticotropin-releasing hormone (CRH) and Gonadotropin-releasing hormone (GnRH). In the past few years, interest has been raised in extrapituitary actions of these neurohormones due to their receptors have been found in many non-pituitary tissues. Also, the receptors are present in immune cells, suggesting an autocrine or paracrine role within the immune system. In general, these neurohormones have been reported to exert immunomodulatory effects on cell proliferation, immune mediators release and cell function. The implications of these findings in understanding the network of hypothalamic neuropeptides and immune system are discussed. PMID:23964208

  4. Hypothalamic neurohormones and immune responses.


    Quintanar, J Luis; Guzmán-Soto, Irene


    The aim of this review is to provide a comprehensive examination of the current literature describing the neural-immune interactions, with emphasis on the most recent findings of the effects of neurohormones on immune system. Particularly, the role of hypothalamic hormones such as Thyrotropin-releasing hormone (TRH), Corticotropin-releasing hormone (CRH) and Gonadotropin-releasing hormone (GnRH). In the past few years, interest has been raised in extrapituitary actions of these neurohormones due to their receptors have been found in many non-pituitary tissues. Also, the receptors are present in immune cells, suggesting an autocrine or paracrine role within the immune system. In general, these neurohormones have been reported to exert immunomodulatory effects on cell proliferation, immune mediators release and cell function. The implications of these findings in understanding the network of hypothalamic neuropeptides and immune system are discussed.

  5. Adaptive immune response during hepatitis C virus infection.


    Larrubia, Juan Ramón; Moreno-Cubero, Elia; Lokhande, Megha Uttam; García-Garzón, Silvia; Lázaro, Alicia; Miquel, Joaquín; Perna, Cristian; Sanz-de-Villalobos, Eduardo


    Hepatitis C virus (HCV) infection affects about 170 million people worldwide and it is a major cause of liver cirrhosis and hepatocellular carcinoma. HCV is a hepatotropic non-cytopathic virus able to persist in a great percentage of infected hosts due to its ability to escape from the immune control. Liver damage and disease progression during HCV infection are driven by both viral and host factors. Specifically, adaptive immune response carries out an essential task in controlling non-cytopathic viruses because of its ability to recognize infected cells and to destroy them by cytopathic mechanisms and to eliminate the virus by non-cytolytic machinery. HCV is able to impair this response by several means such as developing escape mutations in neutralizing antibodies and in T cell receptor viral epitope recognition sites and inducing HCV-specific cytotoxic T cell anergy and deletion. To impair HCV-specific T cell reactivity, HCV affects effector T cell regulation by modulating T helper and Treg response and by impairing the balance between positive and negative co-stimulatory molecules and between pro- and anti-apoptotic proteins. In this review, the role of adaptive immune response in controlling HCV infection and the HCV mechanisms to evade this response are reviewed.

  6. Cellular immunity in ASFV responses.


    Takamatsu, Haru-Hisa; Denyer, Michael S; Lacasta, Anna; Stirling, Catrina M A; Argilaguet, Jordi M; Netherton, Christopher L; Oura, Chris A L; Martins, Carlos; Rodríguez, Fernando


    African swine fever virus (ASFV) infection usually results in an acute haemorrhagic disease with a mortality rate approaching 100% in domestic pigs. However, pigs can survive infection with less-virulent isolates of ASFV and may become chronically infected. Surviving animals are resistant to challenge with homologous or, in some cases, closely related isolates of the virus indicating that pigs can develop protective immunity against ASFV. During asymptomatic, non-virulent ASFV infections natural killer cell activity increases in pigs, suggesting this cell type plays a role in ASFV immunity. Furthermore, depletion of CD8(+) lymphocytes from ASFV immune pigs demolishes protective immunity against related virulent viruses. This suggests that ASFV specific antibody alone is not sufficient for protection against ASFV infection and that there is an important role for the CD8(+) lymphocyte subset in ASFV protective immunity. These results were supported by DNA immunization studies, demonstrating a correlation between the protection afforded against lethal challenge and the detection of a large number of vaccine-induced antigen-specific CD8(+) T-cells. Peripheral blood mononuclear cells (PBMCs) from ASF immune pigs protected from clinical disease show higher proportions of ASFV specific CD4(+)CD8(high+) double positive cytotoxic T cells than PBMCs from ASF immune but clinically diseased pig. The frequency of ASFV specific IFNγ producing T cells induced by immunization correlates to the degree of protection from ASFV challenge, and this may prove to be a useful indicator of any potential cross-protection against heterologous ASFV isolates.

  7. The Immune Response to Astrovirus Infection

    PubMed Central

    Marvin, Shauna A.


    Astroviruses are one of the leading causes of pediatric gastroenteritis worldwide and are clinically importantly pathogens in the elderly and immunocompromised populations. Although the use of cell culture systems and small animal models have enhanced our understanding of astrovirus infection and pathogenesis, little is known about the immune response to astrovirus infection. Studies from humans and animals suggest that adaptive immunity is important in restricting classic and novel astrovirus infections, while studies from animal models and cell culture systems suggest that an innate immune system plays a role in limiting astrovirus replication. The relative contribution of each arm of the immune system in restricting astrovirus infection remains unknown. This review summarizes our current understanding of the immune response to astrovirus infection and highlights some of the key questions that stem from these studies. A full understanding of the immune response to astrovirus infection is required to be able to treat and control astrovirus-induced gastroenteritis. PMID:28042824

  8. Protective host immune responses to Salmonella infection.


    Pham, Oanh H; McSorley, Stephen J


    Salmonella enterica serovars Typhi and Paratyphi are the causative agents of human typhoid fever. Current typhoid vaccines are ineffective and are not widely used in endemic areas. Greater understanding of host-pathogen interactions during Salmonella infection should facilitate the development of improved vaccines to combat typhoid and nontyphoidal Salmonellosis. This review will focus on our current understanding of Salmonella pathogenesis and the major host immune components that participate in immunity to Salmonella infection. In addition, recent findings regarding host immune mechanisms in response to Salmonella infection will be also discussed, providing a new perspective on the utility of improved tools to study the immune response to Salmonella infections.

  9. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology


    A-Al?l 362 HUMAN IMMUNE RESPONSES TO DENGUE YXRUSES(U) MASSACHUSETTS UNIV MEDICAL SCHOOL NORCESTER F A ENNIS SE 83" I ?-2C23 UNCLASSI FIED SE 3IRD?8...SHEET PREVIOUS EDITION MAY BE USED UNTILDTIC FORM 70A OUMNPRESIGSETSTOCK IS EXHAUSTED.DEC 83 AD IHuman Immune Responses to Dengue Viruses Annual Report...edilon may be ued Y01dxffnUICFMCASIAZIlow f~ rolit SUMMARY The purpose of this contract is to analyse the immune responses to dengue virus infections

  10. Human Immune Response to Dengue Infections.

    DTIC Science & Technology



  11. Active immunization with amyloid-beta 1-42 impairs memory performance through TLR2/4-dependent activation of the innate immune system.


    Vollmar, Patrick; Kullmann, Jennifer S; Thilo, Barbara; Claussen, Malte C; Rothhammer, Veit; Jacobi, Hortenzia; Sellner, Johann; Nessler, Stefan; Korn, Thomas; Hemmer, Bernhard


    Active immunization with amyloid-β (Aβ) peptide 1-42 reverses amyloid plaque deposition in the CNS of patients with Alzheimer's disease and in amyloid precursor protein transgenic mice. However, this treatment may also cause severe, life-threatening meningoencephalitis. Physiological responses to immunization with Aβ(1-42) are poorly understood. In this study, we characterized cognitive and immunological consequences of Aβ(1-42)/CFA immunization in C57BL/6 mice. In contrast to mice immunized with myelin oligodendrocyte glycoprotein (MOG)(35-55)/CFA or CFA alone, Aβ(1-42)/CFA immunization resulted in impaired exploratory activity, habituation learning, and spatial-learning abilities in the open field. As morphological substrate of this neurocognitive phenotype, we identified a disseminated, nonfocal immune cell infiltrate in the CNS of Aβ(1-42)/CFA-immunized animals. In contrast to MOG(35-55)/CFA and PBS/CFA controls, the majority of infiltrating cells in Aβ(1-42)/CFA-immunized mice were CD11b(+)CD14(+) and CD45(high), indicating their blood-borne monocyte/macrophage origin. Immunization with Aβ(1-42)/CFA was significantly more potent than immunization with MOG(35-55)/CFA or CFA alone in activating macrophages in the secondary lymphoid compartment and peripheral tissues. Studies with TLR2/4-deficient mice revealed that the TLR2/4 pathway mediated the Aβ(1-42)-dependent proinflammatory cytokine release from cells of the innate immune system. In line with this, TLR2/4 knockout mice were protected from cognitive impairment upon immunization with Aβ(1-42)/CFA. Thus, this study identifies adjuvant effects of Aβ(1-42), which result in a clinically relevant neurocognitive phenotype highlighting potential risks of Aβ immunotherapy.

  12. Type I IFN signaling in CD8– DCs impairs Th1-dependent malaria immunity

    PubMed Central

    Haque, Ashraful; Best, Shannon E.; Montes de Oca, Marcela; James, Kylie R.; Ammerdorffer, Anne; Edwards, Chelsea L.; de Labastida Rivera, Fabian; Amante, Fiona H.; Bunn, Patrick T.; Sheel, Meru; Sebina, Ismail; Koyama, Motoko; Varelias, Antiopi; Hertzog, Paul J.; Kalinke, Ulrich; Gun, Sin Yee; Rénia, Laurent; Ruedl, Christiane; MacDonald, Kelli P.A.; Hill, Geoffrey R.; Engwerda, Christian R.


    Many pathogens, including viruses, bacteria, and protozoan parasites, suppress cellular immune responses through activation of type I IFN signaling. Recent evidence suggests that immune suppression and susceptibility to the malaria parasite, Plasmodium, is mediated by type I IFN; however, it is unclear how type I IFN suppresses immunity to blood-stage Plasmodium parasites. During experimental severe malaria, CD4+ Th cell responses are suppressed, and conventional DC (cDC) function is curtailed through unknown mechanisms. Here, we tested the hypothesis that type I IFN signaling directly impairs cDC function during Plasmodium infection in mice. Using cDC-specific IFNAR1-deficient mice, and mixed BM chimeras, we found that type I IFN signaling directly affects cDC function, limiting the ability of cDCs to prime IFN-γ–producing Th1 cells. Although type I IFN signaling modulated all subsets of splenic cDCs, CD8– cDCs were especially susceptible, exhibiting reduced phagocytic and Th1-promoting properties in response to type I IFNs. Additionally, rapid and systemic IFN-α production in response to Plasmodium infection required type I IFN signaling in cDCs themselves, revealing their contribution to a feed-forward cytokine-signaling loop. Together, these data suggest abrogation of type I IFN signaling in CD8– splenic cDCs as an approach for enhancing Th1 responses against Plasmodium and other type I IFN–inducing pathogens. PMID:24789914

  13. Cellular immune response in intraventricular experimental neurocysticercosis.


    Moura, Vania B L; Lima, Sarah B; Matos-Silva, Hidelberto; Vinaud, Marina C; Loyola, Patricia R A N; Lino, Ruy S


    Neurocysticercosis (NCC) is considered a neglected parasitic infection of the human central nervous system. Its pathogenesis is due to the host immune response, stage of evolution and location of the parasite. The aim of this study was to evaluate the in situ and systemic immune response through cytokines dosage (IL-4, IL-10, IL-17 and IFN-γ) as well as the local inflammatory response of the experimental NCC with Taenia crassiceps. The in situ and systemic cellular and inflammatory immune response were evaluated through the cytokines quantification at 7, 30, 60 and 90 days after inoculation and histopathological analysis. All cysticerci were found within the cerebral ventricles. There was a discrete intensity of inflammatory cells of mixed immune profile, polymorphonuclear and mononuclear cells, at the beginning of the infection and predominance of mononuclear cells at the end. The systemic immune response showed a significant increase in all the analysed cytokines and predominance of the Th2 immune profile cytokines at the end of the infection. These results indicate that the location of the cysticerci may lead to ventriculomegaly. The acute phase of the infection showed a mixed Th1/Th17 profile accompanied by high levels of IL-10 while the late phase showed a Th2 immune profile.

  14. Adaptive immune responses to Acanthamoeba cysts.


    McClellan, Kathy; Howard, Kevin; Mayhew, Elizabeth; Niederkorn, Jerry; Alizadeh, Hassan


    Acanthamoeba cysts are not eliminated from the corneas of human subjects or experimentally infected animals. The persistence of Acanthamoeba cysts in the cornea indicates that either the cysts escape immunological elimination or are not recognized by the host's immunological elements. The aim of this study was to determine the immunogenicity and antigenicity of the Acanthamoeba cyst. Mice were immunized intraperitoneally and serum anti-Acanthamoeba IgG was measured by ELISA. Lymphoproliferative assay and delayed type hypersensitivity (DTH) responses to Acanthamoeba castellanii cyst and trophozoite antigens were used to determine the cell mediated immune responses against Acanthamoeba cysts. A. castellanii cysts were both immunogenic and antigenic, producing anti-Acanthamoeba serum IgG, T lymphocyte proliferation, and delayed type hypersensitivity responses. These results indicate that Acanthamoeba cysts are recognized by the immune system. The persistence of the organism in the human cornea means that these adaptive immune responses fail to kill Acanthamoeba cysts.

  15. HTLV-1 Tax impairs K63-linked ubiquitination of STING to evade host innate immunity.


    Wang, Jie; Yang, Shuai; Liu, Lu; Wang, Hui; Yang, Bo


    The cellular antiviral innate immune system is essential for host defense and viruses have evolved a variety of strategies to evade the innate immunity. Human T lymphotropic virus type 1 (HTLV-1) belongs to the deltaretrovirus family and it can establish persistent infection in human beings for many years. However, how this virus evades the host innate immune responses remains unclear. Here we report a new strategy used by HTLV-1 to block innate immune responses. We observed that stimulator of interferon genes (STING) limited HTLV-1 protein expression and was critical to HTLV-1 reverse transcription intermediate (RTI) ssDNA90 triggered interferon (IFN)-β production in phorbol12-myristate13-acetate (PMA)-differentiated THP1 (PMA-THP1) cells. The HTLV-1 protein Tax inhibited STING overexpression induced transcriptional activation of IFN-β. Tax also impaired poly(dA:dT), interferon stimulatory DNA (ISD) or cyclic GMP-AMP (cGAMP) -stimulated IFN-β production, which was dependent on STING activation. Coimmunoprecipitation assays and confocal microscopy indicated that Tax was associated with STING in the same complex. Mechanistic studies suggested that Tax decreased the K63-linked ubiquitination of STING and disrupted the interactions between STING and TANK-binding kinase 1 (TBK1). These findings may shed more light on the molecular mechanisms underlying HTLV-1 infection.

  16. Cellular immune response experiment MA-031

    NASA Technical Reports Server (NTRS)

    Criswell, B. S.


    Significant changes in phytohemagglutinin (PHA) lymphocytic responsiveness occurred in the cellular immune response of three astronauts during the 9 day flight of the Apollo Soyuz Test Project. Parameters studied were white blood cell concentrations, lymphocyte numbers, B- and T-lymphocyte distributions in peripheral blood, and lymphocyte responsiveness to PHA, pokeweed mitogen, Concanavalin A, and influenza virus antigen.

  17. Impaired immunity in harbour seals [Phoca vitulina] fed environmentally contaminated herring.


    de Swart, R L; Ross, P S; Vos, J G; Osterhaus, A D


    In recent years, mass mortalities among seals and dolphins have been attributed to infections with different morbilliviruses. In all cases, these marine top predators were exposed to high levels of persistent lipophilic environmental contaminants accumulated through the food chain. This observation led to the hypothesis that a contaminant-related suppression of the immune system might have contributed to the severity of the virus outbreaks. We conducted a semi-field feeding experiment, in which we fed two groups of harbour seals (Phoca vitulina) fish with different levels of contaminants. During a period of 2 1/2 years, blood samples were taken at regular intervals, and the functioning of different compartments of the immune system was monitored and compared. We found impaired natural killer (NK) and specific T cell responses in the seals fed contaminated fish. This is the first demonstration of immunosuppression in mammals following chronic exposure to environmental contaminants at ambient environmental levels.

  18. Immune response to lipoproteins in atherosclerosis.


    Samson, Sonia; Mundkur, Lakshmi; Kakkar, Vijay V


    Atherosclerosis, the underlying cause of cardiovascular disease, is characterized by chronic inflammation and altered immune response. Cholesterol is a well-known risk factor associated with the development of cardiovascular diseases. Elevated serum cholesterol is unique because it can lead to development of atherosclerosis in animals and humans even in the absence of other risk factors. Modifications of low-density lipoproteins mediated by oxidation, enzymatic degradation, and aggregation result in changes in their function and activate both innate and adaptive immune system. Oxidized low-density lipoprotein (LDL) has been identified as one of the most important autoantigens in atherosclerosis. This escape from self-tolerance is dependent on the formation of oxidized phospholipids. The emerging understanding of the importance of immune responses against oxidized LDL in atherosclerosis has focused attention on the possibility of development of novel therapy for atherosclerosis. This review provides an overview of immune response to lipoproteins and the fascinating possibility of developing an immunomodulatory therapy for atherosclerosis.

  19. Humoral immune response to the antigen administered as an immune complex.


    Marusić, M; Marusić-Galesić, S; Pokrić, B


    Antigen (HSA) bound in immune complexes at equivalence with syngeneic anti-HSA antibodies elicit much stronger humoral immune response then soluble HSA. On the other hand, administration of immune complexes formed with xenogeneic (rabbit) anti-HSA antibodies suppressed humoral immune response against HSA, but not against rabbit IgG in mice. We suggest that immunization with antigen bound in immune complex might represent a powerful tool in enhancing humoral immune responses.

  20. Effect of blueberries on the immune response of obese mice induced by high fat diet

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Both high fat diet and obesity have been linked to impaired cell-mediated immune response. Blueberry, rich in antioxidant phytochemicals, has been shown to impact biologic functions in several tissues. However, no information is available on immune cells. We investigated whether blueberry consumptio...

  1. IMMUNODEFICIENCIES. Impairment of immunity to Candida and Mycobacterium in humans with bi-allelic RORC mutations.


    Okada, Satoshi; Markle, Janet G; Deenick, Elissa K; Mele, Federico; Averbuch, Dina; Lagos, Macarena; Alzahrani, Mohammed; Al-Muhsen, Saleh; Halwani, Rabih; Ma, Cindy S; Wong, Natalie; Soudais, Claire; Henderson, Lauren A; Marzouqa, Hiyam; Shamma, Jamal; Gonzalez, Marcela; Martinez-Barricarte, Rubén; Okada, Chizuru; Avery, Danielle T; Latorre, Daniela; Deswarte, Caroline; Jabot-Hanin, Fabienne; Torrado, Egidio; Fountain, Jeffrey; Belkadi, Aziz; Itan, Yuval; Boisson, Bertrand; Migaud, Mélanie; Arlehamn, Cecilia S Lindestam; Sette, Alessandro; Breton, Sylvain; McCluskey, James; Rossjohn, Jamie; de Villartay, Jean-Pierre; Moshous, Despina; Hambleton, Sophie; Latour, Sylvain; Arkwright, Peter D; Picard, Capucine; Lantz, Olivier; Engelhard, Dan; Kobayashi, Masao; Abel, Laurent; Cooper, Andrea M; Notarangelo, Luigi D; Boisson-Dupuis, Stéphanie; Puel, Anne; Sallusto, Federica; Bustamante, Jacinta; Tangye, Stuart G; Casanova, Jean-Laurent


    Human inborn errors of immunity mediated by the cytokines interleukin-17A and interleukin-17F (IL-17A/F) underlie mucocutaneous candidiasis, whereas inborn errors of interferon-γ (IFN-γ) immunity underlie mycobacterial disease. We report the discovery of bi-allelic RORC loss-of-function mutations in seven individuals from three kindreds of different ethnic origins with both candidiasis and mycobacteriosis. The lack of functional RORγ and RORγT isoforms resulted in the absence of IL-17A/F-producing T cells in these individuals, probably accounting for their chronic candidiasis. Unexpectedly, leukocytes from RORγ- and RORγT-deficient individuals also displayed an impaired IFN-γ response to Mycobacterium. This principally reflected profoundly defective IFN-γ production by circulating γδ T cells and CD4(+)CCR6(+)CXCR3(+) αβ T cells. In humans, both mucocutaneous immunity to Candida and systemic immunity to Mycobacterium require RORγ, RORγT, or both.

  2. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology


    ND-R171 381 HUR IMMUNE RESPONSES TO DENGUE VIRUSES(U) 1/1 MASSRCHUSETTS UNIY M9DICAL SCHOOL WORCESTER F R~ ENNIS RUG 94 DRMt17-2-C-2233 UNCLASSIFIED...Responses to Dengue Viruses Annual Report 0(August 1983-July 1984) Francis A. Ennis, M.D. August 1984 Supported by U.S. Army Medical Research and...3M1- NO. SON No. Frederick, Maryland 21701-5012 61102A 61102BSI0 AA 104 11. TITLE Oxkf* Samqy Oao" Human Immune Responses to Dengue Viruses 12. PERSON

  3. Effect of cellular mobility on immune response

    NASA Astrophysics Data System (ADS)

    Pandey, R. B.; Mannion, R.; Ruskin, H. J.


    Mobility of cell types in our HIV immune response model is subject to an intrinsic mobility and an explicit directed mobility, which is governed by Pmob. We investigate how restricting the explicit mobility, while maintaining the innate mobility of a viral-infected cell, affects the model's results. We find that increasing the explicit mobility of the immune system cells leads to viral dominance for certain levels of viral mutation. We conclude that increasing immune system cellular mobility indirectly increases the virus’ inherent mobility.

  4. Immune responses and Lassa virus infection.


    Russier, Marion; Pannetier, Delphine; Baize, Sylvain


    Lassa fever is a hemorrhagic fever endemic to West Africa and caused by Lassa virus, an Old World arenavirus. It may be fatal, but most patients recover from acute disease and some experience asymptomatic infection. The immune mechanisms associated with these different outcomes have not yet been fully elucidated, but considerable progress has recently been made, through the use of in vitro human models and nonhuman primates, the only relevant animal model that mimics the pathophysiology and immune responses induced in patients. We discuss here the roles of the various components of the innate and adaptive immune systems in Lassa virus infection and in the control of viral replication and pathogenesis.

  5. Human Immune Response to Dengue Infections

    DTIC Science & Technology


    lhuman Immune Response to Dengue Infections 12. PERSONAL AUTHOR(S) Francis A. Ennis 13a. TYPE OF REPORT 13b. TIME COVERED T14. DATE OF REPORT (Year, Month...Stimulation with live dengue virus of peripheral blood mononuclear cells from a dengue 4-immune donor generated virus-specific serotype cross-reactive CD4- CD8...class I-restricted cytotoxic T lymphocytes (CL) capable of lysing dengue virus-infected autologous fibroblasts and cells pulsed with dengue I

  6. Temozolomide does not impair gene therapy-mediated antitumor immunity in syngeneic brain tumor models

    PubMed Central

    Wibowo, Mia; Ahlzadeh, Gabrielle E; Puntel, Mariana; Ghiasi, Homayon; Kamran, Neha; Paran, Christopher; Lowenstein, Pedro R; Castro, Maria G


    Purpose Glioblastoma multiforme (GBM) is the most common primary brain cancer in adults. Chemotherapy with temozolomide (TMZ) significantly prolongs the survival of GBM patients. However, the 3-year survival is still ~5%. Herein we combined intratumoral administration of an adenoviral vector expressing Flt3L (Ad-Flt3L) with systemic TMZ in order to assess its impact on therapeutic efficacy. Experimental Design Wild type or immunodeficient mice bearing intracranial GBM or metastatic melanoma were treated with an intratumoral injection of Ad-Flt3L alone or in combination with the conditionally cytotoxic enzyme thymidine kinase (Ad-TK), followed by systemic administration of ganciclovir and TMZ. We monitored survival and measured the tumor-infiltrating immune cells. Results While treatment with TMZ alone led to a small improvement in median survival, when used in combination with gene therapy-mediated immunotherapy it significantly increased the survival of tumor-bearing mice. The anti-tumor effect was further enhanced by concomitant intratumoral administration of Ad-TK, leading to 50–70% long-term survival in all tumor models. Although TMZ reduced the content of T cells in the tumor, this did not affect the therapeutic efficacy. The anti-tumor effect of Ad-Flt3L+Ad-TK+TMZ required an intact immune system, since the treatment failed when administered to KO mice that lacked lymphocytes or dendritic cells. Conclusions Our results challenge the notion that chemotherapy leads to a state of immune-suppression which impairs the ability of the immune system to mount an effective anti-tumor response. Our work indicates that TMZ does not inhibit antitumor immunity and supports its clinical implementation in combination with immune-mediated therapies. PMID:24501391

  7. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.


    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna


    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  8. Innate Immune Responses to AAV Vectors.


    Rogers, Geoffrey L; Martino, Ashley T; Aslanidi, George V; Jayandharan, Giridhara R; Srivastava, Arun; Herzog, Roland W


    Gene replacement therapy by in vivo delivery of adeno-associated virus (AAV) is attractive as a potential treatment for a variety of genetic disorders. However, while AAV has been used successfully in many models, other experiments in clinical trials and in animal models have been hampered by undesired responses from the immune system. Recent studies of AAV immunology have focused on the elimination of transgene-expressing cells by the adaptive immune system, yet the innate immune system also has a critical role, both in the initial response to the vector and in prompting a deleterious adaptive immune response. Responses to AAV vectors are primarily mediated by the TLR9-MyD88 pathway, which induces the production of pro-inflammatory cytokines by activating the NF-κB pathways and inducing type I IFN production; self-complementary AAV vectors enhance these inflammatory processes. Additionally, the alternative NF-κB pathway influences transgene expression in cells transduced by AAV. This review highlights these recent discoveries regarding innate immune responses to AAV and discusses strategies to ablate these potentially detrimental signaling pathways.

  9. Cytomegalovirus infection improves immune responses to influenza

    PubMed Central

    Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai; Angel, Cesar J Lopez; Onengut-Gumuscu, Suna; Kidd, Brian; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M


    Cytomegalovirus (CMV) is a beta-herpes virus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV serostatus. In contrast, CMV-infected young adults exhibited an overall up-regulation of immune components including enhanced antibody responses to influenza vaccination, increased CD8+ T cell sensitivity, and elevated levels of circulating IFN-γ compared to uninfected individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the continued coexistence of CMV and mammals throughout their evolution. PMID:25834109

  10. Vaccination Strategies for Mucosal Immune Responses

    PubMed Central

    Ogra, Pearay L.; Faden, Howard; Welliver, Robert C.


    Mucosal administration of vaccines is an important approach to the induction of appropriate immune responses to microbial and other environmental antigens in systemic sites and peripheral blood as well as in most external mucosal surfaces. The development of specific antibody- or T-cell-mediated immunologic responses and the induction of mucosally induced systemic immunologic hyporesponsiveness (oral or mucosal tolerance) depend on complex sets of immunologic events, including the nature of the antigenic stimulation of specialized lymphoid structures in the host, antigen-induced activation of different populations of regulatory T cells (Th1 versus Th2), and the expression of proinflammatory and immunoregulatory cytokines. Availability of mucosal vaccines will provide a painless approach to deliver large numbers of vaccine antigens for human immunization. Currently, an average infant will receive 20 to 25 percutaneous injections for vaccination against different childhood infections by 18 months of age. It should be possible to develop for human use effective, nonliving, recombinant, replicating, transgenic, and microbial vector- or plant-based mucosal vaccines to prevent infections. Based on the experience with many dietary antigens, it is also possible to manipulate the mucosal immune system to induce systemic tolerance against environmental, dietary, and possibly other autoantigens associated with allergic and autoimmune disorders. Mucosal immunity offers new strategies to induce protective immune responses against a variety of infectious agents. Such immunization may also provide new prophylactic or therapeutic avenues in the control of autoimmune diseases in humans. PMID:11292646

  11. Impaired T-cell responses to sphingosine-1-phosphate in HIV-1 infected lymph nodes

    PubMed Central

    Mudd, Joseph C.; Murphy, Patrick; Manion, Maura; Debernardo, Robert; Hardacre, Jeffrey; Ammori, John; Hardy, Gareth A.; Harding, Clifford V.; Mahabaleshwar, Ganapati H.; Jain, Mukesh K.; Jacobson, Jeffrey M.; Brooks, Ari D.; Lewis, Sharon; Schacker, Timothy W.; Anderson, Jodi; Haddad, Elias K.; Cubas, Rafael A.; Rodriguez, Benigno; Sieg, Scott F.


    The determinants of HIV-1-associated lymphadenopathy are poorly understood. We hypothesized that lymphocytes could be sequestered in the HIV-1+ lymph node (LN) through impairments in sphingosine-1-phosphate (S1P) responsiveness. To test this hypothesis, we developed novel assays for S1P-induced Akt phosphorylation and actin polymerization. In the HIV-1+ LN, naïve CD4 T cells and central memory CD4 and CD8 T cells had impaired Akt phosphorylation in response to S1P, whereas actin polymerization responses to S1P were impaired dramatically in all LN maturation subsets. These defects were improved with antiretroviral therapy. LN T cells expressing CD69 were unable to respond to S1P in either assay, yet impaired S1P responses were also seen in HIV-1+ LN T cells lacking CD69 expression. Microbial elements, HIV-1, and interferon α – putative drivers of HIV-1associated immune activation all tended to increase CD69 expression and reduce T-cell responses to S1P in vitro. Impairment in T-cell egress from lymph nodes through decreased S1P responsiveness may contribute to HIV-1-associated LN enlargement and to immune dysregulation in a key organ of immune homeostasis. PMID:23422746

  12. Regulation of immune responses by L-arginine metabolism.


    Bronte, Vincenzo; Zanovello, Paola


    L-Arginine is an essential amino acid for birds and young mammals, and it is a conditionally essential amino acid for adult mammals, as it is important in situations in which requirements exceed production, such as pregnancy. Recent findings indicate that increased metabolism of L-arginine by myeloid cells can result in the impairment of lymphocyte responses to antigen during immune responses and tumour growth. Two enzymes that compete for L-arginine as a substrate - arginase and nitric-oxide synthase - are crucial components of this lymphocyte-suppression pathway, and the metabolic products of these enzymes are important moderators of T-cell function. This Review article focuses on the relevance of L-arginine metabolism by myeloid cells for immunity under physiological and pathological conditions.

  13. Bacterial vaginosis and the cervicovaginal immune response

    PubMed Central

    Mitchell, Caroline; Marrazzo, Jeanne


    Bacterial vaginosis (BV) is a common cause of vaginal discharge in reproductive age women around the world, and is associated with several poor reproductive health outcomes, including HIV-1 acquisition. One possible mechanism for this association is the inflammatory immune response induced by BV in the cervical and vaginal mucosae. There is significant heterogeneity in reports of markers of cervicovaginal inflammation in women with bacterial vaginosis, likely due to microbial and host diversity, as well as differences in study design. In this article we review the characteristics of the mucosal immune response in BV, the potential role of lactobacilli in modulating that response, and the impact of individual BV-associated bacterial species on mucosal immunity. We focus on inflammatory markers that are proposed to increase the risk of HIV-1 acquisition. PMID:24832618

  14. Radiation triggering immune response and inflammation.


    Hekim, Nezih; Cetin, Zafer; Nikitaki, Zacharenia; Cort, Aysegul; Saygili, Eyup Ilker


    Radiation therapy (RT) is a well-established but still under optimization branch of Cancer Therapy (CT). RT uses electromagnetic waves or charged particles in order to kill malignant cells, by accumulating the energy onto these cells. The issue at stake for RT, as well as for any other Cancer Therapy technique, is always to kill only cancer cells, without affecting the surrounding healthy ones. This perspective of CT is usually described under the terms "specificity" and "selectivity". Specificity and selectivity are the ideal goal, but the ideal is never entirely achieved. Thus, in addition to killing healthy cells, changes and effects are observed in the immune system after irradiation. In this review, we mainly focus on the effects of ionizing radiation on the immune system and its components like bone marrow. Additionally, we are interested in the effects and benefits of low-dose ionizing radiation on the hematopoiesis and immune response. Low dose radiation has been shown to induce biological responses like inflammatory responses, innate immune system activation and DNA repair (adaptive response). This review reveals the fact that there are many unanswered questions regarding the role of radiation as either an immune-activating (low dose) or immunosuppressive (high dose) agent.

  15. Damage signals in the insect immune response

    PubMed Central

    Krautz, Robert; Arefin, Badrul; Theopold, Ulrich


    Insects and mammals share an ancient innate immune system comprising both humoral and cellular responses. The insect immune system consists of the fat body, which secretes effector molecules into the hemolymph and several classes of hemocytes, which reside in the hemolymph and of protective border epithelia. Key features of wound- and immune responses are shared between insect and mammalian immune systems including the mode of activation by commonly shared microbial (non-self) patterns and the recognition of these patterns by dedicated receptors. It is unclear how metazoan parasites in insects, which lack these shared motifs, are recognized. Research in recent years has demonstrated that during entry into the insect host, many eukaryotic pathogens leave traces that alert potential hosts of the damage they have afflicted. In accordance with terminology used in the mammalian immune systems, these signals have been dubbed danger- or damage-associated signals. Damage signals are necessary byproducts generated during entering hosts either by mechanical or proteolytic damage. Here, we briefly review the current stage of knowledge on how wound closure and wound healing during mechanical damage is regulated and how damage-related signals contribute to these processes. We also discuss how sensors of proteolytic activity induce insect innate immune responses. Strikingly damage-associated signals are also released from cells that have aberrant growth, including tumor cells. These signals may induce apoptosis in the damaged cells, the recruitment of immune cells to the aberrant tissue and even activate humoral responses. Thus, this ensures the removal of aberrant cells and compensatory proliferation to replace lost tissue. Several of these pathways may have been co-opted from wound healing and developmental processes. PMID:25071815

  16. Immune Response in Human Cerebral Cavernous Malformations

    PubMed Central

    Shi, Changbin; Shenkar, Robert; Du, Hongyan; Duckworth, Edward; Raja, Harish; Batjer, H. Hunt; Awad, Issam A.


    Background and Purpose Preliminary observations suggesting the presence of B and plasma cells and oligoclonality of immunoglobulin (Ig) G in cerebral cavernous malformations (CCMs) have motivated a systematic study correlating the infiltration of the immune cells with clinical activity and antigen-triggered immune response in surgically excised lesions. Methods Infiltration of plasma, B, T and HLA-DR expressing cells and macrophages within 23 excised CCMs was related to clinical activity. Relative amounts of Ig isotypes were determined. IgG clonality of mRNA from CCMs was assessed by spectratyping, cloning and sequencing. Results Infiltration of the immune cells ranged widely within CCM lesions and cells were generally co-expressed with each other. Immune cell infiltration did not associate with recent bleeding and lesion growth. Significantly more B lymphocytes in CCM lesions were associated with venous anomaly. More T cells were present in solitary lesions. More T cells and less macrophages were present in CCMs from younger subjects. IgG isotype was present in all CCM lesions. Most lesions also expressed IgM and IgA, with IgM predominance over IgA correlating with recent CCM growth. Oligoclonality was shown in IgG mRNA from CCMs, but not from peripheral blood lymphocytes, with only eight CDR3 sequences observed among 134 clones from two CCM lesions. Conclusions An antigen-directed oligoclonal IgG immune response is present within CCM lesions regardless of recent clinical activity. Apparent differences in immune response in younger patients and in lesions with recent growth will need confirmation in other series. The pathogenicity of oligoclonal immune response will require systematic hypothesis testing in recently available CCM murine models. PMID:19286587

  17. Myeloid PTEN deficiency impairs tumor-immune surveillance via immune-checkpoint inhibition

    PubMed Central

    Kuttke, M.; Sahin, E.; Pisoni, J.; Percig, S.; Vogel, A.; Kraemmer, D.; Hanzl, L.; Brunner, J. S.; Paar, H.; Soukup, K.; Halfmann, A.; Dohnal, A. M.; Steiner, C. W.; Blüml, S.; Basilio, J.; Hochreiter, B.; Salzmann, M.; Hoesel, B.; Lametschwandtner, G.; Eferl, R.; Schmid, J. A.; Schabbauer, G.


    ABSTRACT Tumor–host interaction is determined by constant immune surveillance, characterized by tumor infiltration of myeloid and lymphoid cells. A malfunctioning or diverted immune response promotes tumor growth and metastasis. Recent advances had been made, by treating of certain tumor types, such as melanoma, with T-cell checkpoint inhibitors. This highlights the importance of understanding the molecular mechanisms underlying the crosstalk between tumors and their environment, in particular myeloid and lymphoid cells. Our aim was to study the contribution of the myeloid PI3K/PTEN-signaling pathway in the regulation of tumor-immune surveillance in murine models of cancer. We made use of conditional PTEN-deficient mice, which exhibit sustained activation of the PI3K-signaling axis in a variety of myeloid cell subsets such as macrophages and dendritic cells (DCs). In colitis-associated colon cancer (CAC), mice deficient in myeloid PTEN showed a markedly higher tumor burden and decreased survival. We attributed this observation to the increased presence of immune-modulatory conventional CD8α+ DCs in the spleen, whereas other relevant myeloid cell subsets were largely unaffected. Notably, we detected enhanced surface expression of PD-L1 and PD-L2 on these DCs. As a consequence, tumoricidal T-cell responses were hampered or redirected. Taken together, our findings indicated an unanticipated role for the PI3K/PTEN-signaling axis in the functional regulation of splenic antigen-presenting cells (APCs). Our data pointed at potential, indirect, tumoricidal effects of subclass-specific PI3K inhibitors, which are currently under clinical investigation for treatment of tumors, via myeloid cell activation. PMID:27622019

  18. Immune Responses in Parasitic Diseases.

    DTIC Science & Technology


    prepared in pure form so that quantitative radial immunodiffusion studies are feasible. The IgGl response to T. rhodesiense infection in the rat has been...sera of infected animals and definitely-separate and quantitate the 19S from 8S species by combining radial immunodiffusion techniques and sucrose

  19. Neuroblastoma Arginase Activity Creates an Immunosuppressive Microenvironment That Impairs Autologous and Engineered Immunity.


    Mussai, Francis; Egan, Sharon; Hunter, Stuart; Webber, Hannah; Fisher, Jonathan; Wheat, Rachel; McConville, Carmel; Sbirkov, Yordan; Wheeler, Kate; Bendle, Gavin; Petrie, Kevin; Anderson, John; Chesler, Louis; De Santo, Carmela


    Neuroblastoma is the most common extracranial solid tumor of childhood, and survival remains poor for patients with advanced disease. Novel immune therapies are currently in development, but clinical outcomes have not matched preclinical results. Here, we describe key mechanisms in which neuroblastoma inhibits the immune response. We show that murine and human neuroblastoma tumor cells suppress T-cell proliferation through increased arginase activity. Arginase II is the predominant isoform expressed and creates an arginine-deplete local and systemic microenvironment. Neuroblastoma arginase activity results in inhibition of myeloid cell activation and suppression of bone marrow CD34(+) progenitor proliferation. Finally, we demonstrate that the arginase activity of neuroblastoma impairs NY-ESO-1-specific T-cell receptor and GD2-specific chimeric antigen receptor-engineered T-cell proliferation and cytotoxicity. High arginase II expression correlates with poor survival for patients with neuroblastoma. The results support the hypothesis that neuroblastoma creates an arginase-dependent immunosuppressive microenvironment in both the tumor and blood that leads to impaired immunosurveillance and suboptimal efficacy of immunotherapeutic approaches.

  20. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology


    D-Ai8i 71S UMAN IMMUNE RESPONSES TO DENGUE VIRUSES(U) MASSACHUSETTS UNIV M DICAL CENTER WORCESTER MA F A ENNIS 81 AUG 86 DAD17-82-C-2233 UNCLSE...Classification) (U) Human Immune Responses to Dengue Viruses 12. PERSONAL AUTHOR(S) Ennis. Francis A. 13a. TYPE OF REPORT 13b. TIME COVERED 414. DATE OF...Continue on reverse if necessary and identify by block number) FIELD GROUP SUB-GROUP06 13 Virus; Dengue ; Arbovirus; Immunology 06 03 I9% ABSTRACT

  1. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology


    t-Ril 630 HuMAN IMMUNE RESPONSES TO DENGUE VIRUSES(U) 1 - MASSACHUSETTS UNIV MEDICAL SCHOOL WORCESTER F A ENNIS 01 AUGO 95 DAMDI-2-C-2233 UNCASSIFIED...Classification) (U) Human Immune Responses to Dengue Viruses 12. PERSONAL AUTHOR(S) Ennis, Francis A. 13a. TYPE OF REPORT 13b. TIME COVERED 14. DATE OF...on reverse if necessary and identify by block number) FIELD GROUP SUB-GROUP06 13 Virus; Dengue ; Arbovirus; Immunology 06 13 19. ABSTRACT (Continue on

  2. Human Immune Response to Dengue Infections.

    DTIC Science & Technology


    DTIC AD-A240 717 AD ____ HUMAN IMMUNE RESPONSE TO DENGUE INFECTIONS ANNUAL REPORT FRANCIS A. ENNIS JUNE 30, 1991 Supported by U.S. ARMY MEDICAL...Immune Response to Dengue Infections DAMDI7-86-C-6208 6. AUTHOR(S) 61102A 1 3M161102BS13 AA Francis A. Ennis WUDA3 12059 7. PERFORMING ORGANIZATION...of NS3, respectively. We also established 16 dengue virus-specific CD8+ CD4_ T cell clones. The clone #/2.8 recognize dengue virus types 2 and 4, and

  3. Immune response inhibits associative learning in insects.

    PubMed Central

    Mallon, Eamonn B; Brockmann, Axel; Schmid-Hempel, Paul


    In vertebrates, it is well established that there are many intricate interactions between the immune system and the nervous system, and vice versa. Regarding insects, until now little has been known about the link between these two systems. Here, we present behavioural evidence indicating a link between the immune system and the nervous system in insects. We show that otherwise non-infected honeybees whose immune systems are challenged by a non-pathogenic immunogenic elicitor lipopolysaccharide (LPS) have reduced abilities to associate an odour with sugar reward in a classical conditioning paradigm. The cost of an immune response therefore not only affects survival of the host, as previously shown, but also everyday behaviour and memory formation. PMID:14667337

  4. A nonequilibrium phase transition in immune response

    NASA Astrophysics Data System (ADS)

    Zhang, Wei; Qi, An-Shen


    The dynamics of immune response correlated to signal transduction in immune thymic cells (T cells) is studied. In particular, the problem of the phosphorylation of the immune-receptor tyrosine-based activation motifs (ITAM) is explored. A nonlinear model is established on the basis of experimental observations. The behaviours of the model can be well analysed using the concepts of nonequilibrium phase transitions. In addition, the Riemann-Hugoniot cusp catastrophe is demonstrated by the model. Due to the application of the theory of nonequilibrium phase transitions, the biological phenomena can be clarified more precisely. The results can also be used to further explain the signal transduction and signal discrimination of an important type of immune T cell.

  5. Immune response from a resource allocation perspective

    PubMed Central

    Rauw, Wendy M.


    The immune system is a life history trait that can be expected to trade off against other life history traits. Whether or not a trait is considered to be a life history trait has consequences for the expectation on how it responds to natural selection and evolution; in addition, it may have consequences for the outcome of artificial selection when it is included in the breeding objective. The immune system involved in pathogen resistance comprises multiple mechanisms that define a host's defensive capacity. Immune resistance involves employing mechanisms that either prevent pathogens from invading or eliminate the pathogens when they do invade. On the other hand, tolerance involves limiting the damage that is caused by the infection. Both tolerance and resistance traits require (re)allocation of resources and carry physiological costs. Examples of trade-offs between immune function and growth, reproduction and stress response are provided in this review, in addition to consequences of selection for increased production on immune function and vice versa. Reaction norms are used to deal with questions of immune resistance vs. tolerance to pathogens that relate host health to infection intensity. In essence, selection for immune tolerance in livestock is a particular case of selection for animal robustness. Since breeding goals that include robustness traits are required in the implementation of more sustainable agricultural production systems, it is of interest to investigate whether immune tolerance is a robustness trait that is positively correlated with overall animal robustness. Considerably more research is needed to estimate the shapes of the cost functions of different immune strategies, and investigate trade-offs and cross-over benefits of selection for disease resistance and/or disease tolerance in livestock production. PMID:23413205

  6. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis Survival

    DTIC Science & Technology


    germinate into vegetative bacteria (10, 23), which are capable of secreting anthrax lethal toxin (LT) and edema toxin . In the lymph nodes, bacteria ...inability of AM to completely eradicate bacteria suggests that intracellularly secreted lethal FIG. 5. Lethal toxin impairs bactericidal activity but...Microbiology. All Rights Reserved. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis

  7. Abnormal immune responses of Bloom's syndrome lymphocytes in vitro.

    PubMed Central

    Hütteroth, T H; Litwin, S D; German, J


    Bloom's syndrome is a rare autosmal recessive disorder, first characterized by growth retardation and asum-sensitive facial telangiectasia and more recently demonstarted to have increased chromosome instability, a predisposition to malignancy, and increased susecptibitily to infection. The present report ocncern the immune function of Bloom's syndrom lymphoctes in vitro. Four affected homozgotes and five heterozygotes were studied. An abnormal serum concentartion of at least one class of immunoglobin was present in three out of four homozgotes. Affected homozgotes were shown capable of both a humoral and cellular response after antigenic challenge, the responses in general being weak but detectable. Blood lymphocytes from Bloom's syndrome individuals were cultured in impaired proliferavite response and synthesized less immunoglobulin at the end of 5 days than did normal controls. In contrast, they had a normal proliferative response to phytohemagglutinin except at highest concentrations of the mitogen. In the mixed lymphocte culture, Bloom's syndrome lymphocytes proved to be poor responder cells but normal stimulator cells. Lmyphoctes from the heterozgotes produced normal responses in these three systems. Distrubed immunity appears to be on of several major consequences of homozygosity for the Bloom's syndrome gene. Although the explanation for this pleiotropism is at present obscure, the idea was advanced that the aberrant immune function is, along with the major clincial feature-small body size, amanifestation of defect in cellular proliferation. PMID:124745

  8. The Innate Immune Response Against Staphylococcus aureus.


    Bekeredjian-Ding, Isabelle; Stein, Christoph; Uebele, Julia


    The innate immune system harbors a multitude of different receptor systems and cells that are constantly prepared to sense and eliminate invading microbial pathogens. Staphylococcus aureus enters the body on its exposed epithelial surfaces, e.g., on skin and mucosa. The initial interaction with epithelial cells is governed by Toll-like receptor (TLR)-2-mediated local production of soluble mediators, including cytokines, chemokines, and antimicrobial peptides. The overall goal is to achieve a steady state of immune mediators and colonizing bacteria. Following cell and tissue invasion clearance of bacteria depends on intracellular microbial sensors and subsequent activation of the inflammasomes. Tissue-resident mast cells and macrophages recruit neutrophils, macrophages, and NK cells. This inflammatory response supports the generation of IL-17 producing NKT, γδ T cells, and T helper cells. Local dendritic cells migrate to the lymph nodes and fine-tune the adaptive immune response. The scope of this chapter is to provide an overview on the major cell types and receptors involved in innate immune defense against S. aureus. By segregating the different stages of infection from epithelial barrier to intracellular and systemic infection, this chapter highlights the different qualities of the innate immune response to S. aureus at different stages of invasiveness.

  9. Peroxiredoxin 5 modulates immune response in Drosophila

    PubMed Central

    Radyuk, Svetlana N.; Michalak, Katarzyna; Klichko, Vladimir I.; Benes, Judith; Orr, William C.


    Background Peroxiredoxins are redox-sensing enzymes with multiple cellular functions. Previously, we reported on the potent antioxidant function of Drosophila peroxiredoxin 5 (dPrx5). Studies with mammalian and human cells suggest that peroxiredoxins can modulate immune-related signaling. Methods Survivorship studies and bacteriological analysis were used to determine resistance of flies to fungal and bacterial infections. RT-PCR and immunoblot analyses determined expression of dPrx5 and immunity factors in response to bacterial challenge. Double mutants for dprx5 gene and genes comprising the Imd/Relish and dTak1/Basket branches of the immune signaling pathways were used in epistatic analysis. Results The dprx5 mutant flies were more resistant to bacterial infection than controls, while flies overexpressing dPrx5 were more susceptible. The enhanced resistance to bacteria was accompanied by rapid induction of the Imd-dependent antimicrobial peptides, phosphorylation of the JNK kinase Basket and altered transcriptional profiling of the transient response genes, puckered, ets21C and relish, while the opposite effects were observed in flies over-expressing dPrx5. Epistatic analysis of double mutants, using attacin D and Puckered as read outs of activation of the Imd and JNK pathways, implicated dPrx5 function in the control of the dTak1-JNK arm of immune signaling. Conclusions Differential effects on fly survivorship suggested a trade-off between the antioxidant and immune functions of dPrx5. Molecular and epistatic analyses identified dPrx5 as a negative regulator in the dTak1-JNK arm of immune signaling. General significance Our findings suggest that peroxiredoxins play an important modulatory role in the Drosophila immune response. PMID:20600624

  10. Obesity impairs cell-mediated immunity during the second trimester of pregnancy

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Obesity is associated with impaired immunity. In obese pregnancy, both mother and fetus are susceptible to the short- and long-term deleterious effects of infectious illness. The objective of the study was to determine the impact of obesity on maternal blood immune cell subsets, intracellular and s...

  11. Impaired Hyperemic Response to Exercise Post Stroke

    PubMed Central

    Durand, Matthew J.; Murphy, Spencer A.; Schaefer, Kathleen K.; Hunter, Sandra K.; Schmit, Brian D.; Gutterman, David D.; Hyngstrom, Allison S.


    Individuals with chronic stroke have reduced perfusion of the paretic lower limb at rest; however, the hyperemic response to graded muscle contractions in this patient population has not been examined. This study quantified blood flow to the paretic and non-paretic lower limbs of subjects with chronic stroke after submaximal contractions of the knee extensor muscles and correlated those measures with limb function and activity. Ten subjects with chronic stroke and ten controls had blood flow through the superficial femoral artery quantified with ultrasonography before and immediately after 10 second contractions of the knee extensor muscles at 20, 40, 60, and 80% of the maximal voluntary contraction (MVC) of the test limb. Blood flow to the paretic and non-paretic limb of stroke subjects was significantly reduced at all load levels compared to control subjects even after normalization to lean muscle mass. Of variables measured, increased blood flow after an 80% MVC was the single best predictor of paretic limb strength, the symmetry of strength between the paretic and non-paretic limbs, coordination of the paretic limb, and physical activity. The impaired hemodynamic response to high intensity contractions was a better predictor of lower limb function than resting perfusion measures. Stroke-dependent weakness and atrophy of the paretic limb do not explain the reduced hyperemic response to muscle contraction alone as the response is similarly reduced in the non-paretic limb when compared to controls. These data may suggest a role for perfusion therapies to optimize rehabilitation post stroke. PMID:26630380

  12. Adaptive immune responses to Candida albicans infection

    PubMed Central

    Richardson, Jonathan P; Moyes, David L


    Fungal infections are becoming increasingly prevalent in the human population and contribute to morbidity and mortality in healthy and immunocompromised individuals respectively. Candida albicans is the most commonly encountered fungal pathogen of humans, and is frequently found on the mucosal surfaces of the body. Host defense against C. albicans is dependent upon a finely tuned implementation of innate and adaptive immune responses, enabling the host to neutralise the invading fungus. Central to this protection are the adaptive Th1 and Th17 cellular responses, which are considered paramount to successful immune defense against C. albicans infections, and enable tissue homeostasis to be maintained in the presence of colonising fungi. This review will highlight the recent advances in our understanding of adaptive immunity to Candida albicans infections. PMID:25607781

  13. Impaired humoral immunity and tolerance in K14-VEGFR-3-Ig mice that lack dermal lymphatic drainage

    PubMed Central

    Thomas, Susan N.; Rutkowski, Joseph M.; Pasquier, Miriella; Kuan, Emma L.; Alitalo, Kari; Randolph, Gwendalyn J.; Swartz, Melody A.


    Lymphatic vessels transport interstitial fluid, soluble antigen, and immune cells from peripheral tissues to lymph nodes (LNs), yet the contribution of peripheral lymphatic drainage to adaptive immunity remains poorly understood. We examined immune responses to dermal vaccination and contact hypersensitivity (CHS) challenge in K14-VEGFR-3-Ig mice, which lack dermal lymphatic capillaries and experience markedly depressed transport of solutes and dendritic cells from the skin to draining LNs. In response to dermal immunization, K14-VEGFR-3-Ig mice produced lower antibody titers. In contrast, although delayed, T cell responses were robust after 21 days, including high levels of antigen-specific CD8+ T cells and production of IFN-γ, IL-4 and IL-10 upon restimulation. T cell-mediated CHS responses were strong in K14-VEGFR-3-Ig mice, but importantly, their ability to induce CHS tolerance in the skin was impaired. Additionally, one-year-old mice displayed multiple signs of autoimmunity. These data suggest that lymphatic drainage plays more important roles in regulating humoral immunity and peripheral tolerance than in effector T cell immunity. PMID:22844119

  14. [Immune response genes products in human physiology].


    Khaitov, R M; Alekseev, L P


    Current data on physiological role of human immune response genes' proteomic products (antigens) are discussed. The antigens are specified by a very high level of diversity that mediates a wide specter ofphysiological functions. They actually provide integrity and biological stability of human as species. These data reveal new ideas on many pathological processes as well as drafts new approaches for prophylaxis and treatment.

