Science.gov

Sample records for impaired immune response

  1. Mice Lacking Endoglin in Macrophages Show an Impaired Immune Response

    PubMed Central

    Ojeda-Fernández, Luisa; Recio-Poveda, Lucía; Aristorena, Mikel; Lastres, Pedro; Blanco, Francisco J.; Sanz-Rodríguez, Francisco; Gallardo-Vara, Eunate; de las Casas-Engel, Mateo; Corbí, Ángel; Arthur, Helen M.; Bernabeu, Carmelo; Botella, Luisa M.

    2016-01-01

    Endoglin is an auxiliary receptor for members of the TGF-β superfamily and plays an important role in the homeostasis of the vessel wall. Mutations in endoglin gene (ENG) or in the closely related TGF-β receptor type I ACVRL1/ALK1 are responsible for a rare dominant vascular dysplasia, the Hereditary Hemorrhagic Telangiectasia (HHT), or Rendu-Osler-Weber syndrome. Endoglin is also expressed in human macrophages, but its role in macrophage function remains unknown. In this work, we show that endoglin expression is triggered during the monocyte-macrophage differentiation process, both in vitro and during the in vivo differentiation of blood monocytes recruited to foci of inflammation in wild-type C57BL/6 mice. To analyze the role of endoglin in macrophages in vivo, an endoglin myeloid lineage specific knock-out mouse line (Engfl/flLysMCre) was generated. These mice show a predisposition to develop spontaneous infections by opportunistic bacteria. Engfl/flLysMCre mice also display increased survival following LPS-induced peritonitis, suggesting a delayed immune response. Phagocytic activity is impaired in peritoneal macrophages, altering one of the main functions of macrophages which contributes to the initiation of the immune response. We also observed altered expression of TGF-β1 target genes in endoglin deficient peritoneal macrophages. Overall, the altered immune activity of endoglin deficient macrophages could help to explain the higher rate of infectious diseases seen in HHT1 patients. PMID:27010826

  2. Immune adjuvants in early life: targeting the innate immune system to overcome impaired adaptive response.

    PubMed

    de Brito, Cyro Alves; Goldoni, Adriana Letícia; Sato, Maria Notomi

    2009-09-01

    The neonatal phase is a transitory period characterized by an absence of memory cells, favoring a slow adaptive response prone to tolerance effects and the development of Th2-type responses. However, when appropriately stimulated, neonates may achieve an immune response comparable with adult counterparts. One strategy to stimulate the immunological response of neonates or children in early infancy has been to explore natural or synthetic ligands of cell receptors to stimulate innate immunity. The use of adjuvants for activating different cell receptors may be the key to enhancing neonatal adaptive immunity. This review highlights recent advances in the emerging field of molecular adjuvants of innate immune response and their implications for the development of immunotherapies, with particular focus on the neonatal period.

  3. Gestational Zinc Deficiency Impairs Humoral and Cellular Immune Responses to Hepatitis B Vaccination in Offspring Mice

    PubMed Central

    Zhao, Ning; Wang, Xuelian; Zhang, Ying; Gu, Qiuhong; Huang, Fen; Zheng, Wei; Li, Zhiwei

    2013-01-01

    Background Gestational zinc deficiency has been confirmed to impair the infant immune function. However, knowledge about effects of maternal mild zinc deficiency during pregnancy on hepatitis B vaccine responsiveness in offspring is limited. In this report, we aimed to examine how maternal zinc deficiency during pregnancy influences humoral and cellular immune responses to hepatitis B vaccination in offspring of BALB/c mice. Methodology/Principal Findings From day 1 of pregnancy upon delivery, maternal mice were given a standard diet (30 mg/kg/day zinc), zinc deficient diet (8 mg/kg/day zinc), or combination of zinc deficient diet (8 mg/kg/day zinc in the first 2 weeks of gestation) and zinc supplement diet (150 mg/kg/day zinc for the last week of pregnancy), respectively. Newborn pups of these maternal mice were immunized with hepatitis B vaccine at postnatal weeks 0, 2 and 4. Then, splenocytes and blood samples from the offspring mice were harvested for detection of serum zinc concentrations, humoral and cell-mediated immune responses, expression of cytokines using ELISA, CCK-8 and flow cytometric analysis. Results from the present study demonstrated that gestational zinc deficiency inhibited antibody responses, and decreased the proliferative capacity of T cells in offsprings immunized with hepatitis B vaccine. Additionally, HBsAg-specific cytokines analysis revealed that gestational zinc deficiency could inhibit secretion of IFN-γ from splenocytes, and decrease IFN-γ expression of CD4+ and CD8+ T cells. Conclusions/Significance Gestational zinc deficiency can weaken the humoral and cell-mediated immune responses to hepatitis B vaccine via decreasing B cell counts and hepatitis B virus-specific immunoglobulin G production, as well as reducing T cell proliferation, CD4+/CD8+ T cell ratio, and Th1-type immune responses. PMID:24069198

  4. Adipose-Derived Mesenchymal Stem Cells Restore Impaired Mucosal Immune Responses in Aged Mice

    PubMed Central

    Aso, Kazuyoshi; Tsuruhara, Akitoshi; Takagaki, Kentaro; Oki, Katsuyuki; Ota, Megumi; Nose, Yasuhiro; Tanemura, Hideki; Urushihata, Naoki; Sasanuma, Jinichi; Sano, Masayuki; Hirano, Atsuyuki; Aso, Rio; McGhee, Jerry R.; Fujihashi, Kohtaro

    2016-01-01

    It has been shown that adipose-derived mesenchymal stem cells (AMSCs) can differentiate into adipocytes, chondrocytes and osteoblasts. Several clinical trials have shown the ability of AMSCs to regenerate these differentiated cell types. Age-associated dysregulation of the gastrointestinal (GI) immune system has been well documented. Our previous studies showed that impaired mucosal immunity in the GI tract occurs earlier during agingthan is seen in the systemic compartment. In this study, we examined the potential of AMSCs to restore the GI mucosal immune system in aged mice. Aged (>18 mo old) mice were adoptively transferred with AMSCs. Two weeks later, mice were orally immunized with ovalbumin (OVA) plus cholera toxin (CT) three times at weekly intervals. Seven days after the final immunization, when fecal extract samples and plasma were subjected to OVA- and CT-B-specific ELISA, elevated levels of mucosal secretory IgA (SIgA) and plasma IgG antibody (Ab) responses were noted in aged mouse recipients. Similar results were also seen aged mice which received AMSCs at one year of age. When cytokine production was examined, OVA-stimulated Peyer’s patch CD4+ T cells produced increased levels of IL-4. Further, CD4+ T cells from the lamina propria revealed elevated levels of IL-4 and IFN-γ production. In contrast, aged mice without AMSC transfer showed essentially no OVA- or CT-B-specific mucosal SIgA or plasma IgG Ab or cytokine responses. Of importance, fecal extracts from AMSC transferred aged mice showed neutralization activity to CT intoxication. These results suggest that AMSCs can restore impaired mucosal immunity in the GI tract of aged mice. PMID:26840058

  5. 5-Lipoxygenase deficiency impairs innate and adaptive immune responses during fungal infection.

    PubMed

    Secatto, Adriana; Rodrigues, Lilian Cataldi; Serezani, Carlos Henrique; Ramos, Simone Gusmão; Dias-Baruffi, Marcelo; Faccioli, Lúcia Helena; Medeiros, Alexandra I

    2012-01-01

    5-Lipoxygenase-derived products have been implicated in both the inhibition and promotion of chronic infection. Here, we sought to investigate the roles of endogenous 5-lipoxygenase products and exogenous leukotrienes during Histoplasma capsulatum infection in vivo and in vitro. 5-LO deficiency led to increased lung CFU, decreased nitric oxide production and a deficient primary immune response during active fungal infection. Moreover, H. capsulatum-infected 5-LO(-/-) mice showed an intense influx of neutrophils and an impaired ability to generate and recruit effector T cells to the lung. The fungal susceptibility of 5-LO(-/-) mice correlated with a lower rate of macrophage ingestion of IgG-H. capsulatum relative to WT macrophages. Conversely, exogenous LTB4 and LTC4 restored macrophage phagocytosis in 5-LO deficient mice. Our results demonstrate that leukotrienes are required to control chronic fungal infection by amplifying both the innate and adaptive immune response during histoplasmosis.

  6. Novel evidence of microglial immune response in impairment of Dengue infection of CNS.

    PubMed

    Bhatt, Rushil S; Kothari, Sweta T; Gohil, Devanshi J; D'Souza, Marsha; Chowdhary, Abhay S

    2015-10-01

    Dengue, the most rampant zoonotic viral disease in tropics, contributes to 14% of acute febrile illness cases globally. Encephalitis in primary Dengue fever, with/without haemorrhage has been reported occasionally. Our study presents novel evidence for this rarity at the molecular level. Murine microglia (BV2) were infected in-vitro with Dengue virus (DENV) serotypes (1-4) and their immune response was evaluated. Gene expressions of TNF-α, IL-10, IFN-γ, and IL1-β constituted the pro-inflammatory response, levels of MCP-1 and IL-6 represented the regulatory mechanism and changes in the levels of Occludin, MMP-2, MMP-9 and TIMP-1 encompassed the break-down of the blood-brain barrier (BBB). Cytokine response was studied using RT-PCR, with relative fold change assessed using ΔΔCt method. We observed that DENV1 increased vascular permeability and trans-membrane transport, while DENV2 resulted in oxidative stress. DENV3 infection presented with impaired immune response and DENV4 manifested a chaotropic response of the BBB protein genes. However, no serotype was able to breakdown the BBB, thus validating the low prevalence of encephalitis in dengue. Our study is the first reported evidence of the microglial immune response resisting the entry of DENV into the CNS. It also supports the theory that primary Dengue infection results in the acute inflammation of the microglia, and the host immune response plays a critical role in development of encephalitis. Copyright © 2015 Elsevier GmbH. All rights reserved.

  7. Impaired immune response to vaccination against infection with human respiratory syncytial virus at advanced age.

    PubMed

    Guichelaar, Teun; Hoeboer, Jeroen; Widjojoatmodjo, Myra N; Reemers, Sylvia S N; van Els, Cécile A C M; Otten, Rob; van Remmerden, Yvonne; Boes, Jolande; Luytjes, Willem

    2014-09-01

    Elderly humans are prone to severe infection with human respiratory syncytial virus (HRSV). The aging of today's human population warrants the development of protective vaccination strategies aimed specifically at the elderly. This may require special approaches due to deteriorating immune function. To design and test vaccination strategies tailored to the elderly population, we need to understand the host response to HRSV vaccination and infection at old age. Moreover, the preclinical need for testing of candidate vaccines requires translational models resembling susceptibility to the (unadapted) human pathogen. Here, we explored the effects of aging on immunity and protection induced by a model HRSV vaccine candidate in a translational aging model in cotton rats (Sigmodon hispidus) and examined possibilities to optimize vaccination concepts for the elderly. We immunized young and aged cotton rats with a live-attenuated recombinant HRSV vaccine candidate and analyzed the induced immune response to and protection against challenge with HRSV. In old cotton rats, HRSV infection persisted longer, and vaccination induced less protection against infection. Aged animals developed lower levels of vaccine-induced IgG, virus-neutralizing serum antibodies, and IgA in lungs. Moreover, booster responses to HRSV challenge were impaired in animals vaccinated at an older age. However, increased dose and reduced attenuation of vaccine improved protection even in old animals. This study shows that cotton rats provide a model for studying the effects of aging on the immune response to the human respiratory pathogen HRSV and possibilities to optimize vaccine concepts for the elderly. HRSV infection poses a risk for severe disease in the elderly. The aging of the population warrants increased efforts to prevent disease at old age, whereas HRSV vaccines are only in the developmental phase. The preclinical need for testing of candidate human vaccines requires translational models

  8. Negative regulatory responses to metabolically triggered inflammation impair renal epithelial immunity in diabetes mellitus.

    PubMed

    Chen, Nelson K F; Chong, Tsung Wen; Loh, Hwai-Liang; Lim, Kiat Hon; Gan, Valerie H L; Wang, Marian; Kon, Oi Lian

    2013-05-01

    Diabetes mellitus is characterized by chronic inflammation and increased risk of infections, particularly of tissues exposed to the external environment. However, the causal molecular mechanisms that affect immune cells and their functions in diabetes are unclear. Here we show, by transcript and protein analyses, signatures of glucose-induced tissue damage, chronic inflammation, oxidative stress, and dysregulated expression of multiple inflammation- and immunity-related molecules in diabetic kidneys compared with non-diabetic controls. Abnormal signaling involving cytokines, G-protein coupled receptors, protein kinase C isoforms, mitogen-activated protein kinases, nuclear factor-κB (NFκB), and Toll-like receptors (TLR) were evident. These were accompanied by overexpression of negative regulators of NFκB, TLR, and other proinflammatory pathways, e.g., A20, SOCS1, IRAK-M, IκBα, Triad3A, Tollip, SIGIRR, and ST2L. Anti-inflammatory and immunomodulatory molecules, e.g., IL-10, IL-4, and TSLP that favor TH2 responses were strongly induced. These molecular indicators of immune dysfunction led us to detect the cryptic presence of bacteria and human cytomegalovirus in more than one third of kidneys of diabetic subjects but none in non-diabetic kidneys. Similar signaling abnormalities could be induced in primary human renal tubular epithelial (but not mesangial) cell cultures exposed to high glucose, proinflammatory cytokines and methylglyoxal, and were reversed by combined pharmacological treatment with an antioxidant and a PKC inhibitor. Our results suggest that diabetes impairs epithelial immunity as a consequence of chronic and inappropriate activation of counter-regulatory immune responses, which are otherwise physiological protective mechanisms against inflammation. The immune abnormalities and cryptic renal infections described here may contribute to progression of diabetic nephropathy.

  9. Impaired Antigen-Specific Immune Response to Vaccines in Children with Antibody Production Defects.

    PubMed

    Szczawinska-Poplonyk, Aleksandra; Breborowicz, Anna; Samara, Husam; Ossowska, Lidia; Dworacki, Grzegorz

    2015-08-01

    The impaired synthesis of antigen-specific antibodies, which is indispensable for an adaptive immune response to infections, is a fundamental pathomechanism that leads to clinical manifestations in children with antibody production defects. The aim of this study was to evaluate the synthesis of antigen-specific antibodies following immunization in relation to peripheral blood B cell subsets in young children with hypogammaglobulinemia. Twenty-two children, aged from 8 to 61 months, with a deficiency in one or more major immunoglobulin classes participated in the study. Postvaccination antibodies against tetanus and diphtheria toxoids, the surface antigen of the hepatitis B virus, and the capsular Haemophilus influenzae type b polysaccharide antigen were assessed along with an immunophenotypic evaluation of peripheral blood B lymph cell maturation. A deficiency of antibodies against the tetanus toxoid was assessed in 73% of cases and that against the diphtheria toxoid was assessed in 68% of cases, whereas a deficiency of antibodies against the surface antigen of the hepatitis B virus was revealed in 59% of the children included in the study. A defective response to immunization with a conjugate vaccine with the Haemophilus influenzae type b polysaccharide antigen was demonstrated in 55% of hypogammaglobulinemic patients. Increased proportions of transitional B lymph cells and an accumulation of plasmablasts accompanied antibody deficiencies. The defective response to vaccine protein and polysaccharide antigens is a predominating disorder of humoral immunity in children with hypogammaglobulinemia and may result from a dysfunctional state of the cellular elements of the immune system. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. Impaired macrophage autophagy increases the immune response in obese mice by promoting proinflammatory macrophage polarization

    PubMed Central

    Liu, Kun; Zhao, Enpeng; Ilyas, Ghulam; Lalazar, Gadi; Lin, Yu; Haseeb, Muhammad; Tanaka, Kathryn E; Czaja, Mark J

    2015-01-01

    Recent evidence that excessive lipid accumulation can decrease cellular levels of autophagy and that autophagy regulates immune responsiveness suggested that impaired macrophage autophagy may promote the increased innate immune activation that underlies obesity. Primary bone marrow-derived macrophages (BMDM) and peritoneal macrophages from high-fat diet (HFD)-fed mice had decreased levels of autophagic flux indicating a generalized impairment of macrophage autophagy in obese mice. To assess the effects of decreased macrophage autophagy on inflammation, mice with a Lyz2-Cre-mediated knockout of Atg5 in macrophages were fed a HFD and treated with low-dose lipopolysaccharide (LPS). Knockout mice developed systemic and hepatic inflammation with HFD feeding and LPS. This effect was liver specific as knockout mice did not have increased adipose tissue inflammation. The mechanism by which the loss of autophagy promoted inflammation was through the regulation of macrophage polarization. BMDM and Kupffer cells from knockout mice exhibited abnormalities in polarization with both increased proinflammatory M1 and decreased anti-inflammatory M2 polarization as determined by measures of genes and proteins. The heightened hepatic inflammatory response in HFD-fed, LPS-treated knockout mice led to liver injury without affecting steatosis. These findings demonstrate that autophagy has a critical regulatory function in macrophage polarization that downregulates inflammation. Defects in macrophage autophagy may underlie inflammatory disease states such as the decrease in macrophage autophagy with obesity that leads to hepatic inflammation and the progression to liver injury. PMID:25650776

  11. Impaired macrophage autophagy increases the immune response in obese mice by promoting proinflammatory macrophage polarization.

    PubMed

    Liu, Kun; Zhao, Enpeng; Ilyas, Ghulam; Lalazar, Gadi; Lin, Yu; Haseeb, Muhammad; Tanaka, Kathryn E; Czaja, Mark J

    2015-01-01

    Recent evidence that excessive lipid accumulation can decrease cellular levels of autophagy and that autophagy regulates immune responsiveness suggested that impaired macrophage autophagy may promote the increased innate immune activation that underlies obesity. Primary bone marrow-derived macrophages (BMDM) and peritoneal macrophages from high-fat diet (HFD)-fed mice had decreased levels of autophagic flux indicating a generalized impairment of macrophage autophagy in obese mice. To assess the effects of decreased macrophage autophagy on inflammation, mice with a Lyz2-Cre-mediated knockout of Atg5 in macrophages were fed a HFD and treated with low-dose lipopolysaccharide (LPS). Knockout mice developed systemic and hepatic inflammation with HFD feeding and LPS. This effect was liver specific as knockout mice did not have increased adipose tissue inflammation. The mechanism by which the loss of autophagy promoted inflammation was through the regulation of macrophage polarization. BMDM and Kupffer cells from knockout mice exhibited abnormalities in polarization with both increased proinflammatory M1 and decreased anti-inflammatory M2 polarization as determined by measures of genes and proteins. The heightened hepatic inflammatory response in HFD-fed, LPS-treated knockout mice led to liver injury without affecting steatosis. These findings demonstrate that autophagy has a critical regulatory function in macrophage polarization that downregulates inflammation. Defects in macrophage autophagy may underlie inflammatory disease states such as the decrease in macrophage autophagy with obesity that leads to hepatic inflammation and the progression to liver injury.

  12. Hyperlipidemia Impaired Innate Immune Response to Periodontal Pathogen Porphyromonas gingivalis in Apolipoprotein E Knockout Mice

    PubMed Central

    Yan, Fuhua; Xiao, Yin

    2013-01-01

    A finely-tuned innate immune response plays a pivotal role in protecting host against bacterial invasion during periodontal disease progression. Hyperlipidemia has been suggested to exacerbate periodontal health condition. However, the underlying mechanism has not been addressed. In the present study, we investigated the effect of hyperlipidemia on innate immune responses to periodontal pathogen Porphyromonas gingivalis infection. Apolipoprotein E-deficient and wild-type mice at the age of 20 weeks were used for the study. Peritoneal macrophages were isolated and subsequently used for the study of viable P. gingivalis infection. ApoE−/− mice demonstrated inhibited iNOS production and impaired clearance of P. gingivalis in vitro and in vivo; furthermore, ApoE−/− mice displayed disrupted cytokine production pattern in response to P. gingivalis, with a decreased production of tumor necrosis factor-α, interleukin-6 (IL-6), IL-1β and monocyte chemotactic protein-1. Microarray data demonstrated that Toll-like receptor (TLR) and NOD-like receptor (NLR) pathway were altered in ApoE−/− mice macrophages; further analysis of pattern recognition receptors (PRRs) demonstrated that expression of triggering receptors on myeloid cells-1 (TREM-1), an amplifier of the TLR and NLR pathway, was decreased in ApoE−/− mice macrophages, leading to decreased recruitment of NF-κB onto the promoters of the TNF-α and IL-6. Our data suggest that in ApoE−/− mice hyperlipidemia disrupts the expression of PRRs, and cripples the host’s capability to generate sufficient innate immune response to P. gingivalis, which may facilitate immune evasion, subgingival colonization and establishment of P. gingivalis in the periodontal niche. PMID:23977160

  13. Impaired primary immune response in type-1 diabetes: results from a controlled vaccination study.

    PubMed

    Eibl, Nicole; Spatz, Martin; Fischer, Gottfried F; Mayr, Wolfgang R; Samstag, Aysen; Wolf, Hermann M; Schernthaner, Guntram; Eibl, Martha M

    2002-06-01

    Patients with diabetes have an increased risk for infections, but information on their adoptive immunity is incomplete and contradictory. Twenty patients with diabetes type-1 and 20 patients with type-2 diabetes were vaccinated with T-cell-dependent primary protein antigens (hepatitis A viral antigen, HAV; diphtheria toxoid) and a T-cell-independent polysaccharide antigen (pneumococcal polysaccharide). In parallel, the proliferative response of CD4+ T-cells to the primary protein antigens keyhole limpet hemocyanin (KLH) and sperm whale myoglobin (SWM) was measured in vitro using monocyte-derived dendritic cells (MDDC) as antigen-presenting cells. Compared to healthy controls, type-1 diabetes patients mounted a significantly impaired primary antibody response to hepatitis A vaccine (median HAV antibody titer after the first vaccination, 53 IU/L in diabetic patients vs 212 IU/L in the controls, P = 0.017) and diphtheria toxoid (median serum antibodies after vaccination, patients, 0.94 IU/ml, controls, 6.38 IU/ml, P = 0.004), while the response to pneumococcal polysaccharide was normal. Type-2 diabetes patients had a comparable metabolic dysregulation but showed a normal antibody response following vaccination, demonstrating that the effect was not due to hyperglycemia. Antigen-induced interferon-gamma and interleukin-13 release was reduced in type-1 diabetes patients, localizing the impairment to the level of antigen-presenting cell-T-cell interaction. In addition, the proliferative response of CD4+ T-cells derived from type-1 diabetes patients to KLH and SWM was significantly reduced (P < or = 0.01). FACS analysis of CD80 (B7.1), CD86 (B7.2), and HLA-DR expression on MDDC could not demonstrate significant differences in the expression of these molecules between type-1 and type-2 diabetes patients and healthy controls. An association of low HAV antibody response with HLA-DR3,4 expression in the patients was shown. Our results indicate that the primary antibody

  14. Skin inflammation arising from cutaneous Treg deficiency leads to impaired viral immune responses1

    PubMed Central

    Freyschmidt, Eva-Jasmin; Mathias, Clinton B.; Diaz, Natalia; MacArthur, Daniel H.; Laouar, Amale; Manjunath, Narasimhaswamy; Hofer, Matthias D.; Wurbel, Marc-Andre; Campbell, James J.; Chatila, Talal A.; Oettgen, Hans C.

    2013-01-01

    Individuals with atopic dermatitis (AD) immunized with the small pox vaccine, vaccinia virus (VV), are susceptible to eczema vaccinatum (EV), a potentially-fatal disseminated infection. Dysfunction of FoxP3+ regulatory T cells (Treg) has been implicated in the pathogenesis of AD. To test whether Treg-deficiency predisposes to EV, we percutaneously VV-infected FoxP3-deficient (FoxP3KO) mice, which completely lack FoxP3+ Treg. These animals generated both fewer VV-specific CD8+ effector T cells and interferon-γ producing CD8+ T cells than controls, had higher viral loads and exhibited abnormal Th2 polarized responses to the virus. To focus on the consequences of Treg deficiency confined to the skin, we generated mixed CCR4KO FoxP3KO bone marrow (CCR4/FoxP3) chimeras in which skin, but not other tissues or central lymphoid organs, lack Treg. Like FoxP3KO mice, the chimeras had impaired VV-specific effector T cell responses and higher viral loads. Skin cytokine expression was significantly altered in infected chimeras compared to controls. Levels of the antiviral cytokines, type I and II interferons and IL-12, were reduced whereas expression of the proinflammatory cytokines, IL-6, IL-10, TGF-β and IL-23, was increased. Importantly, infection of CCR4/FoxP3 chimeras by a non-cutaneous route (i.p.) induced immune responses comparable to controls. Our findings implicate allergic skin inflammation resulting from local Treg deficiency in the pathogenesis of EV. PMID:20548030

  15. Skin inflammation arising from cutaneous regulatory T cell deficiency leads to impaired viral immune responses.

    PubMed

    Freyschmidt, Eva-Jasmin; Mathias, Clinton B; Diaz, Natalia; MacArthur, Daniel H; Laouar, Amale; Manjunath, Narasimhaswamy; Hofer, Matthias D; Wurbel, Marc-Andre; Campbell, James J; Chatila, Talal A; Oettgen, Hans C

    2010-07-15

    Individuals with atopic dermatitis immunized with the small pox vaccine, vaccinia virus (VV), are susceptible to eczema vaccinatum (EV), a potentially fatal disseminated infection. Dysfunction of Forkhead box P3 (FoxP3)-positive regulatory T cells (Treg) has been implicated in the pathogenesis of atopic dermatitis. To test whether Treg deficiency predisposes to EV, we percutaneously VV infected FoxP3-deficient (FoxP3(KO)) mice, which completely lack FoxP3(+) Treg. These animals generated both fewer VV-specific CD8(+) effector T cells and IFN-gamma-producing CD8(+) T cells than controls, had higher viral loads, and exhibited abnormal Th2-polarized responses to the virus. To focus on the consequences of Treg deficiency confined to the skin, we generated mixed CCR4(KO) FoxP3(KO) bone marrow (CCR4/FoxP3) chimeras in which skin, but not other tissues or central lymphoid organs, lack Treg. Like FoxP3(KO) mice, the chimeras had impaired VV-specific effector T cell responses and higher viral loads. Skin cytokine expression was significantly altered in infected chimeras compared with controls. Levels of the antiviral cytokines, type I and II IFNs and IL-12, were reduced, whereas expression of the proinflammatory cytokines, IL-6, IL-10, TGF-beta, and IL-23, was increased. Importantly, infection of CCR4/FoxP3 chimeras by a noncutaneous route (i.p.) induced immune responses comparable to controls. Our findings implicate allergic skin inflammation resulting from local Treg deficiency in the pathogenesis of EV.

  16. Nitric oxide synthase inhibitor, aminoguanidine reduces intracerebroventricular colchicine induced neurodegeneration, memory impairments and changes of systemic immune responses in rats.

    PubMed

    Sil, Susmita; Ghosh, Tusharkanti; Ghosh, Rupsa; Gupta, Pritha

    2017-02-15

    Intracerebroventricular (i.c.v.) injection of colchicine induces neurodegeneration, memory impairments and changes of some systemic immune responses in rats. Though the role of cox 2 in these colchicine induced changes have been evaluated, the influence of nitric oxide synthase (NOS) remains to be studied. The present study was designed to assess the role of NOS on the i.c.v. colchicine induced neurodegeneration, memory impairments and changes of some systemic immune responses by inhibiting its activity with aminoguanidine. In the present study the impairments of working and reference memories, neurodegeneration (chromatolysis and plaque formation) and changes of neuroinflammatory markers in the hippocampus (increased TNF α, IL 1β, ROS and nitrite) along with changes of serum inflammatory markers (TNF α, IL 1β, ROS and nitrite) and alteration of systemic immune responses (higher phagocytic activity of blood WBC and splenic PMN, higher cytotoxicity and lower leukocyte adhesion inhibition index of splenic MNC) were measured in the intracerebroventricular colchicine injected rats (ICIR). Administration of aminoguanidine (p.o. 30/50mg/kg body weight) to ICIR resulted in recovery of neuroinflammation and partial prevention of neurodegeneration which could be corroborated with the partial recovery of memory impairments in this model. The recovery of serum inflammatory markers and the systemic immune responses in ICIR was also observed after administration of aminoguanidine. Therefore, the present study shows that aminoguanidine can protect the colchicine induced neurodegeneration, memory impairments, and changes of systemic immune systemic responses in ICIR by inhibiting the iNOS. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Microbial Degradation of Cellular Kinases Impairs Innate Immune Signaling and Paracrine TNFα Responses

    PubMed Central

    Barth, Kenneth; Genco, Caroline Attardo

    2016-01-01

    The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses. PMID:27698456

  18. Microbial Degradation of Cellular Kinases Impairs Innate Immune Signaling and Paracrine TNFα Responses.

    PubMed

    Barth, Kenneth; Genco, Caroline Attardo

    2016-10-04

    The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses.

  19. Impaired neuroendocrine and immune response to acute stress in medication-naive patients with a first episode of psychosis.

    PubMed

    van Venrooij, Janine A E M; Fluitman, Sjoerd B A H A; Lijmer, Jeroen G; Kavelaars, Annemieke; Heijnen, Cobi J; Westenberg, Herman G M; Kahn, René S; Gispen-de Wied, Christine C

    2012-03-01

    Little is known about how the biological stress response systems--the autonomic nervous system (ANS), the hypothalamic-pituitary-adrenal (HPA) axis, and the immune system--function during psychosis. Results of studies on the effect of stress on the immune and autonomic system in patients with schizophrenia are inconsistent. The present study investigates whether the stress response is impaired in medication-naive patients with a first episode of psychosis. Ten male patients with a first episode of psychosis and 15 controls were exposed to the stress of public speaking. Parameters of the ANS (heart rate and catecholamines), the HPA axis (plasma adrenocorticotropic hormone [ACTH] and cortisol), and the immune system (number and activity of natural killer [NK] cells) were measured. Peak responses were calculated to examine the relationship between stress-induced activation of the different systems. Subjective stress and anxiety before and during the task were assessed. Patients and controls displayed similar autonomic responses to acute stress. However, there was an impaired HPA axis response, slow onset and return of ACTH, and flattened cortisol response and a reduced increase in number NK cells and NK cell activity in patients with a first episode of psychosis. Furthermore, in patients, the relationship between the different stress response systems was weaker or absent compared with controls. These findings indicate that impairments in stress processing are associated with the endophenotype of psychosis and are not a result of illness progression or antipsychotic medication.

  20. Selection for brain size impairs innate, but not adaptive immune responses

    PubMed Central

    Kotrschal, Alexander; Kolm, Niclas; Penn, Dustin J.

    2016-01-01

    Both the brain and the immune system are energetically demanding organs, and when natural selection favours increased investment into one, then the size or performance of the other should be reduced. While comparative analyses have attempted to test this potential evolutionary trade-off, the results remain inconclusive. To test this hypothesis, we compared the tissue graft rejection (an assay for measuring innate and acquired immune responses) in guppies (Poecilia reticulata) artificially selected for large and small relative brain size. Individual scales were transplanted between pairs of fish, creating reciprocal allografts, and the rejection reaction was scored over 8 days (before acquired immunity develops). Acquired immune responses were tested two weeks later, when the same pairs of fish received a second set of allografts and were scored again. Compared with large-brained animals, small-brained animals of both sexes mounted a significantly stronger rejection response to the first allograft. The rejection response to the second set of allografts did not differ between large- and small-brained fish. Our results show that selection for large brain size reduced innate immune responses to an allograft, which supports the hypothesis that there is a selective trade-off between investing into brain size and innate immunity. PMID:26962144

  1. Disruption of TNFα/TNFR1 function in resident skin cells impairs host immune response against cutaneous vaccinia virus infection

    PubMed Central

    Tian, Tian; Dubin, Krista; Jin, Qiushuang; Qureshi, Ali; King, Sandra L.; Liu, Luzheng; Jiang, Xiaodong; Murphy, George F.; Kupper, Thomas S.; Fuhlbrigge, Robert C.

    2012-01-01

    One strategy adopted by vaccinia virus (VV) to evade the host immune system is to encode homologs of TNF receptors (TNFR) that block TNFα function. The response to VV skin infection under conditions of TNFα deficiency, however, has not been reported. We found that TNFR1−/− mice developed larger primary lesions, numerous satellite lesions and higher skin virus levels after VV scarification. Following their recovery, these TNFR1−/− mice were fully protected against challenge with a lethal intranasal dose of VV, suggesting these mice developed an effective memory immune response. A functional systemic immune response of TNFR1−/− mice was further demonstrated by enhanced production of VV-specific IFNγ and VV-specific CD8+ T cells in spleens and draining lymph nodes. Interestingly, bone marrow (BM) reconstitution studies using WT BM in TNFR1−/− host mice, but not TNFR1−/− BM in WT host mice, reproduced the original results seen in TNFR1−/− mice, indicating that TNFR1 deficiency in resident skin cells, rather than hematopoietic cells, accounts for the impaired cutaneous immune response. Our data suggest that lack of TNFR1 leads to a skin-specific immune deficiency and that resident skin cells play a crucial role in mediating an optimal immune defense to VV cutaneous infection via TNFα/TNFR1 signaling. PMID:22318381

  2. Human Immunodeficiency Virus-1 Inhibition of Immunoamphisomes in Dendritic Cells Impairs Early Innate and Adaptive Immune Responses

    PubMed Central

    Blanchet, Fabien P.; Moris, Arnaud; Nikolic, Damjan S.; Lehmann, Martin; Cardinaud, Sylvain; Stalder, Romaine; Garcia, Eduardo; Dinkins, Christina; Leuba, Florence; Wu, Li; Schwartz, Olivier; Deretic, Vojo; Piguet, Vincent

    2010-01-01

    SUMMARY Dendritic cells (DCs) in mucosal surfaces are early targets for human immunodeficiency virus-1 (HIV-1). DCs mount rapid and robust immune responses upon pathogen encounter. However, immune response in the early events of HIV-1 transmission appears limited, suggesting that HIV-1 evade early immune control by DCs. We report that HIV-1 induces a rapid shutdown of autophagy and immunoamphisomes in DCs. HIV-1 envelope activated the mammalian target of rapamycin pathway in DCs, leading to autophagy exhaustion. HIV-1-induced inhibition of autophagy in DC increased cell-associated HIV-1 and transfer of HIV-1 infection to CD4+ T cells. HIV-1-mediated downregulation of autophagy in DCs impaired innate and adaptive immune responses. Immunoamphisomes in DCs engulf incoming pathogens and appear to amplify pathogen degradation as well as Toll-like receptor responses and antigen presentation. The findings that HIV-1 downregulates autophagy and impedes immune functions of DCs represent a pathogenesis mechanism that can be pharmacologically countered with therapeutic and prophylactic implications. PMID:20451412

  3. Impaired cellular immune response to diphtheria and tetanus vaccines in children after thoracic transplantation.

    PubMed

    Urschel, Simon; Rieck, Birgit D; Birnbaum, Julia; Dalla Pozza, Robert; Rieber, Nikolaus; Januszewska, Katarzyna; Fuchs, Alexandra; West, Lori J; Netz, Heinrich; Belohradsky, Bernd H

    2011-05-01

    Safety and immunogenicity of diphtheria and tetanus booster vaccination were evaluated in 28 children after thoracic transplantation. Adverse events were documented in a patient diary. Blood was collected prior to and four wk after vaccination. Specific antibody concentrations were measured by ELISA. Lymphocytes were investigated for expression of activation markers (CD25, HLA-DR) by flow cytometry and proliferation assays with and without stimulation. Post-vaccination antibody titers were higher than prevaccination (p < 0.001), with more patients having protective antibody levels against diphtheria (p < 0.02) and tetanus (p < 0.001). There was no increased proliferation in non-stimulated or stimulated cultures after vaccination. The number of T-lymphocytes activated by the vaccination antigens was similar pre- and post-vaccination, whereas HLA-DR-expression on stimulated and non-stimulated CD4(+) T-cells increased significantly. Increase in antibodies was negatively correlated with tacrolimus dose, and impaired cellular immunity was associated with higher tacrolimus dose and steroid use. Adverse events were similar to the general population; serious adverse events and rejection did not occur. Vaccination with inactivated vaccines can be performed safely in immunosuppressed children after thoracic transplantation and induces protective antibody levels in the majority of patients. Impaired induction of specific cellular immunity is correlated with intensity of immunosuppression and may explain reduced sustainability of antibodies.

  4. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response

    PubMed Central

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-01-01

    Objective To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. Design We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis (Pg), Fusobacterium nucleatum and Prevotella intermedia. The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Results Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. Conclusions We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. PMID:26838600

  5. Impairment of the humoral and CD4+ T cell responses in HTLV-1-infected individuals immunized with tetanus toxoid

    PubMed Central

    Souza, Anselmo; Santos, Silvane; Carvalho, Lucas P.; Grassi, Maria Fernanda R.; Carvalho, Edgar M.

    2016-01-01

    T cells from HTLV-1-infected individuals have a decreased ability to proliferate after stimulation with recall antigens. This abnormality may be due to the production of regulatory cytokine or a dysfunctional antigen presentation. The aims of this study were to evaluate the antibody production and cytokine expression by lymphocytes before and after immunization with tetanus toxoid (TT) and to evaluate the immune response of monocytes after stimulation with TT and frequency of dendritic cells (DC) subsets. HTLV-1 carriers (HC) and uninfected controls with negative serology for TT were immunized with TT, and the antibody titers were determined by ELISA as well as the cell activation markers expression by monocytes. The frequencies of DC subsets were determined by flow cytometry. Following immunization, the IgG anti-TT titers and the frequency of CD4+ T cells expressing IFN-γ, TNF and IL-10 in response to TT were lower in the (HC) than in the controls. Additionally, monocytes from HC did not exhibit increased HLA-DR expression after stimulation with TT, and presented low numbers of DC subsets, therefore, it’s necessary to perform functional studies with antigen-presenting cells. Collectively, our finding suggests that HC present an impairment of the humoral and CD4+ T cell immune responses after vaccination. PMID:27282836

  6. Impairment of the humoral and CD4(+) T cell responses in HTLV-1-infected individuals immunized with tetanus toxoid.

    PubMed

    Souza, Anselmo; Santos, Silvane; Carvalho, Lucas P; Grassi, Maria Fernanda R; Carvalho, Edgar M

    2016-08-01

    T cells from HTLV-1-infected individuals have a decreased ability to proliferate after stimulation with recall antigens. This abnormality may be due to the production of regulatory cytokine or a dysfunctional antigen presentation. The aims of this study were to evaluate the antibody production and cytokine expression by lymphocytes before and after immunization with tetanus toxoid (TT) and to evaluate the immune response of monocytes after stimulation with TT and frequency of dendritic cells (DC) subsets. HTLV-1 carriers (HC) and uninfected controls (UC) with negative serology for TT were immunized with TT, and the antibody titers were determined by ELISA as well as the cell activation markers expression by monocytes. The frequencies of DC subsets were determined by flow cytometry. Following immunization, the IgG anti-TT titers and the frequency of CD4(+) T cells expressing IFN-γ, TNF-α and IL-10 in response to TT were lower in the HC than in the UC. Additionally, monocytes from HC did not exhibit increased HLA-DR expression after stimulation with TT, and presented low numbers of DC subsets, therefore, it's necessary to perform functional studies with antigen-presenting cells. Collectively, our finding suggests that HC present an impairment of the humoral and CD4(+) T cell immune responses after vaccination.

  7. Protein Malnutrition Impairs the Immune Response and Influences the Severity of Infection in a Hamster Model of Chronic Visceral Leishmaniasis

    PubMed Central

    Carrillo, Eugenia; Jimenez, Mª Angeles; Sanchez, Carmen; Cunha, Joana; Martins, Camila Marinelli; da Paixão Sevá, Anaiá; Moreno, Javier

    2014-01-01

    Leishmaniasis remains one of the world's most devastating neglected tropical diseases. It mainly affects developing countries, where it often co-exists with chronic malnutrition, one of the main risk factors for developing the disease. Few studies have been published, however, on the relationship between leishmaniasis progression and malnutrition. The present paper reports the influence of protein malnutrition on the immune response and visceral disease development in adult hamsters infected with Leishmania infantum fed either standard or low protein diets. The low protein diet induced severe malnutrition in these animals, and upon infection with L. infantum 33% had severe visceral leishmaniasis compared to only 8% of animals fed the standard diet. The infected, malnourished animals showed notable leukocyte depletion, mild specific antibody responses, impairment of lymphoproliferation, presence of parasites in blood (16.67% of the hamsters) and significant increase of the splenic parasite burden. Animals fed standard diet suffered agranulocytosis and monocytopenia, but showed stronger specific immune responses and had lower parasite loads than their malnourished counterparts. The present results show that protein malnutrition promotes visceral leishmaniasis and provide clues regarding the mechanisms underlying the impairment of the immune system. PMID:24586759

  8. Protein malnutrition impairs the immune response and influences the severity of infection in a hamster model of chronic visceral leishmaniasis.

    PubMed

    Carrillo, Eugenia; Jimenez, Maria Angeles; Sanchez, Carmen; Cunha, Joana; Martins, Camila Marinelli; da Paixão Sevá, Anaiá; Moreno, Javier

    2014-01-01

    Leishmaniasis remains one of the world's most devastating neglected tropical diseases. It mainly affects developing countries, where it often co-exists with chronic malnutrition, one of the main risk factors for developing the disease. Few studies have been published, however, on the relationship between leishmaniasis progression and malnutrition. The present paper reports the influence of protein malnutrition on the immune response and visceral disease development in adult hamsters infected with Leishmania infantum fed either standard or low protein diets. The low protein diet induced severe malnutrition in these animals, and upon infection with L. infantum 33% had severe visceral leishmaniasis compared to only 8% of animals fed the standard diet. The infected, malnourished animals showed notable leukocyte depletion, mild specific antibody responses, impairment of lymphoproliferation, presence of parasites in blood (16.67% of the hamsters) and significant increase of the splenic parasite burden. Animals fed standard diet suffered agranulocytosis and monocytopenia, but showed stronger specific immune responses and had lower parasite loads than their malnourished counterparts. The present results show that protein malnutrition promotes visceral leishmaniasis and provide clues regarding the mechanisms underlying the impairment of the immune system.