  15. Immune Response in Mussels To Environmental Pollution.

    ERIC Educational Resources Information Center

    Pryor, Stephen C.; Facher, Evan


    Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)

  16. Adaptive immune cells temper initial innate responses

    PubMed Central

    Kim, Kwang Dong; Zhao, Jie; Auh, Sogyong; Yang, Xuanming; Du, Peishuang; Tang, Hong; Fu, Yang-Xin


    Toll-like receptors (TLRs) recognize conserved microbial structures called pathogen-associated molecular patterns. Signaling from TLRs leads to upregulation of co-stimulatory molecules for better priming of T cells and secretion of inflammatory cytokines by innate immune cells1–4. Lymphocytedeficient hosts often die of acute infection, presumably owing to their lack of an adaptive immune response to effectively clear pathogens. However, we show here that an unleashed innate immune response due to the absence of residential T cells can also be a direct cause of death. Viral infection or administration of poly(I:C), a ligand for TLR3, led to cytokine storm in T-cell- or lymphocyte-deficient mice in a fashion dependent on NK cells and tumor necrosis factor. We have further shown, through the depletion of CD4+ and CD8+ cells in wild-type mice and the transfer of T lymphocytes into Rag-1–deficient mice, respectively, that T cells are both necessary and sufficient to temper the early innate response. In addition to the effects of natural regulatory T cells, close contact of resting CD4+CD25−Foxp3− or CD8+ T cells with innate cells could also suppress the cytokine surge by various innate cells in an antigen-independent fashion. Therefore, adaptive immune cells have an unexpected role in tempering initial innate responses. PMID:17891146

  17. [Modulation of immune response by bacterial lipopolysaccharides].


    Aldapa-Vega, Gustavo; Pastelín-Palacios, Rodolfo; Isibasi, Armando; Moreno-Eutimio, Mario A; López-Macías, Constantino


    Lipopolysaccharide (LPS) is a molecule that is profusely found on the outer membrane of Gram-negative bacteria and is also a potent stimulator of the immune response. As the main molecule on the bacterial surface, is also the most biologically active. The immune response of the host is activated by the recognition of LPS through Toll-like receptor 4 (TLR4) and this receptor-ligand interaction is closely linked to LPS structure. Microorganisms have evolved systems to control the expression and structure of LPS, producing structural variants that are used for modulating the host immune responses during infection. Examples of this include Helicobacter pylori, Francisella tularensis, Chlamydia trachomatis and Salmonella spp. High concentrations of LPS can cause fever, increased heart rate and lead to septic shock and death. However, at relatively low concentrations some LPS are highly active immunomodulators, which can induce non-specific resistance to invading microorganisms. The elucidation of the molecular and cellular mechanisms involved in the recognition of LPS and its structural variants has been fundamental to understand inflammation and is currently a pivotal field of research to understand the innate immune response, inflammation, the complex host-pathogen relationship and has important implications for the rational development of new immunomodulators and adjuvants.

  18. Adaptive immune cells temper initial innate responses.


    Kim, Kwang Dong; Zhao, Jie; Auh, Sogyong; Yang, Xuanming; Du, Peishuang; Tang, Hong; Fu, Yang-Xin


    Toll-like receptors (TLRs) recognize conserved microbial structures called pathogen-associated molecular patterns. Signaling from TLRs leads to upregulation of co-stimulatory molecules for better priming of T cells and secretion of inflammatory cytokines by innate immune cells. Lymphocyte-deficient hosts often die of acute infection, presumably owing to their lack of an adaptive immune response to effectively clear pathogens. However, we show here that an unleashed innate immune response due to the absence of residential T cells can also be a direct cause of death. Viral infection or administration of poly(I:C), a ligand for TLR3, led to cytokine storm in T-cell- or lymphocyte-deficient mice in a fashion dependent on NK cells and tumor necrosis factor. We have further shown, through the depletion of CD4+ and CD8+ cells in wild-type mice and the transfer of T lymphocytes into Rag-1-deficient mice, respectively, that T cells are both necessary and sufficient to temper the early innate response. In addition to the effects of natural regulatory T cells, close contact of resting CD4+CD25-Foxp3- or CD8+ T cells with innate cells could also suppress the cytokine surge by various innate cells in an antigen-independent fashion. Therefore, adaptive immune cells have an unexpected role in tempering initial innate responses.

  19. Innate immune responses to hepatitis C virus.


    Schoggins, John W; Rice, Charles M


    The innate immune response provides the first line of defense against invading viral pathogens. Incoming viruses are sensed by dedicated host factors that, when triggered, initiate multiple signal transduction pathways. Activation of these pathways leads to the induction of highly orchestrated transcriptional programs designed to limit virus replication and spread. In recent years, our understanding of innate immune responses targeting hepatitis C virus (HCV) has increased substantially, largely due to the development of new systems and methodologies to study HCV-host interactions in vitro and in vivo. However, significant gaps still remain. Here, we aim to provide a comprehensive view of the innate immune response to HCV, focusing primarily on knowledge gained from cell culture models of HCV infection, as well as data from human patients infected with HCV. While some paradigms of the host response to HCV revealed in cell culture translate to human infection in vivo, others are less clear. Further insight into the similarities and differences in these systems will not only reveal directions for future studies on HCV immunity, but may also guide the development of novel strategies to control HCV and other viral infections.

  20. Impaired SNX9 Expression in Immune Cells during Chronic Inflammation: Prognostic and Diagnostic Implications.


    Ish-Shalom, Eliran; Meirow, Yaron; Sade-Feldman, Moshe; Kanterman, Julia; Wang, Lynn; Mizrahi, Olga; Klieger, Yair; Baniyash, Michal


    Chronic inflammation is associated with immunosuppression and downregulated expression of the TCR CD247. In searching for new biomarkers that could validate the impaired host immune status under chronic inflammatory conditions, we discovered that sorting nexin 9 (SNX9), a protein that participates in early stages of clathrin-mediated endocytosis, is downregulated as well under such conditions. SNX9 expression was affected earlier than CD247 by the generated harmful environment, suggesting that it is a potential marker sensing the generated immunosuppressive condition. We found that myeloid-derived suppressor cells, which are elevated in the course of chronic inflammation, are responsible for the observed SNX9 reduced expression. Moreover, SNX9 downregulation is reversible, as its expression levels return to normal and immune functions are restored when the inflammatory response and/or myeloid-derived suppressor cells are neutralized. SNX9 downregulation was detected in numerous mouse models for pathologies characterized by chronic inflammation such as chronic infection (Leishmania donovani), cancer (melanoma and colorectal carcinoma), and an autoimmune disease (rheumatoid arthritis). Interestingly, reduced levels of SNX9 were also observed in blood samples from colorectal cancer patients, emphasizing the feasibility of its use as a diagnostic and prognostic biomarker sensing the host's immune status and inflammatory stage. Our new discovery of SNX9 as being regulated by chronic inflammation and its association with immunosuppression, in addition to the CD247 regulation under such conditions, show the global impact of chronic inflammation and the generated immune environment on different cellular pathways in a diverse spectrum of diseases.

  1. Innate Immune Sensing and Response to Influenza

    PubMed Central

    Pulendran, Bali; Maddur, Mohan S.


    Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocom-promised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza. PMID:25078919

  2. Acidic chitinase primes the protective immune response to gastrointestinal nematodes.


    Vannella, Kevin M; Ramalingam, Thirumalai R; Hart, Kevin M; de Queiroz Prado, Rafael; Sciurba, Joshua; Barron, Luke; Borthwick, Lee A; Smith, Allen D; Mentink-Kane, Margaret; White, Sandra; Thompson, Robert W; Cheever, Allen W; Bock, Kevin; Moore, Ian; Fitz, Lori J; Urban, Joseph F; Wynn, Thomas A


    Acidic mammalian chitinase (AMCase) is known to be induced by allergens and helminths, yet its role in immunity is unclear. Using AMCase-deficient mice, we show that AMCase deficiency reduced the number of group 2 innate lymphoid cells during allergen challenge but was not required for establishment of type 2 inflammation in the lung in response to allergens or helminths. In contrast, AMCase-deficient mice showed a profound defect in type 2 immunity following infection with the chitin-containing gastrointestinal nematodes Nippostrongylus brasiliensis and Heligmosomoides polygyrus bakeri. The impaired immunity was associated with reduced mucus production and decreased intestinal expression of the signature type 2 response genes Il13, Chil3, Retnlb, and Clca1. CD103(+) dendritic cells, which regulate T cell homing, were also reduced in mesenteric lymph nodes of infected AMCase-deficient mice. Thus, AMCase functions as a critical initiator of protective type 2 responses to intestinal nematodes but is largely dispensable for allergic responses in the lung.

  3. Humoral Immune Response to AAV

    PubMed Central

    Calcedo, Roberto; Wilson, James M.


    Adeno-associated virus (AAV) is a member of the family Parvoviridae that has been widely used as a vector for gene therapy because of its safety profile, its ability to transduce both dividing and non-dividing cells, and its low immunogenicity. AAV has been detected in many different tissues of several animal species but has not been associated with any disease. As a result of natural infections, antibodies to AAV can be found in many animals including humans. It has been shown that pre-existing AAV antibodies can modulate the safety and efficacy of AAV vector-mediated gene therapy by blocking vector transduction or by redirecting distribution of AAV vectors to tissues other than the target organ. This review will summarize antibody responses against natural AAV infections, as well as AAV gene therapy vectors and their impact in the clinical development of AAV vectors for gene therapy. We will also review and discuss the various methods used for AAV antibody detection and strategies to overcome neutralizing antibodies in AAV-mediated gene therapy. PMID:24151496

  4. Humoral Immune Response to AAV.


    Calcedo, Roberto; Wilson, James M


    Adeno-associated virus (AAV) is a member of the family Parvoviridae that has been widely used as a vector for gene therapy because of its safety profile, its ability to transduce both dividing and non-dividing cells, and its low immunogenicity. AAV has been detected in many different tissues of several animal species but has not been associated with any disease. As a result of natural infections, antibodies to AAV can be found in many animals including humans. It has been shown that pre-existing AAV antibodies can modulate the safety and efficacy of AAV vector-mediated gene therapy by blocking vector transduction or by redirecting distribution of AAV vectors to tissues other than the target organ. This review will summarize antibody responses against natural AAV infections, as well as AAV gene therapy vectors and their impact in the clinical development of AAV vectors for gene therapy. We will also review and discuss the various methods used for AAV antibody detection and strategies to overcome neutralizing antibodies in AAV-mediated gene therapy.

  5. Humoral immune responses in foetal sheep.

    PubMed Central

    Fahey, K J; Morris, B


    A total of fifty-two foetal sheep between 49 and 126 days gestation were injected with polymeric and monomeric flagellin, dinitrophenylated monomeric flagellin, chicken red blood cells, ovalbumin, ferritin, chicken gamma-globulin and the somatic antigens of Salmonella typhimurium in a variety of combinations. Immune responses were followed in these animals by taking serial blood samples from them through indwelling vascular cannulae and measuring the circulating titres of antibody. Of the antigens tested, ferritin induced immune responses in the youngest foetuses. A short time later in gestation, the majority of foetuses responded to chicken red blood cells, polymeric flagellin, monomeric flagellin and dinitrophenylated monomeric flagellin. Only older foetuses responded regularly to chicken gamma-globulin and ovalbumin. However, antibodies to all these antigens were first detected over the relatively short period of development between 64 and 82 days gestation and this made it difficult to define any precise order in the development of immune responsiveness. Of the antigens tested only the somatic antigens of S. typhimurium failed to induce a primary antibody response during foetal life. The character and magnitude of the antibody responses in foetuses changed throughout in utero development. Both the total amount of antibody produced and the duration of the response increased with foetal age. Foetuses younger than 87 days gestation did not synthesize 2-mercaptoethanol resistant antibodies or IgG1 immunoglobulin to any of the antigens tested, whereas most foetuses older than this regularly did so. PMID:711249

  6. Ovine model for studying pulmonary immune responses

    SciTech Connect

    Joel, D.D.; Chanana, A.D.


    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with /sup 125/I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables.

  7. Space flight, microgravity, stress, and immune responses

    NASA Astrophysics Data System (ADS)

    Sonnenfeld, G.


    Exposure of animals and humans to space flight conditions has resulted in numerous alterations in immunological parameters. Decreases in lymphocyte blastogenesis, cytokine production, and natural killer cell activity have all been reported after space flight. Alterations in leukocyte subset distribution have also been reported after flight of humans and animals in space. The relative contribution of microgravity conditions and stress to the observed results has not been established. Antiorthostatic, hypokinetic, hypodynamic, suspension of rodents and chronic head-down tilt bed-rest of humans have been used to model effects of microgravity on immune responses. After use of these models, some effects of space flight on immune responses, such as decreases in cytokine function, were observed, but others, such as alterations in leukocyte subset distribution, were not observed. These results suggest that stresses that occur during space flight could combine with microgravity conditions in inducing the changes seen in immune responses after space flight. The biological/biomedical significance of space flight induced changes in immune parameters remains to be established.

  8. Immune responses to infectious diseases in bivalves.


    Allam, Bassem; Raftos, David


    Many species of bivalve mollusks (phylum Mollusca, class Bivalvia) are important in fisheries and aquaculture, whilst others are critical to ecosystem structure and function. These crucial roles mean that considerable attention has been paid to the immune responses of bivalves such as oysters, clams and mussels against infectious diseases that can threaten the viability of entire populations. As with many invertebrates, bivalves have a comprehensive repertoire of immune cells, genes and proteins. Hemocytes represent the backbone of the bivalve immune system. However, it is clear that mucosal tissues at the interface with the environment also play a critical role in host defense. Bivalve immune cells express a range of pattern recognition receptors and are highly responsive to the recognition of microbe-associated molecular patterns. Their responses to infection include chemotaxis, phagolysosomal activity, encapsulation, complex intracellular signaling and transcriptional activity, apoptosis, and the induction of anti-viral states. Bivalves also express a range of inducible extracellular recognition and effector proteins, such as lectins, peptidoglycan-recognition proteins, thioester bearing proteins, lipopolysaccharide and β1,3-glucan-binding proteins, fibrinogen-related proteins (FREPs) and antimicrobial proteins. The identification of FREPs and other highly diversified gene families in bivalves leaves open the possibility that some of their responses to infection may involve a high degree of pathogen specificity and immune priming. The current review article provides a comprehensive, but not exhaustive, description of these factors and how they are regulated by infectious agents. It concludes that one of the remaining challenges is to use new "omics" technologies to understand how this diverse array of factors is integrated and controlled during infection.

  9. Microbes and mucosal immune responses in asthma.


    Hansel, Trevor T; Johnston, Sebastian L; Openshaw, Peter J


    The substantial increase in the worldwide prevalence of asthma and atopy has been attributed to lifestyle changes that reduce exposure to bacteria. A recent insight is that the largely bacterial microbiome maintains a state of basal immune homoeostasis, which modulates immune responses to microbial pathogens. However, some respiratory viral infections cause bronchiolitis of infancy and childhood wheeze, and can exacerbate established asthma; whereas allergens can partly mimic infectious agents. New insights into the host’s innate sensing systems, combined with recently developed methods that characterise commensal and pathogenic microbial exposure, now allow a unified theory for how microbes cause mucosal inflammation in asthma. The respiratory mucosa provides a key microbial interface where epithelial and dendritic cells interact with a range of functionally distinct lymphocytes. Lymphoid cells then control a range of pathways, both innate and specific, which organise the host mucosal immune response. Fundamental to innate immune responses to microbes are the interactions between pathogen-associated molecular patterns and pattern recognition receptors, which are associated with production of type I interferons, proinflammatory cytokines, and the T-helper-2 cell pathway in predisposed people. These coordinated, dynamic immune responses underlie the differing asthma phenotypes, which we delineate in terms of Seven Ages of Asthma. An understanding of the role of microbes in the atopic march towards asthma, and in causing exacerbations of established asthma, provides the rationale for new specific treatments that can be assessed in clinical trials. On the basis of these new ideas, specific host biomarkers might then allow personalised treatment to become a reality for patients with asthma.

  10. The adaptive immune response in celiac disease.


    Qiao, Shuo-Wang; Iversen, Rasmus; Ráki, Melinda; Sollid, Ludvig M


    Compared to other human leukocyte antigen (HLA)-associated diseases such as type 1 diabetes, multiple sclerosis, and rheumatoid arthritis, fundamental aspects of the pathogenesis in celiac disease are relatively well understood. This is mostly because the causative antigen in celiac disease-cereal gluten proteins-is known and the culprit HLA molecules are well defined. This has facilitated the dissection of the disease-relevant CD4+ T cells interacting with the disease-associated HLA molecules. In addition, celiac disease has distinct antibody responses to gluten and the autoantigen transglutaminase 2, which give strong handles to understand all sides of the adaptive immune response leading to disease. Here we review recent developments in the understanding of the role of T cells, B cells, and antigen-presenting cells in the pathogenic immune response of this instructive disorder.

  11. Cytokines and Immune Responses in Murine Atherosclerosis.


    Kusters, Pascal J H; Lutgens, Esther


    Atherosclerosis is an inflammatory disease of the vessel wall characterized by activation of the innate immune system, with macrophages as the main players, as well as the adaptive immune system, characterized by a Th1-dominant immune response. Cytokines play a major role in the initiation and regulation of inflammation. In recent years, many studies have investigated the role of these molecules in experimental models of atherosclerosis. While some cytokines such as TNF or IFNγ clearly had atherogenic effects, others such as IL-10 were found to be atheroprotective. However, studies investigating the different cytokines in experimental atherosclerosis revealed that the cytokine system is complex with both disease stage-dependent and site-specific effects. In this review, we strive to provide an overview of the main cytokines involved in atherosclerosis and to shed light on their individual role during atherogenesis.

  12. Regeneration, tissue injury and the immune response

    PubMed Central

    Godwin, James W; Brockes, Jeremy P


    The involvement of the immune system in the response to tissue injury has raised the possibility that it might influence tissue, organ or appendage regeneration following injury. One hypothesis that has been discussed is that inflammatory aspects may preclude the occurrence of regeneration, but there is also evidence for more positive roles of immune components. The vertebrate eye is an immunoprivileged site where inflammatory aspects are inhibited by several immunomodulatory mechanisms. In various newt species the ocular tissues such as the lens are regenerative and it has recently been shown that the response to local injury of the lens involves activation of antigen-presenting cells which traffic to the spleen and return to displace and engulf the lens, thereby inducing regeneration from the dorsal iris. The activation of thrombin from prothrombin in the dorsal iris is one aspect of the injury response that is important in the initiation of regeneration. The possible relationships between the immune response and the regenerative response are considered with respect to phylogenetic variation of regeneration in general, and lens regeneration in particular. PMID:17005015

  13. Impaired Innate Immunity in Tlr4−/− Mice but Preserved CD8+ T Cell Responses against Trypanosoma cruzi in Tlr4-, Tlr2-, Tlr9- or Myd88-Deficient Mice

    PubMed Central

    Tzelepis, Fanny; Klezewsky, Weberton; da Silva, Raquel N.; Neves, Fabieni S.; Cavalcanti, Gisele S.; Boscardin, Silvia; Nunes, Marise P.; Santiago, Marcelo F.; Nóbrega, Alberto; Rodrigues, Maurício M.; Bellio, Maria


    The murine model of T. cruzi infection has provided compelling evidence that development of host resistance against intracellular protozoans critically depends on the activation of members of the Toll-like receptor (TLR) family via the MyD88 adaptor molecule. However, the possibility that TLR/MyD88 signaling pathways also control the induction of immunoprotective CD8+ T cell-mediated effector functions has not been investigated to date. We addressed this question by measuring the frequencies of IFN-γ secreting CD8+ T cells specific for H-2Kb-restricted immunodominant peptides as well as the in vivo Ag-specific cytotoxic response in infected animals that are deficient either in TLR2, TLR4, TLR9 or MyD88 signaling pathways. Strikingly, we found that T. cruzi-infected Tlr2−/−, Tlr4−/−, Tlr9−/− or Myd88−/− mice generated both specific cytotoxic responses and IFN-γ secreting CD8+ T cells at levels comparable to WT mice, although the frequency of IFN-γ+CD4+ cells was diminished in infected Myd88−/− mice. We also analyzed the efficiency of TLR4-driven immune responses against T. cruzi using TLR4-deficient mice on the C57BL genetic background (B6 and B10). Our studies demonstrated that TLR4 signaling is required for optimal production of IFN-γ, TNF-α and nitric oxide (NO) in the spleen of infected animals and, as a consequence, Tlr4−/− mice display higher parasitemia levels. Collectively, our results indicate that TLR4, as well as previously shown for TLR2, TLR9 and MyD88, contributes to the innate immune response and, consequently, resistance in the acute phase of infection, although each of these pathways is not individually essential for the generation of class I-restricted responses against T. cruzi. PMID:20442858

  14. Changing the energy of an immune response

    PubMed Central

    Delmastro-Greenwood, Meghan M; Piganelli, Jon D


    The breakdown of nutrients into the critical energy source ATP is the general purpose of cellular metabolism and is essential for sustaining life. Similarly, the immune system is composed of different cell subsets that are indispensable for defending the host against pathogens and disease. The interplay between metabolic pathways and immune cells leads to a plethora of different signaling pathways as well as cellular activities. The activation of T cells via glycolysis-mediated upregulation of surface markers, for example, is necessary for an appropriate effector response against an infection. However, tight regulation of immune cell metabolism is required for protecting the host and resuming homeostasis. An imbalance of immunological metabolic function and/or metabolic byproducts (reactive oxygen species) can oftentimes lead to diseases. In the case of cancer, overactive glucose metabolism can lead to hyperproliferation of cells and subsequent decreases in cytotoxic T cell activity, which attack and destroy the tumor. For this reason and many more, targeting metabolism in immune cells may be a novel therapeutic strategy for treatment of disease. The metabolic pathways of immune cells and the possibilities of immunometabolic therapies will be discussed. PMID:23885324

  15. Impaired immune function in seals and laboratory rats exposed to dioxin-like compounds from Baltic herring

    SciTech Connect

    Ross, P.S. |; Swart, R.L. de |; Timmerman, H.H.; Loveren, H. van; Osterhaus, A.D.M.E. ||


    Complex mixtures of lipophilic contaminants have been shown to affect certain top predators in the aquatic food chain, including seals. A recent demonstration that harbor seals (Phoca vitulina) fed Baltic Sea herring displayed impaired natural killer cell activity and T-lymphocyte function represented the first demonstration of immunotoxicity induced by ambient levels of contaminants in the environment. While these animals had a lower ability to respond to immunizations with inactivated vaccines, specific antibody responses, and in vitro antigen-specific lymphoproliferative responses, obvious constraints limited the ability to extend these results with host resistance tests or an evaluation of thymus and other lymphoid organs. The authors therefore set up a parallel study by exposing pregnant laboratory rats to the same Baltic herring contaminant mixture as received the seals. They then examined immune function parameters and host resistance to virus infection. As in the seals, rat pups of the Baltic group had impaired T-lymphocyte function. In addition, thymus cells and/or their precursors appeared to be targeted, as their numbers and function were reduced in the rats. Following challenge with rat cytomegalovirus in a host resistance study, rat pups in the Baltic group had impaired natural killer cell responses to the virus infection, and lower specific CD8 + (cytotoxic T-lymphocyte) responses following in vitro stimulation. By extrapolation, these results suggest that the impaired immune responses observed in the Baltic group of seals may lead to a less effective defense against virus infections in marine mammals inhabiting polluted coastal waters. Toxicological profiles and results of both the captive seal and laboratory rat experiments tend to implicate the 2,3,7,8-TCDD-like PCB, dioxin and furan congeners in the immunosuppression, and point to a major role for the PCBs.

  16. Multiscale modeling of mucosal immune responses

    PubMed Central


    Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut

  17. Clec4A4 is a regulatory receptor for dendritic cells that impairs inflammation and T-cell immunity

    PubMed Central

    Uto, Tomofumi; Fukaya, Tomohiro; Takagi, Hideaki; Arimura, Keiichi; Nakamura, Takeshi; Kojima, Naoya; Malissen, Bernard; Sato, Katsuaki


    Dendritic cells (DCs) comprise several subsets that are critically involved in the initiation and regulation of immunity. Clec4A4/DC immunoreceptor 2 (DCIR2) is a C-type lectin receptor (CLR) exclusively expressed on CD8α− conventional DCs (cDCs). However, how Clec4A4 controls immune responses through regulation of the function of CD8α− cDCs remains unclear. Here we show that Clec4A4 is a regulatory receptor for the activation of CD8α− cDCs that impairs inflammation and T-cell immunity. Clec4a4−/−CD8α− cDCs show enhanced cytokine production and T-cell priming following Toll-like receptor (TLR)-mediated activation. Furthermore, Clec4a4−/− mice exhibit TLR-mediated hyperinflammation. On antigenic immunization, Clec4a4−/− mice show not only augmented T-cell responses but also progressive autoimmune pathogenesis. Conversely, Clec4a4−/− mice exhibit resistance to microbial infection, accompanied by enhanced T-cell responses against microbes. Thus, our findings highlight roles of Clec4A4 in regulation of the function of CD8α− cDCs for control of the magnitude and quality of immune response. PMID:27068492

  18. Humoral innate immune response and disease

    PubMed Central

    Shishido, Stephanie N.; Varahan, Sriram; Yuan, Kai; Li, Xiangdong; Fleming, Sherry D.


    The humoral innate immune response consists of multiple components, including the naturally occurring antibodies (NAb), pentraxins and the complement and contact cascades. As soluble, plasma components, these innate proteins provide key elements in the prevention and control of disease. However, pathogens and cells with altered self proteins utilize multiple humoral components to evade destruction and promote pathogy. Many studies have examined the relationship between humoral immunity and autoimmune disorders. This review focuses on the interactions between the humoral components and their role in promoting the pathogenesis of bacterial and viral infections and chronic diseases such as atherosclerosis and cancer. Understanding the beneficial and detrimental aspects of the individual components and the interactions between proteins which regulate the innate and adaptive response will provide therapeutic targets for subsequent studies. PMID:22771788

  19. Human Immune Response to Dengue Infections

    DTIC Science & Technology


    WUDA312059 11. TITLE (Include Security Classification) (U) Human Immune Response to Dengue Infections 12. PERSONAL AUTHOR(S) Francis A. Ennis 13a. TYPE OF...COSATI CODES 18. SUBJECT TERMS (Continue on reverse if necessary and identify by block number) FIELD GROUP SUB-GROUP RA 1; Vaccines; Dengue ; Cell...mediated; HLA; Interferon 0@ 03 19. ABSTRACT (Continue on reverse if necessary and identify by block number) Thirteen dengue virus-specific, cytotoxic CD4

  20. Evolutionary responses of innate Immunity to adaptive immunity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Innate immunity is present in all metazoans, whereas the evolutionarily more novel adaptive immunity is limited to jawed fishes and their descendants (gnathostomes). We observe that the organisms that possess adaptive immunity lack diversity in their innate pattern recognition receptors (PRRs), rais...

  1. Immune responses to pertussis vaccines and disease.


    Edwards, Kathryn M; Berbers, Guy A M


    In this article we discuss the following: (1) acellular vaccines are immunogenic, but responses vary by vaccine; (2) pertussis antibody levels rapidly wane but promptly increase after vaccination; (3) whole-cell vaccines vary in immunogenicity and efficacy; (4) whole-cell vaccines and naturally occurring pertussis generate predominantly T-helper 1 (Th1) responses, whereas acellular vaccines generate mixed Th1/Th2 responses; (5) active transplacental transport of pertussis antibody is documented; (6) neonatal immunization with diphtheria toxoid, tetanus toxoid, and acellular pertussis vaccine has been associated with some suppression of pertussis antibody, but suppression has been seen less often with acellular vaccines; (7) memory B cells persist in both acellular vaccine- and whole cell vaccine-primed children; and (8) in acellular vaccine-primed children, T-cell responses remain elevated and do not increase with vaccine boosters, whereas in whole-cell vaccine-primed children, these responses can be increased by vaccine boosting and natural exposure. Despite these findings, challenges remain in understanding the immune response to pertussis vaccines.

  2. Cellular immune responses towards regulatory cells.


    Larsen, Stine Kiær


    This thesis describes the results from two published papers identifying spontaneous cellular immune responses against the transcription factors Foxp3 and Foxo3. The tumor microenvironment is infiltrated by cells that hinder effective tumor immunity from developing. Two of these cell types, which have been linked to a bad prognosis for patients, are regulatory T cells (Treg) and tolerogenic dendritic cells (DC). Tregs inhibit effector T cells from attacking the tumor through various mechanisms, including secreted factors and cell-to-cell contact. Tregs express the transcription factor Foxp3, which is necessary for their development and suppressive activities. Tolerogenic DCs participate in creating an environment in the tumor where effector T cells become tolerant towards the tumor instead of attacking it. The transcription factor Foxo3 was recently described to be highly expressed by tolerogenic DCs and to programme their tolerogenic influence. This thesis describes for the first time the existence of spontaneous cellular immune responses against peptides derived from Foxp3 and Foxo3. We have detected the presence of cytotoxic T cells that recognise these peptides in an HLA-A2 restricted manner in cancer patients and for Foxp3 in healthy donors as well. In addition, we have demonstrated that the Foxp3- and Foxo3-specific CTLs recognize Foxp3- and Foxo3-expressing cancer cell lines and importantly, suppressive immune cells, namely Tregs and in vitro generated DCs. Cancer immunotherapy is recently emerging as an important treatment modality improving the survival of selected patients. The current progress is largely owing to targeting of the immune suppressive milieu that is dominating the tumor microenvironment. This is being done through immune checkpoint blockade with CTLA-4 and PD-1/PD-L1 antibodies and through lymphodepleting conditioning of patients and ex vivo activation of TILs in adoptive cell transfer. Several strategies are being explored for depletion of

  3. Human Immune Response to Dengue Infections

    DTIC Science & Technology


    Security Classification) (U) Human Immune Response to Dengue Infections 12. PERSONAL AUTHOR(S) Francis A. Ennis 13a. TYPE OF’REPORTn 13b. TIME COVERED 14...8217SUBJECT TERMS (Continue on reverse if necessary and identify by Nock rumber) FIELD GROUP SUB-GROUP RA .1, Dengue virus, T lymphopytes. 06 03 InB-GROP1.In...responses to dengue antigens in vitro to elucidate the possible role of T lymphocytes in the pathogeneeis of dengue hemorrhagic fever and dengue

  4. Impairment of blood brain barrier is related with the neuroinflammation induced peripheral immune status in intracerebroventricular colchicine injected rats: An experimental study with mannitol.


    Sil, Susmita; Ghosh, Arijit; Ghosh, Tusharkanti


    The neurodegeneration in AD patients may be associated with changes of peripheral immune responses. Some peripheral immune responses are altered due to neuroinflammation in colchicine induced AD (cAD) rats. The leaky blood brain barrier (BBB) in cAD-rats may be involved in inducing peripheral inflammation, though there is no report in this regard. Therefore, the present study was designed to investigate the role of BBB in cADrats by altering the BBB in a time dependent manner with injection (i.v.) of mannitol (BBB opener). The inflammatory markers in the brain and serum along with the peripheral immune responses were measured after 30 and 60min of mannitol injection in cAD rats. The results showed higher inflammatory markers in the hippocampus and serum along with alterations in peripheral immune parameters in cAD rats. Although the hippocampal inflammatory markers did not further change after mannitol injection in cAD rats, the serum inflammatory markers and peripheral immune responses were altered and these changes were greater after 60min than that of 30min of mannitol injection. The present study shows that the peripheral immune responses in cAD rats after 30 and 60min of mannitol injection are related to magnitude of impairment of BBB in these conditions. It can be concluded from this study that impairment of BBB in cAD rats is related to the changes of peripheral immune responses observed in that condition.

  5. Mitochondrial DNA Stress Primes the Antiviral Innate Immune Response

    PubMed Central

    West, A. Phillip; Khoury-Hanold, William; Staron, Matthew; Tal, Michal C.; Pineda, Cristiana M.; Lang, Sabine M.; Bestwick, Megan; Duguay, Brett A.; Raimundo, Nuno; MacDuff, Donna A.; Kaech, Susan M.; Smiley, James R.; Means, Robert E.; Iwasaki, Akiko; Shadel, Gerald S.


    Mitochondrial DNA (mtDNA) is normally present at thousands of copies per cell and is packaged into several hundred higher-order structures termed nucleoids1. The abundant mtDNA-binding protein, transcription factor A mitochondrial (TFAM), regulates nucleoid architecture, abundance, and segregation2. Complete mtDNA depletion profoundly impairs oxidative phosphorylation (OXPHOS), triggering calcium-dependent stress signaling and adaptive metabolic responses3. However, the cellular responses to mtDNA instability, a physiologically relevant stress observed in many human diseases and aging, remain ill-defined4. Here we show that moderate mtDNA stress elicited by TFAM deficiency engages cytosolic antiviral signaling to enhance the expression of a subset of interferon-stimulated genes (ISG). Mechanistically, we have found that aberrant mtDNA packaging promotes escape of mtDNA into the cytosol, where it engages the DNA sensor cGAS and promotes STING-IRF3-dependent signaling to elevate ISG expression, potentiate type I interferon responses, and confer broad viral resistance. Furthermore, we demonstrate that herpesviruses induce mtDNA stress, which potentiates antiviral signaling and type I interferon responses during infection. Our results further demonstrate that mitochondria are central participants in innate immunity, identify mtDNA stress as a cell-intrinsic trigger of antiviral signaling, and suggest that cellular monitoring of mtDNA homeostasis cooperates with canonical virus sensing mechanisms to fully license antiviral innate immunity. PMID:25642965

  6. IL-1 and T Helper Immune Responses

    PubMed Central

    Santarlasci, Veronica; Cosmi, Lorenzo; Maggi, Laura; Liotta, Francesco; Annunziato, Francesco


    CD4 T cells play a critical role in mediating adaptive immunity to a variety of pathogens as well as in tumor immunity. If not adequately regulated, CD4 T cells can be also involved in autoimmunity, asthma, and allergic responses. During TCR activation in a particular cytokine milieu, naïve CD4 T cells may differentiate into one of several lineages of T helper (Th) cells, including Th1, Th2, and Th17, as defined by their pattern of cytokine production and function. IL-1, the prototypic proinflammatory cytokine, has been shown to influence growth and differentiation of immunocompetent lymphocytes. The differential expression of IL-1RI on human CD4 T cell subsets confers distinct capacities to acquire specific effector functions. In this review, we summarize the role of IL-1 on CD4 T cells, in terms of differentiation, activation, and maintenance or survival. PMID:23874332

  7. Standard radiotherapy but not chemotherapy impairs systemic immunity in non-small cell lung cancer

    PubMed Central

    Talebian Yazdi, Mehrdad; Schinkelshoek, Mink S.; Loof, Nikki M.; Taube, Christian; Hiemstra, Pieter S.; Welters, Marij J. P.; van der Burg, Sjoerd H.


    ABSTRACT Introduction: Advanced non-small cell lung cancer (NSCLC) is traditionally treated with platinum-based chemotherapy and radiotherapy. Since immunotherapy holds promise for treating advanced NSCLC, we assessed the systemic effects of the traditional therapies for NSCLC on immune cell composition and function. Methods: 84 pulmonary adenocarcinoma patients, treated either with chemotherapy or radiotherapy, were studied. A prospective study of 23 patients was conducted in which the myeloid and lymphoid cell compartments of peripheral blood were analyzed. Changes in cell populations were validated in a retrospective cohort of 61 adenocarcinoma patients using automated differential counts collected throughout therapy. Furthermore, the functional capacity of circulating T cells and antigen-presenting cells (APC) was studied. Blood samples of healthy individuals were used as controls. Results: In comparison to healthy controls, untreated adenocarcinoma patients display an elevated frequency of myeloid cells coinciding with relative lower frequencies of lymphocytes and dendritic cells. Standard chemotherapy had no overt effects on myeloid and lymphoid cell composition nor on T-cell and APC-function. In contrast, patients treated with radiotherapy displayed a decrease in lymphoid cells and a relative increase in monocytes/macrophages. Importantly, these changes were associated with a reduced APC function and an impaired response of T cells to recall antigens. Conclusions: Platinum-based standard of care chemotherapy for NSCLC has no profound negative effect on the immune cell composition and function. The negative effect of prolonged low-dose radiotherapy on the immune system warrants future studies on the optimal dose and fraction of radiotherapy when combined with immunotherapy. PMID:28123900

  8. Spaceflight and Development of Immune Responses

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald


    Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. The number of flight experiments has been small, and the full breadth of immunological alterations occurring after space flight remains to be established. Among the major effects on immune responses after space flight that have been reported are: alterations in lymphocyte blastogenesis and natural killer cell activity, alterations in production of cytokines, changes in leukocyte sub-population distribution, and decreases in the ability of bone marrow cells to respond to colony stimulating factors. Changes have been reported in immunological parameters of both humans and rodents. The significance of these alterations in relation to resistance to infection remains to be established. The objective of the studies contained in this project was to determine the effects of space flight on immune responses of pregnant rats and their offspring. The hypothesis was that space flight and the attendant period of microgravity will result in alteration of immunological parameters of both the pregnant rats as well as their offspring carried in utero during the flight. The parameters tested included: production of cytokines, composition of leukocyte sub- populations, response of bone marrow/liver cells to granulocyte/monocyte colony stimulating factor, and leukocyte blastogenesis. Changes in immune responses that could yield alterations in resistance to infection were determined. This yielded useful information for planning studies that could contribute to crew health. Additional information that could eventually prove useful to determine the potential for establishment of a permanent colony in space was obtained.

  9. Humoral and Cellular Immune Response in Canine Hypothyroidism.


    Miller, J; Popiel, J; Chełmońska-Soyta, A


    Hypothyroidism is one of the most common endocrine diseases in dogs and is generally considered to be autoimmune in nature. In human hypothyroidism, the thyroid gland is destroyed by both cellular (i.e. autoreactive helper and cytotoxic T lymphocytes) and humoral (i.e. autoantibodies specific for thyroglobulin, thyroxine and triiodothyronine) effector mechanisms. Other suggested factors include impaired peripheral immune suppression (i.e. the malfunction of regulatory T cells) or an additional pro-inflammatory effect of T helper 17 lymphocytes. The aim of this study was to evaluate immunological changes in canine hypothyroidism. Twenty-eight clinically healthy dogs, 25 hypothyroid dogs without thyroglobulin antibodies and eight hypothyroid dogs with these autoantibodies were enrolled into the study. There were alterations in serum proteins in hypothyroid dogs compared with healthy controls (i.e. raised concentrations of α-globulins, β2- and γ-globulins) as well as higher concentration of acute phase proteins and circulating immune complexes. Hypothyroid animals had a lower CD4:CD8 ratio in peripheral blood compared with control dogs and diseased dogs also had higher expression of interferon γ (gene and protein expression) and CD28 (gene expression). Similar findings were found in both groups of hypothyroid dogs. Canine hypothyroidism is therefore characterized by systemic inflammation with dominance of a cellular immune response.

  10. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology


    AD-AISI 652 NUMAN IMMUNE RESPONSES TO DENGUE YIRUSES(U) / MASSACHUSETTS UNJY MEDICAL CENTER WORCESTER "A F A ENNIS 61 JUL 86 DRMDI?-82-C-2233...A S. PAGE COUNT Ie ..U rO l-9SJulyl (vw = T 21 Virus; Dengue ; Arbovirus; Immunology -- 4b he,. SAaaY~d the Interaction between the peripheral blood...lymphocytes (PBL) of non- 10m.0 deors ad dengue virus-Infected cells, which results in Interferon (113) production. AutelepMu mecyts@ or the Zpstein

  11. Human Immune Response to Dengue Infections

    DTIC Science & Technology


    illness, dengue fever (DF) and dengue hemorrhagic fever (DfIF)/dengue shock syndrome (DSS) (5). Dengue fever is a self- limited febrile disease which is...this syndrome (4). Therefore, dengue virus infections are one of the most important human infectious diseases . Immune responses to dengue viruses have...Number Male Female (Range) Primary Secondary DHF 59 28 31 8.9 + 3.0 7 52 (4-14) DF 41 22 19 9.8 + 2.1 6 35 (5-14) Uncharacterized febrile diseases 26

  12. Monitoring Regulatory Immune Responses in Tumor Immunotherapy Clinical Trials

    PubMed Central

    Olson, Brian M.; McNeel, Douglas G.


    While immune monitoring of tumor immunotherapy often focuses on the generation of productive Th1-type inflammatory immune responses, the importance of regulatory immune responses is often overlooked, despite the well-documented effects of regulatory immune responses in suppressing anti-tumor immunity. In a variety of malignancies, the frequency of regulatory cell populations has been shown to correlate with disease progression and a poor prognosis, further emphasizing the importance of characterizing the effects of immunotherapy on these populations. This review focuses on the role of suppressive immune populations (regulatory T cells, myeloid-derived suppressor cells, and tumor-associated macrophages) in inhibiting anti-tumor immunity, how these populations have been used in the immune monitoring of clinical trials, the prognostic value of these responses, and how the monitoring of these regulatory responses can be improved in the future. PMID:23653893

  13. Intrauterine Growth Restriction Impairs Small Intestinal Mucosal Immunity in Neonatal Piglets

    PubMed Central

    Dong, Li; Zhong, Xiang; Ahmad, Hussain; Li, Wei; Wang, Yuanxiao; Zhang, Lili


    Intrauterine growth restriction (IUGR) is a very common problem in both piglet and human neonate populations. We hypothesized that IUGR neonates have impaired intestinal mucosal immunity from birth. Using neonatal piglets as IUGR models, immune organ weights, the weight and length of the small intestine (SI), intestinal morphology, intraepithelial immune cell numbers, levels of cytokines and immunoglobulins, and the relative gene expression of cytokines in the SI were investigated. IUGR neonatal piglets were observed to have lower absolute immune organ weight and SI length, decreased relative weights of the thymus, spleen, mesenteric lymph node, and thinner but longer SIs. Damaged and jagged villi, shorter microvilli, presence of autophagosomes, swelled mitochondria, and decreased villus surface areas were also found in the SIs of IUGR neonatal piglets. We also found a smaller number of epithelial goblet cells and lymphocytes in the SIs of IUGR neonates. In addition, we detected reduced levels of the cytokines TNF-α and IFN-γ and decreased gene expression of cytokines in IUGR neonates. In conclusion, IUGR was shown to impair the mucosal immunity of the SI in neonatal piglets, and the ileum was the major site of impairment. PMID:24710659

  14. Immune Response of Amebiasis and Immune Evasion by Entamoeba histolytica

    PubMed Central

    Nakada-Tsukui, Kumiko; Nozaki, Tomoyoshi


    Entamoeba histolytica is a protozoan parasite and the causative agent of amebiasis. It is estimated approximately 1% of humans are infected with E. histolytica, resulting in an estimate of 100,000 deaths annually. Clinical manifestations of amebic infection range widely from asymptomatic to severe symptoms, including dysentery and extra-intestinal abscesses. Like other infectious diseases, it is assumed that only ~20% of infected individuals develop symptoms, and genetic factors of both the parasite and humans as well as the environmental factors, e.g., microbiota, determine outcome of infection. There are multiple essential steps in amebic infection: degradation of and invasion into the mucosal layer, adherence to the intestinal epithelium, invasion into the tissues, and dissemination to other organs. While the mechanisms of invasion and destruction of the host tissues by the amebae during infection have been elucidated at the molecular levels, it remains largely uncharacterized how the parasite survive in the host by evading and attacking host immune system. Recently, the strategies for immune evasion by the parasite have been unraveled, including immunomodulation to suppress IFN-γ production, elimination of immune cells and soluble immune mediators, and metabolic alterations against reactive oxygen and nitrogen species to fend off the attack from immune system. In this review, we summarized the latest knowledge on immune reaction and immune evasion during amebiasis. PMID:27242782

  15. Alterations in macrophages and monocytes from tumor-bearing mice: evidence of local and systemic immune impairment.


    Torroella-Kouri, Marta; Rodríguez, Dayron; Caso, Raul


    Macrophages are cells of the innate immune system involved in critical activities such as maintaining tissue homeostasis and immune surveillance. Pro-inflammatory macrophages M1 are responsible for the inflammatory response, while M2 macrophages are associated with the immunosuppressive repair phase of tissue remodeling. Most cancers are associated with chronic inflammation, and a high number of macrophages in tumors have been associated with tumor progression. Much effort has been made in elucidating the mechanisms through which macrophages contribute to tumor development, yet much less is known about the initial mechanisms by which tumors modify macrophages. Our work has focused on identifying the mechanisms by which macrophages from tumor hosts are modified by tumors. We have shown that peritoneal macrophages are significantly altered in mice bearing advanced mammary tumors and are not M1 or M2 polarized, but express a mixture of both transcriptional programs. These macrophages are less differentiated and more prone to apoptosis, resulting in increased myelopoiesis as a compensation to regenerate macrophage progenitors in the marrow. Macrophages in the tumor microenvironment are also neither M1 nor M2 cells and through a display of different mechanisms are even more impaired than their peripheral counterparts. Finally, systemic blood monocytes, precursors of tissue macrophages, are also altered in tumor bearers and show a mixed program of pro- and anti-inflammatory functions. We conclude that there is evidence for local and systemic immune impairment in tumor hosts.

  16. Immune responses to coiled coil supramolecular biomaterials.


    Rudra, Jai S; Tripathi, Pulak K; Hildeman, David A; Jung, Jangwook P; Collier, Joel H


    Self-assembly has been increasingly utilized in recent years to create peptide-based biomaterials for 3D cell culture, tissue engineering, and regenerative medicine, but the molecular determinants of these materials' immunogenicity have remained largely unexplored. In this study, a set of molecules that self-assembled through coiled coil oligomerization was designed and synthesized, and immune responses against them were investigated in mice. Experimental groups spanned a range of oligomerization behaviors and included a peptide from the coiled coil region of mouse fibrin that did not form supramolecular structures, an engineered version of this peptide that formed coiled coil bundles, and a peptide-PEG-peptide triblock bioconjugate that formed coiled coil multimers and supramolecular aggregates. In mice, the native peptide and engineered peptide did not produce any detectable antibody response, and none of the materials elicited detectable peptide-specific T cell responses, as evidenced by the absence of IL-2 and interferon-gamma in cultures of peptide-challenged splenocytes or draining lymph node cells. However, specific antibody responses were elevated in mice injected with the multimerizing peptide-PEG-peptide. Minimal changes in secondary structure were observed between the engineered peptide and the triblock peptide-PEG-peptide, making it possible that the triblock's multimerization was responsible for this antibody response.

  17. The interplay between the microbiome and the adaptive immune response in cancer development

    PubMed Central

    Russo, Edda; Taddei, Antonio; Ringressi, Maria Novella; Ricci, Federica; Amedei, Amedeo


    The data from different studies suggest a bacterial role in cancer genesis/progression, often modulating the local immune response. This is particularly so at the mucosal level where the bacterial presence is strong and the immune system is highly reactive. The epithelial surfaces of the body, such as the skin and mucosa, are colonized by a vast number of microorganisms, which represent the so-called normal microbiome. Normally the microbiome does not cause a proinflammatory response because the immune system has developed different strategies for the tolerance of commensal bacteria, but when these mechanisms are impaired or new pathogenic bacteria are introduced into this balanced system, the immune system reacts to the microbiome and can trigger tumor growth in the intestine. In this review, we discuss the potential role of the bacterial microbiome in carcinogenesis, focusing on the direct and indirect immune adaptive mechanisms, that the bacteria can modulate in different ways. PMID:27366226

  18. Foot-and-Mouth Disease Virus 3C Protease Cleaves NEMO To Impair Innate Immune Signaling

    PubMed Central

    Wang, Dang; Fang, Liurong; Li, Kui; Zhong, Huijuan; Fan, Jinxiu; Ouyang, Chao; Zhang, Huan; Duan, Erzhen; Luo, Rui; Zhang, Zhongming; Liu, Xiangtao; Chen, Huanchun


    Foot-and-mouth disease is a highly contagious viral illness of wild and domestic cloven-hoofed animals. The causative agent, foot-and-mouth disease virus (FMDV), replicates rapidly, efficiently disseminating within the infected host and being passed on to susceptible animals via direct contact or the aerosol route. To survive in the host, FMDV has evolved to block the host interferon (IFN) response. Previously, we and others demonstrated that the leader proteinase (Lpro) of FMDV is an IFN antagonist. Here, we report that another FMDV-encoded proteinase, 3Cpro, also inhibits IFN-α/β response and the expression of IFN-stimulated genes. Acting in a proteasome- and caspase-independent manner, the 3Cpro of FMDV proteolytically cleaved nuclear transcription factor kappa B (NF-κB) essential modulator (NEMO), a bridging adaptor protein essential for activating both NF-κB and interferon-regulatory factor signaling pathways. 3Cpro specifically targeted NEMO at the Gln 383 residue, cleaving off the C-terminal zinc finger domain from the protein. This cleavage impaired the ability of NEMO to activate downstream IFN production and to act as a signaling adaptor of the RIG-I/MDA5 pathway. Mutations specifically disrupting the cysteine protease activity of 3Cpro abrogated NEMO cleavage and the inhibition of IFN induction. Collectively, our data identify NEMO as a substrate for FMDV 3Cpro and reveal a novel mechanism evolved by a picornavirus to counteract innate immune signaling. PMID:22718831

  19. Neuroendocrine and Immune System Responses with Spaceflights

    NASA Technical Reports Server (NTRS)

    Tipton, Charles M.; Greenleaf, John E.; Jackson, Catherine G. R.


    Despite the fact that the first human was in space during 1961 and individuals have existed in a microgravity environment for more than a year, there are limited spaceflight data available on the responses of the neuroendocrine and immune systems. Because of mutual interactions between these respective integrative systems, it is inappropriate to assume that the responses of one have no impact on functions of the other. Blood and plasma volume consistently decrease with spaceflight; hence, blood endocrine and immune constituents will be modified by both gravitational and measurement influences. The majority of the in-flight data relates to endocrine responses that influence fluids and electrolytes during the first month in space. Adrenocorticotropin (ACTH), aldo-sterone. and anti-diuretic hormone (ADH) appear to be elevated with little change in the atrial natriuretic peptides (ANP). Flight results longer than 60 d show increased ADH variability with elevations in angiotensin and cortisol. Although post-flight results are influenced by reentry and recovery events, ACTH and ADH appear to be consistently elevated with variable results being reported for the other hormones. Limited in-flight data on insulin and growth hormone levels suggest they are not elevated to counteract the loss in muscle mass. Post-flight results from short- and long-term flights indicate that thyroxine and insulin are increased while growth hormone exhibits minimal change. In-flight parathyroid hormone (PTH) levels are variable for several weeks after which they remain elevated. Post-flight PTH was increased on missions that lasted either 7 or 237 d, whereas calcitonin concentrations were increased after 1 wk but decreased after longer flights. Leukocytes are elevated in flights of various durations because of an increase in neutrophils. The majority of post-flight data indicates immunoglobulin concentrations are not significantly changed from pre-flight measurements. However, the numbers of T

  20. Precision Immunization: NASA Studies Immune Response to Flu Vaccine

    NASA Video Gallery

    NASA Human Research Program Twins Study investigator Emmanuel Mignot, M.D., Ph.D, known for discovering the cause of narcolepsy is related to the immune system, is studying twin astronauts Scott an...

  1. Impact of nutrition on immune function and the inflammatory response

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The review utilizes data on three micronutrients (vitamin A, zinc and iron), anthropometrically defined undernutrition (stunting, wasting and underweight) and obesity to evaluate the effect on immune function, recovery of immune function in response to nutritional interventions, related health outco...

  2. IgG4 subclass antibodies impair antitumor immunity in melanoma

    PubMed Central

    Karagiannis, Panagiotis; Gilbert, Amy E.; Josephs, Debra H.; Ali, Niwa; Dodev, Tihomir; Saul, Louise; Correa, Isabel; Roberts, Luke; Beddowes, Emma; Koers, Alexander; Hobbs, Carl; Ferreira, Silvia; Geh, Jenny L.C.; Healy, Ciaran; Harries, Mark; Acland, Katharine M.; Blower, Philip J.; Mitchell, Tracey; Fear, David J.; Spicer, James F.; Lacy, Katie E.; Nestle, Frank O.; Karagiannis, Sophia N.


    Host-induced antibodies and their contributions to cancer inflammation are largely unexplored. IgG4 subclass antibodies are present in IL-10–driven Th2 immune responses in some inflammatory conditions. Since Th2-biased inflammation is a hallmark of tumor microenvironments, we investigated the presence and functional implications of IgG4 in malignant melanoma. Consistent with Th2 inflammation, CD22+ B cells and IgG4+-infiltrating cells accumulated in tumors, and IL-10, IL-4, and tumor-reactive IgG4 were expressed in situ. When compared with B cells from patient lymph nodes and blood, tumor-associated B cells were polarized to produce IgG4. Secreted B cells increased VEGF and IgG4, and tumor cells enhanced IL-10 secretion in cocultures. Unlike IgG1, an engineered tumor antigen-specific IgG4 was ineffective in triggering effector cell–mediated tumor killing in vitro. Antigen-specific and nonspecific IgG4 inhibited IgG1-mediated tumoricidal functions. IgG4 blockade was mediated through reduction of FcγRI activation. Additionally, IgG4 significantly impaired the potency of tumoricidal IgG1 in a human melanoma xenograft mouse model. Furthermore, serum IgG4 was inversely correlated with patient survival. These findings suggest that IgG4 promoted by tumor-induced Th2-biased inflammation may restrict effector cell functions against tumors, providing a previously unexplored aspect of tumor-induced immune escape and a basis for biomarker development and patient-specific therapeutic approaches. PMID:23454746

  3. IgG4 subclass antibodies impair antitumor immunity in melanoma.


    Karagiannis, Panagiotis; Gilbert, Amy E; Josephs, Debra H; Ali, Niwa; Dodev, Tihomir; Saul, Louise; Correa, Isabel; Roberts, Luke; Beddowes, Emma; Koers, Alexander; Hobbs, Carl; Ferreira, Silvia; Geh, Jenny L C; Healy, Ciaran; Harries, Mark; Acland, Katharine M; Blower, Philip J; Mitchell, Tracey; Fear, David J; Spicer, James F; Lacy, Katie E; Nestle, Frank O; Karagiannis, Sophia N


    Host-induced antibodies and their contributions to cancer inflammation are largely unexplored. IgG4 subclass antibodies are present in IL-10-driven Th2 immune responses in some inflammatory conditions. Since Th2-biased inflammation is a hallmark of tumor microenvironments, we investigated the presence and functional implications of IgG4 in malignant melanoma. Consistent with Th2 inflammation, CD22+ B cells and IgG4(+)-infiltrating cells accumulated in tumors, and IL-10, IL-4, and tumor-reactive IgG4 were expressed in situ. When compared with B cells from patient lymph nodes and blood, tumor-associated B cells were polarized to produce IgG4. Secreted B cells increased VEGF and IgG4, and tumor cells enhanced IL-10 secretion in cocultures. Unlike IgG1, an engineered tumor antigen-specific IgG4 was ineffective in triggering effector cell-mediated tumor killing in vitro. Antigen-specific and nonspecific IgG4 inhibited IgG1-mediated tumoricidal functions. IgG4 blockade was mediated through reduction of FcγRI activation. Additionally, IgG4 significantly impaired the potency of tumoricidal IgG1 in a human melanoma xenograft mouse model. Furthermore, serum IgG4 was inversely correlated with patient survival. These findings suggest that IgG4 promoted by tumor-induced Th2-biased inflammation may restrict effector cell functions against tumors, providing a previously unexplored aspect of tumor-induced immune escape and a basis for biomarker development and patient-specific therapeutic approaches.