  9. Sleep deprivation impairs calcium signaling in mouse splenocytes and leads to a decreased immune response.

    PubMed

    Lungato, Lisandro; Gazarini, Marcos L; Paredes-Gamero, Edgar J; Tersariol, Ivarne L S; Tufik, Sergio; D'Almeida, Vânia

    2012-12-01

    Sleep is a physiological event that directly influences health by affecting the immune system, in which calcium (Ca(2+)) plays a critical signaling role. We performed live cell measurements of cytosolic Ca(2+) mobilization to understand the changes in Ca(2+) signaling that occur in splenic immune cells after various periods of sleep deprivation (SD). Adult male mice were subjected to sleep deprivation by platform technique for different periods (from 12 to 72h) and Ca(2+) intracellular fluctuations were evaluated in splenocytes by confocal microscopy. We also performed spleen cell evaluation by flow cytometry and analyzed intracellular Ca(2+) mobilization in endoplasmic reticulum and mitochondria. Additionally, Ca(2+) channel gene expression was evaluated Splenocytes showed a progressive loss of intracellular Ca(2+) maintenance from endoplasmic reticulum (ER) stores. Transient Ca(2+) buffering by the mitochondria was further compromised. These findings were confirmed by changes in mitochondrial integrity and in the performance of the store operated calcium entry (SOCE) and stromal interaction molecule 1 (STIM1) Ca(2+) channels. These novel data suggest that SD impairs Ca(2+) signaling, most likely as a result of ER stress, leading to an insufficient Ca(2+) supply for signaling events. Our results support the previously described immunosuppressive effects of sleep loss and provide additional information on the cellular and molecular mechanisms involved in sleep function. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Dectin-3 Deficiency Promotes Colitis Development due to Impaired Antifungal Innate Immune Responses in the Gut

    PubMed Central

    Wang, Tingting; Pan, Deng; Zhou, Zhicheng; You, Yun; Jiang, Changying; Zhao, Xueqiang; Lin, Xin

    2016-01-01

    Interactions between commensal fungi and gut immune system are critical for establishing colonic homeostasis. Here we found that mice deficient in Dectin-3 (Clec4d-/-), a C-type lectin receptor that senses fungal infection, were more susceptible to dextran sodium sulfate (DSS)-induced colitis compared with wild-type mice. The specific fungal burden of Candida (C.) tropicalis was markedly increased in the gut after DSS treatment in Clec4d-/- mice, and supplementation with C. tropicalis aggravated colitis only in Clec4d-/- mice, but not in wild-type controls. Mechanistically, Dectin-3 deficiency impairs phagocytic and fungicidal abilities of macrophages, and C. tropicalis-induced NF-κB activation and cytokine production. The conditioned media derived from Dectin-3-deficient macrophages were defective in promoting tissue repairing in colonic epithelial cells. Finally, anti-fungal therapy was effective in treating colitis in Clec4d-/- mice. These studies identified the role of Dectin-3 and its functional interaction with commensal fungi in intestinal immune system and regulation of colonic homeostasis. PMID:27280399

  11. Impaired immune responses in the lungs of aged mice following influenza infection

    PubMed Central

    2009-01-01

    Background Each year, influenza virus infection causes severe morbidity and mortality, particularly in the most susceptible groups including children, the elderly (>65 years-old) and people with chronic respiratory diseases. Among the several factors that contribute to the increased susceptibility in elderly populations are the higher prevalence of chronic diseases (e.g. diabetes) and the senescence of the immune system. Methods In this study, aged and adult mice were infected with sublethal doses of influenza virus (A/Puerto Rico/8/1934). Differences in weight loss, morbidity, virus titer and the kinetics of lung infiltration with cells of the innate and adaptive immune responses were analyzed. Additionally, the main cytokines and chemokines produced by these cells were also assayed. Results Compared to adult mice, aged mice had higher morbidity, lost weight more rapidly, and recovered more slowly from infection. There was a delay in the accumulation of granulocytic cells and conventional dendritic cells (cDCs), but not macrophages in the lungs of aged mice compared to adult animals. The delayed infiltration kinetics of APCs in aged animals correlated with alteration in their activation (CD40 expression), which also correlated with a delayed detection of cytokines and chemokines in lung homogenates. This was associated with retarded lung infiltration by natural killer (NK), CD4+ and CD8+ T-cells. Furthermore, the percentage of activated (CD69+) influenza-specific and IL-2 producer CD8+ T-cells was higher in adult mice compared to aged ones. Additionally, activation (CD69+) of adult B-cells was earlier and correlated with a quicker development of neutralizing antibodies in adult animals. Conclusion Overall, alterations in APC priming and activation lead to delayed production of cytokines and chemokines in the lungs that ultimately affected the infiltration of immune cells following influenza infection. This resulted in delayed activation of the adaptive immune

  12. Impairment of humoral immune responses in mice exposed to nitrogen dioxide and ozone mixtures

    SciTech Connect

    Fujimaki, H.

    1989-04-01

    The relationship between immune defense mechanisms and environmental pollutants remains unknown because of uncertainty about the effects of combined or mixed pollutants. To investigate whether exposure to toxic gas mixtures change the effect of a single gas exposure on immune function, BALB/c mice were continuously exposed to 4.0 ppm nitrogen dioxide (NO/sub 2/), 0.8 ppm ozone (O/sub 3/), or the mixture of NO/sub 2/ plus O/sub 3/ for 3, 7, 14, and 56 days. Organ weights (lung, thymus, and spleen) and antibody responses to sheep red blood cells (SRBC), and to DNP-Ficoll were measured immediately after the exposure. Lung weights in mice exposed to O/sub 3/ or the mixture were increased significantly in all exposure periods. The weights of thymus and spleen in mice exposed for 3, 7, and 14 days to the mixture were decreased. O/sub 3/ exposure for 56 days showed significant decreases of the weights of both organs. Antibody response to SRBC in mice exposed for 3, 7, and 14 days to O/sub 3/ or the mixture was markedly suppressed, but exposure to the mixture for 56 days did not show the suppression of anti-SRBC antibody response. No differences in anti-DNP antibody response between exposed and control mice were observed, except those exposed to O/sub 3/ or the mixture for 14 days. These results suggest that mixed gas exposures variously modify the effects of a single gas exposure on antibody production in mice.

  13. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response.

    PubMed

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-05-01

    To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis (Pg), Fusobacterium nucleatum and Prevotella intermedia. The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  14. Histone deacetylase inhibitors impair innate immune responses to Toll-like receptor agonists and to infection.

    PubMed

    Roger, Thierry; Lugrin, Jérôme; Le Roy, Didier; Goy, Geneviève; Mombelli, Matteo; Koessler, Thibaud; Ding, Xavier C; Chanson, Anne-Laure; Reymond, Marlies Knaup; Miconnet, Isabelle; Schrenzel, Jacques; François, Patrice; Calandra, Thierry

    2011-01-27

    Regulated by histone acetyltransferases and deacetylases (HDACs), histone acetylation is a key epigenetic mechanism controlling chromatin structure, DNA accessibility, and gene expression. HDAC inhibitors induce growth arrest, differentiation, and apoptosis of tumor cells and are used as anticancer agents. Here we describe the effects of HDAC inhibitors on microbial sensing by macrophages and dendritic cells in vitro and host defenses against infection in vivo. HDAC inhibitors down-regulated the expression of numerous host defense genes, including pattern recognition receptors, kinases, transcription regulators, cytokines, chemokines, growth factors, and costimulatory molecules as assessed by genome-wide microarray analyses or innate immune responses of macrophages and dendritic cells stimulated with Toll-like receptor agonists. HDAC inhibitors induced the expression of Mi-2β and enhanced the DNA-binding activity of the Mi-2/NuRD complex that acts as a transcriptional repressor of macrophage cytokine production. In vivo, HDAC inhibitors increased the susceptibility to bacterial and fungal infections but conferred protection against toxic and septic shock. Thus, these data identify an essential role for HDAC inhibitors in the regulation of the expression of innate immune genes and host defenses against microbial pathogens.

  15. Obesity Is Not Associated with Impaired Immune Response to Influenza Vaccination in HIV-Infected Persons

    PubMed Central

    Gowda, Charitha; McKittrick, Noah; Kim, Deborah; Kappes, Rosemarie A.; Lo Re, Vincent; Tebas, Pablo

    2015-01-01

    Introduction. HIV-infected individuals demonstrate lower immunogenicity to the influenza vaccine, despite immunologic and virologic control of HIV infection. Obesity has been previously shown to be associated with diminished antibody responses to other vaccines in HIV-uninfected persons. However, no studies have examined if obesity is associated with diminished protective immune response to influenza vaccination among HIV-infected persons on antiretroviral therapy (ART). Methods. We performed a retrospective analysis of immunogenicity data from a clinical trial of inactivated, trivalent influenza vaccine. The primary endpoint was the proportion of participants with seroconversion, defined as >4-fold increase in anti-hemagglutinin antibody titers after vaccination. Secondary endpoints were the proportion of participants with seroprotection (defined as antibody titers of ≥1 : 40) and geometric mean hemagglutination inhibition antibody titers. Results. Overall, 48 (27%) participants were obese (body mass index ≥ 30 kg/m2). Seroconversion rates were comparable between obese and nonobese subjects for all three vaccine strains. Further, postvaccination geometric mean titers did not differ by body mass index category. Conclusion. Obesity was not associated with diminished antibody response to influenza vaccination in a sample of healthy HIV-infected persons. PMID:26576297

  16. Obesity Is Not Associated with Impaired Immune Response to Influenza Vaccination in HIV-Infected Persons.

    PubMed

    Gowda, Charitha; McKittrick, Noah; Kim, Deborah; Kappes, Rosemarie A; Lo Re, Vincent; Tebas, Pablo

    2015-01-01

    Introduction. HIV-infected individuals demonstrate lower immunogenicity to the influenza vaccine, despite immunologic and virologic control of HIV infection. Obesity has been previously shown to be associated with diminished antibody responses to other vaccines in HIV-uninfected persons. However, no studies have examined if obesity is associated with diminished protective immune response to influenza vaccination among HIV-infected persons on antiretroviral therapy (ART). Methods. We performed a retrospective analysis of immunogenicity data from a clinical trial of inactivated, trivalent influenza vaccine. The primary endpoint was the proportion of participants with seroconversion, defined as >4-fold increase in anti-hemagglutinin antibody titers after vaccination. Secondary endpoints were the proportion of participants with seroprotection (defined as antibody titers of ≥1 : 40) and geometric mean hemagglutination inhibition antibody titers. Results. Overall, 48 (27%) participants were obese (body mass index ≥ 30 kg/m(2)). Seroconversion rates were comparable between obese and nonobese subjects for all three vaccine strains. Further, postvaccination geometric mean titers did not differ by body mass index category. Conclusion. Obesity was not associated with diminished antibody response to influenza vaccination in a sample of healthy HIV-infected persons.

  17. Cannabidiol reduces host immune response and prevents cognitive impairments in Wistar rats submitted to pneumococcal meningitis.

    PubMed

    Barichello, Tatiana; Ceretta, Renan A; Generoso, Jaqueline S; Moreira, Ana Paula; Simões, Lutiana R; Comim, Clarissa M; Quevedo, João; Vilela, Márcia Carvalho; Zuardi, Antonio Waldo; Crippa, José A; Teixeira, Antônio Lucio

    2012-12-15

    Pneumococcal meningitis is a life-threatening disease characterized by an acute infection affecting the pia matter, arachnoid and subarachnoid space. The intense inflammatory response is associated with a significant mortality rate and neurologic sequelae, such as, seizures, sensory-motor deficits and impairment of learning and memory. The aim of this study was to evaluate the effects of acute and extended administration of cannabidiol on pro-inflammatory cytokines and behavioral parameters in adult Wistar rats submitted to pneumococcal meningitis. Male Wistar rats underwent a cisterna magna tap and received either 10μl of sterile saline as a placebo or an equivalent volume of S. pneumoniae suspension. Rats subjected to meningitis were treated by intraperitoneal injection with cannabidiol (2.5, 5, or 10mg/kg once or daily for 9 days after meningitis induction) or a placebo. Six hours after meningitis induction, the rats that received one dose were killed and the hippocampus and frontal cortex were obtained to assess cytokines/chemokine and brain-derived neurotrophic factor levels. On the 10th day, the rats were submitted to the inhibitory avoidance task. After the task, the animals were killed and samples from the hippocampus and frontal cortex were obtained. The extended administration of cannabidiol at different doses reduced the TNF-α level in frontal cortex. Prolonged treatment with canabidiol, 10mg/kg, prevented memory impairment in rats with pneumococcal meningitis. Although descriptive, our results demonstrate that cannabidiol has anti-inflammatory effects in pneumococcal meningitis and prevents cognitive sequel.

  18. Strong Type 1, but Impaired Type 2, Immune Responses Contribute to Orientia tsutsugamushi-Induced Pathology in Mice

    PubMed Central

    Liang, Yuejin; Mendell, Nicole L.; Sun, Jiaren; Gong, Bin; Valbuena, Gustavo A.; Bouyer, Donald H.; Walker, David H.

    2014-01-01

    Scrub typhus is a neglected, but important, tropical disease, which puts one-third of the world's population at risk. The disease is caused by Orientia tsutsugamushi, an obligately intracellular Gram-negative bacterium. Dysregulation in immune responses is known to contribute to disease pathogenesis; however, the nature and molecular basis of immune alterations are poorly defined. This study made use of a newly developed murine model of severe scrub typhus and focused on innate regulators and vascular growth factors in O. tsutsugamushi-infected liver, lungs and spleen. We found no activation or even reduction in base-line expression for multiple molecules (IL-7, IL-4, IL-13, GATA3, ROR-γt, and CXCL12) at 2, 6 and 10 days post-infection. This selective impairment in type 2-related immune responses correlated with a significant activation of the genes for IL-1β, IL-6, IL-10, TNF-α, IFN-γ, as well as CXCR3- and CXCR1-related chemokines in inflamed tissues. The elevated angiopoietin (Ang)-2 expression and Ang-2/Ang-1 ratios suggested excessive inflammation and the loss of endothelial integrity. These alterations, together with extensive recruitment of myeloperoxidase (MPO)-expressing neutrophils and the influx of CD3+ T cells, contributed to acute tissue damage and animal death. This is the first report of selective alterations in a panel of immune regulators during early O. tsutsugamushi infection in intravenously inoculated C57BL/6 mice. Our findings shed new light on the pathogenic mechanisms associated with severe scrub typhus and suggest potential targets for therapeutic investigation. PMID:25254971

  19. Pteromalus puparum venom impairs host cellular immune responses by decreasing expression of its scavenger receptor gene

    USDA-ARS?s Scientific Manuscript database

    Insect host/parasitoid interactions are co-evolved systems in which host defenses are balanced by parasitoid mechanisms to disable or hide from host immune effectors. Although there is a rich literature on these systems, parasitoid immune-disabling mechanisms have not been fully elucidated. Here we ...

  20. Chronic stress impairs the local immune response during cutaneous repair in gilthead sea bream (Sparus aurata, L.).

    PubMed

    Mateus, Ana Patrícia; Anjos, Liliana; Cardoso, João R; Power, Deborah M

    2017-07-01

    Scale removal in fish triggers a damage-repair program to re-establish the lost epidermis and scale and an associated local immune response. In mammals, chronic stress is known to delay wound healing and to modulate the cutaneous stress axis, but this is unstudied in teleost fish the most successful extant vertebrates. The present study was designed to test the hypothesis that chronic stress impairs cutaneous repair in teleost fish as a consequence of suppression of the immune response. The hypothesis was tested by removing the scales and damaging the skin on one side of the body of fish previously exposed for 4 weeks to a chronic crowding stress and then evaluating cutaneous repair for 1 week. Scale removal caused the loss of the epidermis although at 3days it was re-established. At this stage the basement membrane was significantly thicker (p=0.038) and the hypodermis was significantly thinner (p=0.016) in the regenerating skin of stressed fish relative to the control fish. At 3days, stressed fish also had a significantly lower plasma osmolality (p=0.015) than control fish indicative of reduced barrier function. Chronic stress caused a significant down-regulation of the glucocorticoid receptor (gr) in skin before damage (time 0, p=0.005) and of star at 3 and 7days (p<0.05) after regeneration relative to control fish. In regenerating skin key transcripts of cutaneous repair, pcna, colivα1 and mmp9, and the inflammatory response, tgfβ1, csf-1r, mpo and crtac2, were down-regulated (p<0.05) by chronic stress. Irrespective of chronic stress and in contrast to intact skin many hyper pigmented masses, putative melanomacrophages, infiltrated the epidermis of regenerating skin. This study reveals that chronic stress suppresses the local immune response to scale removal and impairs the expression of key transcripts of wound healing. Elements of the stress axis were identified and modulated by chronic stress during cutaneous repair in gilthead seabream skin. Copyright

  1. IL-1R Type 1-Deficient Mice Demonstrate an Impaired Host Immune Response against Cutaneous Vaccinia Virus Infection.

    PubMed

    Tian, Tian; Jin, Michelle Qiushuang; Dubin, Krista; King, Sandra L; Hoetzenecker, Wolfram; Murphy, George F; Chen, Chen Amy; Kupper, Thomas S; Fuhlbrigge, Robert C

    2017-06-01

    The IL-1 superfamily of cytokines and receptors has been studied extensively. However, the specific roles of IL-1 elements in host immunity to cutaneous viral infection remain elusive. In this study, we applied vaccinia virus (VACV) by scarification to IL-1R1 knockout mice (IL-1R1(-/-)) and found that these mice developed markedly larger lesions with higher viral genome copies in skin than did wild-type mice. The phenotype of infected IL-1R1(-/-) mice was similar to eczema vaccinatum, a severe side effect of VACV vaccination that may develop in humans with atopic dermatitis. Interestingly, the impaired cutaneous response of IL-1R1(-/-) mice did not reflect a systemic immune deficiency, because immunized IL-1R1(-/-) mice survived subsequent lethal VACV intranasal challenge, or defects of T cell activation or T cell homing to the site of inoculation. Histologic evaluation revealed that VACV infection and replication after scarification were limited to the epidermal layer of wild-type mice, whereas lack of IL-1R1 permitted extension of VACV infection into dermal layers of the skin. We explored the etiology of this discrepancy and determined that IL-1R1(-/-) mice contained significantly more macrophages and monocyte-derived dendritic cells in the dermis after VACV scarification. These cells were vulnerable to VACV infection and may augment the transmission of virus to adjacent skin, thus leading to larger skin lesions and satellite lesions in IL-1R1(-/-) mice. These results suggest new therapeutic strategies for treatment of eczema vaccinatum and inform assessment of risks in patients receiving IL-1 blocking Abs for treatment of chronic inflammatory disorders. Copyright © 2017 by The American Association of Immunologists, Inc.

  2. Immune impairment thresholds in HIV infection.

    PubMed

    Iwami, Shingo; Nakaoka, Shinji; Takeuchi, Yasuhiro; Miura, Yoshiharu; Miura, Tomoyuki

    2009-04-27

    Longitudinal studies of patients infected with HIV-1 reveal a long and variable length of asymptomatic phase between infection and development of AIDS. Some HIV infected patients are still asymptomatic after 15 or more years of infection but some patients develop AIDS within 2 years. The mechanistic basis of the disease progression has remained obscure but many researchers have been trying to explain it. For example, the possible importance of viral diversity for the disease progression and the development of AIDS has been very well worked out in the early-1990s, especially by some important works of Martin A. Nowak. These studies can give an elegant explanation for a variability of asymptomatic phase. Here, a simple mathematical model was used to propose a new explanation for a variable length of asymptomatic phase. The main idea is that the immune impairment rate increases over the HIV infection. Our model suggested the existence of so-called "Risky threshold" and "Immunodeficiency threshold" on the impairment rate. The former implies that immune system may collapse when the impairment rate of HIV exceeds the threshold value. The latter implies that immune system always collapses when the impairment rate exceeds the value. We found that the length of asymptomatic phase is determined stochastically between these threshold values depending on the virological and immunological states. Furthermore, we investigated a distribution of the length of asymptomatic phase and a survival rate of the immune responses in one HIV patient.

  3. Impaired cellular immune response to tetanus toxoid but not to cytomegalovirus in effectively HAART-treated HIV-infected children.

    PubMed

    Alsina, Laia; Noguera-Julian, Antoni; Fortuny, Clàudia

    2013-05-07

    Despite of highly active antiretroviral therapy, the response to vaccines in HIV-infected children is poor and short-lived, probably due to a defect in cellular immune responses. We compared the cellular immune response (assessed in terms of IFN-γ production) to tetanus toxoid and to cytomegalovirus in a series of 13 HIV-perinatally-infected children and adolescents with optimal immunovirological response to first line antiretroviral therapy, implemented during chronic infection. A stronger cellular response to cytomegalovirus (11 out of 13 patients) was observed, as compared to tetanus toxoid (1 out of 13; p=0.003). These results suggest that the repeated exposition to CMV, as opposed to the past exposition to TT, is able to maintain an effective antigen-specific immune response in stable HIV-infected pediatric patients and strengthen current recommendations on immunization practices in these children.

  4. Hepatitis B virus infection status and infertility causes in couples seeking fertility treatment-Indicator of impaired immune response?

    PubMed

    Lao, Terence T; Mak, Jennifer S M; Li, Tin-Chiu

    2017-04-01

    The relationship between hepatitis B (HBV) infection in infertile couples seeking in vitro fertilization (IVF) treatment and infertility causes is unknown. A total of 831 infertile couples attending our unit seeking IVF during January to December 2015 were recruited. HBV infection was found in 6.3% and 7.3% of female and male partners, respectively, and infection in one or both partners was associated with less primary infertility (44.2% vs 55.1%, P=.038). Infected female partners had increased tubal (69.2% vs 43.2%, P<.001) and uterine (13.7% vs 3.1%, P<.001) causes and reduced idiopathic infertility, while infected male partners were associated with increased tubal (62.3% vs 43.4%, P=.004) causes and reduced endometriosis (62.3% vs 73.9%, P=.050). Our results suggest HBV infection in either partner was associated with tubal infertility. HBV infection in either partner probably increases the risk of pelvic infection in female partner through impaired immune response to sexually transmitted infections, with consequent tubal damage and infertility. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. T-2 toxin impairs murine immune response to respiratory reovirus and exacerbates viral bronchiolitis

    SciTech Connect

    Li Maoxiang; Harkema, Jack R.; Islam, Zahidul; Cuff, Chistopher F.; Pestka, James J. . E-mail: Pestka@msu.edu

    2006-11-15

    Exposure to immunosuppressive environmental contaminants is a possible contributing factor to increased occurrence of viral respiratory diseases. The objective of this study was to test the hypothesis that the trichothecene mycotoxin T-2 toxin (T-2), a frequent food contaminant, alters host resistance to lung infection by reovirus, a model respiratory virus. Balb/c mice (4 week old) were treated intraperitoneally with T-2 toxin (1.75 mg/kg bw) or saline vehicle and then intranasally instilled 2 h later with 10{sup 7} plaque forming unit (PFU) of reovirus, strain Lang (T1/L) or saline vehicle. At 10 days post-instillation (PI), both virus plaque-forming responses and reovirus L2 gene expression were 10-fold higher in lungs of T-2-treated mice compared to controls. No-effect and lowest-effect levels for T-2-induced suppression of reovirus clearance were 20 and 200 {mu}g/kg bw, respectively. Respiratory reovirus infection resulted in a mild bronchiolitis with minimal alveolitis, which was markedly exacerbated by T-2 pretreatment. Reovirus exposure induced marked increases in total cells, neutrophils and lymphocytes at 3 and 7 days PI in bronchial alveolar lavage fluid (BALF) whereas macrophages were increased only at 7 days PI. Although prior T-2 exposure attenuated total cell and macrophage counts in BALF of control and infected mice at 3 days PI, the toxin potentiated total cell, macrophage, neutrophil and lymphocyte counts in infected mice at 7 days PI. At 3 days PI, T-2 suppressed reovirus-induced IFN-{gamma} elevation in BALF, but enhanced production of IL-6 and MCP-1. T-2 pretreatment also suppressed reovirus-specific mucosal IgA responses in lung and enteric tract, but potentiated serum IgA and IgG responses. Taken together, T-2 increased lung viral burden, bronchopneumonia and pulmonary cellular infiltration in reovirus-infected mice. These effects might be attributable to reduced alveolar macrophage levels as well as modulated cytokine and mucosal Ig

  6. Cellular immune responses to HIV

    NASA Astrophysics Data System (ADS)

    McMichael, Andrew J.; Rowland-Jones, Sarah L.

    2001-04-01

    The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.

  7. Perinatal Exposure to a Low Dose of Bisphenol A Impaired Systemic Cellular Immune Response and Predisposes Young Rats to Intestinal Parasitic Infection

    PubMed Central

    Ménard, Sandrine; Guzylack-Piriou, Laurence; Lencina, Corinne; Leveque, Mathilde; Naturel, Manon; Sekkal, Soraya; Harkat, Cherryl; Gaultier, Eric; Olier, Maïwenn; Garcia-Villar, Raphael; Theodorou, Vassilia; Houdeau, Eric

    2014-01-01

    Perinatal exposure to the food contaminant bisphenol A (BPA) in rats induces long lasting adverse effects on intestinal immune homeostasis. This study was aimed at examining the immune response to dietary antigens and the clearance of parasites in young rats at the end of perinatal exposure to a low dose of BPA. Female rats were fed with BPA [5 µg/kg of body weight/day] or vehicle from gestational day 15 to pup weaning. Juvenile female offspring (day (D)25) were used to analyze immune cell populations, humoral and cellular responses after oral tolerance or immunization protocol to ovalbumin (OVA), and susceptibility to infection by the intestinal nematode Nippostrongylus brasiliensis (N. brasiliensis). Anti-OVA IgG titers following either oral tolerance or immunization were not affected after BPA perinatal exposure, while a sharp decrease in OVA-induced IFNγ secretion occurred in spleen and mesenteric lymph nodes (MLN) of OVA-immunized rats. These results are consistent with a decreased number of helper T cells, regulatory T cells and dendritic cells in spleen and MLN of BPA-exposed rats. The lack of cellular response to antigens questioned the ability of BPA-exposed rats to clear intestinal infections. A 1.5-fold increase in N. brasiliensis living larvae was observed in the intestine of BPA-exposed rats compared to controls due to an inappropriate Th1/Th2 cytokine production in infected jejunal tissues. These results show that perinatal BPA exposure impairs cellular response to food antigens, and increases susceptibility to intestinal parasitic infection in the juveniles. This emphasized the maturing immune system during perinatal period highly sensitive to low dose exposure to BPA, altering innate and adaptative immune response capacities in early life. PMID:25415191

  8. Absorption of PCB126 by upper airways impairs G protein-coupled receptor-mediated immune response

    NASA Astrophysics Data System (ADS)

    Shimada, Ana Lúcia B.; Cruz, Wesley S.; Loiola, Rodrigo A.; Drewes, Carine C.; Dörr, Fabiane; Figueiredo, Natália G.; Pinto, Ernani; Farsky, Sandra H. P.

    2015-10-01

    PCB126 is a dioxin-like polychlorinated biphenyl (PCB) environmental pollutant with a significant impact on human health, as it bioaccumulates and causes severe toxicity. PCB126-induced immune toxicity has been described, although the mechanisms have not been fully elucidated. In this study, an in vivo protocol of PCB126 intoxication into male Wistar rats by intranasal route was used, which has not yet been described. The intoxication was characterised by PCB126 accumulation in the lungs and liver, and enhanced aryl hydrocarbon receptor expression in the liver, lungs, kidneys, and adipose tissues. Moreover, an innate immune deficiency was characterised by impairment of adhesion receptors on blood leukocytes and by reduced blood neutrophil locomotion and oxidative burst activation elicited by ex vivo G protein-coupled receptor (GPCR) activation. Specificity of PCB126 actions on the GPCR pathway was shown by normal burst oxidative activation evoked by Toll-like receptor 4 and protein kinase C direct activation. Moreover, in vivo PCB180 intoxication did not alter adhesion receptors on blood leukocytes either blood neutrophil locomotion, and only partially reduced the GPCR-induced burst oxidative activation on neutrophils. Therefore, a novel mechanism of in vivo PCB126 toxicity is described which impairs a pivotal inflammatory pathway to the host defence against infections.

  9. Impaired Toll-Like Receptor 3-Mediated Immune Responses from Macrophages of Patients Chronically Infected with Hepatitis C Virus

    PubMed Central

    Qian, Feng; Bolen, Christopher R.; Jing, Chunxia; Wang, Xiaomei; Zheng, Wei; Zhao, Hongyu; Fikrig, Erol; Bruce, R. Douglas; Kleinstein, Steven H.

    2013-01-01

    Hepatitis C virus (HCV) is the most common chronic blood-borne infection in the United States, with the majority of patients becoming chronically infected and a subset (20%) progressing to cirrhosis and hepatocellular carcinoma. Individual variations in immune responses may help define successful resistance to infection with HCV. We have compared the immune response in primary macrophages from patients who have spontaneously cleared HCV (viral load negative [VL−], n = 37) to that of primary macrophages from HCV genotype 1 chronically infected (VL+) subjects (n = 32) and found that macrophages from VL− subjects have an elevated baseline expression of Toll-like receptor 3 (TLR3). Macrophages from HCV patients were stimulated ex vivo through the TLR3 pathway and assessed using gene expression arrays and pathway analysis. We found elevated TLR3 response genes and pathway activity from VL− subjects. Furthermore, macrophages from VL− subjects showed higher production of beta interferon (IFN-β) and related IFN response genes by quantitative PCR (Q-PCR) and increased phosphorylation of STAT-1 by immunoblotting. Analysis of polymorphisms in TLR3 revealed a significant association of intronic TLR3 polymorphism (rs13126816) with the clearance of HCV and the expression of TLR3. Of note, peripheral blood mononuclear cells (PBMCs) from the same donors showed opposite changes in gene expression, suggesting ongoing inflammatory responses in PBMCs from VL+ HCV patients. Our results suggest that an elevated innate immune response enhances HCV clearance mechanisms and may offer a potential therapeutic approach to increase viral clearance. PMID:23220997

  10. Leptin Regulation of Immune Responses.

    PubMed

    Naylor, Caitlin; Petri, William A

    2016-02-01

    Leptin is a regulatory hormone with multiple roles in the immune system. We favor the concept that leptin signaling 'licenses' various immune cells to engage in immune responses and/or to differentiate. Leptin is an inflammatory molecule that is capable of activating both adaptive and innate immunity. It can also 'enhance' immune functions, including inflammatory cytokine production in macrophages, granulocyte chemotaxis, and increased Th17 proliferation. Leptin can also 'inhibit' cells; CD4(+) T cells are inhibited from differentiating into regulatory T cells in the presence of elevated leptin, while NK cells can exhibit impaired cytotoxicity under the same circumstances. Consequently, understanding the effect of leptin signaling is important to appreciate various aspects of immune dysregulation observed in malnutrition, obesity, and autoimmunity.

  11. Constant light suppresses production of Met-enkephalin-containing peptides in cultured splenic macrophages and impairs primary immune response in rats.

    PubMed

    Valdés-Tovar, Marcela; Escobar, Carolina; Solís-Chagoyán, Héctor; Asai, Miguel; Benítez-King, Gloria

    2015-03-01

    The light-dark cycle is an environmental factor that influences immune physiology, and so, variations of the photoperiod length result in altered immune responsivity. Macrophage physiology comprises a spectrum of functions that goes from host defense to immune down-regulation, in addition to their homeostatic activities. Macrophages also play a key role in the transition from innate to adaptive immune responses. Met-enkephalin (MEnk) has been recognized as a modulator of macrophage physiology acting in an autocrine or paracrine fashion to influence macrophage activation, phenotype polarization and production of cytokines that would enhance lymphocyte activation at early stages of an immune response. Previously it was shown that splenic MEnk tissue content is reduced in rats exposed to constant light. In this work, we explored whether production of Met-enkephalin-containing peptides (MECPs) in cultured splenic macrophages is affected by exposure of rats to a constant light regime. In addition, we explored whether primary immune response was impaired under this condition. We found that in rats, 15 days in constant light was sufficient to disrupt their general activity rhythm. Splenic MEnk content oscillations and levels were also blunted throughout a 24-h period in animals subjected to constant light. In agreement, de novo synthesis of MECPs evaluated through incorporation of (35)S-methionine was reduced in splenic macrophages from rats exposed to constant light. Moreover, MECPs immunocytochemistry showed a decrease in the intracellular content and lack of granule-like deposits in this condition. Furthermore, we found that primary T-dependent antibody response was compromised in rats exposed to constant light. In those animals, pharmacologic treatment with MEnk increased IFN-γ-secreting cells. Also, IL-2 secretion from antigen-stimulated splenocytes was reduced after incubation with naloxone, suggesting that immune-derived opioid peptides and stimulation of opioid

  12. Sustained stimulation and expansion of Tregs by IL2 control autoimmunity without impairing immune responses to infection, vaccination and cancer.

    PubMed

    Churlaud, Guillaume; Jimenez, Veronica; Ruberte, Jesus; Amadoudji Zin, Martin; Fourcade, Gwladys; Gottrand, Gaelle; Casana, Estefania; Lambrecht, Benedicte; Bellier, Bertrand; Piaggio, Eliane; Bosch, Fatima; Klatzmann, David

    2014-04-01

    Interleukin 2 (IL2) is the key cytokine supporting survival and function of regulatory T cells (Tregs). We recently reported that low-dose IL2 safely expands/stimulates Tregs and improves autoimmune conditions in humans. Further development of IL2 in autoimmune diseases will require chronic IL2 administration, which could affect beneficial effector immune responses regulated by Tregs. We used recombinant adeno-associated viral vector (rAAV)-mediated gene transfer to continuously release IL2 in mice and assessed its long-term effects on immune responses. A single rAAV-IL2 injection enabled sustained stimulation and expansion of Tregs without inducing Teff activation and prevented diabetes in NOD mice. After several weeks of IL2 production, mice responded normally to a viral challenge and to vaccination, and had pregnancies with offspring that developed normally. They showed no change in the occurrence and growth of chemically-induced tumors. Altogether, chronic low-dose IL2 treatment does not affect beneficial effector immune responses at doses that prevent autoimmune diabetes. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Divergent Annexin A1 expression in periphery and gut is associated with systemic immune activation and impaired gut immune response during SIV infection.

    PubMed

    Sena, Angela A S; Glavan, Tiffany; Jiang, Guochun; Sankaran-Walters, Sumathi; Grishina, Irina; Dandekar, Satya; Goulart, Luiz R

    2016-08-03

    HIV-1 disease progression is paradoxically characterized by systemic chronic immune activation and gut mucosal immune dysfunction, which is not fully defined. Annexin A1 (ANXA1), an inflammation modulator, is a potential link between systemic inflammation and gut immune dysfunction during the simian immunodeficiency virus (SIV) infection. Gene expression of ANXA1 and cytokines were assessed in therapy-naïve rhesus macaques during early and chronic stages of SIV infection and compared with SIV-negative controls. ANXA1 expression was suppressed in the gut but systemically increased during early infection. Conversely, ANXA1 expression increased in both compartments during chronic infection. ANXA1 expression in peripheral blood was positively correlated with HLA-DR+CD4+ and CD8+ T-cell frequencies, and negatively associated with the expression of pro-inflammatory cytokines and CCR5. In contrast, the gut mucosa presented an anergic cytokine profile in relation to ANXA1 expression. In vitro stimulations with ANXA1 peptide resulted in decreased inflammatory response in PBMC but increased activation of gut lymphocytes. Our findings suggest that ANXA1 signaling is dysfunctional in SIV infection, and may contribute to chronic inflammation in periphery and with immune dysfunction in the gut mucosa. Thus, ANXA1 signaling may be a novel therapeutic target for the resolution of immune dysfunction in HIV infection.

  14. Divergent Annexin A1 expression in periphery and gut is associated with systemic immune activation and impaired gut immune response during SIV infection

    PubMed Central

    Sena, Angela A. S.; Glavan, Tiffany; Jiang, Guochun; Sankaran-Walters, Sumathi; Grishina, Irina; Dandekar, Satya; Goulart, Luiz R.

    2016-01-01

    HIV-1 disease progression is paradoxically characterized by systemic chronic immune activation and gut mucosal immune dysfunction, which is not fully defined. Annexin A1 (ANXA1), an inflammation modulator, is a potential link between systemic inflammation and gut immune dysfunction during the simian immunodeficiency virus (SIV) infection. Gene expression of ANXA1 and cytokines were assessed in therapy-naïve rhesus macaques during early and chronic stages of SIV infection and compared with SIV-negative controls. ANXA1 expression was suppressed in the gut but systemically increased during early infection. Conversely, ANXA1 expression increased in both compartments during chronic infection. ANXA1 expression in peripheral blood was positively correlated with HLA-DR+CD4+ and CD8+ T-cell frequencies, and negatively associated with the expression of pro-inflammatory cytokines and CCR5. In contrast, the gut mucosa presented an anergic cytokine profile in relation to ANXA1 expression. In vitro stimulations with ANXA1 peptide resulted in decreased inflammatory response in PBMC but increased activation of gut lymphocytes. Our findings suggest that ANXA1 signaling is dysfunctional in SIV infection, and may contribute to chronic inflammation in periphery and with immune dysfunction in the gut mucosa. Thus, ANXA1 signaling may be a novel therapeutic target for the resolution of immune dysfunction in HIV infection. PMID:27484833

  15. No change in impaired cellular immune response of HIV-negative homosexuals after 15 years of HIV epidemic in Eastern/Central European region.

    PubMed

    Barabás, E; González, R; Nagy, K; Várkonyi, V; Horváth, A

    2001-01-01

    Impaired cell-mediated immune reactivity to polyclonal mitogens was determined in HIV-negative homosexual men (HIV-MSM). Results were compared to those we reported in a complex clinical and immunological investigation in the same risk groups 15 years ago, before the onset of the AIDS epidemic in Hungary. Cellular immune reactivity to polyclonal mitogens was studied in 74 HIV-infected or HIV-uninfected homosexual men and heterosexual controls. Lymphocytes in whole-blood cultures were stimulated with various doses of phytohaemagglutinin (PHA), concanavalin-A (Con-A), and pokeweed mitogen (PWM) in a blast transformation assay. A significant difference (p = .0002) in lymphocyte proliferation between HIV-MSM vs. heterosexuals using PWM in both concentrations was found. Proliferative capacity was similar in HIV- MSM and HIV infected males with CD4+ > 500/microl. Con-A and PHA showed a less expressed proliferative response. Decreased lymphocyte reactivity to PWM, similar to the one in early HIV infection, could be observed in HIV-MSM. This HIV-independent mild immunodeficiency in MSM is a sign of an increased susceptibility and predisposes to subsequent HIV infection. It seems, however, that MSM's impaired immune response observed over a period of 15 years is an immunodeficiency not changed by the emerging HIV/AIDS epidemic. Our study provides an explanation why the incidence of new HIV cases in homo-/bisexual individuals is still high (> 70%), and it indicates that it remains high in Hungary.

  16. Immune Responses in Neonates

    PubMed Central

    Basha, Saleem; Surendran, Naveen; Pichichero, Michael

    2015-01-01

    Neonates have little immunological memory and a developing immune system, which increases their vulnerability to infectious agents. Recent advances in understanding of neonatal immunity indicate that both innate and adaptive responses are dependent on precursor frequency of lymphocytes, antigenic dose and mode of exposure. Studies in neonatal mouse models and human umbilical cord blood cells demonstrate the capability of neonatal immune cells to produce immune responses similar to adults in some aspects but not others. This review focuses mainly on the developmental and functional mechanisms of the human neonatal immune system. In particular, the mechanism of innate and adaptive immunity and the role of neutrophils, antigen presenting cells, differences in subclasses of T lymphocytes (Th1, Th2, Tregs) and B cells are discussed. In addition, we have included the recent developments in neonatal mouse immune system. Understanding neonatal immunity is essential to development of therapeutic vaccines to combat newly emerging infectious agents. PMID:25088080

  17. Impaired T Cell-dependent Humoral Immune Response Associated with Juvenile-onset Recurrent Respiratory Papillomatosis Progression

    PubMed Central

    Wu, Xunyao; Wang, Guoliang; Chen, Xi; Zhang, Jie; Zhao, Jing; Wang, Jun; Xiao, Yang; Tai, Jun; Wang, Shengcai; Wang, Guixiang; Wang, Hua; Bai, Lina; Gui, Jingang; Ni, Xin

    2016-01-01

    Whether humoral immunity plays a role in HPV type 6 or 11 virus-mediated Juvenile-onset Recurrent Respiratory Papillomatosis (JORRP) remains unknown. In the present study, serum total IgG level in 44 JORRP patients was significantly decreased compared with that in 40 healthy controls. Moreover, expanded CD3−CD19+ B cells with down-regulation of CD23, CD40, HLA-DR and up-regulation of CD86 expression were found in the peripheral blood of JORRP patients. Flow cytometry analysis of B-cell compartment showed that the frequency of both CD19+CD27hi plasma cells and CD19+CD27+ memory B cells were decreased in JORRP patients. Importantly, although the proportion of circulating CXCR5+PD1hi Tfh cells was not changed, the function of Tfh cells were greatly impaired with reduced ability of IL-21 secretion to promote B cell maturation. Association analysis by the Kaplan-Meier method revealed that IL-21 secreting Tfh cell was positively correlated to the CD27+ B cell subset frequency, the serum IgG level and the frequency of recurrence in JORRP patients, but negatively correlated to the percentage of IgD+CD27− B cell. We concluded that a reduced IL-21 secretion by Tfh cells may limit B cell maturation and antibody production in JORRP patients and Tfh cell-derived IL-21 might be associated with JORRP outcome in clinic. PMID:27821867

  18. Mammary gene expression profiles during an intramammary challenge reveal potential mechanisms linking negative energy balance with impaired immune response.