  4. Ontogeny of the Bovine Immune Response 1

    PubMed Central

    Schultz, R. D.; Dunne, H. W.; Heist, C. E.


    The ontogenesis of the bovine immune response was studied in three embryos (<40 days) and 106 fetuses of various ages. In the absence of overt antigenic stimulation, fetuses had lymphoid development of the thymus at 42 days of gestation, the spleen was structurally present at 55 days, and certain peripheral lymph nodes were present at 60 days. Mesenteric lymph nodes were structurally present by 100 days of gestation, and lymphoid tissue of the gastrointestinal tract, particularly the lower ileum, was observed in histologic sections of a 175-day fetus with a bacterial infection. Pyroninophilic cells, plasma cells, and germinal centers were present in lymph node sections of antigenically stimulated fetuses. Lymphoid tissue developed more rapidly in fetuses with bacteria, viral antigens, or apparent maternal red-blood-cell antigens than in the normal fetus. Thymic and splenic indices reached maximal values in the 205- to 220-day fetal age group. Immunoglobulin M (IgM)-containing cells were first observed, by immunofluorescence, in a single fetus at 59 days of gestation. Immunoglobulin G (IgG)-containing cells were observed at 145 days of gestation in one fetus with a bacterial and viral infection. IgM-containing cells were observed in 36 fetuses and IgM and IgG cells were present in seven fetuses. Spleen, lymph nodes, thymus, bone marrow, and liver of one fetus from a dam with lymphosarcoma had immunoglobulin-containing cells. Hemal lymph nodes, blood (buffy coat), Peyer patches, and heart and lung sections from fetuses with immunoglobulin-containing cells in spleen or lymph node did not have immunoglobulin-containing cells. Antigens of the virus of bovine virus diarrhea-mucosal disease (BVD) were detected in one fetus, and antigens of infectious bovine rhinotracheitis (IBR) virus were detected in three fetuses; however, viruses were not isolated in primary bovine embryonic kidney cells. Two of the three fetuses with IBR virus antigens had neutralizing serum antibody

  5. Extracellular Adenosine Mediates a Systemic Metabolic Switch during Immune Response

    PubMed Central

    Bajgar, Adam; Kucerova, Katerina; Jonatova, Lucie; Tomcala, Ales; Schneedorferova, Ivana; Okrouhlik, Jan; Dolezal, Tomas


    Immune defense is energetically costly, and thus an effective response requires metabolic adaptation of the organism to reallocate energy from storage, growth, and development towards the immune system. We employ the natural infection of Drosophila with a parasitoid wasp to study energy regulation during immune response. To combat the invasion, the host must produce specialized immune cells (lamellocytes) that destroy the parasitoid egg. We show that a significant portion of nutrients are allocated to differentiating lamellocytes when they would otherwise be used for development. This systemic metabolic switch is mediated by extracellular adenosine released from immune cells. The switch is crucial for an effective immune response. Preventing adenosine transport from immune cells or blocking adenosine receptor precludes the metabolic switch and the deceleration of development, dramatically reducing host resistance. Adenosine thus serves as a signal that the “selfish” immune cells send during infection to secure more energy at the expense of other tissues. PMID:25915062

  6. The immune response and its therapeutic modulation in bronchiectasis.


    Daheshia, Massoud; Prahl, James D; Carmichael, Jacob J; Parrish, John S; Seda, Gilbert


    Bronchiectasis (BC) is a chronic pulmonary disease with tremendous morbidity and significant mortality. As pathogen infection has been advocated as a triggering insult in the development of BC, a central role for the immune response in this process seems obvious. Inflammatory cells are present in both the airways as well as the lung parenchyma, and multiple mediators of immune cells including proteases and cytokines or their humoral products are increased locally or in the periphery. Interestingly, a defect in the immune system or suppression of immune response during conditions such as immunodeficiency may well predispose one to the devastating effects of BC. Thus, the outcome of an active immune response as detrimental or protective in the pathogenesis of BC may be dependent on the state of the patient's immunity, the severity of infection, and the magnitude of immune response. Here we reassess the function of the innate and acquired immunity in BC, the major sites of immune response, and the nature of the bioactive mediators. Furthermore, the potential link(s) between an ongoing immune response and structural alterations accompanying the disease and the success of therapies that can modulate the nature and extent of immune response in BC are elaborated upon.

  7. Local Immune Response in Helicobacter pylori Infection

    PubMed Central

    Kivrak Salim, Derya; Sahin, Mehmet; Köksoy, Sadi; Adanir, Haydar; Süleymanlar, Inci


    Abstract There have been few studies concerning the cytokine profiles in gastric mucosa of Helicobacter pylori–infected patients with normal mucosa, chronic gastritis, and gastric carcinoma (GAC). In the present study, we aimed to elucidate the genomic expression levels and immune pathological roles of cytokines—interferon (IFN)-γ, tumor necrosis factor (TNF)-α, interleukin (IL)-4, IL-6, IL-10, transforming growth factor (TGF)-β, IL-17A, IL-32—in H pylori–infected patients with normal gastric mucosa (NGM; control), chronic active gastritis (CAG), and GAC. Genomic expression levels of these cytokines were assayed by real-time PCR analysis in gastric biopsy specimens obtained from 93 patients. We found that the genomic expression levels of IFN-γ, TNF-α, IL-6, IL-10, IL-17A mRNA were increased in the CAG group and those of TNF-α, IL-6, IL-10, IL-17A, TGF-β mRNA were increased in the GAC group with reference to H pylori–infected NGM group. This study is on the interest of cytokine profiles in gastric mucosa among individuals with normal, gastritis, or GAC. Our findings suggest that the immune response of gastric mucosa to infection of H pylori differs from patient to patient. For individual therapy, levels of genomic expression of IL-6 or other cytokines may be tracked in patients. PMID:27196487

  8. Toll-Like Receptor 9 Activation Rescues Impaired Antibody Response in Needle-free Intradermal DNA Vaccination

    PubMed Central

    Arunachalam, Prabhu S.; Mishra, Ria; Badarinath, Krithika; Selvam, Deepak; Payeli, Sravan K.; Stout, Richard R.; Ranga, Udaykumar


    The delivery of plasmid DNA to the skin can target distinct subsets of dermal dendritic cells to confer a superior immune response. The needle-free immunization technology offers a reliable, safe and efficient means to administer intradermal (ID) injections. We report here that the ID injection of DNA vectors using an NF device (NF-ID) elicits a superior cell-mediated immune response, at much lesser DNA dosage, comparable in magnitude to the traditional intramuscular immunization. However, the humoral response is significantly impaired, possibly at the stage of B cell isotype switching. We found that the NF-ID administration deposits the DNA primarily on the epidermis resulting in a rapid loss of the DNA as well as the synthesized antigen due to the faster regeneration rate of the skin layers. Therefore, despite the immune-rich nature of the skin, the NF-ID immunization of DNA vectors may be limited by the impaired humoral response. Additional booster injections are required to augment the antibody response. As an alternative and a viable solution, we rescued the IgG response by coadministration of a Toll-like receptor 9 agonist, among other adjuvants examined. Our work has important implication for the optimization of the emerging needle-free technology for ID immunization. PMID:27658623

  9. Cell-autonomous stress responses in innate immunity.


    Moretti, Julien; Blander, J Magarian


    The innate immune response of phagocytes to microbes has long been known to depend on the core signaling cascades downstream of pattern recognition receptors (PRRs), which lead to expression and production of inflammatory cytokines that counteract infection and induce adaptive immunity. Cell-autonomous responses have recently emerged as important mechanisms of innate immunity. Either IFN-inducible or constitutive, these processes aim to guarantee cell homeostasis but have also been shown to modulate innate immune response to microbes and production of inflammatory cytokines. Among these constitutive cell-autonomous responses, autophagy is prominent and its role in innate immunity has been well characterized. Other stress responses, such as metabolic stress, the ER stress/unfolded protein response, mitochondrial stress, or the DNA damage response, seem to also be involved in innate immunity, although the precise mechanisms by which they regulate the innate immune response are not yet defined. Of importance, these distinct constitutive cell-autonomous responses appear to be interconnected and can also be modulated by microbes and PRRs, which add further complexity to the interplay between innate immune signaling and cell-autonomous responses in the mediation of an efficient innate immune response.

  10. Natural selection on immune responsiveness in blue tits Parus caeruleus.


    Råberg, Lars; Stjernman, Martin


    What is the form of natural selection on immune responsiveness? For a population at evolutionary equilibrium, there are two different scenarios. First, it is generally assumed that immune defense has both benefits and costs. If variation in immune responsiveness is due to variation in how individuals trade off these costs and benefits, one would expect immune responsiveness to be subject to stabilizing selection. Second, it is well known that an individual's immune responsiveness is often dependent on its overall condition. If immune responsiveness is condition-dependent, one would expect immune responsiveness to be under positive directional selection. We would therefore expect that the form of natural selection on immune responsiveness depends on the relative magnitude of these two sources of variation: variation in how individuals trade off the costs and benefits of defense, and variation in condition. We measured primary and secondary antibody responsiveness to diphtheria-tetanus vaccine in blue tits during winter and investigated the relationship between responsiveness and survival to the following breeding season. We use responsiveness to these antigens as measures of an individual's ability or propensity to mount an antibody response in case of an infection. Interestingly, different measures of responsiveness were subject to different selective regimes: primary responsiveness to diphtheria was subject to stabilizing selection, whereas secondary responsiveness to tetanus was subject to positive directional selection. In contrast, there was no significant selection on primary responsiveness to tetanus or secondary responsiveness to diphtheria. The finding of stabilizing selection on a measure of responsiveness is evidence that immune defense can incur fitness costs; a central but little-tested assumption of theories of the ecology and evolution of immunological defense. The finding of directional selection on a measure of responsiveness is consistent with the

  11. Impaired synaptic development in a maternal immune activation mouse model of neurodevelopmental disorders.


    Coiro, Pierluca; Padmashri, Ragunathan; Suresh, Anand; Spartz, Elizabeth; Pendyala, Gurudutt; Chou, Shinnyi; Jung, Yoosun; Meays, Brittney; Roy, Shreya; Gautam, Nagsen; Alnouti, Yazen; Li, Ming; Dunaevsky, Anna


    Both genetic and environmental factors are thought to contribute to neurodevelopmental and neuropsychiatric disorders with maternal immune activation (MIA) being a risk factor for both autism spectrum disorders and schizophrenia. Although MIA mouse offspring exhibit behavioral impairments, the synaptic alterations in vivo that mediate these behaviors are not known. Here we employed in vivo multiphoton imaging to determine that in the cortex of young MIA offspring there is a reduction in number and turnover rates of dendritic spines, sites of majority of excitatory synaptic inputs. Significantly, spine impairments persisted into adulthood and correlated with increased repetitive behavior, an ASD relevant behavioral phenotype. Structural analysis of synaptic inputs revealed a reorganization of presynaptic inputs with a larger proportion of spines being contacted by both excitatory and inhibitory presynaptic terminals. These structural impairments were accompanied by altered excitatory and inhibitory synaptic transmission. Finally, we report that a postnatal treatment of MIA offspring with the anti-inflammatory drug ibudilast, prevented both synaptic and behavioral impairments. Our results suggest that a possible altered inflammatory state associated with maternal immune activation results in impaired synaptic development that persists into adulthood but which can be prevented with early anti-inflammatory treatment.

  12. Antibody-mediated immunity in CFW mice infected with Mycobacterium lepraemurium. Humoral immune response in murine leprosy.

    PubMed Central

    Rojas-Espinosa, O; Casoluengo-Méndez, M; Díaz, G V


    A depression in antibody-mediated immunity (AMI) measured both in terms of circulating antibody and plaque-forming cells in the spleen was observed in CFW mice infected with M. lepraemurium when sheep red blood cells (SRBC) and human gammaglobulin (HGG) were used as antigens. The impairment in AMI was evident only after 75 days of infection thereafter the antibody response to SRBC antigen progressively decreased until the last day of experimentation (135 days). Within the first 60 days of infection no alteration in AMI was observed with the HGG antigen while the response to the SRBC antigen was significantly higher in the infected animals than in uninfected controls. PMID:795574

  13. Population-expression models of immune response

    NASA Astrophysics Data System (ADS)

    Stromberg, Sean P.; Antia, Rustom; Nemenman, Ilya


    The immune response to a pathogen has two basic features. The first is the expansion of a few pathogen-specific cells to form a population large enough to control the pathogen. The second is the process of differentiation of cells from an initial naive phenotype to an effector phenotype which controls the pathogen, and subsequently to a memory phenotype that is maintained and responsible for long-term protection. The expansion and the differentiation have been considered largely independently. Changes in cell populations are typically described using ecologically based ordinary differential equation models. In contrast, differentiation of single cells is studied within systems biology and is frequently modeled by considering changes in gene and protein expression in individual cells. Recent advances in experimental systems biology make available for the first time data to allow the coupling of population and high dimensional expression data of immune cells during infections. Here we describe and develop population-expression models which integrate these two processes into systems biology on the multicellular level. When translated into mathematical equations, these models result in non-conservative, non-local advection-diffusion equations. We describe situations where the population-expression approach can make correct inference from data while previous modeling approaches based on common simplifying assumptions would fail. We also explore how model reduction techniques can be used to build population-expression models, minimizing the complexity of the model while keeping the essential features of the system. While we consider problems in immunology in this paper, we expect population-expression models to be more broadly applicable.

  14. Fetal immune response following prematurely ruptured membranes.


    Cederqvist, L L; Francis, L C; Zervoudakis, I A; Becker, C G; Litwin, S D


    Concentrations of immunoglobulins (Ig)A1, and IgA2, IgD, IgE, IgG, and IgM have been determined in cord blood, amniotic fluid, and maternal serum in a group of patients with a history of prematurely ruptured membranes (PRM) prior to the onset of labor and in a control group of patients undergoing normal delivery and without a history of infection during pregnancy. IgA and IgD were determined by sensitive hemagglutination-inhibition tests; IgG and IgM, by radial immunodiffusion; IgE, by a radioimmunoassay. There was evidence for an immune response in 10 of 16 cases of PRM: five of 16 had increased IgA but normal IgM; three of 16 had increased IgA and IgM; two of 16 had high IgM and normal IgA in cord blood. In patients with significantly increased levels of either IgA or IgM or both, there was a decreased level of IgD. These changes are most likely the result of the immune response to ascending infection from the maternal genitals. The sensitive testing method employed could demonstrate the presence of IgD in 53 per cent of normal cord blood samples and 72 per cent of amniotic fluid samples obtained at term. IgE was found in all normal cord blood and amniotic fluid samples tested. By concentrating the amniotic fluid up to 180-fold, IgM was demonstrated in all normal samples tested. The potential importance of IgA determinations in cord blood in addition to IgM determination for detection of intrauterine infections is stressed.

  15. Chemical agents and the immune response.

    PubMed Central

    Luster, M I; Rosenthal, G J


    Our desire to understand the potential adverse human health effects of environmental chemical exposure has coincided with an increased understanding of the immune system and an appreciation of its complex regulatory network. This has spawned a broad interest in the area of immunotoxicology within the scientific community as well as certain concerns in the public sector regarding chemical-induced hypersensitivity and immunosuppression. The incidence of alleged human sensitization to chemicals has increased, in part, due to the fact that chemical companies are moving to larger and/or different markets. It has been estimated that 35 million Americans suffer from allergic disease, of which 2-5% are from occupational exposure. Although there is not yet a clear understanding of dose-response relationships or disease predisposition, there are many well-defined examples (isocyanates, anhydrides) of chemical sensitizers in humans and experimental animals. Evidence that chemicals suppress immune responses in humans is considerably less well established, although there is a public perception that chemicals generally cause immunosuppression. This perception has been fueled by highly publicized legal cases and scientific controversies within the academic and industrial communities. As a consequence of these public and scientific concerns, many of the regulatory agencies are developing immunotoxicity testing guidelines. At the present, however, there are limitations on adequate human methodology and data that allow the extrapolation of animal data to assess human risk. The potential for human immunosuppression remains of concern, however, because of a large database generated from animal studies that demonstrates immunosuppression as well as reports of immunosuppression in humans inadvertently (e.g., halogenated aromatic hydrocarbons) or occupationally (asbestos, benzene) exposed to xenobiotics.(ABSTRACT TRUNCATED AT 250 WORDS) Images FIGURE 1. PMID:8354170

  16. Time of appearance and distribution of cells capable of secondary immune response following primary immunization

    PubMed Central

    Vischer, T. L.; Stastny, P.


    Immunological memory was studied by measurement of tritiated thymidine incorporation in tissue culture. After primary immunization with keyhole limpet haemocyanin (KLH) secondary responsiveness could be detected as early as the 2nd day after immunization with Freund's adjuvant into the footpads and on the 4th day after injection of KLH intravenously. In each case immunological memory developed first in the area of the injection, that is, the popliteal lymph nodes after footpad immunization and the spleen after intravenous injection. The secondary response could also be detected in the lymphoid cells of the blood. Cell suspensions enriched in small lymphocytes showed a similar reactivity. Cells from the thymus, however, did not develop immunological memory. Rabbits immunized with BSA showed a relatively weaker response which was clearly detectable only when Freund's adjuvant was used for immunization. The results suggest that a response essentially of a secondary type may play an important role in what is usually considered the primary immune response. PMID:6027423

  17. Immune response of pregnant cows to bovine rotavirus immunization.


    Saif, L J; Smith, K L; Landmeier, B J; Bohl, E H; Theil, K W; Todhunter, D A


    Fifteen pregnant Holstein cows were freely assigned to 3 experimental groups (5 cows in each group). Cows in group I were inoculated IM and intramammarily (IMm) with Ohio Agricultural Research and Development Center (OARDC) tissue culture-propagated modified-live Nebraska calf diarrhea bovine rotavirus with added adjuvant (OARDC vaccine-immunized cows). Group II cows were given IM injections of a commercial modified-live rotavirus-coronavirus vaccine (commercial vaccine-immunized cows), and the remaining 5 cows were noninoculated controls (group III). Rotavirus antibody in colostrum and milk was mainly associated with immunoglobulin (Ig)G1, and less so with IgG2, IgA, and IgM, as analyzed by the enzyme-linked immunosorbent assay (ELISA), using monospecific anti-bovine IgG1, IgG2, IgM, and IgA sera. In serum, the rotavirus antibody was distributed almost equally between IgG1 and IgG2. The same relationships appeared in both immunized and nonvaccinated cows. All OARDC vaccine-injected cows had virus-neutralization (VN) and ELISA IgG1 rotavirus antibody titers in serum and mammary secretions at significantly increased levels (at least 100-fold; P less than 0.05) compared with the titers in groups II (commercial vaccine-immunized cows) and III (controls). Serum, colostrum, and milk antibody titers from these latter 2 groups did not differ statistically. The ELISA IgG2, IgA, and IgM rotavirus antibody titers also were significantly greater in mammary secretions from OARDC vaccine-immunized cows than in groups II and III cows. There was a high correlation between ELISA IgG1 and VN rotavirus antibody titers for all samples tested (r = 0.97, P less than 0.001), but ELISA IgG1 antibody titers were consistently higher than VN titers. The ELISA IgG1 and VN antibody titers of milk samples collected from cows 30 days after parturition were higher from the OARDC vaccine-immunized cows (ELISA IgG1, geometric mean titer (GMT) = 3,511; VN GMT = 1,689) than were titers from the

  18. Essential oil of clove (Eugenia caryophyllata) augments the humoral immune response but decreases cell mediated immunity.


    Halder, Sumita; Mehta, Ashish K; Mediratta, Pramod K; Sharma, Krishna K


    The present study was undertaken to explore the effect of the essential oil isolated from the buds of Eugenia caryophyllata on some immunological parameters. Humoral immunity was assessed by measuring the hemagglutination titre to sheep red blood cells and delayed type hypersensitivity was assessed by measuring foot pad thickness. Clove oil administration produced a significant increase in the primary as well as secondary humoral immune response. In addition, it also produced a significant decrease in foot pad thickness compared with the control group. Thus, these results suggest that clove oil can modulate the immune response by augmenting humoral immunity and decreasing cell mediated immunity.

  19. Impaired Cytokine Responses to Epstein-Barr Virus Antigens in Systemic Lupus Erythematosus Patients.


    Draborg, Anette Holck; Sandhu, Noreen; Larsen, Nanna; Lisander Larsen, Janni; Jacobsen, Søren; Houen, Gunnar


    We analyzed cytokine responses against latent and lytic Epstein-Barr virus (EBV) antigens in systemic lupus erythematosus (SLE) patients and healthy controls (HCs) to obtain an overview of the distinctive immune regulatory response in SLE patients and to expand the previously determined impaired EBV-directed T-cell response. The concentrations of 14 cytokines (IL2, IL4, IL5, IL6, IL10, IL12, IL17, IL18, IL1β, IFNγ, TNFα, TNFβ, TGFβ, and GM-CSF) were quantified upon stimulation of whole blood with latent state antigen EBNA1, lytic cycle antigen EBV-EA/D, and the superantigen SEB. To avoid results affected by lack of lymphocytes, we focused on SLE patients with normal levels. Decreased induction of IL12, IFNγ, IL17, and IL6 upon EBNA1 stimulation and that of IFNγ, IL6, TNFβ, IL1β, and GM-CSF upon EBV-EA/D stimulation were detected in SLE patients compared to HCs. IFNγ responses, especially, were shown to be reduced. Induction of several cytokines was furthermore impaired in SLE patients upon SEB stimulation, but no difference was observed in basic levels. Results substantiate the previously proposed impaired regulation of the immune response against latent and lytic cycle EBV infection in SLE patients without lymphopenia. Furthermore, results indicate general dysfunction of leukocytes and their cytokine regulations in SLE patients.

  20. Opioid peptides and innate immune response in mollusc.


    Liu, Dong-Wu


    The nervous and the immune systems can exchange information through opioid peptides. Furthermore, some opioid peptides can function as endogenous messengers of the immune system, and participate in an important part in the regulation of the various components of the immune response. Since the capacity of immunocytes to release and respond to opioid neuropeptide messengers is not restricted to mammalian organisms, recent studies have indicated that invertebrate models have been particularly useful to understand the mechanisms of the immune response. Moreover, the immunocytes of molluscs resemble cells of the vertebrate monocyte/macrophage lineage and are activated by similar substances, which control the main immune responses, i.e. phagocytosis, chemotaxis, and cytotoxicity. Recently, Mytilus edulis has been the subject of recent studies to determine whether the relationship between the immune and nervous systems seen in vertebrates also exists in invertebrates. The focus of this review is to describe how the opioid peptides participate in immune processes in molluscs.


    PubMed Central

    McDevitt, Hugh O.; Deak, Beverly D.; Shreffler, Donald C.; Klein, Jan; Stimpfling, Jack H.; Snell, George D.


    Eleven strains of mice bearing recombinant H-2 chromosomes derived from known crossover events between known H-2 types were immunized with a series of branched, multichain, synthetic polypeptide antigens [(T,G)-A--L, (H,G)-A--L, and (Phe,G)-A--L]. Results with nine of the eleven H-2 recombinants indicated that the gene(s) controlling immune response to these synthetic polypeptides (Ir-1) is on the centromeric or H-2K part of the recombinant H-2 chromosome. Results with two of the eleven recombinant H-2 chromosomes indicated that Ir-1 was on the telomeric or H-2D part of the recombinant H-2 chromosome. Both of these recombinants were derived from crossovers between the H-2K locus and the Ss-Slp locus near the center of the H-2 region. One of these recombinants, H-2y, was derived from a known single crossover event. These results indicate that Ir-1 lies near the center of the H-2 region between the H-2K locus and the Ss-Slp locus. The results of a four-point linkage test were consistent with these results. In 484 offspring of a cross designed to detect recombinants between H-2 and Ir-1, only two putative recombinants were detected. Both of these recombinants were confirmed by progeny testing. Extensive analysis of one of them has shown that the crossover event occurred within the H-2 region. (Testing of the second recombinant is currently under way.) Thus, in the linkage test, recombinants between H-2 and Ir-1 are in fact intra-H-2 crossovers. These results permit assignment of Ir-1 to a position between the H-2K locus and the Ss-Slp locus. PMID:4554451

  2. Spaceflight and immune responses of rhesus monkeys

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald; Morton, Darla S.; Swiggett, Jeanene P.; Hakenewerth, Anne M.; Fowler, Nina A.


    The effects of restraint on immunological parameters was determined in an 18 day ARRT (adult rhesus restraint test). The monkeys were restrained for 18 days in the experimental station for the orbiting primate (ESOP), the chair of choice for Space Shuttle experiments. Several immunological parameters were determined using peripheral blood, bone marrow, and lymph node specimens from the monkeys. The parameters included: response of bone marrow cells to GM-CSF (granulocyte-macrophage colony stimulating factor), leukocyte subset distribution, and production of IFN-a (interferon-alpha) and IFN-gamma (interferon-gamma). The only parameter changed after 18 days of restraint was the percentage of CD8+ T cells. No other immunological parameters showed changes due to restraint. Handling and changes in housing prior to the restraint period did apparently result in some restraint-independent immunological changes. Handling must be kept to a minimum and the animals allowed time to recover prior to flight. All experiments must be carefully controlled. Restraint does not appear to be a major issue regarding the effects of space flight on immune responses.

  3. Spaceflight and Immune Responses of Rhesus Monkeys

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald


    In the grant period, we perfected techniques for determination of interleukin production and leukocyte subset analysis of rhesus monkeys. These results are outlined in detail in publication number 2, appended to this report. Additionally, we participated in the ARRT restraint test to determine if restraint conditions for flight in the Space Shuttle could contribute to any effects of space flight on immune responses. All immunological parameters listed in the methods section were tested. Evaluation of the data suggests that the restraint conditions had minimal effects on the results observed, but handling of the monkeys could have had some effect. These results are outlined in detail in manuscript number 3, appended to this report. Additionally, to help us develop our rhesus monkey immunology studies, we carried out preliminary studies in mice to determine the effects of stressors on immunological parameters. We were able to show that there were gender-based differences in the response of immunological parameters to a stressor. These results are outlined in detail in manuscript number 4, appended to this report.

  4. Maternal antibodies reduce costs of an immune response during development.


    Grindstaff, Jennifer L


    Young vertebrates are dependent primarily on innate immunity and maternally derived antibodies for immune defense. This reliance on innate immunity and the associated inflammatory response often leads to reduced growth rates after antigenic challenge. However, if offspring have maternal antibodies that recognize an antigen, these antibodies should block stimulation of the inflammatory response and reduce growth suppression. To determine whether maternal and/or offspring antigen exposure affect antibody transmission and offspring growth, female Japanese quail (Coturnix japonica) and their newly hatched chicks were immunized. Mothers were immunized with lipopolysaccharide (LPS), killed avian reovirus vaccine (AR), or were given a control, phosphate-buffered saline, injection. Within each family, one-third of offspring were immunized with LPS, one-third were immunized with AR, and one-third were given the control treatment. Maternal immunization significantly affected the specific types of antibodies that were transmitted. In general, immunization depressed offspring growth. However, offspring immunized with the same antigen as their mother exhibited elevated growth in comparison to siblings immunized with a different antigen. This suggests that the growth suppressive effects of antigen exposure during development can be partially ameliorated by the presence of maternal antibodies, but in the absence of specific maternal antibodies, offspring are dependent on more costly innate immune defenses. Together, the results suggest that the local disease environment of mothers prior to reproduction significantly affects maternal antibody transmission and these maternal antibodies may allow offspring to partially maintain growth during infection in addition to providing passive humoral immune defense.

  5. Immune function trade-offs in response to parasite threats.


    Kirschman, Lucas J; Quade, Adam H; Zera, Anthony J; Warne, Robin W


    Immune function is often involved in physiological trade-offs because of the energetic costs of maintaining constitutive immunity and mounting responses to infection. However, immune function is a collection of discrete immunity factors and animals should allocate towards factors that combat the parasite threat with the highest fitness cost. For example, animals on dispersal fronts of expanding population may be released from density-dependent diseases. The costs of immunity, however, and life history trade-offs in general, are often context dependent. Trade-offs are often most apparent under conditions of unusually limited resources or when animals are particularly stressed, because the stress response can shift priorities. In this study we tested how humoral and cellular immune factors vary between phenotypes of a wing dimorphic cricket and how physiological stress influences these immune factors. We measured constitutive lysozyme activity, a humoral immune factor, and encapsulation response, a cellular immune factor. We also stressed the crickets with a sham predator in a full factorial design. We found that immune strategy could be explained by the selective pressures encountered by each morph and that stress decreased encapsulation, but not lysozyme activity. These results suggest a possible trade-off between humoral and cellular immunity. Given limited resources and the expense of immune factors, parasite pressures could play a key factor in maintaining insect polyphenism via disruptive selection.

  6. CIP2A Promotes T-Cell Activation and Immune Response to Listeria monocytogenes Infection

    PubMed Central

    Cvrljevic, Anna; Khan, Mohd Moin; Treise, Irina; Adler, Thure; Aguilar-Pimentel, Juan Antonio; Au-Yeung, Byron; Sittig, Eleonora; Laajala, Teemu Daniel; Chen, Yiling; Oeder, Sebastian; Calzada-Wack, Julia; Horsch, Marion; Aittokallio, Tero; Busch, Dirk H.; Ollert, Markus W.; Neff, Frauke; Beckers, Johannes; Gailus-Durner, Valerie; Fuchs, Helmut; de Angelis, Martin Hrabě; Chen, Zhi; Lahesmaa, Riitta; Westermarck, Jukka


    The oncoprotein Cancerous Inhibitor of Protein Phosphatase 2A (CIP2A) is overexpressed in most malignancies and is an obvious candidate target protein for future cancer therapies. However, the physiological importance of CIP2A-mediated PP2A inhibition is largely unknown. As PP2A regulates immune responses, we investigated the role of CIP2A in normal immune system development and during immune response in vivo. We show that CIP2A-deficient mice (CIP2AHOZ) present a normal immune system development and function in unchallenged conditions. However when challenged with Listeria monocytogenes, CIP2AHOZ mice display an impaired adaptive immune response that is combined with decreased frequency of both CD4+ T-cells and CD8+ effector T-cells. Importantly, the cell autonomous effect of CIP2A deficiency for T-cell activation was confirmed. Induction of CIP2A expression during T-cell activation was dependent on Zap70 activity. Thus, we reveal CIP2A as a hitherto unrecognized mediator of T-cell activation during adaptive immune response. These results also reveal CIP2AHOZ as a possible novel mouse model for studying the role of PP2A activity in immune regulation. On the other hand, the results also indicate that CIP2A targeting cancer therapies would not cause serious immunological side-effects. PMID:27100879

  7. The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

    DTIC Science & Technology


    caused by penicillin -resistant Streptococcus pneumoniae in rabbits. Antimicrob. Agents Chemother. 46: 1760- 1765. Takeuchi, O., Hoshino, K., and...2006 2. REPORT TYPE 3. DATES COVERED 00-00-2006 to 00-00-2006 4. TITLE AND SUBTITLE The host immune response to Streptococcus pneumoniae immune response to Streptococcus pneumoniae : bridging innate and adaptive immunity Katherine Shi-Hui Lee Thesis directed by: Clifford M

  8. The unfolded protein response in immunity and inflammation

    PubMed Central

    Grootjans, Joep; Kaser, Arthur; Kaufman, Randal J.; Blumberg, Richard S.


    The unfolded protein response (UPR) is a highly conserved pathway that allows the cell to manage endoplasmic reticulum (ER) stress that is imposed by the secretory demands associated with environmental forces. In this role, the UPR has increasingly been shown to have crucial functions in immunity and inflammation. In this Review, we discuss the importance of the UPR in the development, differentiation, function and survival of immune cells in meeting the needs of an immune response. In addition, we review current insights into how the UPR is involved in complex chronic inflammatory diseases and, through its role in immune regulation, antitumour responses. PMID:27346803

  9. Impairing loyalty: corporate responsibility for clinical misadventure.


    Kipnis, Kenneth


    A medical device manufacturer pays a surgeon to demonstrate a novel medical instrument in a live broadcast to an audience of specialists in another city. The surgical patient is unaware of the broadcast and unaware of the doctor's relationship with the manufacturer. It turns out that the patient required a different surgical approach to her condition-one that would not have allowed a demonstration of the instrument--and she later dies. The paper is an exploration of whether the manufacturer shares, along with the doctor, responsibility for the death of the patient. Three arguments for corporate responsibility are considered; two are criticized and the third is offered as sound.

  10. Immune recovery in HIV-infected patients after Candida esophagitis is impaired despite long-term antiretroviral therapy

    PubMed Central

    Stuehler, Claudia; Bernardini, Claudia; Elzi, Luigia; Stoeckle, Marcel; Zimmerli, Stefan; Furrer, Hansjakob; Günthard, Huldrych F.; Leibundgut-Landmann, Salomé; Battegay, Manuel; Khanna, Nina


    Objective: Candida esophagitis belongs to the most common AIDS-defining diseases; however, a comprehensive immune pathogenic concept is lacking. Design: We investigated the immune status of 37 HIV-1-infected patients from the Swiss HIV cohort study at diagnosis of Candida esophagitis, 1 year before, 1 year later and after 2 years of suppressed HIV RNA. We compared these patients with three groups: 37 HIV-1-infected patients without Candida esophagitis but similar CD4+ cell counts as the patients at diagnosis (advanced HIV group), 15 HIV-1-infected patients with CD4+ cell counts higher than 500 cells/μl, CD4+ cell nadirs higher than 350 cells/μl and suppressed HIV RNA under combination antiretroviral therapy (cART) (early cART group) and 20 healthy individuals. Methods: We investigated phenotype, cytokine production and proliferative capacity of different immune cells by flow cytometry and enzyme-linked immunosorbent spot. Results: We found that patients with Candida esophagitis had nearly abolished CD4+ cell proliferation in response to Candida albicans, significantly increased percentages of dysfunctional CD4+ cells, significantly decreased cytotoxic natural killer cell counts and peripheral innate lymphoid cell counts and significantly reduced IFN-γ and IL-17 production compared with the early cART group and healthy individuals. Most of these defects remained for more than 2 years despite viral suppression. The advanced HIV group without opportunistic infection showed partly improved immune recovery. Conclusion: Our data indicate that Candida esophagitis in HIV-1-infected patients is caused by an accumulation of multiple, partly Candida-specific immunological defects. Long-term immune recovery is impaired, illustrating that specific immunological gaps persist despite cART. These data also support the rationale for early cART initiation to prevent irreversible immune defects. PMID:27149086

  11. High-dose dexamethasone corrects impaired myeloid-derived suppressor cell function via Ets1 in immune thrombocytopenia.


    Hou, Yu; Feng, Qi; Xu, Miao; Li, Guo-Sheng; Liu, Xue-Na; Sheng, Zi; Zhou, Hai; Ma, Ji; Wei, Yu; Sun, Yuan-Xin; Yu, Ying-Yi; Qiu, Ji-Hua; Shao, Lin-Lin; Liu, Xin-Guang; Hou, Ming; Peng, Jun


    Myeloid-derived suppressor cells (MDSCs) are heterogeneous immature cells and natural inhibitors of adaptive immunity. In this study, the MDSC population was evaluated in adult patients with primary immune thrombocytopenia (ITP), where cell-mediated immune mechanisms are involved in platelet destruction. Our data demonstrated that both the numbers and suppressive functions of MDSCs were impaired in the peripheral blood and spleens of patients with ITP compared with healthy control patients. High-dose dexamethasone (HD-DXM) treatment rescued MDSC numbers in patients with ITP. And DXM modulation promoted the suppressive function of MDSCs induced in vitro. Moreover, the expression of interleukin 10 and transforming growth factor β was significantly upregulated in DXM-modulated MDSCs compared with the unmodulated cultures. DXM-modulated MDSCs inhibited autologous CD4(+)T-cell proliferation and significantly attenuated cytotoxic T lymphocyte-mediated platelet lysis, further indicating enhanced control over T-cell responses. Elevated expression of the transcription factor Ets1 was identified in DXM-modulated MDSCs. Transfection of Ets-1 small interfering RNA efficiently blocked regulatory effects of MDSCs, which almost offset the augmentation of MDSC function by DXM. Meanwhile, splenocytes from CD61 knockout mice immunized with CD61(+)platelets were transferred into severe combined immunodeficient (SCID) mouse recipients (C57/B6 background) to induce a murine model of severe ITP. We passively transferred the DXM-modulated MDSCs induced from bone marrow of wild-type C57/B6 mice into the SCID mouse recipients, which significantly increased platelet counts in vivo compared with those receiving splenocyte engraftment alone. These findings suggested that impaired MDSCs are involved in the pathogenesis of ITP, and that HD-DXM corrected MDSC functions via a mechanism underlying glucocorticoid action and Ets1.

  12. Innate immune response development in nestling tree swallows

    USGS Publications Warehouse

    Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.


    We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.

  13. Impaired immunity in harbour seals (Phoca vitulina) exposed to bioaccumulated environmental contaminants: review of a long-term feeding study.

    PubMed Central

    de Swart, R L; Ross, P S; Vos, J G; Osterhaus, A D


    Mass mortalities among seals and dolphins inhabiting contaminated marine regions have led to speculation about a possible involvement of immunosuppression associated with environmental pollution. To evaluate whether contaminants at ambient environmental levels can affect immune function of seals, we carried out an immunotoxicological study under semifield conditions. Two groups of 11 harbour seals (Phoca vitulina) originating from a relatively uncontaminated area were fed herring from either the highly polluted Baltic Sea or the relatively uncontaminated Atlantic Ocean. Changes in immune function were monitored over a 2 1/2-year period. The seals that were fed contaminated Baltic herring developed significantly higher body burdens of potentially immunotoxic organochlorines and displayed impaired immune responses as demonstrated by suppression of natural killer cell activity and specific T-cell responses. During a 2-week fasting experiment performed at the end of the feeding study, mobilization of organochlorines from the blubber did not lead to a strong increase of contaminant levels in the blood, and no enhancement of the existing immunosuppression was observed. These results demonstrate that chronic exposure to environmental contaminants accumulated through the food chain affects immune function in harbour seals, whereas short-term fasting periods, which are normal for seals, do not seem to pose an additional risk. The seals of this study were not exposed perinatally to high levels of environmental chemicals, and body burdens of organochlorines measured near the end of the study were lower than those generally observed in free-ranging seals inhabiting many contaminated regions. Therefore, it may be expected that environmental contaminants adversely affect immune function of free-ranging seals inhabiting contaminated regions at least as seriously as observed in these studies. PMID:8880005

  14. Linear ubiquitination signals in adaptive immune responses.


    Ikeda, Fumiyo


    Ubiquitin can form eight different linkage types of chains using the intrinsic Met 1 residue or one of the seven intrinsic Lys residues. Each linkage type of ubiquitin chain has a distinct three-dimensional topology, functioning as a tag to attract specific signaling molecules, which are so-called ubiquitin readers, and regulates various biological functions. Ubiquitin chains linked via Met 1 in a head-to-tail manner are called linear ubiquitin chains. Linear ubiquitination plays an important role in the regulation of cellular signaling, including the best-characterized tumor necrosis factor (TNF)-induced canonical nuclear factor-κB (NF-κB) pathway. Linear ubiquitin chains are specifically generated by an E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) and hydrolyzed by a deubiquitinase (DUB) called ovarian tumor (OTU) DUB with linear linkage specificity (OTULIN). LUBAC linearly ubiquitinates critical molecules in the TNF pathway, such as NEMO and RIPK1. The linear ubiquitin chains are then recognized by the ubiquitin readers, including NEMO, which control the TNF pathway. Accumulating evidence indicates an importance of the LUBAC complex in the regulation of apoptosis, development, and inflammation in mice. In this article, I focus on the role of linear ubiquitin chains in adaptive immune responses with an emphasis on the TNF-induced signaling pathways.

  15. Probiotics and the immune response to vaccines.


    MacDonald, Thomas T; Bell, Iona


    Probiotics are bacteria, but sometimes fungi, which when taken by the oral route may give some health benefits. The most compelling evidence for beneficial effects of probiotics is in the prevention and reduction in the duration of symptoms related to gut infectious disease. There is also evidence to show that some specific probiotics are beneficial in Clostridium difficile diarrhoea in the elderly. As further and better controlled clinical studies have appeared, some specific probiotics also appear to have beneficial effects in perhaps preventing and reducing the duration of symptoms due to acquired upper respiratory tract infections. In an attempt to explain these effects, attention has turned to the effects of some specific probiotics on the immune system. There is evidence that some specific probiotics can alter monocyte and natural killer cell function in the blood. Evidence is also accumulating that taking some specific probiotics can boost antibody responses to oral and systemically administered vaccines. The effect when shown is modest and is not always seen in different studies to all vaccines, but there is enough of a trend to make the area worthy of further investigation, particularly to tease out the mechanisms involved.

  16. Importins and exportins regulating allergic immune responses.


    Aggarwal, Ankita; Agrawal, Devendra K


    Nucleocytoplasmic shuttling of macromolecules is a well-controlled process involving importins and exportins. These karyopherins recognize and bind to receptor-mediated intracellular signals through specific signal sequences that are present on cargo proteins and transport into and out of the nucleus through nuclear pore complexes. Nuclear localization signals (NLS) present on cargo molecules to be imported while nuclear export signals (NES) on the molecules to be exported are recognized by importins and exportins, respectively. The classical NLS are found on many transcription factors and molecules that are involved in the pathogenesis of allergic diseases. In addition, several immune modulators, including corticosteroids and vitamin D, elicit their cellular responses by regulating the expression and activity of importin molecules. In this review article, we provide a comprehensive list of importin and exportin molecules and their specific cargo that shuttled between cytoplasm and the nucleus. We also critically review the role and regulation of specific importin and exportin involved in the transport of activated transcription factors in allergic diseases, the underlying molecular mechanisms, and the potential target sites for developing better therapeutic approaches.

  17. Suppression of immune response to Listeria monocytogenes: mechanism(s) of immune complex suppression.

    PubMed Central

    Virgin, H W; Wittenberg, G F; Bancroft, G J; Unanue, E R


    We have investigated possible mechanisms underlying immune complex suppression of resistance to Listeria monocytogenes. Inhibition of resistance was found when immune complexes were formed in vivo in immune mice or in nonimmune mice adoptively transferred with specific antibody. Suppression was also found when nonimmune mice were injected with immune complexes preformed in vitro. We investigated the role of complement by decomplementing mice with cobra venom factor purified by high-pressure liquid chromatography. Complete depletion of serum C3 did not eliminate immune complex suppression of resistance to L. monocytogenes, suggesting that complement activation is not required for immune complex suppression. Infection-induced changes in the surface phenotype and functional properties of macrophages from normal and immune complex-suppressed mice were also investigated. Macrophage expression of both H-2K and Ia molecules increased during the response of normal mice to L. monocytogenes. However, these changes were not found in immune complex-suppressed mice. In contrast, membrane interleukin 1 expression was increased in macrophages from suppressed mice compared with macrophages from normal mice. Macrophages from L. monocytogenes-infected normal and immune complex-suppressed mice expressed cytotoxicity against tumor cells in vitro. We conclude that immune complexes do not inhibit resistance to L. monocytogenes by activation of complement or decreasing macrophage cytotoxic activity. Rather, defects in Ia expression by macrophages from suppressed mice might be one component responsible for immune complex suppression of resistance to L. monocytogenes. PMID:3932204

  18. [Immune response and digestive cancers: Prognostic and therapeutic implications].


    Bibeau, Frédéric; Bazille, Céline; Svrcek, Magali; Pierson, Rémi; Lagorce-Pagès, Christine; Cohen, Romain; André, Thierry


    The aim of this article is to emphasize the impact of the immune response in digestive cancers, especially from colorectal (CRC) origin. In this setting, an adaptive lymphocytic infiltrate underlines the prognostic impact of the immune response, because it is associated to a favorable outcome. The next challenge will be to validate, in a prospective therapeutic trial, the integration of the immune response as decisional parameter for adjuvant therapy. The immune response is also a predictive parameter in microsatellite instable metastatic CRC, characterized by an adaptive lymphocytic infiltrate, leading to a very high response rate to immune therapies. However, prognostic and predictive biomarkers still need to be optimized in order to better select patients. These data are also valuable for digestive non-colorectal cancers, which are briefly analyzed. The methodology for the assessment of these prognostic and predictive biomarkers, which represents an important issue in precision medicine, is also discussed.

  19. Evaluating immune responses after sipuleucel-T therapy.


    Strauss, Julius; Madan, Ravi A; Figg, William D


    Following FDA approval of sipuleucel-T in 2010 for metastatic castration resistant prostate cancer (mCRPC), several studies have described the effect of sipuleucel-T on peripheral immune responses. Retrospective associations have also been made with immune responses and survival. A recently published study by Fong et al. was the first to characterize the immune response of sipuleucel-T in the tumor microenvironment. The findings of this study have been hypothesis generating, yet it remains unclear whether the peri-tumor immune response described is predictive of survival. Increasing evidence suggests that radiographic or PSA progression does not accurately reflect survival with sipuleucel-T and other immunotherapies. Finding an immune biomarker which can accurately reflect clinical benefit and validating it prospectively offers the potential for a predictive indicator of response in an area where none currently exists.

  20. The nociception genes painless and Piezo are required for the cellular immune response of Drosophila larvae to wasp parasitization.


    Tokusumi, Yumiko; Tokusumi, Tsuyoshi; Schulz, Robert A


    In vertebrates, interaction between the nervous system and immune system is important to protect a challenged host from stress inputs from external sources. In this study, we demonstrate that sensory neurons are involved in the cellular immune response elicited by wasp infestation of Drosophila larvae. Multidendritic class IV neurons sense contacts from external stimuli and induce avoidance behaviors for host defense. Our findings show that inactivation of these sensory neurons impairs the cellular response against wasp parasitization. We also demonstrate that the nociception genes encoding the mechanosensory receptors Painless and Piezo, both expressed in class IV neurons, are essential for the normal cellular immune response to parasite challenge.

  1. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    SciTech Connect

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.; Ballestas, Mary E.; Elmets, Craig A.; Robbins, David J.; Matalon, Sadis; Deshane, Jessy S.; Afaq, Farrukh; Bickers, David R.; Athar, Mohammad


    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.

  2. Caloric Restriction reduces inflammation and improves T cell-mediated immune response in obese mice but concomitant consumption of curcumin/piperine adds no further benefit

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Obesity is associated with low-grade inflammation and impaired immune response. Caloric restriction (CR) has been shown to inhibit inflammatory response and enhance cell-mediated immune function. Curcumin, the bioactive phenolic component of turmeric spice, is proposed to have anti-obesity and anti-...

  3. Impaired Leukocyte Trafficking and Skin Inflammatory Responses in Hamsters Lacking a Functional Circadian System

    PubMed Central

    Prendergast, Brian J.; Cable, Erin J.; Patel, Priyesh N.; Pyter, Leah M.; Onishi, Kenneth G.; Stevenson, Tyler J.; Ruby, Norman F.; Bradley, Sean P.


    The immune system is under strong circadian control, and circadian desynchrony is a risk factor for metabolic disorders, inflammatory responses and cancer. Signaling pathways that maintain circadian rhythms (CRs) in immune function in vivo, and the mechanisms by which circadian desynchrony impairs immune function, remain to be fully-identified. These experiments tested the hypothesis that the hypothalamic circadian pacemaker in the suprachiasmatic nucleus (SCN) drives CRs in the immune system, using a non-invasive model of SCN circadian arrhythmia. Robust CRs in blood leukocyte trafficking, with a peak during the early light phase (ZT4) and nadir in the early dark phase (ZT18), were absent in arrhythmic hamsters, as were CRs in spleen clock gene (per1, bmal1) expression, indicating that a functional pacemaker in the SCN is required for the generation of CRs in leukocyte trafficking and for driving peripheral clocks in secondary lymphoid organs. Pinealectomy was without effect on CRs in leukocyte trafficking, but abolished CRs in spleen clock gene expression, indicating that nocturnal melatonin secretion is necessary for communicating circadian time information to the spleen. CRs in trafficking of antigen presenting cells (CD11c+ dendritic cells) in the skin were abolished, and antigen-specific delayed-type hypersensitivity skin inflammatory responses were markedly impaired in arrhythmic hamsters. The SCN drives robust CRs in leukocyte trafficking and lymphoid clock gene expression; the latter of which is not expressed in the absence of melatonin. Robust entrainment of the circadian pacemaker provides a signal critical to diurnal rhythms in immunosurveilliance and optimal memory T-cell dependent immune responses. PMID:23474187

  4. Biomimetic and synthetic interfaces to tune immune responses (Review)

    PubMed Central

    Garapaty, Anusha; Champion, Julie A.


    Organisms depend upon complex intercellular communication to initiate, maintain, or suppress immune responses during infection or disease. Communication occurs not only between different types of immune cells, but also between immune cells and nonimmune cells or pathogenic entities. It can occur directly at the cell–cell contact interface, or indirectly through secreted signals that bind cell surface molecules. Though secreted signals can be soluble, they can also be particulate in nature and direct communication at the cell–particle interface. Secreted extracellular vesicles are an example of native particulate communication, while viruses are examples of foreign particulates. Inspired by communication at natural immunological interfaces, biomimetic materials and designer molecules have been developed to mimic and direct the type of immune response. This review describes the ways in which native, biomimetic, and designer materials can mediate immune responses. Examples include extracellular vesicles, particles that mimic immune cells or pathogens, and hybrid designer molecules with multiple signaling functions, engineered to target and bind immune cell surface molecules. Interactions between these materials and immune cells are leading to increased understanding of natural immune communication and function, as well as development of immune therapeutics for the treatment of infection, cancer, and autoimmune disease. PMID:26178262

  5. Immune-responsiveness of CD4+ T cells during Streptococcus suis serotype 2 infection

    PubMed Central

    Lecours, Marie-Pier; Letendre, Corinne; Clarke, Damian; Lemire, Paul; Galbas, Tristan; Benoit-Biancamano, Marie-Odile; Thibodeau, Jacques; Gottschalk, Marcelo; Segura, Mariela


    The pathogenesis of Streptococcus suis infection, a major swine and human pathogen, is only partially understood and knowledge on the host adaptive immune response is critically scarce. Yet, S. suis virulence factors, particularly its capsular polysaccharide (CPS), enable this bacterium to modulate dendritic cell (DC) functions and potentially impair the immune response. This study aimed to evaluate modulation of T cell activation during S. suis infection and the role of DCs in this response. S. suis-stimulated total mouse splenocytes readily produced TNF-α, IL-6, IFN-γ, CCL3, CXCL9, and IL-10. Ex vivo and in vivo analyses revealed the involvement of CD4+ T cells and a Th1 response. Nevertheless, during S. suis infection, levels of the Th1-derived cytokines TNF-α and IFN-γ were very low. A transient splenic depletion of CD4+ T cells and a poor memory response were also observed. Moreover, CD4+ T cells secreted IL-10 and failed to up-regulate optimal levels of CD40L and CD69 in coculture with DCs. The CPS hampered release of several T cell-derived cytokines in vitro. Finally, a correlation was established between severe clinical signs of S. suis disease and impaired antibody responses. Altogether, these results suggest S. suis interferes with the adaptive immune response. PMID:27905502

  6. Inhibition of viral replication reduces regulatory T cells and enhances the antiviral immune response in chronic hepatitis B

    SciTech Connect

    Stoop, Jeroen N. . E-mail:; Molen, Renate G. van der . E-mail:; Kuipers, Ernst J. . E-mail:; Kusters, Johannes G. . E-mail:; Janssen, Harry L.A. . E-mail:


    Regulatory T cells (Treg) play a key role in the impaired immune response that is typical for a chronic Hepatitis B virus (HBV) infection. To gain more insight in the mechanism that is responsible for this impaired immune response, the effect of viral load reduction resulting from treatment with the nucleotide analogue adefovir dipivoxil on the percentages of Treg and HBV-specific T-cell responses was analyzed. Peripheral blood mononuclear cells (PBMC) of 12 patients were collected at baseline and during treatment. In parallel to the decline in viral load, we found a decline in circulating Treg, combined with an increase in HBV core antigen-specific IFN-{gamma} production and proliferation. The production of IL10 did not decrease during therapy. In conclusion, adefovir induced viral load reduction results in a decline of circulating Treg together with a partial recovery of the immune response.