    PubMed

    Moyes, Kasey M; Drackley, James K; Morin, Dawn E; Rodriguez-Zas, Sandra L; Everts, Robin E; Lewin, Harris A; Loor, Juan J

    2010-04-01

    Our objective was to compare mammary tissue gene expression profiles during a Streptococcus uberis (S. uberis) mastitis challenge between lactating cows subjected to dietary-induced negative energy balance (NEB; n = 5) and cows fed ad libitum to maintain positive energy balance (PEB; n = 5) to better understand the mechanisms associated with NEB and risk of mastitis during the transition period. The NEB cows were feed-restricted to 60% of calculated net energy for lactation requirements for 7 days, and cows assigned to PEB were fed the same diet for ad libitum intake. Five days after feed restriction, one rear mammary quarter of each cow was inoculated with 5,000 cfu of S. uberis (O140J). At 20 h postinoculation, S. uberis-infected mammary quarters from all cows were biopsied for RNA extraction. Negative energy balance resulted in 287 differentially expressed genes (DEG; false discovery rate ≤ 0.05), with 86 DEG upregulated and 201 DEG downregulated in NEB vs. PEB. Canonical pathways most affected by NEB were IL-8 signaling (10 genes), glucocorticoid receptor signaling (13), and NRF2-mediated oxidative stress response (10). Among the genes differentially expressed by NEB, cell growth and proliferation (48) and cellular development (36) were the most enriched functions. Regarding immune response, HLA-A was upregulated due to NEB, whereas the majority of genes involved in immune response were downregulated (e.g., AKT1, IRAK1, MAPK9, and TRAF6). This study provided new avenues for investigation into the mechanisms relating NEB and susceptibility to mastitis in lactating dairy cows.

  19. Mammary gene expression profiles during an intramammary challenge reveal potential mechanisms linking negative energy balance with impaired immune response

    PubMed Central

    Moyes, Kasey M.; Drackley, James K.; Morin, Dawn E.; Rodriguez-Zas, Sandra L.; Everts, Robin E.; Lewin, Harris A.

    2010-01-01

    Our objective was to compare mammary tissue gene expression profiles during a Streptococcus uberis (S. uberis) mastitis challenge between lactating cows subjected to dietary-induced negative energy balance (NEB; n = 5) and cows fed ad libitum to maintain positive energy balance (PEB; n = 5) to better understand the mechanisms associated with NEB and risk of mastitis during the transition period. The NEB cows were feed-restricted to 60% of calculated net energy for lactation requirements for 7 days, and cows assigned to PEB were fed the same diet for ad libitum intake. Five days after feed restriction, one rear mammary quarter of each cow was inoculated with 5,000 cfu of S. uberis (O140J). At 20 h postinoculation, S. uberis-infected mammary quarters from all cows were biopsied for RNA extraction. Negative energy balance resulted in 287 differentially expressed genes (DEG; false discovery rate ≤ 0.05), with 86 DEG upregulated and 201 DEG downregulated in NEB vs. PEB. Canonical pathways most affected by NEB were IL-8 signaling (10 genes), glucocorticoid receptor signaling (13), and NRF2-mediated oxidative stress response (10). Among the genes differentially expressed by NEB, cell growth and proliferation (48) and cellular development (36) were the most enriched functions. Regarding immune response, HLA-A was upregulated due to NEB, whereas the majority of genes involved in immune response were downregulated (e.g., AKT1, IRAK1, MAPK9, and TRAF6). This study provided new avenues for investigation into the mechanisms relating NEB and susceptibility to mastitis in lactating dairy cows. PMID:20103698

  20. Infant HIV-1 Infection Severely Impairs the Bacille Calmette-Guerin Vaccine-Induced Immune Response1

    PubMed Central

    Mansoor, Nazma; Scriba, Thomas J.; de Kock, Marwou; Tameris, Michele; Abel, Brian; Keyser, Alana; Little, Francesca; Soares, Andreia; Gelderbloem, Sebastian; Mlenjeni, Silvia; Denation, Lea; Hawkridge, Anthony; Boom, W. Henry; Kaplan, Gilla; Hussey, Gregory D.; Hanekom, Willem A.

    2010-01-01

    Background World-wide, most infants born to HIV-infected mothers receive BCG. Tuberculosis is a major cause of death of HIV-infected infants in sub-Saharan Africa, and should be prevented. However, BCG may itself cause disease (BCGosis) in these infants. Information regarding the immunogenicity of BCG is imperative for the risk/benefit assessment of BCG vaccination in HIV-infected infants; however, no such data exists. Methods We compared BCG-induced CD4 and CD8 T cell responses, assessed by flow cytometry, in HIV-infected (n = 20), HIV-exposed but uninfected (n = 25), and HIV-unexposed (n = 23) infants, over their first year of life. Results BCG vaccination of the 2 HIV-uninfected groups induced a robust response, characterized by IFN-γ, TNF-α, and/or IL-2-expressing CD4 T cells. In contrast, HIV-infected infants had a markedly lower response, throughout the first year of life. These infants also had significantly reduced numbers of IFN-γ, TNF-α and IL-2 co-expressing polyfunctional CD4 T cells, thought to indicate T cell quality. Conclusions HIV-1 infection severely impairs the BCG-specific T cell response during the first year of life. BCG may therefore provide little, if any, vaccine-induced benefit in HIV-infected infants. Considering the significant risk of BCGosis, these data strongly support not giving BCG to HIV-infected infants. PMID:19236280

  1. HIV-TB coinfection impairs CD8(+) T-cell differentiation and function while dehydroepiandrosterone improves cytotoxic antitubercular immune responses.

    PubMed

    Suarez, Guadalupe V; Angerami, Matías T; Vecchione, María B; Laufer, Natalia; Turk, Gabriela; Ruiz, Maria J; Mesch, Viviana; Fabre, Bibiana; Maidana, Patricia; Ameri, Diego; Cahn, Pedro; Sued, Omar; Salomón, Horacio; Bottasso, Oscar A; Quiroga, María F

    2015-09-01

    Tuberculosis (TB) is the leading cause of death among HIV-positive patients. The decreasing frequencies of terminal effector (TTE ) CD8(+) T cells may increase reactivation risk in persons latently infected with Mycobacterium tuberculosis (Mtb). We have previously shown that dehydroepiandrosterone (DHEA) increases the protective antitubercular immune responses in HIV-TB patients. Here, we aimed to study Mtb-specific cytotoxicity, IFN-γ secretion, memory status of CD8(+) T cells, and their modulation by DHEA during HIV-TB coinfection. CD8(+) T cells from HIV-TB patients showed a more differentiated phenotype with diminished naïve and higher effector memory and TTE T-cell frequencies compared to healthy donors both in total and Mtb-specific CD8(+) T cells. Notably, CD8(+) T cells from HIV-TB patients displayed higher Terminal Effector (TTE ) CD45RA(dim) proportions with lower CD45RA expression levels, suggesting a not fully differentiated phenotype. Also, PD-1 expression levels on CD8(+) T cells from HIV-TB patients increased although restricted to the CD27(+) population. Interestingly, DHEA plasma levels positively correlated with TTE in CD8(+) T cells and in vitro DHEA treatment enhanced Mtb-specific cytotoxic responses and terminal differentiation in CD8(+) T cells from HIV-TB patients. Our data suggest that HIV-TB coinfection promotes a deficient CD8(+) T-cell differentiation, whereas DHEA may contribute to improving antitubercular immunity by enhancing CD8(+) T-cell functions during HIV-TB coinfection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. HIV-1 infection in infants severely impairs the immune response induced by Bacille Calmette-Guérin vaccine.

    PubMed

    Mansoor, Nazma; Scriba, Thomas J; de Kock, Marwou; Tameris, Michele; Abel, Brian; Keyser, Alana; Little, Francesca; Soares, Andreia; Gelderbloem, Sebastian; Mlenjeni, Silvia; Denation, Lea; Hawkridge, Anthony; Boom, W Henry; Kaplan, Gilla; Hussey, Gregory D; Hanekom, Willem A

    2009-04-01

    Worldwide, most infants born to mothers infected with human immunodeficiency virus (HIV) receive bacille Calmette-Guérin (BCG) vaccine. Tuberculosis is a major cause of death among infants infected with HIV in sub-Saharan Africa, and it should be prevented. However, BCG may itself cause disease (known as "BCGosis") in these infants. Information regarding the immunogenicity of BCG is imperative for the risk/benefit assessment of BCG vaccination in HIV-infected infants; however, no such data exist. We compared BCG-induced CD4 and CD8 T cell responses, as assessed by flow cytometry, in HIV-infected (n=20), HIV-exposed but uninfected (n=25), and HIV-unexposed (n=23) infants, during their first year of life. BCG vaccination of the 2 HIV-uninfected groups induced a robust response, which was characterized by CD4 T cells expressing interferon (IFN)-gamma, tumor necrosis factor (TNF)-alpha, and/or interleukin (IL)-2. In contrast, HIV-infected infants demonstrated a markedly lower response throughout the first year of life. These infants also had significantly reduced numbers of polyfunctional CD4 T cells coexpressing IFN-gamma, TNF-alpha, and IL-2, a finding that is thought to indicate T cell quality. Infection with HIV severely impairs the BCG-specific T cell response during the first year of life. BCG may therefore provide little, if any, vaccine-induced benefit in HIV-infected infants. Considering the significant risk of BCGosis, these data strongly support not giving BCG to HIV-infected infants.

  3. Immune responses to metastases

    SciTech Connect

    Herberman, R.B.; Wiltrout, R.H.; Gorelik, E.

    1987-01-01

    The authors present the changes in the immune system in tumor-bearing hosts that may influence the development of progression of metastases. Included are mononuclear cell infiltration of metastases; alterations in natural resistance mediated by natural killer cells and macrophages; development of specific immunity mediated by T-lymphocytes or antibodies; modulation of tumor-associated antigen expression; and the down-regulation of the immune response to the tumor by several suppressor mechanisms; the augmentation of the immune response and its potential for therapeutic application; includes the prophylaxis of metastases formation by NK cells; the therapy of metastases by augmentation NK-, macrophage-, or T-lymphocyte-mediated responses by biological response modifiers; and the transfer of anticancer activity by cytoxic T-lymphocytes or immunoconjugates of monoclonal antibodies with specificity for tumors.

  4. Impaired mucosal antibody response to cholera toxin in vitamin A-deficient rats immunized with oral cholera vaccine.

    PubMed Central

    Wiedermann, U; Hanson, L A; Holmgren, J; Kahu, H; Dahlgren, U I

    1993-01-01

    To investigate the importance of vitamin A in the ability to respond to oral antigen administration, rats were fed a vitamin A-free diet. The animals were immunized perorally three times with a mixture of cholera toxin (CT) and a commercial cholera vaccine. The total immunoglobulin A (IgA) concentration as well as the specific IgA anti-CT antibody levels in serum and bile was significantly lower in the vitamin A-deficient animals than in the paired fed controls (animals that were fed a normal commercial diet in an amount equal to the amount the deficient animals consumed), while the levels of total and specific anti-CT IgG were not affected to the same extent by the vitamin A deficiency. The number of IgA anti-CT antibody-producing cells in the mesenteric lymph nodes after immunization was also significantly lower in the vitamin A-deficient rats than in the control rats. Supplementation of the diet with retinyl palmitate restored the ability to mount an IgA antibody response to the antigen, since the level of specific IgA anti-CT antibodies in relation to the total IgA concentration was as high in the vitamin A-supplemented group as in the paired fed control group. Restricted diet intake by itself did not affect the ability to respond adequately to the antigen since there was no difference in IgA anti-CT antibody level between paired fed rats and those being fed ad libitum. Assessment of transforming growth factor beta in cell cultures revealed no difference between vitamin A-deficient and paired fed animals. In summary, vitamin A deficiency resulted in a decreased number of IgA-producing cells, decreased IgA production, and a reduced ability to respond with IgA antibodies to the oral cholera vaccine. PMID:8359917

  5. Prenatal vitamin A deficiency impairs adaptive immune responses to pentavalent rotavirus vaccine (RotaTeq®) in a neonatal gnotobiotic pig model.

    PubMed

    Kandasamy, Sukumar; Chattha, Kuldeep S; Vlasova, Anastasia N; Saif, Linda J

    2014-02-07

    Vitamin A deficiency (VAD) is associated with increased childhood mortality and morbidity in impoverished Asian and African countries, but the impact of VAD on rotavirus (RV) vaccine or infection is poorly understood. We assessed effects of gestational and dietary induced pre- and post-natal VAD and vitamin A supplementation on immune responses to a pentavalent rotavirus vaccine, RotaTeq(®) in a neonatal gnotobiotic pig model. Vaccine efficacy was assessed against virulent G1P[8] human rotavirus (HRV) challenge. VAD and vitamin A sufficient (VAS) piglets were derived from dietary VAD and VAS sows, respectively. VAD piglets had significantly lower levels of hepatic vitamin A compared to that of VAS piglets. RotaTeq(®)-vaccinated VAD piglets had 350-fold higher fecal virus shedding titers compared to vaccinated VAS piglets post-challenge. Only 25% of vaccinated non-vitamin A supplemented VAD piglets were protected against diarrhea compared with 100% protection rate in vaccinated non-supplemented VAS piglets post-challenge. Intestinal HRV specific immune responses were compromised in VAD piglets. Vaccinated VAD piglets had significantly lower ileal HRV IgG antibody secreting cell (ASC) responses (pre-challenge) and duodenal HRV IgA ASC responses (post-challenge) compared to vaccinated VAS piglets. Also, intestinal HRV IgA antibody titers were 11-fold lower in vaccinated VAD compared to vaccinated VAS piglets post-challenge. Persistently elevated levels of IL-8, a pro-inflammatory mediator, and lower IL-10 responses (anti-inflammatory) in vaccinated VAD compared to VAS piglets suggest more severe inflammatory responses in VAD piglets post-challenge. Moreover higher IFN-γ responses pre-challenge were observed in VAD compared to VAS piglets. The impaired vaccine-specific intestinal antibody responses and decreased immunoregulatory cytokine responses coincided with reduced protective efficacy of the RV vaccine against virulent HRV challenge in VAD piglets. In

  6. Restimulation-induced T-cell death through NTB-A/SAP signaling pathway is impaired in tuberculosis patients with depressed immune responses.

    PubMed

    Hernández Del Pino, Rodrigo E; Pellegrini, Joaquín M; Rovetta, Ana I; Peña, Delfina; Álvarez, Guadalupe I; Rolandelli, Agustín; Musella, Rosa M; Palmero, Domingo J; Malbran, Alejandro; Pasquinelli, Virginia; García, Verónica E

    2017-09-01

    Production of IFN-γ contributes to host defense against Mycobacterium tuberculosis (Mtb) infection. We previously demonstrated that Signaling lymphocytic activation molecule-associated protein (SAP) expression on cells from tuberculosis (TB) patients was inversely correlated with IFN-γ production. Here we first investigated the role of NK, T- and B-cell antigen (NTB-A)/SAP pathway in the regulation of Th1 response against Mtb. Upon antigen stimulation, NTB-A phosphorylation rapidly increases and afterwards modulates IFN-γ and IL-17 secretion. To sustain a healthy immune system, controlled expansion and contraction of lymphocytes, both during and after an adaptive immune response, is essential. Besides, restimulation-induced cell death (RICD) results in an essential homeostatic mechanism for precluding excess T-cell accumulation and associated immunopathology during the course of certain infections. Accordingly, we found that the NTB-A/SAP pathway was required for RICD during active tuberculosis. In low responder (LR) TB patients, impaired RICD was associated with diminished FASL levels, IL-2 production and CD25(high) expression after cell-restimulation. Interestingly, we next observed that SAP mediated the recruitment of the Src-related kinase FYNT, only in T cells from LR TB patients that were resistant to RICD. Together, we showed that the NTB-A/SAP pathway regulates T-cell activation and RICD during human TB. Moreover, the NTB-A/SAP/FYNT axis promotes polarization to an unfavorable Th2-phenotype.

  7. The immune response to surgery and infection

    PubMed Central

    Słotwiński, Robert

    2014-01-01

    Surgical trauma affects both the innate and acquired immunity. The severity of immune disorders is proportional to the extent of surgical trauma and depends on a number of factors, including primarily the basic disease requiring surgical treatment (e.g. cancer), often coexisting infections and impaired nutritional status. Disorder of the immune response following surgical trauma may predispose to septic complications burdened with the highest mortality rate. Extensive surgery in cancer patients is associated with simultaneous activation of pro- and anti-inflammatory processes defined as SIRS (systemic inflammatory immune response) and CARS (compensatory anti-inflammatory immune response). However, it is generally believed that major surgical trauma is accompanied by sustained postoperative immunosuppression, which is particularly important in patients operated on for cancer, since the suppression of the immune system promotes not only septic complications, but also proliferation and tumor metastasis. This paper reviews the main features of immune response to surgical trauma and possibilities of its regulation. PMID:26155175

  8. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    PubMed Central

    Dang, N.N.; Pang, S.G.; Song, H.Y.; An, L.G.; Ma, X.L.

    2014-01-01

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response. PMID:25493381

  9. Dietary zinc deficiency impairs humoral and cellular immune responses to BCG and ESAT-6/CFP-10 vaccination in offspring and adult rats.

    PubMed

    Shi, Lina; Zhang, Lianying; Li, Changcai; Hu, Xiaoyan; Wang, Xiaolei; Huang, Qing; Zhou, Gengyin

    2016-03-01

    Besides being the world's most widely used vaccine, BCG is the most controversial vaccine in current use. Estimates of protection impaired by BCG against pulmonary TB vary from nil to 80%. Dietary zinc deficiency has been confirmed to impair the immune function of animals. However, knowledge about effects of mild dietary zinc deficiency and the time of vaccination on BCG vaccine responsiveness in offspring and adult rats is limited. This work investigated the consequences of feeding zinc deficient and normal zinc diets to rats during gestation, infancy or adulthood on the immune responses to BCG vaccination. On gestation day 0, sixteen maternal rats were divided into two groups and fed with diets bellow: a control diet ad libitum (30 μg zinc/g diet, NC), a zinc deficient diet ad libitum (8 μg zinc/g diet, ZnD). Pup rats were served as experimental subjects. From day 1 of pregnancy upon delivery, maternal rats were given a standard diet (30 mg/kg/day zinc) or zinc deficient diet (8 mg/kg/day zinc) respectively. Adult male 10-week Wistar rats were divided into two dietary groups for 17 weeks of feeding: a control diet ad libitum (30 μg zinc/g diet, NC), a zinc deficient diet ad libitum (8 μg zinc/g diet, ZnD). The birth time of newborn pups was recorded as the zero week. For adult male rats, the time of receiving different assigned diet was recorded as the zeroth week. Newborn pups of these maternal rats were immunized with BCG vaccine or MTB antigen ESAT-6/CFP-10 at postnatal 0 and 2 week. The adult male rats were immunized on the 12th and 14th week. Then, blood samples, thymus and spleen from the rats were harvested for detection of humoral and cell-mediated immune responses using ELISA, MTT and QRT-PCR analysis. Decreased INF-γ and TNF-α production in plasma, changes of expression level of ZIP2, ZIP8, NF-κB and IL-6 mRNA in immune organs, together with reduced T cell proliferation was observed in pups and adult BCG rats suffered from dietary zinc deficiency

  10. Exercise boosts immune response.

    PubMed

    Sander, Ruth

    2012-06-29

    Ageing is associated with a decline in normal functioning of the immune system described as 'immunosenescence'. This contributes to poorer vaccine response and increased incidence of infection and malignancy seen in older people. Regular exercise can enhance vaccination response, increase T-cells and boost the function of the natural killer cells in the immune system. Exercise also lowers levels of the inflammatory cytokines that cause the 'inflamm-ageing' that is thought to play a role in conditions including cardiovascular disease; type 2 diabetes; Alzheimer's disease; osteoporosis and some cancers.

  11. Immune responses in space flight

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.

    1998-01-01

    significance of space flight-induced changes in immune parameters remains to be established; however, as duration of flights increases, the potential for difficulties due to impaired immune responses also increases.

  12. Immune responses in space flight

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.

    1998-01-01

    significance of space flight-induced changes in immune parameters remains to be established; however, as duration of flights increases, the potential for difficulties due to impaired immune responses also increases.

  13. Alteration of cell wall xylan acetylation triggers defense responses that counterbalance the immune deficiencies of plants impaired in the β-subunit of the heterotrimeric G-protein.

    PubMed

    Escudero, Viviana; Jordá, Lucía; Sopeña-Torres, Sara; Mélida, Hugo; Miedes, Eva; Muñoz-Barrios, Antonio; Swami, Sanjay; Alexander, Danny; McKee, Lauren S; Sánchez-Vallet, Andrea; Bulone, Vincent; Jones, Alan M; Molina, Antonio

    2017-08-09

    Arabidopsis heterotrimeric G-protein complex modulates pathogen-associated molecular pattern-triggered immunity (PTI) and disease resistance responses to different types of pathogens. It also plays a role in plant cell wall integrity as mutants impaired in the Gβ- (agb1-2) or Gγ-subunits have an altered wall composition compared with wild-type plants. Here we performed a mutant screen to identify suppressors of agb1-2 (sgb) that restore susceptibility to pathogens to wild-type levels. Out of the four sgb mutants (sgb10-sgb13) identified, sgb11 is a new mutant allele of ESKIMO1 (ESK1), which encodes a plant-specific polysaccharide O-acetyltransferase involved in xylan acetylation. Null alleles (sgb11/esk1-7) of ESK1 restore to wild-type levels the enhanced susceptibility of agb1-2 to the necrotrophic fungus Plectosphaerella cucumerina BMM (PcBMM), but not to the bacterium Pseudomonas syringae pv. tomato DC3000 or to the oomycete Hyaloperonospora arabidopsidis. The enhanced resistance to PcBMM of the agb1-2 esk1-7 double mutant was not the result of the re-activation of deficient PTI responses in agb1-2. Alteration of cell wall xylan acetylation caused by ESK1 impairment was accompanied by an enhanced accumulation of abscisic acid, the constitutive expression of genes encoding antibiotic peptides and enzymes involved in the biosynthesis of tryptophan-derived metabolites, and the accumulation of disease resistance-related secondary metabolites and different osmolites. These esk1-mediated responses counterbalance the defective PTI and PcBMM susceptibility of agb1-2 plants, and explain the enhanced drought resistance of esk1 plants. These results suggest that a deficient PTI-mediated resistance is partially compensated by the activation of specific cell-wall-triggered immune responses. © 2017 The Authors The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

  14. Conditional deletion of Stat3 in mammary epithelium impairs the acute phase response and modulates immune cell numbers during post-lactational regression

    PubMed Central

    Hughes, Katherine; Wickenden, Julie A; Allen, Judith E; Watson, Christine J

    2012-01-01

    Mammary gland regression following weaning (involution) is associated with extensive cell death and the acquisition of an inflammatory signature. Characterizing the interplay between mammary epithelial cells, the re-emerging stroma and immune cells has implications for the understanding of the pathogenesis of pregnancy-associated breast cancer. Stat3 has a role in orchestrating cell death and involution, and we sought to determine whether expression of Stat3 by the mammary epithelium also influences the innate immune environment and inflammatory cell influx in the gland. We examined mice in which Stat3 is conditionally deleted only in the mammary epithelium. Distinct sets of genes associated with the acute phase response and innate immunity are markedly up-regulated during first phase involution in a Stat3-dependent manner. During second phase involution, chitinase 3-like 1, which has been associated with wound healing and chronic inflammatory conditions, is dramatically up-regulated by Stat3. Also at this time, the number of mammary macrophages and mast cells increases per unit area, and this increase is impaired in the absence of epithelial Stat3. Furthermore, expression of arginase-1 and Ym1, markers of alternatively activated macrophages, is significantly decreased in the absence of Stat3, whilst iNOS, a marker associated with classically activated macrophages, shows significantly increased expression in the Stat3-deleted glands. Thus, Stat3 is a key transcriptional regulator of genes associated with innate immunity and wound healing and influences mammary macrophage and mast cell numbers. The presence of epithelial Stat3 appears to polarize the macrophages and epithelial cells towards an alternatively activated phenotype, since in the absence of Stat3, the gland retains a phenotype associated with classically activated macrophages. These findings have relevance to the study of pregnancy-associated breast cancer and the role of Stat3 signalling in recruitment

  15. Mutant huntingtin impairs immune cell migration in Huntington disease

    PubMed Central

    Kwan, Wanda; Träger, Ulrike; Davalos, Dimitrios; Chou, Austin; Bouchard, Jill; Andre, Ralph; Miller, Aaron; Weiss, Andreas; Giorgini, Flaviano; Cheah, Christine; Möller, Thomas; Stella, Nephi; Akassoglou, Katerina; Tabrizi, Sarah J.; Muchowski, Paul J.

    2012-01-01

    In Huntington disease (HD), immune cells are activated before symptoms arise; however, it is unclear how the expression of mutant huntingtin (htt) compromises the normal functions of immune cells. Here we report that primary microglia from early postnatal HD mice were profoundly impaired in their migration to chemotactic stimuli, and expression of a mutant htt fragment in microglial cell lines was sufficient to reproduce these deficits. Microglia expressing mutant htt had a retarded response to a laser-induced brain injury in vivo. Leukocyte recruitment was defective upon induction of peritonitis in HD mice at early disease stages and was normalized upon genetic deletion of mutant htt in immune cells. Migration was also strongly impaired in peripheral immune cells from pre-manifest human HD patients. Defective actin remodeling in immune cells expressing mutant htt likely contributed to their migration deficit. Our results suggest that these functional changes may contribute to immune dysfunction and neurodegeneration in HD, and may have implications for other polyglutamine expansion diseases in which mutant proteins are ubiquitously expressed. PMID:23160193

  16. Glycobiology of immune responses

    PubMed Central

    Rabinovich, Gabriel A.; van Kooyk, Yvette; Cobb, Brian A.

    2013-01-01

    Unlike their protein “roommates” and their nucleic acid “cousins,” carbohydrates remain an enigmatic arm of biology. The central reason for the difficulty in fully understanding how carbohydrate structure and biological function are tied is the nontemplate nature of their synthesis and the resulting heterogeneity. The goal of this collection of expert reviews is to highlight what is known about how carbohydrates and their binding partners—the microbial (non-self), tumor (altered-self), and host (self)—cooperate within the immune system, while also identifying areas of opportunity to those willing to take up the challenge of understanding more about how carbohydrates influence immune responses. In the end, these reviews will serve as specific examples of how carbohydrates are as integral to biology as are proteins, nucleic acids, and lipids. Here, we attempt to summarize general concepts on glycans and glycan-binding proteins (mainly C-type lectins, siglecs, and galectins) and their contributions to the biology of immune responses in physiologic and pathologic settings. PMID:22524422

  17. Correction of age-associated deficiency in germinal center response by immunization with immune complexes.

    PubMed

    Zheng, Biao; Switzer, Kirsten; Marinova, Ekaterina; Wansley, Daniel; Han, Shuhua

    2007-08-01

    In aging, both primary and secondary antibody responses are impaired. One of the most notable changes in age-associated immune deficiency is the diminished germinal center (GC) reaction. This impaired GC response reduces antibody affinity maturation, decreases memory B cell development, and prevents the establishment of long-term antibody-forming cells in the bone marrow. It is of great importance to explore novel strategy in improving GC response in the elderly. In this study, the efficacy of immunization with immune complexes in overcoming age-associated deficiency in GC response was investigated. We show that the depressed GC response in aged mice can be significantly elevated by immunization with immune complexes. Importantly, there is a significant improvement of B cell memory response and long-lived plasma cells. Our results demonstrate that immune complex immunization may represent a novel strategy to elicit functional GC response in aging, and possibly, to overcome age-related immune deficiency in general.

  18. Transient immune impairment after a simulated long-haul flight.

    PubMed

    Wilder-Smith, Annelies; Mustafa, Fatima B; Peng, Chung Mien; Earnest, Arul; Koh, David; Lin, Gen; Hossain, Iqbal; MacAry, Paul A

    2012-04-01

    Almost 2 billion people travel aboard commercial airlines every year, with about 20% developing symptoms of the common cold within 1 wk after air travel. We hypothesize that hypobaric hypoxic conditions associated with air travel may contribute to immune impairment. We studied the effects of hypobaric hypoxic conditions during a simulated flight at 8000 ft (2438 m) cruising altitude on immune and stress markers in 52 healthy volunteers (mean age 31) before and on days 1, 4, and 7 after the flight. We did a cohort study using a generalized estimating equation to examine the differences in the repeated measures. Our findings show that the hypobaric hypoxic conditions of a 10-h overnight simulation flight are not associated with severe immune impairment or abnormal IgA or cortisol levels, but with transient impairment in some parameters: we observed a transient decrease in lymphocyte proliferative responses combined with an upregulation in CD69 and CD14 cells and a decrease in HLA-DR in the immediate days following the simulated flight that normalized by day 7 in most instances. These transient immune changes may contribute to an increased susceptibility to respiratory infections commonly seen after long-haul flights.

  19. Selenium and immune responses

    SciTech Connect

    Kiremidjian-Schumacher, L.; Stotzky, G.

    1987-04-01

    Selenium (Se) affects all components of the immune system, i.e., the development and expression of nonspecific, humoral, and cell-mediated responses. In general, a deficiency in Se appears to result in immunosuppression, whereas supplementation with low doses of Se appears to result in augmentation and/or restoration of immunologic functions. A deficiency of Se has been shown to inhibit (1) resistance to microbial and viral infections, (2) neutrophil function, (3) antibody production, (4) proliferation of T and B lymphocytes in response to mitogens, and (5) cytodestruction by T lymphocytes and NK cells. Supplementation with Se has been shown to stimulate (1) the function of neutrophils, (2) production of antibodies, (3) proliferation of T and B lymphocytes in response to mitogens, (4) production of lymphokines, (5) NK cell-mediated cytodestruction, (6) delayed-type hypersensitivity reactions and allograft rejection, and (7) the ability of a host to reject transplanted malignant tumors. The mechanism(s) whereby Se affects the immune system is speculative. The effects of Se on the function of glutathione peroxidase and on the cellular levels of reduced glutathione and H/sub 2/Se, as well as the ability of Se to interact with cell membranes, probably represent only a few of many regulatory mechanisms. The manipulation of cellular levels of Se may be significant for the maintenance of general health and for the control of immunodeficiency disorders and the chemoprevention of cancer.

  20. Human immune responses in cryptosporidiosis

    PubMed Central

    Borad, Anoli; Ward, Honorine

    2010-01-01

    Immune responses play a critical role in protection from, and resolution of, cryptosporidiosis. However, the nature of these responses, particularly in humans, is not completely understood. Both innate and adaptive immune responses are important. Innate immune responses may be mediated by Toll-like receptor pathways, antimicrobial peptides, prostaglandins, mannose-binding lectin, cytokines and chemokines. Cell-mediated responses, particularly those involving CD4+ T cells and IFN-γ play a dominant role. Mucosal antibody responses may also be involved. Proteins mediating attachment and invasion may serve as putative protective antigens. Further knowledge of human immune responses in cryptosporidiosis is essential in order to develop targeted prophylactic and therapeutic interventions. This review focuses on recent advances and future prospects in the understanding of human immune responses to Cryptosporidium infection. PMID:20210556

  1. Psychological stress exacerbates primary vaginal herpes simplex virus type 1 (HSV-1) infection by impairing both innate and adaptive immune responses.

    PubMed

    Ashcraft, Kathleen A; Bonneau, Robert H

    2008-11-01

    Chronic psychological stress is generally immunosuppressive and contributes to an increase in herpes simplex virus (HSV) pathogenicity. We have previously shown that mice experiencing stress at the time of intranasal HSV infection have increased levels of infectious virus in their nasal cavity, as compared to control mice that were not subjected to stress. We have extended our studies to determine the effects of stress at another clinically-relevant mucosal site by examining the immune response to and pathogenesis of vaginal HSV infection. Mice experiencing psychological stress during vaginal HSV infection exhibited an increase in both vaginal viral titers and the pathology associated with this HSV infection. We demonstrate that these observations result from the failure of both the innate and HSV-specific adaptive immune responses. At 2 days post-infection, NK cell numbers were significantly decreased in mice experiencing restraint stress. Studies examining the adaptive immune response revealed a decrease in the number of HSV-specific CD8(+) T cells in not only the vaginal tissue itself but also the draining iliac lymph nodes (ILN). Furthermore, the number of functional cells, in terms of both their degranulation and interferon-gamma production, in the ILN of stressed mice was decreased as compared to non-stressed mice. We conclude that psychological stress, through its suppression of both innate and adaptive immune responses, may be an important factor in the ability to control vaginal HSV infection.

  2. Remune. Immune Response.

    PubMed

    Lai, Derhsing; Jones, Taff

    2002-03-01

    The Immune Response Corp (IRC) is developing Remune, a potential HIV therapeutic vaccine. Remune is based on the Salk Immunogen, which is derived from an HIV isolate which has been inactivated by chemical depletion of glycoprotein 120 (gp120). Preliminary data suggested that Remune, in combination with antiviral drug therapy, results in undetectable levels of HIV. Phase III trials commenced in May 1997 and it was initially expected that registration filings would be made in 1999. However, following interim analysis of the 2500-patient, multicenter, double-blind, pivotal phase III study (study 806) in May 1999, an independent panel recommended concluding the clinical endpoint trial and IRC and licensee, Agouron, decided to pursue alternative regulatory strategies, including initiating two additional phase III surrogate marker trials. Despite this, Agouron gave IRC notice of termination of its continued development in July 2001. In August 2001, IRC informed Agouron that, due to the total number of endpoints to date falling short of that previously assumed by Agouron, it did not intend to continue Agouron's Study 202 of Remune. In July 2001, licensee Trinity Medical Group filed an NDA with the governing health authorities in Thailand for Remune. The Thai FDA certified Immune Response's Remune manufacturing facility as being in compliance with GMP standards, following an on site inspection by Thai officials in November 2001 that was performed as a requirement of Trinity's Thai NDA. As a result of this certification, Trinity expected that a "timely determination" could be made by the Thai FDA. Rhĵne-Poulenc Rorer discontinued its part in the development of Remune, with all manufacturing, marketing and distribution rights reverting to IRC. After Agouron returned rights to Remune in July 2001, IRC heldfull rights in the US, Europe and Japan, while collaborating with its partners Trinity Medical Group and Roemmers Laboratory in the Southeast Asian and Latin American

  3. Ubiquitin signaling in immune responses

    PubMed Central

    Hu, Hongbo; Sun, Shao-Cong

    2016-01-01

    Ubiquitination has emerged as a crucial mechanism that regulates signal transduction in diverse biological processes, including different aspects of immune functions. Ubiquitination regulates pattern-recognition receptor signaling that mediates both innate immune responses and dendritic cell maturation required for initiation of adaptive immune responses. Ubiquitination also regulates the development, activation, and differentiation of T cells, thereby maintaining efficient adaptive immune responses to pathogens and immunological tolerance to self-tissues. Like phosphorylation, ubiquitination is a reversible reaction tightly controlled by the opposing actions of ubiquitin ligases and deubiquitinases. Deregulated ubiquitination events are associated with immunological disorders, including autoimmune and inflammatory diseases. PMID:27012466

  4. Peroral Ciprofloxacin Therapy Impairs the Generation of a Protective Immune Response in a Mouse Model for Salmonella enterica Serovar Typhimurium Diarrhea, while Parenteral Ceftriaxone Therapy Does Not

    PubMed Central

    Endt, Kathrin; Maier, Lisa; Käppeli, Rina; Barthel, Manja; Misselwitz, Benjamin; Kremer, Marcus

    2012-01-01

    Nontyphoidal Salmonella (NTS) species cause self-limiting diarrhea and sometimes severe disease. Antibiotic treatment is considered only in severe cases and immune-compromised patients. The beneficial effects of antibiotic therapy and the consequences for adaptive immune responses are not well understood. We used a mouse model for Salmonella diarrhea to assess the effects of per os treatment with ciprofloxacin (15 mg/kg of body weight intragastrically 2 times/day, 5 days) or parenteral ceftriaxone (50 mg/kg intraperitoneally, 5 days), two common drugs used in human patients. The therapeutic and adverse effects were assessed with respect to generation of a protective adaptive immune response, fecal pathogen excretion, and the emergence of nonsymptomatic excreters. In the mouse model, both therapies reduced disease severity and reduced the level of fecal shedding. In line with clinical data, in most animals, a rebound of pathogen gut colonization/fecal shedding was observed 2 to 12 days after the end of the treatment. Yet, levels of pathogen shedding and frequency of appearance of nonsymptomatic excreters did not differ from those for untreated controls. Moreover, mice treated intraperitoneally with ceftriaxone developed an adaptive immunity protecting the mice from enteropathy in wild-type Salmonella enterica serovar Typhimurium challenge infections. In contrast, the mice treated intragastrically with ciprofloxacin were not protected. Thus, antibiotic treatment regimens can disrupt the adaptive immune response, but treatment regimens may be optimized in order to preserve the generation of protective immunity. It might be of interest to determine whether this also pertains to human patients. In this case, the mouse model might be a tool for further mechanistic studies. PMID:22354292

  5. Peroral ciprofloxacin therapy impairs the generation of a protective immune response in a mouse model for Salmonella enterica serovar Typhimurium diarrhea, while parenteral ceftriaxone therapy does not.

    PubMed

    Endt, Kathrin; Maier, Lisa; Käppeli, Rina; Barthel, Manja; Misselwitz, Benjamin; Kremer, Marcus; Hardt, Wolf-Dietrich

    2012-05-01

    Nontyphoidal Salmonella (NTS) species cause self-limiting diarrhea and sometimes severe disease. Antibiotic treatment is considered only in severe cases and immune-compromised patients. The beneficial effects of antibiotic therapy and the consequences for adaptive immune responses are not well understood. We used a mouse model for Salmonella diarrhea to assess the effects of per os treatment with ciprofloxacin (15 mg/kg of body weight intragastrically 2 times/day, 5 days) or parenteral ceftriaxone (50 mg/kg intraperitoneally, 5 days), two common drugs used in human patients. The therapeutic and adverse effects were assessed with respect to generation of a protective adaptive immune response, fecal pathogen excretion, and the emergence of nonsymptomatic excreters. In the mouse model, both therapies reduced disease severity and reduced the level of fecal shedding. In line with clinical data, in most animals, a rebound of pathogen gut colonization/fecal shedding was observed 2 to 12 days after the end of the treatment. Yet, levels of pathogen shedding and frequency of appearance of nonsymptomatic excreters did not differ from those for untreated controls. Moreover, mice treated intraperitoneally with ceftriaxone developed an adaptive immunity protecting the mice from enteropathy in wild-type Salmonella enterica serovar Typhimurium challenge infections. In contrast, the mice treated intragastrically with ciprofloxacin were not protected. Thus, antibiotic treatment regimens can disrupt the adaptive immune response, but treatment regimens may be optimized in order to preserve the generation of protective immunity. It might be of interest to determine whether this also pertains to human patients. In this case, the mouse model might be a tool for further mechanistic studies.

  6. Immune Responses in Parasitic Diseases

    DTIC Science & Technology

    1982-09-01

    RESPONSES IN PARASITIC DISEASES Final Scientific Report Daniel J. Stechschulte, M.D. Herbert B. Lindsley, M.D. September 1982 (July 1974 - December 1979...REPORT & PERIOD COVERED IMMUNE RESPONSES IN PARASITIC DISEASES Final Report July 1977 - Dec. 1979 6. PERFORMING ORG. REPORT NUMBER S 4 7. AUTNIOR(a) 6...DAMD 17-74-C-4136 AD_______________ IMMUNE RESPONSES IN PARASITIC DISEASES Final Scientific Report Daniel J. Stechschulte, M.D. Herbert B. Lindsley

  7. Impairment of the cellular immune response in acute murine toxoplasmosis: regulation of interleukin 2 production and macrophage-mediated inhibitory effects.