  7. Mumps virus-induced innate immune responses in mouse Sertoli and Leydig cells.


    Wu, Han; Shi, Lili; Wang, Qing; Cheng, Lijing; Zhao, Xiang; Chen, Qiaoyuan; Jiang, Qian; Feng, Min; Li, Qihan; Han, Daishu


    Mumps virus (MuV) infection frequently causes orchitis and impairs male fertility. However, the mechanisms underlying the innate immune responses to MuV infection in the testis have yet to be investigated. This study showed that MuV induced innate immune responses in mouse Sertoli and Leydig cells through TLR2 and retinoic acid-inducible gene I (RIG-I) signaling, which result in the production of proinflammatory cytokines and chemokines, including TNF-α, IL-6, MCP-1, CXCL10, and type 1 interferons (IFN-α and IFN-β). By contrast, MuV did not induce the cytokine production in male germ cells. In response to MuV infection, Sertoli cells produced higher levels of proinflammatory cytokines and chemokines but lower levels of type 1 IFNs than Leydig cells did. The MuV-induced cytokine production by Sertoli and Leydig cells was significantly reduced by the knockout of TLR2 or the knockdown of RIG-I signaling. The local injection of MuV into the testis triggered the testicular innate immune responses in vivo. Moreover, MuV infection suppressed testosterone synthesis by Leydig cells. This is the first study examining the innate immune responses to MuV infection in testicular cells. The results provide novel insights into the mechanisms underlying the MuV-induced innate immune responses in the testis.

  8. Mumps virus-induced innate immune responses in mouse Sertoli and Leydig cells

    PubMed Central

    Wu, Han; Shi, Lili; Wang, Qing; Cheng, Lijing; Zhao, Xiang; Chen, Qiaoyuan; Jiang, Qian; Feng, Min; Li, Qihan; Han, Daishu


    Mumps virus (MuV) infection frequently causes orchitis and impairs male fertility. However, the mechanisms underlying the innate immune responses to MuV infection in the testis have yet to be investigated. This study showed that MuV induced innate immune responses in mouse Sertoli and Leydig cells through TLR2 and retinoic acid-inducible gene I (RIG-I) signaling, which result in the production of proinflammatory cytokines and chemokines, including TNF-α, IL-6, MCP-1, CXCL10, and type 1 interferons (IFN-α and IFN-β). By contrast, MuV did not induce the cytokine production in male germ cells. In response to MuV infection, Sertoli cells produced higher levels of proinflammatory cytokines and chemokines but lower levels of type 1 IFNs than Leydig cells did. The MuV-induced cytokine production by Sertoli and Leydig cells was significantly reduced by the knockout of TLR2 or the knockdown of RIG-I signaling. The local injection of MuV into the testis triggered the testicular innate immune responses in vivo. Moreover, MuV infection suppressed testosterone synthesis by Leydig cells. This is the first study examining the innate immune responses to MuV infection in testicular cells. The results provide novel insights into the mechanisms underlying the MuV-induced innate immune responses in the testis. PMID:26776505

  9. Immune responses and disease enhancement during respiratory syncytial virus infection.


    Openshaw, Peter J M; Tregoning, John S


    Respiratory syncytial virus (RSV) is one of the commonest and most troublesome viruses of infancy. It causes most cases of bronchiolitis, which is associated with wheezing in later childhood. In primary infection, the peak of disease typically coincides with the development of specific T- and B-cell responses, which seem, in large part, to be responsible for disease. Animal models clearly show that a range of immune responses can enhance disease severity, particularly after vaccination with formalin-inactivated RSV. Prior immune sensitization leads to exuberant chemokine production, an excessive cellular influx, and an overabundance of cytokines during RSV challenge. Under different circumstances, specific mediators and T-cell subsets and antibody-antigen immune complex deposition are incriminated as major factors in disease. Animal models of immune enhancement permit a deep understanding of the role of specific immune responses in RSV disease, assist in vaccine design, and indicate which immunomodulatory therapy might be beneficial to children with bronchiolitis.

  10. Nifurtimox-induced alterations in the cell-mediated immune response to PPD tin guinea-pigs.

    PubMed Central

    Lelchuk, R; Cardoni, R L; Levis, S


    Positive skin reactions to PPD in guinea-pigs immunized with Freund's complete adjuvant (FCA) were reversed after treatment with 10 mg/kg/day nifurtimox for 12 days. The in vitro migration of peripheral blood leucocytes from FCA-immunized guinea-pigs was inhibited with PPD, but it returned to normal values after nifurtimox treatment. Furthermore, the cell-free supernatant from PPD-stimulated lymphocytes from FCA-immunized nifurtimox-treated guinea-pigs did not inhibit the migration of normal cells. Thus the administration of nifurtimox impaired the specific cell-mediated immune response to PPD both in vivo and in vitro. PMID:414870

  11. Social Behavior, Prolactin and the Immune Response

    DTIC Science & Technology


    on the immune processes. (Locke, Ader, Besedovsky, Hall, Solomon & Strom, 1985). The term psychoneuroimmunology has been coined by researchers to...34mind and immunity" covering a five year period (Locke and Hornig-Rohan, 1983) and a collection of seminal papers on psychoneuroimmunology (Locke, et...In: Psychoneuroimmunology (R. Ader, ed.), Academic Press, NY, 1981, 609-617. Friedman, S. B., Glasgow, L. A. and Ader, R. Psychological factors

  12. Innate and adaptive immune responses in neurodegeneration and repair.


    Amor, Sandra; Woodroofe, M Nicola


    Emerging evidence suggests important roles of the innate and adaptive immune responses in the central nervous system (CNS) in neurodegenerative diseases. In this special review issue, five leading researchers discuss the evidence for the beneficial as well as the detrimental impact of the immune system in the CNS in disorders including Alzheimer's disease, multiple sclerosis and CNS injury. Several common pathological mechanisms emerge indicating that these pathways could provide important targets for manipulating the immune reposes in neurodegenerative disorders. The articles highlight the role of the traditional resident immune cell of the CNS - the microglia - as well as the role of other glia astrocytes and oligodendrocytes in immune responses and their interplay with other immune cells including, mast cells, T cells and B cells. Future research should lead to new discoveries which highlight targets for therapeutic interventions which may be applicable to a range of neurodegenerative diseases.

  13. Transcutaneous DNA immunization following waxing-based hair depilation elicits both humoral and cellular immune responses

    PubMed Central

    Xiao, Gang; Li, Xinran; Kumar, Amit; Cui, Zhengrong


    Previously, we showed that transcutaneous (TC) DNA immunization by applying plasmid DNA onto a mouse skin area wherein the hair follicles were induced into growth stage by plucking the hair using warm waxing induced strong and functional antigen-specific antibody responses. In the present study, using plasmids that encode β-galactosidase gene or ovalbumin (OVA) gene, we showed that this mode of TC DNA immunization not only induced specific antibody responses, but also induced antigen-specific cytotoxic T lymphocyte responses. In fact, TC DNA immunization using a plasmid that encodes OVA gene prevented the growth of OVA-expressing B16-OVA tumor cells in the immunized mice. Moreover, we provided additional evidence supporting that hair follicles are essential for this mode of TC DNA immunization. PMID:22771558

  14. Sexual dimorphism in immunity: improving our understanding of vaccine immune responses in men.


    Furman, David


    Weaker immune responses are often observed in males compared to females. Since female hormones have proinflammatory properties and androgens have potent immunomodulatory effects, this sexual dimorphism in the immune response seems to be hormone dependent. Despite our current knowledge about the effect of sex hormones on immune cells, definition of the factors driving the sex differences in immunoclinical outcomes, such as the diminished response to infection and vaccination observed in men or the higher rates of autoimmunity observed in females, remains elusive. Recently, systems approaches to immune function have started to suggest a way toward establishing this connection. Such studies promise to improve our understanding of the mechanisms underlying the sexual dimorphism observed in the human immune system.

  15. Care Partner Responses to the Onset of Mild Cognitive Impairment

    ERIC Educational Resources Information Center

    Blieszner, Rosemary; Roberto, Karen A.


    Purpose: We examined characteristics, responses, and psychological well-being of care partners who support and assist older adults recently diagnosed with mild cognitive impairment (MCI). Design and Methods: Based on a sample of 106 care partners of community residents diagnosed with MCI at memory clinics, we conducted face-to-face interviews…

  16. Immune Response in Microgravity: Genetic Basis and Countermeasure Development Implications

    NASA Technical Reports Server (NTRS)

    Risin, Diana; Ward, Nancy E.; Risin, Semyon A.; Pellis, Neal R.


    Impairment of the immunity in astronauts and cosmonauts even in shortterm flights is a recognized risk. Longterm orbital space missions and anticipated interplanetary flights increase the concern for more pronounced effects on the immune system with potential clinical consequences. Studies in true and modeled microgravity (MG) have demonstrated that MG directly affects numerous lymphocyte functions. The purpose of this study was to screen for genes involved in lymphocytes response to modeled microgravity (MMG) that could explain the functional and structural changes observed earlier. The microgravity-induced changes in gene expression were analyzed by microarray DNA chip technology. CD3and IL2activated Tcells were cultured in 1g (static) and modeled microgravity (NASA Rotating Wall Vessel bioreactor) conditions for 24 hours. Total RNA was extracted using the RNeasy isolation kit (Qiagen, Valencia, CA). Microarray experiments were performed utilizing Affymetrix Gene Chips (U133A), allowing testing for 18,400 human genes. To decrease the biological variation and aid in detecting microgravity-associated changes, experiments were performed in triplicate using cells obtained from three different donors. Exposure to modeled microgravity resulted in alteration of 89 genes, 10 of which were upregulated and 79 down-regulated. Altered genes were categorized by their function, structural role and by association with metabolic and regulatory pathways. A large proportion was found to be involved in fundamental cellular processes: signal transduction, DNA repair, apoptosis, and multiple metabolic pathways. There was a group of genes directly related to immune and inflammatory responses (IL7R, granulysin, proteasome activator subunit 2, peroxiredoxin 4, HLADRA, lymphocyte antigen 75, IL18R and DOCK2 genes). Among these genes only one (IL7R) was upregulated, the rest were downregulated. The upregulation of the IL7 receptor gene was confirmed by RT PCR. Three genes with altered

  17. Immune Response in Thyroid Cancer: Widening the Boundaries

    PubMed Central

    Ward, Laura Sterian


    The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756

  18. Innate immune responses in raccoons after raccoon rabies virus infection.


    Srithayakumar, Vythegi; Sribalachandran, Hariharan; Rosatte, Rick; Nadin-Davis, Susan A; Kyle, Christopher J


    Zoonotic wildlife diseases pose significant health risks not only to their primary vectors but also to humans and domestic animals. Rabies is a lethal encephalitis caused by rabies virus (RV). This RNA virus can infect a range of terrestrial mammals but each viral variant persists in a particular reservoir host. Active management of these host vectors is needed to minimize the negative impacts of this disease, and an understanding of the immune response to RV infection aids strategies for host vaccination. Current knowledge of immune responses to RV infection comes primarily from rodent models in which an innate immune response triggers activation of several genes and signalling pathways. It is unclear, however, how well rodent models represent the immune response of natural hosts. This study investigates the innate immune response of a primary host, the raccoon, to a peripheral challenge using the raccoon rabies virus (RRV). The extent and temporal course of this response during RRV infection was analysed using genes predicted to be upregulated during infection (IFNs; IFN regulatory factors; IL-6; Toll like receptor-3; TNF receptor). We found that RRV activated components of the innate immune system, with changes in levels of transcripts correlated with presence of viral RNA. Our results suggest that natural reservoirs of rabies may not mimic the immune response triggered in rodent models, highlighting the need for further studies of infection in primary hosts.

  19. PDT-apoptotic tumor cells induce macrophage immune response

    NASA Astrophysics Data System (ADS)

    Zhou, Fei-fan; Xing, Da; Chen, Wei R.


    Photodynamic therapy (PDT) functions as a cancer therapy through two major cell death mechanisms: apoptosis and necrosis. Immunological responses induced by PDT has been mainly associated with necrosis while apoptosis associated immune responses have not fully investigated. Heat shock proteins (HSPs) play an important role in regulating immune responses. In present study, we studied whether apoptotic tumor cells could induce immune response and how the HSP70 regulates immune response. The endocytosis of tumor cells by the activated macrophages was observed at single cell level by LSM. The TNF-α release of macrophages induced by co-incubated with PDT-apoptotic tumor cells was detected by ELISA. We found that apoptotic tumor cells treated by PDT could activate the macrophages, and the immune effect decreased evidently when HSP70 was blocked. These findings not only show that apoptosis can induce immunological responses, but also show HSP70 may serves as a danger signal for immune cells and induce immune responses to regulate the efficacy of PDT.

  20. [Immune response in the pathogenesis of hepatitis C virus infection].


    Chalupa, P; Holub, M; Davidová, A; Arientová, S; Beran, O


    The pathogenesis of hepatitis C virus (HCV) infection is regulated by the host immunity and several metabolic factors affecting liver metabolism, including oxidative stress, insulin resistance, and hepatic steatosis. Both innate and adaptive immunity play an important role in HCV infection. Cytotoxic lymphocytes have a crucial role in viral eradication or viral persistence. Major cause of viral persistence during HCV infection could be the development of a weak antiviral immune response to the viral antigens, with corresponding inability to eradicate infected cells.

  1. Transcriptional analysis of the innate immune response using the avian innate immunity microarray

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The avian innate immunity microarray (AIIM) is a genomics tool designed to study the transcriptional activity of the avian immune response (Cytogenet. Genome Res. 117:139-145, 2007). It is an avian cDNA microarray representing 4,959 avian genes spotted in triplicate. The AIIM contains 25 avian int...

  2. Fallen Angels or Risen Apes? A Tale of the Intricate Complexities of Imbalanced Immune Responses in the Pathogenesis and Progression of Immune-Mediated and Viral Cancers

    PubMed Central

    Ondondo, Beatrice Omusiro


    Excessive immune responses directed against foreign pathogens, self-antigens, or commensal microflora can cause cancer establishment and progression if the execution of tight immuno-regulatory mechanisms fails. On the other hand, induction of potent tumor antigen-specific immune responses together with stimulation of the innate immune system is a pre-requisite for effective anti-tumor immunity, and if suppressed by the strong immuno-regulatory mechanisms can lead to cancer progression. Therefore, it is crucial that the inevitable co-existence of these fundamental, yet conflicting roles of immune-regulatory cells is carefully streamlined as imbalances can be detrimental to the host. Infection with chronic persistent viruses is characterized by severe immune dysfunction resulting in T cell exhaustion and sometimes deletion of antigen-specific T cells. More often, this is due to increased immuno-regulatory processes, which are triggered to down-regulate immune responses and limit immunopathology. However, such heightened levels of immune disruption cause a concomitant loss of tumor immune-surveillance and create a permissive microenvironment for cancer establishment and progression, as demonstrated by increased incidences of cancer in immunosuppressed hosts. Paradoxically, while some cancers arise as a consequence of increased immuno-regulatory mechanisms that inhibit protective immune responses and impinge on tumor surveillance, other cancers arise due to impaired immuno-regulatory mechanisms and failure to limit pathogenic inflammatory responses. This intricate complexity, where immuno-regulatory cells can be beneficial in certain immune settings but detrimental in other settings underscores the need for carefully formulated interventions to equilibrate the balance between immuno-stimulatory and immuno-regulatory processes. PMID:24639678

  3. Augmenting Antitumor Immune Responses with Epigenetic Modifying Agents

    PubMed Central

    Héninger, Erika; Krueger, Timothy E. G.; Lang, Joshua M.


    Epigenetic silencing of immune-related genes is a striking feature of the cancer genome that occurs in the process of tumorigenesis. This phenomena impacts antigen processing and antigen presentation by tumor cells and facilitates evasion of immunosurveillance. Further modulation of the tumor microenvironment by altered expression of immunosuppressive cytokines impairs antigen-presenting cells and cytolytic T-cell function. The potential reversal of immunosuppression by epigenetic modulation is therefore a promising and versatile therapeutic approach to reinstate endogenous immune recognition and tumor lysis. Pre-clinical studies have identified multiple elements of the immune system that can be modulated by epigenetic mechanisms and result in improved antigen presentation, effector T-cell function, and breakdown of suppressor mechanisms. Recent clinical studies are utilizing epigenetic therapies prior to, or in combination with, immune therapies to improve clinical outcomes. PMID:25699047

  4. Incomplete immune response to coxsackie B viruses associates with early autoimmunity against insulin

    PubMed Central

    Ashton, Michelle P.; Eugster, Anne; Walther, Denise; Daehling, Natalie; Riethausen, Stephanie; Kuehn, Denise; Klingel, Karin; Beyerlein, Andreas; Zillmer, Stephanie; Ziegler, Anette-Gabriele; Bonifacio, Ezio


    Viral infections are associated with autoimmunity in type 1 diabetes. Here, we asked whether this association could be explained by variations in host immune response to a putative type 1 etiological factor, namely coxsackie B viruses (CVB). Heterogeneous antibody responses were observed against CVB capsid proteins. Heterogeneity was largely defined by different binding to VP1 or VP2. Antibody responses that were anti-VP2 competent but anti-VP1 deficient were unable to neutralize CVB, and were characteristic of children who developed early insulin-targeting autoimmunity, suggesting an impaired ability to clear CVB in early childhood. In contrast, children who developed a GAD-targeting autoimmunity had robust VP1 and VP2 antibody responses to CVB. We further found that 20% of memory CD4+ T cells responding to the GAD65247-266 peptide share identical T cell receptors to T cells responding to the CVB4 p2C30-51 peptide, thereby providing direct evidence for the potential of molecular mimicry as a mechanism for GAD autoimmunity. Here, we highlight functional immune response differences between children who develop insulin-targeting and GAD-targeting autoimmunity, and suggest that children who lose B cell tolerance to insulin within the first years of life have a paradoxical impaired ability to mount humoral immune responses to coxsackie viruses. PMID:27604323

  5. Metabolic and immune impairments induced by the endocrine disruptors benzo[a]pyrene and triclosan in Xenopus tropicalis.


    Regnault, Christophe; Willison, John; Veyrenc, Sylvie; Airieau, Antinéa; Méresse, Patrick; Fortier, Marlène; Fournier, Michel; Brousseau, Pauline; Raveton, Muriel; Reynaud, Stéphane


    Despite numerous studies suggesting that amphibians are highly sensitive to cumulative anthropogenic stresses, the role played by endocrine disruptors (EDs) in the decline of amphibian populations remains unclear. EDs have been extensively studied in adult amphibians for their capacity to disturb reproduction by interfering with the sexual hormone axis. Here, we studied the in vivo responses of Xenopus tropicalis males exposed to environmentally relevant concentrations of each ED, benzo[a]pyrene (BaP) and triclosan (TCS) alone (10 μg L(-1)) or a mixture of the two (10 μg L(-1) each) over a 24 h exposure period by following the modulation of the transcription of key genes involved in metabolic, sexual and immunity processes and the cellular changes in liver, spleen and testis. BaP, TCS and the mixture of the two all induced a marked metabolic disorder in the liver highlighted by insulin resistance-like and non-alcoholic fatty liver disease (NAFLD)-like phenotypes together with hepatotoxicity due to the impairment of lipid metabolism. For TCS and the mixture, these metabolic disorders were concomitant with modulation of innate immunity. These results confirmed that in addition to the reproductive effects induced by EDs in amphibians, metabolic disorders and immune system disruption should also be considered.

  6. TNF Drives Monocyte Dysfunction with Age and Results in Impaired Anti-pneumococcal Immunity.


    Puchta, Alicja; Naidoo, Avee; Verschoor, Chris P; Loukov, Dessi; Thevaranjan, Netusha; Mandur, Talveer S; Nguyen, Phuong-Son; Jordana, Manel; Loeb, Mark; Xing, Zhou; Kobzik, Lester; Larché, Maggie J; Bowdish, Dawn M E


    Monocyte phenotype and output changes with age, but why this occurs and how it impacts anti-bacterial immunity are not clear. We found that, in both humans and mice, circulating monocyte phenotype and function was altered with age due to increasing levels of TNF in the circulation that occur as part of the aging process. Ly6C+ monocytes from old (18-22 mo) mice and CD14+CD16+ intermediate/inflammatory monocytes from older adults also contributed to this "age-associated inflammation" as they produced more of the inflammatory cytokines IL6 and TNF in the steady state and when stimulated with bacterial products. Using an aged mouse model of pneumococcal colonization we found that chronic exposure to TNF with age altered the maturity of circulating monocytes, as measured by F4/80 expression, and this decrease in monocyte maturation was directly linked to susceptibility to infection. Ly6C+ monocytes from old mice had higher levels of CCR2 expression, which promoted premature egress from the bone marrow when challenged with Streptococcus pneumoniae. Although Ly6C+ monocyte recruitment and TNF levels in the blood and nasopharnyx were higher in old mice during S. pneumoniae colonization, bacterial clearance was impaired. Counterintuitively, elevated TNF and excessive monocyte recruitment in old mice contributed to impaired anti-pneumococcal immunity since bacterial clearance was improved upon pharmacological reduction of TNF or Ly6C+ monocytes, which were the major producers of TNF. Thus, with age TNF impairs inflammatory monocyte development, function and promotes premature egress, which contribute to systemic inflammation and is ultimately detrimental to anti-pneumococcal immunity.

  7. Chemical Tools To Monitor and Manipulate Adaptive Immune Responses.


    Doran, Todd M; Sarkar, Mohosin; Kodadek, Thomas


    Methods to monitor and manipulate the immune system are of enormous clinical interest. For example, the development of vaccines represents one of the earliest and greatest accomplishments of the biomedical research enterprise. More recently, drugs capable of "reawakening" the immune system to cancer have generated enormous excitement. But, much remains to be done. All drugs available today that manipulate the immune system cannot distinguish between "good" and "bad" immune responses and thus drive general and systemic immune suppression or activation. Indeed, with the notable exception of vaccines, our ability to monitor and manipulate antigen-specific immune responses is in its infancy. Achieving this finer level of control would be highly desirable. For example, it might allow the pharmacological editing of pathogenic immune responses without restricting the ability of the immune system to defend against infection. On the diagnostic side, a method to comprehensively monitor the circulating, antigen-specific antibody population could provide a treasure trove of clinically useful biomarkers, since many diseases expose the immune system to characteristic molecules that are deemed foreign and elicit the production of antibodies against them. This Perspective will discuss the state-of-the-art of this area with a focus on what we consider seminal opportunities for the chemistry community to contribute to this important field.

  8. Depressed immunity and impaired proliferation of hematopoietic progenitor cells in patients with complete spinal cord injury.


    Iversen, P O; Hjeltnes, N; Holm, B; Flatebo, T; Strom-Gundersen, I; Ronning, W; Stanghelle, J; Benestad, H B


    The bone marrow is supplied with both sensory and autonomic neurons, but their roles in regulating hematopoietic and immunocompetent cells are unknown. Leukocyte growth and activity in patients with stable and complete spinal cord injuries were studied. The innervation of the bone marrow below the injury level lacked normal supraspinal activity, that is, a decentralized bone marrow. Lymphocyte functions were markedly decreased in injured patients. Long-term colony formation of all hematopoietic cell lineages, including dendritic cells, by decentralized bone marrow cells was substantially reduced. It was concluded that nonspecific and adaptive lymphocyte-mediated immunity and growth of early hematopoietic progenitor cells are impaired in patients with spinal cord injuries. Possibly, this reflects cellular defects caused by the malfunctioning neuronal regulation of immune and bone marrow function.

  9. Interferon regulatory factor 3 in adaptive immune responses.


    Ysebrant de Lendonck, Laure; Martinet, Valerie; Goriely, Stanislas


    Interferon regulatory factor (IRF) 3 plays a key role in innate responses against viruses. Indeed, activation of this transcription factor triggers the expression of type I interferons and downstream interferon-stimulated genes in infected cells. Recent evidences indicate that this pathway also modulates adaptive immune responses. This review focuses on the different mechanisms that are implicated in this process. We discuss the role of IRF3 within antigen-presenting cells and T lymphocytes in the polarization of the cellular immune response and its implication in the pathogenesis of immune disorders.

  10. Global analysis of the immune response

    NASA Astrophysics Data System (ADS)

    Ribeiro, Leonardo C.; Dickman, Ronald; Bernardes, Américo T.


    The immune system may be seen as a complex system, characterized using tools developed in the study of such systems, for example, surface roughness and its associated Hurst exponent. We analyze densitometric (Panama blot) profiles of immune reactivity, to classify individuals into groups with similar roughness statistics. We focus on a population of individuals living in a region in which malaria endemic, as well as a control group from a disease-free region. Our analysis groups individuals according to the presence, or absence, of malaria symptoms and number of malaria manifestations. Applied to the Panama blot data, our method proves more effective at discriminating between groups than principal-components analysis or super-paramagnetic clustering. Our findings provide evidence that some phenomena observed in the immune system can be only understood from a global point of view. We observe similar tendencies between experimental immune profiles and those of artificial profiles, obtained from an immune network model. The statistical entropy of the experimental profiles is found to exhibit variations similar to those observed in the Hurst exponent.

  11. Cervical Carcinogenesis and Immune Response Gene Polymorphisms: A Review

    PubMed Central

    Mooij, Merel


    The local immune response is considered a key determinant in cervical carcinogenesis after persistent infection with oncogenic, high-risk human papillomavirus (HPV) infections. Genetic variation in various immune response genes has been shown to influence risk of developing cervical cancer, as well as progression and survival among cervical cancer patients. We reviewed the literature on associations of immunogenetic single nucleotide polymorphism, allele, genotype, and haplotype distributions with risk and progression of cervical cancer. Studies on HLA and KIR gene polymorphisms were excluded due to the abundance on literature on that subject. We show that multiple genes and loci are associated with variation in risk of cervical cancer. Rather than one single gene being responsible for cervical carcinogenesis, we postulate that variations in the different immune response genes lead to subtle differences in the effectiveness of the antiviral and antitumour immune responses, ultimately leading to differences in risk of developing cervical cancer and progressive disease after HPV infection. PMID:28280748

  12. Apoptosis and other immune biomarkers predict influenza vaccine responsiveness

    PubMed Central

    Furman, David; Jojic, Vladimir; Kidd, Brian; Shen-Orr, Shai; Price, Jordan; Jarrell, Justin; Tse, Tiffany; Huang, Huang; Lund, Peder; Maecker, Holden T; Utz, Paul J; Dekker, Cornelia L; Koller, Daphne; Davis, Mark M


    Despite the importance of the immune system in many diseases, there are currently no objective benchmarks of immunological health. In an effort to identifying such markers, we used influenza vaccination in 30 young (20–30 years) and 59 older subjects (60 to >89 years) as models for strong and weak immune responses, respectively, and assayed their serological responses to influenza strains as well as a wide variety of other parameters, including gene expression, antibodies to hemagglutinin peptides, serum cytokines, cell subset phenotypes and in vitro cytokine stimulation. Using machine learning, we identified nine variables that predict the antibody response with 84% accuracy. Two of these variables are involved in apoptosis, which positively associated with the response to vaccination and was confirmed to be a contributor to vaccine responsiveness in mice. The identification of these biomarkers provides new insights into what immune features may be most important for immune health. PMID:23591775

  13. Tissue engineering tools for modulation of the immune response

    PubMed Central

    Boehler, Ryan M.; Graham, John G.; Shea, Lonnie D.


    Tissue engineering scaffolds have emerged as a powerful tool within regenerative medicine. These materials are being designed to create environments that promote regeneration through a combination of: (i) scaffold architecture, (ii) the use of scaffolds as vehicles for transplanting progenitor cells, and/or (iii) localized delivery of inductive factors or genes encoding for these inductive factors. This review describes the techniques associated with each of these components. Additionally, the immune response is increasingly recognized as a factor influencing regeneration. The immune reaction to an implant begins with an acute response to the injury and innate recognition of foreign materials, with the subsequent chronic immune response involving specific recognition of antigens (e.g., transplanted cells) by the adaptive immune response, which can eventually lead to rejection of the implant. Thus, we also describe the impact of each component on the immune response, and strategies (e.g., material design, anti-inflammatory cytokine delivery, and immune cell recruitment/transplantation) to modulate, yet not eliminate, the local immune response in order to promote regeneration, which represents another important tool for regenerative medicine. PMID:21988690

  14. Subversion of the Immune Response by Rabies Virus.


    Scott, Terence P; Nel, Louis H


    Rabies has affected mankind for several centuries and is one of the oldest known zoonoses. It is peculiar how little is known regarding the means by which rabies virus (RABV) evades the immune response and kills its host. This review investigates the complex interplay between RABV and the immune system, including the various means by which RABV evades, or advantageously utilizes, the host immune response in order to ensure successful replication and spread to another host. Different factors that influence immune responses-including age, sex, cerebral lateralization and temperature-are discussed, with specific reference to RABV and the effects on host morbidity and mortality. We also investigate the role of apoptosis and discuss whether it is a detrimental or beneficial mechanism of the host's response to infection. The various RABV proteins and their roles in immune evasion are examined in depth with reference to important domains and the downstream effects of these interactions. Lastly, an overview of the means by which RABV evades important immune responses is provided. The research discussed in this review will be important in determining the roles of the immune response during RABV infections as well as to highlight important therapeutic target regions and potential strategies for rabies treatment.

  15. Immune and stress responses in oysters with insights on adaptation.


    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude


    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments.

  16. Photodynamic therapy and immune response in tumor-bearing mice

    NASA Astrophysics Data System (ADS)

    Canti, Gianfranco L.; Cubeddu, Rinaldo; Taroni, Paola; Valentini, Gianluca


    Since immune response of the host is important in the control of tumor growth and spreading, and the Photodynamic therapy (PDT) is able to increase the antitumor immunity, in our laboratory we examine the effect of PDT on immune compartment of tumor bearing mice. Lymphocytes and macrophages collected from tumor bearing mice pretreated with PDT are cytotoxic in vitro and in vivo against the parental tumor lines, in contrast the same immune cells population collected from tumor bearing mice pretreated only with laser light are unable to lyse the parental tumor cells. In adoptive immunotherapy experiments, treatment of mice bearing MS-2 tumor with adoptive transfer of immune lymphocytes collected from mice pretreated with PDT is able to significantly increase the survival time; in contrast the lymphocytes collected from mice pretreated only with laser light were not able to modify the survival time suggesting that the laser treatment alone did not increase the immune response of the host. In conclusion these results demonstrate that the PDT induce a strong immune response on the host and the stimulated lymphocytes generated could be used for an adoptive immunotherapy approach; moreover laser treatment alone (thermal effect) is unable to modulate the immune response of the host.

  17. European Sea Bass (Dicentrarchus labrax) Immune Status and Disease Resistance Are Impaired by Arginine Dietary Supplementation

    PubMed Central

    Azeredo, Rita; Pérez-Sánchez, Jaume; Sitjà-Bobadilla, Ariadna; Fouz, Belén; Tort, Lluis; Aragão, Cláudia; Oliva-Teles, Aires; Costas, Benjamín


    Infectious diseases and fish feeds management are probably the major expenses in the aquaculture business. Hence, it is a priority to define sustainable strategies which simultaneously avoid therapeutic procedures and reinforce fish immunity. Currently, one preferred approach is the use of immunostimulants which can be supplemented to the fish diets. Arginine is a versatile amino acid with important mechanisms closely related to the immune response. Aiming at finding out how arginine affects the innate immune status or improve disease resistance of European seabass (Dicentrarchus labrax) against vibriosis, fish were fed two arginine-supplemented diets (1% and 2% arginine supplementation). A third diet meeting arginine requirement level for seabass served as control diet. Following 15 or 29 days of feeding, fish were sampled for blood, spleen and gut to assess cell-mediated immune parameters and immune-related gene expression. At the same time, fish from each dietary group were challenged against Vibrio anguillarum and survival was monitored. Cell-mediated immune parameters such as the extracellular superoxide and nitric oxide decreased in fish fed arginine-supplemented diets. Interleukins and immune-cell marker transcripts were down-regulated by the highest supplementation level. Disease resistance data were in accordance with a generally depressed immune status, with increased susceptibility to vibriosis in fish fed arginine supplemented diets. Altogether, these results suggest a general inhibitory effect of arginine on the immune defences and disease resistance of European seabass. Still, further research will certainly clarify arginine immunomodulation pathways thereby allowing the validation of its potential as a prophylactic strategy. PMID:26447480

  18. Selective ablation of lung epithelial IKK2 impairs pulmonary Th17 responses and delays the clearance of Pneumocystis.


    Perez-Nazario, Nelissa; Rangel-Moreno, Javier; O'Reilly, Michael A; Pasparakis, Manolis; Gigliotti, Francis; Wright, Terry W


    Pneumocystis is an atypical fungal pathogen that causes severe, often fatal pneumonia in immunocompromised patients. Healthy humans and animals also encounter this pathogen, but they generate a protective CD4(+) T cell-dependent immune response that clears the pathogen with little evidence of disease. Pneumocystis organisms attach tightly to respiratory epithelial cells, and in vitro studies have demonstrated that this interaction triggers NF-κB-dependent epithelial cell responses. However, the contribution of respiratory epithelial cells to the normal host response to Pneumocystis remains unknown. IκB kinase 2 (IKK2) is the upstream kinase that is critical for inducible NF-κB activation. To determine whether IKK2-dependent lung epithelial cell (LEC) responses contribute to the anti-Pneumocystis immune response in vivo, transgenic mice with LEC-specific deletion of IKK2 (IKK2(ΔLEC)) were generated. Compared to wild-type mice, IKK2(ΔLEC) mice exhibited a delayed onset of Th17 and B cell responses in the lung and delayed fungal clearance. Importantly, delayed Pneumocystis clearance in IKK2(ΔLEC) mice was associated with an exacerbated immune response, impaired pulmonary function, and altered lung histology. These data demonstrate that IKK2-dependent LEC responses are important regulators of pulmonary adaptive immune responses and are required for optimal host defense against Pneumocystis infection. LECs likely set the threshold for initiation of the pulmonary immune response and serve to prevent exacerbated lung inflammation by promoting the rapid control of respiratory fungal infection.

  19. Subversion of the Immune Response by Rabies Virus

    PubMed Central

    Scott, Terence P.; Nel, Louis H.


    Rabies has affected mankind for several centuries and is one of the oldest known zoonoses. It is peculiar how little is known regarding the means by which rabies virus (RABV) evades the immune response and kills its host. This review investigates the complex interplay between RABV and the immune system, including the various means by which RABV evades, or advantageously utilizes, the host immune response in order to ensure successful replication and spread to another host. Different factors that influence immune responses—including age, sex, cerebral lateralization and temperature—are discussed, with specific reference to RABV and the effects on host morbidity and mortality. We also investigate the role of apoptosis and discuss whether it is a detrimental or beneficial mechanism of the host’s response to infection. The various RABV proteins and their roles in immune evasion are examined in depth with reference to important domains and the downstream effects of these interactions. Lastly, an overview of the means by which RABV evades important immune responses is provided. The research discussed in this review will be important in determining the roles of the immune response during RABV infections as well as to highlight important therapeutic target regions and potential strategies for rabies treatment. PMID:27548204

  20. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    PubMed Central

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas


    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses. PMID:24213131

  1. DNA-mediated immunization and the energetic immune response to hepatitis B surface antigen.


    Whalen, R G; Davis, H L


    A new and unusual approach for evoking an immune response has recently been introduced--that of DNA-based immunization. Purified plasmid DNA, containing protein coding sequences and the necessary regulatory elements to express them, can be introduced into tissues of the organism by means of a parenteral injection or by particle bombardment. The number of cells transfected and the amount of protein produced is sufficient to produce a remarkably strong and broad-based immune response to a wide variety of foreign proteins. The absence of an exogenous infectious agent or immunogen results in the abrupt appearance of a foreign protein within the normal cells of an immunologically mature and healthy animal and provokes an energetic and efficient reaction to this form of antigen presentation. This review summarizes the results obtained with the various experimental models that have been described to date and considers in greater depth the immune response to the surface antigen of the human hepatitis B virus that has been achieved using DNA-based immunization. Several issues are addressed in a prospective manner in order to anticipate some future developments and to point out topics likely to be pertinent to this field. DNA-mediated induction of immune responses may soon be applied as a form of therapeutic treatment. Although this method may constitute a revolution for vaccination, many issues must first be dealt with, especially concerning the safety of using DNA as an immunizing molecule.

  2. Taenia solium: immune response against oral or systemic immunization with purified recombinant calreticulin in mice.


    Fonseca-Coronado, Salvador; Ruiz-Tovar, Karina; Pérez-Tapia, Mayra; Mendlovic, Fela; Flisser, Ana


    Recombinant functional Taenia solium calreticulin (rTsCRT) confers different degrees of protection in the experimental model of intestinal taeniosis in hamsters. The aim of this study was to evaluate the immune response induced after oral or systemic immunization with an electroeluted rTsCRT in BALB/c mice. Oral immunization elicited high fecal IgA and the production of IL-4 and IL-5 by mesenteric lymph node cells after in vitro stimulation with rTSCRT, indicating a Th2 response. Mice subcutaneously immunized produced high amounts of serum IgG, being IgG1 (Th2-related) the predominant isotype, while in vitro stimulated spleen cells synthesized IL-4, IL-5 and also IFN-γ, indicating a mixed Th1/Th2 cellular response after systemic immunization. Our data show that purified rTsCRT induces polarized Th2 responses after oral immunization of mice, a common characteristic of protective immunity against helminths and, consequently, a desirable hallmark in the search for a vaccine.

  3. Immune Activation and Bacterial Translocation: A Link between Impaired Immune Recovery and Frequent Visceral Leishmaniasis Relapses in HIV-Infected Patients.


    Silva-Freitas, Maria Luciana; Cota, Glaucia Fernandes; Machado-de-Assis, Talia S; Giacoia-Gripp, Carmem; Rabello, Ana; Da-Cruz, Alda M; Santos-Oliveira, Joanna R


    The maintenance of chronic immune activation due to leishmaniasis or even due to microbial translocation is associated with immunosenescence and may contribute to frequent relapses. Our aim was to investigate whether patients with HIV-associated visceral leishmaniasis (VL/HIV) who experience a single episode of VL have different immunological behaviors in comparison to those who experience frequent relapses. VL/HIV patients were allocated to non-relapsing (NR, n = 6) and relapsing (R, n = 11) groups and were followed from the active phase of VL up to 12 months post-treatment (mpt). The patients were receiving highly active antiretroviral therapy (HAART) and secondary prophylaxis after VL therapy. During active VL, the two groups were similar in all immunological parameters, including the parasite load. At 6 and 12 mpt, the NR group showed a significant gain of CD4+ T cells, a reduction of lymphocyte activation, and lower soluble CD14 and anti-Leishmania IgG3 levels compared to the R group. The viral load remained low, without correlation with the activation. The two groups showed elevated but similar percentages of senescent T cells. These findings suggest a decreased ability of the R group to downmodulate immune activation compared to the NR group. Such functional impairment of the effector response may be a useful indicator for predicting clinical prognosis and recommending starting or stopping secondary prophylaxis.

  4. Immune Activation and Bacterial Translocation: A Link between Impaired Immune Recovery and Frequent Visceral Leishmaniasis Relapses in HIV-Infected Patients

    PubMed Central

    Machado-de-Assis, Talia S.; Giacoia-Gripp, Carmem; Rabello, Ana; Da-Cruz, Alda M.; Santos-Oliveira, Joanna R.


    The maintenance of chronic immune activation due to leishmaniasis or even due to microbial translocation is associated with immunosenescence and may contribute to frequent relapses. Our aim was to investigate whether patients with HIV-associated visceral leishmaniasis (VL/HIV) who experience a single episode of VL have different immunological behaviors in comparison to those who experience frequent relapses. VL/HIV patients were allocated to non-relapsing (NR, n = 6) and relapsing (R, n = 11) groups and were followed from the active phase of VL up to 12 months post-treatment (mpt). The patients were receiving highly active antiretroviral therapy (HAART) and secondary prophylaxis after VL therapy. During active VL, the two groups were similar in all immunological parameters, including the parasite load. At 6 and 12 mpt, the NR group showed a significant gain of CD4+ T cells, a reduction of lymphocyte activation, and lower soluble CD14 and anti-Leishmania IgG3 levels compared to the R group. The viral load remained low, without correlation with the activation. The two groups showed elevated but similar percentages of senescent T cells. These findings suggest a decreased ability of the R group to downmodulate immune activation compared to the NR group. Such functional impairment of the effector response may be a useful indicator for predicting clinical prognosis and recommending starting or stopping secondary prophylaxis. PMID:27907136

  5. Cutting edge: DNAX accessory molecule 1-deficient CD8+ T cells display immunological synapse defects that impair antitumor immunity.


    Ramsbottom, Kelly M; Hawkins, Edwin D; Shimoni, Raz; McGrath, Mairi; Chan, Christopher J; Russell, Sarah M; Smyth, Mark J; Oliaro, Jane


    DNAX accessory molecule 1 (DNAM-1) is expressed on all CD8(+) T cells and promotes their activation and effector function. DNAM-1 interacts with LFA-1, a critical molecule for immunological synapse formation between T cells and APCs, and for cytotoxic killing of target cells. Mice that lack DNAM-1 display abnormal T cell responses and antitumor activity; however, the mechanism involved is unclear. In this article, we show that DNAM-1 deficiency results in reduced proliferation of CD8(+) T cells after Ag presentation and impaired cytotoxic activity. We also demonstrate that DNAM-1-deficient T cells show reduced conjugations with tumor cells and decreased recruitment of both LFA-1 and lipid rafts to the immunological synapse, which correlates with reduced tumor cell killing in vitro. This synapse defect may explain why DNAM-1-deficient mice cannot clear tumors in vivo, and highlights the importance of DNAM-1 and the immunological synapse in T cell-mediated antitumor immunity.

  6. Virus-like nanostructures for tuning immune response

    NASA Astrophysics Data System (ADS)

    Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.


    Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.

  7. Virus-like nanostructures for tuning immune response

    PubMed Central

    Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.


    Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system. PMID:26577983

  8. Impaired immune tolerance to Porphyromonas gingivalis lipopolysaccharide promotes neutrophil migration and decreased apoptosis.


    Zaric, Svetislav; Shelburne, Charles; Darveau, Richard; Quinn, Derek J; Weldon, Sinéad; Taggart, Clifford C; Coulter, Wilson A


    Periodontitis, a chronic inflammatory disease of the tissues supporting the teeth, is characterized by an exaggerated host immune and inflammatory response to periopathogenic bacteria. Toll-like receptor activation, cytokine network induction, and accumulation of neutrophils at the site of inflammation are important in the host defense against infection. At the same time, induction of immune tolerance and the clearance of neutrophils from the site of infection are essential in the control of the immune response, resolution of inflammation, and prevention of tissue destruction. Using a human monocytic cell line, we demonstrate that Porphyromonas gingivalis lipopolysaccharide (LPS), which is a major etiological factor in periodontal disease, induces only partial immune tolerance, with continued high production of interleukin-8 (IL-8) but diminished secretion of tumor necrosis factor alpha (TNF-α) after repeated challenge. This cytokine response has functional consequences for other immune cells involved in the response to infection. Primary human neutrophils incubated with P. gingivalis LPS-treated naïve monocyte supernatant displayed a high migration index and increased apoptosis. In contrast, neutrophils treated with P. gingivalis LPS-tolerized monocyte supernatant showed a high migration index but significantly decreased apoptosis. Overall, these findings suggest that induction of an imbalanced immune tolerance in monocytes by P. gingivalis LPS, which favors continued secretion of IL-8 but decreased TNF-α production, may be associated with enhanced migration of neutrophils to the site of infection but also with decreased apoptosis and may play a role in the chronic inflammatory state seen in periodontal disease.

  9. Transcriptional Profiling of the Immune Response to Marburg Virus Infection

    PubMed Central

    Yen, Judy; Caballero, Ignacio S.; Garamszegi, Sara; Malhotra, Shikha; Lin, Kenny; Hensley, Lisa; Goff, Arthur J.


    ABSTRACT Marburg virus is a genetically simple RNA virus that causes a severe hemorrhagic fever in humans and nonhuman primates. The mechanism of pathogenesis of the infection is not well understood, but it is well accepted that pathogenesis is appreciably driven by a hyperactive immune response. To better understand the overall response to Marburg virus challenge, we undertook a transcriptomic analysis of immune cells circulating in the blood following aerosol exposure of rhesus macaques to a lethal dose of Marburg virus. Using two-color microarrays, we analyzed the transcriptomes of peripheral blood mononuclear cells that were collected throughout the course of infection from 1 to 9 days postexposure, representing the full course of the infection. The response followed a 3-stage induction (early infection, 1 to 3 days postexposure; midinfection, 5 days postexposure; late infection, 7 to 9 days postexposure) that was led by a robust innate immune response. The host response to aerosolized Marburg virus was evident at 1 day postexposure. Analysis of cytokine transcripts that were overexpressed during infection indicated that previously unanalyzed cytokines are likely induced in response to exposure to Marburg virus and further suggested that the early immune response is skewed toward a Th2 response that would hamper the development of an effective antiviral immune response early in disease. Late infection events included the upregulation of coagulation-associated factors. These findings demonstrate very early host responses to Marburg virus infection and provide a rich data set for identification of factors expressed throughout the course of infection that can be investigated as markers of infection and targets for therapy. IMPORTANCE Marburg virus causes a severe infection that is associated with high mortality and hemorrhage. The disease is associated with an immune response that contributes to the lethality of the disease. In this study, we investigated how the

  10. Proteomic contributions to our understanding of vaccine and immune responses

    PubMed Central

    Galassie, Allison C.; Link, Andrew J.


    Vaccines are one of the greatest public health successes; yet, due to the empirical nature of vaccine design, we have an incomplete understanding of how the genes and proteins induced by vaccines contribute to the development of both protective innate and adaptive immune responses. While the advent of genomics has enabled new vaccine development and facilitated understanding of the immune response, proteomics identifies potentially new vaccine antigens with increasing speed and sensitivity. In addition, as proteomics is complementary to transcriptomic approaches, a combination of both approaches provides a more comprehensive view of the immune response after vaccination via systems vaccinology. This review details the advances that proteomic strategies have made in vaccine development and reviews how proteomics contributes to the development of a more complete understanding of human vaccines and immune responses. PMID:26172619

  11. Type I Interferon Impairs Specific Antibody Responses Early during Establishment of LCMV Infection

    PubMed Central

    Daugan, Matthieu; Murira, Armstrong; Mindt, Barbara C.; Germain, Amélie; Tarrab, Esther; Lapierre, Pascal; Fritz, Jörg H.; Lamarre, Alain


    Elicitation of type I interferon (IFN-I) has been shown to both enhance and impair cell-mediated immune responses in acute and persistent viral infections, respectively. Here, we show that, in addition to its effect on T cells, IFN-I drives impairment of specific antibody responses through interaction with B cells in the acute phase of lymphocytic choriomeningitis virus (LCMV) infection. This impairment was limited to the T cell-dependent B cell response and was associated with disruption of B cell follicles, development of hypergammaglobulinemia (HGG), and expansion of the T follicular helper cell population. Antigen-specific antibody responses were restored by ablation of IFN-I signaling through antibody-mediated IFN-I receptor blockade and B cell-specific IFN-I receptor knockout. Importantly, IFN-I receptor deficiency in B cells also accelerated the development of LCMV neutralizing antibodies and alleviated HGG. These results provide a potential therapeutic target toward efficient treatment measures that limit immunopathology in persistent viral infections. PMID:27994594

  12. Different impairment of immune and inflammation functions in short and long-term after ischemic stroke

    PubMed Central

    Li, Wen-Xing; Qi, Fei; Liu, Jia-Qian; Li, Gong-Hua; Dai, Shao-Xing; Zhang, Tao; Cheng, Fei; Liu, Dahai; Zheng, Song Guo


    Ischemic stroke therapy and prognosis outcomes largely depend on the time periods after symptom onset. This study aims to explore the difference of global gene expression profiles and impairment of biological functions between short-term and long-term after stroke onset. We compared three short-term (3 h, 5 h and 24 h) and a long-term (6-month) gene expression levels by a multi-platform microarray data integration method. RankProd was used to calculate the differentially expressed genes between stroke patients and controls. DAVID Bioinformatics Resources was utilized to determine affected biological functions. Consensus cluster and hierarchical cluster methods were employed to compare the gene expression patterns of the commonly biological functions among these four time course groups. The results showed that severe impairment of inflammation and immune related functions in 5 h and 24 h after symptom onset. However, these functions were less affected in the 3 h and the 6-month groups. In addition, several key genes (CCL20, THBS1, EREG, and IL6 et al.) were dramatically down-regulated in 5 h and 24 h groups, whereas these genes showed no change or even a slight contrary expression in 3 h or 6-month groups. This study has identified the large differences of altered immune and inflammation functions based on gene levels between short and long-term after stroke onset. The findings provide valuable insight into the clinical practice and prognosis evaluation of ischemic stroke. PMID:28337302

  13. Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease

    NASA Astrophysics Data System (ADS)

    Sun, Jun; Earl, David J.; Deem, Michael W.


    The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self-antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely, gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system’s search for antibodies, a balance has evolved between binding affinity and specificity.

  14. DNA Damage Response and Immune Defense: Links and Mechanisms

    PubMed Central

    Nakad, Rania; Schumacher, Björn


    DNA damage plays a causal role in numerous human pathologies including cancer, premature aging, and chronic inflammatory conditions. In response to genotoxic insults, the DNA damage response (DDR) orchestrates DNA damage checkpoint activation and facilitates the removal of DNA lesions. The DDR can also arouse the immune system by for example inducing the expression of antimicrobial peptides as well as ligands for receptors found on immune cells. The activation of immune signaling is triggered by different components of the DDR including DNA damage sensors, transducer kinases, and effectors. In this review, we describe recent advances on the understanding of the role of DDR in activating immune signaling. We highlight evidence gained into (i) which molecular and cellular pathways of DDR activate immune signaling, (ii) how DNA damage drives chronic inflammation, and (iii) how chronic inflammation causes DNA damage and pathology in humans. PMID:27555866

  15. Heat-Based Tumor Ablation: Role of the Immune Response.


    Wu, Feng


    The ideal cancer therapy not only induces the death of all localized tumor cells with less damage to surrounding normal tissue, but also activates a systemic antitumor immunity. Heat-based tumor ablation has the potential to be such a treatment as it can minimal-invasively ablate a targeted tumor below the skin surface, and may subsequently augment host antitumor immunity. This chapter primarily introduces increasing pre-clinical and clinical evidence linking antitumor immune response to thermal tumor ablation, and then discusses the potential mechanisms involved in ablation-enhanced host antitumor immunity. The seminal studies performed so far indicate that although it is not possible to make definite conclusions on the connection between thermal ablation and antitumor immune response, it is nonetheless important to conduct extensive studies on the subject in order to elucidate the processes involved.

  16. Impaired intrinsic immunity to HSV-1 in human iPSC-derived TLR3-deficient CNS cells.


    Lafaille, Fabien G; Pessach, Itai M; Zhang, Shen-Ying; Ciancanelli, Michael J; Herman, Melina; Abhyankar, Avinash; Ying, Shui-Wang; Keros, Sotirios; Goldstein, Peter A; Mostoslavsky, Gustavo; Ordovas-Montanes, Jose; Jouanguy, Emmanuelle; Plancoulaine, Sabine; Tu, Edmund; Elkabetz, Yechiel; Al-Muhsen, Saleh; Tardieu, Marc; Schlaeger, Thorsten M; Daley, George Q; Abel, Laurent; Casanova, Jean-Laurent; Studer, Lorenz; Notarangelo, Luigi D


    In the course of primary infection with herpes simplex virus 1 (HSV-1), children with inborn errors of toll-like receptor 3 (TLR3) immunity are prone to HSV-1 encephalitis (HSE). We tested the hypothesis that the pathogenesis of HSE involves non-haematopoietic CNS-resident cells. We derived induced pluripotent stem cells (iPSCs) from the dermal fibroblasts of TLR3- and UNC-93B-deficient patients and from controls. These iPSCs were differentiated into highly purified populations of neural stem cells (NSCs), neurons, astrocytes and oligodendrocytes. The induction of interferon-β (IFN-β) and/or IFN-λ1 in response to stimulation by the dsRNA analogue polyinosinic:polycytidylic acid (poly(I:C)) was dependent on TLR3 and UNC-93B in all cells tested. However, the induction of IFN-β and IFN-λ1 in response to HSV-1 infection was impaired selectively in UNC-93B-deficient neurons and oligodendrocytes. These cells were also much more susceptible to HSV-1 infection than control cells, whereas UNC-93B-deficient NSCs and astrocytes were not. TLR3-deficient neurons were also found to be susceptible to HSV-1 infection. The rescue of UNC-93B- and TLR3-deficient cells with the corresponding wild-type allele showed that the genetic defect was the cause of the poly(I:C) and HSV-1 phenotypes. The viral infection phenotype was rescued further by treatment with exogenous IFN-α or IFN-β ( IFN-α/β) but not IFN-λ1. Thus, impaired TLR3- and UNC-93B-dependent IFN-α/β intrinsic immunity to HSV-1 in the CNS, in neurons and oligodendrocytes in particular, may underlie the pathogenesis of HSE in children with TLR3-pathway deficiencies.

  17. [Defects in immune system response by our organisms].


    Español, Teresa


    When some of the mechanisms in our immune response system fail, this can be due to external problems such as infections or transplants or due to congenital errors, known as Primary Immunologic Deficiencies. Dr. Español briefly reviews the most important characteristics of our immune response system, and then continues with an analysis of the defects of this system, especially those defects which are classified as Primary Immunologic Deficiencies.

  18. Constant illumination reduces circulating melatonin and impairs immune function in the cricket Teleogryllus commodus.