    PubMed Central

    Haque, S; Khan, I; Haque, A; Kasper, L

    1994-01-01

    Depression of the cellular immune response to Toxoplasma gondii has been reported in both mice and humans. The present study was undertaken to determine the kinetics and mechanism of the observed downregulation of interleukin 2 (IL-2) production during experimental murine toxoplasmosis. For these investigations, the cell-mediated immune response to the wild type (PTg) was compared with that to the less-virulent mutant parasite (PTgB), which is deficient in the major surface antigen, p30 (SAG-1). Spleen cells from infected A/J mice failed to proliferate in response to Toxoplasma antigens during the first week of infection. Both PTg- and PTgB-infected A/J mice exhibited a significant reduction in the concanavalin A (Con A)-induced lymphoproliferative response. Further, the response of splenocytes from mice infected with the wild-type parasite was significantly diminished compared with that of mice infected with PTgB. The lymphoproliferative response to Con A reached its nadir at day 7 and remained below control levels for at least 14 days postinfection. By day 21 postinfection, the response to Con A and to Toxoplasma antigens was restored to the level observed prior to day 7. Con A-stimulated culture supernatants of spleen cells from mice on day 7 postinfection contained significantly less IL-2 than normal mice. There was no significant difference in the numbers of binding sites or capacity of high-affinity IL-2 receptors between infected and normal mouse splenocytes as determined by Scatchard analysis. Exogenous IL-2 at different concentrations failed to restore the proliferative response of lymphocytes from infected mice to Con A. Adherent macrophages from 7-day-infected mice were able to suppress IL-2 production by normal splenocytes following stimulation with Con A. The inhibitory activity mediated by infected cells was reversed by the antibody to IL-10 but not transforming growth factor beta. There were insignificant levels of nitric oxide production in both

  8. Impaired primary antibody response in experimental nephrotic syndrome.

    PubMed Central

    Garin, E H; Sausville, P J; Richard, G A

    1983-01-01

    The primary antibody response to sheep red blood cells (SRBC) is reduced in rats with aminonucleoside of puromycin (AP) nephrosis, as measured by haemagglutination and IgM antibody forming spleen cells (AFC). Since rats immunized 1 day after AP administration had a normal antibody response, these studies suggest that the impaired immune response in nephrotic rats is not due to a direct effect of AP but that it is secondary to the nephrotic state. PMID:6347472

  9. Impaired T-bet-pSTAT1α and perforin-mediated immune responses in the tumoral region of lung adenocarcinoma

    PubMed Central

    Andreev, Katerina; Denis Iulian Trufa, I; Siegemund, Raphaela; Rieker, Ralf; Hartmann, Arndt; Schmidt, Joachim; Sirbu, Horia; Finotto, Susetta

    2015-01-01

    Background: In spite of modern therapies for non-small-cell lung cancer (NSCLC), prognosis for many patients is still poor and survival rates are low. Immunotherapy is the possibility to improve the lung immune response surrounding the tumour. However, this approach requires detailed understanding of the local immune-responses of NSCLC patients. Methods: We analysed samples from three different regions within the lungs of NSCLC patients, whereas we distinguished between patients suffering from adenocarcinoma and squamous cell carcinoma. Expression of type 1 T helper (Th1)/type 1 cytotoxic (Tc1) factors was assessed by quantitative real-time PCR, western blot analyses or immunohistochemistry. Cytotoxic cell activity of CD8+ T cells was determined via co-culture with autologous tumour cells and apoptosis assay. Results: We found decreased levels of the transcription factor T-box expressed in T cells (T-bet or Tbx21) and of the downstream activated IFN-γ-dependent pSTAT1α isoform in the lung tumour areas of patients with NSCLC as compared with tumour-free control regions. In these patients, reduced T-bet and pSTAT1α levels were found associated with increased immunosuppressive markers like cytotoxic T lymphocyte-associated protein 4, programmed cell death 1 and with a suppression of the Th1 cell cytokine production and Tc1 cell activity. Conclusions: These findings confirm a central role of T-bet in targeted immunotherapy for patients with NSCLC. PMID:26348446

  10. Immune Responses to HCV and Other Hepatitis Viruses

    PubMed Central

    Park, Su-Hyung; Rehermann, Barbara

    2014-01-01

    Summary Five human hepatitis viruses cause most acute and chronic liver disease worldwide. Over the past 25 years hepatitis C virus (HCV) in particular has received much interest because of its ability to persist in most immunocompetent adults and the lack of a protective vaccine. Here we examine innate and adaptive immune responses to HCV infection. Although HCV activates an innate immune response, it employs an elaborate set of mechanisms to evade interferon (IFN)-based antiviral immunity. By comparing innate and adaptive immune responses to HCV with those to hepatitis A and B viruses, we suggest that prolonged innate immune activation impairs the development of successful adaptive immune responses. Comparative immunology furthermore provides insights into the maintenance of immune protection. We conclude by discussing prospects for an HCV vaccine and future research needs for the hepatitis viruses. PMID:24439265

  11. Impaired toll like receptor-7 and 9 induced immune activation in chronic spinal cord injured patients contributes to immune dysfunction

    PubMed Central

    Gungor, Bilgi; Kahraman, Tamer; Gursel, Mayda; Yilmaz, Bilge

    2017-01-01

    Reduced immune activation or immunosuppression is seen in patients withneurological diseases. Urinary and respiratory infections mainly manifested as septicemia and pneumonia are the most frequent complications following spinal cord injuries and they account for the majority of deaths. The underlying reason of these losses is believed to arise due to impaired immune responses to pathogens. Here, we hypothesized that susceptibility to infections of chronic spinal cord injured (SCI) patients might be due to impairment in recognition of pathogen associated molecular patterns and subsequently declining innate and adaptive immune responses that lead to immune dysfunction. We tested our hypothesis on healthy and chronic SCI patients with a level of injury above T-6. Donor PBMCs were isolated and stimulated with different toll like receptor ligands and T-cell inducers aiming to investigate whether chronic SCI patients display differential immune activation to multiple innate and adaptive immune cell stimulants. We demonstrate that SCI patients' B-cell and plasmacytoid dendritic cells retain their functionality in response to TLR7 and TLR9 ligand stimulation as they secreted similar levels of IL6 and IFNα. The immune dysfunction is not probably due to impaired T-cell function, since neither CD4+ T-cell dependent IFNγ producing cell number nor IL10 producing regulatory T-cells resulted different outcomes in response to PMA-Ionomycin and PHA-LPS stimulation, respectively. We showed that TLR7 dependent IFNγ and IP10 levels and TLR9 mediated APC function reduced substantially in SCI patients compared to healthy subjects. More importantly, IP10 producing monocytes were significantly fewer compared to healthy subjects in response to TLR7 and TLR9 stimulation of SCI PBMCs. When taken together this work implicated that these defects could contribute to persistent complications due to increased susceptibility to infections of chronic SCI patients. PMID:28170444

  12. Significant Impairment in Immune Recovery Following Cancer Treatment

    PubMed Central

    Kang, Duck-Hee; Weaver, Michael T.; Park, Na-Jin; Smith, Barbara; McArdle, Traci; Carpenter, John

    2009-01-01

    Background Although immunosuppression from cancer adjuvant therapy has been documented, how these suppressed immune responses recover to baseline values after completion of cancer adjuvant therapy has not been studied systematically. Objectives To examine the probability of immune recovery following cancer adjuvant therapy and the potential impact of cancer adjuvant therapy type and cancer stage on immune recovery in newly diagnosed breast cancer patients. Method In a repeated-measures design, immune responses were measured 4 times in 80 early stage breast cancer patients: prior to, and at 2, 6, and 12 months from the beginning of cancer adjuvant therapy. Natural killer cell activity (NKCA), lymphokine-activated killer cell activity, lymphocyte proliferation, CD subsets (CD4, CD8, and CD56), and cytokines (IFN-γ, IL-2, IL-4, IL-6, and IL-1α) were selected for their relevance to breast cancer. Immune recovery was defined by the level of immune response reaching to and above baseline levels. Data were analyzed using a multivariate generalized linear mixed model approach. Results Delayed immune recovery to pretreatment baseline levels continued to the 12-month time point in all parameters. The percentages of immune recovery ranged from 6% to 76% of the patients, varying among immune parameters. Overall, immune recovery was poorer for IFN-γ, IL-2, IL-4, lymphocyte proliferation and NKCA than for CD subsets and IL-6. The type of cancer adjuvant therapy, not cancer stage, showed selective influence on immune recovery. Chemotherapy or chemo- and radiotherapy combination significantly delayed IL-2 recovery, whereas radiotherapy significantly delayed IL-4 recovery. Discussion Immune recovery following breast cancer adjuvant therapy is delayed significantly for an extended time period in numerous immune parameters. The type of cancer adjuvant therapy has selective influence on immune recovery. Future investigations are warranted to elucidate the time course of immune

  13. Stability and Hopf Bifurcation in a Delayed HIV Infection Model with General Incidence Rate and Immune Impairment

    PubMed Central

    Li, Fuxiang; Jiang, Zhichao

    2015-01-01

    We investigate the dynamical behavior of a delayed HIV infection model with general incidence rate and immune impairment. We derive two threshold parameters, the basic reproduction number R 0 and the immune response reproduction number R 1. By using Lyapunov functional and LaSalle invariance principle, we prove the global stability of the infection-free equilibrium and the infected equilibrium without immunity. Furthermore, the existence of Hopf bifurcations at the infected equilibrium with CTL response is also studied. By theoretical analysis and numerical simulations, the effect of the immune impairment rate on the stability of the infected equilibrium with CTL response has been studied. PMID:26413141

  14. Stability and Hopf Bifurcation in a Delayed HIV Infection Model with General Incidence Rate and Immune Impairment.

    PubMed

    Li, Fuxiang; Ma, Wanbiao; Jiang, Zhichao; Li, Dan

    2015-01-01

    We investigate the dynamical behavior of a delayed HIV infection model with general incidence rate and immune impairment. We derive two threshold parameters, the basic reproduction number R 0 and the immune response reproduction number R 1. By using Lyapunov functional and LaSalle invariance principle, we prove the global stability of the infection-free equilibrium and the infected equilibrium without immunity. Furthermore, the existence of Hopf bifurcations at the infected equilibrium with CTL response is also studied. By theoretical analysis and numerical simulations, the effect of the immune impairment rate on the stability of the infected equilibrium with CTL response has been studied.

  15. Immune Response to Giardia duodenalis

    PubMed Central

    Faubert, Gaétan

    2000-01-01

    The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490

  16. The reciprocal link between sleep and immune responses.

    PubMed

    Del Gallo, F; Opp, M R; Imeri, L

    2014-01-01

    Good sleep is necessary for both physical and mental health; sleep and immune responses are reciprocally and closely linked. Sleep loss impairs the immune response, while, on the other hand, the immune response, activated for instance by an infection, alters sleep. Sleep alterations induced by immune activation are mediated by cytokines such as interleukin-1. In the past, it was thought that cytokines were produced only by the immune system, and active only there as signaling molecules. Today it is clear that IL-1 and other cytokines are present and active in the healthy brain, where they physiologically interact with the brain circuits and the neurotransmitter systems (for instance the serotonergic, GABAergic, and cholinergic systems) that control sleep. These interactions are altered by immune response, and, as a result, non-rapid eye movement (NREM) sleep is increased and fragmented, whereas rapid eye movements (REM) sleep is inhibited.

  17. Immune responses to improving welfare

    PubMed Central

    Berghman, L. R.

    2016-01-01

    The relationship between animal welfare and the immune status of an animal has a complex nature. Indeed, the intuitive notion that “increased vigilance of the immune system is by definition better” because it is expected to better keep the animal healthy, does not hold up under scrutiny. This is mostly due to the fact that the immune system consists of 2 distinct branches, the innate and the adaptive immune system. While they are intimately intertwined and synergistic in the living organism, they are profoundly different in their costs, both in terms of performance and wellbeing. In contrast to the adaptive immune system, the action of the innate immune system has a high metabolic cost as well as undesirable behavioral consequences. When a pathogen breaches the first line of defense (often a mucosal barrier), that organism's molecular signature is recognized by resident macrophages. The macrophages respond by releasing a cocktail of pro-inflammatory cytokines (including interleukin-1 and -6) that signal the brain via multiple pathways (humoral as well as neural) of the ongoing peripheral innate immune response. The behavioral response to the release of proinflammatory cytokines, known as “sickness behavior,” includes nearly all the behavioral aspects that are symptomatic for clinical depression in humans. Hence, undesired innate immune activity, such as chronic inflammation, needs to be avoided by the industry. From an immunological standpoint, one of the most pressing poultry industry needs is the refinement of our current veterinary vaccine arsenal. The response to a vaccine, especially to a live attenuated vaccine, is often a combination of innate and adaptive immune activities, and the desired immunogenicity comes at the price of high reactogenicity. The morbidity, albeit limited and transient, caused by live vaccines against respiratory diseases and coccidiosis are good examples. Thankfully, the advent of various post-genomics technologies, such as DNA

  18. Reduced Naive CD4 T Cell Numbers and Impaired Induction of CD27 in Response to T Cell Receptor Stimulation Reflect a State of Immune Activation in Chronic Hepatitis C Virus Infection

    PubMed Central

    Yonkers, Nicole L.; Sieg, Scott; Rodriguez, Benigno

    2011-01-01

    Background. Chronic hepatitis C virus (HCV) infection is characterized by reduced numbers of functional HCV-specific T cells. In addition, chronically HCV-infected individuals have reduced response to vaccine. Alterations in naive CD4 T cell phenotype or function may contribute to these immune impairments. Methods. Using flow cytometric analysis and enzyme-linked immunospot assay, we examined peripheral naive CD4 T cell phenotype and function in chronically HCV-infected patients and control subjects. Results. We observed significantly lower absolute cell numbers of naive CD4 T cells in HCV-infected patients, localized to the CD127+CD25low/- and CD31+ (RTE) subsets. Moreover, we found greater percentages of naive cells expressing CD25 and KI67 in HCV-infected patients, consistent with immune activation, further supported by higher plasma sCD27 levels. Functional analysis revealed an intact interferon-γ response to allogeneic B cell stimulus. However, after direct TCR stimulation, naive CD4 T cells from HCV-infected patients had altered up-regulation of KI67 and CD25 and less CD27 expression. The latter was associated with elevated baseline activation state. In addition, naive CD4 T cells from HCV-infected patients were more susceptible to cell death. Conclusions. These numerical and functional defects may contribute to inadequate formation of virus and neoantigen-specific T cell responses during chronic HCV infection. PMID:21220773

  19. Cutting edge: impairment of dendritic cells and adaptive immunity by Ebola and Lassa viruses.

    PubMed

    Mahanty, Siddhartha; Hutchinson, Karen; Agarwal, Sudhanshu; McRae, Michael; Rollin, Pierre E; Pulendran, Bali

    2003-03-15

    Acute infection of humans with Ebola and Lassa viruses, two principal etiologic agents of hemorrhagic fevers, often results in a paradoxical pattern of immune responses: early infection, characterized by an outpouring of inflammatory mediators such as TNF-alpha, IL-1 beta, and IL-6, vs late stage infections, which are associated with poor immune responses. The mechanisms underlying these diverse outcomes are poorly understood. In particular, the role played by cells of the innate immune system, such as dendritic cells (DC), is not known. In this study, we show that Ebola and Lassa viruses infect human monocyte-derived DC and impair their function. Monocyte-derived DC exposed to either virus fail to secrete proinflammatory cytokines, do not up-regulate costimulatory molecules, and are poor stimulators of T cells. These data represent the first evidence for a mechanism by which Ebola and Lassa viruses target DC to impair adaptive immunity.

  20. Sex differences in immune responses.

    PubMed

    Klein, Sabra L; Flanagan, Katie L

    2016-10-01

    Males and females differ in their immunological responses to foreign and self-antigens and show distinctions in innate and adaptive immune responses. Certain immunological sex differences are present throughout life, whereas others are only apparent after puberty and before reproductive senescence, suggesting that both genes and hormones are involved. Furthermore, early environmental exposures influence the microbiome and have sex-dependent effects on immune function. Importantly, these sex-based immunological differences contribute to variations in the incidence of autoimmune diseases and malignancies, susceptibility to infectious diseases and responses to vaccines in males and females. Here, we discuss these differences and emphasize that sex is a biological variable that should be considered in immunological studies.

  1. Dysbiosis-induced IL-33 contributes to impaired antiviral immunity in the genital mucosa.

    PubMed

    Oh, Ji Eun; Kim, Byoung-Chan; Chang, Dong-Ho; Kwon, Meehyang; Lee, Sun Young; Kang, Dukjin; Kim, Jin Young; Hwang, Inhwa; Yu, Je-Wook; Nakae, Susumu; Lee, Heung Kyu

    2016-02-09

    Commensal microbiota are well known to play an important role in antiviral immunity by providing immune inductive signals; however, the consequence of dysbiosis on antiviral immunity remains unclear. We demonstrate that dysbiosis caused by oral antibiotic treatment directly impairs antiviral immunity following viral infection of the vaginal mucosa. Antibiotic-treated mice succumbed to mucosal herpes simplex virus type 2 infection more rapidly than water-fed mice, and also showed delayed viral clearance at the site of infection. However, innate immune responses, including type I IFN and proinflammatory cytokine production at infection sites, as well as induction of virus-specific CD4 and CD8 T-cell responses in draining lymph nodes, were not impaired in antibiotic-treated mice. By screening the factors controlling antiviral immunity, we found that IL-33, an alarmin released in response to tissue damage, was secreted from vaginal epithelium after the depletion of commensal microbiota. This cytokine suppresses local antiviral immunity by blocking the migration of effector T cells to the vaginal tissue, thereby inhibiting the production of IFN-γ, a critical cytokine for antiviral defense, at local infection sites. These findings provide insight into the mechanisms of homeostasis maintained by commensal bacteria, and reveal a deleterious consequence of dysbiosis in antiviral immune defense.

  2. Capture-related stressors impair immune system function in sablefish

    USGS Publications Warehouse

    Lupes, S.C.; Davis, M.W.; Olla, B.L.; Schreck, C.B.

    2006-01-01

    The sablefish Anoplopoma fimbria is a valuable North Pacific Ocean species that, when not targeted in various commercial fisheries, is often a part of discarded bycatch. Predictions of the survival of discarded fish are dependent on understanding how a fish responds to stressful conditions. Our objective was to describe the immunological health of sablefish exposed to capture stressors. In laboratory experiments designed to simulate the capture process, we subjected sablefish to various stressors that might influence survival: towing in a net, hooking, elevated seawater and air temperatures, and air exposure time. After stress was imposed, the in vitro mitogen-stimulated proliferation of sablefish leukocytes was used to evaluate the function of the immune system in an assay we validated for this species. The results demonstrated that regardless of fishing gear type, exposure to elevated seawater temperature, or time in air, the leukocytes from stressed sablefish exhibited significantly diminished proliferative responses to the T-cell mitogen, concanavalin A, or the B-cell mitogen, lipopolysaccharide. There was no difference in the immunological responses associated with seawater or air temperature. The duration and severity of the capture stressors applied in our study were harsh enough to induce significantly elevated levels of plasma cortisol and glucose, but there was no difference in the magnitude of levels among stressor treatments. These data suggest that immunological suppression occurs in sablefish subjected to capture-related stressors. The functional impairment of the immune system after capture presents a potential reason why delayed mortality is possible in discarded sablefish. Further studies are needed to determine whether delayed mortality in discarded sablefish can be caused by increased susceptibility to infectious agents resulting from stressor-mediated immunosuppression.

  3. Fetal immune response to chorioamnionitis.

    PubMed

    Kallapur, Suhas G; Presicce, Pietro; Rueda, Cesar M; Jobe, Alan H; Chougnet, Claire A

    2014-01-01

    Chorioamnionitis is a frequent cause of preterm birth and is associated with an increased risk for injury responses in the lung, gastrointestinal tract, brain, and other fetal organs. Chorioamnionitis is a polymicrobial nontraditional infectious disease because the organisms causing chorioamnionitis are generally of low virulence and colonize the amniotic fluid often for extended periods, and the host (mother and the fetus) does not have typical infection-related symptoms such as fever. In this review, we discuss the effects of chorioamnionitis in experimental animal models that mimic the human disease. Our focus is on the immune changes in multiple fetal organs and the pathogenesis of chorioamnionitis-induced injury in different fetal compartments. As chorioamnionitis disproportionately affects preterm infants, we discuss the relevant developmental context for the immune system. We also provide a clinical context for the fetal responses. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  4. Fetal immune response to chorioamnionitis

    PubMed Central

    Kallapur, Suhas G.; Presicce, Pietro; Rueda, Cesar M.; Jobe, Alan H.; Chougnet, Claire A.

    2014-01-01

    Chorioamnionitis is a frequent cause of preterm birth and is associated with an increased risk for injury responses in the lung, GI tract, brain and other fetal organs. Chorioamnionitis is a polymicrobial non-traditional infectious disease because the organisms causing chorioamnionitis are generally of low virulence and colonize the amniotic fluid often for extended periods, and the host (mother and the fetus) does not have typical infection related symptoms such as fever. In this review, we discuss the effects of chorioamnionitis in experimental animal models that mimic the human disease. Our focus is on the immune changes in multiple fetal organs and the pathogenesis of chorioamnionitis induced injury in different fetal compartments. Since chorioamnionitis disproportionately affects preterm infants, we discuss the relevant developmental context for the immune system. We also provide a clinical context for the fetal responses. PMID:24390922

  5. [Immune response to influenza vaccination].

    PubMed

    Alvarez, I; Corral, J; Arranz, A; Foruria, A; Landa, V; Lejarza, J R; Marijuán, L; Martínez, J M

    1989-01-01

    The present study investigated the level of immunity of the population against three strains of the influenza virus (A Chile/1/83 -A Philippines/2/82 and B URSS/100/83) before and three months after vaccination, and the immune response to whole virus vaccine as compared with fragmented virus vaccine. A high percentage of the population had titers greater than or equal to 1/10 before vaccination for the Chile (54%) and Philippines (65.7%) strains, while titers against the URSS strain were lower (25.4%). There was a definitive increase in antibody titer in the vaccinated population, although it was lower than expected. The overall response to both vaccines, with protecting titers greater than or equal to 1/40 after vaccination was 65.2% for the Chile strain, 74.6% for the Philippines strain, and 15% for the URSS strain. No differences in the overall immune response were found between the groups vaccinated with whole and fragmented virus.

  6. Conditioning of the immune response.

    PubMed

    Ader, R; Cohen, N

    1991-10-01

    Experimental studies in humans and experimental animals document the acquisition and extinction of classically conditioned alterations of different parameters of humoral- and cell-mediated immune responses. Although the aversive effects of cyclophosphamide in a taste aversion learning paradigm has been the most frequently used model, conditioned immunomodulatory effects are not confined to this conditioning procedure, and they are not limited to cyclophosphamide or, for that matter, the use of immunomodulating drugs as unconditioned stimuli. Conditioned changes in immunologic reactivity have also been found to modulate the progression of spontaneously-developing or experimentally-induced pathophysiological processes in experimental animals. The available data on the immunoregulatory effects of conditioning indicate that the immune system, like other systems operating in the interests of homeostasis, is integrated with other physiological processes and is therefore influenced by and capable of influencing the brain.

  7. Candesartan Ameliorates Impaired Fear Extinction Induced by Innate Immune Activation

    PubMed Central

    Quiñones, María M.; Maldonado, Lizette; Velazquez, Bethzaly; Porter, James T.

    2015-01-01

    Patients with post-traumatic stress disorder (PTSD) tend to show signs of a relatively increased inflammatory state suggesting that activation of the immune system may contribute to the development of PTSD. In the present study, we tested whether activation of the innate immune system can disrupt acquisition or recall of auditory fear extinction using an animal model of PTSD. Male adolescent rats received auditory fear conditioning in context A. The next day, an intraperitoneal injection of lipopolysaccharide (LPS; 100 μg/kg) prior to auditory fear extinction in context B impaired acquisition and recall of extinction. LPS (100 μg/kg) given after extinction training did not impair extinction recall suggesting that LPS did not affect consolidation of extinction. In contrast to cued fear extinction, contextual fear extinction was not affected by prior injection of LPS (100 μg/kg). Although LPS also reduced locomotion, we could dissociate the effects of LPS on extinction and locomotion by using a lower dose of LPS (50 μg/kg) which impaired locomotion without affecting extinction. In addition, 15 hrs after an injection of 250 μg/kg LPS in adult rats, extinction learning and recall were impaired without affecting locomotion. A sub-chronic treatment with candesartan, an angiotensin II type 1 receptor blocker, prevented the LPS-induced impairment of extinction in adult rats. Our results demonstrate that activation of the innate immune system can disrupt auditory fear extinction in adolescent and adult animals. These findings also provide direction for clinical studies of novel treatments that modulate the innate immune system for stress-related disorders like PTSD. PMID:26520214

  8. Candesartan ameliorates impaired fear extinction induced by innate immune activation.

    PubMed

    Quiñones, María M; Maldonado, Lizette; Velazquez, Bethzaly; Porter, James T

    2016-02-01

    Patients with post-traumatic stress disorder (PTSD) tend to show signs of a relatively increased inflammatory state suggesting that activation of the immune system may contribute to the development of PTSD. In the present study, we tested whether activation of the innate immune system can disrupt acquisition or recall of auditory fear extinction using an animal model of PTSD. Male adolescent rats received auditory fear conditioning in context A. The next day, an intraperitoneal injection of lipopolysaccharide (LPS; 100 μg/kg) prior to auditory fear extinction in context B impaired acquisition and recall of extinction. LPS (100 μg/kg) given after extinction training did not impair extinction recall suggesting that LPS did not affect consolidation of extinction. In contrast to cued fear extinction, contextual fear extinction was not affected by prior injection of LPS (100 μg/kg). Although LPS also reduced locomotion, we could dissociate the effects of LPS on extinction and locomotion by using a lower dose of LPS (50 μg/kg) which impaired locomotion without affecting extinction. In addition, 15 h after an injection of 250 μg/kg LPS in adult rats, extinction learning and recall were impaired without affecting locomotion. A sub-chronic treatment with candesartan, an angiotensin II type 1 receptor blocker, prevented the LPS-induced impairment of extinction in adult rats. Our results demonstrate that activation of the innate immune system can disrupt auditory fear extinction in adolescent and adult animals. These findings also provide direction for clinical studies of novel treatments that modulate the innate immune system for stress-related disorders like PTSD.

  9. Immune responses to resistance exercise.

    PubMed

    Freidenreich, Daniel J; Volek, Jeff S

    2012-01-01

    Resistance exercise induces changes in leukocyte redistribution, phenotypical surface expression and leukocyte functionality. Several factors have been shown to alter the temporal pattern and/or magnitude of response including manipulation of acute program variables, the aging process, and nutritional supplementation. Rest period length and load can modify the temporal pattern and/or magnitude of leukocytosis post exercise. Aging diminishes both the duration and magnitude of the post exercise leukocytosis and reduces leukocyte functionality. The few studies that assessed the effects of nutritional supplements (e.g., carbohydrate, whey protein, caffeine) peri-resistance exercise showed minimal effects on leukocyte responses. Sex differences exist in the timing and magnitude of leukocyte infiltration into skeletal muscle. The immune response to resistance exercise is only a small part of the recovery paradigm. A better understanding of how acute program variables and other factors such as aging, sex and nutritional supplementation affect the immune response to resistance exercise is important in the context of improving recovery, performance and health.

  10. Decreasing the frequency of energy supplementation from daily to three times weekly impairs growth and humoral immune response of preconditioning beef steers.

    PubMed

    Artioli, L F A; Moriel, P; Poore, M H; Marques, R S; Cooke, R F

    2015-11-01

    We evaluated the effects of frequency of energy supplementation on growth and measurements of innate and humoral immune responses of preconditioning beef steers following vaccination. Angus steers ( = 24; 221 ± 6.3 kg; 177 ± 4 d of age) were weaned on d -7 and kept in a single drylot pen with free access to tall fescue hay and concentrate DMI at 0.5% of BW (50:50 mix of soyhulls and corn gluten pellets; DM basis) from d -7 to 0. On d 0, steers were stratified by BW and age and randomly assigned to 1 of 8 feedlot pens (3 steers/pen). Treatments were randomly assigned to pens (4 pens/treatment) and consisted of steers provided daily free access to ground tall fescue hay and similar weekly concentrate DMI (1% of BW times 7 d), which was divided and offered either daily (S7) or 3 times weekly (S3; Monday, Wednesday, and Friday) from d 0 to 42. Individual BW was measured before feeding on d 0 and 42, after 12 h of feed and water withdrawal. Steers were vaccinated against infectious bovine rhinotracheitis, bovine viral diarrhea virus (BVDV), and clostridium on d 7 and 21. Blood samples were collected from the jugular vein on d -7 and 4 h after concentrate supplementation on d 0, 7, 8, 9, 10, 14, 21, 22, 23, 24, 28, 35, and 42. Steers offered concentrate daily had greater ( ≤ 0.02) BW on d 42, overall ADG, and total DMI, but similar ( = 0.14) G:F, than S3 steers. On days that S7 and S3 steers were offered concentrate, total DMI was greater and hay DMI was less for S3 vs. S7 steers ( ≤ 0.05). On days that only S7 steers were supplemented, hay DMI was greater, but total DMI was less for S3 vs. S7 steers ( ≤ 0.05). Mean CP and NEg intake were greater ( ≤ 0.03) for S7 vs. S3 steers. Plasma cortisol concentrations on d 7 and 28, and mean plasma haptoglobin concentrations, but not liver mRNA expression of haptoglobin ( = 0.75), were greater for S3 vs. S7 steers ( ≤ 0.03). Plasma IGF-1 concentrations on d 0 and urea nitrogen on d 1 and 3, relative to vaccination

  11. Eosinophils in mucosal immune responses

    PubMed Central

    Travers, J; Rothenberg, M E

    2015-01-01

    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  12. Immune responses to bioengineered organs

    PubMed Central

    Ochando, Jordi; Charron, Dominique; Baptista, Pedro M.; Uygun, Basak E.

    2017-01-01

    Purpose of review Organ donation in the United States registered 9079 deceased organ donors in 2015. This high percentage of donations allowed organ transplantation in 29 851 recipients. Despite increasing numbers of transplants performed in comparison with previous years, the numbers of patients that are in need for a transplant increase every year at a higher rate. This reveals that the discrepancy between the demand and availability of organs remains fundamental problem in organ transplantation. Recent findings Development of bioengineered organs represents a promising approach to increase the pool of organs for transplantation. The technology involves obtaining complex three-dimensional scaffolds that support cellular activity and functional remodeling though tissue recellularization protocols using progenitor cells. This innovative approach integrates cross-thematic approaches from specific areas of transplant immunology, tissue engineering and stem cell biology, to potentially manufacture an unlimited source of donor organs for transplantation. Summary Although bioengineered organs are thought to escape immune recognition, the potential immune reactivity toward each of its components has not been studied in detail. Here, we summarize the host immune response toward different progenitor cells and discuss the potential implications of using nonself biological scaffolds to develop bioengineered organs. PMID:27926545

  13. EVOLUTION OF THE IMMUNE RESPONSE

    PubMed Central

    Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.

    1964-01-01

    1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that

  14. Connecting impairment, disability, and handicap in immune mediated polyneuropathies.

    PubMed

    Merkies, I S J; Schmitz, P I M; van der Meché, F G A; Samijn, J P A; van Doorn, P A

    2003-01-01

    In the World Health Organisation (WHO) International Classification of Impairments, Disabilities, and Handicaps (ICIDH), it is suggested that various levels of outcome are associated with one another. However, the ICIDH has been criticised on the grounds that it only represents a general, non-specific relation between its entities. To examine the significance of the ICIDH in immune mediated polyneuropathies. Four impairment measures (fatigue severity scale, MRC sum score, "INCAT" sensory sum score, grip strength with the Vigorimeter), five disability scales (nine hole peg test, 10 metres walking test, an overall disability sum score (ODSS), Hughes functional grading scale, Rankin scale), and a handicap scale (Rotterdam nine items handicap scale (RIHS9)) were assessed in 113 clinically stable patients (83 with Guillain-Barré syndrome, 22 with chronic inflammatory demyelinating polyneuropathy, eight with a gammopathy related polyneuropathy). Regression analyses with backward and forward stepwise strategies were undertaken to determine the correlation between the various levels of outcome (impairment on disability, impairment on handicap, disability leading to handicap, and impairment plus disability on handicap). Impairment measures explained a substantial part of disability (R(2) = 0.64) and about half of the variance in handicap (R(2) = 0.52). Disability measures showed a stronger association with handicap (R(2) = 0.76). Combining impairment and disability scales accounted for 77% of the variance in handicap (RIHS9) scores. In contrast to some suggestions, support for the ICIDH model is found in the current study because significant associations were shown between its various levels in patients with immune mediated polyneuropathies. Further studies are required to examine other possible contributors to deficits in daily life and social functioning in these conditions.

  15. Connecting impairment, disability, and handicap in immune mediated polyneuropathies

    PubMed Central

    Merkies, I; Schmitz, P; van der Meche, F G A; Samijn, J; van Doorn, P A

    2003-01-01

    Background: In the World Health Organisation (WHO) International Classification of Impairments, Disabilities, and Handicaps (ICIDH), it is suggested that various levels of outcome are associated with one another. However, the ICIDH has been criticised on the grounds that it only represents a general, non-specific relation between its entities. Objective: To examine the significance of the ICIDH in immune mediated polyneuropathies. Methods: Four impairment measures (fatigue severity scale, MRC sum score, "INCAT" sensory sum score, grip strength with the Vigorimeter), five disability scales (nine hole peg test, 10 metres walking test, an overall disability sum score (ODSS), Hughes functional grading scale, Rankin scale), and a handicap scale (Rotterdam nine items handicap scale (RIHS9)) were assessed in 113 clinically stable patients (83 with Guillain–Barré syndrome, 22 with chronic inflammatory demyelinating polyneuropathy, eight with a gammopathy related polyneuropathy). Regression analyses with backward and forward stepwise strategies were undertaken to determine the correlation between the various levels of outcome (impairment on disability, impairment on handicap, disability leading to handicap, and impairment plus disability on handicap). Results: Impairment measures explained a substantial part of disability (R2 = 0.64) and about half of the variance in handicap (R2 = 0.52). Disability measures showed a stronger association with handicap (R2 = 0.76). Combining impairment and disability scales accounted for 77% of the variance in handicap (RIHS9) scores. Conclusions: In contrast to some suggestions, support for the ICIDH model is found in the current study because significant associations were shown between its various levels in patients with immune mediated polyneuropathies. Further studies are required to examine other possible contributors to deficits in daily life and social functioning in these conditions. PMID:12486276

  16. Early impairment of CD8+ T cells immune response against Epstein-Barr virus (EBV) antigens associated with high level of circulating mononuclear EBV DNA load in HIV infection.

    PubMed

    Legoff, Jérôme; Amiel, Corinne; Calisonni, Olivier; Fromentin, Delphine; Rajoely, Bakoliarisoa; Abuaf, Nisen; Tartour, Eric; Rozenbaum, Willy; Bélec, Laurent; Nicolas, Jean-Claude

    2004-03-01

    Immunodeficiency related to HIV may increase the incidence of EBV-associated lymphomas, by altering EBV-specific immune control and consequently favoring EBV reactivation. The aim of the present study was to assess the relationship between the decrease of EBV-specific cellular immunity and the increase of EBV reactivation in a prospective cohort of 72 unselected HIV-infected individuals. EBV-specific immunity was evaluated by a highly sensitive IFN-gamma ELISPOT assay using 22 peptides mimicking latent and lytic antigens, and circulating mononuclear (PBMC) EBV DNA load was quantified by real-time quantitative PCR. The mean circulating cell-associated EBV DNA load was higher in HIV-infected patients (639 copies/10(6) PBMC) than in healthy controls (21, n = 14) ( P = 0.005) and was higher in patients with CD4(+) T-cell count below 350/microL than that in patients harboring higher CD4(+) T-cell count (1112 vs. 389, P = 0.003). The mean intensity of EBV-specific cellular responses was lower in HIV-infected patients than in controls ( P = 0.001), even in patients with CD4(+) T-cell count above 350/-microL ( P = 0.007). The number of EBV peptides recognized was lower in HIV-infected patients than in controls (frequency: 0.44 vs. 0.67; P = 0.02), indicating reduced polyclonality in HIV-infected patients. The polyclonality was 1.5-fold lower in HIV-infected patients with CD4(+) T-cell count below 350/-microL ( P =0.007). For EBV load >1000 copies/10(6) PBMC, the levels of cell-associated EBV DNA and those of EBV-specific cellular immunity, either in intensity or in polyclonality, or both, were inversely correlated. These findings demonstrate early impairment of the EBV-specific cellular immune control with progressive increase of EBV reactivation in the course of HIV infection. These observations likely provide a basis for appreciating the risk to develop non-Hodgkin's lymphomas in HIV-infected individuals.

  17. Tilapia show immunization response against Ich

    USDA-ARS?s Scientific Manuscript database

    This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...

  18. A genetic inference on cancer immune responsiveness

    PubMed Central

    Wang, Ena; Uccellini, Lorenzo; Marincola, Francesco M.

    2012-01-01

    A cancer immune signature implicating good prognosis and responsiveness to immunotherapy was described that is observed also in other aspects of immune-mediated, tissue-specific destruction (TSD). Its determinism remains, however, elusive. Based on limited but unique clinical observations, we propose a multifactorial genetic model of human cancer immune responsiveness. PMID:22754772

  19. Social impairments in autism spectrum disorder are related to maternal immune history profile.

    PubMed

    Patel, S; Masi, A; Dale, R C; Whitehouse, A J O; Pokorski, I; Alvares, G A; Hickie, I B; Breen, E; Guastella, A J

    2017-10-10

    Maternal immune activation has been highlighted as a factor that might increase the risk and severity of autism spectrum disorder (ASD) in children. Preclinical animal evidence shows that immune activation in mothers during pregnancy causes ASD-like behavioural traits in offspring. To this point, there has been no investigation of whether immune system activation in human mothers during pregnancy is associated with more severe symptoms in children with ASD. In this study, data from an existing ASD cohort (N=220) were analysed to investigate whether immune conditions in the mother were associated with greater severity of autism-related symptoms. Results showed that children whose mothers reported a history of immune activation (allergies and asthma) had significantly higher scores on the Social Responsiveness Scale (SRS; P=0.016), suggesting more severe social impairment symptoms in these children. This increasing severity of social impairment symptoms was further shown on the SRS cognition (P=0.007) and mannerisms (P=0.002) subscales. While immune history was associated with an increase in the severity of social impairment symptoms, history of autoimmune conditions in the mother did not have any effect in this cohort. To the best of our knowledge, this study is the first to show an association between immune activation history in the mother and increased ASD symptom severity in children with ASD. These findings support the idea of an immune system-mediated subtype in ASD, where the immune history of the mother may be an important factor.Molecular Psychiatry advance online publication, 10 October 2017; doi:10.1038/mp.2017.201.

  20. Selective loss of gastrointestinal mast cells and impaired immunity in PI3K-deficient mice.

    PubMed

    Fukao, Taro; Yamada, Taketo; Tanabe, Masanobu; Terauchi, Yasuo; Ota, Takayuki; Takayama, Tetsuro; Asano, Tomoichiro; Takeuchi, Tsutomu; Kadowaki, Takashi; Hata Ji, Jun-ichi; Koyasu, Shigeo

    2002-03-01

    Mice that lack the p85alpha regulatory subunit of phosphatidylinositol-3 kinase (PI3K) are deficient in gastrointestinal and peritoneal mast cells but have dermal mast cells. Accordingly, these mice show impaired bacterial clearance in response to acute septic peritonitis and are highly susceptible to infection by the intestinal nematode Strongyloides venezuelensis. Systemic anaphylactic shock responses, however, are intact. We found that although reconstitution of PI3Kminus sign/minus sign mice with bone marrow--derived mast cells (BMMCs) restored anti-bacterial immunity, only T helper type 2 (TH2)-conditioned BMMCs, not "standard" BMMCs, were able to restore anti-nematode immunity. This finding highlights the importance of the TH2 response in the control of nematode infection. Thus, PI3K likely plays an essential role in host immune responses by regulating both the development and induction of mast cells.

  1. A mutation of Ikbkg causes immune deficiency without impairing degradation of IκBα

    PubMed Central

    Siggs, Owen M.; Berger, Michael; Krebs, Philippe; Arnold, Carrie N.; Eidenschenk, Celine; Huber, Christoph; Pirie, Elaine; Smart, Nora G.; Khovananth, Kevin; Xia, Yu; McInerney, Gerald; Karlsson Hedestam, Gunilla B.; Nemazee, David; Beutler, Bruce

    2010-01-01

    Null alleles of the gene encoding NEMO (NF-κB essential modulator) are lethal in hemizygous mice and men, whereas hypomorphic alleles typically cause a syndrome of immune deficiency and ectodermal dysplasia. Here we describe an allele of Ikbkg in mice that impaired Toll-like receptor signaling, lymph node formation, development of memory and regulatory T cells, and Ig production, but did not cause ectodermal dysplasia. Degradation of IκBα, which is considered a primary requirement for NEMO-mediated immune signaling, occurred normally in response to Toll-like receptor stimulation, yet ERK phosphorylation and NF-κB p65 nuclear translocation were severely impaired. This selective loss of function highlights the immunological importance of NEMO-regulated pathways beyond IκBα degradation, and offers a biochemical explanation for rare immune deficiencies in man. PMID:20133626

  2. Immune responses and vaccination against periodontal infections.

    PubMed

    Persson, G Rutger

    2005-01-01

    The infectious aetiology of periodontitis is complex and no curative treatment modality exists. Palliative therapy is available. To review the evidence that active or passive immunization against periodontitis provides immune protection. PubMed (Medline), the National Institutes of Health, the Food and Drug Administration, and the Center for Disease Control electronic databases were searched to extrapolate information on immune responses to immunization against periodontitis. Studies in non-human primate models using ligature-induced experimental periodontitis suggest that antibody responses by active immunization against Porphyromonas gingivalis can safely be induced, enhanced, and obtained over time. Immune responses to whole bacterial cell and purified protein preparations considered as vaccine candidates have been evaluated in different animal models demonstrating that there are several valid vaccine candidates. Data suggest that immunization reduces the rate and severity of bone loss. It is also, temporarily, possible to alter the composition of the subgingival microflora. Natural active immunization by therapeutic interventions results in antibody titre enhancement and potentially improves treatment outcomes. Passive immunization of humans using P. gingivalis monoclonal antibodies temporarily prevents colonization of P. gingivalis. Probiotic therapy may be an alternative approach. Regulatory and safety issues for human periodontal vaccine trials must be considered. Shared infectious aetiology between periodontitis and systemic diseases may enhance vaccine effort developments. Proof of principle that active and passive immunization can induce protective antibody responses is given. The impact of natural immunization and passive immunization in humans should be explored and may, presently, be more feasible than active immunization studies.