    Durrant, Joanna; Michaelides, Ellie B; Rupasinghe, Thusitha; Tull, Dedreia; Green, Mark P; Jones, Therésa M


    Exposure to constant light has a range of negative effects on behaviour and physiology, including reduced immune function in both vertebrates and invertebrates. It is proposed that the associated suppression of melatonin (a ubiquitous hormone and powerful antioxidant) in response to the presence of light at night could be an underlying mechanistic link driving the changes to immune function. Here, we investigated the relationship between constant illumination, melatonin and immune function, using a model invertebrate species, the Australian black field cricket, Teleogryllus commodus. Crickets were reared under either a 12 h light: 12 h dark regimen or a constant 24 h light regimen. Circulating melatonin concentration and immune function (haemocyte concentration, lytic activity and phenoloxidase (PO) activity) were assessed in individual adult crickets through the analysis of haemolymph. Constant illumination reduced melatonin and had a negative impact on haemocyte concentrations and lytic activity, but its effect on PO activity was less apparent. Our data provide the first evidence, to our knowledge, of a link between exposure to constant illumination and variation in haemocyte concentration in an invertebrate model, while also highlighting the potential complexity of the immune response following exposure to constant illumination. This study provides insight into the possible negative effect of artificial night-time lighting on the physiology of invertebrates, but whether lower and potentially more ecologically relevant levels of light at night produce comparable results, as has been reported in several vertebrate taxa, remains to be tested.

  19. Constant illumination reduces circulating melatonin and impairs immune function in the cricket Teleogryllus commodus

    PubMed Central

    Michaelides, Ellie B.; Rupasinghe, Thusitha; Tull, Dedreia; Green, Mark P.; Jones, Therésa M.


    Exposure to constant light has a range of negative effects on behaviour and physiology, including reduced immune function in both vertebrates and invertebrates. It is proposed that the associated suppression of melatonin (a ubiquitous hormone and powerful antioxidant) in response to the presence of light at night could be an underlying mechanistic link driving the changes to immune function. Here, we investigated the relationship between constant illumination, melatonin and immune function, using a model invertebrate species, the Australian black field cricket, Teleogryllus commodus. Crickets were reared under either a 12 h light: 12 h dark regimen or a constant 24 h light regimen. Circulating melatonin concentration and immune function (haemocyte concentration, lytic activity and phenoloxidase (PO) activity) were assessed in individual adult crickets through the analysis of haemolymph. Constant illumination reduced melatonin and had a negative impact on haemocyte concentrations and lytic activity, but its effect on PO activity was less apparent. Our data provide the first evidence, to our knowledge, of a link between exposure to constant illumination and variation in haemocyte concentration in an invertebrate model, while also highlighting the potential complexity of the immune response following exposure to constant illumination. This study provides insight into the possible negative effect of artificial night-time lighting on the physiology of invertebrates, but whether lower and potentially more ecologically relevant levels of light at night produce comparable results, as has been reported in several vertebrate taxa, remains to be tested. PMID:26339535

  20. Airway Epithelial Orchestration of Innate Immune Function in Response to Virus Infection. A Focus on Asthma.


    Ritchie, Andrew I; Jackson, David J; Edwards, Michael R; Johnston, Sebastian L


    Asthma is a very common respiratory condition with a worldwide prevalence predicted to increase. There are significant differences in airway epithelial responses in asthma that are of particular interest during exacerbations. Preventing exacerbations is a primary aim when treating asthma because they often necessitate unscheduled healthcare visits and hospitalizations and are a significant cause of morbidity and mortality. The most common cause of asthma exacerbations is a respiratory virus infection, of which the most likely type is rhinovirus infection. This article focuses on the role played by the epithelium in orchestrating the innate immune responses to respiratory virus infection. Recent studies show impaired bronchial epithelial cell innate antiviral immune responses, as well as augmentation of a pro-Th2 response characterized by the epithelial-derived cytokines IL-25 and IL-33, crucial in maintaining the Th2 cytokine response to virus infection in asthma. A better understanding of the mechanisms of these abnormal immune responses has the potential to lead to the development of novel therapeutic targets for virus-induced exacerbations. The aim of this article is to highlight current knowledge regarding the role of viruses and immune modulation in the asthmatic epithelium and to discuss exciting areas for future research and novel treatments.

  1. Modeling the interactions between pathogenic bacteria, bacteriophage and immune response

    NASA Astrophysics Data System (ADS)

    Leung, Chung Yin (Joey); Weitz, Joshua S.

    The prevalence of antibiotic-resistant strains of pathogenic bacteria has led to renewed interest in the use of bacteriophage (phage), or virus that infects bacteria, as a therapeutic agent against bacterial infections. However, little is known about the theoretical mechanism by which phage therapy may work. In particular, interactions between the bacteria, the phage and the host immune response crucially influences the outcome of the therapy. Few models of phage therapy have incorporated all these three components, and existing models suffer from unrealistic assumptions such as unbounded growth of the immune response. We propose a model of phage therapy with an emphasis on nonlinear feedback arising from interactions with bacteria and the immune response. Our model shows a synergistic effect between the phage and the immune response which underlies a possible mechanism for phage to catalyze the elimination of bacteria even when neither the immune response nor phage could do so alone. We study the significance of this effect for different parameters of infection and immune response, and discuss its implications for phage therapy.

  2. Advances in Overcoming Immune Responses following Hemophilia Gene Therapy

    PubMed Central

    Miao, Carol H.


    Both Clinical trials and pre-clinical experiments for hemophilia gene therapy showed that it is important to overcome potential immune responses against gene transfer vectors and/or transgene products to ensure the success of gene therapy. Recently various approaches have been investigated to prevent or modulate such responses. Gene transfer vectors have been specifically engineered and immunosuppressive regimens have been administered to avoid or manipulate the immune responses against the vectors. In order to prevent cytotoxic lymphocyte or antibody formation induced by transgene expression, novel approaches have been developed, including methods to manipulate antigen presentation, development of variant genes encoding less immunogenic proteins or gene transfer protocols to evade immune responses, as well as immunosuppressive strategies to target either T and/or B cell responses. Most of these successful protocols involve the induction of activated regulatory T cells to create a regulatory immune environment during tolerance induction. Recent development of these strategies to evade vector-specific immune responses and induce long-term immune tolerance specific to the transgene product will be discussed. PMID:22737594

  3. Circadian rhythm and the immune response: a review.


    Habbal, O A; Al-Jabri, A A


    For long, the immune system has been thought of as an effector mechanism reacting to antigenic challenge with defensive responses designed to eliminate 'foreign' material and return to a standby or surveillance mode. However, the recent concept now supported by substantial evidence suggests that immunity is not effector biased but is also a sensory organ and forms part of an integrated homeostatic network. The bidirectional information flow between the neuroendocrine and immune systems functions to maintain and protect the internal homeostasis of the organism. The paradox of this interwined function is that homeostasis may require the neuroendocrine system to work for or against the immune system, as is the case in infection. Potential dangers necessitate activation of the immune system, and such a response may pose risks to the integrity of the host. This occurs when an overly vigorous response may be detrimental and kill the host, as is the case of toxic shock syndrome. Therefore, the constant monitoring role of the neuroendocrine system to control and, when necessary, regulate the function of the immune system is crucial for the homeostatic integrity of the host. This reciprocity of functional need determines the mode of action to determine the context of a perceived threat and the best way to respond. Any breakdown in this two-way communication may manifest itself in problems such as autoimmunity, septic shock, or chronic infection. In this article, we review our current knowledge of circadian rhythm and its relation to the immune response.

  4. Impaired Adaptive Response to Mechanical Overloading in Dystrophic Skeletal Muscle

    PubMed Central

    Joanne, Pierre; Hourdé, Christophe; Ochala, Julien; Caudéran, Yvain; Medja, Fadia; Vignaud, Alban; Mouisel, Etienne; Hadj-Said, Wahiba; Arandel, Ludovic; Garcia, Luis; Goyenvalle, Aurélie; Mounier, Rémi; Zibroba, Daria; Sakamato, Kei; Butler-Browne, Gillian; Agbulut, Onnik; Ferry, Arnaud


    Dystrophin contributes to force transmission and has a protein-scaffolding role for a variety of signaling complexes in skeletal muscle. In the present study, we tested the hypothesis that the muscle adaptive response following mechanical overloading (ML) would be decreased in MDX dystrophic muscle lacking dystrophin. We found that the gains in muscle maximal force production and fatigue resistance in response to ML were both reduced in MDX mice as compared to healthy mice. MDX muscle also exhibited decreased cellular and molecular muscle remodeling (hypertrophy and promotion of slower/oxidative fiber type) in response to ML, and altered intracellular signalings involved in muscle growth and maintenance (mTOR, myostatin, follistatin, AMPKα1, REDD1, atrogin-1, Bnip3). Moreover, dystrophin rescue via exon skipping restored the adaptive response to ML. Therefore our results demonstrate that the adaptive response in response to ML is impaired in dystrophic MDX muscle, most likely because of the dystrophin crucial role. PMID:22511986

  5. Protective immune responses to fungal infections.


    Rivera, A


    The incidence of fungal infections has been on the rise over several decades. Fungal infections threaten animals, plants and humans alike and are thus of significant concern to scientists across disciplines. Over the last decade, significant advances on fungal immunology have lead to a better understanding of important mechanisms of host protection against fungi. In this article, I review recent advances of relevant mechanisms of immune-mediated protection to fungal infections.

  6. Arterial Hypertension Aggravates Innate Immune Responses after Experimental Stroke

    PubMed Central

    Möller, Karoline; Pösel, Claudia; Kranz, Alexander; Schulz, Isabell; Scheibe, Johanna; Didwischus, Nadine; Boltze, Johannes; Weise, Gesa; Wagner, Daniel-Christoph


    Arterial hypertension is not only the leading risk factor for stroke, but also attributes to impaired recovery and poor outcome. The latter could be explained by hypertensive vascular remodeling that aggravates perfusion deficits and blood–brain barrier disruption. However, besides vascular changes, one could hypothesize that activation of the immune system due to pre-existing hypertension may negatively influence post-stroke inflammation and thus stroke outcome. To test this hypothesis, male adult spontaneously hypertensive rats (SHRs) and normotensive Wistar Kyoto rats (WKYs) were subjected to photothrombotic stroke. One and 3 days after stroke, infarct volume and functional deficits were evaluated by magnetic resonance imaging and behavioral tests. Expression levels of adhesion molecules and chemokines along with the post-stroke inflammatory response were analyzed by flow cytometry, quantitative real-time PCR and immunohistochemistry in rat brains 4 days after stroke. Although comparable at day 1, lesion volumes were significantly larger in SHR at day 3. The infarct volume showed a strong correlation with the amount of CD45 highly positive leukocytes present in the ischemic hemispheres. Functional deficits were comparable between SHR and WKY. Brain endothelial expression of intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and P-selectin (CD62P) was neither increased by hypertension nor by stroke. However, in SHR, brain infiltrating myeloid leukocytes showed significantly higher surface expression of ICAM-1 which may augment leukocyte transmigration by leukocyte–leukocyte interactions. The expression of chemokines that primarily attract monocytes and granulocytes was significantly increased by stroke and, furthermore, by hypertension. Accordingly, ischemic hemispheres of SHR contain considerably higher numbers of monocytes, macrophages and granulocytes. Exacerbated brain inflammation in SHR may finally be responsible for

  7. Mucosal immune responses following intestinal nematode infection

    PubMed Central

    Zaph, C; Cooper, P J; Harris, N L


    In most natural environments, the large majority of mammals harbour parasitic helminths that often live as adults within the intestine for prolonged periods (1–2 years) 1. Although these organisms have been eradicated to a large extent within westernized human populations, those living within rural areas of developing countries continue to suffer from high infection rates. Indeed, recent estimates indicate that approximately 2·5 billion people worldwide, mainly children, currently suffer from infection with intestinal helminths (also known as geohelminths and soil-transmitted helminths) 2. Paradoxically, the eradication of helminths is thought to contribute to the increased incidence of autoimmune diseases and allergy observed in developed countries. In this review, we will summarize our current understanding of host–helminth interactions at the mucosal surface that result in parasite expulsion or permit the establishment of chronic infections with luminal dwelling adult worms. We will also provide insight into the adaptive immune mechanisms that provide immune protection against re-infection with helminth larvae, a process that is likely to be key to the future development of successful vaccination strategies. Lastly, the contribution of helminths to immune modulation and particularly to the treatment of allergy and inflammatory bowel disease will be discussed. PMID:25201407

  8. Yulangsan polysaccharide improves redox homeostasis and immune impairment in D-galactose-induced mimetic aging.


    Doan, Van Minh; Chen, Chunxia; Lin, Xing; Nguyen, Van Phuc; Nong, Zhihuan; Li, Weisi; Chen, Qingquan; Ming, Jianjun; Xie, Qiuqiao; Huang, Renbin


    Yulangsan polysaccharide (YLSP) is a traditional Chinese medicine used in long-term treatment as a modulator of brain dysfunction and immunity. In this study, we evaluated the protective effect of YLSP against D-galactose-induced impairment of oxidative stress and the immune system and evaluated its possible mechanism of action. D-galactose was subcutaneously injected into the dorsal neck of mice daily for 8 weeks to establish the aging model. YLSP was simultaneously administered once daily. The results indicate that YLSP significantly improves the general appearance of the aging mice. YLSP significantly increased the levels of antioxidant enzymes, such as super oxide dismutase, glutathione peroxidase, catalase and total anti-oxidation capability, while decreasing the content of malondialdehyde in different tissues, including the liver, brain, and serum. YLSP also increased the interleukin-2 level while decreasing the interleukin-6 level. Moreover, YLSP significantly inhibited advanced glycation end product formation. Furthermore, YLSP decreased p21 and p53 gene expressions in the liver and brain of D-galactose-treated mice. These results suggest that YLSP may have a protective effect suppressing the aging process by enhancing antioxidant activity and immunity, as well as modulating aging-related gene expression.

  9. Characterization of host immune responses in Ebola virus infections.


    Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo


    Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.

  10. Autophagy-associated immune responses and cancer immunotherapy.


    Pan, Hongming; Chen, Liuxi; Xu, Yinghua; Han, Weidong; Lou, Fang; Fei, Weiqiang; Liu, Shuiping; Jing, Zhao; Sui, Xinbing


    Autophagy is an evolutionarily conserved catabolic process by which cellular components are sequestered into a double-membrane vesicle and delivered to the lysosome for terminal degradation and recycling. Accumulating evidence suggests that autophagy plays a critical role in cell survival, senescence and homeostasis, and its dysregulation is associated with a variety of diseases including cancer, cardiovascular disease, neurodegeneration. Recent studies show that autophagy is also an important regulator of cell immune response. However, the mechanism by which autophagy regulates tumor immune responses remains elusive. In this review, we will describe the role of autophagy in immune regulation and summarize the possible molecular mechanisms that are currently well documented in the ability of autophagy to control cell immune response. In addition, the scientific and clinical hurdles regarding the potential role of autophagy in cancer immunotherapy will be discussed.

  11. Sex Drives Dimorphic Immune Responses to Viral Infections.


    Ghosh, Soumitra; Klein, Robyn S


    New attention to sexual dimorphism in normal mammalian physiology and disease has uncovered a previously unappreciated breadth of mechanisms by which females and males differentially exhibit quantitative phenotypes. Thus, in addition to the established modifying effects of hormones, which prenatally and postpubertally pattern cells and tissues in a sexually dimorphic fashion, sex differences are caused by extragonadal and dosage effects of genes encoded on sex chromosomes. Sex differences in immune responses, especially during autoimmunity, have been studied predominantly within the context of sex hormone effects. More recently, immune response genes have been localized to sex chromosomes themselves or found to be regulated by sex chromosome genes. Thus, understanding how sex impacts immunity requires the elucidation of complex interactions among sex hormones, sex chromosomes, and immune response genes. In this Brief Review, we discuss current knowledge and new insights into these intricate relationships in the context of viral infections.

  12. Immune responses to methamphetamine by active immunization with peptide-based, molecular adjuvant-containing vaccines.


    Duryee, Michael J; Bevins, Rick A; Reichel, Carmela M; Murray, Jennifer E; Dong, Yuxiang; Thiele, Geoffrey M; Sanderson, Sam D


    Vaccines to methamphetamine (meth) were designed by covalently attaching a meth hapten (METH) to peptide constructs that contained a conformationally biased, response-selective molecular adjuvant, YSFKPMPLaR (EP54). Rats immunized with EP54-containing meth vaccines generated serum antibody titers to authentic meth, an immune outcome that altered meth self-administration. Immunization increased meth self-administration suggesting pharmacokinetic antagonism. The ability of immune sera to bind a METH-modified target protein dramatically decreased during and shortly after the meth self-administration assay, suggesting effective sequestration of free meth. However, the binding ability of immune sera to the METH-modified target protein was recovered 34 days after meth-free clearance time.

  13. Impaired serotype-specific immune function following pneumococcal vaccination in infants with prior carriage.


    Licciardi, Paul V; Russell, Fiona M; Balloch, Anne; Burton, Robert L; Nahm, Moon H; Gilbert, Gwendolyn; Tang, Mimi L K; Mulholland, Edward K


    The impact of prior nasopharyngeal carriage on serotype-specific IgG responses following immunization with pneumococcal conjugate vaccines (PCV) has recently been described. This report extends these findings to describe the attenuation of functional immune responses following 23-valent pneumococcal polysaccharide vaccination (PPS). We report the attenuation of immune responses following booster with the 23-valent pneumococcal polysaccharide vaccination (PPS) in infants with prior nasopharyngeal carriage of Streptococcus pneumoniae. Fijian infants who were part of a phase II randomized, controlled trial of reduced dose PCV7 schedules were the basis of this study. Pneumococcal carriage was determined at 6, 9 and 12 months of age, prior to PPS immunization. Serum samples collected at 18 weeks (post-PCV7), 12 months (pre-PPS), 12.5 months and 17 months (post-PPS) of age were assessed for serotype-specific IgG and opsonophagocytic responses. The most frequently carried serotypes were 6B (N=11), 19F (N=14) and 23F (N=23). Significantly lower serotype-specific IgG for 19F, 23F but not 6B post-PPS were detected in infants with homologous serotype carriage prior to PPS compared with non-carriers (N=230). However, OPA levels for 6B and 23F were lower in infants that carried these serotypes. Pneumococcal carriage with 19F or 23F at any time prior to PPS immunization in infants at 12 months of age who were previously primed with PCV resulted in serotype-specific hyporesponsiveness that persisted until 17 months of age. These results may have implications for the timing of infant vaccine schedules, particularly in high disease burden settings.

  14. Charon Mediates Immune Deficiency-Driven PARP-1-Dependent Immune Responses in Drosophila.


    Ji, Yingbiao; Thomas, Colin; Tulin, Nikita; Lodhi, Niraj; Boamah, Ernest; Kolenko, Vladimir; Tulin, Alexei V


    Regulation of NF-κB nuclear translocation and stability is central to mounting an effective innate immune response. In this article, we describe a novel molecular mechanism controlling NF-κB-dependent innate immune response. We show that a previously unknown protein, termed as Charon, functions as a regulator of antibacterial and antifungal immune defense in Drosophila Charon is an ankyrin repeat-containing protein that mediates poly(ADP-ribose) polymerase-1 (PARP-1)-dependent transcriptional responses downstream of the innate immune pathway. Our results demonstrate that Charon interacts with the NF-κB ortholog Relish inside perinuclear particles and delivers active Relish to PARP-1-bearing promoters, thus triggering NF-κB/PARP-1-dependent transcription of antimicrobial peptides. Ablating the expression of Charon prevents Relish from targeting promoters of antimicrobial genes and effectively suppresses the innate immune transcriptional response. Taken together, these results implicate Charon as an essential mediator of PARP-1-dependent transcription in the innate immune pathway. Thus, to our knowledge, our results are the first to describe the molecular mechanism regulating translocation of the NF-κB subunit from cytoplasm to chromatin.

  15. A cognitive computational model inspired by the immune system response.


    Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim


    The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective.

  16. Modeling Systems-Level Regulation of Host Immune Responses

    PubMed Central

    Thakar, Juilee; Pilione, Mylisa; Kirimanjeswara, Girish; Harvill, Eric T; Albert, Réka


    Many pathogens are able to manipulate the signaling pathways responsible for the generation of host immune responses. Here we examine and model a respiratory infection system in which disruption of host immune functions or of bacterial factors changes the dynamics of the infection. We synthesize the network of interactions between host immune components and two closely related bacteria in the genus Bordetellae. We incorporate existing experimental information on the timing of immune regulatory events into a discrete dynamic model, and verify the model by comparing the effects of simulated disruptions to the experimental outcome of knockout mutations. Our model indicates that the infection time course of both Bordetellae can be separated into three distinct phases based on the most active immune processes. We compare and discuss the effect of the species-specific virulence factors on disrupting the immune response during their infection of naive, antibody-treated, diseased, or convalescent hosts. Our model offers predictions regarding cytokine regulation, key immune components, and clearance of secondary infections; we experimentally validate two of these predictions. This type of modeling provides new insights into the virulence, pathogenesis, and host adaptation of disease-causing microorganisms and allows systems-level analysis that is not always possible using traditional methods. PMID:17559300

  17. The immune and inflammatory response to orf virus.


    Haig, D M; McInnes, C; Deane, D; Reid, H; Mercer, A


    Orf virus is a zoonotic, epitheliotropic DNA parapox virus that principally infects sheep and goats. The fact that the virus can repeatedly reinfect sheep has provoked an interest in the underlying cellular, virological and molecular mechanisms for its apparent escape from the host protective immune response. The local immune and inflammatory response in skin and the cell phenotype and cytokine response in lymph analysed around a single lymph node are characteristic of an anti-viral response. An unusual feature is the dense accumulation of MHC Class II+ dendritic cells in the skin lesion. The function of these cells is not known. Orf virus virulence genes and activities have been identified that may interfere with the development of the host protective immune and inflammatory response.

  18. Long-term moderate calorie restriction inhibits inflammation without impairing cell-mediated immunity: a randomized controlled trial in non-obese humans

    PubMed Central

    Meydani, Simin N.; Das, Sai K.; Pieper, Carl F.; Lewis, Michael R.; Klein, Sam; Dixit, Vishwa D.; Gupta, Alok K.; Villareal, Dennis T.; Bhapkar, Manjushri; Huang, Megan; Fuss, Paul J.; Roberts, Susan B.; Holloszy, John O.; Fontana, Luigi


    Calorie restriction (CR) inhibits inflammation and slows aging in many animal species, but in rodents housed in pathogen-free facilities, CR impairs immunity against certain pathogens. However, little is known about the effects of long-term moderate CR on immune function in humans. In this multi-center, randomized clinical trial to determine CR's effect on inflammation and cell-mediated immunity, 218 healthy non-obese adults (20-50 y), were assigned 25% CR (n=143) or an ad-libitum (AL) diet (n=75), and outcomes tested at baseline, 12, and 24 months of CR. CR induced a 10.4% weight loss over the 2-y period. Relative to AL group, CR reduced circulating inflammatory markers, including total WBC and lymphocyte counts, ICAM-1 and leptin. Serum CRP and TNF-α concentrations were about 40% and 50% lower in CR group, respectively. CR had no effect on the delayed-type hypersensitivity skin response or antibody response to vaccines, nor did it cause difference in clinically significant infections. In conclusion, long-term moderate CR without malnutrition induces a significant and persistent inhibition of inflammation without impairing key in vivo indicators of cell-mediated immunity. Given the established role of these pro-inflammatory molecules in the pathogenesis of multiple chronic diseases, these CR-induced adaptations suggest a shift toward a healthy phenotype. PMID:27410480

  19. Methylglyoxal modulates immune responses: relevance to diabetes.


    Price, Claire L; Hassi, Hafid O S Al; English, Nicholas R; Blakemore, Alexandra I F; Stagg, Andrew J; Knight, Stella C


    Increased methylglyoxal (MG) concentrations and formation of advanced glycation end-products (AGEs) are major pathways of glycaemic damage in diabetes, leading to vascular and neuronal complications. Diabetes patients also suffer increased susceptibility to many common infections, the underlying causes of which remain elusive. We hypothesized that immune glycation damage may account for this increased susceptibility. We previously showed that the reaction mixture (RM) for MG glycation of peptide blocks up regulation of CD83 in myeloid cells and inhibits primary stimulation of T cells. Here, we continue to investigate immune glycation damage, assessing surface and intracellular cytokine protein expression by flow cytometry, T-cell proliferation using a carboxyfluorescein succinimidyl ester assay, and mRNA levels by RT-PCR. We show that the immunomodulatory component of this RM was MG itself, with MG alone causing equivalent block of CD83 and loss of primary stimulation. Block of CD83 expression could be reversed by MG scavenger N-acetyl cysteine. Further, MG within RM inhibited stimulated production of interleukin (IL)-10 protein from myeloid cells plus interferon (IFN)-gamma and tumour necrosis factor (TNF)-alpha from T cells. Loss of IL-10 and IFN-gamma was confirmed by RT-PCR analysis of mRNA, while TNF-alpha message was raised. Loss of TNF-alpha protein was also shown by ELISA of culture supernatants. In addition, MG reduced major histocompatibility complex (MHC) class I expression on the surface of myeloid cells and increased their propensity to apoptose. We conclude that MG is a potent suppressor of myeloid and T-cell immune function and may be a major player in diabetes-associated susceptibility to infection.

  20. [Effect of anabolic steroid on immune response].


    Yamagishi, H; Kobayashi, M; Konosu, H; Kurioka, H; Naito, K; Sonoyama, T; Nishimoto, T; Hashimoto, I


    Using lymphocyte, monocyte and eosinophil counts of the peripheral blood, PHA-blastoid transformation, immunoglobulin and beta 2-microglobulin, the influence of anabolic steroid on the immune reactivity of the host was dissected by administration of Deca-Durabolin ( nandrolone decanoate) to both tumor-bearing host and tumor-free host after operation for alimentary tract. The number of peripheral lymphocytes and monocytes, the PHA-blastoid transformation of peripheral lymphocytes and the IgG level were increased, and the beta 2-microglobulin level showed the tendency of decrease after the administration of Deca-Durabolin.

  1. Immune allergic response in Asperger syndrome.


    Magalhães, Elizabeth S; Pinto-Mariz, Fernanda; Bastos-Pinto, Sandra; Pontes, Adailton T; Prado, Evandro A; deAzevedo, Leonardo C


    Asperger's syndrome is a subgroup of autism characterized by social deficits without language delay, and high cognitive performance. The biological nature of autism is still unknown but there are controversial evidence associating an immune imbalance and autism. Clinical findings, including atopic family history, serum IgE levels as well as cutaneous tests showed that incidence of atopy was higher in the Asperger group compared to the healthy controls. These findings suggest that atopy is frequent in this subgroup of autism implying that allergic inflammation might be an important feature in Asperger syndrome.

  2. Impaired immune regulation after radioiodine therapy for Graves' disease and the protective effect of Methimazole.


    Côté-Bigras, Sarah; Tran, Viet; Turcotte, Sylvie; Rola-Pleszczynski, Marek; Verreault, Jean; Rottembourg, Diane


    Both therapies for Graves' disease (GD), radioactive iodine (RAI) and antithyroid drugs (ATD), were reported to have specific immune effects. We aimed at investigating the effects of RAI therapy on cellular subsets involved in immune regulation. We conducted a thirty day follow-up prospective cohort study of adult patients. Patients eligible for RAI therapy at our centre were approached. Twenty seven patients with GD were recruited, among whom 11 were treated with ATD. Twenty-two healthy subjects (HS) were also studied. Over time, frequency of regulatory T cells (Treg) and of invariant natural killer T cells (iNKT), along with Treg cell-mediated suppression and underlying mechanisms, were monitored in the peripheral blood. Variance in frequency of Treg and iNKT after RAI therapy was higher in GD patients than in HS over time (p < 0.0001). Reduced Treg suppressive function was observed after RAI therapy in GD patients (p = 0.002). ATD medication prior to RAI dampened these outcomes: less variation of Treg frequency (p = 0.0394), a trend toward less impaired Treg function, and prevention of reduced levels of suppressive cytokines (p < 0.05). Shortly after RAI therapy, alterations in immunoregulatory cells in patients with GD were observed and partially prevented by an ATD pretreatment. Worsening of autoimmunity after RAI was explained in previous studies by enhanced immune activity. This study adds new highlights on immune regulation deficiencies after therapeutic interventions in thyroid autoimmunity.

  3. Comparison between impairment and disability scales in immune-mediated polyneuropathies.


    Merkies, Ingemar S J; Schmitz, Paul I M; Van Der Meché, Frans G A; Van Doorn, Pieter A


    The ability of a scale to detect clinical relevant changes over time, i.e., its "responsiveness," may help clinicians to choose among valid and reliable measures. Therefore, we investigated the responsiveness' rank ordering (best to worse) of six selected valid and reliable scales, namely the Medical Research Council (MRC)-sumscore, sensory-sumscore, grip-strength (Vigorimeter), nine-hole peg, ten-meters walking, and a disability-sumscore, in immune-mediated polyneuropathies. Patients with newly diagnosed Guillain-Barré syndrome (n = 7) or chronic inflammatory demyelinating polyneuropathy (n = 13) were examined over 52 weeks. Responsiveness of each scale was measured using different methods (effect-size, standardized response mean score, Wilcoxon matched-pairs signed-rank, and a newly devised Schmitz's distribution-free responsiveness score), and the obtained scores in each method were plotted against the follow-up period, thus allowing area-under-the-curve calculations (higher area-under-the-curve indicating better responsiveness). Also, longitudinal correlations were performed between the scales' values and patients' own clinical judgments (deteriorated, unchanged, improved) (higher correlation = better responsiveness). A consistent rank ordering was observed in each technique with the disability-sumscore, MRC-sumscore, and Vigorimeter being among the best responsive scales. Hence, the primary use of these measures is suggested in studies of immune-mediated polyneuropathies.

  4. Subverting the adaptive immune resistance mechanism to improve clinical responses to immune checkpoint blockade therapy

    PubMed Central

    Kim, Young J


    The correlation between tumor-infiltrating lymphocyte (TIL)-expression of programmed cell death ligand 1 (PD-L1) and clinical responsiveness to the PD-1 blocking antibody nivolumab implicates adaptive immune evasion mechanisms in cancer. We review our findings that tumor cell PD-L1 expression is induced by interferon γ (IFNγ) producing TILs. We provide a mechanistic rationale for combining IFNγ+ T helper type 1 (Th1)-inducing cancer vaccines with PD-1 immune checkpoint blockade. PMID:25964860

  5. Modulation of Primary Immune Response by Different Vaccine Adjuvants

    PubMed Central

    Ciabattini, Annalisa; Pettini, Elena; Fiorino, Fabio; Pastore, Gabiria; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata


    Adjuvants contribute to enhancing and shaping the vaccine immune response through different modes of action. Here early biomarkers of adjuvanticity after primary immunization were investigated using four different adjuvants combined with the chimeric tuberculosis vaccine antigen H56. C57BL/6 mice were immunized by the subcutaneous route with different vaccine formulations, and the modulation of primary CD4+ T cell and B cell responses was assessed within draining lymph nodes, blood, and spleen, 7 and 12 days after priming. Vaccine formulations containing the liposome system CAF01 or a squalene-based oil-in-water emulsion (o/w squalene), but not aluminum hydroxide (alum) or CpG ODN 1826, elicited a significant primary antigen-specific CD4+ T cell response compared to antigen alone, 7 days after immunization. The effector function of activated CD4+ T cells was skewed toward a Th1/Th17 response by CAF01, while a Th1/Th2 response was elicited by o/w squalene. Differentiation of B cells in short-lived plasma cells, and subsequent early H56-specific IgG secretion, was observed in mice immunized with o/w squalene or CpG adjuvants. Tested adjuvants promoted the germinal center reaction with different magnitude. These results show that the immunological activity of different adjuvants can be characterized by profiling early immunization biomarkers after primary immunization. These data and this approach could give an important contribution to the rational development of heterologous prime–boost vaccine immunization protocols. PMID:27781036

  6. Transgenerational effects enhance specific immune response in a wild passerine.


    Broggi, Juli; Soriguer, Ramon C; Figuerola, Jordi


    Vertebrate mothers transfer diverse compounds to developing embryos that can affect their development and final phenotype (i.e., maternal effects). However, the way such effects modulate offspring phenotype, in particular their immunity, remains unclear. To test the impact of maternal effects on offspring development, we treated wild breeding house sparrows (Passer domesticus) in Sevilla, SE Spain with Newcastle disease virus (NDV) vaccine. Female parents were vaccinated when caring for first broods, eliciting a specific immune response to NDV. The immune response to the same vaccine, and to the PHA inflammatory test were measured in 11-day-old chicks from their following brood. Vaccinated chicks from vaccinated mothers developed a stronger specific response that was related to maternal NDV antibody concentration while rearing their chicks. The chicks' carotenoid concentration and total antioxidant capacity in blood were negatively related to NDV antibody concentration, whereas no relation with PHA response was found. Specific NDV antibodies could not be detected in 11-day-old control chicks from vaccinated mothers, implying that maternally transmitted antibodies are not directly involved but may promote offspring specific immunity through a priming effect, while other immunity components remain unaffected. Maternally transmitted antibodies in the house sparrow are short-lived, depend on maternal circulation levels and enhance pre-fledging chick specific immunity when exposed to the same pathogens as the mothers.

  7. Transgenerational effects enhance specific immune response in a wild passerine

    PubMed Central

    Soriguer, Ramon C.; Figuerola, Jordi


    Vertebrate mothers transfer diverse compounds to developing embryos that can affect their development and final phenotype (i.e., maternal effects). However, the way such effects modulate offspring phenotype, in particular their immunity, remains unclear. To test the impact of maternal effects on offspring development, we treated wild breeding house sparrows (Passer domesticus) in Sevilla, SE Spain with Newcastle disease virus (NDV) vaccine. Female parents were vaccinated when caring for first broods, eliciting a specific immune response to NDV. The immune response to the same vaccine, and to the PHA inflammatory test were measured in 11-day-old chicks from their following brood. Vaccinated chicks from vaccinated mothers developed a stronger specific response that was related to maternal NDV antibody concentration while rearing their chicks. The chicks’ carotenoid concentration and total antioxidant capacity in blood were negatively related to NDV antibody concentration, whereas no relation with PHA response was found. Specific NDV antibodies could not be detected in 11-day-old control chicks from vaccinated mothers, implying that maternally transmitted antibodies are not directly involved but may promote offspring specific immunity through a priming effect, while other immunity components remain unaffected. Maternally transmitted antibodies in the house sparrow are short-lived, depend on maternal circulation levels and enhance pre-fledging chick specific immunity when exposed to the same pathogens as the mothers. PMID:27069782

  8. Trachoma: Protective and Pathogenic Ocular Immune Responses to Chlamydia trachomatis

    PubMed Central

    Hu, Victor H.; Holland, Martin J.; Burton, Matthew J.


    Trachoma, caused by Chlamydia trachomatis (Ct), is the leading infectious blinding disease worldwide. Chronic conjunctival inflammation develops in childhood and leads to eyelid scarring and blindness in adulthood. The immune response to Ct provides only partial protection against re-infection, which can be frequent. Moreover, the immune response is central to the development of scarring pathology, leading to loss of vision. Here we review the current literature on both protective and pathological immune responses in trachoma. The resolution of Ct infection in animal models is IFNγ-dependent, involving Th1 cells, but whether this is the case in human ocular infection still needs to be confirmed. An increasing number of studies indicate that innate immune responses arising from the epithelium and other innate immune cells, along with changes in matrix metalloproteinase activity, are important in the development of tissue damage and scarring. Current trachoma control measures, which are centred on repeated mass antibiotic treatment of populations, are logistically challenging and have the potential to drive antimicrobial resistance. A trachoma vaccine would offer significant advantages. However, limited understanding of the mechanisms of both protective immunity and immunopathology to Ct remain barriers to vaccine development. PMID:23457650

  9. Semiquantitative measure of immune responses against erythropoietic stem cell antigens

    SciTech Connect

    Harrison, D.E.


    A semiquantitative assay was developed and used to measure the effects of immune responses against 16 independent non-H-2 antigenic loci on erythropoietic stem cells. The assay compares repopulation in genetically anemic WBB6F1-W/Wv recipients that have normal immune responses, and in lethally irradiated WBB6F1 +/+ mice whose immune responses are suppressed by the irradiation. The differences in repopulating ability between these two types of recipients measure how immune responses affect erythropoietic stem cells. Stem cell repopulating abilities for the cells with antigens specified by the Thy-1, H-1, H-24, Ly-1, H-37, and H-17 loci were affected slightly, if at all. Repopulating abilities were moderately reduced by responses against antigens specified by H-15, 16, Ea-2, and Ly-2, 3 loci, and against the differences between the B6 and B10 genotypes, although marrow of these types cured W/Wv recipients. A surprising result occurred for the antigen specified by the H-8 locus, in which immune responses strongly reduced repopulating abilities, although this type of marrow cell cured W/Wv recipients. A comparison of these results with skin graft survival times suggests that the antigens specified by the H-17 and H-24 loci are strongly immunogenic on skin but not on marrow stem cells, while those specified by the H-12 and H-8 loci are strongly immunogenic on marrow stem cells but not on skin.

  10. Modulation of immune response in experimental Chagas disease.


    Basso, Beatriz


    Trypanosoma cruzi (T. cruzi), the etiological agent of Chagas disease, affects nearly 18 million people in Latin America and 90 million are at risk of infection. The parasite presents two stages of medical importance in the host, the amastigote, intracellular replicating form, and the extracellular trypomastigote, the infective form. Thus infection by T. cruzi induces a complex immune response that involves effectors and regulatory mechanisms. That is why control of the infection requires a strong humoral and cellular immune response; hence, the outcome of host-parasite interaction in the early stages of infection is extremely important. A critical event during this period of the infection is innate immune response, in which the macrophage's role is vital. Thus, after being phagocytized, the parasite is able to develop intracellularly; however, during later periods, these cells induce its elimination by means of toxic metabolites. In turn, as the infection progresses, adaptive immune response mechanisms are triggered through the TH1 and TH2 responses. Finally, T. cruzi, like other protozoa such as Leishmania and Toxoplasma, have numerous evasive mechanisms to the immune response that make it possible to spread around the host. In our Laboratory we have developed a vaccination model in mice with Trypanosoma rangeli, nonpathogenic to humans, which modulates the immune response to infection by T. cruzi, thus protecting them. Vaccinated animals showed an important innate response (modulation of NO and other metabolites, cytokines, activation of macrophages), a strong adaptive cellular response and significant increase in specific antibodies. The modulation caused early elimination of the parasites, low parasitaemia, the absence of histological lesions and high survival rates. Even though progress has been made in the knowledge of some of these mechanisms, new studies must be conducted which could target further prophylactic and therapeutic trials against T. cruzi

  11. Pramipexole Impairs Stimulus-Response Learning in Healthy Young Adults

    PubMed Central

    Gallant, Haley; Vo, Andrew; Seergobin, Ken N.; MacDonald, Penny A.


    Dopaminergic therapy has paradoxical effects on cognition in Parkinson's disease (PD) patients, with some functions worsened and others improved. The dopamine overdose hypothesis is proposed as an explanation for these opposing effects of medication taking into account the varying levels of dopamine within different brain regions in PD. The detrimental effects of medication on cognition have been attributed to exogenous dopamine overdose in brain regions with spared dopamine levels in PD. It has been demonstrated that learning is most commonly worsened by dopaminergic medication. The current study aimed to investigate whether the medication-related learning impairment exhibited in PD patients is due to a main effect of medication by evaluating the dopamine overdose hypothesis in healthy young adults. Using a randomized, double-blind, placebo-controlled design, 40 healthy young undergraduate students completed a stimulus-response learning task. Half of the participants were treated with 0.5 mg of pramipexole, a dopamine agonist, whereas the other half were treated with a placebo. We found that stimulus-response learning was significantly impaired in participants on pramipexole relative to placebo controls. These findings are consistent with the dopamine overdose hypothesis and suggest that dopaminergic medication impairs learning independent of PD pathology. Our results have important clinical implications for conditions treated with pramipexole, particularly PD, restless leg syndrome, some forms of dystonia, and potentially depression. PMID:27594823

  12. Factors influencing innate immunity and vaccine responses in infancy

    PubMed Central

    Kampmann, Beate; Jones, Christine E


    Despite significant progress in reducing the burden of mortality in children under the age of five, reducing mortality in newborns remains a major challenge. Infection plays a significant role in infant deaths and interventions such as early vaccination or antenatal immunization could make a significant contribution to prevention of such deaths. In the last few years, we have gained new insights into immune ontogeny and are now beginning to understand the impact of vaccines, nutrition and environmental factors on ‘training′ of the immune response in early life. This review article sets out to explain why vaccine responses can be heterogeneous between populations and individuals by providing examples chosen to illustrate the impact of host, pathogen and environmental factors on shaping the immune ‘interactome′ in young children. PMID:25964459

  13. The immune response against Candida spp. and Sporothrix schenckii.


    Martínez-Álvarez, José A; Pérez-García, Luis A; Flores-Carreón, Arturo; Mora-Montes, Héctor M


    Candida albicans is the main causative agent of systemic candidiasis, a condition with high mortality rates. The study of the interaction between C. albicans and immune system components has been thoroughly studied and nowadays there is a model for the anti-C. albicans immune response; however, little is known about the sensing of other pathogenic species of the Candida genus. Sporothrix schenckii is the causative agent of sporotrichosis, a subcutaneous mycosis, and thus far there is limited information about its interaction with the immune system. In this paper, we review the most recent information about the immune sensing of species from genus Candida and S. schenckii. Thoroughly searches in scientific journal databases were performed, looking for papers addressing either Candida- or Sporothrix-immune system interactions. There is a significant advance in the knowledge of non-C. albicans species of Candida and Sporothrix immune sensing; however, there are still relevant points to address, such as the specific contribution of pathogen-associated molecular patterns (PAMPs) for sensing by different immune cells and the immune receptors involved in such interactions. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012).

  14. Autophagy as a Stress Response Pathway in the Immune System.


    Bhattacharya, Abhisek; Eissa, N Tony


    Macroautophagy, hereafter, referred to as autophagy, has long been regarded as a housekeeping pathway involved in intracellular degradation and energy recycling. These housekeeping and homeostatic functions are especially important during cellular stress, such as periods of nutrient deprivation. However, importance of autophagy extends far beyond its degradative functions. Recent evidence shows that autophagy plays an essential role in development, organization and functions of the immune system, and defects in autophagy lead to several diseases, including cancer and autoimmunity. In the immune system, autophagy is important in regulation of the innate and adaptive immune responses. This review focuses on the roles of autophagy in the adaptive immune system. We first introduce the autophagy pathway and provide a brief description of the major molecular players involved in autophagy. We then discuss the importance of autophagy as a stress integrator mechanism and provide relevant examples of this role of autophagy in adaptive immune cells. Then we proceed to describe how autophagy regulates development, activation and functions of different adaptive immune cells. In these contexts, we mention both degradative and non-degradative roles of autophagy, and illustrate their importance. We also discuss role of autophagy in antigen presenting cells, which play critical roles in the activation of adaptive immune cells. Further, we describe how autophagy regulates functions of different adaptive immune cells during infection, inflammation and autoimmunity.

  15. Chitin and Its Effects on Inflammatory and Immune Responses.


    Elieh Ali Komi, Daniel; Sharma, Lokesh; Dela Cruz, Charles S


    Chitin, a potential allergy-promoting pathogen-associated molecular pattern (PAMP), is a linear polymer composed of N-acetylglucosamine residues which are linked by β-(1,4)-glycosidic bonds. Mammalians are potential hosts for chitin-containing protozoa, fungi, arthropods, and nematodes; however, mammalians themselves do not synthetize chitin and thus it is considered as a potential target for recognition by mammalian immune system. Chitin is sensed primarily in the lungs or gut where it activates a variety of innate (eosinophils, macrophages) and adaptive immune cells (IL-4/IL-13 expressing T helper type-2 lymphocytes). Chitin induces cytokine production, leukocyte recruitment, and alternative macrophage activation. Intranasal or intraperitoneal administration of chitin (varying in size, degree of acetylation and purity) to mice has been applied as a routine approach to investigate chitin's priming effects on innate and adaptive immunity. Structural chitin present in microorganisms is actively degraded by host true chitinases, including acidic mammalian chitinases and chitotriosidase into smaller fragments that can be sensed by mammalian receptors such as FIBCD1, NKR-P1, and RegIIIc. Immune recognition of chitin also involves pattern recognition receptors, mainly via TLR-2 and Dectin-1, to activate immune cells to induce cytokine production and creation of an immune network that results in inflammatory and allergic responses. In this review, we will focus on various immunological aspects of the interaction between chitin and host immune system such as sensing, interactions with immune cells, chitinases as chitin degrading enzymes, and immunologic applications of chitin.

  16. Emerging functions of the unfolded protein response in immunity

    PubMed Central

    Janssens, Sophie; Pulendran, Bali; Lambrecht, Bart N.


    The unfolded protein response (UPR) has traditionally been viewed as an adaptive response triggered upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), aimed at restoring ER function. The UPR can also be an anticipatory response that is activated well before the disruption of protein homeostasis. UPR signaling intersects at many levels with the innate and adaptive immune response. In some immune cell types like dendritic cells and B cells, particular UPR sensors appear constitutively active in the absence of traditional UPR gene program induction, necessary for antigen presentation and immunoglobulin synthesis. The UPR also influences Toll-like receptor signaling and NF-κB activation, and some pathogens subvert the UPR. This review summarizes these emerging non-canonical functions of the UPR in immunity. PMID:25232821

  17. Modulation of Human Immune Response by Fungal Biocontrol Agents

    PubMed Central

    Konstantinovas, Cibele; de Oliveira Mendes, Tiago A.; Vannier-Santos, Marcos A.; Lima-Santos, Jane


    Although the vast majority of biological control agents is generally regarded as safe for humans and environment, the increased exposure of agriculture workers, and consumer population to fungal substances may affect the immune system. Those compounds may be associated with both intense stimulation, resulting in IgE-mediated allergy and immune downmodulation induced by molecules such as cyclosporin A and mycotoxins. This review discusses the potential effects of biocontrol fungal components on human immune responses, possibly associated to infectious, inflammatory diseases, and defective defenses. PMID:28217107

  18. Modulation of Human Immune Response by Fungal Biocontrol Agents.


    Konstantinovas, Cibele; de Oliveira Mendes, Tiago A; Vannier-Santos, Marcos A; Lima-Santos, Jane


    Although the vast majority of biological control agents is generally regarded as safe for humans and environment, the increased exposure of agriculture workers, and consumer population to fungal substances may affect the immune system. Those compounds may be associated with both intense stimulation, resulting in IgE-mediated allergy and immune downmodulation induced by molecules such as cyclosporin A and mycotoxins. This review discusses the potential effects of biocontrol fungal components on human immune responses, possibly associated to infectious, inflammatory diseases, and defective defenses.

  19. The effect of cadmium chloride on the immune response in mice.

    PubMed Central

    Blakley, B R


    Six week old BDF1 female mice were exposed to cadmium chloride in the drinking water at concentrations ranging from 0 to 50 micrograms/mL cadmium for three weeks. The humoral immune response against sheep red blood cells which is T-lymphocyte and macrophage dependent, was suppressed in a dose dependent fashion with the maximum suppression of 28.2% observed in the highest exposure group (P less than 0.0001). Mitogen studies demonstrated that cadmium was a weak mitogen, producing a dose-dependent enhancement of blastogenesis (P = 0.026). T-lymphocyte responses which were induced by concanavalin A were not affected by cadmium exposure (P = 0.284). A dose-dependent enhancement of the B-lymphocyte activity was produced in the presence of cadmium when the lymphocytes were induced with Escherichia coli, lipopolysaccharide, a B-lymphocyte mitogen (P = 0.007). These results suggest that the immunosuppressive effects of cadmium associated with the humoral immune response are not due to an impairment of lymphocyte proliferation, an intermediate step involved in the generation of an immune response. The immunosuppressive effects were produced at relatively low cadmium exposures as indicated by the renal cadmium concentrations suggesting that the immune systems is very vulnerable to the toxic effects of cadmium. PMID:3872706

  20. Balancing Immune Protection and Immune Pathology by CD8+ T-Cell Responses to Influenza Infection

    PubMed Central

    Duan, Susu; Thomas, Paul G.


    Influenza A virus (IAV) is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL)-mediated immunity contributes to the clearance of virus-infected cells, and CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, its cytotoxicity, and the effects of produced proinflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL antiviral immunity from those necessary to restrain CTL-mediated non-specific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity. PMID:26904022

  1. Maximizing Immune Response to Carbohydrate Antigens on Breast Tumors

    DTIC Science & Technology


    antigens expressed on breast tumors. Towards this end we are developing peptide mimotopes of tumor associated carbohydrate antigens as they are T cell...dependent antigens. In our progress to date we have shown the 1) immunization with peptide mimotope activates a specific cellular response to a model murine...tumor cell line; 2) vaccination of mice with peptide eradicates established tumor; 3) Immunization with DNA format of the peptide suppresses tumor

  2. SUMO-Enriched Proteome for Drosophila Innate Immune Response

    PubMed Central

    Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S.


    Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. PMID:26290570

  3. Harnessing DNA-induced immune responses for improving cancer vaccines

    PubMed Central

    Herrada, Andrés A.; Rojas-Colonelli, Nicole; González-Figueroa, Paula; Roco, Jonathan; Oyarce, César; Ligtenberg, Maarten A.; Lladser, Alvaro


    DNA vaccines have emerged as an attractive strategy to promote protective cellular and humoral immunity against the encoded antigen. DNA vaccines are easy to generate, inexpensive to produce and purify at large-scale, highly stable and safe. In addition, plasmids used for DNA vaccines act as powerful “danger signals” by stimulating several DNA-sensing innate immune receptors that promote the induction of protective adaptive immunity. The induction of tumor-specific immune responses represents a major challenge for DNA vaccines because most of tumor-associated antigens are normal non-mutated self-antigens. As a consequence, induction of potentially self-reactive T cell responses against such poorly immunogenic antigens is controlled by mechanisms of central and peripheral tolerance as well as tumor-induced immunosuppression. Although several DNA vaccines against cancer have reached clinical testing, disappointing results have been observed. Therefore, the development of new adjuvants that strongly stimulate the induction of antitumor T cell immunity and counteract immune-suppressive regulation is an attractive approach to enhance the potency of DNA vaccines and overcome tumor-associated tolerance. Understanding the DNA-sensing signaling pathways of innate immunity that mediate the induction of T cell responses elicited by DNA vaccines represents a unique opportunity to develop novel adjuvants that enhance vaccine potency. The advance of DNA adjuvants needs to be complemented with the development of potent delivery systems, in order to step toward successful clinical application. Here, we briefly discuss recent evidence showing how to harness DNA-induced immune response to improve the potency of cancer vaccines and counteract tumor-associated tolerance. PMID:23111166

  4. Innate immune responses of temperamental and calm cattle after transportation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective was to investigate measures of cellular innate immune responses among calm and temperamental Brahman bulls in response to handling and transportation. Sixteen Brahman bulls (344 ± 37 days of age; 271.6 ± 45.5 kg BW) classified as either calm (n = 8) or temperamental (n = 8) were loaded...

  5. Enhancing the Immune Response to Recombinant Plague Antigens

    DTIC Science & Technology


    parvovirus (CPMV). In those studies, animals primed IN and boosted SC developed significantly higher serum anti-CPMV IgG2a responses than did animals...Wakelin. 2003. Effect of priming/booster immunisation protocols on immune response to canine parvovirus peptide induced by vaccination with a chimaeric

  6. The architects of B and T cell immune responses.


    Lane, Peter J L


    Published work links adult lymphoid tissue-inducer cells (LTi) with T cell-dependent antibody responses. In this issue of Immunity, Tsuji et al. (2008) associate LTi with T cell-independent IgA antibody responses in the gut.

  7. Neutrophilic myeloid-derived suppressor cells in cord blood modulate innate and adaptive immune responses

    PubMed Central

    Rieber, N; Gille, C; Köstlin, N; Schäfer, I; Spring, B; Ost, M; Spieles, H; Kugel, H A; Pfeiffer, M; Heininger, V; Alkhaled, M; Hector, A; Mays, L; Kormann, M; Zundel, S; Fuchs, J; Handgretinger, R; Poets, C F; Hartl, D


    Neonates show an impaired anti-microbial host defence, but the underlying immune mechanisms are not understood fully. Myeloid-derived suppressor cells (MDSCs) represent an innate immune cell subset characterized by their capacity to suppress T cell immunity. In this study we demonstrate that a distinct MDSC subset with a neutrophilic/granulocytic phenotype (Gr-MDSCs) is highly increased in cord blood compared to peripheral blood of children and adults. Functionally, cord blood isolated Gr-MDSCs suppressed T cell proliferation efficiently as well as T helper type 1 (Th1), Th2 and Th17 cytokine secretion. Beyond T cells, cord blood Gr-MDSCs controlled natural killer (NK) cell cytotoxicity in a cell contact-dependent manner. These studies establish neutrophilic Gr-MDSCs as a novel immunosuppressive cell subset that controls innate (NK) and adaptive (T cell) immune responses in neonates. Increased MDSC activity in cord blood might serve as key fetomaternal immunosuppressive mechanism impairing neonatal host defence. Gr-MDSCs in cord blood might therefore represent a therapeutic target in neonatal infections. PMID:23701226

  8. Neutrophilic myeloid-derived suppressor cells in cord blood modulate innate and adaptive immune responses.


    Rieber, N; Gille, C; Köstlin, N; Schäfer, I; Spring, B; Ost, M; Spieles, H; Kugel, H A; Pfeiffer, M; Heininger, V; Alkhaled, M; Hector, A; Mays, L; Kormann, M; Zundel, S; Fuchs, J; Handgretinger, R; Poets, C F; Hartl, D


    Neonates show an impaired anti-microbial host defence, but the underlying immune mechanisms are not understood fully. Myeloid-derived suppressor cells (MDSCs) represent an innate immune cell subset characterized by their capacity to suppress T cell immunity. In this study we demonstrate that a distinct MDSC subset with a neutrophilic/granulocytic phenotype (Gr-MDSCs) is highly increased in cord blood compared to peripheral blood of children and adults. Functionally, cord blood isolated Gr-MDSCs suppressed T cell proliferation efficiently as well as T helper type 1 (Th1), Th2 and Th17 cytokine secretion. Beyond T cells, cord blood Gr-MDSCs controlled natural killer (NK) cell cytotoxicity in a cell contact-dependent manner. These studies establish neutrophilic Gr-MDSCs as a novel immunosuppressive cell subset that controls innate (NK) and adaptive (T cell) immune responses in neonates. Increased MDSC activity in cord blood might serve as key fetomaternal immunosuppressive mechanism impairing neonatal host defence. Gr-MDSCs in cord blood might therefore represent a therapeutic target in neonatal infections.

  9. Physical Function Impairment of Older, HIV-Infected Adults Is Associated with Cytomegalovirus Immunoglobulin Response

    PubMed Central

    Allshouse, Amanda A.; Rapaport, Eric; Palmer, Brent E.; Wilson, Cara C.; Weinberg, Adriana; MaWhinney, Samantha; Campbell, Thomas B.


    Abstract Cytomegalovirus (CMV) is associated with poor outcomes, including physical function impairment, in older HIV-uninfected adults. Whether CMV is associated with physical functional impairment in HIV-infected adults is unknown. The primary objective of this study was to determine the relationship between CMV-specific humoral and cell-mediated immune responses with functional impairment in well-controlled HIV infection. In a case-control study, low-function cases were matched by age, gender, and time from HIV diagnosis to high-function controls. Quantitative CMV IgG and %CMV-specific CD8+ and CD4+ T cells (interferon-γ expression following CMV pp65 stimulation) were used to estimate physical function. Among 30 low-function cases and 48 high-function matched controls, CMV IgG ranged from <10 to 8,830 EU/ml, including four controls with results <10 EU/ml. Each log10 increase in CMV IgG was associated with 5-fold greater odds of low function (p=0.01); these findings were robust to adjustment for concomitant CD4+ count, tobacco use, and age; to exclusion of subjects with CMV IgG <10 EU/ml; and to adjustment for hepatitis C viremia. %CMV-specific CD4+ or CD8+ T cells were not associated with low function. In bivariable models, the relationship between CMV IgG and physical function was attenuated and was no longer significant when including IL-6, CD4/CD8 ratio, or the Veterans Aging Cohort Study Index score. High levels of CMV-specific IgG were associated with impaired physical function. Attenuation of the strength of this association in bivariable models suggests an indirect relationship mediated by systemic inflammation and immune suppression. PMID:26061347

  10. Lentinula edodes-derived polysaccharide rejuvenates mice in terms of immune responses and gut microbiota.


    Xu, Xiaofei; Yang, Jiguo; Ning, Zhengxiang; Zhang, Xuewu


    Aging is characterized by impaired immunity and unbalanced gut microbiota. Prebiotics have the capability to prevent or reverse age-related declines in health by modulating gut microbiota. Mushroom polysaccharides have been suggested to be potential prebiotics. However, their effects on the immunity and gut microbiota in aged mice have not been determined. This study firstly assessed the effects of a heteropolysaccharide L2 isolated from the fruit body of L. edodes on the immune response of aged mice, and then compared the composition of fecal microbiota in adult (N), old (O) and L2-treated old (Oa) mice using the high-throughput pyrosequencing technique. The results showed that L2 can restore the age-attenuated immune responses by increasing cytokine levels in peripheral blood. Moreover, L2 can partly reverse the age-altered composition of gut microbiota. The Euclidean distances (De) among 3 groups (N, O and Oa) are determined to be De(O, N) = 0.19, De(O, Oa) = 0.20, and De(N, Oa) = 0.10, i.e. there is a marked reduction in the distance from 0.19 to 0.1 by L2. This suggests the beneficial effects of L2 on enhancing immunity and improving gut health.

  11. Immune cell changes in response to a swimming training session during a 24-h recovery period.


    Morgado, José P; Monteiro, Cristina P; Teles, Júlia; Reis, Joana F; Matias, Catarina; Seixas, Maria T; Alvim, Marta G; Bourbon, Mafalda; Laires, Maria J; Alves, Francisco


    Understanding the impact of training sessions on the immune response is crucial for the adequate periodization of training, to prevent both a negative influence on health and a performance impairment of the athlete. This study evaluated acute systemic immune cell changes in response to an actual swimming session, during a 24-h recovery period, controlling for sex, menstrual cycle phases, maturity, and age group. Competitive swimmers (30 females, 15 ± 1.3 years old; and 35 males, 16.5 ± 2.1 years old) performed a high-intensity training session. Blood samples were collected before, immediately after, 2 h after, and 24 h after exercise. Standard procedures for the assessment of leukogram by automated counting (Coulter LH 750, Beckman) and lymphocytes subsets by flow cytometry (FACS Calibur BD, Biosciences) were used. Subjects were grouped according to competitive age groups and pubertal Tanner stages. Menstrual cycle phase was monitored. The training session induced neutrophilia, lymphopenia, and a low eosinophil count, lasting for at least 2 h, independent of sex and maturity. At 24 h postexercise, the acquired immunity of juniors (15-17 years old), expressed by total lymphocytes and total T lymphocytes (CD3(+)), was not fully recovered. This should be accounted for when planning a weekly training program. The observed lymphopenia suggests a lower immune surveillance at the end of the session that may depress the immunity of athletes, highlighting the need for extra care when athletes are exposed to aggressive environmental agents such as swimming pools.

  12. Executive impairment determines ADHD medication response: implications for academic achievement.


    Hale, James B; Reddy, Linda A; Semrud-Clikeman, Margaret; Hain, Lisa A; Whitaker, James; Morley, Jessica; Lawrence, Kyle; Smith, Alex; Jones, Nicole


    Methylphenidate (MPH) often ameliorates attention-deficit/hyperactivity disorder (ADHD) behavioral dysfunction according to indirect informant reports and rating scales. The standard of care behavioral MPH titration approach seldom includes direct neuropsychological or academic assessment data to determine treatment efficacy. Documenting "cool" executive-working memory (EWM) and "hot" self-regulation (SR) neuropsychological impairments could aid in differential diagnosis of ADHD subtypes and determining cognitive and academic MPH response. In this study, children aged 6 to 16 with ADHD inattentive type (IT; n = 19) and combined type (n = 33)/hyperactive-impulsive type (n = 4) (CT) participated in double-blind placebo-controlled MPH trials with baseline and randomized placebo, low MPH dose, and high MPH dose conditions. EWM/ SR measures and behavior ratings/classroom observations were rank ordered separately across conditions, with nonparametric randomization tests conducted to determine individual MPH response. Participants were subsequently grouped according to their level of cool EWM and hot SR circuit dysfunction. Robust cognitive and behavioral MPH response was achieved for children with significant baseline EWM/SR impairment, yet response was poor for those with adequate EWM/ SR baseline performance. Even for strong MPH responders, the best dose for neuropsychological functioning was typically lower than the best dose for behavior. Findings offer one possible explanation for why long-term academic MPH treatment gains in ADHD have not been realized. Implications for academic achievement and medication titration practices for children with behaviorally diagnosed ADHD will be discussed.

  13. Shortened night sleep impairs facial responsiveness to emotional stimuli.


    Schwarz, Johanna F A; Popp, Roland; Haas, Jessica; Zulley, Jürgen; Geisler, Peter; Alpers, Georg W; Osterheider, Michael; Eisenbarth, Hedwig


    Sleep deprivation deteriorates mood, impairs the recognition of facial expressions, and affects the ability to regulate emotions. The present study investigated the effect of partial sleep deprivation on facial responses to emotional stimuli. Thirty-three healthy undergraduates were tested twice: after a night with (i) 8h and (ii) 4h sleep. Self-reported sleepiness and sustained attention (Psychomotor Vigilance Task) were assessed. Emotional reactivity was measured with facial Electromyogram (EMG) while participants were asked to respond with either compatible or incompatible facial muscles to emotional stimuli in order to study whether partial sleep deprivation caused slower reactions mainly in response to incompatible stimuli (due to an additional effort to suppress the compatible reaction caused by decreased inhibitory control) or in response to both compatible and incompatible stimuli. Self-reported sleepiness and reaction times in a sustained attention task significantly increased after one night of partial sleep deprivation. Facial reactions to emotional stimuli were decelerated. No significant interaction between sleep restriction and compatibility of the muscle to the picture valence could be observed. Hence, volitional facial reactions in response to emotional stimuli were slower after one night of reduced sleep, but affective inhibitory control was not significantly impaired. However, slowed facial responding to emotional stimuli may affect social interaction after sleep restriction.

  14. Activating transcription factor 4 underlies the pathogenesis of arsenic trioxide-mediated impairment of macrophage innate immune functions.


    Srivastava, Ritesh K; Li, Changzhao; Wang, Yong; Weng, Zhiping; Elmets, Craig A; Harrod, Kevin S; Deshane, Jessy S; Athar, Mohammad


    Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here, we show that activating transcription factor 4 (ATF4), a UPR transcription factor, regulates arsenic trioxide (ATO)-mediated dysregulation of macrophage functions. In ATO-treated ATF4(+/+) wild-type mice, a significant down-regulation of CD11b expression was associated with the reduced phagocytic functions of peritoneal and lung macrophages. This severe immuno-toxicity phenotype was not observed in ATO-treated ATF4(+/-) heterozygous mice. To confirm these observations, we demonstrated in Raw 264.7 cells that ATF4 knock-down rescues ATO-mediated impairment of macrophage functions including cytokine production, bacterial engulfment and clearance of engulfed bacteria. Sustained activation of ATF4 by ATO in macrophages induces apoptosis, while diminution of ATF4 expression protects against ATO-induced apoptotic cell death. Raw 264.7 cells treated with ATO also manifest dysregulated Ca(++) homeostasis. ATO induces Ca(++)-dependent calpain-1 and caspase-12 expression which together regulated macrophage apoptosis. Additionally, apoptosis was also induced by mitochondria-regulated pathway. Restoring ATO-impaired Ca(++) homeostasis in ER/mitochondria by treatments with the inhibitors of inositol 1,4,5-trisphosphate receptor (IP3R) and voltage-dependent anion channel (VDAC) attenuate innate immune functions of macrophages. These studies identify a novel role for ATF4 in underlying pathogenesis of macrophage dysregulation and immuno-toxicity of arsenic.

  15. Reduced cellular immune response in social insect lineages

    PubMed Central

    Sconiers, Warren B.; Frank, Steven D.; Dunn, Robert R.; Tarpy, David R.


    Social living poses challenges for individual fitness because of the increased risk of disease transmission among conspecifics. Despite this challenge, sociality is an evolutionarily successful lifestyle, occurring in the most abundant and diverse group of organisms on earth—the social insects. Two contrasting hypotheses predict the evolutionary consequences of sociality on immune systems. The social group hypothesis posits that sociality leads to stronger individual immune systems because of the higher risk of disease transmission in social species. By contrast, the relaxed selection hypothesis proposes that social species have evolved behavioural immune defences that lower disease risk within the group, resulting in lower immunity at the individual level. We tested these hypotheses by measuring the encapsulation response in 11 eusocial and non-eusocial insect lineages. We built phylogenetic mixed linear models to investigate the effect of behaviour, colony size and body size on cellular immune response. We found a significantly negative effect of colony size on encapsulation response (Markov chain Monte Carlo generalized linear mixed model (mcmcGLMM) p < 0.05; phylogenetic generalized least squares (PGLS) p < 0.05). Our findings suggest that insects living in large societies may rely more on behavioural mechanisms, such as hygienic behaviours, than on immune function to reduce the risk of disease transmission among nest-mates. PMID:26961895

  16. TIGIT predominantly regulates the immune response via regulatory T cells

    PubMed Central

    Kurtulus, Sema; Sakuishi, Kaori; Ngiow, Shin-Foong; Joller, Nicole; Tan, Dewar J.; Teng, Michele W.L.; Smyth, Mark J.; Kuchroo, Vijay K.; Anderson, Ana C.


    Coinhibitory receptors are critical for the maintenance of immune homeostasis. Upregulation of these receptors on effector T cells terminates T cell responses, while their expression on Tregs promotes their suppressor function. Understanding the function of coinhibitory receptors in effector T cells and Tregs is crucial, as therapies that target coinhibitory receptors are currently at the forefront of treatment strategies for cancer and other chronic diseases. T cell Ig and ITIM domain (TIGIT) is a recently identified coinhibitory receptor that is found on the surface of a variety of lymphoid cells, and its role in immune regulation is just beginning to be elucidated. We examined TIGIT-mediated immune regulation in different murine cancer models and determined that TIGIT marks the most dysfunctional subset of CD8+ T cells in tumor tissue as well as tumor-tissue Tregs with a highly active and suppressive phenotype. We demonstrated that TIGIT signaling in Tregs directs their phenotype and that TIGIT primarily suppresses antitumor immunity via Tregs and not CD8+ T cells. Moreover, TIGIT+ Tregs upregulated expression of the coinhibitory receptor TIM-3 in tumor tissue, and TIM-3 and TIGIT synergized to suppress antitumor immune responses. Our findings provide mechanistic insight into how TIGIT regulates immune responses in chronic disease settings. PMID:26413872

  17. Modulation of immune responses in stress by Yoga

    PubMed Central

    Arora, Sarika; Bhattacharjee, Jayashree


    Stress is a constant factor in today's fastpaced life that can jeopardize our health if left unchecked. It is only in the last half century that the role of stress in every ailment from the common cold to AIDS has been emphasized, and the mechanisms involved in this process have been studied. Stress influences the immune response presumably through the activation of the hypothalamic-pituitary adrenal axis, hypothalamic pituitary-gonadal axis, and the sympathetic-adrenal-medullary system. Various neurotransmitters, neuropeptides, hormones, and cytokines mediate these complex bidirectional interactions between the central nervous system (CNS) and the immune system. The effects of stress on the immune responses result in alterations in the number of immune cells and cytokine dysregulation. Various stress management strategies such as meditation, yoga, hypnosis, and muscle relaxation have been shown to reduce the psychological and physiological effects of stress in cancers and HIV infection. This review aims to discuss the effect of stress on the immune system and examine how relaxation techniques such as Yoga and meditation could regulate the cytokine levels and hence, the immune responses during stress. PMID:21829284

  18. TIGIT predominantly regulates the immune response via regulatory T cells.


    Kurtulus, Sema; Sakuishi, Kaori; Ngiow, Shin-Foong; Joller, Nicole; Tan, Dewar J; Teng, Michele W L; Smyth, Mark J; Kuchroo, Vijay K; Anderson, Ana C


    Coinhibitory receptors are critical for the maintenance of immune homeostasis. Upregulation of these receptors on effector T cells terminates T cell responses, while their expression on Tregs promotes their suppressor function. Understanding the function of coinhibitory receptors in effector T cells and Tregs is crucial, as therapies that target coinhibitory receptors are currently at the forefront of treatment strategies for cancer and other chronic diseases. T cell Ig and ITIM domain (TIGIT) is a recently identified coinhibitory receptor that is found on the surface of a variety of lymphoid cells, and its role in immune regulation is just beginning to be elucidated. We examined TIGIT-mediated immune regulation in different murine cancer models and determined that TIGIT marks the most dysfunctional subset of CD8+ T cells in tumor tissue as well as tumor-tissue Tregs with a highly active and suppressive phenotype. We demonstrated that TIGIT signaling in Tregs directs their phenotype and that TIGIT primarily suppresses antitumor immunity via Tregs and not CD8+ T cells. Moreover, TIGIT+ Tregs upregulated expression of the coinhibitory receptor TIM-3 in tumor tissue, and TIM-3 and TIGIT synergized to suppress antitumor immune responses. Our findings provide mechanistic insight into how TIGIT regulates immune responses in chronic disease settings.

  19. Genetics of the immune response: identifying immune variation within the MHC and throughout the genome.


    Geraghty, Daniel E; Daza, Riza; Williams, Luke M; Vu, Quyen; Ishitani, Akiko


    With the advent of modern genomic sequencing technology the ability to obtain new sequence data and to acquire allelic polymorphism data from a broad range of samples has become routine. In this regard, our investigations have started with the most polymorphic of genetic regions fundamental to the immune response in the major histocompatibility complex (MHC). Starting with the completed human MHC genomic sequence, we have developed a resource of methods and information that provide ready access to a large portion of human and nonhuman primate MHCs. This resource consists of a set of primer pairs or amplicons that can be used to isolate about 15% of the 4.0 Mb MHC. Essentially similar studies are now being carried out on a set of immune response loci to broaden the usefulness of the data and tools developed. A panel of 100 genes involved in the immune response have been targeted for single nucleotide polymorphism (SNP) discovery efforts that will analyze 120 Mb of sequence data for the presence of immune-related SNPs. The SNP data provided from the MHC and from the immune response panel has been adapted for use in studies of evolution, MHC disease associations, and clinical transplantation.

  20. Genetic control of the innate immune response

    PubMed Central

    Wells, Christine A; Ravasi, Timothy; Faulkner, Geoffrey J; Carninci, Piero; Okazaki, Yasushi; Hayashizaki, Yoshihide; Sweet, Matthew; Wainwright, Brandon J; Hume, David A


    Background Susceptibility to infectious diseases is directed, in part, by the interaction between the invading pathogen and host macrophages. This study examines the influence of genetic background on host-pathogen interactions, by assessing the transcriptional responses of macrophages from five inbred mouse strains to lipopolysaccharide (LPS), a major determinant of responses to gram-negative microorganisms. Results The mouse strains examined varied greatly in the number, amplitude and rate of induction of genes expressed in response to LPS. The response was attenuated in the C3H/HeJlpsd strain, which has a mutation in the LPS receptor Toll-like receptor 4 (TLR4). Variation between mouse strains allowed clustering into early (C57Bl/6J and DBA/2J) and delayed (BALB/c and C3H/ARC) transcriptional phenotypes. There was no clear correlation between gene induction patterns and variation at the Bcg locus (Slc11A1) or propensity to bias Th1 versus Th2 T cell activation responses. Conclusion Macrophages from each strain responded to LPS with unique gene expression profiles. The variation apparent between genetic backgrounds provides insights into the breadth of possible inflammatory responses, and paradoxically, this divergence was used to identify a common transcriptional program that responds to TLR4 signalling, irrespective of genetic background. Our data indicates that many additional genetic loci control the nature and the extent of transcriptional responses promoted by a single pathogen-associated molecular pattern (PAMP), such as LPS. PMID:12826024

  1. Characterization of the immune response of domestic fowl following immunization with proteins extracted from Dermanyssus gallinae.


    Harrington, David; Din, Hatem Mohi El; Guy, Jonathan; Robinson, Karen; Sparagano, Olivier


    Dermanyssus gallinae is the most significant ectoparasite of European poultry egg laying production systems due to high costs of control and associated production losses as well as adverse effects on bird welfare. In this study, soluble proteins were extracted from unfed D. gallinae (DGE) using a urea-based detergent and ultra-filtration, passed through a 0.22 microm filter and blended aseptically with adjuvant. One group of laying hens was immunized with DGE and adjuvant (Montanide ISA 50 V) whilst another group (Control) received physiological saline and adjuvant. All birds were immunized on two occasions, 21 days apart. Antibody response to immunization was determined by ELISA and western blotting using immunoglobulins (Igs) extracted from egg yolk. DGE immunization of hens resulted in a significant (P<0.05) IgY response compared to controls, although there was no significant difference in IgM response between treatments. A number of proteins were identified by western blotting using IgY antibodies from DGE immunized birds, most prominently at 40 and 230kDa. Analysis of proteins from approximately corresponding bands on SDS-PAGE confirmed the identity of tropomyosin, whilst other proteins showed high sequence homology with myosin and actin from other arachnid and insect species. Immunization of hens with DGE resulted in a 50.6% increase in mite mortality (P<0.001) 17h after feeding when tested by an in vitro mite feeding model. Data in this study demonstrate that somatic antigens from D. gallinae can be used to stimulate a protective immune response in laying hens. Further work is needed to identify other proteins of interest that could confer higher protection against D. gallinae, as well as optimization of the vaccination and in vitro testing protocol.

  2. Clostridium perfringens α-Toxin Impairs Innate Immunity via Inhibition of Neutrophil Differentiation

    PubMed Central

    Takehara, Masaya; Takagishi, Teruhisa; Seike, Soshi; Ohtani, Kaori; Kobayashi, Keiko; Miyamoto, Kazuaki; Shimizu, Tohru; Nagahama, Masahiro


    Although granulopoiesis is accelerated to suppress bacteria during infection, some bacteria can still cause life-threatening infections, but the mechanism behind this remains unclear. In this study, we found that mature neutrophils in bone marrow cells (BMCs) were decreased in C. perfringens-infected mice and also after injection of virulence factor α-toxin. C. perfringens infection interfered with the replenishment of mature neutrophils in the peripheral circulation and the accumulation of neutrophils at C. perfringens-infected sites in an α-toxin-dependent manner. Measurements of bacterial colony-forming units in C. perfringens-infected muscle revealed that α-toxin inhibited a reduction in the load of C. perfringens. In vitro treatment of isolated BMCs with α-toxin (phospholipase C) revealed that α-toxin directly decreased mature neutrophils. α-Toxin did not influence the viability of isolated mature neutrophils, while simultaneous treatment of BMCs with granulocyte colony-stimulating factor attenuated the reduction of mature neutrophils by α-toxin. Together, our results illustrate that impairment of the innate immune system by the inhibition of neutrophil differentiation is crucial for the pathogenesis of C. perfringens to promote disease to a life-threatening infection, which provides new insight to understand how pathogenic bacteria evade the host immune system. PMID:27306065

  3. A basic mathematical model of the immune response

    NASA Astrophysics Data System (ADS)

    Mayer, H.; Zaenker, K. S.; an der Heiden, U.


    Interaction of the immune system with a target population of, e.g., bacteria, viruses, antigens, or tumor cells must be considered as a dynamic process. We describe this process by a system of two ordinary differential equations. Although the model is strongly idealized it demonstrates how the combination of a few proposed nonlinear interaction rules between the immune system and its targets are able to generate a considerable variety of different kinds of immune responses, many of which are observed both experimentally and clinically. In particular, solutions of the model equations correspond to states described by immunologists as ``virgin state,'' ``immune state'' and ``state of tolerance.'' The model successfully replicates the so-called primary and secondary response. Moreover, it predicts the existence of a threshold level for the amount of pathogen germs or of transplanted tumor cells below which the host is able to eliminate the infectious organism or to reject the tumor graft. We also find a long time coexistence of targets and immune competent cells including damped and undamped oscillations of both. Plausibly the model explains that if the number of transformed cells or pathogens exeeds definable values (poor antigenicity, high reproduction rate) the immune system fails to keep the disease under control. On the other hand, the model predicts apparently paradoxical situations including an increased chance of target survival despite enhanced immune activity or therapeutically achieved target reduction. A further obviously paradoxical behavior consists of a positive effect for the patient up to a complete cure by adding an additional target challenge where the benefit of the additional targets depends strongly on the time point and on their amount. Under periodically pulsed stimulation the model may show a chaotic time behavior of both target growth and immune response.

  4. Hypomorphic, homozygous mutations in Phosphoglucomutase 3 impair immunity and increase serum IgE levels

    PubMed Central

    Sassi, Atfa; Lazaroski, Sandra; Wu, Gang; Haslam, Stuart M.; Fliegauf, Manfred; Mellouli, Fethi; Patiroglu, Turkan; Unal, Ekrem; Ozdemir, Mehmet Akif; Jouhadi, Zineb; Khadir, Khadija; Ben-Khemis, Leila; Ben-Ali, Meriem; Ben-Mustapha, Imen; Borchani, Lamia; Pfeifer, Dietmar; Jakob, Thilo; Khemiri, Monia; Asplund, A. Charlotta; Gustafsson, Manuela O.; Lundin, Karin E.; Falk-Sörqvist, Elin; Moens, Lotte N.; Gungor, Hatice Eke; Engelhardt, Karin R.; Dziadzio, Magdalena; Stauss, Hans; Fleckenstein, Bernhard; Meier, Rebecca; Prayitno, Khairunnadiya; Maul-Pavicic, Andrea; Schaffer, Sandra; Rakhmanov, Mirzokhid; Henneke, Philipp; Kraus, Helene; Eibel, Hermann; Kölsch, Uwe; Nadifi, Sellama; Nilsson, Mats; Bejaoui, Mohamed; Schäffer, Alejandro A.; Edvard Smith, C. I.; Dell, Anne; Barbouche, Mohamed-Ridha; Grimbacher, Bodo


    Background Recurrent bacterial and fungal infections, eczema and elevated serum IgE levels characterize patients with the hyper-IgE syndrome (HIES). Known genetic causes for HIES are mutations in STAT3 and DOCK8, involved in signal transduction pathways. However, glycosylation defects have not been described in HIES. One crucial enzyme in the glycosylation pathway is Phosphoglucomutase 3 (PGM3), which catalyzes a key step in the synthesis of UDP-GlcNAc which is required for the biosynthesis of N-glycans. Objective To elucidate the genetic cause in HIES patients who do not carry mutations in STAT3 or DOCK8. Methods After establishing a linkage interval by SNP-chip genotyping and homozygosity mapping in two HIES families from Tunisia, mutational analysis was performed with selector-based, high-throughput sequencing. Protein expression was analyzed by Western blotting and glycosylation was profiled by mass spectrometry. Results Mutational analysis of candidate genes in a 11.9 Mb linkage region on chromosome 6 shared by two multiplex families identified two homozygous mutations in PGM3 which segregated with the disease status and followed a recessive inheritance trait. The mutations predict amino acid changes in Phosphoglucomutase-3; PGM3 (p.Glu340del and p.Leu83Ser). A third homozygous mutation (p.Asp502Tyr) and the p.Leu83Ser variant were identified in two other affected families, respectively. These hypomorphic mutations have impact on the biosynthetic reactions involving UDP-GlcNAc. Glycomic analysis revealed an aberrant glycosylation pattern in leukocytes demonstrated by a reduced level of tri-/tetra-antennary N-glycans. T cell proliferation and differentiation was impaired in patients. Most patients showed developmental delay and many had psychomotor retardation. Conclusion Impairment of PGM3 function leads to a novel primary (inborn) error of development and immunity, as biallelic hypomorphic mutations are associated with impaired glycosylation and a hyper

  5. RNA-Seq revealed the impairment of immune defence of tilapia against the infection of Streptococcus agalactiae with simulated climate warming.


    Wang, Le; Liu, Peng; Wan, Zi Yi; Huang, Shu Qing; Wen, Yan Fei; Lin, Grace; Yue, Gen Hua


    Global warming is one of the causes of disease outbreaks in fishes. Understanding its mechanisms is critical in aquaculture and fisheries. We used tilapia to study the effects of a high temperature on the infection of a bacterial pathogen Streptococcus agalactiae using RNA-Seq. We found that the dissolved oxygen level in water at 32 °C is lower than at 22 °C, and tilapia infected with the pathogen died more rapidly at 32 °C. The gene expression profiles showed significant differences in fish raised under different conditions. We identified 126 and 576 differentially expressed genes (DEGs) at 4 and 24 h post infection at 22 °C, respectively, whereas at 32 °C, the data were 312 and 1670, respectively. Almost all responding pathways at 22 °C were involved in the immune responses, whereas at 32 °C, the enriched pathways were not only involved in immune responses but also involved in oxygen and energy metabolisms. We identified significant signals of immunosuppression of immune responses at 32 °C. In addition, many of the enriched transcription factors and DEGs under positive selection were involved in immune responses, oxygen and/or energy metabolisms. Our results suggest that global warming could reduce the oxygen level in water and impair the defence of tilapia against bacterial infection.

  6. Cellular immune response in multiple sclerosis plaques.

    PubMed Central

    Boyle, E. A.; McGeer, P. L.


    Multiple sclerosis plaques were immunohistochemically stained to exhibit cells expressing immune-system antigens. Human leukocyte antigen (HLA)-DR-positive cells formed dense rings around all plaque regions. The majority were reactive microglia/macrophages. Counterstaining with oil red O revealed heavy myelin debris within these cells. They were distinct from astrocytes, which were identified with an antibody to glial fibrillary acidic protein (GFAP) and which did not contain oil red O myelin debris. Numerous leukocytes and microglia were stained with antibody to leukocyte common antigen (LCA). Lymphocytes in cuffs around vessels, along the margins of capillary walls, and, sparingly, in the tissue matrix of affected areas, were stained with antibodies to CD4 (T-helper/inducer) and CD8 (T-cytotoxic/suppressor). In experimental allergic encephalomyelitis (EAE) induced in Lewis rats, a similar proliferation of Ia-positive (OX6, OX17) cells displaying reactive microglia/macrophage morphology was observed. These Ia-positive cells also were easily distinguished from GFAP-positive astrocytes. The results suggest that macrophages/reactive microglia, and not astrocytes, express class II MHC antigens in multiple sclerosis and EAE plaques. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:1698025

  7. Crosstalk between microbiota, pathogens and the innate immune responses.


    Günther, Claudia; Josenhans, Christine; Wehkamp, Jan


    Research in the last decade has convincingly demonstrated that the microbiota is crucial in order to prime and orchestrate innate and adaptive immune responses of their host and influence barrier function as well as multiple developmental and metabolic parameters of the host. Reciprocally, host reactions and immune responses instruct the composition of the microbiota. This review summarizes recent evidence from experimental and human studies which supports these arms of mutual relationship and crosstalk between host and resident microbiota, with a focus on innate immune responses in the gut, the role of cell death pathways and antimicrobial peptides. We also provide some recent examples on how dysbiosis and pathogens can act in concert to promote intestinal infection, inflammatory pathologies and cancer. The future perspectives of these combined research efforts include the discovery of protective species within the microbiota and specific traits and factors of microbes that weaken or enforce host intestinal homeostasis.

  8. Determinants of early life immune responses to RSV infection.


    Ruckwardt, Tracy J; Morabito, Kaitlyn M; Graham, Barney S


    Respiratory syncytial virus causes significant morbidity and mortality in both developed and developing countries, and a vaccine that adequately protects from severe disease remains an important unmet need. RSV disease has an inordinate impact on the very young, and the physical and immunological immaturity of early life complicates vaccine design. Defining and targeting the functional capacities of early life immune responses and controlling responses during primary antigen exposure with selected vaccine delivery approaches will be important for protecting infants by active immunization. Alternatively, vaccination of older children and pregnant mothers may ameliorate disease burden indirectly until infants reach about six months of age, when they can generate more effective anti-RSV immune responses.

  9. Innate Immune Responses to Nanoparticle Exposure in the Lung.


    Thompson, Elizabeth A; Sayers, Brian C; Glista-Baker, Ellen E; Shipkowski, Kelly A; Taylor, Alexia J; Bonner, James C


    The nanotechnology revolution offers enormous societal and economic benefits for innovation in the fields of engineering, electronics, and medicine. Nevertheless, evidence from rodent studies show that biopersistent engineered nanomaterials (ENMs) stimulate immune, inflammatory, and fibroproliferative responses in the lung, suggesting possible risks for lung diseases or systemic immune disorders as a consequence of occupational, environmental, or consumer exposure. Due to their nanoscale dimensions and increased surface area per unit mass, ENMs have a much greater potential to reach the distal regions of the lung and generate ROS. High aspect ratio ENMs (e.g., nanotubes, nanofibers) activate inflammasomes in macrophages, triggering IL-1β release and neutrophilic infiltration into the lungs. Moreover, some ENMs alter allergen-induced eosinophilic inflammation by immunostimulation, immunosuppression, or modulating the balance between Th1, Th2, and Th17 cells, thereby influencing the nature of the inflammatory response. ENMs also migrate from the lungs across epithelial, endothelial, or mesothelial barriers to stimulate or suppress systemic immune responses.

  10. Innate and Adaptive Immune Response to Apoptotic Cells

    PubMed Central

    Peng, YuFeng; Martin, David A; Kenkel, Justin; Zhang, Kang; Ogden, Carol Anne; Elkon, Keith B.


    The immune system is constantly exposed to dying cells, most of which arise during central tolerance and from effete circulating immune cells. Under homeostatic conditions, phagocytes (predominantly macrophages and dendritic cells) belonging to the innate immune system, rapidly ingest cells and their debris. Apoptotic cell removal requires recognition of altered self on the apoptotic membrane, a process which is facilitated by natural antibodies and serum opsonins. Recognition, may be site and context specific. Uptake and ingestion of apoptotic cells promotes an immunosuppressive environment that avoids inflammatory responses to self antigens. However, it does not preclude a T cell response and it is likely that constant exposure to self antigen, particularly by immature dendritic cells, leads to T cell tolerance. Tolerance occurs by several different mechanisms including anergy and deletion (for CD8+ T cells) and induction of T regulatory cells (for CD4+ T cells). Failed apoptotic cell clearance promotes immune responses to self antigens, especially when the cellular contents are leaked from the cell (necrosis). Inflammatory responses may be induced by nucleic acid stimulation of toll like receptors and other immune sensors, specific intracellular proteins and non protein (uric acid) stimulation of inflammasomes. PMID:17888627

  11. Probiotics, antibiotics and the immune responses to vaccines.


    Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep


    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome.

  12. Readapting the adaptive immune response - therapeutic strategies for atherosclerosis.


    Sage, Andrew P; Mallat, Ziad


    Cardiovascular diseases remain a major global health issue, with the development of atherosclerosis as a major underlying cause. Our treatment of cardiovascular disease has improved greatly over the past three decades, but much remains to be done reduce disease burden. Current priorities include reducing atherosclerosis advancement to clinically significant stages and preventing plaque rupture or erosion. Inflammation and involvement of the adaptive immune system influences all these aspects and therefore is one focus for future therapeutic development. The atherosclerotic vascular wall is now recognized to be invaded from both sides (arterial lumen and adventitia), for better or worse, by the adaptive immune system. Atherosclerosis is also affected at several stages by adaptive immune responses, overall providing many opportunities to target these responses and to reduce disease progression. Protective influences that may be defective in diseased individuals include humoral responses to modified LDL and regulatory T cell responses. There are many strategies in development to boost these pathways in humans, including vaccine-based therapies. The effects of various existing adaptive immune targeting therapies, such as blocking critical co-stimulatory pathways or B cell depletion, on cardiovascular disease are beginning to emerge with important consequences for both autoimmune disease patients and the potential for wider use of such therapies. Entering the translation phase for adaptive immune targeting therapies is an exciting and promising prospect.

  13. Probiotics, antibiotics and the immune responses to vaccines

    PubMed Central

    Praharaj, Ira; John, Sushil M.; Bandyopadhyay, Rini; Kang, Gagandeep


    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. PMID:25964456

  14. Innate immune responses in hepatitis C virus infection.


    Li, Kui; Lemon, Stanley M


    Hepatitis C virus (HCV) is a major causative agent of chronic hepatitis and hepatocellular carcinoma worldwide and thus poses a significant public health threat. A hallmark of HCV infection is the extraordinary ability of the virus to persist in a majority of infected people. Innate immune responses represent the front line of defense of the human body against HCV immediately after infection. They also play a crucial role in orchestrating subsequent HCV-specific adaptive immunity that is pivotal for viral clearance. Accumulating evidence suggests that the host has evolved multifaceted innate immune mechanisms to sense HCV infection and elicit defense responses, while HCV has developed elaborate strategies to circumvent many of these. Defining the interplay of HCV with host innate immunity reveals mechanistic insights into hepatitis C pathogenesis and informs approaches to therapy. In this review, we summarize recent advances in understanding innate immune responses to HCV infection, focusing on induction and effector mechanisms of the interferon antiviral response as well as the evasion strategies of HCV.

  15. Effect of protein release rates from tablet formulations on the immune response after sublingual immunization.


    Borde, Annika; Ekman, Annelie; Holmgren, Jan; Larsson, Anette


    Dry vaccine formulations for sublingual administration would provide great advantages for public health use, especially in developing countries, since they are easy to administer and might also have improved stability properties. This study investigates the influence of protein release rate from mucoadhesive two-layer tablets on the elicited antibody responses after sublingual immunization. Two fast release tablets, one based on a mixture of lactose and microcrystalline cellulose (MCC) and one protein coated ethylcellulose (EC) tablet, and three hydrophilic matrix tablets with extended release (ER) properties based on HPMC 90 SH 100000 or Carbopol® 974-P NF were tested. The in vitro release profiles of the model protein ovalbumin (OVA) from these tablets were characterized and correlated to the in vivo potential of the tablets to induce an immune response after sublingual immunization in BALB/c mice. It could be concluded that a tablet with fast protein release elicits antibody titres not significantly different from titres obtained with OVA in solution, whereas low immune responses were observed with a slow release of OVA from the ER formulations. Thus, an ER tablet seems not favorable for vaccine delivery to the sublingual mucosa. Thus, we can present a fast releasing tablet formulation with attractive features for sublingual immunization, whereas the use of ER formulations for sublingual vaccination has to be investigated more in detail.

  16. Immunotoxicity of aflatoxin B1: Impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression

    SciTech Connect

    Meissonnier, Guylaine M.; Pinton, Philippe; Laffitte, Joelle; Cossalter, Anne-Marie; Gong, Yun Yun; Wild, Christopher P.; Bertin, Gerard; Galtier, Pierre; Oswald, Isabelle P.


    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus or A. parasiticus, is a frequent contaminant of food and feed. This toxin is hepatotoxic and immunotoxic. The present study analyzed in pigs the influence of AFB1 on humoral and cellular responses, and investigated whether the immunomodulation observed is produced through interference with cytokine expression. For 28 days, pigs were fed a control diet or a diet contaminated with 385, 867 or 1807 {mu}g pure AFB1/kg feed. At days 4 and 15, pigs were vaccinated with ovalbumin. AFB1 exposure, confirmed by an observed dose-response in blood aflatoxin-albumin adduct, had no major effect on humoral immunity as measured by plasma concentrations of total IgA, IgG and IgM and of anti-ovalbumin IgG. Toxin exposure did not impair the mitogenic response of lymphocytes but delayed and decreased their specific proliferation in response to the vaccine antigen, suggesting impaired lymphocyte activation in pigs exposed to AFB1. The expression level of pro-inflammatory (TNF-{alpha}, IL-1{beta}, IL-6, IFN-{gamma}) and regulatory (IL-10) cytokines was assessed by real-time PCR in spleen. A significant up-regulation of all 5 cytokines was observed in spleen from pigs exposed to the highest dose of AFB1. In pigs exposed to the medium dose, IL-6 expression was increased and a trend towards increased IFN-{gamma} and IL-10 was observed. In addition we demonstrate that IL-6 impaired in vitro the antigenic- but not the mitogenic-induced proliferation of lymphocytes from control pigs vaccinated with ovalbumin. These results indicate that AFB1 dietary exposure decreases cell-mediated immunity while inducing an inflammatory response. These impairments in the immune response could participate in failure of vaccination protocols and increased susceptibility to infections described in pigs exposed to AFB1.

  17. Acute psychological stress induces short-term variable immune response.


    Breen, Michael S; Beliakova-Bethell, Nadejda; Mujica-Parodi, Lilianne R; Carlson, Joshua M; Ensign, Wayne Y; Woelk, Christopher H; Rana, Brinda K


    In spite of advances in understanding the cross-talk between the peripheral immune system and the brain, the molecular mechanisms underlying the rapid adaptation of the immune system to an acute psychological stressor remain largely unknown. Conventional approaches to classify molecular factors mediating these responses have targeted relatively few biological measurements or explored cross-sectional study designs, and therefore have restricted characterization of stress-immune interactions. This exploratory study analyzed transcriptional profiles and flow cytometric data of peripheral blood leukocytes with physiological (endocrine, autonomic) measurements collected throughout the sequence of events leading up to, during, and after short-term exposure to physical danger in humans. Immediate immunomodulation to acute psychological stress was defined as a short-term selective up-regulation of natural killer (NK) cell-associated cytotoxic and IL-12 mediated signaling genes that correlated with increased cortisol, catecholamines and NK cells into the periphery. In parallel, we observed down-regulation of innate immune toll-like receptor genes and genes of the MyD88-dependent signaling pathway. Correcting gene expression for an influx of NK cells revealed a molecular signature specific to the adrenal cortex. Subsequently, focusing analyses on discrete groups of coordinately expressed genes (modules) throughout the time-series revealed immune stress responses in modules associated to immune/defense response, response to wounding, cytokine production, TCR signaling and NK cell cytotoxicity which differed between males and females. These results offer a spring-board for future research towards improved treatment of stress-related disease including the impact of stress on cardiovascular and autoimmune disorders, and identifies an immune mechanism by which vulnerabilities to these diseases may be gender-specific.

  18. Microgravity and immune responsiveness: implications for space travel.


    Borchers, Andrea T; Keen, Carl L; Gershwin, M Eric


    To date, several hundred cosmonauts and astronauts have flown in space, yet knowledge about the adaptation of their immune system to space flight is rather limited. It is evident that a variety of immune parameters are changed during and after space flight, but the magnitude and pattern of these changes can differ dramatically between missions and even between crew members on the same mission. A literature search was conducted involving a total of 335 papers published between 1972 and 2002 that dealt with the key words immune response, microgravity and astronauts/cosmonauts, isolation, gravity, and human health. The data from multiple studies suggested that major discrepancies in outcome are due to methodologic differences. However, the data also suggested major factors that affect and modulate the immune response during space travel. In part at least, these discrepancies can be attributed to methodologic differences. In addition, a variety of other features, in particular the types and extent of stressors encountered during space missions, are likely to contribute to the variability of immune responses during and after space flight. That stress plays an important role in the effects of space flight on immunologic parameters is suggested by the frequent findings that stress hormones are upregulated during and after space flight. Unfortunately, however, the existing data on hormonal parameters are almost as varied as those on immunologic changes, and correlations between the two datasets have only rarely been attempted. The functional implications of space flight-induced alterations in immune response largely remain to be elucidated, but the data suggest that long-term travel will be associated with the development of immune-compromised hosts.

  19. A protective role of murine langerin+ cells in immune responses to cutaneous vaccination with microneedle patches

    PubMed Central

    Pulit-Penaloza, Joanna A.; Esser, E. Stein; Vassilieva, Elena V.; Lee, Jeong Woo; Taherbhai, Misha T.; Pollack, Brian P.; Prausnitz, Mark R.; Compans, Richard W.; Skountzou, Ioanna


    Cutaneous vaccination with microneedle patches offers several advantages over more frequently used approaches for vaccine delivery, including improved protective immunity. However, the involvement of specific APC subsets and their contribution to the induction of immunity following cutaneous vaccine delivery is not well understood. A better understanding of the functions of individual APC subsets in the skin will allow us to target specific skin cell populations in order to further enhance vaccine efficacy. Here we use a Langerin-EGFP-DTR knock-in mouse model to determine the contribution of langerin+ subsets of skin APCs in the induction of adaptive immune responses following cutaneous microneedle delivery of influenza vaccine. Depletion of langerin+ cells prior to vaccination resulted in substantial impairment of both Th1 and Th2 responses, and decreased post-challenge survival rates, in mice vaccinated cutaneously but not in those vaccinated via the intramuscular route or in non-depleted control mice. Our results indicate that langerin+ cells contribute significantly to the induction of protective immune responses following cutaneous vaccination with a subunit influenza vaccine. PMID:25130187

  20. Suppressive influences in the immune response to cancer.


    Bronte, Vincenzo; Mocellin, Simone


    Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.

  1. Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids

    PubMed Central

    Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe


    The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406

  2. Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics.


    Fins, Joseph J


    Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.

  3. Effects of NO/sub 2/ on immune responses

    SciTech Connect

    Lefkowitz, S.S.; McGrath, J.J.; Lefkowitz, D.L.


    The effects of NO/sub 2/ on immune responses of mice were investigated. Mice were exposed to various concentrations of NO/sub 2/ in inhalation chambers. After exposure the following parameters were measured: phagocytosis of polystyrene beads by both peritoneal and alveolar macrophages, production of antibody-forming cells from mice immunized with sheep erythrocytes, lymphocyte blastogenesis of splenic cells, and susceptibility to influenza virus. The production of antibody-forming cells was reduced in mice that were exposed to 5 ppm NO/sub 2/. The serum antibody titers, phagocytosis, and other immune parameters measured were not affected. Exposure to NO/sub 2/ did not affect mortality to influenza virus. These data indicate that certain immune parameters were altered by exposure to NO/sub 2/; however, NO/sub 2/ does not appear to be a major immunosuppressive factor at the concentrations tested.

  4. Host cell autophagy in immune response to zoonotic infections.


    Skendros, Panagiotis; Mitroulis, Ioannis


    Autophagy is a fundamental homeostatic process in which cytoplasmic targets are sequestered within double-membraned autophagosomes and subsequently delivered to lysosomes for degradation. Accumulating evidence supports the pivotal role of autophagy in host defense against intracellular pathogens implicating both innate and adaptive immunity. Many of these pathogens cause common zoonotic infections worldwide. The induction of the autophagic machinery by innate immune receptors signaling, such as TLRs, NOD1/2, and p62/SQSTM1 in antigen-presenting cells results in inhibition of survival and elimination of invading pathogens. Furthermore, Th1 cytokines induce the autophagic process, whereas autophagy also contributes to antigen processing and MHC class II presentation, linking innate to adaptive immunity. However, several pathogens have developed strategies to avoid autophagy or exploit autophagic machinery to their advantage. This paper focuses on the role of host cell autophagy in the regulation of immune response against intracellular pathogens, emphasizing on selected bacterial and protozoan zoonoses.

  5. Impaired Memory Retrieval Correlates with Individual Differences in Cortisol Response but Not Autonomic Response

    ERIC Educational Resources Information Center

    Tranel, Daniel; Adolphs, Ralph; Buchanan, Tony W.


    Stress can enhance or impair memory performance. Both cortisol release and sympathetic nervous system responses have been implicated in these differential effects. Here we investigated how memory retrieval might be affected by stress-induced cortisol release, independently of sympathetic nervous system stress responses. Thirty-two healthy…


    PubMed Central

    Macario, Alberto J. L.; de Macario, Everly Conway; Franceschi, Claudio; Celada, Franco


    We have cultivated lymph node microfragments from β-D-galactosidase (Escherichia coli) primed rabbits and have measured their secondary response directed towards the whole molecule (precipitating antibodies) and to a single determinant (activating antibodies) of the antigen. By decreasing the size of the fragments to 105 cells, we began to observe heterogeneity among identical cultures in terms of positivity of response, antibody specificity, and titers. The affinity of "early" activating antibodies was inversely proportional to the dose of challenge. While no maturation was seen in low and excessive challenge, in all cultures receiving intermediate doses the association constant was raised several orders of magnitude within periods of 20 days. The relevance of these data to the mechanism of affinity selection of antigen-sensitive cells is discussed. PMID:4557772

  7. Photodynamic therapy for cancer and activation of immune response

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.


    Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.

  8. Environmental Toxicants-Induced Immune Responses in the Olfactory Mucosa

    PubMed Central

    Imamura, Fumiaki; Hasegawa-Ishii, Sanae


    Olfactory sensory neurons (OSNs) are the receptor cells for the sense of smell. Although cell bodies are located in the olfactory mucosa (OM) of the nasal cavity, OSN axons directly project to the olfactory bulb (OB) that is a component of the central nervous system (CNS). Because of this direct and short connection from this peripheral tissue to the CNS, the olfactory system has attracted attention as a port-of-entry for environmental toxicants that may cause neurological dysfunction. Selected viruses can enter the OB via the OM and directly affect the CNS. On the other hand, environmental toxicants may induce inflammatory responses in the OM, including infiltration of immune cells and production of inflammatory cytokines. In addition, these inflammatory responses cause the loss of OSNs that are then replaced with newly generated OSNs that re-connect to the OB after inflammation has subsided. It is now known that immune cells and cytokines in the OM play important roles in both degeneration and regeneration of OSNs. Thus, the olfactory system is a unique neuroimmune interface where interaction between nervous and immune systems in the periphery significantly affects the structure, neuronal circuitry, and immunological status of the CNS. The mechanisms by which immune cells regulate OSN loss and the generation of new OSNs are, however, largely unknown. To help develop a better understanding of the mechanisms involved, we have provided a review of key research that has investigated how the immune response in the OM affects the pathophysiology of OSNs. PMID:27867383

  9. miRNAs associated with immune response in teleost fish.


    Andreassen, Rune; Høyheim, Bjørn


    MicroRNAs (miRNAs) have been identified as important post transcriptional regulators of gene expression. In higher vertebrates, a subset of miRNAs has been identified as important regulators of a number of key genes in immune system gene networks, and this paper review recent studies on miRNAs associated with immune response in teleost fish. Challenge studies conducted in several species have identified differently expressed miRNAs associated with viral or bacterial infection. The results from these studies point out several miRNAs that are likely to have evolutionary conserved functions that are related to immune response in teleost fish. Changed expression levels of mature miRNAs from the five miRNA genes miRNA-462, miRNA-731, miRNA-146, miRNA-181 and miRNA-223 are observed following viral as well as bacterial infection in several teleost fish. Furthermore, significant changes in expression of mature miRNAs from the five genes miRNA-21, miRNA-155, miRNA-1388, miRNA-99 and miRNA-100 are observed in multiple studies of virus infected fish while changes in expression of mature miRNA from the three genes miRNA-122, miRNA-192 and miRNA-451 are observed in several studies of fish with bacterial infections. Interestingly, some of these genes are not present in higher vertebrates. The function of the evolutionary conserved miRNAs responding to infection depends on the target gene(s) they regulate. A few target genes have been identified while a large number of target genes have been predicted by in silico analysis. The results suggest that many of the targets are genes from the host's immune response gene networks. We propose a model with expected temporal changes in miRNA expression if they target immune response activators/effector genes or immune response inhibitors, respectively. The best way to understand the function of a miRNA is to identify its target gene(s), but as the amount of genome resources for teleost fish is limited, with less well characterized genomes

  10. Effect of immunization route on mucosal and systemic immune response in Atlantic salmon (Salmo salar).


    Valdenegro-Vega, Victoria A; Crosbie, Philip; Vincent, Benita; Cain, Kenneth D; Nowak, Barbara F


    This study aimed to assess systemic and mucosal immune responses of Atlantic salmon (Salmo salar) exposed to two protein-hapten antigens - dinitrophenol (DNP) and fluorescein isothiocyanate (FITC) each conjugated with keyhole limpet haemocyanin (KLH) - administered using different delivery strategies. Fish were exposed to the antigens through different routes, and were given a booster 4 weeks post initial exposure. Both systemic and mucosal antibody responses were measured for a period of 12 weeks using an enzyme-linked immunosorbent assay (ELISA). Only fish exposed to both antigens via intraperitoneal (IP) injection showed increased systemic antibody response starting 6 weeks post immunization. No treatment was able to produce a mucosal antibody response; however there was an increase in antibody levels in the tissue supernatant from skin explants obtained 12 weeks post immunization from fish injected with FITC. Western blots probed with serum and culture supernatant from skin explants showed a specific response against the antigens. In conclusion, IP injection of hapten-antigen in Atlantic salmon was the best delivery route for inducing an antibody response against these antigens in this species. Even though IP injection did not induce an increase in antibody levels in the skin mucus, there was an increased systemic antibody response and an apparent increase of antibody production in mucosal tissues as demonstrated by the increased level of specific antibody levels in supernatants from the tissue explants.

  11. Immune Responses to Low Back Pain Risk Factors

    PubMed Central

    Splittstoesser, Riley E.; Marras, William S.; Best, Thomas M.


    Objective Investigate effects of interactions between biomechanical, psychosocial and individual risk factors on the body’s immune inflammatory responses. Background Current theories for low back pain causation do not fully account for the body’s response to tissue loading and tissue trauma. Methods Two groups possessing a preference for the sensor or intuitor personality trait performed repetitive lifting combined with high or low mental workload on separate occasions. Spinal loading was assessed using an EMG-assisted subject-specific biomechanical model and immune markers were collected before and after exposure. Results Mental workload was associated with a small decrease in AP shear. Both conditions were characterized by a regulated time-dependent immune response making use of markers of inflammation, tissue trauma and muscle damage. Intuitors’ creatine kinase levels were increased following low mental workload compared to that observed in Sensors with the opposite trend occurring for high mental workload. Conclusions A temporally regulated immune response to lifting combined with mental workload exists. This response is influenced by personality and mental workload. PMID:22317743

  12. Cytomegalovirus infection enhances the immune response to influenza.


    Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M


    Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species.

  13. A peptide mimotope of type 8 pneumococcal capsular polysaccharide induces a protective immune response in mice.


    Buchwald, Ulrike K; Lees, Andrew; Steinitz, Michael; Pirofski, Liise-Anne


    Increasing antibiotic resistance and a rising patient population at risk for infection due to impaired immunity underscore the importance of vaccination against pneumococci. However, available capsular polysaccharide vaccines are often poorly immunogenic in patients at risk for pneumococcal disease. The goal of this study was to explore the potential of peptide mimotopes to function as alternative vaccine antigens to elicit a type-specific antibody response to pneumococci. We used a human monoclonal immunoglobulin A (IgA) antibody (NAD) to type 8 Streptococcus pneumoniae capsular polysaccharide (type 8 PS) to screen a phage display library, and the phage PUB1 displaying the peptide FHLPYNHNWFAL was selected after three rounds of biopanning. Inhibition studies with phage-displayed peptide or the peptide PUB1 and type 8 PS showed that PUB1 is a mimetic of type 8 PS. PUB1 conjugated to tetanus toxoid (PUB1-TT) induced a type 8 PS-specific antibody response in BALB/c mice, further defining it as a mimotope of type 8 PS. The administration of immune sera obtained from PUB1-TT-immunized mice earlier (days 14 and 21) and later (days 87 and 100) after primary and reimmunization resulted in a highly significant prolongation of the survival of naive mice after pneumococcal challenge compared to controls. The survival of PUB1-TT-immunized mice was also prolonged after pneumococcal challenge nearly 4 months after primary immunization. The efficacy of PUB1-TT-induced immune sera provides proof of principle that a mimotope-induced antibody response can protect against pneumococci and suggests that peptide mimotopes selected by type-specific human antibodies could hold promise as immunogens for pneumococci.

  14. VAP-1-deficient mice display defects in mucosal immunity and antimicrobial responses: implications for antiadhesive applications.