  3. Innate immune responses of Drosophila melanogaster are altered by spaceflight.

    PubMed

    Marcu, Oana; Lera, Matthew P; Sanchez, Max E; Levic, Edina; Higgins, Laura A; Shmygelska, Alena; Fahlen, Thomas F; Nichol, Helen; Bhattacharya, Sharmila

    2011-01-11

    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways.

  4. Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight

    PubMed Central

    Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila

    2011-01-01

    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

  5. Impaired cell mediated immunity in haemophilia in the absence of infection with human immunodeficiency virus.

    PubMed Central

    Madhok, R; Gracie, A; Lowe, G D; Burnett, A; Froebel, K; Follett, E; Forbes, C D

    1986-01-01

    The cell mediated immune response was evaluated in vivo in 29 patients with clinically severe haemophilia by means of the dinitrochlorobenzene skin test. All patients had a response below the median normal value, and in 19 the response was on or below the lower limit of the normal range. There was no difference in skin response between patients positive and negative for the human immunodeficiency virus (HIV; formerly known as human T cell lymphotropic virus III or lymphadenopathy associated virus). In the whole group, and in seronegative patients (n = 17), there was an inverse relation between exposure to clotting factor and skin response. In seropositive patients (n = 12) no such association was apparent. This study shows that clotting factor concentrate impairs the cell mediated immune response to a new antigen in the absence of infection with HIV. PMID:3094762

  6. Does allergy impair innate immunity? Leads and lessons from atopic dermatitis.

    PubMed

    Mrabet-Dahbi, S; Maurer, M

    2010-11-01

    Host defence responses against invading pathogens are well-balanced, inflammatory processes of the innate and adaptive immune system. Impaired development or abnormal function of either system can result in failure to control pathogens and to clear infections. Infections have been claimed to modulate the onset and course of allergic diseases. This so-called hygiene hypothesis is still an active area of research. In contrast, the effects of allergies on infections and pathogen-directed immune responses are less well understood. Here, we have reviewed the existing evidence that allergies result in impaired innate immunity and we discuss recent observations that may explain why and how innate immunity is dysfunctional in allergic patients. With a focus on atopic dermatitis as a model of allergic disease, we speculate that one of the key features of allergic conditions, namely Th2 polarization, leads to several independent inhibitory effects on host defence and consequently to a higher risk of infections in allergic patients. A better understanding of impaired host defence and its mechanisms in allergic subjects will help to improve the management of these diseases.

  7. Spaceflight and immune responses of Rhesus monkeys

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1994-01-01

    Evidence from both human and rodent studies indicates that alterations in immunological parameters occur after space flight. The objective of this project is to determine the effects of space flight on immune responses of Rhesus monkeys. The expected significance of the work is a determination of the range of immunological functions of the Rhesus monkey, a primate similar in many ways to man, affected by space flight. Changes in immune responses that could yield alterations in resistance to infection may be determined as well as the duration of alterations in immune responses. Additional information on the nature of cellular interactions for the generation of immune responses may also be obtained.

  8. Impairment of immunity to Candida and Mycobacterium in humans with bi-allelic RORC mutations*

    PubMed Central

    Halwani, Rabih; Ma, Cindy S.; Wong, Natalie; Soudais, Claire; Henderson, Lauren A.; Marzouqa, Hiyam; Shamma, Jamal; Gonzalez, Marcela; Martinez-Barricarte, Rubén; Okada, Chizuru; Avery, Danielle T.; Latorre, Daniela; Deswarte, Caroline; Jabot-Hanin, Fabienne; Torrado, Egidio; Fountain, Jeffrey; Belkadi, Aziz; Itan, Yuval; Boisson, Bertrand; Migaud, Mélanie; Arlehamn, Cecilia S. Lindestam; Sette, Alessandro; Breton, Sylvain; McCluskey, James; Rossjohn, Jamie; de Villartay, Jean-Pierre; Moshous, Despina; Hambleton, Sophie; Latour, Sylvain; Arkwright, Peter D.; Picard, Capucine; Lantz, Olivier; Engelhard, Dan; Kobayashi, Masao; Abel, Laurent; Casanova, Jean-Laurent

    2015-01-01

    Human inborn errors of immunity mediated by the cytokines interleukin (IL)-17A/F underlie mucocutaneous candidiasis, whereas inborn errors of interferon (IFN)-γ immunity underlie mycobacterial disease. We report the discovery of bi-allelic RORC loss-of-function mutations in seven individuals from three kindreds of different ethnic origins with both candidiasis and mycobacteriosis. The lack of functional RORγ and RORγT isoforms resulted in the absence of IL-17A/F-producing T cells in these individuals, probably accounting for their chronic candidiasis. Unexpectedly, leukocytes from RORγ- and RORγT-deficient individuals also displayed an impaired IFN-γ response to Mycobacterium. This principally reflected profoundly defective IFN-γ production by circulating γδ T cells and CD4+CCR6+ CXCR3+ αβ T cells. In humans, both mucocutaneous immunity to Candida and systemic immunity to Mycobacterium require RORγ, or RORγT, or both. PMID:26160376

  9. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    PubMed

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  10. Noninvasive imaging of immune responses

    PubMed Central

    Rashidian, Mohammad; Keliher, Edmund J.; Bilate, Angelina M.; Duarte, Joao N.; Wojtkiewicz, Gregory R.; Jacobsen, Johanne Tracey; Cragnolini, Juanjo; Swee, Lee Kim; Victora, Gabriel D.; Weissleder, Ralph; Ploegh, Hidde L.

    2015-01-01

    At their margins, tumors often contain neutrophils, dendritic cells, and activated macrophages, which express class II MHC and CD11b products. The interplay between stromal cells, tumor cells, and migratory cells such as lymphocytes creates opportunities for noninvasive imaging of immune responses. We developed alpaca-derived antibody fragments specific for mouse class II MHC and CD11b products, expressed on the surface of a variety of myeloid cells. We validated these reagents by flow cytometry and two-photon microscopy to obtain images at cellular resolution. To enable noninvasive imaging of the targeted cell populations, we developed a method to site-specifically label VHHs [the variable domain (VH) of a camelid heavy-chain only antibody] with 18F or 64Cu. Radiolabeled VHHs rapidly cleared the circulation (t1/2 ≈ 20 min) and clearly visualized lymphoid organs. We used VHHs to explore the possibility of imaging inflammation in both xenogeneic and syngeneic tumor models, which resulted in detection of tumors with remarkable specificity. We also imaged the infiltration of myeloid cells upon injection of complete Freund’s adjuvant. Both anti-class II MHC and anti-CD11b VHHs detected inflammation with excellent specificity. Given the ease of manufacture and labeling of VHHs, we believe that this method could transform the manner in which antitumor responses and/or infectious events may be tracked. PMID:25902531

  11. Hypothalamic neurohormones and immune responses

    PubMed Central

    Quintanar, J. Luis; Guzmán-Soto, Irene

    2013-01-01

    The aim of this review is to provide a comprehensive examination of the current literature describing the neural-immune interactions, with emphasis on the most recent findings of the effects of neurohormones on immune system. Particularly, the role of hypothalamic hormones such as Thyrotropin-releasing hormone (TRH), Corticotropin-releasing hormone (CRH) and Gonadotropin-releasing hormone (GnRH). In the past few years, interest has been raised in extrapituitary actions of these neurohormones due to their receptors have been found in many non-pituitary tissues. Also, the receptors are present in immune cells, suggesting an autocrine or paracrine role within the immune system. In general, these neurohormones have been reported to exert immunomodulatory effects on cell proliferation, immune mediators release and cell function. The implications of these findings in understanding the network of hypothalamic neuropeptides and immune system are discussed. PMID:23964208

  12. Hypothalamic neurohormones and immune responses.

    PubMed

    Quintanar, J Luis; Guzmán-Soto, Irene

    2013-01-01

    The aim of this review is to provide a comprehensive examination of the current literature describing the neural-immune interactions, with emphasis on the most recent findings of the effects of neurohormones on immune system. Particularly, the role of hypothalamic hormones such as Thyrotropin-releasing hormone (TRH), Corticotropin-releasing hormone (CRH) and Gonadotropin-releasing hormone (GnRH). In the past few years, interest has been raised in extrapituitary actions of these neurohormones due to their receptors have been found in many non-pituitary tissues. Also, the receptors are present in immune cells, suggesting an autocrine or paracrine role within the immune system. In general, these neurohormones have been reported to exert immunomodulatory effects on cell proliferation, immune mediators release and cell function. The implications of these findings in understanding the network of hypothalamic neuropeptides and immune system are discussed.

  13. Antigen processing and immune regulation in the response to tumours.

    PubMed

    Reeves, Emma; James, Edward

    2017-01-01

    The MHC class I and II antigen processing and presentation pathways display peptides to circulating CD8(+) cytotoxic and CD4(+) helper T cells respectively to enable pathogens and transformed cells to be identified. Once detected, T cells become activated and either directly kill the infected / transformed cells (CD8(+) cytotoxic T lymphocytes) or orchestrate the activation of the adaptive immune response (CD4(+) T cells). The immune surveillance of transformed/tumour cells drives alteration of the antigen processing and presentation pathways to evade detection and hence the immune response. Evasion of the immune response is a significant event tumour development and considered one of the hallmarks of cancer. To avoid immune recognition, tumours employ a multitude of strategies with most resulting in a down-regulation of the MHC class I expression at the cell surface, significantly impairing the ability of CD8(+) cytotoxic T lymphocytes to recognize the tumour. Alteration of the expression of key players in antigen processing not only affects MHC class I expression but also significantly alters the repertoire of peptides being presented. These modified peptide repertoires may serve to further reduce the presentation of tumour-specific/associated antigenic epitopes to aid immune evasion and tumour progression. Here we review the modifications to the antigen processing and presentation pathway in tumours and how it affects the anti-tumour immune response, considering the role of tumour-infiltrating cell populations and highlighting possible future therapeutic targets.

  14. Cellular immunity in ASFV responses.

    PubMed

    Takamatsu, Haru-Hisa; Denyer, Michael S; Lacasta, Anna; Stirling, Catrina M A; Argilaguet, Jordi M; Netherton, Christopher L; Oura, Chris A L; Martins, Carlos; Rodríguez, Fernando

    2013-04-01

    African swine fever virus (ASFV) infection usually results in an acute haemorrhagic disease with a mortality rate approaching 100% in domestic pigs. However, pigs can survive infection with less-virulent isolates of ASFV and may become chronically infected. Surviving animals are resistant to challenge with homologous or, in some cases, closely related isolates of the virus indicating that pigs can develop protective immunity against ASFV. During asymptomatic, non-virulent ASFV infections natural killer cell activity increases in pigs, suggesting this cell type plays a role in ASFV immunity. Furthermore, depletion of CD8(+) lymphocytes from ASFV immune pigs demolishes protective immunity against related virulent viruses. This suggests that ASFV specific antibody alone is not sufficient for protection against ASFV infection and that there is an important role for the CD8(+) lymphocyte subset in ASFV protective immunity. These results were supported by DNA immunization studies, demonstrating a correlation between the protection afforded against lethal challenge and the detection of a large number of vaccine-induced antigen-specific CD8(+) T-cells. Peripheral blood mononuclear cells (PBMCs) from ASF immune pigs protected from clinical disease show higher proportions of ASFV specific CD4(+)CD8(high+) double positive cytotoxic T cells than PBMCs from ASF immune but clinically diseased pig. The frequency of ASFV specific IFNγ producing T cells induced by immunization correlates to the degree of protection from ASFV challenge, and this may prove to be a useful indicator of any potential cross-protection against heterologous ASFV isolates.

  15. Constant light exposure impairs immune tolerance development in mice.

    PubMed

    Mizutani, Hiromi; Tamagawa-Mineoka, Risa; Minami, Yoichi; Yagita, Kazuhiro; Katoh, Norito

    2017-04-01

    An intrinsic daily physiological rhythm called circadian rhythm has been indicated to affect the immune system and its related diseases. Immune tolerance development is closely associated with the onset of immunological disorders. However, the effect of circadian rhythm in the mechanisms of immune tolerance development has not yet been fully understood. The purpose of this study was to investigate the effects of circadian rhythm disruption on the development of immune tolerance by the perturbation of light environment, using a mouse model of neonatally induced cutaneous tolerance. Mice were kept under constant light (LL) or light-dark (LD) conditions, and hapten was applied at 2days after birth. Six weeks later, hapten was reapplied to abdominal skin, followed by hapten application to ear skin 5days later. The ear-swelling responses and cell infiltration into inflamed skin significantly increased in LL mice compared with those in LD mice. Interestingly, the percentage and the number of Foxp3(+)-regulatory T cells notably decreased in inflamed skin and draining lymph nodes of LL mice compared with that in LD mice. Loss-of-function mutation of a key circadian gene, Bmal1, also exacerbated the ear-swelling responses and cell infiltration into inflamed skin in mice. These results suggest that circadian rhythm may be implicated in immune tolerance development in allergic inflammation. Copyright © 2016 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  16. Flavored e-cigarette liquids and cinnamaldehyde impair respiratory innate immune cell function.

    PubMed

    Clapp, Phillip W; Pawlak, Erica A; Lackey, Justin T; Keating, James E; Reeber, Steven L; Glish, Gary L; Jaspers, Ilona

    2017-08-01

    Innate immune cells of the respiratory tract are the first line of defense against pathogenic and environmental insults. Failure of these cells to perform their immune functions leaves the host susceptible to infection and may contribute to impaired resolution of inflammation. While combustible tobacco cigarettes have been shown to suppress respiratory immune cell function, the effects of flavored electronic cigarette liquids (e-liquids) and individual flavoring agents on respiratory immune cell responses are unknown. We investigated the effects of seven flavored nicotine-free e-liquids on primary human alveolar macrophages, neutrophils, and natural killer (NK) cells. Cells were challenged with a range of e-liquid dilutions and assayed for their functional responses to pathogenic stimuli. End points included phagocytic capacity (neutrophils and macrophages), neutrophil extracellular trap formation, proinflammatory cytokine production, and cell-mediated cytotoxic response (NK cells). E-liquids were then analyzed via mass spectrometry to identify individual flavoring components. Three cinnamaldehyde-containing e-liquids exhibited dose-dependent broadly immunosuppressive effects. Quantitative mass spectrometry was used to determine concentrations of cinnamaldehyde in each of the three e-liquids, and cells were subsequently challenged with a range of cinnamaldehyde concentrations. Cinnamaldehyde alone recapitulated the impaired function observed with e-liquid exposures, and cinnamaldehyde-induced suppression of macrophage phagocytosis was reversed by addition of the small-molecule reducing agent 1,4-dithiothreitol. We conclude that cinnamaldehyde has the potential to impair respiratory immune cell function, illustrating an immediate need for further toxicological evaluation of chemical flavoring agents to inform regulation governing their use in e-liquid formulations. Copyright © 2017 the American Physiological Society.

  17. Adaptive immune response during hepatitis C virus infection.

    PubMed

    Larrubia, Juan Ramón; Moreno-Cubero, Elia; Lokhande, Megha Uttam; García-Garzón, Silvia; Lázaro, Alicia; Miquel, Joaquín; Perna, Cristian; Sanz-de-Villalobos, Eduardo

    2014-04-07

    Hepatitis C virus (HCV) infection affects about 170 million people worldwide and it is a major cause of liver cirrhosis and hepatocellular carcinoma. HCV is a hepatotropic non-cytopathic virus able to persist in a great percentage of infected hosts due to its ability to escape from the immune control. Liver damage and disease progression during HCV infection are driven by both viral and host factors. Specifically, adaptive immune response carries out an essential task in controlling non-cytopathic viruses because of its ability to recognize infected cells and to destroy them by cytopathic mechanisms and to eliminate the virus by non-cytolytic machinery. HCV is able to impair this response by several means such as developing escape mutations in neutralizing antibodies and in T cell receptor viral epitope recognition sites and inducing HCV-specific cytotoxic T cell anergy and deletion. To impair HCV-specific T cell reactivity, HCV affects effector T cell regulation by modulating T helper and Treg response and by impairing the balance between positive and negative co-stimulatory molecules and between pro- and anti-apoptotic proteins. In this review, the role of adaptive immune response in controlling HCV infection and the HCV mechanisms to evade this response are reviewed.

  18. The Immune Response to Astrovirus Infection

    PubMed Central

    Marvin, Shauna A.

    2016-01-01

    Astroviruses are one of the leading causes of pediatric gastroenteritis worldwide and are clinically importantly pathogens in the elderly and immunocompromised populations. Although the use of cell culture systems and small animal models have enhanced our understanding of astrovirus infection and pathogenesis, little is known about the immune response to astrovirus infection. Studies from humans and animals suggest that adaptive immunity is important in restricting classic and novel astrovirus infections, while studies from animal models and cell culture systems suggest that an innate immune system plays a role in limiting astrovirus replication. The relative contribution of each arm of the immune system in restricting astrovirus infection remains unknown. This review summarizes our current understanding of the immune response to astrovirus infection and highlights some of the key questions that stem from these studies. A full understanding of the immune response to astrovirus infection is required to be able to treat and control astrovirus-induced gastroenteritis. PMID:28042824

  19. Immune memory-boosting dose of rapamycin impairs macrophage vesicle acidification and curtails glycolysis in effector CD8 cells, impairing defense against acute infections.

    PubMed

    Goldberg, Emily L; Smithey, Megan J; Lutes, Lydia K; Uhrlaub, Jennifer L; Nikolich-Žugich, Janko

    2014-07-15

    Direct mammalian target of rapamycin (Rapa) complex 1 inhibition by short-term low-dose Rapa treatment has recently been shown to improve CD8 T cell immunological memory. Whereas these studies focused on memory development, the impact of low-dose Rapa on the primary immune response, particularly as it relates to functional effector immunity, is far less clear. In this study, we investigated the impact of acute Rapa treatment on immune effector cell function during the primary immune response to several acute infections. We found that functional CD8 T cell and macrophage responses to both viral and intracellular bacterial pathogens were depressed in mice in vivo and in humans to phorbol ester and calcium ionophore stimulation in vitro in the face of low-dose Rapa treatment. Mechanistically, the CD8 defect was linked to impaired glycolytic switch in stimulated naive cells and the reduced formation of short-lived effector cells. Therefore, more than one cell type required for a protective effector immune response is impaired by Rapa in both mice and humans, at the dose shown to improve immune memory and extend lifespan. This urges caution with regard to the relative therapeutic costs and benefits of Rapa treatment as means to improve immune memory. Copyright © 2014 by The American Association of Immunologists, Inc.

  20. Cytokines and the immune response.

    PubMed

    Van der Meide, P H; Schellekens, H

    1996-01-01

    Cytokines participate in many physiological processes including the regulation of immune and inflammatory responses. These effector molecules are produced transiently and locally controlling the amplitude and duration of the response. A variety of experiments has shown that excessive or insufficient production may significantly contribute to the pathophysiology of a range of diseases. Particularly cytokines released by CD4+ T cells at the onset of an immune response are thought to be decisive for pathological or physiological consequences. The meeting in Budapest was focussed on cytokines known to contribute to the pathophysiology of autoimmune diseases, infectious diseases and allograft rejection (e.g., IL-1, IL-4, IL-6, IL-10, IL-12, TNF-alpha and IFN-alpha, -beta, -gamma). A central role for IFN-gamma in autoimmunity was suggested by blocking experiments in vivo using monoclonal antibodies and soluble forms of the IFN-gamma receptor (IFN-gamma SR). These agents ameliorated disease development in a variety of experimental autoimmune diseases in rodents. In a mouse model for the human disease Myasthenia gravis, IFN-alpha was found to reduce both the incidence and progression of the disease. Treatment of R. aurantiacus-infected mice with anti-IL-4 monoclonal antibodies (mAbs) was reported to interfere with the regression of granulomas in spleen and liver, most likely through inadequate IL-4-mediated suppression of IFN-gamma production. In addition, it was shown that mice with disrupted IFN-gamma R genes died rapidly after infection with the BCG strain of M. bovis, whereas normal mice survived the infection. IL-12 was found to be the main inductor of IFN-gamma during the lethal Shwartzman reaction. TNF-alpha was identified as the principal cause of mortality after the second injection with LPS. In a variety of studies examining the role of cytokines in the pathogenesis of AIDS, much attention was given to the in vitro effects of HIV-1 and/or the HIV-1 viral membrane

  1. Protective host immune responses to Salmonella infection.

    PubMed

    Pham, Oanh H; McSorley, Stephen J

    2015-01-01

    Salmonella enterica serovars Typhi and Paratyphi are the causative agents of human typhoid fever. Current typhoid vaccines are ineffective and are not widely used in endemic areas. Greater understanding of host-pathogen interactions during Salmonella infection should facilitate the development of improved vaccines to combat typhoid and nontyphoidal Salmonellosis. This review will focus on our current understanding of Salmonella pathogenesis and the major host immune components that participate in immunity to Salmonella infection. In addition, recent findings regarding host immune mechanisms in response to Salmonella infection will be also discussed, providing a new perspective on the utility of improved tools to study the immune response to Salmonella infections.

  2. Protective host immune responses to Salmonella infection

    PubMed Central

    Pham, Oanh H; McSorley, Stephen J.

    2015-01-01

    Salmonella enterica serovars Typhi and Paratyphi are the causative agents of human typhoid fever. Current typhoid vaccines are ineffective and are not widely used in endemic areas. Greater understanding of host–pathogen interactions during Salmonella infection should facilitate the development of improved vaccines to combat typhoid and nontyphoidal Salmonellosis. This review will focus on our current understanding of Salmonella pathogenesis and the major host immune components that participate in immunity to Salmonella infection. In addition, recent findings regarding host immune mechanisms in response to Salmonella infection will be also discussed, providing a new perspective on the utility of improved tools to study the immune response to Salmonella infections. PMID:25598340

  3. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology

    1983-09-01

    A-Al?l 362 HUMAN IMMUNE RESPONSES TO DENGUE YXRUSES(U) MASSACHUSETTS UNIV MEDICAL SCHOOL NORCESTER F A ENNIS SE 83" I ?-2C23 UNCLASSI FIED SE 3IRD?8...SHEET PREVIOUS EDITION MAY BE USED UNTILDTIC FORM 70A OUMNPRESIGSETSTOCK IS EXHAUSTED.DEC 83 AD IHuman Immune Responses to Dengue Viruses Annual Report...edilon may be ued Y01dxffnUICFMCASIAZIlow f~ rolit SUMMARY The purpose of this contract is to analyse the immune responses to dengue virus infections

  4. Human Immune Response to Dengue Infections.

    DTIC Science & Technology

    1987-07-30

    W5l "I± H"MN IMMUNE RESPONSE TO DENGUE INFECTIONS(U) i/il MASSACHUSETTS UNIV MEDICAL CENTER NORCESTER MR1 F R ENIS 36 JUL 87 DAMD7-86-C-6200...1 U . AD HUMAN IMMUNE RESPONSE TO DENGUE INFECTIONS ANNUAL REPORT In 00 FRANCIS A. ENNIS JULY 30, 1987 Supported by U.S. ARMY MEDICAL RESEARCH...Human Immune Response to Dengue Infections 12. PERSONAL AUTHOR(S) Ennis, Francis A. 13a. TYPE OF REPORT 13b. TIME COVERED 14. DATE OF REPORT (Year

  5. Crude oil impairs immune function and increases susceptibility to pathogenic bacteria in southern flounder.

    PubMed

    Bayha, Keith M; Ortell, Natalie; Ryan, Caitlin N; Griffitt, Kimberly J; Krasnec, Michelle; Sena, Johnny; Ramaraj, Thiruvarangan; Takeshita, Ryan; Mayer, Gregory D; Schilkey, Faye; Griffitt, Robert J

    2017-01-01

    Exposure to crude oil or its individual constituents can have detrimental impacts on fish species, including impairment of the immune response. Increased observations of skin lesions in northern Gulf of Mexico fish during the 2010 Deepwater Horizon oil spill indicated the possibility of oil-induced immunocompromisation resulting in bacterial or viral infection. This study used a full factorial design of oil exposure and bacterial challenge to examine how oil exposure impairs southern flounder (Paralichthys lethostigma) immune function and increases susceptibility to the bacteria Vibrio anguillarum, a causative agent of vibriosis. Fish exposed to oil prior to bacterial challenge exhibited 94.4% mortality within 48 hours of bacterial exposure. Flounder challenged with V. anguillarum without prior oil exposure had <10% mortality. Exposure resulted in taxonomically distinct gill and intestine bacterial communities. Mortality strongly correlated with V. anguillarum levels, where it comprised a significantly higher percentage of the microbiome in Oil/Pathogen challenged fish and was nearly non-existent in the No Oil/Pathogen challenged fish bacterial community. Elevated V. anguillarum levels were a direct result of oil exposure-induced immunosuppression. Oil-exposure reduced expression of immunoglobulin M, the major systemic fish antibody, and resulted in an overall downregulation in transcriptome response, particularly in genes related to immune function, response to stimulus and hemostasis. Ultimately, sediment-borne oil exposure impairs immune function, leading to increased incidences of bacterial infections. This type of sediment-borne exposure may result in long-term marine ecosystem effects, as oil-bound sediment in the northern Gulf of Mexico will likely remain a contamination source for years to come.

  6. Crude oil impairs immune function and increases susceptibility to pathogenic bacteria in southern flounder

    PubMed Central

    Bayha, Keith M.; Ortell, Natalie; Ryan, Caitlin N.; Griffitt, Kimberly J.; Krasnec, Michelle; Sena, Johnny; Ramaraj, Thiruvarangan; Takeshita, Ryan; Mayer, Gregory D.; Schilkey, Faye; Griffitt, Robert J.

    2017-01-01

    Exposure to crude oil or its individual constituents can have detrimental impacts on fish species, including impairment of the immune response. Increased observations of skin lesions in northern Gulf of Mexico fish during the 2010 Deepwater Horizon oil spill indicated the possibility of oil-induced immunocompromisation resulting in bacterial or viral infection. This study used a full factorial design of oil exposure and bacterial challenge to examine how oil exposure impairs southern flounder (Paralichthys lethostigma) immune function and increases susceptibility to the bacteria Vibrio anguillarum, a causative agent of vibriosis. Fish exposed to oil prior to bacterial challenge exhibited 94.4% mortality within 48 hours of bacterial exposure. Flounder challenged with V. anguillarum without prior oil exposure had <10% mortality. Exposure resulted in taxonomically distinct gill and intestine bacterial communities. Mortality strongly correlated with V. anguillarum levels, where it comprised a significantly higher percentage of the microbiome in Oil/Pathogen challenged fish and was nearly non-existent in the No Oil/Pathogen challenged fish bacterial community. Elevated V. anguillarum levels were a direct result of oil exposure-induced immunosuppression. Oil-exposure reduced expression of immunoglobulin M, the major systemic fish antibody, and resulted in an overall downregulation in transcriptome response, particularly in genes related to immune function, response to stimulus and hemostasis. Ultimately, sediment-borne oil exposure impairs immune function, leading to increased incidences of bacterial infections. This type of sediment-borne exposure may result in long-term marine ecosystem effects, as oil-bound sediment in the northern Gulf of Mexico will likely remain a contamination source for years to come. PMID:28464028

  7. [Correlation between chemical carcinogenesis and immune response].

    PubMed

    Brai, M; Bonasera, L; Tolone, G

    1975-01-01

    Methylcholanthrene, in amount sufficient to induce tumors in 100% of treated animals failed to influence primary and secondary phases of antibody synthesis in mice immunized with sheep erythrocytes and human serum albumin. The early immune response in tumor bearing mice was also indistinguischable from that of normal animals, despite the presence of marked splenomegaly in the former group.

  8. Innate immune responses to Pseudomonas aeruginosa infection

    PubMed Central

    Lavoie, Elise G.; Wangdi, Tamding; Kazmierczak, Barbara I.

    2011-01-01

    Innate immune responses play a critical role in controlling acute infections due to Pseudomonas aeruginosa in both mice and in humans. In this review we focus on innate immune recognition and clearance mechanisms that are important for controlling P. aeruginosa in the mammalian lung, with particular attention to those that influence the outcome of in vivo infection in murine models. PMID:21839853

  9. Antifouling biocides: Impairment of bivalve immune system by chlorothalonil.

    PubMed

    Guerreiro, Amanda da Silveira; Rola, Regina Coimbra; Rovani, Monique Tomazele; Costa, Simone Rutz da; Sandrini, Juliana Zomer

    2017-08-01

    Marine ecosystems are subjected to a variety of contaminants. Antifouling paints, for example, have been extensively used to protect ship surfaces from marine biofouling, but their toxicity has generated great concern. Thus, we evaluated the effect of the biocide chlorothalonil on the immune system of Perna perna mussels. The mussels were exposed to 0 (control), 0.1μg/L and 10μg/L of chlorothalonil for up to 96h. After 24h and 96h of exposure, the following immune-related parameters were analyzed in the hemolymph of mussels: total hemocyte count, cell adhesion, phagocytic activity, level of reactive oxygen species, cell viability and comet assay. After 24h and 96h of chlorothalonil exposure, cellular adhesion increased and the hemocyte viability reduced. Moreover, an increase in phagocytic activity was also observed after 96h of exposure to cholorothalonil. The exposure to 10μg/L of chlorothalonil for 96h reduced the air survival capacity of mussels. Total hemocyte count, ROS generation and DNA damage were not affected by the contaminant exposure. Our results indicate that chlorothalonil affected important immune responses of the bivalves, demonstrating that this biocide has effects on non-target species. This modulation of immune system reduced the health status of mussels, which could compromise their ability to survive in the environment. Copyright © 2017. Published by Elsevier B.V.

  10. Epigenetics and the Adaptive Immune Response

    PubMed Central

    Kondilis-Mangum, Hrisavgi D.; Wade, Paul A.

    2012-01-01

    Cells of the adaptive immune response undergo dynamic epigenetic changes as they develop and respond to immune challenge. Plasticity is a necessary prerequisite for the chromosomal dynamics of lineage specification, development, and the immune effector function of the mature cell types. The alterations in DNA methylation and histone modification that characterize activation may be integral to the generation of immunologic memory, thereby providing an advantage on secondary exposure to pathogens. While the immune system benefits from the dynamic nature of the epigenome, such benefit comes at a cost – increased likelihood of disease-causing mutation. PMID:22789989

  11. Cellular immune response in intraventricular experimental neurocysticercosis.

    PubMed

    Moura, Vania B L; Lima, Sarah B; Matos-Silva, Hidelberto; Vinaud, Marina C; Loyola, Patricia R A N; Lino, Ruy S

    2016-03-01

    Neurocysticercosis (NCC) is considered a neglected parasitic infection of the human central nervous system. Its pathogenesis is due to the host immune response, stage of evolution and location of the parasite. The aim of this study was to evaluate the in situ and systemic immune response through cytokines dosage (IL-4, IL-10, IL-17 and IFN-γ) as well as the local inflammatory response of the experimental NCC with Taenia crassiceps. The in situ and systemic cellular and inflammatory immune response were evaluated through the cytokines quantification at 7, 30, 60 and 90 days after inoculation and histopathological analysis. All cysticerci were found within the cerebral ventricles. There was a discrete intensity of inflammatory cells of mixed immune profile, polymorphonuclear and mononuclear cells, at the beginning of the infection and predominance of mononuclear cells at the end. The systemic immune response showed a significant increase in all the analysed cytokines and predominance of the Th2 immune profile cytokines at the end of the infection. These results indicate that the location of the cysticerci may lead to ventriculomegaly. The acute phase of the infection showed a mixed Th1/Th17 profile accompanied by high levels of IL-10 while the late phase showed a Th2 immune profile.

  12. Adaptive immune responses to Acanthamoeba cysts.

    PubMed

    McClellan, Kathy; Howard, Kevin; Mayhew, Elizabeth; Niederkorn, Jerry; Alizadeh, Hassan

    2002-09-01

    Acanthamoeba cysts are not eliminated from the corneas of human subjects or experimentally infected animals. The persistence of Acanthamoeba cysts in the cornea indicates that either the cysts escape immunological elimination or are not recognized by the host's immunological elements. The aim of this study was to determine the immunogenicity and antigenicity of the Acanthamoeba cyst. Mice were immunized intraperitoneally and serum anti-Acanthamoeba IgG was measured by ELISA. Lymphoproliferative assay and delayed type hypersensitivity (DTH) responses to Acanthamoeba castellanii cyst and trophozoite antigens were used to determine the cell mediated immune responses against Acanthamoeba cysts. A. castellanii cysts were both immunogenic and antigenic, producing anti-Acanthamoeba serum IgG, T lymphocyte proliferation, and delayed type hypersensitivity responses. These results indicate that Acanthamoeba cysts are recognized by the immune system. The persistence of the organism in the human cornea means that these adaptive immune responses fail to kill Acanthamoeba cysts.

  13. Immune Response in Hepatitis B Virus Infection

    PubMed Central

    Tan, Anthony; Koh, Sarene; Bertoletti, Antonio

    2015-01-01

    Hepatitis B virus (HBV) can replicate within hepatocytes without causing direct cell damage. The host immune response is, therefore, not only essential to control the spread of virus infection, but it is also responsible for the inflammatory events causing liver pathologies. In this review, we discuss how HBV deals with host immunity and how we can harness it to achieve virus control and suppress liver damage. PMID:26134480

  14. Cellular immune response experiment MA-031

    NASA Technical Reports Server (NTRS)

    Criswell, B. S.

    1976-01-01

    Significant changes in phytohemagglutinin (PHA) lymphocytic responsiveness occurred in the cellular immune response of three astronauts during the 9 day flight of the Apollo Soyuz Test Project. Parameters studied were white blood cell concentrations, lymphocyte numbers, B- and T-lymphocyte distributions in peripheral blood, and lymphocyte responsiveness to PHA, pokeweed mitogen, Concanavalin A, and influenza virus antigen.

  15. Natural immunity has significant impact on immune responses against cancer.

    PubMed

    Rubin, B

    2009-03-01

    The immune system defends the host against pathogenic attacks by micro-organisms and their products. It does not react against self-components due to the relatively efficient negative selection of developing T lymphocytes in the thymus. This process does permit T cells with low avidity against self to be present in the T cell repertoire. Such cells play an important physiological role as the host needs so-called autoimmune reactions in order to eliminate dying cells or transformed tumour cells. One of the mysteries in immunology is how the host maintains beneficial autoimmune reactions and avoids pathogenic autoimmune reactions. Activation of the adaptive T lymphocytes is mediated by the low avidity interaction between T-cell antigen receptors and antigenic peptides associated with major histocompatibility complex class I or class II molecules. This interaction is strengthened by T-cell co-receptors such as CD2, CD4, CD8, CD28 and CD154, which react with ligands expressed by cells of the innate immune system. In recent years, the importance of pre-activation of the innate immune system for initiation of adaptive T-cell immune responses has been appreciated. In the present review, I will summarize our work on how natural immunity plays an important role in determining the level of beneficial autoimmune reactions against cancer.

  16. Active immunization with amyloid-beta 1-42 impairs memory performance through TLR2/4-dependent activation of the innate immune system.

    PubMed

    Vollmar, Patrick; Kullmann, Jennifer S; Thilo, Barbara; Claussen, Malte C; Rothhammer, Veit; Jacobi, Hortenzia; Sellner, Johann; Nessler, Stefan; Korn, Thomas; Hemmer, Bernhard

    2010-11-15

    Active immunization with amyloid-β (Aβ) peptide 1-42 reverses amyloid plaque deposition in the CNS of patients with Alzheimer's disease and in amyloid precursor protein transgenic mice. However, this treatment may also cause severe, life-threatening meningoencephalitis. Physiological responses to immunization with Aβ(1-42) are poorly understood. In this study, we characterized cognitive and immunological consequences of Aβ(1-42)/CFA immunization in C57BL/6 mice. In contrast to mice immunized with myelin oligodendrocyte glycoprotein (MOG)(35-55)/CFA or CFA alone, Aβ(1-42)/CFA immunization resulted in impaired exploratory activity, habituation learning, and spatial-learning abilities in the open field. As morphological substrate of this neurocognitive phenotype, we identified a disseminated, nonfocal immune cell infiltrate in the CNS of Aβ(1-42)/CFA-immunized animals. In contrast to MOG(35-55)/CFA and PBS/CFA controls, the majority of infiltrating cells in Aβ(1-42)/CFA-immunized mice were CD11b(+)CD14(+) and CD45(high), indicating their blood-borne monocyte/macrophage origin. Immunization with Aβ(1-42)/CFA was significantly more potent than immunization with MOG(35-55)/CFA or CFA alone in activating macrophages in the secondary lymphoid compartment and peripheral tissues. Studies with TLR2/4-deficient mice revealed that the TLR2/4 pathway mediated the Aβ(1-42)-dependent proinflammatory cytokine release from cells of the innate immune system. In line with this, TLR2/4 knockout mice were protected from cognitive impairment upon immunization with Aβ(1-42)/CFA. Thus, this study identifies adjuvant effects of Aβ(1-42), which result in a clinically relevant neurocognitive phenotype highlighting potential risks of Aβ immunotherapy.

  17. Immune response to lipoproteins in atherosclerosis.

    PubMed

    Samson, Sonia; Mundkur, Lakshmi; Kakkar, Vijay V

    2012-01-01

    Atherosclerosis, the underlying cause of cardiovascular disease, is characterized by chronic inflammation and altered immune response. Cholesterol is a well-known risk factor associated with the development of cardiovascular diseases. Elevated serum cholesterol is unique because it can lead to development of atherosclerosis in animals and humans even in the absence of other risk factors. Modifications of low-density lipoproteins mediated by oxidation, enzymatic degradation, and aggregation result in changes in their function and activate both innate and adaptive immune system. Oxidized low-density lipoprotein (LDL) has been identified as one of the most important autoantigens in atherosclerosis. This escape from self-tolerance is dependent on the formation of oxidized phospholipids. The emerging understanding of the importance of immune responses against oxidized LDL in atherosclerosis has focused attention on the possibility of development of novel therapy for atherosclerosis. This review provides an overview of immune response to lipoproteins and the fascinating possibility of developing an immunomodulatory therapy for atherosclerosis.

  18. Initiation of adaptive immune responses by transcutaneous immunization.

    PubMed

    Warger, Tobias; Schild, Hansjörg; Rechtsteiner, Gerd

    2007-03-15

    The development of new, effective, easy-to-use and lower-cost vaccination approaches for the combat against malignant and infectious diseases is a pre-eminent need: cancer is a leading cause of morbidity in the Western World; there are numerous pathogenic diseases for which we still have no protective or therapeutic cure; and the financial limitations of developing countries to fight these diseases. In this mini-review we focus on transcutaneous immunization (TCI), a relatively new route for antigen delivery. TCI protocols appear to be particularly promising by gaining access to skin resident APC, which are highly efficient for the initiation of humoral and/or cellular immune responses. Consisting of an adjuvant as a stimulus in combination with an antigen which defines the target, TCI offers a most attractive immunization strategy to mount highly specific full-blown adaptive immune responses. As a topically applicable cell-free adjuvant/antigen mixture, TCI might be suitable to improve patient compliance, as well as feasible economically for the use in Third World countries. In addition, this non-invasive procedure might increase the safety of vaccinations by eliminating the risk of infections related to the recycling and improper disposal of needles. The dissection of antigen and adjuvant is important because it allows "free" combinations in contrast to classical immunizations which are based on application of the pathogen of interest. The most relevant ways and means to find new, effective pathogenic target antigens are "reverse vaccinology" and the direct peptide-epitope identification from MHC molecules with mass-spectrometry. Due to these efficient approaches the variety of antigenic epitopes for potential protective/therapeutic use is perpetually expanding. The most studied adjuvants in TCI approaches are cholera toxin (CT) and its less toxic relative, the heat-labile enterotoxin (LT). Both CT and LT can serve as antigen as well. In contrast to these large

  19. Humoral immune response to the antigen administered as an immune complex.

    PubMed

    Marusić, M; Marusić-Galesić, S; Pokrić, B

    1992-12-01

    Antigen (HSA) bound in immune complexes at equivalence with syngeneic anti-HSA antibodies elicit much stronger humoral immune response then soluble HSA. On the other hand, administration of immune complexes formed with xenogeneic (rabbit) anti-HSA antibodies suppressed humoral immune response against HSA, but not against rabbit IgG in mice. We suggest that immunization with antigen bound in immune complex might represent a powerful tool in enhancing humoral immune responses.

  20. Modulating immune responses with probiotic bacteria.

    PubMed

    Matsuzaki, T; Chin, J

    2000-02-01

    For many years, probiotic bacteria have been known to confer health benefits to the consumer. One possible mechanism for this may be the ability of probiotic bacteria to modulate immune responses. Oral administration of Lactobacillus casei strain Shirota (LcS) has been found to enhance innate immunity by stimulating the activity of splenic NK cells. Oral feeding with killed LcS was able to stimulate the production of Th1 cytokines, resulting in repressed production of IgE antibodies against Ovalbumin in experimental mice. The ability to switch mucosal immune responses towards Th1 with probiotic bacteria provides a strategy for treatment of allergic disorders. Growth of Meth A tumour cells in the lungs was also inhibited by intrapleural injection of LcS. Oral administration of other probiotic bacteria, such as Streptococcus thermophilus (St), Lactobacillus fermentum (Lf) and yeast (Y), elicited different immune responses. Mice that were prefed yeast or Lf followed by feeding with ovalbumin (OVA) responded better to vaccination with OVA than mice not given either probiotic or OVA or mice that had been prefed only OVA. However, antibody responses were significantly suppressed in response to vaccination with OVA in mice that had been prefed yeast followed by yeast and OVA as well as mice prefed Lf followed by Lf and OVA. Prefeeding St followed by OVA feeding enhanced cellular immune responses against ovalbumin. In contrast, mice prefed St followed by St + OVA were hyporesponsive against OVA. While antigen feeding alone appears to prime for an immune response, cofeeding antigen with probiotic bacteria can suppress both antibody and cellular immune responses and may provide an efficacious protocol to attenuate autoimmune diseases, such as experimental allergic encephalomyelitis, by jointly dosing with myelin basic protein and probiotic bacteria.

  1. Type I IFN signaling in CD8– DCs impairs Th1-dependent malaria immunity

    PubMed Central

    Haque, Ashraful; Best, Shannon E.; Montes de Oca, Marcela; James, Kylie R.; Ammerdorffer, Anne; Edwards, Chelsea L.; de Labastida Rivera, Fabian; Amante, Fiona H.; Bunn, Patrick T.; Sheel, Meru; Sebina, Ismail; Koyama, Motoko; Varelias, Antiopi; Hertzog, Paul J.; Kalinke, Ulrich; Gun, Sin Yee; Rénia, Laurent; Ruedl, Christiane; MacDonald, Kelli P.A.; Hill, Geoffrey R.; Engwerda, Christian R.

    2014-01-01

    Many pathogens, including viruses, bacteria, and protozoan parasites, suppress cellular immune responses through activation of type I IFN signaling. Recent evidence suggests that immune suppression and susceptibility to the malaria parasite, Plasmodium, is mediated by type I IFN; however, it is unclear how type I IFN suppresses immunity to blood-stage Plasmodium parasites. During experimental severe malaria, CD4+ Th cell responses are suppressed, and conventional DC (cDC) function is curtailed through unknown mechanisms. Here, we tested the hypothesis that type I IFN signaling directly impairs cDC function during Plasmodium infection in mice. Using cDC-specific IFNAR1-deficient mice, and mixed BM chimeras, we found that type I IFN signaling directly affects cDC function, limiting the ability of cDCs to prime IFN-γ–producing Th1 cells. Although type I IFN signaling modulated all subsets of splenic cDCs, CD8– cDCs were especially susceptible, exhibiting reduced phagocytic and Th1-promoting properties in response to type I IFNs. Additionally, rapid and systemic IFN-α production in response to Plasmodium infection required type I IFN signaling in cDCs themselves, revealing their contribution to a feed-forward cytokine-signaling loop. Together, these data suggest abrogation of type I IFN signaling in CD8– splenic cDCs as an approach for enhancing Th1 responses against Plasmodium and other type I IFN–inducing pathogens. PMID:24789914

  2. Immune response to biologic scaffold materials.

    PubMed

    Badylak, Stephen F; Gilbert, Thomas W

    2008-04-01

    Biologic scaffold materials composed of mammalian extracellular matrix are commonly used in regenerative medicine and in surgical procedures for the reconstruction of numerous tissue and organs. These biologic materials are typically allogeneic or xenogeneic in origin and are derived from tissues such as small intestine, urinary bladder, dermis, and pericardium. The innate and acquired host immune response to these biologic materials and the effect of the immune response upon downstream remodeling events has been largely unexplored. Variables that affect the host response include manufacturing processes, the rate of scaffold degradation, and the presence of cross species antigens. This manuscript provides an overview of studies that have evaluated the immune response to biologic scaffold materials and variables that affect this response.

  3. Pneumococcal polysaccharide vaccine responses are impaired in a subgroup of children with cystic fibrosis.

    PubMed

    Browning, Michael J; Lim, Michael T C; Kenia, Priti; Whittle, Michelle; Doffinger, Rainer; Barcenas-Morales, Gabriela; Kumararatne, Dinakantha; Viskaduraki, Maria; O'Callaghan, Christopher; Gaillard, Erol A

    2014-12-01

    Pneumococcal immunization is recommended in children with cystic fibrosis (CF). To date, however, there are no published studies on the efficacy of pneumococcal vaccination in this group of patients. We carried out a retrospective study of serotype-specific pneumococcal antibody responses to immunization with Prevenar 7 and Pneumovax II in a cohort of children with CF. Nine children had been immunized with Prevenar 7, and all had serotype-specific pneumococcal antibody levels in the protective range (>0.35mg/L) to all 7 immunizing serotypes. In contrast, only 7 of 33 patients (21%) immunized with Pneumovax II made protective antibody responses to all 7 serotypes, and 3 failed to make protective antibodies to any of the serotypes. Controlling for age as a confounder in the analysis, children with impaired antibody responses to pneumococcal polysaccharide (Pneumovax II) immunization had lower Shwachman-Kulczycki scores than children with normal polysaccharide antibody responses. All isolates of Pseudomonas aeruginosa occurred in patients with impaired anti-pneumococcal antibody responses, and a broader range of respiratory pathogens was isolated from these children. Impaired antibody responses to immunization with Pneumovax II are common in children with CF and this may be associated with increased disease severity. Copyright © 2014 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  4. Effect of blueberries on the immune response of obese mice induced by high fat diet

    USDA-ARS?s Scientific Manuscript database

    Both high fat diet and obesity have been linked to impaired cell-mediated immune response. Blueberry, rich in antioxidant phytochemicals, has been shown to impact biologic functions in several tissues. However, no information is available on immune cells. We investigated whether blueberry consumptio...

  5. Effect of cellular mobility on immune response

    NASA Astrophysics Data System (ADS)

    Pandey, R. B.; Mannion, R.; Ruskin, H. J.

    2000-08-01

    Mobility of cell types in our HIV immune response model is subject to an intrinsic mobility and an explicit directed mobility, which is governed by Pmob. We investigate how restricting the explicit mobility, while maintaining the innate mobility of a viral-infected cell, affects the model's results. We find that increasing the explicit mobility of the immune system cells leads to viral dominance for certain levels of viral mutation. We conclude that increasing immune system cellular mobility indirectly increases the virus’ inherent mobility.

  6. Immune responses and Lassa virus infection.

    PubMed

    Russier, Marion; Pannetier, Delphine; Baize, Sylvain

    2012-11-05

    Lassa fever is a hemorrhagic fever endemic to West Africa and caused by Lassa virus, an Old World arenavirus. It may be fatal, but most patients recover from acute disease and some experience asymptomatic infection. The immune mechanisms associated with these different outcomes have not yet been fully elucidated, but considerable progress has recently been made, through the use of in vitro human models and nonhuman primates, the only relevant animal model that mimics the pathophysiology and immune responses induced in patients. We discuss here the roles of the various components of the innate and adaptive immune systems in Lassa virus infection and in the control of viral replication and pathogenesis.

  7. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology

    1984-08-01

    ND-R171 381 HUR IMMUNE RESPONSES TO DENGUE VIRUSES(U) 1/1 MASSRCHUSETTS UNIY M9DICAL SCHOOL WORCESTER F R~ ENNIS RUG 94 DRMt17-2-C-2233 UNCLASSIFIED...Responses to Dengue Viruses Annual Report 0(August 1983-July 1984) Francis A. Ennis, M.D. August 1984 Supported by U.S. Army Medical Research and...3M1- NO. SON No. Frederick, Maryland 21701-5012 61102A 61102BSI0 AA 104 11. TITLE Oxkf* Samqy Oao" Human Immune Responses to Dengue Viruses 12. PERSON

  8. HTLV-1 Tax impairs K63-linked ubiquitination of STING to evade host innate immunity.

    PubMed

    Wang, Jie; Yang, Shuai; Liu, Lu; Wang, Hui; Yang, Bo

    2017-03-15

    The cellular antiviral innate immune system is essential for host defense and viruses have evolved a variety of strategies to evade the innate immunity. Human T lymphotropic virus type 1 (HTLV-1) belongs to the deltaretrovirus family and it can establish persistent infection in human beings for many years. However, how this virus evades the host innate immune responses remains unclear. Here we report a new strategy used by HTLV-1 to block innate immune responses. We observed that stimulator of interferon genes (STING) limited HTLV-1 protein expression and was critical to HTLV-1 reverse transcription intermediate (RTI) ssDNA90 triggered interferon (IFN)-β production in phorbol12-myristate13-acetate (PMA)-differentiated THP1 (PMA-THP1) cells. The HTLV-1 protein Tax inhibited STING overexpression induced transcriptional activation of IFN-β. Tax also impaired poly(dA:dT), interferon stimulatory DNA (ISD) or cyclic GMP-AMP (cGAMP) -stimulated IFN-β production, which was dependent on STING activation. Coimmunoprecipitation assays and confocal microscopy indicated that Tax was associated with STING in the same complex. Mechanistic studies suggested that Tax decreased the K63-linked ubiquitination of STING and disrupted the interactions between STING and TANK-binding kinase 1 (TBK1). These findings may shed more light on the molecular mechanisms underlying HTLV-1 infection. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Human Immune Response to Dengue Infections

    DTIC Science & Technology

    1989-07-31

    lhuman Immune Response to Dengue Infections 12. PERSONAL AUTHOR(S) Francis A. Ennis 13a. TYPE OF REPORT 13b. TIME COVERED T14. DATE OF REPORT (Year, Month...Stimulation with live dengue virus of peripheral blood mononuclear cells from a dengue 4-immune donor generated virus-specific serotype cross-reactive CD4- CD8...class I-restricted cytotoxic T lymphocytes (CL) capable of lysing dengue virus-infected autologous fibroblasts and cells pulsed with dengue I

  10. Cytomegalovirus infection improves immune responses to influenza

    PubMed Central

    Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai; Angel, Cesar J Lopez; Onengut-Gumuscu, Suna; Kidd, Brian; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M

    2015-01-01

    Cytomegalovirus (CMV) is a beta-herpes virus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV serostatus. In contrast, CMV-infected young adults exhibited an overall up-regulation of immune components including enhanced antibody responses to influenza vaccination, increased CD8+ T cell sensitivity, and elevated levels of circulating IFN-γ compared to uninfected individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the continued coexistence of CMV and mammals throughout their evolution. PMID:25834109

  11. Innate Immune Responses to AAV Vectors.

    PubMed

    Rogers, Geoffrey L; Martino, Ashley T; Aslanidi, George V; Jayandharan, Giridhara R; Srivastava, Arun; Herzog, Roland W

    2011-01-01

    Gene replacement therapy by in vivo delivery of adeno-associated virus (AAV) is attractive as a potential treatment for a variety of genetic disorders. However, while AAV has been used successfully in many models, other experiments in clinical trials and in animal models have been hampered by undesired responses from the immune system. Recent studies of AAV immunology have focused on the elimination of transgene-expressing cells by the adaptive immune system, yet the innate immune system also has a critical role, both in the initial response to the vector and in prompting a deleterious adaptive immune response. Responses to AAV vectors are primarily mediated by the TLR9-MyD88 pathway, which induces the production of pro-inflammatory cytokines by activating the NF-κB pathways and inducing type I IFN production; self-complementary AAV vectors enhance these inflammatory processes. Additionally, the alternative NF-κB pathway influences transgene expression in cells transduced by AAV. This review highlights these recent discoveries regarding innate immune responses to AAV and discusses strategies to ablate these potentially detrimental signaling pathways.

  12. Vaccination strategies for mucosal immune responses.

    PubMed

    Ogra, P L; Faden, H; Welliver, R C

    2001-04-01

    Mucosal administration of vaccines is an important approach to the induction of appropriate immune responses to microbial and other environmental antigens in systemic sites and peripheral blood as well as in most external mucosal surfaces. The development of specific antibody- or T-cell-mediated immunologic responses and the induction of mucosally induced systemic immunologic hyporesponsiveness (oral or mucosal tolerance) depend on complex sets of immunologic events, including the nature of the antigenic stimulation of specialized lymphoid structures in the host, antigen-induced activation of different populations of regulatory T cells (Th1 versus Th2), and the expression of proinflammatory and immunoregulatory cytokines. Availability of mucosal vaccines will provide a painless approach to deliver large numbers of vaccine antigens for human immunization. Currently, an average infant will receive 20 to 25 percutaneous injections for vaccination against different childhood infections by 18 months of age. It should be possible to develop for human use effective, nonliving, recombinant, replicating, transgenic, and microbial vector- or plant-based mucosal vaccines to prevent infections. Based on the experience with many dietary antigens, it is also possible to manipulate the mucosal immune system to induce systemic tolerance against environmental, dietary, and possibly other autoantigens associated with allergic and autoimmune disorders. Mucosal immunity offers new strategies to induce protective immune responses against a variety of infectious agents. Such immunization may also provide new prophylactic or therapeutic avenues in the control of autoimmune diseases in humans.

  13. Vaccination Strategies for Mucosal Immune Responses

    PubMed Central

    Ogra, Pearay L.; Faden, Howard; Welliver, Robert C.

    2001-01-01

    Mucosal administration of vaccines is an important approach to the induction of appropriate immune responses to microbial and other environmental antigens in systemic sites and peripheral blood as well as in most external mucosal surfaces. The development of specific antibody- or T-cell-mediated immunologic responses and the induction of mucosally induced systemic immunologic hyporesponsiveness (oral or mucosal tolerance) depend on complex sets of immunologic events, including the nature of the antigenic stimulation of specialized lymphoid structures in the host, antigen-induced activation of different populations of regulatory T cells (Th1 versus Th2), and the expression of proinflammatory and immunoregulatory cytokines. Availability of mucosal vaccines will provide a painless approach to deliver large numbers of vaccine antigens for human immunization. Currently, an average infant will receive 20 to 25 percutaneous injections for vaccination against different childhood infections by 18 months of age. It should be possible to develop for human use effective, nonliving, recombinant, replicating, transgenic, and microbial vector- or plant-based mucosal vaccines to prevent infections. Based on the experience with many dietary antigens, it is also possible to manipulate the mucosal immune system to induce systemic tolerance against environmental, dietary, and possibly other autoantigens associated with allergic and autoimmune disorders. Mucosal immunity offers new strategies to induce protective immune responses against a variety of infectious agents. Such immunization may also provide new prophylactic or therapeutic avenues in the control of autoimmune diseases in humans. PMID:11292646

  14. Age-Dependent Cell Trafficking Defects in Draining Lymph Nodes Impair Adaptive Immunity and Control of West Nile Virus Infection

    PubMed Central

    Richner, Justin M.; Gmyrek, Grzegorz B.; Govero, Jennifer; Tu, Yizheng; van der Windt, Gerritje J. W.; Metcalf, Talibah U.; Haddad, Elias K.; Textor, Johannes; Miller, Mark J.; Diamond, Michael S.

    2015-01-01

    Impaired immune responses in the elderly lead to reduced vaccine efficacy and increased susceptibility to viral infections. Although several groups have documented age-dependent defects in adaptive immune priming, the deficits that occur prior to antigen encounter remain largely unexplored. Herein, we identify novel mechanisms for compromised adaptive immunity that occurs with aging in the context of infection with West Nile virus (WNV), an encephalitic flavivirus that preferentially causes disease in the elderly. An impaired IgM and IgG response and enhanced vulnerability to WNV infection during aging was linked to delayed germinal center formation in the draining lymph node (DLN). Adoptive transfer studies and two-photon intravital microscopy revealed a decreased trafficking capacity of donor naïve CD4+ T cells from old mice, which manifested as impaired T cell diapedesis at high endothelial venules and reduced cell motility within DLN prior to antigen encounter. Furthermore, leukocyte accumulation in the DLN within the first few days of WNV infection or antigen-adjuvant administration was diminished more generally in old mice and associated with a second aging-related defect in local cytokine and chemokine production. Thus, age-dependent cell-intrinsic and environmental defects in the DLN result in delayed immune cell recruitment and antigen recognition. These deficits compromise priming of early adaptive immune responses and likely contribute to the susceptibility of old animals to acute WNV infection. PMID:26204259

  15. Age-Dependent Cell Trafficking Defects in Draining Lymph Nodes Impair Adaptive Immunity and Control of West Nile Virus Infection.

    PubMed

    Richner, Justin M; Gmyrek, Grzegorz B; Govero, Jennifer; Tu, Yizheng; van der Windt, Gerritje J W; Metcalf, Talibah U; Haddad, Elias K; Textor, Johannes; Miller, Mark J; Diamond, Michael S

    2015-07-01

    Impaired immune responses in the elderly lead to reduced vaccine efficacy and increased susceptibility to viral infections. Although several groups have documented age-dependent defects in adaptive immune priming, the deficits that occur prior to antigen encounter remain largely unexplored. Herein, we identify novel mechanisms for compromised adaptive immunity that occurs with aging in the context of infection with West Nile virus (WNV), an encephalitic flavivirus that preferentially causes disease in the elderly. An impaired IgM and IgG response and enhanced vulnerability to WNV infection during aging was linked to delayed germinal center formation in the draining lymph node (DLN). Adoptive transfer studies and two-photon intravital microscopy revealed a decreased trafficking capacity of donor naïve CD4+ T cells from old mice, which manifested as impaired T cell diapedesis at high endothelial venules and reduced cell motility within DLN prior to antigen encounter. Furthermore, leukocyte accumulation in the DLN within the first few days of WNV infection or antigen-adjuvant administration was diminished more generally in old mice and associated with a second aging-related defect in local cytokine and chemokine production. Thus, age-dependent cell-intrinsic and environmental defects in the DLN result in delayed immune cell recruitment and antigen recognition. These deficits compromise priming of early adaptive immune responses and likely contribute to the susceptibility of old animals to acute WNV infection.

  16. Impaired immunity in harbour seals [Phoca vitulina] fed environmentally contaminated herring.

    PubMed

    de Swart, R L; Ross, P S; Vos, J G; Osterhaus, A D

    1996-01-01

    In recent years, mass mortalities among seals and dolphins have been attributed to infections with different morbilliviruses. In all cases, these marine top predators were exposed to high levels of persistent lipophilic environmental contaminants accumulated through the food chain. This observation led to the hypothesis that a contaminant-related suppression of the immune system might have contributed to the severity of the virus outbreaks. We conducted a semi-field feeding experiment, in which we fed two groups of harbour seals (Phoca vitulina) fish with different levels of contaminants. During a period of 2 1/2 years, blood samples were taken at regular intervals, and the functioning of different compartments of the immune system was monitored and compared. We found impaired natural killer (NK) and specific T cell responses in the seals fed contaminated fish. This is the first demonstration of immunosuppression in mammals following chronic exposure to environmental contaminants at ambient environmental levels.

  17. Immune responses and the emergence of drug-resistant virus strains in vivo.

    PubMed Central

    Wodarz, Dominik; Lloyd, Alun L.

    2004-01-01

    The treatment of viral infections using antiviral drugs has had a significant public health benefit in the setting of human immunodeficiency virus (HIV) infection, and newly developed drugs offer potential benefits in the management of other viral infections, including acute self-limiting infections such as influenza and picornaviruses (including the rhinoviruses that are responsible for a large proportion of 'common colds'). A serious concern with such treatments is that they may lead to the selection of drug-resistant strains. This has been a significant problem in the case of HIV infection. Existing mathematical-modelling studies of drug resistance have focused on the interactions between virus, target cells and infected cells, ignoring the impact of immune responses. Here, we present a model that explores the role of immune responses in the rise of drug-resistant mutants in vivo. We find that drug resistance is unlikely to be a problem if immune responses are maintained above a threshold level during therapy. Alternatively, if immune responses decline at a fast rate and fall below a threshold level during treatment (indicating impaired immunity), the rise of drug-resistant mutants is more likely. This indicates an important difference between HIV, which impairs immunity and for which immune responses have been observed to vanish during treatment, and viral infections such as influenza and rhinoviruses, for which such immune impairment is not present. Drug resistance is much more likely to be a problem in HIV than in acute and self-limiting infections. PMID:15306358

  18. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.

    PubMed

    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna

    2014-01-01

    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  19. Bacterial vaginosis and the cervicovaginal immune response

    PubMed Central

    Mitchell, Caroline; Marrazzo, Jeanne

    2014-01-01

    Bacterial vaginosis (BV) is a common cause of vaginal discharge in reproductive age women around the world, and is associated with several poor reproductive health outcomes, including HIV-1 acquisition. One possible mechanism for this association is the inflammatory immune response induced by BV in the cervical and vaginal mucosae. There is significant heterogeneity in reports of markers of cervicovaginal inflammation in women with bacterial vaginosis, likely due to microbial and host diversity, as well as differences in study design. In this article we review the characteristics of the mucosal immune response in BV, the potential role of lactobacilli in modulating that response, and the impact of individual BV-associated bacterial species on mucosal immunity. We focus on inflammatory markers that are proposed to increase the risk of HIV-1 acquisition. PMID:24832618

  20. Immune responses after live attenuated influenza vaccination.

    PubMed

    Mohn, Kristin G-I; Smith, Ingrid; Sjursen, Haakon; Cox, Rebecca

    2017-09-21

    Since 2003 (US) and 2012 (Europe) the live attenuated influenza vaccine (LAIV) has been used as an alternative to the traditional inactivated influenza vaccines (IIV). The immune responses elicted by LAIV mimic natural infection and have been found to provide broader clinical protection in children compared to the IIVs. However, our knowledge of the detailed immunological mechanisims induced by LAIV remain to be fully elucidated, and despite 14 years on the global market, there exists no correlate of protection. Recently, matters are further complicated by differing efficacy data from the US and Europe which are not understood. Better understanding of the immune responses after LAIV may aid in achieving the ultimate goal of a future "universal influenza vaccine". In this review we aim to cover the current understanding of the immune responses induced after LAIV.

  1. Radiation triggering immune response and inflammation.

    PubMed

    Hekim, Nezih; Cetin, Zafer; Nikitaki, Zacharenia; Cort, Aysegul; Saygili, Eyup Ilker

    2015-11-28

    Radiation therapy (RT) is a well-established but still under optimization branch of Cancer Therapy (CT). RT uses electromagnetic waves or charged particles in order to kill malignant cells, by accumulating the energy onto these cells. The issue at stake for RT, as well as for any other Cancer Therapy technique, is always to kill only cancer cells, without affecting the surrounding healthy ones. This perspective of CT is usually described under the terms "specificity" and "selectivity". Specificity and selectivity are the ideal goal, but the ideal is never entirely achieved. Thus, in addition to killing healthy cells, changes and effects are observed in the immune system after irradiation. In this review, we mainly focus on the effects of ionizing radiation on the immune system and its components like bone marrow. Additionally, we are interested in the effects and benefits of low-dose ionizing radiation on the hematopoiesis and immune response. Low dose radiation has been shown to induce biological responses like inflammatory responses, innate immune system activation and DNA repair (adaptive response). This review reveals the fact that there are many unanswered questions regarding the role of radiation as either an immune-activating (low dose) or immunosuppressive (high dose) agent.

  2. Trichinella spiralis: shaping the immune response.

    PubMed

    Ilic, Natasa; Gruden-Movsesijan, Alisa; Sofronic-Milosavljevic, Ljiljana

    2012-04-01

    The co-evolution of a wide range of helminth parasites and vertebrates represented a constant pressure on the host's immune system and a selective force for shaping the immune response. Modulation of the immune system by parasites is accomplished partly by dendritic cells. When exposed to helminth parasites or their products, dendritic cells do not become classically mature and are potent inducers of Th2 and regulatory responses. Treating animals with helminths (eggs, larvae, extracts) causes dampening or in some cases prevention of allergic or autoimmune diseases. Trichinella spiralis (T. spiralis) possess a capacity to retune the immune cell repertoire, acting as a moderator of the host response not only to itself but also to third party antigens. In this review, we will focus on the ability of T. spiralis-stimulated dendritic cells to polarize the immune response toward Th2 and regulatory mode in vitro and in vivo and also on the capacity of this parasite to modulate autoimmune disease--such as experimental autoimmune encephalomyelitis.

  3. Injury-induced immune responses in Hydra.

    PubMed

    Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte

    2014-08-01

    The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights

  4. Damage signals in the insect immune response

    PubMed Central

    Krautz, Robert; Arefin, Badrul; Theopold, Ulrich

    2014-01-01

    Insects and mammals share an ancient innate immune system comprising both humoral and cellular responses. The insect immune system consists of the fat body, which secretes effector molecules into the hemolymph and several classes of hemocytes, which reside in the hemolymph and of protective border epithelia. Key features of wound- and immune responses are shared between insect and mammalian immune systems including the mode of activation by commonly shared microbial (non-self) patterns and the recognition of these patterns by dedicated receptors. It is unclear how metazoan parasites in insects, which lack these shared motifs, are recognized. Research in recent years has demonstrated that during entry into the insect host, many eukaryotic pathogens leave traces that alert potential hosts of the damage they have afflicted. In accordance with terminology used in the mammalian immune systems, these signals have been dubbed danger- or damage-associated signals. Damage signals are necessary byproducts generated during entering hosts either by mechanical or proteolytic damage. Here, we briefly review the current stage of knowledge on how wound closure and wound healing during mechanical damage is regulated and how damage-related signals contribute to these processes. We also discuss how sensors of proteolytic activity induce insect innate immune responses. Strikingly damage-associated signals are also released from cells that have aberrant growth, including tumor cells. These signals may induce apoptosis in the damaged cells, the recruitment of immune cells to the aberrant tissue and even activate humoral responses. Thus, this ensures the removal of aberrant cells and compensatory proliferation to replace lost tissue. Several of these pathways may have been co-opted from wound healing and developmental processes. PMID:25071815

  5. Immune Response in Human Cerebral Cavernous Malformations

    PubMed Central

    Shi, Changbin; Shenkar, Robert; Du, Hongyan; Duckworth, Edward; Raja, Harish; Batjer, H. Hunt; Awad, Issam A.

    2009-01-01

    Background and Purpose Preliminary observations suggesting the presence of B and plasma cells and oligoclonality of immunoglobulin (Ig) G in cerebral cavernous malformations (CCMs) have motivated a systematic study correlating the infiltration of the immune cells with clinical activity and antigen-triggered immune response in surgically excised lesions. Methods Infiltration of plasma, B, T and HLA-DR expressing cells and macrophages within 23 excised CCMs was related to clinical activity. Relative amounts of Ig isotypes were determined. IgG clonality of mRNA from CCMs was assessed by spectratyping, cloning and sequencing. Results Infiltration of the immune cells ranged widely within CCM lesions and cells were generally co-expressed with each other. Immune cell infiltration did not associate with recent bleeding and lesion growth. Significantly more B lymphocytes in CCM lesions were associated with venous anomaly. More T cells were present in solitary lesions. More T cells and less macrophages were present in CCMs from younger subjects. IgG isotype was present in all CCM lesions. Most lesions also expressed IgM and IgA, with IgM predominance over IgA correlating with recent CCM growth. Oligoclonality was shown in IgG mRNA from CCMs, but not from peripheral blood lymphocytes, with only eight CDR3 sequences observed among 134 clones from two CCM lesions. Conclusions An antigen-directed oligoclonal IgG immune response is present within CCM lesions regardless of recent clinical activity. Apparent differences in immune response in younger patients and in lesions with recent growth will need confirmation in other series. The pathogenicity of oligoclonal immune response will require systematic hypothesis testing in recently available CCM murine models. PMID:19286587

  6. Immune Responses in Parasitic Diseases.

    DTIC Science & Technology

    1982-09-01

    prepared in pure form so that quantitative radial immunodiffusion studies are feasible. The IgGl response to T. rhodesiense infection in the rat has been...sera of infected animals and definitely-separate and quantitate the 19S from 8S species by combining radial immunodiffusion techniques and sucrose

  7. Immune response inhibits associative learning in insects.

    PubMed Central

    Mallon, Eamonn B; Brockmann, Axel; Schmid-Hempel, Paul

    2003-01-01

    In vertebrates, it is well established that there are many intricate interactions between the immune system and the nervous system, and vice versa. Regarding insects, until now little has been known about the link between these two systems. Here, we present behavioural evidence indicating a link between the immune system and the nervous system in insects. We show that otherwise non-infected honeybees whose immune systems are challenged by a non-pathogenic immunogenic elicitor lipopolysaccharide (LPS) have reduced abilities to associate an odour with sugar reward in a classical conditioning paradigm. The cost of an immune response therefore not only affects survival of the host, as previously shown, but also everyday behaviour and memory formation. PMID:14667337

  8. A nonequilibrium phase transition in immune response

    NASA Astrophysics Data System (ADS)

    Zhang, Wei; Qi, An-Shen

    2004-07-01

    The dynamics of immune response correlated to signal transduction in immune thymic cells (T cells) is studied. In particular, the problem of the phosphorylation of the immune-receptor tyrosine-based activation motifs (ITAM) is explored. A nonlinear model is established on the basis of experimental observations. The behaviours of the model can be well analysed using the concepts of nonequilibrium phase transitions. In addition, the Riemann-Hugoniot cusp catastrophe is demonstrated by the model. Due to the application of the theory of nonequilibrium phase transitions, the biological phenomena can be clarified more precisely. The results can also be used to further explain the signal transduction and signal discrimination of an important type of immune T cell.

  9. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology

    1986-08-01

    D-Ai8i 71S UMAN IMMUNE RESPONSES TO DENGUE VIRUSES(U) MASSACHUSETTS UNIV M DICAL CENTER WORCESTER MA F A ENNIS 81 AUG 86 DAD17-82-C-2233 UNCLSE...Classification) (U) Human Immune Responses to Dengue Viruses 12. PERSONAL AUTHOR(S) Ennis. Francis A. 13a. TYPE OF REPORT 13b. TIME COVERED 414. DATE OF...Continue on reverse if necessary and identify by block number) FIELD GROUP SUB-GROUP06 13 Virus; Dengue ; Arbovirus; Immunology 06 03 I9% ABSTRACT

  10. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology

    1985-08-01

    t-Ril 630 HuMAN IMMUNE RESPONSES TO DENGUE VIRUSES(U) 1 - MASSACHUSETTS UNIV MEDICAL SCHOOL WORCESTER F A ENNIS 01 AUGO 95 DAMDI-2-C-2233 UNCASSIFIED...Classification) (U) Human Immune Responses to Dengue Viruses 12. PERSONAL AUTHOR(S) Ennis, Francis A. 13a. TYPE OF REPORT 13b. TIME COVERED 14. DATE OF...on reverse if necessary and identify by block number) FIELD GROUP SUB-GROUP06 13 Virus; Dengue ; Arbovirus; Immunology 06 13 19. ABSTRACT (Continue on

  11. Human Immune Response to Dengue Infections.

    DTIC Science & Technology

    1991-06-30

    DTIC AD-A240 717 AD ____ HUMAN IMMUNE RESPONSE TO DENGUE INFECTIONS ANNUAL REPORT FRANCIS A. ENNIS JUNE 30, 1991 Supported by U.S. ARMY MEDICAL...Immune Response to Dengue Infections DAMDI7-86-C-6208 6. AUTHOR(S) 61102A 1 3M161102BS13 AA Francis A. Ennis WUDA3 12059 7. PERFORMING ORGANIZATION...of NS3, respectively. We also established 16 dengue virus-specific CD8+ CD4_ T cell clones. The clone #/2.8 recognize dengue virus types 2 and 4, and

  12. Regulation of immune responses by L-arginine metabolism.

    PubMed

    Bronte, Vincenzo; Zanovello, Paola

    2005-08-01

    L-Arginine is an essential amino acid for birds and young mammals, and it is a conditionally essential amino acid for adult mammals, as it is important in situations in which requirements exceed production, such as pregnancy. Recent findings indicate that increased metabolism of L-arginine by myeloid cells can result in the impairment of lymphocyte responses to antigen during immune responses and tumour growth. Two enzymes that compete for L-arginine as a substrate - arginase and nitric-oxide synthase - are crucial components of this lymphocyte-suppression pathway, and the metabolic products of these enzymes are important moderators of T-cell function. This Review article focuses on the relevance of L-arginine metabolism by myeloid cells for immunity under physiological and pathological conditions.

  13. Immune response from a resource allocation perspective

    PubMed Central

    Rauw, Wendy M.

    2012-01-01

    The immune system is a life history trait that can be expected to trade off against other life history traits. Whether or not a trait is considered to be a life history trait has consequences for the expectation on how it responds to natural selection and evolution; in addition, it may have consequences for the outcome of artificial selection when it is included in the breeding objective. The immune system involved in pathogen resistance comprises multiple mechanisms that define a host's defensive capacity. Immune resistance involves employing mechanisms that either prevent pathogens from invading or eliminate the pathogens when they do invade. On the other hand, tolerance involves limiting the damage that is caused by the infection. Both tolerance and resistance traits require (re)allocation of resources and carry physiological costs. Examples of trade-offs between immune function and growth, reproduction and stress response are provided in this review, in addition to consequences of selection for increased production on immune function and vice versa. Reaction norms are used to deal with questions of immune resistance vs. tolerance to pathogens that relate host health to infection intensity. In essence, selection for immune tolerance in livestock is a particular case of selection for animal robustness. Since breeding goals that include robustness traits are required in the implementation of more sustainable agricultural production systems, it is of interest to investigate whether immune tolerance is a robustness trait that is positively correlated with overall animal robustness. Considerably more research is needed to estimate the shapes of the cost functions of different immune strategies, and investigate trade-offs and cross-over benefits of selection for disease resistance and/or disease tolerance in livestock production. PMID:23413205

  14. The Innate Immune Response Against Staphylococcus aureus.

    PubMed

    Bekeredjian-Ding, Isabelle; Stein, Christoph; Uebele, Julia

    2015-12-15

    The innate immune system harbors a multitude of different receptor systems and cells that are constantly prepared to sense and eliminate invading microbial pathogens. Staphylococcus aureus enters the body on its exposed epithelial surfaces, e.g., on skin and mucosa. The initial interaction with epithelial cells is governed by Toll-like receptor (TLR)-2-mediated local production of soluble mediators, including cytokines, chemokines, and antimicrobial peptides. The overall goal is to achieve a steady state of immune mediators and colonizing bacteria. Following cell and tissue invasion clearance of bacteria depends on intracellular microbial sensors and subsequent activation of the inflammasomes. Tissue-resident mast cells and macrophages recruit neutrophils, macrophages, and NK cells. This inflammatory response supports the generation of IL-17 producing NKT, γδ T cells, and T helper cells. Local dendritic cells migrate to the lymph nodes and fine-tune the adaptive immune response. The scope of this chapter is to provide an overview on the major cell types and receptors involved in innate immune defense against S. aureus. By segregating the different stages of infection from epithelial barrier to intracellular and systemic infection, this chapter highlights the different qualities of the innate immune response to S. aureus at different stages of invasiveness.

  15. IMMUNODEFICIENCIES. Impairment of immunity to Candida and Mycobacterium in humans with bi-allelic RORC mutations.

    PubMed

    Okada, Satoshi; Markle, Janet G; Deenick, Elissa K; Mele, Federico; Averbuch, Dina; Lagos, Macarena; Alzahrani, Mohammed; Al-Muhsen, Saleh; Halwani, Rabih; Ma, Cindy S; Wong, Natalie; Soudais, Claire; Henderson, Lauren A; Marzouqa, Hiyam; Shamma, Jamal; Gonzalez, Marcela; Martinez-Barricarte, Rubén; Okada, Chizuru; Avery, Danielle T; Latorre, Daniela; Deswarte, Caroline; Jabot-Hanin, Fabienne; Torrado, Egidio; Fountain, Jeffrey; Belkadi, Aziz; Itan, Yuval; Boisson, Bertrand; Migaud, Mélanie; Arlehamn, Cecilia S Lindestam; Sette, Alessandro; Breton, Sylvain; McCluskey, James; Rossjohn, Jamie; de Villartay, Jean-Pierre; Moshous, Despina; Hambleton, Sophie; Latour, Sylvain; Arkwright, Peter D; Picard, Capucine; Lantz, Olivier; Engelhard, Dan; Kobayashi, Masao; Abel, Laurent; Cooper, Andrea M; Notarangelo, Luigi D; Boisson-Dupuis, Stéphanie; Puel, Anne; Sallusto, Federica; Bustamante, Jacinta; Tangye, Stuart G; Casanova, Jean-Laurent

    2015-08-07

    Human inborn errors of immunity mediated by the cytokines interleukin-17A and interleukin-17F (IL-17A/F) underlie mucocutaneous candidiasis, whereas inborn errors of interferon-γ (IFN-γ) immunity underlie mycobacterial disease. We report the discovery of bi-allelic RORC loss-of-function mutations in seven individuals from three kindreds of different ethnic origins with both candidiasis and mycobacteriosis. The lack of functional RORγ and RORγT isoforms resulted in the absence of IL-17A/F-producing T cells in these individuals, probably accounting for their chronic candidiasis. Unexpectedly, leukocytes from RORγ- and RORγT-deficient individuals also displayed an impaired IFN-γ response to Mycobacterium. This principally reflected profoundly defective IFN-γ production by circulating γδ T cells and CD4(+)CCR6(+)CXCR3(+) αβ T cells. In humans, both mucocutaneous immunity to Candida and systemic immunity to Mycobacterium require RORγ, RORγT, or both.

  16. Peroxiredoxin 5 modulates immune response in Drosophila

    PubMed Central

    Radyuk, Svetlana N.; Michalak, Katarzyna; Klichko, Vladimir I.; Benes, Judith; Orr, William C.

    2010-01-01

    Background Peroxiredoxins are redox-sensing enzymes with multiple cellular functions. Previously, we reported on the potent antioxidant function of Drosophila peroxiredoxin 5 (dPrx5). Studies with mammalian and human cells suggest that peroxiredoxins can modulate immune-related signaling. Methods Survivorship studies and bacteriological analysis were used to determine resistance of flies to fungal and bacterial infections. RT-PCR and immunoblot analyses determined expression of dPrx5 and immunity factors in response to bacterial challenge. Double mutants for dprx5 gene and genes comprising the Imd/Relish and dTak1/Basket branches of the immune signaling pathways were used in epistatic analysis. Results The dprx5 mutant flies were more resistant to bacterial infection than controls, while flies overexpressing dPrx5 were more susceptible. The enhanced resistance to bacteria was accompanied by rapid induction of the Imd-dependent antimicrobial peptides, phosphorylation of the JNK kinase Basket and altered transcriptional profiling of the transient response genes, puckered, ets21C and relish, while the opposite effects were observed in flies over-expressing dPrx5. Epistatic analysis of double mutants, using attacin D and Puckered as read outs of activation of the Imd and JNK pathways, implicated dPrx5 function in the control of the dTak1-JNK arm of immune signaling. Conclusions Differential effects on fly survivorship suggested a trade-off between the antioxidant and immune functions of dPrx5. Molecular and epistatic analyses identified dPrx5 as a negative regulator in the dTak1-JNK arm of immune signaling. General significance Our findings suggest that peroxiredoxins play an important modulatory role in the Drosophila immune response. PMID:20600624

  17. Adaptive immune responses to Candida albicans infection

    PubMed Central

    Richardson, Jonathan P; Moyes, David L

    2015-01-01

    Fungal infections are becoming increasingly prevalent in the human population and contribute to morbidity and mortality in healthy and immunocompromised individuals respectively. Candida albicans is the most commonly encountered fungal pathogen of humans, and is frequently found on the mucosal surfaces of the body. Host defense against C. albicans is dependent upon a finely tuned implementation of innate and adaptive immune responses, enabling the host to neutralise the invading fungus. Central to this protection are the adaptive Th1 and Th17 cellular responses, which are considered paramount to successful immune defense against C. albicans infections, and enable tissue homeostasis to be maintained in the presence of colonising fungi. This review will highlight the recent advances in our understanding of adaptive immunity to Candida albicans infections. PMID:25607781

  18. Temozolomide does not impair gene therapy-mediated antitumor immunity in syngeneic brain tumor models

    PubMed Central

    Wibowo, Mia; Ahlzadeh, Gabrielle E; Puntel, Mariana; Ghiasi, Homayon; Kamran, Neha; Paran, Christopher; Lowenstein, Pedro R; Castro, Maria G

    2014-01-01

    Purpose Glioblastoma multiforme (GBM) is the most common primary brain cancer in adults. Chemotherapy with temozolomide (TMZ) significantly prolongs the survival of GBM patients. However, the 3-year survival is still ~5%. Herein we combined intratumoral administration of an adenoviral vector expressing Flt3L (Ad-Flt3L) with systemic TMZ in order to assess its impact on therapeutic efficacy. Experimental Design Wild type or immunodeficient mice bearing intracranial GBM or metastatic melanoma were treated with an intratumoral injection of Ad-Flt3L alone or in combination with the conditionally cytotoxic enzyme thymidine kinase (Ad-TK), followed by systemic administration of ganciclovir and TMZ. We monitored survival and measured the tumor-infiltrating immune cells. Results While treatment with TMZ alone led to a small improvement in median survival, when used in combination with gene therapy-mediated immunotherapy it significantly increased the survival of tumor-bearing mice. The anti-tumor effect was further enhanced by concomitant intratumoral administration of Ad-TK, leading to 50–70% long-term survival in all tumor models. Although TMZ reduced the content of T cells in the tumor, this did not affect the therapeutic efficacy. The anti-tumor effect of Ad-Flt3L+Ad-TK+TMZ required an intact immune system, since the treatment failed when administered to KO mice that lacked lymphocytes or dendritic cells. Conclusions Our results challenge the notion that chemotherapy leads to a state of immune-suppression which impairs the ability of the immune system to mount an effective anti-tumor response. Our work indicates that TMZ does not inhibit antitumor immunity and supports its clinical implementation in combination with immune-mediated therapies. PMID:24501391

  19. Abnormal immune responses of Bloom's syndrome lymphocytes in vitro.

    PubMed Central

    Hütteroth, T H; Litwin, S D; German, J

    1975-01-01

    Bloom's syndrome is a rare autosmal recessive disorder, first characterized by growth retardation and asum-sensitive facial telangiectasia and more recently demonstarted to have increased chromosome instability, a predisposition to malignancy, and increased susecptibitily to infection. The present report ocncern the immune function of Bloom's syndrom lymphoctes in vitro. Four affected homozgotes and five heterozygotes were studied. An abnormal serum concentartion of at least one class of immunoglobin was present in three out of four homozgotes. Affected homozgotes were shown capable of both a humoral and cellular response after antigenic challenge, the responses in general being weak but detectable. Blood lymphocytes from Bloom's syndrome individuals were cultured in impaired proliferavite response and synthesized less immunoglobulin at the end of 5 days than did normal controls. In contrast, they had a normal proliferative response to phytohemagglutinin except at highest concentrations of the mitogen. In the mixed lymphocte culture, Bloom's syndrome lymphocytes proved to be poor responder cells but normal stimulator cells. Lmyphoctes from the heterozgotes produced normal responses in these three systems. Distrubed immunity appears to be on of several major consequences of homozygosity for the Bloom's syndrome gene. Although the explanation for this pleiotropism is at present obscure, the idea was advanced that the aberrant immune function is, along with the major clincial feature-small body size, amanifestation of defect in cellular proliferation. PMID:124745

  20. Immune Response in Mussels To Environmental Pollution.

    ERIC Educational Resources Information Center

    Pryor, Stephen C.; Facher, Evan

    1997-01-01

    Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)

  1. [Modulation of immune response by bacterial lipopolysaccharides].