    Koskinen, Kaisa; Nevalainen, Suvi; Karikoski, Marika; Hänninen, Arno; Jalkanen, Sirpa; Salmi, Marko


    VAP-1, an ecto-enzyme expressed on the surface of endothelial cells, is involved in leukocyte trafficking between the blood and tissues under physiological and pathological conditions. In this study, we used VAP-1-deficient mice to elucidate whether absence of VAP-1 alters the immune system under normal conditions and upon immunization and microbial challenge. We found that VAP-1-deficient mice display age-dependent paucity of lymphocytes, in the Peyer's patches of the gut. IgA concentration in serum was also found to be lower in VAP-1(-/-) animals than in wild-type mice. Although there were slightly less CD11a on B and T cells isolated from VAP-1-deficient mice than on those from wild-type mice, there were no differences in the expression of gut-homing-associated adhesion molecules or chemokine receptors. Because anti-VAP-1 therapies are being developed for clinical use to treat inflammation, we determined the effect of VAP-1 deletion on useful immune responses. Oral immunization with OVA showed defective T and B cell responses in VAP-1-deficient mice. Antimicrobial immune responses against Staphylococcus aureus and coxsackie B4 virus were also affected by the absence of VAP-1. Importantly, when the function of VAP-1 was acutely neutralized using small molecule enzyme inhibitors and anti-VAP-1 Abs rather than by gene deletion, no significant impairment in antimicrobial control was detected. In conclusion, VAP-1-deficient mice have mild deviations in the mucosal immune system and therapeutic targeting of VAP-1 does not appear to cause a generalized increase in the risk of infection.

  15. Immune Responses and Protection of Aotus Monkeys Immunized with Irradiated Plasmodium vivax Sporozoites

    PubMed Central

    Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates


    A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877

  16. Sialic acids siglec interaction: A unique strategy to circumvent innate immune response by pathogens

    PubMed Central

    Khatua, Biswajit; Roy, Saptarshi; Mandal, Chitra


    Sialic acids (Sias) are nine-carbon keto sugars primarily present on the terminal residue of cell surface glycans. Sialic acid binding immunoglobulins (Ig)-like lectins (siglecs) are generally expressed on various immune cells. They selectively recognize different linkage-specific sialic acids and undertake a variety of cellular functions. Many pathogens either synthesize or acquire sialic acids from the host. Sialylated pathogens generally use siglecs to manipulate the host immune response. The present review mainly deals with the newly developed information regarding mechanism of acquisition of sialic acids by pathogens and their biological relevance especially in the establishment of successful infection by impairing host innate immunity. The pathogens which are unable to synthesize sialic acids might adsorb these from the host as a way to engage the inhibitory siglecs. They promote association with the immune cells through sialic acids-siglec dependent manner. Such an association plays an important role to subvert host's immunity. Detailed investigation of these pathways has been discussed in this review. Particular attention has been focused on Pseudomonas aeruginosa (PA) and Leishmania donovani. PMID:24434319

  17. Recent progress in HIV vaccines inducing mucosal immune responses.


    Pavot, Vincent; Rochereau, Nicolas; Lawrence, Philip; Girard, Marc P; Genin, Christian; Verrier, Bernard; Paul, Stéphane


    In spite of several attempts over many years at developing a HIV vaccine based on classical strategies, none has convincingly succeeded to date. As HIV is transmitted primarily by the mucosal route, particularly through sexual intercourse, understanding antiviral immunity at mucosal sites is of major importance. An ideal vaccine should elicit HIV-specific antibodies and mucosal CD8⁺ cytotoxic T-lymphocyte (CTL) as a first line of defense at a very early stage of HIV infection, before the virus can disseminate into the secondary lymphoid organs in mucosal and systemic tissues. A primary focus of HIV preventive vaccine research is therefore the induction of protective immune responses in these crucial early stages of HIV infection. Numerous approaches are being studied in the field, including building upon the recent RV144 clinical trial. In this article, we will review current strategies and briefly discuss the use of adjuvants in designing HIV vaccines that induce mucosal immune responses.

  18. Adjuvant effects of saponins on animal immune responses*

    PubMed Central

    Rajput, Zahid Iqbal; Hu, Song-hua; Xiao, Chen-wen; Arijo, Abdullah G.


    Vaccines require optimal adjuvants including immunopotentiator and delivery systems to offer long term protection from infectious diseases in animals and man. Initially it was believed that adjuvants are responsible for promoting strong and sustainable antibody responses. Now it has been shown that adjuvants influence the isotype and avidity of antibody and also affect the properties of cell-mediated immunity. Mostly oil emulsions, lipopolysaccharides, polymers, saponins, liposomes, cytokines, ISCOMs (immunostimulating complexes), Freund’s complete adjuvant, Freund’s incomplete adjuvant, alums, bacterial toxins etc., are common adjuvants under investigation. Saponin based adjuvants have the ability to stimulate the cell mediated immune system as well as to enhance antibody production and have the advantage that only a low dose is needed for adjuvant activity. In the present study the importance of adjuvants, their role and the effect of saponin in immune system is reviewed. PMID:17323426

  19. The humoral immune response induced by snake venom toxins.


    da Silva, Wilmar Dias; Tambourgi, Denise V


    This review summarizes the key contributions to our knowledge regarding the immune response induced by snake venom toxins, focusing particularly on the production of antibodies and their venom-neutralizing effects. We cover the past and present state of the art of anti-snake venom production, followed by an overview of the venomous snakes and their venoms. The toxic properties of relevant snake venom toxins are approached in some details, with particular emphasis on the molecular domains responsible for binding to cells or plasma components in victims. The interactions of these domains are also reviewed, particularly the putatively relevant epitopes, along with the immune system and the resulting antibodies. We also review trials aimed at reducing the quantities of non-relevant antibodies in the antivenoms by substituting whole venoms with purified toxins to immunize animals, or the immunogenicity of the heterologous antivenom antibodies by humanizing their molecules.

  20. Induction and detection of immune responses by photoimmunotherapy

    NASA Astrophysics Data System (ADS)

    Chen, Wei R.; Bartels, Kenneth E.; Liu, Hong; Nordquist, Robert E.


    A specific method of photoimmunotherapy, using a combination of selective photothermal laser tissue interactions and an in situ immunoadjuvant, has showed promising results in pre-clinical studies. Its effect on untreated remote metastases is especially interesting. To understand the mechanism of the combination of laser therapy and immunotherapy, immune responses have been investigated. The following laser photoimmunotherapy-induced tumor-specific immunological activities have been observed in our studies. 1. The photoimmunotherapy-cured tumor-bearing animal could resist repeated, dose escalated tumor rechallenges. 2. The serum from cured animals showed tumor-specific antibodies to enhance the binding to the tumor cells. 3. The serum from cured animals could also serve as antibody sources to bind certain specific tumor proteins. 4. In vivo, the spleen cells from cured animals showed anti-tumor immunity that could be adoptively transferred. The methods and the results of these immune responses are summarized.

  1. Immune Responses and Protection of Aotus Monkeys Immunized with Irradiated Plasmodium vivax Sporozoites

    DTIC Science & Technology


    responses and protective efficacy induced by vacci- nation with irradiated P vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups...received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that...responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner.l11ese findings suggest that the

  2. Radiation, Inflammation, and Immune Responses in Cancer

    PubMed Central

    Multhoff, Gabriele; Radons, Jürgen


    Chronic inflammation has emerged as one of the hallmarks of cancer. Inflammation also plays a pivotal role in modulating radiation responsiveness of tumors. As discussed in this review, ionizing radiation (IR) leads to activation of several transcription factors modulating the expression of numerous mediators in tumor cells and cells of the microenvironment promoting cancer development. Novel therapeutic approaches thus aim to interfere with the activity or expression of these factors, either in single-agent or combinatorial treatment or as supplements of the existing therapeutic concepts. Among them, NF-κB, STAT-3, and HIF-1 play a crucial role in radiation-induced inflammatory responses embedded in a complex inflammatory network. A great variety of classical or novel drugs including nutraceuticals such as plant phytochemicals have the capacity to interfere with the inflammatory network in cancer and are considered as putative radiosensitizers. Thus, targeting the inflammatory signaling pathways induced by IR offers the opportunity to improve the clinical outcome of radiation therapy by enhancing radiosensitivity and decreasing putative metabolic effects. Since inflammation and sex steroids also impact tumorigenesis, a therapeutic approach targeting glucocorticoid receptors and radiation-induced production of tumorigenic factors might be effective in sensitizing certain tumors to IR. PMID:22675673

  3. A Drosophila immune response against Ras-induced overgrowth

    PubMed Central

    Hauling, Thomas; Krautz, Robert; Markus, Robert; Volkenhoff, Anne; Kucerova, Lucie; Theopold, Ulrich


    ABSTRACT Our goal is to characterize the innate immune response against the early stage of tumor development. For this, animal models where genetic changes in specific cells and tissues can be performed in a controlled way have become increasingly important, including the fruitfly Drosophila melanogaster. Many tumor mutants in Drosophila affect the germline and, as a consequence, also the immune system itself, making it difficult to ascribe their phenotype to a specific tissue. Only during the past decade, mutations have been induced systematically in somatic cells to study the control of tumorous growth by neighboring cells and by immune cells. Here we show that upon ectopic expression of a dominant-active form of the Ras oncogene (RasV12), both imaginal discs and salivary glands are affected. Particularly, the glands increase in size, express metalloproteinases and display apoptotic markers. This leads to a strong cellular response, which has many hallmarks of the granuloma-like encapsulation reaction, usually mounted by the insect against larger foreign objects. RNA sequencing of the fat body reveals a characteristic humoral immune response. In addition we also identify genes that are specifically induced upon expression of RasV12. As a proof-of-principle, we show that one of the induced genes (santa-maria), which encodes a scavenger receptor, modulates damage to the salivary glands. The list of genes we have identified provides a rich source for further functional characterization. Our hope is that this will lead to a better understanding of the earliest stage of innate immune responses against tumors with implications for mammalian immunity. PMID:24659248

  4. Durable and sustained immune tolerance to ERT in Pompe disease with entrenched immune responses

    PubMed Central

    Kazi, Zoheb B.; Prater, Sean N.; Kobori, Joyce A.; Viskochil, David; Bailey, Carrie; Gera, Renuka; Stockton, David W.; McIntosh, Paul; Rosenberg, Amy S.; Kishnani, Priya S.


    BACKGROUND. Enzyme replacement therapy (ERT) has prolonged survival and improved clinical outcomes in patients with infantile Pompe disease (IPD), a rapidly progressive neuromuscular disorder. Yet marked interindividual variability in response to ERT, primarily attributable to the development of antibodies to ERT, remains an ongoing challenge. Immune tolerance to ongoing ERT has yet to be described in the setting of an entrenched immune response. METHODS. Three infantile Pompe patients who developed high and sustained rhGAA IgG antibody titers (HSAT) and received a bortezomib-based immune tolerance induction (ITI) regimen were included in the study and were followed longitudinally to monitor the long-term safety and efficacy. A trial to taper the ITI protocol was attempted to monitor if true immune tolerance was achieved. RESULTS. Bortezomib-based ITI protocol was safely tolerated and led to a significant decline in rhGAA antibody titers with concomitant sustained clinical improvement. Two of the 3 IPD patients were successfully weaned off all ITI protocol medications and continue to maintain low/no antibody titers. ITI protocol was significantly tapered in the third IPD patient. B cell recovery was observed in all 3 IPD patients. CONCLUSION. This is the first report to our knowledge on successful induction of long-term immune tolerance in patients with IPD and HSAT refractory to agents such as cyclophosphamide, rituximab, and methotrexate, based on an approach using the proteasome inhibitor bortezomib. As immune responses limit the efficacy and cost-effectiveness of therapy for many conditions, proteasome inhibitors may have new therapeutic applications. FUNDING. This research was supported by a grant from the Genzyme Corporation, a Sanofi Company (Cambridge, Massachusetts, USA), and in part by the Lysosomal Disease Network, a part of NIH Rare Diseases Clinical Research Network (RDCRN). PMID:27493997

  5. HTLV-1, Immune Response and Autoimmunity.


    Quaresma, Juarez A S; Yoshikawa, Gilberto T; Koyama, Roberta V L; Dias, George A S; Fujihara, Satomi; Fuzii, Hellen T


    Human T-lymphotropic virus type-1 (HTLV-1) infection is associated with adult T-cell leukemia/lymphoma (ATL). Tropical spastic paraparesis/HTLV-1-associated myelopathy (PET/HAM) is involved in the development of autoimmune diseases including Rheumatoid Arthritis (RA), Systemic Lupus Erythematosus (SLE), and Sjögren's Syndrome (SS). The development of HTLV-1-driven autoimmunity is hypothesized to rely on molecular mimicry, because virus-like particles can trigger an inflammatory response. However, HTLV-1 modifies the behavior of CD4⁺ T cells on infection and alters their cytokine production. A previous study showed that in patients infected with HTLV-1, the activity of regulatory CD4⁺ T cells and their consequent expression of inflammatory and anti-inflammatory cytokines are altered. In this review, we discuss the mechanisms underlying changes in cytokine release leading to the loss of tolerance and development of autoimmunity.

  6. HTLV-1, Immune Response and Autoimmunity

    PubMed Central

    Quaresma, Juarez A S; Yoshikawa, Gilberto T; Koyama, Roberta V L; Dias, George A S; Fujihara, Satomi; Fuzii, Hellen T


    Human T-lymphotropic virus type-1 (HTLV-1) infection is associated with adult T-cell leukemia/lymphoma (ATL). Tropical spastic paraparesis/HTLV-1-associated myelopathy (PET/HAM) is involved in the development of autoimmune diseases including Rheumatoid Arthritis (RA), Systemic Lupus Erythematosus (SLE), and Sjögren’s Syndrome (SS). The development of HTLV-1-driven autoimmunity is hypothesized to rely on molecular mimicry, because virus-like particles can trigger an inflammatory response. However, HTLV-1 modifies the behavior of CD4+ T cells on infection and alters their cytokine production. A previous study showed that in patients infected with HTLV-1, the activity of regulatory CD4+ T cells and their consequent expression of inflammatory and anti-inflammatory cytokines are altered. In this review, we discuss the mechanisms underlying changes in cytokine release leading to the loss of tolerance and development of autoimmunity. PMID:26712781

  7. Sharing the burden: antigen transport and firebreaks in immune responses.


    Handel, Andreas; Yates, Andrew; Pilyugin, Sergei S; Antia, Rustom


    Communication between cells is crucial for immune responses. An important means of communication during viral infections is the presentation of viral antigen on the surface of an infected cell. Recently, it has been shown that antigen can be shared between infected and uninfected cells through gap junctions, connexin-based channels, that allow the transport of small molecules. The uninfected cell receiving antigen can present it on its surface. Cells presenting viral antigen are detected and killed by cytotoxic T lymphocytes. The killing of uninfected cells can lead to increased immunopathology. However, the immune response might also profit from killing those uninfected bystander cells. One benefit might be the removal of future 'virus factories'. Another benefit might be through the creation of 'firebreaks', areas void of target cells, which increase the diffusion time of free virions, making their clearance more likely. Here, we use theoretical models and simulations to explore how the mechanism of gap junction-mediated antigen transport (GMAT) affects the dynamics of the virus and immune response. We show that under the assumption of a well-mixed system, GMAT leads to increased immunopathology, which always outweighs the benefit of reduced virus production due to the removal of future virus factories. By contrast, a spatially explicit model leads to quite different results. Here we find that the firebreak mechanism reduces both viral load and immunopathology. Our study thus shows the potential benefits of GMAT and illustrates how spatial effects may be crucial for the quantitative understanding of infection dynamics and immune responses.

  8. Regulation of the acute phase and immune responses

    SciTech Connect

    Sehgal, P.B.; Grieninger, G.; Tosato, G.


    This book contains the conference entitled Regulation of the acute phase and immune responses: Interleukin-L. Topics covered include: Interferon-B{sub 2}/26kDa Protein, Regulation of acute phase liver gene expression, and Genetics and regulation of expression of IL-6.

  9. Suppression of the Immune Response by Synthetic Adjuvants.

    DTIC Science & Technology



  10. Immune Response Genotypes and Risk of Young Adult Hodgkin Lymphoma

    DTIC Science & Technology


    1) To identify, enroll and collect blood specimens from 368 adolescents and young adults 18 years of age or older at the time of participation... Young Adult Hodgkin Lymphoma PRINCIPAL INVESTIGATOR: Wendy Cozen, Victoria Cortessis...COVERED 1 Sep 2007 – 31 Aug 2008 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Immune Response Genotypes and Risk of Young Adult Hodgkin Lymphoma 5b

  11. Immune Response to Plasmid- and Chromosome-Encoded Yersinia Antigens,

    DTIC Science & Technology

    The immune response of humans and mice to temperature-specific, plasmid- or chromosome-encoded proteins of Yersinia pestis and Yersinia ... enterocolitica was investigated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting. Extracts from Y. pestis and Y. enterocolitica

  12. Radiation-induced augmentation of the immune response

    SciTech Connect

    Anderson, R.E.; Lefkovits, I.; Troup, G.M.


    Radiation-induced augmentation of the immune response has been shown to occur both in vivo and in vitro. Evidence is presented to implicate injury to an extremely radiosensitive T cell in the expression of this phenomenon. Experiments are outlined which could be employed to support or reflect this hypothesis.

  13. Francisella tularensis Catalase Restricts Immune Function by Impairing TRPM2 Channel Activity.


    Shakerley, Nicole L; Chandrasekaran, Akshaya; Trebak, Mohamed; Miller, Barbara A; Melendez, J Andrés


    As an innate defense mechanism, macrophages produce reactive oxygen species that weaken pathogens and serve as secondary messengers involved in immune function. The Gram-negative bacterium Francisella tularensis utilizes its antioxidant armature to limit the host immune response, but the mechanism behind this suppression is not defined. Here we establish that F. tularensis limits Ca(2+) entry in macrophages, thereby limiting actin reorganization and IL-6 production in a redox-dependent fashion. Wild type (live vaccine strain) or catalase-deficient F. tularensis (ΔkatG) show distinct profiles in their H2O2 scavenging rates, 1 and 0.015 pm/s, respectively. Murine alveolar macrophages infected with ΔkatG display abnormally high basal intracellular Ca(2+) concentration that did not increase further in response to H2O2. Additionally, ΔkatG-infected macrophages displayed limited Ca(2+) influx in response to ionomycin, as a result of ionophore H2O2 sensitivity. Exogenously added H2O2 or H2O2 generated by ΔkatG likely oxidizes ionomycin and alters its ability to transport Ca(2+). Basal increases in cytosolic Ca(2+) and insensitivity to H2O2-mediated Ca(2+) entry in ΔkatG-infected cells are reversed by the Ca(2+) channel inhibitors 2-aminoethyl diphenylborinate and SKF-96365. 2-Aminoethyl diphenylborinate but not SKF-96365 abrogated ΔkatG-dependent increases in macrophage actin remodeling and IL-6 secretion, suggesting a role for H2O2-mediated Ca(2+) entry through the transient receptor potential melastatin 2 (TRPM2) channel in macrophages. Indeed, increases in basal Ca(2+), actin polymerization, and IL-6 production are reversed in TRPM2-null macrophages infected with ΔkatG. Together, our findings provide compelling evidence that F. tularensis catalase restricts reactive oxygen species to temper macrophage TRPM2-mediated Ca(2+) signaling and limit host immune function.

  14. Immune Responses to Intestinal Microbes in Inflammatory Bowel Diseases.


    Hansen, Jonathan J


    Inflammatory bowel diseases (IBDs), including Crohn's disease and ulcerative colitis, are characterized by chronic, T-cell-mediated inflammation of the gastrointestinal tract that can cause significant, lifelong morbidity. Data from both human and animal studies indicate that IBDs are likely caused by dysregulated immune responses to resident intestinal microbes. Certain products from mycobacteria, fungi, and Clostridia stimulate increased effector T cell responses during intestinal inflammation, whereas other bacterial products from Clostridia and Bacteroides promote anti-inflammatory regulatory T cell responses. Antibody responses to bacterial and fungal components may help predict the severity of IBDs. While most currently approved treatments for IBDs generally suppress the patient's immune system, our growing understanding of microbial influences in IBDs will likely lead to the development of new diagnostic tools and therapies that target the intestinal microbiota.

  15. Tumor PDT-associated immune response: relevance of sphingolipids

    NASA Astrophysics Data System (ADS)

    Korbelik, Mladen; Merchant, Soroush; Separovic, Duska M.


    Sphingolipids have become recognized as essential effector molecules in signal transduction with involvement in various aspects of cell function and death, immune response and cancer treatment response. Major representatives of sphingolipids family, ceramide, sphingosine and sphingosine-1-phosphate (S1P), have attracted interest in their relevance to tumor response to photodynamic therapy (PDT) because of their roles as enhancers of apoptosis, mediators of cell growth and vasculogenesis, and regulators of immune response. Our recent in vivo studies with mouse tumor models have confirmed that PDT treatment has a pronounced impact on sphingolipid profile in the targeted tumor and that significant advances in therapeutic gain with PDT can be attained by combining this modality with adjuvant treatment with ceramide analog LCL29.

  16. Sulfated polysaccharides and immune response: promoter or inhibitor?


    Chen, D; Wu, X Z; Wen, Z Y


    Sulfated polysaccharides, which frequently connect to core protein, are expressed not only on cell surface but also throughout the extracellular matrix. Besides providing structural integrity of cells, sulfated polysaccharides interact with a variety of sulfated polysaccharides-binding proteins, such as growth factors, cytokines, chemokines and proteases. Sulfated polysaccharides play two-edged roles, inhibitor and promoter, in immune response. Some sulfated polysaccharides act as the immunosuppressor by blocking inflammatory signal transduction induced by proinflammatory cytokines, suppressing the activation of complement and inhibiting the process that leukocytes adhere to and pass through endothelium. On the contrary, the interaction between immune cells and sulfated polysaccharides produced by bacteria, endothelial cells and immune cells initiate the occurrence of immune response. It promotes the processes of recognizing and arresting antigen, migrating transendothelium, moving into and out of immune organ and enhancing the proliferation of lymphocyte. The structure of sulfated polysaccharides, such as molecular weight and sulfated sites heterogeneity, especially the degree of disaccharide sulfation, position of the sulfate moiety and organization of sulfated domains, may play critical role in their controversial effects. As a consequence, the interaction between sulfated polysaccharides and sulfated polysaccharide-binding proteins may be changed by modifying the structure of sulfated polysaccharides chains. The administration of drug targeting sulfated polysaccharide-protein interaction may be useful in treating inflammatory related diseases.

  17. Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease

    NASA Astrophysics Data System (ADS)

    Sun, Jun; Deem, Michael


    The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross-reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system a balance has evolved between binding affinity and specificity in the mechanism for searching the amino acid sequence space of antibodies. Our model predicts that chronic infection may lead to autoimmune disease as well due to cross-reactivity and suggests a broad distribution for the time of onset of autoimmune disease due to chronic exposure. The slow search of antibody sequence space by point mutation leads to the broad of distribution times.

  18. The Immune Response to Sand Fly Salivary Proteins and Its Influence on Leishmania Immunity

    PubMed Central

    Gomes, Regis; Oliveira, Fabiano


    Leishmaniasis is a vector-borne disease transmitted by bites of phlebotomine sand flies. During Leishmania transmission, sand fly saliva is co-inoculated with parasites into the skin of the mammalian host. Sand fly saliva consists of roughly thirty different salivary proteins, many with known roles linked to blood feeding facilitation. Apart from the anti-hemostatic capacity of saliva, several sand fly salivary proteins have been shown to be immunogenic. Immunization with a single salivary protein or exposure to uninfected bites was shown to result in a protective immune response against leishmaniasis. Antibodies to saliva were not required for this protection. A strong body of evidence points to the role for saliva-specific T cells producing IFN-γ in the form of a delayed-type hypersensitivity reaction at the bite site as the main protective response. Herein, we review the immunity to sand fly salivary proteins in the context of its vector–parasite–host combinations and their vaccine potential, as well as some recent advances to shed light on the mechanism of how an immune response to sand fly saliva protects against leishmaniasis. PMID:22593758

  19. Immune Response to Electromagnetic Fields through Cybernetic Modeling

    NASA Astrophysics Data System (ADS)

    Godina-Nava, J. J.; Segura, M. A. Rodríguez; Cadena, S. Reyes; Sierra, L. C. Gaitán


    We study the optimality of the humoral immune response through a mathematical model, which involves the effect of electromagnetic fields over the large lymphocytes proliferation. Are used the so called cybernetic variables in the context of the matching law of microeconomics or mathematical psychology, to measure the large lymphocytes population and to maximize the instantaneous antibody production rate in time during the immunologic response in order to most efficiently inactivate the antigen.

  20. Immune Response to Electromagnetic Fields through Cybernetic Modeling

    SciTech Connect

    Godina-Nava, J. J.; Segura, M. A. Rodriguez; Cadena, S. Reyes; Sierra, L. C. Gaitan


    We study the optimality of the humoral immune response through a mathematical model, which involves the effect of electromagnetic fields over the large lymphocytes proliferation. Are used the so called cybernetic variables in the context of the matching law of microeconomics or mathematical psychology, to measure the large lymphocytes population and to maximize the instantaneous antibody production rate in time during the immunologic response in order to most efficiently inactivate the antigen.

  1. Role of Activin A in Immune Response to Breast Cancer

    DTIC Science & Technology


    20Gyx1. Data indicate that fractionated RT can mimic, at least in part, a viral infection and activate canonical defense pathways in neoplastic...and CXCL11 by TSA cells irradiated with 8Gyx3 but not 20Gyx1. Data indicate that fractionated RT can mimic, at least in part, a viral infection and...activate canonical path- ways of response to infections and potentially elicit powerful antitumor innate and adaptive immune responses. The changes

  2. The endogenous immune response modulates the course of IgA-immune complex mediated nephropathy.


    Chao, T-K; Rifai, A; Ka, S-M; Yang, S-M; Shui, H-A; Lin, Y-F; Sytwu, H-K; Lee, W-H; Kung, J T; Chen, A


    In animal models of IgA nephropathy, the inevitable endogenous immune response to passively administered antigens alone or in complex with specific IgA mask the exact role each might play in pathogenesis. To delineate the role the immune response might play, we have developed a passive model with exclusive IgA-immune complex-mediated nephropathy in B-cell-deficient (BCD) mice. Glomerular IgA immune deposits were induced by administration of purified IgA antiphosphorylcholine and the specific pneumococcal C-polysaccharide (PnC) antigen daily for 2 weeks into BCD and wild-type (WT) mice. In BCD mice IgA+PnC deposits induced severe glomerular injury and renal dysfunction. In contrast, WT mice developed intense glomerular IgG and IgM and C3 co-deposits of the IgA+PnC with significantly less renal injury. Cytofluorometric analysis revealed that PnC induced in BCD, but not in WT, a rapid and dramatic increase in number of activated CD3(+)/CD69(+) T-cell population. The nuclear factor-kappa B (NF-kappaB) transcription factor was activated early and progressively increased in response to glomerular IgA+PnC deposits. These results suggest that nephritogenic IgA+PnC immune deposits induce glomerular and renal dysfunction through activation of the NF-kappaB. This inflammatory pathway is modulated by the endogenous cellular and antibody response to the antigen affecting the course of IgA nephropathy progression.

  3. Bifidobacterium bifidum PRL2010 Modulates the Host Innate Immune Response

    PubMed Central

    Turroni, Francesca; Taverniti, Valentina; Ruas-Madiedo, Patricia; Duranti, Sabrina; Guglielmetti, Simone; Lugli, Gabriele Andrea; Gioiosa, Laura; Palanza, Paola; Margolles, Abelardo; van Sinderen, Douwe


    Here, we describe data obtained from transcriptome profiling of human cell lines and intestinal cells of a murine model upon exposure and colonization, respectively, with Bifidobacterium bifidum PRL2010. Significant changes were detected in the transcription of genes that are known to be involved in innate immunity. Furthermore, results from enzyme-linked immunosorbent assays (ELISAs) showed that exposure to B. bifidum PRL2010 causes enhanced production of interleukin 6 (IL-6) and IL-8 cytokines, presumably through NF-κB activation. The obtained global transcription profiles strongly suggest that Bifidobacterium bifidum PRL2010 modulates the innate immune response of the host. PMID:24242237

  4. Reprogramming immune responses via microRNA modulation

    PubMed Central

    Cubillos-Ruiz, Juan R.; Rutkowski, Melanie R; Tchou, Julia; Conejo-Garcia, Jose R.


    It is becoming increasingly clear that there are unique sets of miRNAs that have distinct governing roles in several aspects of both innate and adaptive immune responses. In addition, new tools allow selective modulation of the expression of individual miRNAs, both in vitro and in vivo. Here, we summarize recent advances in our understanding of how miRNAs drive the activity of immune cells, and how their modulation in vivo opens new avenues for diagnostic and therapeutic interventions in multiple diseases, from immunodeficiency to cancer. PMID:25285232

  5. The Influence of Innate and Adaptive Immune Responses on Atherosclerosis

    PubMed Central

    Witztum, Joseph L.; Lichtman, Andrew H.


    Both the chronic development of atherosclerotic lesions and the acute changes in lesion phenotype that lead to clinical cardiovascular events are significantly influenced by the innate and adaptive immune responses to lipoprotein deposition and oxidation in the arterial wall. The rapid pace of discovery of mechanisms of immunologic recognition, effector functions, and regulation has significantly influenced the study of atherosclerosis, and our new knowledge is beginning to affect how we treat this ubiquitous disease. In this review, we discuss recent advances in our understanding of how innate and adaptive immunity contribute to atherosclerosis, as well as therapeutic opportunities that arise from this knowledge. PMID:23937439

  6. [Association of ocular inflammation and innate immune response].


    Sonoda, Koh-Hei


    Immune response has been divided into innate immunity and acquired immunity. We focused on the role of innate immunity during the formation of uveitis and choroidal neovascularization (CNV)-related diseases. To carry out a comprehensive analysis of ocular inflammatory responses in patients with uveitis, vitreous fluid was analyzed using a microbead-based multiplex ELIZA system. We found that cytokines which were related with innate immunity were elevated, but cytokines which were related with acquired immunity were not. We also found that the role of IL-17 was to produce Th17 cells in the chronic phase of experimental uveitis. Next, we investigated the role of the natural killer (NK) T cells which restrict CD1 and participate in the innate immune response in laser-induced experimental CNV. We studied the CNV formation in two independent NK T cell-deficient strains of mice, CD1 knockout (KO) mice and Jalpha18 KO mice, and found that both KO mice showed significant reduction of the effects of experimental CNV. After laser treatment, both CD1 KO mice and Jalpha18 KO mice showed a decrease in the expression of vascular endothelial growth factor (VEGF) expression in retina and choroid. Interestingly, intravitreous inoculation of a galactosylceramide (alphaGalCer), which is the ligand of NK Tcells, inhibited CNV in C57BL6 mice. Collectively, we conclude that NK T cells play an important role in forming CNV as one of the inducers of VEGS. Because NK T cells bear the potential to regulate immune response, alphaGalCer might activate NK T cells differently to produce angiostatic factors and have a therapeutic potential in vivo. During the clinical process of CNV-related diseases, not only CNV formation, but also subretinal scarring is thought to be another important step. We thus established the experimental model of subretinal scaring by injecting peritoneal exudating macrophases into the subretinal space. This scaring was inhibited by inoculation of anti-IL-6 antibody and

  7. Control of immune response by amino acid metabolism.


    Grohmann, Ursula; Bronte, Vincenzo


    The interaction between pathogenic microorganisms and their hosts is regulated by reciprocal survival strategies, including competition for essential nutrients. Though paradoxical, mammalian hosts have learned to take advantage of amino acid catabolism for controlling pathogen invasion and, at the same time, regulating their own immune responses. In this way, ancient catabolic enzymes have acquired novel functions and evolved into new structures with highly specialized functions, which go beyond the struggle for survival. In this review, we analyze the evidence supporting a critical role for the metabolism of various amino acids in regulating different steps of both innate and adaptive immunity.

  8. Increased oxidative stress and impaired antioxidant response in Lafora disease.


    Romá-Mateo, Carlos; Aguado, Carmen; García-Giménez, José Luis; Ibáñez-Cabellos, José Santiago; Seco-Cervera, Marta; Pallardó, Federico V; Knecht, Erwin; Sanz, Pascual


    Lafora disease (LD, OMIM 254780, ORPHA501) is a fatal neurodegenerative disorder characterized by the presence of glycogen-like intracellular inclusions called Lafora bodies and caused, in the vast majority of cases, by mutations in either EPM2A or EPM2B genes, encoding respectively laforin and malin. In the last years, several reports have revealed molecular details of these two proteins and have identified several processes affected in LD, but the pathophysiology of the disease still remains largely unknown. Since autophagy impairment has been reported as a characteristic treat in both Lafora disease cell and animal models, and as there is a link between autophagy and mitochondrial performance, we sought to determine if mitochondrial function could be altered in those models. Using fibroblasts from LD patients, deficient in laforin or malin, we found mitochondrial alterations, oxidative stress and a deficiency in antioxidant enzymes involved in the detoxification of reactive oxygen species (ROS). Similar results were obtained in brain tissue samples from transgenic mice deficient in either the EPM2A or EPM2B genes. Furthermore, in a proteomic analysis of brain tissue obtained from Epm2b-/- mice, we observed an increase in a modified form of peroxiredoxin-6, an antioxidant enzyme involved in other neurological pathologies, thus corroborating an alteration of the redox condition. These data support that oxidative stress produced by an increase in ROS production and an impairment of the antioxidant enzyme response to this stress play an important role in development of LD.

  9. Effect of age and maternal antibodies on the systemic and mucosal immune response after neonatal immunization in a porcine model

    PubMed Central

    Guzman-Bautista, Edgar R; Garcia-Ruiz, Carlos E; Gama-Espinosa, Alicia L; Ramirez-Estudillo, Carmen; Rojas-Gomez, Oscar I; Vega-Lopez, Marco A


    Newborn mammals are highly susceptible to respiratory infections. Although maternal antibodies (MatAb) offer them some protection, they may also interfere with their systemic immune response to vaccination. However, the impact of MatAb on the neonatal mucosal immune response remains incompletely described. This study was performed to determine the effect of ovalbumin (OVA)-specific MatAb on the anti-OVA antibody response in sera, nasal secretions and saliva from specific pathogen-free Vietnamese miniature piglets immunized at 7 or 14 days of age. Our results demonstrated that MatAb increased antigen-specific IgA and IgG responses in sera, and transiently enhanced an early secretory IgA response in nasal secretions of piglets immunized at 7 days of age. In contrast, we detected a lower mucosal (nasal secretion and saliva) anti-OVA IgG response in piglets with MatAb immunized at 14 days of age, compared with piglets with no MatAb, suggesting a modulatory effect of antigen-specific maternal factors on the isotype transfer to the mucosal immune exclusion system. In our porcine model, we demonstrated that passive maternal immunity positively modulated the systemic and nasal immune responses of animals immunized early in life. Our results, therefore, open the possibility of inducing systemic and respiratory mucosal immunity in the presence of MatAb through early vaccination. PMID:24754050

  10. Stimulating immune responses to fight cancer: Basic biology and mechanisms.


    O'Byrne, Kenneth


    Chronic inflammation is now recognized as a major cause of malignant disease. In concert with various mechanisms (including DNA instability), hypoxia and activation of inflammatory bioactive lipid pathways and pro-inflammatory cytokines open the doorway to malignant transformation and proliferation, angiogenesis, and metastasis in many cancers. A balance between stimulatory and inhibitory signals regulates the immune response to cancer. These include inhibitory checkpoints that modulate the extent and duration of the immune response and may be activated by tumor cells. This contributes to immune resistance, especially against tumor antigen-specific T-cells. Targeting these checkpoints is an evolving approach to cancer immunotherapy, designed to foster an immune response. The current focus of these trials is on the programmed cell death protein 1 (PD-1) receptor and its ligands (PD-L1, PD-L2) and cytotoxic T-lymphocyte-associated protein 4 (CTLA-4). Researchers have developed anti-PD-1 and anti-PDL-1 antibodies that interfere with the ligands and receptor and allow the tumor cell to be recognized and attacked by tumor-infiltrating T-cells. These are currently being studied in lung cancer. Likewise, CTLA-4 inhibitors, which have had success treating advanced melanoma, are being studied in lung cancer with encouraging results.

  11. Bacillus cereus var. toyoi enhanced systemic immune response in piglets.


    Schierack, Peter; Wieler, Lothar H; Taras, David; Herwig, Volker; Tachu, Babila; Hlinak, Andreas; Schmidt, Michael F G; Scharek, Lydia


    Probiotic bacteria have been suggested to stimulate the host immune system. In this study we evaluated the immunomodulatory effects of probiotic Bacillus cereus var. toyoi on the systemic immunity of piglets. A pool of 70 piglets was divided into a probiotic or control group. We determined the ratios of peripheral blood mononuclear cell (PBMC) subsets and measured proliferative responses and cytokine production of PBMCs and effects on vaccination responses. Blood samples of probiotic-treated piglets showed a significantly lower frequency of CD8(high)/CD3+ T cells and CD8(low)/CD3+ T cells and a significant higher CD4+/CD8+ ratio. IL-4 and IFN-gamma production of polyclonally stimulated PBMCs was on average higher in the probiotic group. Specific proliferative responses of PBMCs to Influenza vaccination antigens were significantly higher and antibody titers against H3N2 Influenza and Mycoplasma vaccination antigens were on average higher in the probiotic group. In conclusion, B. cereus var. toyoi therefore alters the immune status of piglets as indicated by changes in the ratios as well as functionalities of systemic immune cell populations.

  12. RNA Editing, ADAR1, and the Innate Immune Response

    PubMed Central

    Wang, Qingde; Li, Xiaoni; Qi, Ruofan; Billiar, Timothy


    RNA editing, particularly A-to-I RNA editing, has been shown to play an essential role in mammalian embryonic development and tissue homeostasis, and is implicated in the pathogenesis of many diseases including skin pigmentation disorder, autoimmune and inflammatory tissue injury, neuron degeneration, and various malignancies. A-to-I RNA editing is carried out by a small group of enzymes, the adenosine deaminase acting on RNAs (ADARs). Only three members of this protein family, ADAR1–3, exist in mammalian cells. ADAR3 is a catalytically null enzyme and the most significant function of ADAR2 was found to be in editing on the neuron receptor GluR-B mRNA. ADAR1, however, has been shown to play more significant roles in biological and pathological conditions. Although there remains much that is not known about how ADAR1 regulates cellular function, recent findings point to regulation of the innate immune response as an important function of ADAR1. Without appropriate RNA editing by ADAR1, endogenous RNA transcripts stimulate cytosolic RNA sensing receptors and therefore activate the IFN-inducing signaling pathways. Overactivation of innate immune pathways can lead to tissue injury and dysfunction. However, obvious gaps in our knowledge persist as to how ADAR1 regulates innate immune responses through RNA editing. Here, we review critical findings from ADAR1 mechanistic studies focusing on its regulatory function in innate immune responses and identify some of the important unanswered questions in the field. PMID:28106799

  13. Host Immune Status and Response to Hepatitis E Virus Infection

    PubMed Central

    Krain, Lisa J.; Nelson, Kenrad E.


    SUMMARY Hepatitis E virus (HEV), identified over 30 years ago, remains a serious threat to life, health, and productivity in developing countries where access to clean water is limited. Recognition that HEV also circulates as a zoonotic and food-borne pathogen in developed countries is more recent. Even without treatment, most cases of HEV-related acute viral hepatitis (with or without jaundice) resolve within 1 to 2 months. However, HEV sometimes leads to acute liver failure, chronic infection, or extrahepatic symptoms. The mechanisms of pathogenesis appear to be substantially immune mediated. This review covers the epidemiology of HEV infection worldwide, the humoral and cellular immune responses to HEV, and the persistence and protection of antibodies produced in response to both natural infection and vaccines. We focus on the contributions of altered immune states (associated with pregnancy, human immunodeficiency virus [HIV], and immunosuppressive agents used in cancer and transplant medicine) to the elevated risks of chronic infection (in immunosuppressed/immunocompromised patients) and acute liver failure and mortality (among pregnant women). We conclude by discussing outstanding questions about the immune response to HEV and interactions with hormones and comorbid conditions. These questions take on heightened importance now that a vaccine is available. PMID:24396140

  14. Inflammation and immune response in COPD: where do we stand?


    Rovina, Nikoletta; Koutsoukou, Antonia; Koulouris, Nikolaos G


    Increasing evidence indicates that chronic inflammatory and immune responses play key roles in the development and progression of COPD. Recent data provide evidence for a role in the NLRP3 inflammasome in the airway inflammation observed in COPD. Cigarette smoke activates innate immune cells by triggering pattern recognition receptors (PRRs) to release "danger signal". These signals act as ligands to Toll-like receptors (TLRs), triggering the production of cytokines and inducing innate inflammation. In smokers who develop COPD there appears to be a specific pattern of inflammation in the airways and parenchyma as a result of both innate and adaptive immune responses, with the predominance of CD8+ and CD4+ cells, and in the more severe disease, with the presence of lymphoid follicles containing B lymphocytes and T cells. Furthermore, viral and bacterial infections interfere with the chronic inflammation seen in stable COPD and exacerbations via pathogen-associated molecular patterns (PAMPs). Finally, autoimmunity is another novel aspect that may play a critical role in the pathogenesis of COPD. This review is un update of the currently discussed roles of inflammatory and immune responses in the pathogenesis of COPD.

  15. Immunization with Brucella VirB Proteins Reduces Organ Colonization in Mice through a Th1-Type Immune Response and Elicits a Similar Immune Response in Dogs

    PubMed Central

    Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.


    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276

  16. Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th1-type immune response and elicits a similar immune response in dogs.


    Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C


    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs.

  17. Impaired and imbalanced cellular immunological status assessed in advanced cancer patients and restoration of the T cell immune status by adoptive T-cell immunotherapy.


    Noguchi, Atsutaka; Kaneko, Toru; Naitoh, Keiko; Saito, Masashi; Iwai, Kazuro; Maekawa, Ryuji; Kamigaki, Takashi; Goto, Shigenori


    Recent progress has been made in understanding the mechanisms of antitumor immune responses, which may further clarify the immune status of cancer patients. In this study, we performed a detailed evaluation of the immunological status of 47 patients with advanced solid cancer, who had received no immunosuppressive treatment, and compared the results with 32 healthy subjects. Flow-cytometry data for peripheral blood were obtained using 19 monoclonal antibodies against various cell surface and intracellular molecules. Absolute numbers of T cells, several T cell subsets, B cells, and NK cells were significantly decreased in patients compared with healthy subjects. The percentage of CD27(+)CD45RA(+) T cells was lower and that of CD27(-)CD45RA(-) T cells was higher in patients compared with controls. Regulatory and type 2 helper T cells were elevated in patients relative to healthy subjects. The percentage of perforin(+) NK cells was significantly lower in patients than in controls. These results suggest a dysfunctional anti-tumor immune response in cancer patients. Furthermore, peripheral blood from 26 of 47 cancer patients was analyzed after adoptive T cell immunotherapy (ATI). ATI increased the number of T cell subsets, but not B and NK cells. The number and percentage of regulatory T cells decreased significantly. These results suggest that ATI can restore impaired and imbalanced T cell immune status.

  18. Immune marker CD68 correlates with cognitive impairment in normally aged rats.


    Farso, Mark; Ménard, Caroline; Colby-Milley, Jessica; Quirion, Rémi


    The relationship between heightened neuroinflammation and cognitive decline in the normally aged brain is still debatable, as most data are derived from insult-related models. Accordingly, the aim of the current study was to determine whether a link could be established for 2 immune markers at the post-transcriptional level; CD68 and MHC-II, in a normally aged (24-month-old) rat population discriminated for their learning abilities. Using the Morris Water Maze (MWM) task, aged rats were divided into aged learning-impaired (AI) or -unimpaired (AU) groups. Western immunoblots of hippocampal tissue revealed a significant increase of CD68 in AI rats compared to the AU group. Moreover, up-regulated CD68 expression correlated with increased latency times in the MWM task. Immunofluorescence for CD68 revealed intense staining in the white matter regions and CA3 subregion of the hippocampus in the AI group. Despite expression of MHC-II in the AI group, no correlation was found. Overall, these data suggest that CD68 could play a role associated with cognitive decline in a subgroup of the normally aged population.

  19. Carpal tunnel syndrome impairs index finger responses to unpredictable perturbations.


    Grandy, Emily L; Xiu, Kaihua; Marquardt, Tamara L; Li, Chengliu; Evans, Peter J; Li, Zong-Ming


    The fine-tuning of digit forces to object properties can be disrupted by carpal tunnel syndrome (CTS). CTS' effects on hand function have mainly been investigated using predictable manipulation tasks; however, unpredictable perturbations are commonly encountered during manual tasks, presenting situations which may be more challenging to CTS patients given their hand impairments. The purpose of this study was to investigate muscle and force responses of the index finger to unpredictable perturbations in patients with CTS. Nine CTS patients and nine asymptomatic controls were instructed to stop the movement of a sliding plate by increasing index finger force following an unexpected perturbation. The electrical activity of the first dorsal interosseous muscle and forces exerted by the index finger were recorded. CTS patients demonstrated 20.9% greater muscle response latency and 12.0% greater force response latency compared to controls (p<0.05). The duration of plate sliding was significantly different between groups (p<0.05); the CTS group's duration was 142.2±5.8ms compared to the control group's duration of 133.1±8.4ms. Although CTS patients had increased muscle and force response durations comparatively, these differences were not statistically significant. Findings from this study suggest CTS-induced sensorimotor deficits interfere with accurate detection, processing and response to unpredictable perturbations. These deficits could be accounted for at multiple levels of the peripheral and central nervous systems. Delayed and decreased responses may indicate inefficient object manipulation by CTS patients and may help to explain why CTS patients tend to drop objects.

  20. Immune Response to Coccidioidomycosis and the Development of a Vaccine

    PubMed Central

    Castro-Lopez, Natalia; Hung, Chiung-Yu


    Coccidioidomycosis is a fungal infection caused by Coccidioides posadasii and Coccidioides immitis. It is estimated that 150,000 new infections occur in the United States each year. The incidence of this infection continues to rise in endemic regions. There is an urgent need for the development of better therapeutic drugs and a vaccine against coccidioidomycosis. This review discusses the features of host innate and adaptive immune responses to Coccidioides infection. The focus is on the recent advances in the immune response and host-pathogen interactions, including the recognition of spherules by the host and defining the signal pathways that guide the development of the adaptive T-cell response to Coccidioides infection. Also discussed is an update on progress in developing a vaccine against these fungal pathogens. PMID:28300772

  1. Autophagy and the regulation of the immune response.


    Valdor, Rut; Macian, Fernando


    Autophagy is a highly conserved mechanism of lysosomal-mediated protein degradation that plays a crucial role in maintaining cellular homeostasis by recycling amino acids, reducing the amount of damaged proteins and regulating protein levels in response to extracellular signals. In the last few years specific functions for different forms of autophagy have been identified in many tissues and organs. In the Immune System, autophagy functions range from the elimination infectious agents and the modulation of the inflammatory response, to the selection of antigens for presentation and the regulation of T cell homeostasis and activation. Here, we review the recent advances that have allowed us to better understand why autophagy is a crucial process in the regulation of the innate and adaptive immune responses.

  2. Genomics of immune response to typhoid and cholera vaccines.


    Majumder, Partha P


    Considerable variation in antibody response (AR) was observed among recipients of an injectable typhoid vaccine and an oral cholera vaccine. We sought to find whether polymorphisms in genes of the immune system, both innate and adaptive, were associated with the observed variation in response. For both vaccines, we were able to discover and validate several polymorphisms that were significantly associated with immune response. For the typhoid vaccines, these polymorphisms were on genes that belonged to pathways of polysaccharide recognition, signal transduction, inhibition of T-cell proliferation, pro-inflammatory signalling and eventual production of antimicrobial peptides. For the cholera vaccine, the pathways included epithelial barrier integrity, intestinal homeostasis and leucocyte recruitment. Even though traditional wisdom indicates that both vaccines should act as T-cell-independent antigens, our findings reveal that the vaccines induce AR using different pathways.

  3. Immune Responses Associated with Resistance to Haemonchosis in Sheep

    PubMed Central

    Alba-Hurtado, Fernando; Muñoz-Guzmán, Marco Antonio


    This paper examines the known immunological and genetic factors associated with sheep resistance to infection by Haemonchus contortus. Such resistance is an inheritable genetic trait (h2, 0.22–0.63) associated with certain sheep breeds. Resistant sheep do not completely reject the disease; they only harbor fewer parasites than susceptible sheep and therefore have a lower fecal egg count. Protective immune response to haemonchosis is an expression of genetic resistance. Genes associated with resistance and susceptibility are described. Genetically resistant sheep have nonspecific mechanisms that block the initial colonization by Haemonchus contortus larvae. These sheep also have an efficacious Th2 type response (e.g., increases in blood and tissue eosinophils, specific IgE class antibodies, mast cells, IL-5, IL-13, and TNFα) that protects them against the infection; in contrast, susceptible sheep do not efficiently establish this type of immune response. Finally, the main reported antigens of H. contortus were reviewed. PMID:23509684

  4. B lymphocyte immune response gene phenotype is genetically determined

    SciTech Connect

    Tse, H.Y.; Mond, J.J.; Longo, D.L.


    We examined the effects of the developmental milieu on the capacity of B cells to undergo immune response gene-controlled, T cell-dependent polyclonal proliferation. Although I-Aq poly(Glu60 Ala30 Tyr10)n (GAT)-nonresponder T cells developing in a responder environment become phenotypic GAT-responders, I-Aq B cells remain unresponsive to GAT, even after maturation in a GAT-responder animal. Conversely, (B10.A x B10.Q)F1 ((GAT responder x GAT nonresponder)F1) T cells developing in a B10.Q GAT nonresponder host fail to respond to GAT, but F1 B cells from the same F1 leads to parent chimeras make excellent proliferative responses in the presence of GAT and responder T cells. Thus, by this assay, B cell immune response gene function is genetically determined and is not affected by the developmental milieu.

  5. Immune response triggered by Brucella abortus following infection or vaccination.


    Dorneles, Elaine M S; Teixeira-Carvalho, Andréa; Araújo, Márcio S S; Sriranganathan, Nammalwar; Lage, Andrey P


    Brucella abortus live vaccines have been used successfully to control bovine brucellosis worldwide for decades. However, due to some limitations of these live vaccines, efforts are being made for the development of new safer and more effective vaccines that could also be used in other susceptible species. In this context, understanding the protective immune responses triggered by B. abortus is critical for the development of new vaccines. Such understandings will enhance our knowledge of the host/pathogen interactions and enable to develop methods to evaluate potential vaccines and innovative treatments for animals or humans. At present, almost all the knowledge regarding B. abortus specific immunological responses comes from studies in mice. Active participation of macrophages, dendritic cells, IFN-γ producing CD4(+) T-cells and cytotoxic CD8(+) T-cells are vital to overcome the infection. In this review, we discuss the characteristics of the immune responses triggered by vaccination versus infection by B. abortus, in different hosts.

  6. The Reticular Cell Network: A Robust Backbone for Immune Responses

    PubMed Central

    Textor, Johannes; Mandl, Judith N.; de Boer, Rob J.


    Lymph nodes are meeting points for circulating immune cells. A network of reticular cells that ensheathe a mesh of collagen fibers crisscrosses the tissue in each lymph node. This reticular cell network distributes key molecules and provides a structure for immune cells to move around on. During infections, the network can suffer damage. A new study has now investigated the network’s structure in detail, using methods from graph theory. The study showed that the network is remarkably robust to damage: it can still support immune responses even when half of the reticular cells are destroyed. This is a further important example of how network connectivity achieves tolerance to failure, a property shared with other important biological and nonbiological networks. PMID:27727272

  7. Glycan-Based Cell Targeting To Modulate Immune Responses.


    Johannssen, Timo; Lepenies, Bernd


    Glycosylation is an integral post-translational modification present in more than half of all eukaryotic proteins. It affects key protein functions, including folding, stability, and immunogenicity. Glycoengineering approaches, such as the use of bacterial N-glycosylation systems, or expression systems, including yeasts, insect cells, and mammalian cells, have enabled access to defined and homogenous glycoproteins. Given that glycan structures on proteins can be recognized by host lectin receptors, they may facilitate cell-specific targeting and immune modulation. Myeloid C-type lectin receptors (CLRs) expressed by antigen-presenting cells are attractive targets to shape immune responses. Multivalent glycan display on nanoparticles, liposomes, or dendrimers has successfully enabled CLR targeting. In this review, we discuss novel strategies to access defined glycan structures and highlight CLR targeting approaches for immune modulation.

  8. Profiling the host immune response to tuberculosis vaccines.


    Fletcher, Helen A


    There is an urgent need for improved vaccines for protection against tuberculosis (TB) disease and an immune correlate of protection would aid in the design, development and testing of a new TB vaccine candidates. The immune response to TB is likely to be multi-factorial and transcriptional profiling is a potentially useful tool for the simultaneous measurement of multiple immune processes. Although there are 16 candidate TB vaccines in clinical development the only published transcriptomics studies are from the MVA85A trials. With the publication of transcriptional signatures from the South African adolescent cohort study and the GC6 consortium also expected in 2015 the next year could see an increase of interest in the use of transcriptomics in TB vaccine development.