    PubMed

    Aldapa-Vega, Gustavo; Pastelín-Palacios, Rodolfo; Isibasi, Armando; Moreno-Eutimio, Mario A; López-Macías, Constantino

    2016-01-01

    Lipopolysaccharide (LPS) is a molecule that is profusely found on the outer membrane of Gram-negative bacteria and is also a potent stimulator of the immune response. As the main molecule on the bacterial surface, is also the most biologically active. The immune response of the host is activated by the recognition of LPS through Toll-like receptor 4 (TLR4) and this receptor-ligand interaction is closely linked to LPS structure. Microorganisms have evolved systems to control the expression and structure of LPS, producing structural variants that are used for modulating the host immune responses during infection. Examples of this include Helicobacter pylori, Francisella tularensis, Chlamydia trachomatis and Salmonella spp. High concentrations of LPS can cause fever, increased heart rate and lead to septic shock and death. However, at relatively low concentrations some LPS are highly active immunomodulators, which can induce non-specific resistance to invading microorganisms. The elucidation of the molecular and cellular mechanisms involved in the recognition of LPS and its structural variants has been fundamental to understand inflammation and is currently a pivotal field of research to understand the innate immune response, inflammation, the complex host-pathogen relationship and has important implications for the rational development of new immunomodulators and adjuvants.

  2. Adaptive immune cells temper initial innate responses.

    PubMed

    Kim, Kwang Dong; Zhao, Jie; Auh, Sogyong; Yang, Xuanming; Du, Peishuang; Tang, Hong; Fu, Yang-Xin

    2007-10-01

    Toll-like receptors (TLRs) recognize conserved microbial structures called pathogen-associated molecular patterns. Signaling from TLRs leads to upregulation of co-stimulatory molecules for better priming of T cells and secretion of inflammatory cytokines by innate immune cells. Lymphocyte-deficient hosts often die of acute infection, presumably owing to their lack of an adaptive immune response to effectively clear pathogens. However, we show here that an unleashed innate immune response due to the absence of residential T cells can also be a direct cause of death. Viral infection or administration of poly(I:C), a ligand for TLR3, led to cytokine storm in T-cell- or lymphocyte-deficient mice in a fashion dependent on NK cells and tumor necrosis factor. We have further shown, through the depletion of CD4+ and CD8+ cells in wild-type mice and the transfer of T lymphocytes into Rag-1-deficient mice, respectively, that T cells are both necessary and sufficient to temper the early innate response. In addition to the effects of natural regulatory T cells, close contact of resting CD4+CD25-Foxp3- or CD8+ T cells with innate cells could also suppress the cytokine surge by various innate cells in an antigen-independent fashion. Therefore, adaptive immune cells have an unexpected role in tempering initial innate responses.

  3. Adaptive immune cells temper initial innate responses

    PubMed Central

    Kim, Kwang Dong; Zhao, Jie; Auh, Sogyong; Yang, Xuanming; Du, Peishuang; Tang, Hong; Fu, Yang-Xin

    2008-01-01

    Toll-like receptors (TLRs) recognize conserved microbial structures called pathogen-associated molecular patterns. Signaling from TLRs leads to upregulation of co-stimulatory molecules for better priming of T cells and secretion of inflammatory cytokines by innate immune cells1–4. Lymphocytedeficient hosts often die of acute infection, presumably owing to their lack of an adaptive immune response to effectively clear pathogens. However, we show here that an unleashed innate immune response due to the absence of residential T cells can also be a direct cause of death. Viral infection or administration of poly(I:C), a ligand for TLR3, led to cytokine storm in T-cell- or lymphocyte-deficient mice in a fashion dependent on NK cells and tumor necrosis factor. We have further shown, through the depletion of CD4+ and CD8+ cells in wild-type mice and the transfer of T lymphocytes into Rag-1–deficient mice, respectively, that T cells are both necessary and sufficient to temper the early innate response. In addition to the effects of natural regulatory T cells, close contact of resting CD4+CD25−Foxp3− or CD8+ T cells with innate cells could also suppress the cytokine surge by various innate cells in an antigen-independent fashion. Therefore, adaptive immune cells have an unexpected role in tempering initial innate responses. PMID:17891146

  4. Immune Response in Mussels To Environmental Pollution.

    ERIC Educational Resources Information Center

    Pryor, Stephen C.; Facher, Evan

    1997-01-01

    Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)

  5. [Immune response genes products in human physiology].

    PubMed

    Khaitov, R M; Alekseev, L P

    2012-09-01

    Current data on physiological role of human immune response genes' proteomic products (antigens) are discussed. The antigens are specified by a very high level of diversity that mediates a wide specter ofphysiological functions. They actually provide integrity and biological stability of human as species. These data reveal new ideas on many pathological processes as well as drafts new approaches for prophylaxis and treatment.

  6. Innate immune responses to hepatitis C virus.

    PubMed

    Schoggins, John W; Rice, Charles M

    2013-01-01

    The innate immune response provides the first line of defense against invading viral pathogens. Incoming viruses are sensed by dedicated host factors that, when triggered, initiate multiple signal transduction pathways. Activation of these pathways leads to the induction of highly orchestrated transcriptional programs designed to limit virus replication and spread. In recent years, our understanding of innate immune responses targeting hepatitis C virus (HCV) has increased substantially, largely due to the development of new systems and methodologies to study HCV-host interactions in vitro and in vivo. However, significant gaps still remain. Here, we aim to provide a comprehensive view of the innate immune response to HCV, focusing primarily on knowledge gained from cell culture models of HCV infection, as well as data from human patients infected with HCV. While some paradigms of the host response to HCV revealed in cell culture translate to human infection in vivo, others are less clear. Further insight into the similarities and differences in these systems will not only reveal directions for future studies on HCV immunity, but may also guide the development of novel strategies to control HCV and other viral infections.

  7. Myeloid PTEN deficiency impairs tumor-immune surveillance via immune-checkpoint inhibition

    PubMed Central

    Kuttke, M.; Sahin, E.; Pisoni, J.; Percig, S.; Vogel, A.; Kraemmer, D.; Hanzl, L.; Brunner, J. S.; Paar, H.; Soukup, K.; Halfmann, A.; Dohnal, A. M.; Steiner, C. W.; Blüml, S.; Basilio, J.; Hochreiter, B.; Salzmann, M.; Hoesel, B.; Lametschwandtner, G.; Eferl, R.; Schmid, J. A.; Schabbauer, G.

    2016-01-01

    ABSTRACT Tumor–host interaction is determined by constant immune surveillance, characterized by tumor infiltration of myeloid and lymphoid cells. A malfunctioning or diverted immune response promotes tumor growth and metastasis. Recent advances had been made, by treating of certain tumor types, such as melanoma, with T-cell checkpoint inhibitors. This highlights the importance of understanding the molecular mechanisms underlying the crosstalk between tumors and their environment, in particular myeloid and lymphoid cells. Our aim was to study the contribution of the myeloid PI3K/PTEN-signaling pathway in the regulation of tumor-immune surveillance in murine models of cancer. We made use of conditional PTEN-deficient mice, which exhibit sustained activation of the PI3K-signaling axis in a variety of myeloid cell subsets such as macrophages and dendritic cells (DCs). In colitis-associated colon cancer (CAC), mice deficient in myeloid PTEN showed a markedly higher tumor burden and decreased survival. We attributed this observation to the increased presence of immune-modulatory conventional CD8α+ DCs in the spleen, whereas other relevant myeloid cell subsets were largely unaffected. Notably, we detected enhanced surface expression of PD-L1 and PD-L2 on these DCs. As a consequence, tumoricidal T-cell responses were hampered or redirected. Taken together, our findings indicated an unanticipated role for the PI3K/PTEN-signaling axis in the functional regulation of splenic antigen-presenting cells (APCs). Our data pointed at potential, indirect, tumoricidal effects of subclass-specific PI3K inhibitors, which are currently under clinical investigation for treatment of tumors, via myeloid cell activation. PMID:27622019

  8. Innate Immune Sensing and Response to Influenza

    PubMed Central

    Pulendran, Bali; Maddur, Mohan S.

    2015-01-01

    Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocom-promised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza. PMID:25078919

  9. Humoral Immune Response to AAV.

    PubMed

    Calcedo, Roberto; Wilson, James M

    2013-10-18

    Adeno-associated virus (AAV) is a member of the family Parvoviridae that has been widely used as a vector for gene therapy because of its safety profile, its ability to transduce both dividing and non-dividing cells, and its low immunogenicity. AAV has been detected in many different tissues of several animal species but has not been associated with any disease. As a result of natural infections, antibodies to AAV can be found in many animals including humans. It has been shown that pre-existing AAV antibodies can modulate the safety and efficacy of AAV vector-mediated gene therapy by blocking vector transduction or by redirecting distribution of AAV vectors to tissues other than the target organ. This review will summarize antibody responses against natural AAV infections, as well as AAV gene therapy vectors and their impact in the clinical development of AAV vectors for gene therapy. We will also review and discuss the various methods used for AAV antibody detection and strategies to overcome neutralizing antibodies in AAV-mediated gene therapy.

  10. Pulmonary contusion primes systemic innate immunity responses.

    PubMed

    Hoth, J Jason; Martin, R S; Yoza, Barbara K; Wells, Jonathan D; Meredith, J W; McCall, Charles E

    2009-07-01

    Traumatic injury may result in an exaggerated response to subsequent immune stimuli such as nosocomial infection. This "second hit" phenomenon and molecular mechanism(s) of immune priming by traumatic lung injury, specifically, pulmonary contusion, remain unknown. We used an animal model of pulmonary contusion to determine whether the injury resulted in priming of the innate immune response and to test the hypothesis that resuscitation fluids could attenuate the primed response to a second hit. Male, 8 to 9 weeks, C57/BL6 mice with a pulmonary contusion were challenged by a second hit of intratracheal administration of the Toll-like receptor 4 agonist, lipopolysaccharide (LPS, 50 microg) 24 hours after injury (injury + LPS). Other experimental groups were injury + vehicle or LPS alone. A separate group was injured and resuscitated by 4 cc/kg of hypertonic saline (HTS) or Lactated Ringer's (LR) resuscitation before LPS challenge. Mice were killed 4 hours after LPS challenge and blood, bronchoalveolar lavage, and tissue were isolated and analyzed. Data were analyzed using one-way analysis of variance with Bonferroni multiple comparison posttest for significant differences (*p < or = 0.05). Injury + LPS showed immune priming observed by lung injury histology and increased bronchoalveolar lavage neutrophilia, lung myeloperoxidase and serum IL-6, CXCL1, and MIP-2 levels when compared with injury + vehicle or LPS alone. After injury, resuscitation with HTS, but not Lactated Ringer's was more effective in attenuating the primed response to a second hit. Pulmonary contusion primes innate immunity for an exaggerated response to a second hit with the Toll-like receptor 4 agonist, LPS. We observed synergistic increases in inflammatory mediator expression in the blood and a more severe lung injury in injured animals challenged with LPS. This priming effect was reduced when HTS was used to resuscitate the animal after lung contusion.

  11. Pulmonary contusion primes systemic innate immunity responses

    PubMed Central

    Hoth, JJ; Martin, RS; Yoza, BK; Wells, JD; Meredith, JW; McCall, CE

    2010-01-01

    Introduction Traumatic injury may result in an exaggerated response to subsequent immune stimuli such as nosocomial infection. This “second hit” phenomenon, and molecular mechanism(s) of immune priming by traumatic lung injury, specifically pulmonary contusion, remains unknown. We used an animal model of pulmonary contusion to determine if the injury resulted in priming of the innate immune response and to test the hypothesis that resuscitation fluids could attenuate the primed response to a second hit. Methods Male, 8-9 wk, C57/BL6 mice with a pulmonary contusion were challenged by a second hit of intratracheal administration of the Toll like receptor (TLR) 4 agonist, lipopolysaccharide (LPS, 50mcg) 24hrs after injury (injury+LPS). Other experimental groups were injury+vehicle or LPS alone. A separate group were injured and resuscitated by 4cc/kg of hypertonic saline (HTS) or Lactated Ringer's (LR) resuscitation prior to LPS challenge. Mice were euthanized 4hrs after LPS challenge and blood, bronchoalveolar lavage (BAL), and tissue were isolated and analyzed. Data were analyzed using one way ANOVA with Bonferroni multiple comparison post-test for significant differences (*, p≤0.05). Results Injury+LPS showed immune priming observed by lung injury histology and increased BAL neutrophilia, lung myeloperoxidase, and serum IL-6, CXCL1 and MIP-2 levels when compared to injury+vehicle or LPS alone. After injury, resuscitation with HTS, but not LR was more effective in attenuating the primed response to a second hit. Conclusion Pulmonary contusion primes innate immunity for an exaggerated response to a second hit with the TLR4 agonist, LPS. We observed synergistic increases in inflammatory mediator expression in the blood and a more severe lung injury in injured animals challenged with LPS. This priming effect was reduced when HTS was used to resuscitate the animal after lung contusion. PMID:19590302

  12. Humoral immune responses in foetal sheep.

    PubMed Central

    Fahey, K J; Morris, B

    1978-01-01

    A total of fifty-two foetal sheep between 49 and 126 days gestation were injected with polymeric and monomeric flagellin, dinitrophenylated monomeric flagellin, chicken red blood cells, ovalbumin, ferritin, chicken gamma-globulin and the somatic antigens of Salmonella typhimurium in a variety of combinations. Immune responses were followed in these animals by taking serial blood samples from them through indwelling vascular cannulae and measuring the circulating titres of antibody. Of the antigens tested, ferritin induced immune responses in the youngest foetuses. A short time later in gestation, the majority of foetuses responded to chicken red blood cells, polymeric flagellin, monomeric flagellin and dinitrophenylated monomeric flagellin. Only older foetuses responded regularly to chicken gamma-globulin and ovalbumin. However, antibodies to all these antigens were first detected over the relatively short period of development between 64 and 82 days gestation and this made it difficult to define any precise order in the development of immune responsiveness. Of the antigens tested only the somatic antigens of S. typhimurium failed to induce a primary antibody response during foetal life. The character and magnitude of the antibody responses in foetuses changed throughout in utero development. Both the total amount of antibody produced and the duration of the response increased with foetal age. Foetuses younger than 87 days gestation did not synthesize 2-mercaptoethanol resistant antibodies or IgG1 immunoglobulin to any of the antigens tested, whereas most foetuses older than this regularly did so. PMID:711249

  13. Acidic chitinase primes the protective immune response to gastrointestinal nematodes.

    PubMed

    Vannella, Kevin M; Ramalingam, Thirumalai R; Hart, Kevin M; de Queiroz Prado, Rafael; Sciurba, Joshua; Barron, Luke; Borthwick, Lee A; Smith, Allen D; Mentink-Kane, Margaret; White, Sandra; Thompson, Robert W; Cheever, Allen W; Bock, Kevin; Moore, Ian; Fitz, Lori J; Urban, Joseph F; Wynn, Thomas A

    2016-05-01

    Acidic mammalian chitinase (AMCase) is known to be induced by allergens and helminths, yet its role in immunity is unclear. Using AMCase-deficient mice, we show that AMCase deficiency reduced the number of group 2 innate lymphoid cells during allergen challenge but was not required for establishment of type 2 inflammation in the lung in response to allergens or helminths. In contrast, AMCase-deficient mice showed a profound defect in type 2 immunity following infection with the chitin-containing gastrointestinal nematodes Nippostrongylus brasiliensis and Heligmosomoides polygyrus bakeri. The impaired immunity was associated with reduced mucus production and decreased intestinal expression of the signature type 2 response genes Il13, Chil3, Retnlb, and Clca1. CD103(+) dendritic cells, which regulate T cell homing, were also reduced in mesenteric lymph nodes of infected AMCase-deficient mice. Thus, AMCase functions as a critical initiator of protective type 2 responses to intestinal nematodes but is largely dispensable for allergic responses in the lung.

  14. The tumor suppressor ARF regulates innate immune responses in mice.

    PubMed

    Través, Paqui G; López-Fontal, Raquel; Luque, Alfonso; Hortelano, Sonsoles

    2011-12-15

    The innate immune system is the first line of defense against invading organisms, and TLRs are the main sensors of microbial components, initiating signaling pathways that induce the production of proinflammatory cytokines and type I IFNs. An antiviral action for the tumor suppressor alternative reading frame (ARF) has been reported; however, the precise role of ARF in innate immunity is unknown. In this study, we show that ARF plays an important role in regulation of inflammatory responses. In peritoneal macrophages and bone marrow-derived macrophages from ARF-deficient animals, the induction of proinflammatory cytokines and chemokines by TLR ligands was severely impaired. The altered responses of ARF(-/-) cells to TLR ligands result from aberrant activation of intracellular signaling molecules including MAPKs, IκBα degradation, and NF-κB activation. Additionally, animals lacking ARF were resistant to LPS-induced endotoxic shock. This impaired activation of inflammation in ARF(-/-) mice was not restricted to TLRs, as it was also shown in response to non-TLR signaling pathways. Thus, ARF(-/-) mice were also unable to trigger a proper inflammatory response in experimental peritonitis or in 12-O-tetradecanoylphorbol-13-acetate-induced edema. Overexpression of ARF, but not its downstream target p53, rescued the ARF-deficient phenotype, increasing TLR4 levels and restoring inflammatory reaction. An increase in the E2F1 protein levels observed in ARF(-/-) macrophages at basal condition and after LPS stimulation may be involved in the impaired response in this system, as E2F1 has been described as an inflammatory suppressor. These results indicate that tumor suppressor ARF is a new regulator of inflammatory cell signaling.

  15. Ovine model for studying pulmonary immune responses

    SciTech Connect

    Joel, D.D.; Chanana, A.D.

    1984-11-25

    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with /sup 125/I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables.

  16. Space flight, microgravity, stress, and immune responses

    NASA Astrophysics Data System (ADS)

    Sonnenfeld, G.

    1999-01-01

    Exposure of animals and humans to space flight conditions has resulted in numerous alterations in immunological parameters. Decreases in lymphocyte blastogenesis, cytokine production, and natural killer cell activity have all been reported after space flight. Alterations in leukocyte subset distribution have also been reported after flight of humans and animals in space. The relative contribution of microgravity conditions and stress to the observed results has not been established. Antiorthostatic, hypokinetic, hypodynamic, suspension of rodents and chronic head-down tilt bed-rest of humans have been used to model effects of microgravity on immune responses. After use of these models, some effects of space flight on immune responses, such as decreases in cytokine function, were observed, but others, such as alterations in leukocyte subset distribution, were not observed. These results suggest that stresses that occur during space flight could combine with microgravity conditions in inducing the changes seen in immune responses after space flight. The biological/biomedical significance of space flight induced changes in immune parameters remains to be established.

  17. Differential temperature operation of plant immune responses

    PubMed Central

    Cheng, Cheng; Gao, Xiquan; Feng, Baomin; Sheen, Jen; Shan, Libo; He, Ping

    2014-01-01

    Temperature fluctuation is a key determinant for microbial invasion and host evasion. In contrast to mammalians that maintain constant body temperature, plant temperature oscillates on a daily basis. It remains elusive how plants operate inducible defenses in response to temperature fluctuation. Here we report that ambient temperature changes lead to pronounced shifts of two distinct plant immune responses: pattern-triggered immunity (PTI) and effector-triggered immunity (ETI). Plants preferentially activate ETI signaling at relatively low temperatures (10~23°C), whereas they switch to PTI signaling at moderately elevated temperatures (23~32°C). The Arabidopsis arp6 and hta9hta11 mutants, phenocopying plants grown at the elevated temperatures, exhibit enhanced PTI and yet reduced ETI responses. As the secretion of bacterial effectors favors low temperatures whereas bacteria multiply vigorously at elevated temperatures accompanied with increased microbe-associated molecular pattern production, our findings suggest that temperature oscillation might have driven dynamic co-evolution of distinct plant immune signaling responding to pathogen physiological changes. PMID:24067909

  18. Impaired Innate Immunity in Tlr4 −/− Mice but Preserved CD8+ T Cell Responses against Trypanosoma cruzi in Tlr4-, Tlr2-, Tlr9- or Myd88-Deficient Mice

    PubMed Central

    Tzelepis, Fanny; Klezewsky, Weberton; da Silva, Raquel N.; Neves, Fabieni S.; Cavalcanti, Gisele S.; Boscardin, Silvia; Nunes, Marise P.; Santiago, Marcelo F.; Nóbrega, Alberto; Rodrigues, Maurício M.; Bellio, Maria

    2010-01-01

    The murine model of T. cruzi infection has provided compelling evidence that development of host resistance against intracellular protozoans critically depends on the activation of members of the Toll-like receptor (TLR) family via the MyD88 adaptor molecule. However, the possibility that TLR/MyD88 signaling pathways also control the induction of immunoprotective CD8+ T cell-mediated effector functions has not been investigated to date. We addressed this question by measuring the frequencies of IFN-γ secreting CD8+ T cells specific for H-2Kb-restricted immunodominant peptides as well as the in vivo Ag-specific cytotoxic response in infected animals that are deficient either in TLR2, TLR4, TLR9 or MyD88 signaling pathways. Strikingly, we found that T. cruzi-infected Tlr2−/−, Tlr4−/−, Tlr9−/ − or Myd88−/− mice generated both specific cytotoxic responses and IFN-γ secreting CD8+ T cells at levels comparable to WT mice, although the frequency of IFN-γ+CD4+ cells was diminished in infected Myd88−/− mice. We also analyzed the efficiency of TLR4-driven immune responses against T. cruzi using TLR4-deficient mice on the C57BL genetic background (B6 and B10). Our studies demonstrated that TLR4 signaling is required for optimal production of IFN-γ, TNF-α and nitric oxide (NO) in the spleen of infected animals and, as a consequence, Tlr4−/− mice display higher parasitemia levels. Collectively, our results indicate that TLR4, as well as previously shown for TLR2, TLR9 and MyD88, contributes to the innate immune response and, consequently, resistance in the acute phase of infection, although each of these pathways is not individually essential for the generation of class I-restricted responses against T. cruzi. PMID:20442858

  19. Generation of cellular immune memory and B-cell immunity is impaired by natural killer cells.

    PubMed

    Rydyznski, Carolyn; Daniels, Keith A; Karmele, Erik P; Brooks, Taylor R; Mahl, Sarah E; Moran, Michael T; Li, Caimei; Sutiwisesak, Rujapak; Welsh, Raymond M; Waggoner, Stephen N

    2015-02-27

    The goal of most vaccines is the induction of long-lived memory T and B cells capable of protecting the host from infection by cytotoxic mechanisms, cytokines and high-affinity antibodies. However, efforts to develop vaccines against major human pathogens such as HIV and HCV have not been successful, thereby highlighting the need for novel approaches to circumvent immunoregulatory mechanisms that limit the induction of protective immunity. Here, we show that mouse natural killer (NK) cells inhibit generation of long-lived virus-specific memory T- and B cells as well as virus-specific antibody production after acute infection. Mechanistically, NK cells suppressed CD4 T cells and follicular helper T cells (T(FH)) in a perforin-dependent manner during the first few days of infection, resulting in a weaker germinal centre (GC) response and diminished immune memory. We anticipate that innovative strategies to relieve NK cell-mediated suppression of immunity should facilitate development of efficacious new vaccines targeting difficult-to-prevent infections.

  20. Neuroblastoma Arginase Activity Creates an Immunosuppressive Microenvironment That Impairs Autologous and Engineered Immunity.

    PubMed

    Mussai, Francis; Egan, Sharon; Hunter, Stuart; Webber, Hannah; Fisher, Jonathan; Wheat, Rachel; McConville, Carmel; Sbirkov, Yordan; Wheeler, Kate; Bendle, Gavin; Petrie, Kevin; Anderson, John; Chesler, Louis; De Santo, Carmela

    2015-08-01

    Neuroblastoma is the most common extracranial solid tumor of childhood, and survival remains poor for patients with advanced disease. Novel immune therapies are currently in development, but clinical outcomes have not matched preclinical results. Here, we describe key mechanisms in which neuroblastoma inhibits the immune response. We show that murine and human neuroblastoma tumor cells suppress T-cell proliferation through increased arginase activity. Arginase II is the predominant isoform expressed and creates an arginine-deplete local and systemic microenvironment. Neuroblastoma arginase activity results in inhibition of myeloid cell activation and suppression of bone marrow CD34(+) progenitor proliferation. Finally, we demonstrate that the arginase activity of neuroblastoma impairs NY-ESO-1-specific T-cell receptor and GD2-specific chimeric antigen receptor-engineered T-cell proliferation and cytotoxicity. High arginase II expression correlates with poor survival for patients with neuroblastoma. The results support the hypothesis that neuroblastoma creates an arginase-dependent immunosuppressive microenvironment in both the tumor and blood that leads to impaired immunosurveillance and suboptimal efficacy of immunotherapeutic approaches.

  1. Immune responses to infectious diseases in bivalves.

    PubMed

    Allam, Bassem; Raftos, David

    2015-10-01

    Many species of bivalve mollusks (phylum Mollusca, class Bivalvia) are important in fisheries and aquaculture, whilst others are critical to ecosystem structure and function. These crucial roles mean that considerable attention has been paid to the immune responses of bivalves such as oysters, clams and mussels against infectious diseases that can threaten the viability of entire populations. As with many invertebrates, bivalves have a comprehensive repertoire of immune cells, genes and proteins. Hemocytes represent the backbone of the bivalve immune system. However, it is clear that mucosal tissues at the interface with the environment also play a critical role in host defense. Bivalve immune cells express a range of pattern recognition receptors and are highly responsive to the recognition of microbe-associated molecular patterns. Their responses to infection include chemotaxis, phagolysosomal activity, encapsulation, complex intracellular signaling and transcriptional activity, apoptosis, and the induction of anti-viral states. Bivalves also express a range of inducible extracellular recognition and effector proteins, such as lectins, peptidoglycan-recognition proteins, thioester bearing proteins, lipopolysaccharide and β1,3-glucan-binding proteins, fibrinogen-related proteins (FREPs) and antimicrobial proteins. The identification of FREPs and other highly diversified gene families in bivalves leaves open the possibility that some of their responses to infection may involve a high degree of pathogen specificity and immune priming. The current review article provides a comprehensive, but not exhaustive, description of these factors and how they are regulated by infectious agents. It concludes that one of the remaining challenges is to use new "omics" technologies to understand how this diverse array of factors is integrated and controlled during infection. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Microbes and mucosal immune responses in asthma.

    PubMed

    Hansel, Trevor T; Johnston, Sebastian L; Openshaw, Peter J

    2013-03-09

    The substantial increase in the worldwide prevalence of asthma and atopy has been attributed to lifestyle changes that reduce exposure to bacteria. A recent insight is that the largely bacterial microbiome maintains a state of basal immune homoeostasis, which modulates immune responses to microbial pathogens. However, some respiratory viral infections cause bronchiolitis of infancy and childhood wheeze, and can exacerbate established asthma; whereas allergens can partly mimic infectious agents. New insights into the host’s innate sensing systems, combined with recently developed methods that characterise commensal and pathogenic microbial exposure, now allow a unified theory for how microbes cause mucosal inflammation in asthma. The respiratory mucosa provides a key microbial interface where epithelial and dendritic cells interact with a range of functionally distinct lymphocytes. Lymphoid cells then control a range of pathways, both innate and specific, which organise the host mucosal immune response. Fundamental to innate immune responses to microbes are the interactions between pathogen-associated molecular patterns and pattern recognition receptors, which are associated with production of type I interferons, proinflammatory cytokines, and the T-helper-2 cell pathway in predisposed people. These coordinated, dynamic immune responses underlie the differing asthma phenotypes, which we delineate in terms of Seven Ages of Asthma. An understanding of the role of microbes in the atopic march towards asthma, and in causing exacerbations of established asthma, provides the rationale for new specific treatments that can be assessed in clinical trials. On the basis of these new ideas, specific host biomarkers might then allow personalised treatment to become a reality for patients with asthma.

  3. Cytokines and Immune Responses in Murine Atherosclerosis.

    PubMed

    Kusters, Pascal J H; Lutgens, Esther

    2015-01-01

    Atherosclerosis is an inflammatory disease of the vessel wall characterized by activation of the innate immune system, with macrophages as the main players, as well as the adaptive immune system, characterized by a Th1-dominant immune response. Cytokines play a major role in the initiation and regulation of inflammation. In recent years, many studies have investigated the role of these molecules in experimental models of atherosclerosis. While some cytokines such as TNF or IFNγ clearly had atherogenic effects, others such as IL-10 were found to be atheroprotective. However, studies investigating the different cytokines in experimental atherosclerosis revealed that the cytokine system is complex with both disease stage-dependent and site-specific effects. In this review, we strive to provide an overview of the main cytokines involved in atherosclerosis and to shed light on their individual role during atherogenesis.

  4. The adaptive immune response in celiac disease.

    PubMed

    Qiao, Shuo-Wang; Iversen, Rasmus; Ráki, Melinda; Sollid, Ludvig M

    2012-07-01

    Compared to other human leukocyte antigen (HLA)-associated diseases such as type 1 diabetes, multiple sclerosis, and rheumatoid arthritis, fundamental aspects of the pathogenesis in celiac disease are relatively well understood. This is mostly because the causative antigen in celiac disease-cereal gluten proteins-is known and the culprit HLA molecules are well defined. This has facilitated the dissection of the disease-relevant CD4+ T cells interacting with the disease-associated HLA molecules. In addition, celiac disease has distinct antibody responses to gluten and the autoantigen transglutaminase 2, which give strong handles to understand all sides of the adaptive immune response leading to disease. Here we review recent developments in the understanding of the role of T cells, B cells, and antigen-presenting cells in the pathogenic immune response of this instructive disorder.

  5. Regeneration, tissue injury and the immune response

    PubMed Central

    Godwin, James W; Brockes, Jeremy P

    2006-01-01

    The involvement of the immune system in the response to tissue injury has raised the possibility that it might influence tissue, organ or appendage regeneration following injury. One hypothesis that has been discussed is that inflammatory aspects may preclude the occurrence of regeneration, but there is also evidence for more positive roles of immune components. The vertebrate eye is an immunoprivileged site where inflammatory aspects are inhibited by several immunomodulatory mechanisms. In various newt species the ocular tissues such as the lens are regenerative and it has recently been shown that the response to local injury of the lens involves activation of antigen-presenting cells which traffic to the spleen and return to displace and engulf the lens, thereby inducing regeneration from the dorsal iris. The activation of thrombin from prothrombin in the dorsal iris is one aspect of the injury response that is important in the initiation of regeneration. The possible relationships between the immune response and the regenerative response are considered with respect to phylogenetic variation of regeneration in general, and lens regeneration in particular. PMID:17005015

  6. Changing the energy of an immune response

    PubMed Central

    Delmastro-Greenwood, Meghan M; Piganelli, Jon D

    2013-01-01

    The breakdown of nutrients into the critical energy source ATP is the general purpose of cellular metabolism and is essential for sustaining life. Similarly, the immune system is composed of different cell subsets that are indispensable for defending the host against pathogens and disease. The interplay between metabolic pathways and immune cells leads to a plethora of different signaling pathways as well as cellular activities. The activation of T cells via glycolysis-mediated upregulation of surface markers, for example, is necessary for an appropriate effector response against an infection. However, tight regulation of immune cell metabolism is required for protecting the host and resuming homeostasis. An imbalance of immunological metabolic function and/or metabolic byproducts (reactive oxygen species) can oftentimes lead to diseases. In the case of cancer, overactive glucose metabolism can lead to hyperproliferation of cells and subsequent decreases in cytotoxic T cell activity, which attack and destroy the tumor. For this reason and many more, targeting metabolism in immune cells may be a novel therapeutic strategy for treatment of disease. The metabolic pathways of immune cells and the possibilities of immunometabolic therapies will be discussed. PMID:23885324

  7. Impaired T-cell responses to sphingosine-1-phosphate in HIV-1 infected lymph nodes

    PubMed Central

    Mudd, Joseph C.; Murphy, Patrick; Manion, Maura; Debernardo, Robert; Hardacre, Jeffrey; Ammori, John; Hardy, Gareth A.; Harding, Clifford V.; Mahabaleshwar, Ganapati H.; Jain, Mukesh K.; Jacobson, Jeffrey M.; Brooks, Ari D.; Lewis, Sharon; Schacker, Timothy W.; Anderson, Jodi; Haddad, Elias K.; Cubas, Rafael A.; Rodriguez, Benigno; Sieg, Scott F.

    2013-01-01

    The determinants of HIV-1-associated lymphadenopathy are poorly understood. We hypothesized that lymphocytes could be sequestered in the HIV-1+ lymph node (LN) through impairments in sphingosine-1-phosphate (S1P) responsiveness. To test this hypothesis, we developed novel assays for S1P-induced Akt phosphorylation and actin polymerization. In the HIV-1+ LN, naïve CD4 T cells and central memory CD4 and CD8 T cells had impaired Akt phosphorylation in response to S1P, whereas actin polymerization responses to S1P were impaired dramatically in all LN maturation subsets. These defects were improved with antiretroviral therapy. LN T cells expressing CD69 were unable to respond to S1P in either assay, yet impaired S1P responses were also seen in HIV-1+ LN T cells lacking CD69 expression. Microbial elements, HIV-1, and interferon α – putative drivers of HIV-1associated immune activation all tended to increase CD69 expression and reduce T-cell responses to S1P in vitro. Impairment in T-cell egress from lymph nodes through decreased S1P responsiveness may contribute to HIV-1-associated LN enlargement and to immune dysregulation in a key organ of immune homeostasis. PMID:23422746

  8. Obesity impairs cell-mediated immunity during the second trimester of pregnancy

    USDA-ARS?s Scientific Manuscript database

    Obesity is associated with impaired immunity. In obese pregnancy, both mother and fetus are susceptible to the short- and long-term deleterious effects of infectious illness. The objective of the study was to determine the impact of obesity on maternal blood immune cell subsets, intracellular and s...

  9. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis Survival

    DTIC Science & Technology

    2006-06-14

    germinate into vegetative bacteria (10, 23), which are capable of secreting anthrax lethal toxin (LT) and edema toxin . In the lymph nodes, bacteria ...inability of AM to completely eradicate bacteria suggests that intracellularly secreted lethal FIG. 5. Lethal toxin impairs bactericidal activity but...Microbiology. All Rights Reserved. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis

  10. Multiscale modeling of mucosal immune responses

    PubMed Central

    2015-01-01

    Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut

  11. Multiscale modeling of mucosal immune responses.

    PubMed

    Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep

    2015-01-01

    Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T

  12. Mesenchymal stem cells and adaptive immune responses.

    PubMed

    Cao, Wei; Cao, Kai; Cao, Jianchang; Wang, Ying; Shi, Yufang

    2015-12-01

    Over the past decade, our understanding of the regulatory role of mesenchymal stem cells (MSCs) in adaptive immune responses through both preclinical and clinical studies has dramatically expanded, providing great promise for treating various inflammatory diseases. Most studies are focused on the modulatory effects of these cells on the properties of T cell-mediated immune responses, including activation, proliferation, survival, and subset differentiation. Interestingly, the immunosuppressive function of MSCs was found to be licensed by IFN-γ and TNF-α produced by T cells and that can be further amplified by cytokines such as IL-17. However, the immunosuppressive function of MSCs can be reversed in certain situation, such as suboptimal levels of inflammatory cytokines, or in the presence of immunosuppressive molecules. Here we review the influence of MSCs on adaptive immune system, especially their bidirectional interaction in tuning the immune microenvironment and subsequently repairing damaged tissue. Understanding MSC-mediated regulation of T cells is expected to provide fundamental information for guiding appropriate applications of MSCs in clinical settings. Copyright © 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  13. The Memory Immune Response to Tuberculosis.

    PubMed

    Kirman, Joanna R; Henao-Tamayo, Marcela I; Agger, Else Marie

    2016-12-01

    Immunological memory is a central feature of the adaptive immune system and a prerequisite for generating effective vaccines. Understanding long-term memory responses to Mycobacterium tuberculosis will thus provide us with valuable insights that can guide us in the search for a novel vaccine against tuberculosis (TB). For many years, triggering CD4 T cells and, in particular, those secreting interferon-γ has been the goal of most TB vaccine research, and numerous data from animals and humans support the key role of this subset in protective immunity. More recently, we have learned that the memory response required for effective control of M. tuberculosis is much more complex, probably involving several phenotypically different CD4 T cell subsets as well as other cell types that are yet to be defined. Herein, we describe recent insights into memory immunity to TB in the context of both animal models and the human infection. With the increasing amount of data generated from clinical testing of novel TB vaccines, we also summarize recent knowledge of vaccine-induced memory immunity.

  14. Impaired humoral immunity and tolerance in K14-VEGFR-3-Ig mice that lack dermal lymphatic drainage

    PubMed Central

    Thomas, Susan N.; Rutkowski, Joseph M.; Pasquier, Miriella; Kuan, Emma L.; Alitalo, Kari; Randolph, Gwendalyn J.; Swartz, Melody A.

    2012-01-01

    Lymphatic vessels transport interstitial fluid, soluble antigen, and immune cells from peripheral tissues to lymph nodes (LNs), yet the contribution of peripheral lymphatic drainage to adaptive immunity remains poorly understood. We examined immune responses to dermal vaccination and contact hypersensitivity (CHS) challenge in K14-VEGFR-3-Ig mice, which lack dermal lymphatic capillaries and experience markedly depressed transport of solutes and dendritic cells from the skin to draining LNs. In response to dermal immunization, K14-VEGFR-3-Ig mice produced lower antibody titers. In contrast, although delayed, T cell responses were robust after 21 days, including high levels of antigen-specific CD8+ T cells and production of IFN-γ, IL-4 and IL-10 upon restimulation. T cell-mediated CHS responses were strong in K14-VEGFR-3-Ig mice, but importantly, their ability to induce CHS tolerance in the skin was impaired. Additionally, one-year-old mice displayed multiple signs of autoimmunity. These data suggest that lymphatic drainage plays more important roles in regulating humoral immunity and peripheral tolerance than in effector T cell immunity. PMID:22844119

  15. THE EVOLUTION OF THE IMMUNE RESPONSE

    PubMed Central

    Finstad, Joanne; Good, Robert A.

    1964-01-01

    1. Studies of the immune response have been carried out in more than 1700 lampreys representing three stages in the life cycle of these animals. 2. Lampreys used in this study were unable to clear certain soluble protein antigens and bacteriophage and were unable to make antibodies to these antigens. Hemocyanin was cleared from the circulation. 3. The immune responses demonstrated in lampreys include the production of specific antibody to killed Brucella cells, the rejection of skin homografts, and the development of a delayed allergic response to old tuberculin. 4. A responsive proliferation of lymphoid cells occurred in the protovertebral arch following antigen-adjuvant stimulation. 5. Electrophoretic and immunoelectrophoretic analysis of lamprey serum revealed gamma globulin. Ultracentrifugal analysis of serum revealed proteins with sedimentation coefficients of 17S, 8S, 7S, and 3S. 6. The antibodies thus far observed in the lamprey are of relatively high molecular weight and destroyed by 2-mercaptoethanol. 7. In the lamprey it would appear that there is reflected the coordinate evolution of a primitive thymus, primitive spleen containing lymphoid foci, a family of lymphocytes in the peripheral blood and capacity for gamma globulin synthesis and expression of adaptive immunity. PMID:14238932

  16. The innate and adaptive immune response to avian influenza virus

    USDA-ARS?s Scientific Manuscript database

    Protective immunity against viruses is mediated by the early innate immune responses and later on by the adaptive immune responses. The early innate immunity is designed to contain and limit virus replication in the host, primarily through cytokine and interferon production. Most all cells are cap...

  17. MYC and HIF in shaping immune response and immune metabolism.

    PubMed

    Gnanaprakasam, J N Rashida; Sherman, John William; Wang, Ruoning

    2017-06-01

    Upon antigen stimulation, quiescent naive T cells undergo a phase of cell mass accumulation followed by cell cycle entry, clonal expansion, differentiation into functional subsets and back again to a quiescent state as they develop into memory cells. The transitions between these distinct cellular states place unique metabolic demands on energy, redox and biosynthesis. To fulfill these demands, T cells switch back and forth between their primary catabolic pathways. While quiescent naive and memory T cells largely rely on the oxidation of fatty acids and glucose, active T cells rely on glycolysis and glutaminolysis to sustain cell growth, proliferation and differentiation. Beyond several key signaling kinase cascades, the hypoxia inducible factor 1 (HIF-1) and the proto-oncogene MYC, act alone or in concert, to coordinate T cell metabolic reprogramming, cell proliferation, functional differentiation and apoptosis, enabling a robust T cell-mediated adaptive immune response. Copyright © 2017. Published by Elsevier Ltd.