  9. Radiation-induced immune responses: mechanisms and therapeutic perspectives

    PubMed Central

    Jeong, Hoibin; Bok, Seoyeon; Hong, Beom-Ju; Choi, Hyung-Seok


    Recent advancement in the radiotherapy technology has allowed conformal delivery of high doses of ionizing radiation precisely to the tumors while sparing large volume of the normal tissues, which have led to better clinical responses. Despite this technological advancement many advanced tumors often recur and they do so within the previously irradiated regions. How could tumors recur after receiving such high ablative doses of radiation? In this review, we outlined how radiation can elicit anti-tumor responses by introducing some of the cytokines that can be induced by ionizing radiation. We then discuss how tumor hypoxia, a major limiting factor responsible for failure of radiotherapy, may also negatively impact the anti-tumor responses. In addition, we highlight how there may be other populations of immune cells including regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and tumor-associated macrophages (TAMs) that can be recruited to tumors interfering with the anti-tumor immunity. Finally, the impact of irradiation on tumor hypoxia and the immune responses according to different radiotherapy regimen is also delineated. It is indeed an exciting time to see that radiotherapy is being combined with immunotherapy in the clinic and we hope that this review can add an excitement to the field. PMID:27722125

  10. B cells enhance early innate immune responses during bacterial sepsis

    PubMed Central

    Kelly-Scumpia, Kindra M.; Scumpia, Philip O.; Weinstein, Jason S.; Delano, Matthew J.; Cuenca, Alex G.; Nacionales, Dina C.; Wynn, James L.; Lee, Pui Y.; Kumagai, Yutaro; Efron, Philip A.; Akira, Shizuo; Wasserfall, Clive; Atkinson, Mark A.


    Microbes activate pattern recognition receptors to initiate adaptive immunity. T cells affect early innate inflammatory responses to viral infection, but both activation and suppression have been demonstrated. We identify a novel role for B cells in the early innate immune response during bacterial sepsis. We demonstrate that Rag1−/− mice display deficient early inflammatory responses and reduced survival during sepsis. Interestingly, B cell–deficient or anti-CD20 B cell–depleted mice, but not α/β T cell–deficient mice, display decreased inflammatory cytokine and chemokine production and reduced survival after sepsis. Both treatment of B cell–deficient mice with serum from wild-type (WT) mice and repletion of Rag1−/− mice with B cells improves sepsis survival, suggesting antibody-independent and antibody-dependent roles for B cells in the outcome to sepsis. During sepsis, marginal zone and follicular B cells are activated through type I interferon (IFN-I) receptor (IFN-α/β receptor [IFNAR]), and repleting Rag1−/− mice with WT, but not IFNAR−/−, B cells improves IFN-I–dependent and –independent early cytokine responses. Repleting B cell–deficient mice with the IFN-I–dependent chemokine, CXCL10 was also sufficient to improve sepsis survival. This study identifies a novel role for IFN-I–activated B cells in protective early innate immune responses during bacterial sepsis. PMID:21746813

  11. Immune responses of patients to orf virus infection.


    Yirrell, D L; Vestey, J P; Norval, M


    Orf is a disease of sheep and goats which is caused by a parapox virus. It can be transmitted to humans, and is considered an occupational hazard by those handling sheep. In this paper we present the first report of both cell-mediated and humoral immune responses to naturally acquired orf virus infection in humans. Lymphoproliferative responses of peripheral blood mononuclear cells of patients to an orf virus antigen were vigorous soon after infection, but rapidly declined. Orf virus antibody levels, detected by ELISA, were shown to rise during infection. Western blot analysis confirmed this, and demonstrated that the antibody produced in response to the infection was directed against the 40-kDa viral surface tubule protein. Where direct comparisons were possible, the immune response of humans to orf virus infection was similar to that previously reported for sheep. Evidence was obtained suggesting that prior exposure to vaccinia virus (smallpox vaccination) provided no protection from subsequent orf virus infection. In addition, orf virus infection did not enhance immune responses to vaccinia virus antigens.

  12. Immune response in Dobrava-Belgrade virus infections.


    Tsergouli, Katerina; Papa, Anna


    Dobrava-Belgrade virus (DOBV) is a hantavirus that causes a disease in humans known as hemorrhagic fever with renal syndrome. Hallmarks of hantaviral infections are increased vascular permeability due to dysregulation of the endothelial cell barrier and acute thrombocytopenia. In order to gain insight into the immune response in DOBV infections, the serum levels of 27 cytokines in 24 hospitalized Greek HFRS patients were evaluated. Compared to the control group, significantly higher IL-1ra, IL-6, IL-8, IL-9, IL-10, GM-CSF, IP-10, MIP-1b, TNF-α and VEGF levels were found in severe cases, while in non-severe cases, IL-13 and TNF-α levels were significantly higher (p < 0.05). In all groups, IP-10 was increased and RANTES was decreased. Significant and time- (after onset of illness) dependent differences among fatal, severe and non-severe cases were seen. VEGF was positively associated with disease severity. A strong immune response was seen during the first week of illness, especially in severe cases, while the response in non-severe cases was weaker and delayed. The Th1 response was strong in non-severe cases and weak in the fatal case, while a mixed Th1/Th2 immune response was seen in the survivors of severe disease.

  13. Innate and adaptive immune responses against Staphylococcus aureus skin infections.


    Krishna, Sheila; Miller, Lloyd S


    Staphylococcus aureus is an important human pathogen that is responsible for the vast majority of bacterial skin and soft tissue infections in humans. S. aureus can also become more invasive and cause life-threatening infections such as bacteremia, pneumonia, abscesses of various organs, meningitis, osteomyelitis, endocarditis, and sepsis. These infections represent a major public health threat due to the enormous numbers of these infections and the widespread emergence of methicillin-resistant S. aureus (MRSA) strains. MSRA is endemic in hospitals worldwide and is rapidly spreading throughout the normal human population in the community. The increasing frequency of MRSA infections has complicated treatment as these strains are more virulent and are increasingly becoming resistant to multiple different classes of antibiotics. The important role of the immune response against S. aureus infections cannot be overemphasized as humans with certain genetic and acquired immunodeficiency disorders are at an increased risk for infection. Understanding the cutaneous immune responses against S. aureus is essential as most of these infections occur or originate from a site of infection or colonization of the skin and mucosa. This review will summarize the innate immune responses against S. aureus skin infections, including antimicrobial peptides that have direct antimicrobial activity against S. aureus as well as pattern recognition receptors and proinflammatory cytokines that promote neutrophil abscess formation in the skin, which is required for bacterial clearance. Finally, we will discuss the recent discoveries involving IL-17-mediated responses, which provide a key link between cutaneous innate and adaptive immune responses against S. aureus skin infections.

  14. Inhibition of Local Immune Responses by the Frog-Killing Fungus Batrachochytrium dendrobatidis

    PubMed Central

    Fites, J. Scott; Reinert, Laura K.; Chappell, Timothy M.


    Amphibians are suffering unprecedented global declines. A leading cause is the infectious disease chytridiomycosis caused by the chytrid fungus Batrachochytrium dendrobatidis. Chytridiomycosis is a skin disease which disrupts transport of essential ions leading to death. Soluble factors produced by B. dendrobatidis impair amphibian and mammalian lymphocytes in vitro, but previous studies have not shown the effects of these inhibitory factors in vivo. To demonstrate in vivo inhibition of immunity by B. dendrobatidis, a modified delayed-type-hypersensitivity (DTH) protocol was developed to induce innate and adaptive inflammatory swelling in the feet of Xenopus laevis by injection of killed bacteria or phytohemagglutinin (PHA). Compared to previous protocols for PHA injection in amphibians, this method induced up to 20-fold greater inflammatory swelling. Using this new protocol, we measured DTH responses induced by killed bacteria or PHA in the presence of B. dendrobatidis supernatants. Swelling induced by single injection of PHA or killed bacteria was not significantly affected by B. dendrobatidis supernatants. However, swelling caused by a secondary injection of PHA, was significantly reduced by B. dendrobatidis supernatants. As previously described in vitro, factors from B. dendrobatidis appear to inhibit lymphocyte-mediated inflammatory swelling but not swelling caused by an inducer of innate leukocytes. This suggests that B. dendrobatidis is capable of inhibiting lymphocytes in a localized response to prevent adaptive immune responses in the skin. The modified protocol used to induce inflammatory swelling in the present study may be more effective than previous methods to investigate amphibian immune competence, particularly in nonmodel species. PMID:25156734

  15. Innate and adaptive immune responses to in utero infection with bovine viral diarrhea virus.


    Hansen, Thomas R; Smirnova, Natalia P; Webb, Brett T; Bielefeldt-Ohmann, Helle; Sacco, Randy E; Van Campen, Hana


    Infection of pregnant cows with noncytopathic (ncp) bovine viral diarrhea virus (BVDV) induces rapid innate and adaptive immune responses, resulting in clearance of the virus in less than 3 weeks. Seven to 14 days after inoculation of the cow, ncpBVDV crosses the placenta and induces a fetal viremia. Establishment of persistent infection with ncpBVDV in the fetus has been attributed to the inability to mount an immune response before 90-150 days of gestational age. The result is 'immune tolerance', persistent viral replication and shedding of ncpBVDV. In contrast, we describe the chronic upregulation of fetal Type I interferon (IFN) pathway genes and the induction of IFN-γ pathways in fetuses of cows infected on day 75 of gestation. Persistently infected (PI) fetal IFN-γ concentrations also increased at day 97 at the peak of fetal viremia and IFN-γ mRNA was significantly elevated in fetal thymus, liver and spleen 14-22 days post maternal inoculation. PI fetuses respond to ncpBVDV infection through induction of Type I IFN and IFN-γ activated genes leading to a reduction in ncpBVDV titer. We hypothesize that fetal infection with BVDV persists because of impaired induction of IFN-γ in the face of activated Type I IFN responses. Clarification of the mechanisms involved in the IFN-associated pathways during BVDV fetal infection may lead to better detection methods, antiviral compounds and selection of genetically resistant breeding animals.

  16. Drosophila Rab14 mediates phagocytosis in the immune response to Staphylococcus aureus

    PubMed Central

    Garg, Aprajita; Wu, Louisa P.


    Drosophila hemocytes are essential for the animal to resist Staphylococcus aureus infections. Phagocytosis is a central component of the hemocyte-mediated immune response. It involves regulated interaction between the phagocytic and the endocytic compartments. Rab GTPases are pivotal for the membrane trafficking and fusion events, and thus are often targets of intracellular pathogens that subvert phagocytosis. An in vivo screen identified Rab2 and Rab14 as candidates for proteins regulating phagosome maturation. Since Rab14 is often targeted by intracellular pathogens, an understanding of its function during phagocytosis and the overall immune response can give insight into the pathogenesis of intracellular microbes. We generated a Drosophila Rab14 mutant and characterized the resulting immune defects in animals and specifically in hemocytes in response to an S. aureus infection. Hemocyte based immunofluorescence studies indicate that Rab14 is recruited to the phagosome and like Rab7, a well-characterized regulator of the phagocytic pathway, is essential for progression of phagosome maturation. Rab14 mutant hemocytes show impaired recruitment of Rab7 and of a lysosomal marker onto S. aureus phagosomes. The defect in phagocytosis is associated with higher bacterial load and increased susceptibility to S. aureus in the animal. PMID:24119134

  17. Cellular Stress Response and Immune Signaling in Retinal Ischemia–Reperfusion Injury

    PubMed Central

    Minhas, Gillipsie; Sharma, Jyoti; Khan, Nooruddin


    Ischemia–reperfusion injury is a well-known pathological hallmark associated with diabetic retinopathy, glaucoma, and other related retinopathies that ultimately can lead to visual impairment and vision loss. Retinal ischemia pathogenesis involves a cascade of detrimental events that include energy failure, excitotoxic damage, calcium imbalance, oxidative stress, and eventually cell death. Retina for a long time has been known to be an immune privileged site; however, recent investigations reveal that retina, as well as the central nervous system, elicits immunological responses during various stress cues. Stress condition, such as reperfusion of blood supply post-ischemia results in the sequestration of different immune cells, inflammatory mediators including cytokines, chemokines, etc., to the ischemic region, which in turn facilitates induction of inflammatory conditions in these tissues. The immunological activation during injury or stress per se is beneficial for repair and maintenance of cellular homeostasis, but whether the associated inflammation is good or bad, during ischemia–reperfusion injury, hitherto remains to be explored. Keeping all these notions in mind, the current review tries to address the immune response and host stress response mechanisms involved in ischemia–reperfusion injury with the focus on the retina. PMID:27822213

  18. Immune response to measles vaccine in Peruvian children.

    PubMed Central

    Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.


    OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811

  19. The innate and adaptive immune response to avian influenza virus infections and vaccines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protective immunity against viruses is mediated by the early innate immune responses and later on by the adaptive immune responses. The early innate immunity is designed to contain and limit virus replication in the host, primarily through cytokine and interferon production. Most all cells are cap...

  20. How B cells shape the immune response against Mycobacterium tuberculosis.


    Maglione, Paul J; Chan, John


    Extensive work illustrating the importance of cellular immune mechanisms for protection against Mycobacterium tuberculosis has largely relegated B-cell biology to an afterthought within the tuberculosis (TB) field. However, recent studies have illustrated that B lymphocytes, through a variety of interactions with the cellular immune response, play previously underappreciated roles in shaping host defense against non-viral intracellular pathogens, including M. tuberculosis. Work in our laboratory has recently shown that, by considering these lymphocytes more broadly within their variety of interactions with cellular immunity, B cells have a significant impact on the outcome of airborne challenge with M. tuberculosis as well as the resultant inflammatory response. In this review, we advocate for a revised view of TB immunology in which roles of cellular and humoral immunity are not mutually exclusive. In the context of our current understanding of host defense against non-viral intracellular infections, we review recent data supporting a more significant role of B cells during M. tuberculosis infection than previously thought.

  1. Responses of innate immune cells to group A Streptococcus.


    Fieber, Christina; Kovarik, Pavel


    Group A Streptococcus (GAS), also called Streptococcus pyogenes, is a Gram-positive beta-hemolytic human pathogen which causes a wide range of mostly self-limiting but also several life-threatening diseases. Innate immune responses are fundamental for defense against GAS, yet their activation by pattern recognition receptors (PRRs) and GAS-derived pathogen-associated molecular patterns (PAMPs) is incompletely understood. In recent years, the use of animal models together with the powerful tools of human molecular genetics began shedding light onto the molecular mechanisms of innate immune defense against GAS. The signaling adaptor MyD88 was found to play a key role in launching the immune response against GAS in both humans and mice, suggesting that PRRs of the Toll-like receptor (TLR) family are involved in sensing this pathogen. The specific TLRs and their ligands have yet to be identified. Following GAS recognition, induction of cytokines such as TNF and type I interferons (IFNs), leukocyte recruitment, phagocytosis, and the formation of neutrophil extracellular traps (NETs) have been recognized as key events in host defense. A comprehensive knowledge of these mechanisms is needed in order to understand their frequent failure against GAS immune evasion strategies.

  2. Polychlorinated Biphenyls (PCB 101, 153, and 180) Impair Murine Macrophage Responsiveness to Lipopolysaccharide: Involvement of NF-κB Pathway.


    Santoro, Anna; Ferrante, Maria C; Di Guida, Francesca; Pirozzi, Claudio; Lama, Adriano; Simeoli, Raffaele; Clausi, Maria T; Monnolo, Anna; Mollica, Maria Pina; Mattace Raso, Giuseppina; Meli, Rosaria


    Non-dioxin-like (NDL) polychlorinated biphenyls (PCBs) are persistent organic pollutants, associated with a range of adverse health effects, including interference with the immune system. In this study, we investigate the capability of NDL-PCBs 101, 153, and 180, 3 of the 6 NDL-PCBs defined as indicators, to impair the immune response in lipopolysaccharide (LPS)-activated J774A.1 and primary murine macrophages. Our results clearly demonstrate that the exposure of J774A.1 and primary macrophages to NDL-PCB 153 or 180 or all NDL-PCBs mixtures causes a significant reduction in LPS-induced cytokine/chemokine synthesis, such as tumor necrosis factor-α and interleukin-6, together with monocyte chemoattractant protein-1, involved in cell recruitment. Moreover, PCBs were found to suppress LPS-stimulated NO production, and to reduce cyclooxygenase-2 and inducible nitric oxide synthase expression in J774A.1 and primary macrophages. At mechanistic level, PCBs significantly counteract the LPS-driven toll-like receptor (TLR) 4 and CD14 upregulation, therefore inhibiting downstream nuclear factor-κB (NF-κB) activation in J774A.1. Furthermore, PCBs determine a significant loss of macrophage endocytic capacity, a prerequisite for efficient antigen presentation. Taken together, these data indicate that NDL-PCBs reduce macrophage responsiveness, particularly when they are combined at concentrations per se inactive, impairing the capability to orchestrate a proper immune response to an infectious stimulus, disrupting TLR4/NF-κB pathway.

  3. Inhibition of the immune response to experimental fresh osteoarticular allografts

    SciTech Connect

    Rodrigo, J.J.; Schnaser, A.M.; Reynolds, H.M. Jr.; Biggart, J.M. 3d.; Leathers, M.W.; Chism, S.E.; Thorson, E.; Grotz, T.; Yang, Q.M. )


    The immune response to osteoarticular allografts is capable of destroying the cartilage--a tissue that has antigens on its cells identical to those on the bone and marrow cells. Osteoarticular allografts of the distal femur were performed in rats using various methods to attempt to temporarily inhibit the antibody response. The temporary systemic immunosuppressant regimens investigated were cyclophosphamide, azathioprine and prednisolone, cyclosporine A, and total lymphoid irradiation. The most successful appeared to be cyclosporine A, but significant side effects were observed. To specifically inhibit the immune response in the allograft antigens without systemically inhibiting the entire immune system, passive enhancement and preadministration of donor blood were tried. Neither was as effective as coating the donor bone with biodegradable cements, a method previously found to be successful. Cyclosporine A was investigated in dogs in a preliminary study of medial compartmental knee allografts and was found to be successful in inhibiting the antibody response and in producing a more successful graft; however, some significant side effects were similarly observed.

  4. Plasmodium activates the innate immune response of Anopheles gambiae mosquitoes.

    PubMed Central

    Richman, A M; Dimopoulos, G; Seeley, D; Kafatos, F C


    Innate immune-related gene expression in the major disease vector mosquito Anopheles gambiae has been analyzed following infection by the malaria parasite, Plasmodium berghei. Substantially increased levels of mRNAs encoding the antibacterial peptide defensin and a putative Gram-negative bacteria-binding protein (GNBP) are observed 20-30 h after ingestion of an infected blood-meal, at a time which indicates that this induction is a response to parasite invasion of the midgut epithelium. The induction is dependent upon the ingestion of infective, sexual-stage parasites, and is not due to opportunistic co-penetration of resident gut micro-organisms into the hemocoel. The response is activated following infection both locally (in the midgut) and systemically (in remaining tissues, presumably fat body and/or hemocytes). The observation that Plasmodium can trigger a molecularly defined immune response in the vector constitutes an important advance in our understanding of parasite-vector interactions that are potentially involved in malaria transmission, and extends knowledge of the innate immune system of insects to encompass responses to protozoan parasites. PMID:9321391

  5. Regulation of Cellular Immune Responses in Sepsis by Histone Modifications.


    Carson, W F; Kunkel, S L


    Severe sepsis, septic shock, and related inflammatory syndromes are driven by the aberrant expression of proinflammatory mediators by immune cells. During the acute phase of sepsis, overexpression of chemokines and cytokines drives physiological stress leading to organ failure and mortality. Following recovery from sepsis, the immune system exhibits profound immunosuppression, evidenced by an inability to produce the same proinflammatory mediators that are required for normal responses to infectious microorganisms. Gene expression in inflammatory responses is influenced by the transcriptional accessibility of the chromatin, with histone posttranslational modifications determining whether inflammatory gene loci are set to transcriptionally active, repressed, or poised states. Experimental evidence indicates that histone modifications play a central role in governing the cytokine storm of severe sepsis, and that aberrant chromatin modifications induced during the acute phase of sepsis may mediate chronic immunosuppression in sepsis survivors. This review will focus on the role of histone modifications in governing immune responses in severe sepsis, with an emphasis on specific leukocyte subsets and the histone modifications observed in these cells during chronic stages of sepsis. Additionally, the expression and function of chromatin-modifying enzymes (CMEs) will be discussed in the context of severe sepsis, as potential mediators of epigenetic regulation of gene expression in sepsis responses. In summary, this review will argue for the use of chromatin modifications and CME expression in leukocytes as potential biomarkers of immunosuppression in patients with severe sepsis.

  6. The Immune Response to Blood-Group Substances

    PubMed Central

    Holborow, E. J.; Loewi, G.


    Guinea pigs were immunized with purified human A and Lea blood-group substances. Skin testing revealed a delayed hypersensitivity response to A and Lea and other human blood-group substances, showing a very marked degree of cross-reactivity, irrespective of the immunizing antigen. Circulating antibody was tested for by eliciting systemic anaphylaxis, by direct cutaneous anaphylaxis using a dye-spreading method, and by the passive cutaneous anaphylaxis test of Ovary. Precipitation and red-cell agglutination tests were also employed. It was found that immunization with A substance consistently produced a major specific anti-A antibody and a minor separate antibody specific for Lea. Immunization with Lea substance did not consistently give rise to detectable circulating antibody. In those animals, however, in which antibody to Lea was found, a reaction with A substance could also be shown. These results could be explained in terms of a small amount of Lea activity in A substance, as revealed by agglutination-inhibition and P.C.A. tests. The results indicate that the polypeptide part of blood-group mucopolysaccharides is the entity chiefly concerned in producing and eliciting delayed hypersensitivity to these substances. The cross-reactivity of the delayed response supports the view that the different human blood-group mucopolysaccharides share a similar polypeptide component. The more precise nature of the circulating antibody is explicable in terms of a response to the specific polysaccharide entity of blood-group substances. These findings are considered in the light of previous work on the relationship of delayed hypersensitivity to the circulating antibody response. The question of a possible delayed response to carbohydrate antigen is left unanswered. PMID:13908295

  7. Inflammation and breast cancer. Balancing immune response: crosstalk between adaptive and innate immune cells during breast cancer progression

    PubMed Central

    DeNardo, David G; Coussens, Lisa M


    Recent insights into the molecular and cellular mechanisms underlying cancer development have revealed that immune cells functionally regulate epithelial cancer development and progression. Moreover, accumulated clinical and experimental data indicate that the outcome of an immune response toward an evolving breast neoplasm is largely determined by the type of immune response elicited. Acute tumor-directed immune responses involving cytolytic T lymphocytes appear to protect against tumor development, whereas immune responses involving chronic activation of humoral immunity, infiltration by Th2 cells, and protumor-polarized innate inflammatory cells result in the promotion of tumor development and disease progression. Herein we review this body of literature and summarize important new findings revealing the paradoxical role of innate and adaptive leukocytes as regulators of breast carcinogenesis. PMID:17705880

  8. The Immune Response to Epstein Barr Virus and Implications for Posttransplant Lymphoproliferative Disorder.


    Martinez, Olivia M; Krams, Sheri M


    Posttransplant lymphoproliferative disorder (PTLD) is a serious complication in organ transplant recipients and is most often associated with the Epstein Barr virus (EBV). EBV is a common gammaherpes virus with tropism for B lymphocytes and infection in immunocompetent individuals is typically asymptomatic and benign. However, infection in immunocompromised or immunosuppressed individuals can result in malignant B cell lymphoproliferations such as PTLD. EBV+ PTLD can arise following primary EBV infection, or because of reactivation of a prior infection, and represents a leading malignancy in the transplant population. The incidence of EBV+ PTLD is variable depending on the organ transplanted and whether the recipient has preexisting immunity to EBV but can be as high as 20%. It is generally accepted that impaired immune function due to immunosuppression is a primary cause of EBV+ PTLD. In this overview, we review the EBV life cycle and discuss our current understanding of the immune response to EBV in healthy, immunocompetent individuals, in transplant recipients, and in PTLD patients. We review the strategies that EBV utilizes to subvert and evade host immunity and discuss the implications for the development of EBV+ PTLD.

  9. Interactions between negative energy balance, metabolic diseases, uterine health and immune response in transition dairy cows.


    Esposito, Giulia; Irons, Pete C; Webb, Edward C; Chapwanya, Aspinas


    The biological cycles of milk production and reproduction determine dairying profitability thus making management decisions dynamic and time-dependent. Diseases also negatively impact on net earnings of a dairy enterprise. Transition cows in particular face the challenge of negative energy balance (NEB) and/or disproportional energy metabolism (fatty liver, ketosis, subacute, acute ruminal acidosis); disturbed mineral utilization (milk fever, sub-clinical hypocalcemia); and perturbed immune function (retained placenta, metritis, mastitis). Consequently NEB and reduced dry matter intake are aggravated. The combined effects of all these challenges are reduced fertility and milk production resulting in diminishing profits. Risk factors such as NEB, inflammation and impairment of the immune response are highly cause-and-effect related. Thus, managing cows during the transition period should be geared toward reducing NEB or feeding specially formulated diets to improve immunity. Given that all cows experience a reduced feed intake and body condition, infection and inflammation of the uterus after calving, there is a need for further research on the immunology of transition dairy cows. Integrative approaches at the molecular, cellular and animal level may unravel the complex interactions between disturbed metabolism and immune function that predispose cows to periparturient diseases.

  10. The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.


    Griffin, Diane E


    Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.

  11. The Immune Response in Measles: Virus Control, Clearance and Protective Immunity

    PubMed Central

    Griffin, Diane E.


    Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10–14 days. The first appearance of the disease is a 2–3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4+ and CD8+ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity. PMID:27754341

  12. Chicken Immune Response after In Ovo Immunization with Chimeric TLR5 Activating Flagellin of Campylobacter jejuni

    PubMed Central

    Radomska, Katarzyna A.; Vaezirad, Mahdi M.; Verstappen, Koen M.; Wösten, Marc M. S. M.; Wagenaar, Jaap A.; van Putten, Jos P. M.


    Campylobacter jejuni is the main cause of bacterial food-borne diseases in developed countries. Chickens are the most important source of human infection. Vaccination of poultry is an attractive strategy to reduce the number of C. jejuni in the intestinal tract of chickens. We investigated the immunogenicity and protective efficacy of a recombinant C. jejuni flagellin-based subunit vaccine with intrinsic adjuvant activity. Toll-like receptor activation assays demonstrated the purity and TLR5 stimulating (adjuvant) activity of the vaccine. The antigen (20–40 μg) was administered in ovo to 18 day-old chicken embryos. Serum samples and intestinal content were assessed for antigen-specific systemic and mucosal humoral immune responses. In ovo vaccination resulted in the successful generation of IgY and IgM serum antibodies against the flagellin-based subunit vaccine as determined by ELISA and Western blotting. Vaccination did not induce significant amounts of flagellin-specific secretory IgA in the chicken intestine. Challenge of chickens with C. jejuni yielded similar intestinal colonization levels for vaccinated and control animals. Our results indicate that in ovo delivery of recombinant C. jejuni flagellin subunit vaccine is a feasible approach to yield a systemic humoral immune response in chickens but that a mucosal immune response may be needed to reduce C. jejuni colonization. PMID:27760175

  13. Anti-tumor immune response after photodynamic therapy

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Castano, Ana P.; Wu, Mei X.; Kung, Andrew L.; Hamblin, Michael R.


    Anti-tumor immunity is stimulated after PDT due a number of factors including: the acute inflammatory response caused by PDT, release of antigens from PDT-damaged tumor cells, priming of the adaptive immune system to recognize tumor-associated antigens (TAA), and induction of heat-shock proteins. The induction of specific CD8+ T-lymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy as it would allow the treatment of tumors that may have already metastasized. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. We have carried out in vivo PDT with a BPD-mediated vascular regimen using a pair of BALB/c mouse colon carcinomas: CT26 wild type expressing the naturally occurring retroviral antigen gp70 and CT26.CL25 additionally expressing beta-galactosidase (b-gal) as a model tumor rejection antigen. PDT of CT26.CL25 cured 100% of tumors but none of the CT26WT tumors (all recurred). Cured CT26.CL25 mice were resistant to rechallenge. Moreover mice with two bilateral CT26.CL25 tumors that had only one treated with PDT demonstrated spontaneous regression of 70% of untreated contralateral tumors. T-lymphocytes were isolated from lymph nodes of PDT cured mice that recognized a particular peptide specific to b-gal antigen. T-lymphocytes from LN were able to kill CT26.CL25 target cells in vitro but not CT26WT cells as shown by a chromium release assay. CT26.CL25 tumors treated with PDT and removed five days later had higher levels of Th1 cytokines than CT26 WT tumors showing a higher level of immune response. When mice bearing CT26WT tumors were treated with a regimen of low dose cyclophosphamide (CY) 2 days before, PDT led to 100% of cures (versus 0% without CY) and resistance to rechallenge. Low dose CY is thought to deplete regulatory T-cells (Treg, CD4+CD25+foxp

  14. Immune responses in humans after 60 days of confinement

    NASA Technical Reports Server (NTRS)

    Schmitt, D. A.; Peres, C.; Sonnenfeld, G.; Tkackzuk, J.; Arquier, M.; Mauco, G.; Ohayon, E.


    A confinement experiment in a normobaric diving chamber was undertaken to better understand the effect of confinement and isolation on human psychology and physiology. Pre- and postconfinement blood samples were obtained from four test subjects and control donors to analyze immune responses. No modification in the levels of CD2+, CD3+, CD4+, CD8+, CD19+, and CD56+ cells was observed after confinement. Mitogen-induced T-lymphocyte proliferation and interleukin-2 receptor expression were not altered significantly. Whole blood interferon-alpha and gamma-induction and plasma cortisol levels were also unchanged, as was natural killer cell activity. These data suggest that in humans, no specific components of the immune response are affected by a 2-month isolation and confinement of a small group.

  15. Responsive immunization and intervention for infectious diseases in social networks

    NASA Astrophysics Data System (ADS)

    Wu, Qingchu; Zhang, Haifeng; Zeng, Guanghong


    By using the microscopic Markov-chain approximation approach, we investigate the epidemic spreading and the responsive immunization in social networks. It is assumed that individual vaccination behavior depends on the local information of an epidemic. Our results suggest that the responsive immunization has negligible impact on the epidemic threshold and the critical value of initial epidemic outbreak, but it can effectively inhibit the outbreak of epidemic. We also analyze the influence of the intervention on the disease dynamics, where the vaccination is available only to those individuals whose number of neighbors is greater than a certain value. Simulation analysis implies that the intervention strategy can effectively reduce the vaccine use under the epidemic control.

  16. Time-delayed model of immune response in plants.


    Neofytou, G; Kyrychko, Y N; Blyuss, K B


    In the studies of plant infections, the plant immune response is known to play an essential role. In this paper we derive and analyse a new mathematical model of plant immune response with particular account for post-transcriptional gene silencing (PTGS). Besides biologically accurate representation of the PTGS dynamics, the model explicitly includes two time delays to represent the maturation time of the growing plant tissue and the non-instantaneous nature of the PTGS. Through analytical and numerical analysis of stability of the steady states of the model we identify parameter regions associated with recovery and resistant phenotypes, as well as possible chronic infections. Dynamics of the system in these regimes is illustrated by numerical simulations of the model.

  17. Curcumin prevents human dendritic cell response to immune stimulants

    SciTech Connect

    Shirley, Shawna A.; Montpetit, Alison J.; Lockey, R.F.; Mohapatra, Shyam S.


    Curcumin, a compound found in the Indian spice turmeric, has anti-inflammatory and immunomodulatory properties, though the mechanism remains unclear. Dendritic cells (DCs) are important to generating an immune response and the effect of curcumin on human DCs has not been explored. The role curcumin in the DC response to bacterial and viral infection was investigated in vitro using LPS and Poly I:C as models of infection. CD14{sup +} monocytes, isolated from human peripheral blood, were cultured in GM-CSF- and IL-4-supplemented medium to generate immature DCs. Cultures were incubated with curcumin, stimulated with LPS or Poly I:C and functional assays were performed. Curcumin prevents DCs from responding to immunostimulants and inducing CD4{sup +} T cell proliferation by blocking maturation marker, cytokine and chemokine expression and reducing both migration and endocytosis. These data suggest a therapeutic role for curcumin as an immune suppressant.

  18. Humoral and cell mediated immune responses to a pertussis containing vaccine in pregnant and nonpregnant women.


    Huygen, Kris; Caboré, Raïssa Nadège; Maertens, Kirsten; Van Damme, Pierre; Leuridan, Elke


    Vaccination of pregnant women is recommended for some infectious diseases in order to protect both women and offspring through high titres of maternal IgG antibodies. Less is known on the triggering of cellular immune responses by vaccines administered during pregnancy. In an ongoing study on maternal pertussis vaccination (2012-2014) 18 pregnant women were vaccinated with a tetanus-diphtheria-acellular pertussis (Tdap) containing vaccine (Boostrix®) during the third pregnancy trimester. Sixteen age-matched nonpregnant women received the same vaccine in the same time period. A blood sample was taken at the moment of, but before vaccination and one month and one year after vaccination. Anti-Pertussis Toxin (PT), filamentous hemagglutinin (FHA), pertactin (Prn), tetanus toxin (TT) and diphtheria toxin (DT) antibodies were measured by ELISA. Cellular immune responses were analyzed using a diluted whole blood assay, measuring proliferation, and cytokine release in response to vaccine antigens PT, FHA, TT, and to pokeweed mitogen (PWM) as polyclonal stimulus. Antibody levels to all five vaccine components increased significantly and to the same extent after vaccination in pregnant and nonpregnant women. One year after vaccination, antibody titres had decreased particularly to PT, but they were still significantly higher to all antigens than before vaccination. In contrast, proliferative and IFN-γ responses were increased to TT, PT, and FHA in nonpregnant women one month after vaccination, whereas in pregnant women only TT specific T cell responses were increased and to a lesser extent than in the control group. One year after vaccination, cellular responses equaled the baseline levels detected prior to vaccination in both groups. In conclusion, a Tdap vaccination can increase vaccine specific IgG antibodies to the same extent in pregnant and in nonpregnant women, whereas the stimulation of vaccine specific Th1 type cellular immune responses with this acellular vaccine

  19. Immune response profiling in early rheumatoid arthritis: discovery of a novel interaction of treatment response with viral immunity

    PubMed Central


    Introduction It remains challenging to predict the outcomes of therapy in patients with rheumatoid arthritis (RA). The objective of this study was to identify immune response signatures that correlate with clinical treatment outcomes in patients with RA. Methods A cohort of 71 consecutive patients with early RA starting treatment with disease-modifying antirheumatic drugs (DMARDs) was recruited. Disease activity at baseline and after 21 to 24 weeks of follow-up was measured using the Disease Activity Score in 28 joints (DAS28). Immune response profiling was performed by analyzing multi-cytokine production from peripheral blood cells following incubation with a panel of stimuli, including a mixture of human cytomegalovirus (CMV) and Epstein-Barr virus (EBV) lysates. Profiles identified via principal components analysis (PCA) for each stimulus were then correlated with the ΔDAS28 from baseline to follow-up. A clinically meaningful improvement in the DAS28 was defined as a decrease of ≥1.2. Results A profile of T-cell cytokines (IL-13, IL-4, IL-5, IL-2, IL-12, and IFN-γ) produced in response to CMV/EBV was found to correlate with the ΔDAS28 from baseline to follow-up. At baseline, a higher magnitude of the CMV/EBV immune response profile predicted inadequate DAS28 improvement (mean PCA-1 scores: 65.6 versus 50.2; P = 0.029). The baseline CMV/EBV response was particularly driven by IFN-γ (P = 0.039) and IL-4 (P = 0.027). Among patients who attained clinically meaningful DAS28 improvement, the CMV/EBV PCA-1 score increased from baseline to follow-up (mean +11.6, SD 25.5), whereas among patients who responded inadequately to DMARD therapy, the CMV/EBV PCA-1 score decreased (mean -12.8, SD 25.4; P = 0.002). Irrespective of the ΔDAS28, methotrexate use was associated with up-regulation of the CMV/EBV response. The CMV/EBV profile was associated with positive CMV IgG (P <0.001), but not EBV IgG (P = 0.32), suggesting this response was related to

  20. Recognition of pathogens and activation of immune responses in Drosophila and horseshoe crab innate immunity.


    Kurata, Shoichiro; Ariki, Shigeru; Kawabata, Shun-ichiro


    In innate immunity, pattern recognition receptors discriminate between self- and infectious non-self-matter. Mammalian homologs of the Drosophila Toll protein, which are collectively referred to as Toll-like receptors (TLRs), recognize pathogen-associated molecular patterns (PAMPs), including lipopolysaccharides (LPS) and lipoproteins, whereas the Drosophila Toll protein does not act as a PAMP receptor, but rather binds to Spätzle, an endogenous peptide. In Drosophila, innate immune surveillance is mediated by members of the peptidoglycan recognition protein (PGRP) family, which recognize diverse bacteria-derived peptidoglycans and initiate appropriate immune reactions including the release of antimicrobial peptides and the activation of the prophenoloxidase cascade, the latter effecting localized wound healing, melanization, and microbial phagocytosis. In the horseshoe crab, LPS induces hemocyte exocytotic degranulation, resulting in the secretion of various defense molecules, such as coagulation factors, antimicrobial peptides, and lectins. Recent studies have demonstrated that the zymogen form of the serine protease factor C, a major granular component of hemocyte, also exists on the hemocyte surface and functions as a biosensor for LPS. The proteolytic activity of activated factor C initiates hemocyte exocytosis via a G protein mediated signal transduction pathway. Furthermore, it has become clear that an endogenous mechanism for the feedback amplification of the innate immune response exists and is dependent upon a granular component of the horseshoe crab hemocyte.

  1. Antibody- and cell-mediated immune responses to a synthetic oligosaccharide conjugate vaccine after booster immunization.


    Safari, Dodi; Dekker, Huberta A Th; de Jong, Ben; Rijkers, Ger T; Kamerling, Johannis P; Snippe, Harm


    Memory formation to CRM-neoglycoconjugate, a synthetic branched tetrasaccharide of Streptococcus pneumoniae type 14 polysaccharide (Pn14PS) that is conjugated to a CRM197 protein, was investigated using mice models. Mice were first immunized with the CRM-neoglycoconjugate and then boosted with either the same neoglycoconjugate or a native Pn14PS in order to investigate the effect of booster immunization. Boosting with the CRM-neoglycoconjugate resulted in increased levels of interleukin 5 (IL-5) in the serum on Day 1, followed by the appearance of high levels of specific anti-Pn14PS IgG antibodies on Day 7. Boosting with native Pn14PS resulted in neither IL-5 induction nor the generation of anti-Pn14PS IgG antibodies. In vitro (re)stimulation of spleen cells after booster injection with the neoglycoconjugate revealed the presence of IL-4 and IL-5. This was not seen in spleen cells obtained from mice boosted with the polysaccharide. When stimulated with heat-inactivated bacteria, however, the polysaccharide-boosted mice did have higher levels of IFN-γ and lower levels of IL-17 than both the CRM-neoglycoconjugate-boosted mice and the mock-immunized mice. In conclusion, neoglycoconjugate boosting is responsible for the activation of memory cells and the establishment of sustained immunity. Not only is a booster with native polysaccharide ineffective in inducing opsonic antibodies, but it also interferes with several immunoregulatory mechanisms.

  2. Interplay between thermal and immune ecology: effect of environmental temperature on insect immune response and energetic costs after an immune challenge.


    Catalán, Tamara P; Wozniak, Aniela; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco


    Although the study of thermoregulation in insects has shown that infected animals tend to prefer higher temperatures than healthy individuals, the immune response and energetic consequences of this preference remain unknown. We examined the effect of environmental temperature and the energetic costs associated to the activation of the immune response of Tenebrio molitor larvae following a lipopolysaccharide (LPS) challenge. We measured the effect of temperature on immune parameters including phenoloxidase (PO) activity and antibacterial responses. Further as proximal and distal costs of the immune response we determined the standard metabolic rate (SMR) and the loss of body mass (m(b)), respectively. Immune response was stronger at 30°C than was at 10 or 20°C. While SMR at 10 and 20°C did not differ between immune treatments, at 30°C SMR of LPS-treated larvae was almost 25-60% higher than SMR of PBS-treated and naïve larvae. In addition, the loss in m(b) was 1.9 and 4.2 times higher in LPS-treated larvae than in PBS-treated and naïve controls. The immune responses exhibited a positive correlation with temperature and both, SMR and m(b) change, were sensitive to environmental temperature. These data suggest a significant effect of environmental temperature on the immune response and on the energetic costs of immunity.

  3. Sharing the burden: antigen transport and firebreaks in immune responses

    PubMed Central

    Handel, Andreas; Yates, Andrew; Pilyugin, Sergei S.; Antia, Rustom


    Communication between cells is crucial for immune responses. An important means of communication during viral infections is the presentation of viral antigen on the surface of an infected cell. Recently, it has been shown that antigen can be shared between infected and uninfected cells through gap junctions, connexin-based channels, that allow the transport of small molecules. The uninfected cell receiving antigen can present it on its surface. Cells presenting viral antigen are detected and killed by cytotoxic T lymphocytes. The killing of uninfected cells can lead to increased immunopathology. However, the immune response might also profit from killing those uninfected bystander cells. One benefit might be the removal of future ‘virus factories’. Another benefit might be through the creation of ‘firebreaks’, areas void of target cells, which increase the diffusion time of free virions, making their clearance more likely. Here, we use theoretical models and simulations to explore how the mechanism of gap junction-mediated antigen transport (GMAT) affects the dynamics of the virus and immune response. We show that under the assumption of a well-mixed system, GMAT leads to increased immunopathology, which always outweighs the benefit of reduced virus production due to the removal of future virus factories. By contrast, a spatially explicit model leads to quite different results. Here we find that the firebreak mechanism reduces both viral load and immunopathology. Our study thus shows the potential benefits of GMAT and illustrates how spatial effects may be crucial for the quantitative understanding of infection dynamics and immune responses. PMID:18708323

  4. Immune responses of poultry to Newcastle disease virus.


    Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J


    Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be

  5. Immune responses to colophony, an agent causing occupational asthma.

    PubMed Central

    Cullen, R T; Cherrie, B; Soutar, C A


    BACKGROUND: Inhalation of fumes from heated colophony (pine resin) is a recognised cause of occupational asthma, although the mechanisms by which colophony produces symptoms are unclear and specific immune responses to colophony have not been reported in sensitised workers. A study was carried out to determine whether colophony is antigenic. METHODS: The immune responses to colophony were studied in C57BL/6 mice and Dunkin Hartley guinea pigs after intraperitoneal injection of colophony conjugated to bovine serum albumin (BSA) or human IgG by a mixed anhydride procedure. Colophony and dinitrofluorobenzene were also compared in an assay of dermal sensitisation. RESULTS: Mice immunised with the colophony conjugates produced antibodies which recognised conjugates of both BSA and human IgG irrespective of which had been used as the immunogen. Solutions of unconjugated colophony inhibited the binding of antibodies to the BSA-colophony and BSA-abietic acid conjugates, confirming that the antibodies recognised one or more components in the colophony. Portuguese colophony also abrogated the antigen binding of serum from guinea pigs immunised with the BSA-colophony conjugate. Spleen cells from immunised mice proliferated in the presence of the conjugates. Although there was some cross reactivity in these responses, it was not as marked as in the antibody assays. Unconjugated colophony failed to induce an immune response when injected intraperitoneally with adjuvant. Skin sensitisation could not be induced in mice by topical application, or by subcutaneous or intradermal injection of unconjugated colophony. CONCLUSIONS: Colophony components have the potential to act as haptens and an immune component could be involved in the pathogenesis of occupational asthma in workers exposed to colophony. Colophony is not readily immunogenic unless conjugated ex vivo to proteins. Images PMID:1494769

  6. Enhancing the Immune Response to Recombinant Plague Antigens

    DTIC Science & Technology


    CONTRACT NUMBER Enhancing the Immune Response to Recombinant Plague Antigens 5b. GRANT NUMBER DAMD17-02-2-0058 5c. PROGRAM ELEMENT NUMBER 6...mally integrated copy of the Bacillus anthracis protective antigen gene protects mice against an anthrax spore challenge. Infect Im- mun 2003;71(7):3831...multiplying the empirically determined aerosol exposure concentration (CFU/liter air) in the chamber by the amount of air that was estimated to have been

  7. Intestinal immune response to human Cryptosporidium sp. infection

    DTIC Science & Technology


    and eliminate the infection, which typically causes acute, self-limited watery diarrhea lasting 5 to 10 days. However, in patients with defects in ...cellular immune responses (e.g., AIDS, malnutrition, or defects in the CD40- CD154 system), Cryptosporidium frequently causes persistent or chronic...diarrhea and may also involve the biliary tract (40). In malnourished children, persistent diarrhea is associated with increased susceptibility to recurrent

  8. Harnessing the exosome-induced immune response for cancer immunotherapy.


    Gehrmann, Ulf; Näslund, Tanja I; Hiltbrunner, Stefanie; Larssen, Pia; Gabrielsson, Susanne


    In recent years exosomes have emerged as potent stimulators of immune responses and as agents for cancer therapy. Exosomes can carry a broad variety of immunostimulatory molecules depending on the cell of origin and in vitro culture conditions. Dendritic cell-derived exosomes (dexosomes) have been shown to carry NK cell activating ligands and can be loaded with antigen to activate invariant NKT cells and to induce antigen-specific T and B cell responses. Dexosomes have been investigated as therapeutic agents against cancer in two phase I clinical trials, with a phase II clinical trial currently ongoing. Dexosomes were well tolerated but therapeutic success and immune activation were limited. Several reports suggest that multiple factors need to be considered in order to improve exosomal immunogenicity for cancer immunotherapy. These include antigen-loading strategies, exosome composition and exosomal trafficking in vivo. Hence, a better understanding of how to engineer and deliver exosomes to specific cells is crucial to generate strong immune responses and to improve the immunotherapeutic potential of exosomes.

  9. DAP12 Inhibits Pulmonary Immune Responses to Cryptococcus neoformans

    PubMed Central

    Heung, Lena J.


    Cryptococcus neoformans is an opportunistic fungal pathogen that is inhaled into the lungs and can lead to life-threatening meningoencephalitis in immunocompromised patients. Currently, the molecular mechanisms that regulate the mammalian immune response to respiratory cryptococcal challenge remain poorly defined. DAP12, a signaling adapter for multiple pattern recognition receptors in myeloid and natural killer (NK) cells, has been shown to play both activating and inhibitory roles during lung infections by different bacteria and fungi. In this study, we demonstrate that DAP12 plays an important inhibitory role in the immune response to C. neoformans. Infectious outcomes in DAP12−/− mice, including survival and lung fungal burden, are significantly improved compared to those in C57BL/6 wild-type (WT) mice. We find that eosinophils and macrophages are decreased while NK cells are increased in the lungs of infected DAP12−/− mice. In contrast to WT NK cells, DAP12−/− NK cells are able to repress C. neoformans growth in vitro. Additionally, DAP12−/− macrophages are more highly activated than WT macrophages, with increased production of tumor necrosis factor (TNF) and CCL5/RANTES and more efficient uptake and killing of C. neoformans. These findings suggest that DAP12 acts as a brake on the pulmonary immune response to C. neoformans by promoting pulmonary eosinophilia and by inhibiting the activation and antifungal activities of effector cells, including NK cells and macrophages. PMID:27068093

  10. Hantaan virus triggers TLR4-dependent innate immune responses.


    Yu, Hai-Tao; Jiang, Hong; Zhang, Ye; Nan, Xue-Ping; Li, Yu; Wang, Wei; Jiang, Wei; Yang, Dong-Qiang; Su, Wen-Jing; Wang, Jiu-Ping; Wang, Ping-Zhong; Bai, Xue-Fan


    The innate immune response induced by Hantavirus is responsible for endothelial cell dysfunction and viral pathogenicity. Recent studies demonstrate that TLR4 expression is upregulated and mediates the secretion of several cytokines in Hantaan virus (HTNV)-infected endothelial cells. To examine viral interactions with host endothelial cells and characterize the innate antiviral responses associated with Toll-like receptors, we selected TLR4 as the target molecule to investigate anti-hantavirus immunity. TLR4 mRNA-silenced EVC-304 (EVC-304 TLR4-) cells and EVC-304 cells were used to investigate signaling molecules downstream of TLR4. The expression of the adaptor protein TRIF was higher in HTNV-infected EVC-304 cells than in EVC-304 TLR4- cells. However, there was no apparent difference in the expression of MyD88 in either cell line. The transcription factors for NF-κB and IRF-3 were translocated from the cytoplasm into the nucleus in HTNV-infected EVC-304 cells, but not in HTNV-infected EVC-304 TLR4- cells. Our results demonstrate that TLR4 may play an important role in the antiviral immunity of the host against HTNV infection through an MyD88-independent signaling pathway.

  11. [The role of the class A scavenger receptors, SR-A and MARCO, in the immune system. Part 2. Contribution to recognition and phagocytosis of pathogens as well as induction of immune response].


    Józefowski, Szczepan


    Recognition of pathogens by innate immune cells is mediated by pattern recognition receptors (PRR), which include the class A scavenger receptors (SR), SR-A/CD204 and MARCO. It seems that in addition to activating innate immune responses, phagocytosis and inflammation, this initial, PRR-mediated recognition also determines polarization of adaptive immune responses (Th1, Th2, Th17 or Treg). It has been demonstrated that class A SR are major PRR mediating opsonin-independent phagocytosis. SR-A- or MARCO-deficient mice exhibit impaired ability to control bacterial infections, resulting in increased mortality. Our results suggest that in addition to impaired bacterial destruction by macrophages, dysregulation of immune responses may contribute to defective antibacterial defense in class A SR-deficient mice. Using specific receptor ligation with antibodies, we showed that SR-A and MARCO regulate in an opposite manner production of IL-12 in macrophages, the cytokine playing a crucial role in Th1/Th2 polarization of adaptive immune responses. Together with the observation that expression of MARCO is increased by different Th1-polarizing factors and decreased by Th2-polarizing factors, these results suggest that changes in relative expression levels of SR-A and MARCO may be a mechanism of sustained polarization of adaptive immune responses.

  12. An immunoenzymatic system to study in vitro immune responses

    PubMed Central

    Macario, A. J. L.; Conway De Macario, E.; Celada, F.


    A system for studying in vitro the antibody response against a single determinant and to all the determinants of a macromolecule (β-D-Galactosidase of Escherichia coli) is described. It consists of culturing fragments of rabbit lymph nodes (either preimmunized in vivo or not) and exposing them to antigen in vitro. Antibodies secreted into the culture during several days, and up to 3 months in the secondary response, were titrated for: (a) one-hit activation AMEF, the cross-reacting material produced by a point mutant Lac- E. coli; and (b) precipitation of wild type enzyme. Titrations of activating and binding antibodies are very sensitive owing to the amplification potential inherent in the enzymatic assays, which allows several antibody measurements on minute samples. In addition antigen decay in vitro was followed and correlated with the antibody response, showing faster disappearance when the latter took place. Time-course studies of the in vitro antibody response demonstrated that precipitating titres are higher and last longer than activating antibody titres. Repeated in vitro challenges showed decay of the memory potential of in vivo primed lymph nodes, as well as the possibility of inducing an immune response in vitro using non-primed lymph nodes. The results underline the amenability of the present system to the study of in vitro primary and secondary immune responses toward restricted portions of a macromolecule. PMID:4120932

  13. Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas

    USGS Publications Warehouse

    Work, T.M.; Balazs, G.H.; Rameyer, R.A.; Chang, S.P.; Berestecky, J.


    Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freunda??s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a

  14. Differential requirements of MyD88 and TRIF pathways in TLR4-mediated immune responses in murine B cells.


    Yanagibashi, Tsutomu; Nagai, Yoshinori; Watanabe, Yasuharu; Ikutani, Masashi; Hirai, Yoshikatsu; Takatsu, Kiyoshi


    LPS stimulates the TLR4/Myeloid differentiation protein-2 (MD-2) complex and promotes a variety of immune responses in B cells. TLR4 has two main signaling pathways, MyD88 and Toll/IL-1R (TIR)-domain-containing adaptor-inducing interferon-β (TRIF) pathways, but relatively few studies have examined these pathways in B cells. In this study, we investigated MyD88- or TRIF-dependent LPS responses in B cells by utilizing their knockout mice. Compared with wild-type (WT) B cells, MyD88(-/-) B cells were markedly impaired in up-regulation of CD86 and proliferation induced by lipid A moiety of LPS. TRIF(-/-) B cells were also impaired in these responses compared with WT B cells, but showed better responses than MyD88(-/-) B cells. Regarding class switch recombination (CSR) elicited by lipid A plus IL-4, MyD88(-/-) B cells showed similar patterns of CSR to WT B cells. However, TRIF(-/-) B cells showed the impaired in the CSR. Compared with WT and MyD88(-/-) B cells, TRIF(-/-) B cells exhibited reduced cell division, fewer IgG1(+) cells per division, and decreased activation-induced cytidine deaminase (Aicda) mRNA expression in response to lipid A plus IL-4. Finally, IgG1 production to trinitrophenyl (TNP)-LPS immunization was impaired in TRIF(-/-) mice, while MyD88(-/-) mice exhibited increased IgG1 production. Thus, MyD88 and TRIF pathways differently regulate TLR4-induced immune responses in B cells.

  15. Biophotonics and immune responses-Highlights from a new SPIE photonics west conference (BIOS 2006).


    Chen, Wei R; Huang, Zheng


    This report summarizes some highlights from the "Biophotonics and Immune Responses", a new 2006 SPIE Photonics West Biomedical Optics (BIOS 2006) Conference. Some exciting recent progresses in host immune responses elicited by photodynamic therapy and other novel phototherapies are discussed.

  16. Differential effect of pancreatectomy on humoral and cell-mediated immune responses.

    PubMed Central

    Fabris, N; Piantanelli, L


    Cell-mediated immune reactions, such as allogenic skin-graft rejection and PHA or MLC responses, and antibody synthesis against different antigens (sheep erythrocytes, Brucella antigen, bovine serum albumin) have been evaluated in rats suffering from experimentally-induced diabetes and in age-matched sham-treated controls. Cell-mediated immune reactions are strongly depressed diabetic rats. The cellularity of the thymus and of thymus-dependent areas and the number of peripheral blood lymphocytes is significantly reduced in pancreatectomized rats. Moreover, the immunological recovery from heavy cortisonization is also greatly impaired. Daily treatment with insulin may prevent these immunological alterations. By contrast, antibody responses in diabetic rats are not quantitatively altered in respect to either the number of antibody producing cells in the spleen or the circulating antibody titres. The discrepancy between the abnormality of cell-mediated