  18. Impaired SNX9 Expression in Immune Cells during Chronic Inflammation: Prognostic and Diagnostic Implications.

    PubMed

    Ish-Shalom, Eliran; Meirow, Yaron; Sade-Feldman, Moshe; Kanterman, Julia; Wang, Lynn; Mizrahi, Olga; Klieger, Yair; Baniyash, Michal

    2016-01-01

    Chronic inflammation is associated with immunosuppression and downregulated expression of the TCR CD247. In searching for new biomarkers that could validate the impaired host immune status under chronic inflammatory conditions, we discovered that sorting nexin 9 (SNX9), a protein that participates in early stages of clathrin-mediated endocytosis, is downregulated as well under such conditions. SNX9 expression was affected earlier than CD247 by the generated harmful environment, suggesting that it is a potential marker sensing the generated immunosuppressive condition. We found that myeloid-derived suppressor cells, which are elevated in the course of chronic inflammation, are responsible for the observed SNX9 reduced expression. Moreover, SNX9 downregulation is reversible, as its expression levels return to normal and immune functions are restored when the inflammatory response and/or myeloid-derived suppressor cells are neutralized. SNX9 downregulation was detected in numerous mouse models for pathologies characterized by chronic inflammation such as chronic infection (Leishmania donovani), cancer (melanoma and colorectal carcinoma), and an autoimmune disease (rheumatoid arthritis). Interestingly, reduced levels of SNX9 were also observed in blood samples from colorectal cancer patients, emphasizing the feasibility of its use as a diagnostic and prognostic biomarker sensing the host's immune status and inflammatory stage. Our new discovery of SNX9 as being regulated by chronic inflammation and its association with immunosuppression, in addition to the CD247 regulation under such conditions, show the global impact of chronic inflammation and the generated immune environment on different cellular pathways in a diverse spectrum of diseases.

  19. Characterization of human antiviral adaptive immune responses during hepatotropic virus infection in HLA-transgenic human immune system mice

    PubMed Central

    Billerbeck, Eva; Horwitz, Joshua A.; Labitt, Rachael N.; Donovan, Bridget M.; Vega, Kevin; Budell, William C.; Koo, Gloria C.; Rice, Charles M.; Ploss, Alexander

    2013-01-01

    Humanized mice have emerged as a promising model to study human immunity in vivo. While they are susceptible to many pathogens exhibiting an almost exclusive human tropism, human immune responses to infection remain functionally impaired. It has recently been demonstrated that the expression of HLA molecules improves human immunity to lymphotropic virus infections in humanized mice. However, little is known about the extent of functional human immune responses in non-lymphoid tissues, such as in the liver, and the role of HLA expression in this context. Therefore, we analyzed human antiviral immunity in humanized mice during a hepatotropic adenovirus infection. We compared immune responses of conventional humanized NOD SCID IL2RγNULL(NSG) mice to those of a novel NSG strain transgenic for both HLA-A*0201 and a chimeric HLA-DR*0101 molecule. Using a firefly luciferase expressing adenovirus and in vivo bioluminescence imaging, we demonstrate a human T cell dependent partial clearance of adenovirus-infected cells from the liver of HLA-transgenic humanized mice. This correlated with liver-infiltration and activation of T cells, as well as the detection of antigen-specific humoral and cellular immune responses. When infected with an HCV NS3 expressing adenovirus, HLA-transgenic humanized mice mounted an HLA-A*0201 restricted HCV NS3-specific CD8+ T cell response. In conclusion, our study provides evidence for the generation of partial functional antiviral immune responses against a hepatotropic pathogen in humanized HLA-transgenic mice. The adenovirus reporter system used in our study may serve as simple in vivo method to evaluate future strategies for improving human intrahepatic immune responses in humanized mice. PMID:23833235

  20. Humoral innate immune response and disease

    PubMed Central

    Shishido, Stephanie N.; Varahan, Sriram; Yuan, Kai; Li, Xiangdong; Fleming, Sherry D.

    2012-01-01

    The humoral innate immune response consists of multiple components, including the naturally occurring antibodies (NAb), pentraxins and the complement and contact cascades. As soluble, plasma components, these innate proteins provide key elements in the prevention and control of disease. However, pathogens and cells with altered self proteins utilize multiple humoral components to evade destruction and promote pathogy. Many studies have examined the relationship between humoral immunity and autoimmune disorders. This review focuses on the interactions between the humoral components and their role in promoting the pathogenesis of bacterial and viral infections and chronic diseases such as atherosclerosis and cancer. Understanding the beneficial and detrimental aspects of the individual components and the interactions between proteins which regulate the innate and adaptive response will provide therapeutic targets for subsequent studies. PMID:22771788

  1. Evolutionary responses of innate Immunity to adaptive immunity

    USDA-ARS?s Scientific Manuscript database

    Innate immunity is present in all metazoans, whereas the evolutionarily more novel adaptive immunity is limited to jawed fishes and their descendants (gnathostomes). We observe that the organisms that possess adaptive immunity lack diversity in their innate pattern recognition receptors (PRRs), rais...

  2. Immune responses to pertussis vaccines and disease.

    PubMed

    Edwards, Kathryn M; Berbers, Guy A M

    2014-04-01

    In this article we discuss the following: (1) acellular vaccines are immunogenic, but responses vary by vaccine; (2) pertussis antibody levels rapidly wane but promptly increase after vaccination; (3) whole-cell vaccines vary in immunogenicity and efficacy; (4) whole-cell vaccines and naturally occurring pertussis generate predominantly T-helper 1 (Th1) responses, whereas acellular vaccines generate mixed Th1/Th2 responses; (5) active transplacental transport of pertussis antibody is documented; (6) neonatal immunization with diphtheria toxoid, tetanus toxoid, and acellular pertussis vaccine has been associated with some suppression of pertussis antibody, but suppression has been seen less often with acellular vaccines; (7) memory B cells persist in both acellular vaccine- and whole cell vaccine-primed children; and (8) in acellular vaccine-primed children, T-cell responses remain elevated and do not increase with vaccine boosters, whereas in whole-cell vaccine-primed children, these responses can be increased by vaccine boosting and natural exposure. Despite these findings, challenges remain in understanding the immune response to pertussis vaccines.

  3. Impaired Hyperemic Response to Exercise Post Stroke

    PubMed Central

    Durand, Matthew J.; Murphy, Spencer A.; Schaefer, Kathleen K.; Hunter, Sandra K.; Schmit, Brian D.; Gutterman, David D.; Hyngstrom, Allison S.

    2015-01-01

    Individuals with chronic stroke have reduced perfusion of the paretic lower limb at rest; however, the hyperemic response to graded muscle contractions in this patient population has not been examined. This study quantified blood flow to the paretic and non-paretic lower limbs of subjects with chronic stroke after submaximal contractions of the knee extensor muscles and correlated those measures with limb function and activity. Ten subjects with chronic stroke and ten controls had blood flow through the superficial femoral artery quantified with ultrasonography before and immediately after 10 second contractions of the knee extensor muscles at 20, 40, 60, and 80% of the maximal voluntary contraction (MVC) of the test limb. Blood flow to the paretic and non-paretic limb of stroke subjects was significantly reduced at all load levels compared to control subjects even after normalization to lean muscle mass. Of variables measured, increased blood flow after an 80% MVC was the single best predictor of paretic limb strength, the symmetry of strength between the paretic and non-paretic limbs, coordination of the paretic limb, and physical activity. The impaired hemodynamic response to high intensity contractions was a better predictor of lower limb function than resting perfusion measures. Stroke-dependent weakness and atrophy of the paretic limb do not explain the reduced hyperemic response to muscle contraction alone as the response is similarly reduced in the non-paretic limb when compared to controls. These data may suggest a role for perfusion therapies to optimize rehabilitation post stroke. PMID:26630380

  4. The immune response of the human brain to abdominal surgery.

    PubMed

    Forsberg, Anton; Cervenka, Simon; Jonsson Fagerlund, Malin; Rasmussen, Lars S; Zetterberg, Henrik; Erlandsson Harris, Helena; Stridh, Pernilla; Christensson, Eva; Granström, Anna; Schening, Anna; Dymmel, Karin; Knave, Nina; Terrando, Niccolò; Maze, Mervyn; Borg, Jacqueline; Varrone, Andrea; Halldin, Christer; Blennow, Kaj; Farde, Lars; Eriksson, Lars I

    2017-04-01

    Surgery launches a systemic inflammatory reaction that reaches the brain and associates with immune activation and cognitive decline. Although preclinical studies have in part described this systemic-to-brain signaling pathway, we lack information on how these changes appear in humans. This study examines the short- and long-term impact of abdominal surgery on the human brain immune system by positron emission tomography (PET) in relation to blood immune reactivity, plasma inflammatory biomarkers, and cognitive function. Eight males undergoing prostatectomy under general anesthesia were included. Prior to surgery (baseline), at postoperative days 3 to 4, and after 3 months, patients were examined using [(11) C]PBR28 brain PET imaging to assess brain immune cell activation. Concurrently, systemic inflammatory biomarkers, ex vivo blood tests on immunoreactivity to lipopolysaccharide (LPS) stimulation, and cognitive function were assessed. Patients showed a global downregulation of gray matter [(11) C]PBR28 binding of 26 ± 26% (mean ± standard deviation) at 3 to 4 days postoperatively compared to baseline (p = 0.023), recovering or even increasing after 3 months. LPS-induced release of the proinflammatory marker tumor necrosis factor-α in blood displayed a reduction (41 ± 39%) on the 3rd to 4th postoperative day, corresponding to changes in [(11) C]PBR28 distribution volume. Change in Stroop Color-Word Test performance between postoperative days 3 to 4 and 3 months correlated to change in [(11) C]PBR28 binding (p = 0.027). This study translates preclinical data on changes in the brain immune system after surgery to humans, and suggests an interplay between the human brain and the inflammatory response of the peripheral innate immune system. These findings may be related to postsurgical impairments of cognitive function. Ann Neurol 2017;81:572-582. © 2017 American Neurological Association.

  5. Cellular immune responses towards regulatory cells.

    PubMed

    Larsen, Stine Kiær

    2016-01-01

    This thesis describes the results from two published papers identifying spontaneous cellular immune responses against the transcription factors Foxp3 and Foxo3. The tumor microenvironment is infiltrated by cells that hinder effective tumor immunity from developing. Two of these cell types, which have been linked to a bad prognosis for patients, are regulatory T cells (Treg) and tolerogenic dendritic cells (DC). Tregs inhibit effector T cells from attacking the tumor through various mechanisms, including secreted factors and cell-to-cell contact. Tregs express the transcription factor Foxp3, which is necessary for their development and suppressive activities. Tolerogenic DCs participate in creating an environment in the tumor where effector T cells become tolerant towards the tumor instead of attacking it. The transcription factor Foxo3 was recently described to be highly expressed by tolerogenic DCs and to programme their tolerogenic influence. This thesis describes for the first time the existence of spontaneous cellular immune responses against peptides derived from Foxp3 and Foxo3. We have detected the presence of cytotoxic T cells that recognise these peptides in an HLA-A2 restricted manner in cancer patients and for Foxp3 in healthy donors as well. In addition, we have demonstrated that the Foxp3- and Foxo3-specific CTLs recognize Foxp3- and Foxo3-expressing cancer cell lines and importantly, suppressive immune cells, namely Tregs and in vitro generated DCs. Cancer immunotherapy is recently emerging as an important treatment modality improving the survival of selected patients. The current progress is largely owing to targeting of the immune suppressive milieu that is dominating the tumor microenvironment. This is being done through immune checkpoint blockade with CTLA-4 and PD-1/PD-L1 antibodies and through lymphodepleting conditioning of patients and ex vivo activation of TILs in adoptive cell transfer. Several strategies are being explored for depletion of

  6. Immune response and immunopathology during toxoplasmosis1

    PubMed Central

    Dupont, Christopher D.; Christian, David A.; Hunter, Christopher A.

    2012-01-01

    Toxoplasma gondii is a protozoan parasite of medical and veterinary significance that is able to infect any warm-blooded vertebrate host. In addition to its importance to public health, several inherent features of the biology of T. gondii have made it an important model organism to study host-pathogen interactions. One factor is the genetic tractability of the parasite, which allows studies on the microbial factors that affect virulence and allows the development of tools that facilitate immune studies. Additionally, mice are natural hosts for T. gondii, and the availability of numerous reagents to study the murine immune system makes this an ideal experimental system to understand the functions of cytokines and effector mechanisms involved in immunity to intracellular microorganisms. In this article, we will review current knowledge of the innate and adaptive immune responses required for resistance to toxoplasmosis, the events that lead to the development of immunopathology, and the natural regulatory mechanisms that limit excessive inflammation during this infection. PMID:22955326

  7. Immune responses of honeybees and their fitness costs as compared to bumblebees.

    PubMed

    Riessberger-Gallé, Ulrike; Hernández López, Javier; Schuehly, Wolfgang; Crockett, Sara; Krainer, Sophie; Crailsheim, Karl

    Immune responses of invertebrates imply more than developing a merely unspecific response to an infection. Great interest has been raised to unveil whether this investment into immunity also involves fitness costs associated to the individual or the group. Focusing on the immune responses of honeybees, we use the well-studied insect bumblebee for comparison. Bumblebees are capable of producing specific immune responses to infections whereas this has not been assessed for honeybees so far. We investigated whether a prior bacterial encounter provides protection against a later exposure to the same or a different bacterium in honeybees. Additionally, we studied whether the foraging activities of honeybees and bumblebees are affected upon immune stimulation by assessing the flight performance. Finally, the acceptance behavior of nestmates toward immune-challenged honeybees was determined. Results show that despite stimulating the immune system of honeybees, no protective effects to infections were found. Further, honeybees were not affected by an immune challenge in their flight performance whereas bumblebees showed significant flight impairment. Immune-challenged honeybees showed lower survival rates than naive individuals when introduced into a regular colony. Here, we reveal different immune response-cost scenarios in honeybees and bumblebees for the first time.

  8. Staphylococcal manipulation of host immune responses

    PubMed Central

    Thammavongsa, Vilasack; Kim, Hwan Keun; Missiakas, Dominique; Schneewind, Olaf

    2015-01-01

    Staphylococcus aureus, a bacterial commensal of the human nares and skin, is a frequent cause of soft tissue and bloodstream infections. A hallmark of staphylococcal infections is their frequent recurrence, even when treated with antibiotics and surgical intervention, which demonstrates the bacterium’s ability to manipulate innate and adaptive immune responses. In this Review, we highlight how S. aureus virulence factors inhibit complement activation, block and destroy phagocytic cells and modify host B and T cell responses, and we discuss how these insights might be useful for the development of novel therapies against infections with antibiotic resistant strains such as methicillin-resistant S. aureus. PMID:26272408

  9. Human Immune Response to Dengue Infections

    DTIC Science & Technology

    1988-07-31

    Security Classification) (U) Human Immune Response to Dengue Infections 12. PERSONAL AUTHOR(S) Francis A. Ennis 13a. TYPE OF’REPORTn 13b. TIME COVERED 14...8217SUBJECT TERMS (Continue on reverse if necessary and identify by Nock rumber) FIELD GROUP SUB-GROUP RA .1, Dengue virus, T lymphopytes. 06 03 InB-GROP1.In...responses to dengue antigens in vitro to elucidate the possible role of T lymphocytes in the pathogeneeis of dengue hemorrhagic fever and dengue

  10. Antiviral immune responses of bats: a review.

    PubMed

    Baker, M L; Schountz, T; Wang, L-F

    2013-02-01

    Despite being the second most species-rich and abundant group of mammals, bats are also among the least studied, with a particular paucity of information in the area of bat immunology. Although bats have a long history of association with rabies, the emergence and re-emergence of a number of viruses from bats that impact human and animal health has resulted in a resurgence of interest in bat immunology. Understanding how bats coexist with viruses in the absence of disease is essential if we are to begin to develop therapeutics to target viruses in humans and susceptible livestock and companion animals. Here, we review the current status of knowledge in the field of bat antiviral immunology including both adaptive and innate mechanisms of immune defence and highlight the need for further investigations in this area. Because data in this field are so limited, our discussion is based on both scientific discoveries and theoretical predictions. It is hoped that by provoking original, speculative or even controversial ideas or theories, this review may stimulate further research in this important field. Efforts to understand the immune systems of bats have been greatly facilitated in recent years by the availability of partial genome sequences from two species of bats, a megabat, Pteropus vampyrus, and a microbat, Myotis lucifugus, allowing the rapid identification of immune genes. Although bats appear to share most features of the immune system with other mammals, several studies have reported qualitative and quantitative differences in the immune responses of bats. These observations warrant further investigation to determine whether such differences are associated with the asymptomatic nature of viral infections in bats.

  11. Immune Response among Patients Exposed to Molds

    PubMed Central

    Edmondson, David A.; Barrios, Christy S.; Brasel, Trevor L.; Straus, David C.; Kurup, Viswanath P.; Fink, Jordan N.

    2009-01-01

    Macrocyclic trichothecenes, mycotoxins produced by Stachybotrys chartarum, have been implicated in adverse reactions in individuals exposed to mold-contaminated environments. Cellular and humoral immune responses and the presence of trichothecenes were evaluated in patients with mold-related health complaints. Patients underwent history, physical examination, skin prick/puncture tests with mold extracts, immunological evaluations and their sera were analyzed for trichothecenes. T-cell proliferation, macrocyclic trichothecenes, and mold specific IgG and IgA levels were not significantly different than controls; however 70% of the patients had positive skin tests to molds. Thus, IgE mediated or other non-immune mechanisms could be the cause of their symptoms. PMID:20054481

  12. IL-1 and T Helper Immune Responses

    PubMed Central

    Santarlasci, Veronica; Cosmi, Lorenzo; Maggi, Laura; Liotta, Francesco; Annunziato, Francesco

    2013-01-01

    CD4 T cells play a critical role in mediating adaptive immunity to a variety of pathogens as well as in tumor immunity. If not adequately regulated, CD4 T cells can be also involved in autoimmunity, asthma, and allergic responses. During TCR activation in a particular cytokine milieu, naïve CD4 T cells may differentiate into one of several lineages of T helper (Th) cells, including Th1, Th2, and Th17, as defined by their pattern of cytokine production and function. IL-1, the prototypic proinflammatory cytokine, has been shown to influence growth and differentiation of immunocompetent lymphocytes. The differential expression of IL-1RI on human CD4 T cell subsets confers distinct capacities to acquire specific effector functions. In this review, we summarize the role of IL-1 on CD4 T cells, in terms of differentiation, activation, and maintenance or survival. PMID:23874332

  13. Impaired immune function in seals and laboratory rats exposed to dioxin-like compounds from Baltic herring

    SciTech Connect

    Ross, P.S. |; Swart, R.L. de |; Timmerman, H.H.; Loveren, H. van; Osterhaus, A.D.M.E. ||

    1995-12-31

    Complex mixtures of lipophilic contaminants have been shown to affect certain top predators in the aquatic food chain, including seals. A recent demonstration that harbor seals (Phoca vitulina) fed Baltic Sea herring displayed impaired natural killer cell activity and T-lymphocyte function represented the first demonstration of immunotoxicity induced by ambient levels of contaminants in the environment. While these animals had a lower ability to respond to immunizations with inactivated vaccines, specific antibody responses, and in vitro antigen-specific lymphoproliferative responses, obvious constraints limited the ability to extend these results with host resistance tests or an evaluation of thymus and other lymphoid organs. The authors therefore set up a parallel study by exposing pregnant laboratory rats to the same Baltic herring contaminant mixture as received the seals. They then examined immune function parameters and host resistance to virus infection. As in the seals, rat pups of the Baltic group had impaired T-lymphocyte function. In addition, thymus cells and/or their precursors appeared to be targeted, as their numbers and function were reduced in the rats. Following challenge with rat cytomegalovirus in a host resistance study, rat pups in the Baltic group had impaired natural killer cell responses to the virus infection, and lower specific CD8 + (cytotoxic T-lymphocyte) responses following in vitro stimulation. By extrapolation, these results suggest that the impaired immune responses observed in the Baltic group of seals may lead to a less effective defense against virus infections in marine mammals inhabiting polluted coastal waters. Toxicological profiles and results of both the captive seal and laboratory rat experiments tend to implicate the 2,3,7,8-TCDD-like PCB, dioxin and furan congeners in the immunosuppression, and point to a major role for the PCBs.

  14. Mitochondrial DNA Stress Primes the Antiviral Innate Immune Response

    PubMed Central

    West, A. Phillip; Khoury-Hanold, William; Staron, Matthew; Tal, Michal C.; Pineda, Cristiana M.; Lang, Sabine M.; Bestwick, Megan; Duguay, Brett A.; Raimundo, Nuno; MacDuff, Donna A.; Kaech, Susan M.; Smiley, James R.; Means, Robert E.; Iwasaki, Akiko; Shadel, Gerald S.

    2014-01-01

    Mitochondrial DNA (mtDNA) is normally present at thousands of copies per cell and is packaged into several hundred higher-order structures termed nucleoids1. The abundant mtDNA-binding protein, transcription factor A mitochondrial (TFAM), regulates nucleoid architecture, abundance, and segregation2. Complete mtDNA depletion profoundly impairs oxidative phosphorylation (OXPHOS), triggering calcium-dependent stress signaling and adaptive metabolic responses3. However, the cellular responses to mtDNA instability, a physiologically relevant stress observed in many human diseases and aging, remain ill-defined4. Here we show that moderate mtDNA stress elicited by TFAM deficiency engages cytosolic antiviral signaling to enhance the expression of a subset of interferon-stimulated genes (ISG). Mechanistically, we have found that aberrant mtDNA packaging promotes escape of mtDNA into the cytosol, where it engages the DNA sensor cGAS and promotes STING-IRF3-dependent signaling to elevate ISG expression, potentiate type I interferon responses, and confer broad viral resistance. Furthermore, we demonstrate that herpesviruses induce mtDNA stress, which potentiates antiviral signaling and type I interferon responses during infection. Our results further demonstrate that mitochondria are central participants in innate immunity, identify mtDNA stress as a cell-intrinsic trigger of antiviral signaling, and suggest that cellular monitoring of mtDNA homeostasis cooperates with canonical virus sensing mechanisms to fully license antiviral innate immunity. PMID:25642965

  15. Clec4A4 is a regulatory receptor for dendritic cells that impairs inflammation and T-cell immunity

    PubMed Central

    Uto, Tomofumi; Fukaya, Tomohiro; Takagi, Hideaki; Arimura, Keiichi; Nakamura, Takeshi; Kojima, Naoya; Malissen, Bernard; Sato, Katsuaki

    2016-01-01

    Dendritic cells (DCs) comprise several subsets that are critically involved in the initiation and regulation of immunity. Clec4A4/DC immunoreceptor 2 (DCIR2) is a C-type lectin receptor (CLR) exclusively expressed on CD8α− conventional DCs (cDCs). However, how Clec4A4 controls immune responses through regulation of the function of CD8α− cDCs remains unclear. Here we show that Clec4A4 is a regulatory receptor for the activation of CD8α− cDCs that impairs inflammation and T-cell immunity. Clec4a4−/−CD8α− cDCs show enhanced cytokine production and T-cell priming following Toll-like receptor (TLR)-mediated activation. Furthermore, Clec4a4−/− mice exhibit TLR-mediated hyperinflammation. On antigenic immunization, Clec4a4−/− mice show not only augmented T-cell responses but also progressive autoimmune pathogenesis. Conversely, Clec4a4−/− mice exhibit resistance to microbial infection, accompanied by enhanced T-cell responses against microbes. Thus, our findings highlight roles of Clec4A4 in regulation of the function of CD8α− cDCs for control of the magnitude and quality of immune response. PMID:27068492

  16. Clec4A4 is a regulatory receptor for dendritic cells that impairs inflammation and T-cell immunity.

    PubMed

    Uto, Tomofumi; Fukaya, Tomohiro; Takagi, Hideaki; Arimura, Keiichi; Nakamura, Takeshi; Kojima, Naoya; Malissen, Bernard; Sato, Katsuaki

    2016-04-12

    Dendritic cells (DCs) comprise several subsets that are critically involved in the initiation and regulation of immunity. Clec4A4/DC immunoreceptor 2 (DCIR2) is a C-type lectin receptor (CLR) exclusively expressed on CD8α(-) conventional DCs (cDCs). However, how Clec4A4 controls immune responses through regulation of the function of CD8α(-) cDCs remains unclear. Here we show that Clec4A4 is a regulatory receptor for the activation of CD8α(-) cDCs that impairs inflammation and T-cell immunity. Clec4a4(-/-)CD8α(-) cDCs show enhanced cytokine production and T-cell priming following Toll-like receptor (TLR)-mediated activation. Furthermore, Clec4a4(-/-) mice exhibit TLR-mediated hyperinflammation. On antigenic immunization, Clec4a4(-/-) mice show not only augmented T-cell responses but also progressive autoimmune pathogenesis. Conversely, Clec4a4(-/-) mice exhibit resistance to microbial infection, accompanied by enhanced T-cell responses against microbes. Thus, our findings highlight roles of Clec4A4 in regulation of the function of CD8α(-) cDCs for control of the magnitude and quality of immune response.

  17. Spaceflight and Development of Immune Responses

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1996-01-01

    Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. The number of flight experiments has been small, and the full breadth of immunological alterations occurring after space flight remains to be established. Among the major effects on immune responses after space flight that have been reported are: alterations in lymphocyte blastogenesis and natural killer cell activity, alterations in production of cytokines, changes in leukocyte sub-population distribution, and decreases in the ability of bone marrow cells to respond to colony stimulating factors. Changes have been reported in immunological parameters of both humans and rodents. The significance of these alterations in relation to resistance to infection remains to be established. The objective of the studies contained in this project was to determine the effects of space flight on immune responses of pregnant rats and their offspring. The hypothesis was that space flight and the attendant period of microgravity will result in alteration of immunological parameters of both the pregnant rats as well as their offspring carried in utero during the flight. The parameters tested included: production of cytokines, composition of leukocyte sub- populations, response of bone marrow/liver cells to granulocyte/monocyte colony stimulating factor, and leukocyte blastogenesis. Changes in immune responses that could yield alterations in resistance to infection were determined. This yielded useful information for planning studies that could contribute to crew health. Additional information that could eventually prove useful to determine the potential for establishment of a permanent colony in space was obtained.

  18. [Types of immune response in advanced suppurative peritonitis].

    PubMed

    Borisov, A G; Savchenko, A A; Cherdantsev, D V; Zdzitovetsky, D E; Pervova, O V; Kudryavtsev, I V; Belenyuk, V D; Shapkina, V A

    to assess types of immune response in patients with advanced suppurative peritonitis and course of disease. We examined 79 patients with acute surgical abdominal diseases and injuries complicated by advanced suppurative peritonitis. Blood immunological parameters were estimated using flowing cytometry and enzyme immunoassay. It was concluded that functional parameters of immune system are very various in patients with advanced suppurative peritonitis. Cluster analysis defined 4 immune types which are determined by different state of congenital and acquired immunity. Immunodeficient and unreactive immune types are unfavorable. Immune types with activation of congenital and acquired immunity are the most favourable. This stratification personifies diagnosis and treatment of immune disorders in patients with advanced suppurative peritonitis.

  19. Roles of Toll-like receptors in innate immune responses.

    PubMed

    Takeda, K; Akira, S

    2001-09-01

    Innate immunity recognizes invading micro-organisms and triggers a host defence response. However, the molecular mechanism for innate immune recognition was unclear. Recently, a family of Toll-like receptors (TLRs) was identified, and crucial roles for these receptors in the recognition of microbial components have been elucidated. The TLR family consists of 10 members and will be expanding. Each TLR distinguishes between specific patterns of microbial components to provoke innate immune responses. The activation of innate immunity then leads to the development of antigen-specific adaptive immunity. Thus, TLRs control both innate and adaptive immune responses.

  20. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology

    1986-07-01

    AD-AISI 652 NUMAN IMMUNE RESPONSES TO DENGUE YIRUSES(U) / MASSACHUSETTS UNJY MEDICAL CENTER WORCESTER "A F A ENNIS 61 JUL 86 DRMDI?-82-C-2233...A S. PAGE COUNT Ie ..U rO l-9SJulyl (vw = T 21 Virus; Dengue ; Arbovirus; Immunology -- 4b he,. SAaaY~d the Interaction between the peripheral blood...lymphocytes (PBL) of non- 10m.0 deors ad dengue virus-Infected cells, which results in Interferon (113) production. AutelepMu mecyts@ or the Zpstein

  1. Assessing human responses to impairments of atmospheric visibility

    SciTech Connect

    Flachsbart, P.G.

    1980-01-01

    Solving the problems of visibility impairments in Class I (pristine) areas will require both strategic and tactical measures. A proposed framework for assessing impairments to visibility is described. A method for predicting human response to visibility impairments must consider behavioral, psychophysiological, and psychological aspects of human response to the environment. Human perceptual thresholds corresponding to objective measurements of visibility impairment must be determined. The ability of humans to distinguish between natural and anthropogenic visibility impairments occurring simultaneously at a given setting must be considered. Economic, social, and psychological costs and benefits of protecting visibility on Class I lands must be identified. (2 diagrams, 17 references)

  2. Monitoring Regulatory Immune Responses in Tumor Immunotherapy Clinical Trials

    PubMed Central

    Olson, Brian M.; McNeel, Douglas G.

    2013-01-01

    While immune monitoring of tumor immunotherapy often focuses on the generation of productive Th1-type inflammatory immune responses, the importance of regulatory immune responses is often overlooked, despite the well-documented effects of regulatory immune responses in suppressing anti-tumor immunity. In a variety of malignancies, the frequency of regulatory cell populations has been shown to correlate with disease progression and a poor prognosis, further emphasizing the importance of characterizing the effects of immunotherapy on these populations. This review focuses on the role of suppressive immune populations (regulatory T cells, myeloid-derived suppressor cells, and tumor-associated macrophages) in inhibiting anti-tumor immunity, how these populations have been used in the immune monitoring of clinical trials, the prognostic value of these responses, and how the monitoring of these regulatory responses can be improved in the future. PMID:23653893

  3. Immune Response of Amebiasis and Immune Evasion by Entamoeba histolytica

    PubMed Central

    Nakada-Tsukui, Kumiko; Nozaki, Tomoyoshi

    2016-01-01

    Entamoeba histolytica is a protozoan parasite and the causative agent of amebiasis. It is estimated approximately 1% of humans are infected with E. histolytica, resulting in an estimate of 100,000 deaths annually. Clinical manifestations of amebic infection range widely from asymptomatic to severe symptoms, including dysentery and extra-intestinal abscesses. Like other infectious diseases, it is assumed that only ~20% of infected individuals develop symptoms, and genetic factors of both the parasite and humans as well as the environmental factors, e.g., microbiota, determine outcome of infection. There are multiple essential steps in amebic infection: degradation of and invasion into the mucosal layer, adherence to the intestinal epithelium, invasion into the tissues, and dissemination to other organs. While the mechanisms of invasion and destruction of the host tissues by the amebae during infection have been elucidated at the molecular levels, it remains largely uncharacterized how the parasite survive in the host by evading and attacking host immune system. Recently, the strategies for immune evasion by the parasite have been unraveled, including immunomodulation to suppress IFN-γ production, elimination of immune cells and soluble immune mediators, and metabolic alterations against reactive oxygen and nitrogen species to fend off the attack from immune system. In this review, we summarized the latest knowledge on immune reaction and immune evasion during amebiasis. PMID:27242782

  4. Immune Response of Amebiasis and Immune Evasion by Entamoeba histolytica.

    PubMed

    Nakada-Tsukui, Kumiko; Nozaki, Tomoyoshi

    2016-01-01

    Entamoeba histolytica is a protozoan parasite and the causative agent of amebiasis. It is estimated approximately 1% of humans are infected with E. histolytica, resulting in an estimate of 100,000 deaths annually. Clinical manifestations of amebic infection range widely from asymptomatic to severe symptoms, including dysentery and extra-intestinal abscesses. Like other infectious diseases, it is assumed that only ~20% of infected individuals develop symptoms, and genetic factors of both the parasite and humans as well as the environmental factors, e.g., microbiota, determine outcome of infection. There are multiple essential steps in amebic infection: degradation of and invasion into the mucosal layer, adherence to the intestinal epithelium, invasion into the tissues, and dissemination to other organs. While the mechanisms of invasion and destruction of the host tissues by the amebae during infection have been elucidated at the molecular levels, it remains largely uncharacterized how the parasite survive in the host by evading and attacking host immune system. Recently, the strategies for immune evasion by the parasite have been unraveled, including immunomodulation to suppress IFN-γ production, elimination of immune cells and soluble immune mediators, and metabolic alterations against reactive oxygen and nitrogen species to fend off the attack from immune system. In this review, we summarized the latest knowledge on immune reaction and immune evasion during amebiasis.

  5. Humoral and Cellular Immune Response in Canine Hypothyroidism.

    PubMed

    Miller, J; Popiel, J; Chełmońska-Soyta, A

    2015-07-01

    Hypothyroidism is one of the most common endocrine diseases in dogs and is generally considered to be autoimmune in nature. In human hypothyroidism, the thyroid gland is destroyed by both cellular (i.e. autoreactive helper and cytotoxic T lymphocytes) and humoral (i.e. autoantibodies specific for thyroglobulin, thyroxine and triiodothyronine) effector mechanisms. Other suggested factors include impaired peripheral immune suppression (i.e. the malfunction of regulatory T cells) or an additional pro-inflammatory effect of T helper 17 lymphocytes. The aim of this study was to evaluate immunological changes in canine hypothyroidism. Twenty-eight clinically healthy dogs, 25 hypothyroid dogs without thyroglobulin antibodies and eight hypothyroid dogs with these autoantibodies were enrolled into the study. There were alterations in serum proteins in hypothyroid dogs compared with healthy controls (i.e. raised concentrations of α-globulins, β2- and γ-globulins) as well as higher concentration of acute phase proteins and circulating immune complexes. Hypothyroid animals had a lower CD4:CD8 ratio in peripheral blood compared with control dogs and diseased dogs also had higher expression of interferon γ (gene and protein expression) and CD28 (gene expression). Similar findings were found in both groups of hypothyroid dogs. Canine hypothyroidism is therefore characterized by systemic inflammation with dominance of a cellular immune response.

  6. Autosomal recessive PGM3 mutations link glycosylation defects to atopy, immune deficiency, autoimmunity, and neurocognitive impairment

    PubMed Central

    Zhang, Yu; Yu, Xiaomin; Ichikawa, Mie; Lyons, Jonathan J.; Datta, Shrimati; Lamborn, Ian T.; Jing, Huie; Kim, Emily S.; Biancalana, Matthew; Wolfe, Lynne A.; DiMaggio, Thomas; Matthews, Helen F.; Kranick, Sarah M.; Stone, Kelly D.; Holland, Steven M.; Reich, Daniel S.; Hughes, Jason D.; Mehmet, Huseyin; McElwee, Joshua; Freeman, Alexandra F.; Freeze, Hudson H.; Su, Helen C.; Milner, Joshua D.

    2014-01-01

    Background Identifying genetic syndromes that lead to significant atopic disease can open new pathways for investigation and intervention in allergy. Objective To define a genetic syndrome of severe atopy, elevated serum IgE, immune deficiency, autoimmunity, and motor and neurocognitive impairment. Methods Eight patients from two families who had similar syndromic features were studied. Thorough clinical evaluations, including brain MRI and sensory evoked potentials, were performed. Peripheral lymphocyte flow cytometry, antibody responses, and T cell cytokine production were measured. Whole exome sequencing was performed to identify disease-causing mutations. Immunoblotting, qRT-PCR, enzymatic assays, nucleotide sugar and sugar phosphate analyses along with MALDI-TOF mass spectrometry of glycans were used to determine the molecular consequences of the mutations. Results Marked atopy and autoimmunity were associated with increased TH2 and TH17 cytokine production by CD4+ T cells. Bacterial and viral infection susceptibility were noted along with T cell lymphopenia, particularly of CD8+ T cells, and reduced memory B cells. Apparent brain hypomyelination resulted in markedly delayed evoked potentials and likely contributed to neurological abnormalities. Disease segregated with novel autosomal recessive mutations in a single gene, phosphoglucomutase 3 (PGM3). Although PGM3 protein expression was variably diminished, impaired function was demonstrated by decreased enzyme activity and reduced UDP-GlcNAc, along with decreased O- and N-linked protein glycosylation in patients’ cells. These results define a new Congenital Disorder of Glycosylation. Conclusions Autosomal recessive, hypomorphic PGM3 mutations underlie a disorder of severe atopy, immune deficiency, autoimmunity, intellectual disability and hypomyelination. PMID:24589341

  7. Impairment of blood brain barrier is related with the neuroinflammation induced peripheral immune status in intracerebroventricular colchicine injected rats: An experimental study with mannitol.

    PubMed

    Sil, Susmita; Ghosh, Arijit; Ghosh, Tusharkanti

    2016-09-01

    The neurodegeneration in AD patients may be associated with changes of peripheral immune responses. Some peripheral immune responses are altered due to neuroinflammation in colchicine induced AD (cAD) rats. The leaky blood brain barrier (BBB) in cAD-rats may be involved in inducing peripheral inflammation, though there is no report in this regard. Therefore, the present study was designed to investigate the role of BBB in cADrats by altering the BBB in a time dependent manner with injection (i.v.) of mannitol (BBB opener). The inflammatory markers in the brain and serum along with the peripheral immune responses were measured after 30 and 60min of mannitol injection in cAD rats. The results showed higher inflammatory markers in the hippocampus and serum along with alterations in peripheral immune parameters in cAD rats. Although the hippocampal inflammatory markers did not further change after mannitol injection in cAD rats, the serum inflammatory markers and peripheral immune responses were altered and these changes were greater after 60min than that of 30min of mannitol injection. The present study shows that the peripheral immune responses in cAD rats after 30 and 60min of mannitol injection are related to magnitude of impairment of BBB in these conditions. It can be concluded from this study that impairment of BBB in cAD rats is related to the changes of peripheral immune responses observed in that condition.

  8. Immune responses to coiled coil supramolecular biomaterials.

    PubMed

    Rudra, Jai S; Tripathi, Pulak K; Hildeman, David A; Jung, Jangwook P; Collier, Joel H

    2010-11-01

    Self-assembly has been increasingly utilized in recent years to create peptide-based biomaterials for 3D cell culture, tissue engineering, and regenerative medicine, but the molecular determinants of these materials' immunogenicity have remained largely unexplored. In this study, a set of molecules that self-assembled through coiled coil oligomerization was designed and synthesized, and immune responses against them were investigated in mice. Experimental groups spanned a range of oligomerization behaviors and included a peptide from the coiled coil region of mouse fibrin that did not form supramolecular structures, an engineered version of this peptide that formed coiled coil bundles, and a peptide-PEG-peptide triblock bioconjugate that formed coiled coil multimers and supramolecular aggregates. In mice, the native peptide and engineered peptide did not produce any detectable antibody response, and none of the materials elicited detectable peptide-specific T cell responses, as evidenced by the absence of IL-2 and interferon-gamma in cultures of peptide-challenged splenocytes or draining lymph node cells. However, specific antibody responses were elevated in mice injected with the multimerizing peptide-PEG-peptide. Minimal changes in secondary structure were observed between the engineered peptide and the triblock peptide-PEG-peptide, making it possible that the triblock's multimerization was responsible for this antibody response.

  9. Precision Immunization: NASA Studies Immune Response to Flu Vaccine

    NASA Image and Video Library

    NASA Human Research Program Twins Study investigator Emmanuel Mignot, M.D., Ph.D, known for discovering the cause of narcolepsy is related to the immune system, is studying twin astronauts Scott an...

  10. Neuroendocrine and Immune System Responses with Spaceflights

    NASA Technical Reports Server (NTRS)

    Tipton, Charles M.; Greenleaf, John E.; Jackson, Catherine G. R.

    1996-01-01

    Despite the fact that the first human was in space during 1961 and individuals have existed in a microgravity environment for more than a year, there are limited spaceflight data available on the responses of the neuroendocrine and immune systems. Because of mutual interactions between these respective integrative systems, it is inappropriate to assume that the responses of one have no impact on functions of the other. Blood and plasma volume consistently decrease with spaceflight; hence, blood endocrine and immune constituents will be modified by both gravitational and measurement influences. The majority of the in-flight data relates to endocrine responses that influence fluids and electrolytes during the first month in space. Adrenocorticotropin (ACTH), aldo-sterone. and anti-diuretic hormone (ADH) appear to be elevated with little change in the atrial natriuretic peptides (ANP). Flight results longer than 60 d show increased ADH variability with elevations in angiotensin and cortisol. Although post-flight results are influenced by reentry and recovery events, ACTH and ADH appear to be consistently elevated with variable results being reported for the other hormones. Limited in-flight data on insulin and growth hormone levels suggest they are not elevated to counteract the loss in muscle mass. Post-flight results from short- and long-term flights indicate that thyroxine and insulin are increased while growth hormone exhibits minimal change. In-flight parathyroid hormone (PTH) levels are variable for several weeks after which they remain elevated. Post-flight PTH was increased on missions that lasted either 7 or 237 d, whereas calcitonin concentrations were increased after 1 wk but decreased after longer flights. Leukocytes are elevated in flights of various durations because of an increase in neutrophils. The majority of post-flight data indicates immunoglobulin concentrations are not significantly changed from pre-flight measurements. However, the numbers of T

  11. Neuroendocrine and Immune System Responses with Spaceflights

    NASA Technical Reports Server (NTRS)

    Tipton, Charles M.; Greenleaf, John E.; Jackson, Catherine G. R.

    1996-01-01

    Despite the fact that the first human was in space during 1961 and individuals have existed in a microgravity environment for more than a year, there are limited spaceflight data available on the responses of the neuroendocrine and immune systems. Because of mutual interactions between these respective integrative systems, it is inappropriate to assume that the responses of one have no impact on functions of the other. Blood and plasma volume consistently decrease with spaceflight; hence, blood endocrine and immune constituents will be modified by both gravitational and measurement influences. The majority of the in-flight data relates to endocrine responses that influence fluids and electrolytes during the first month in space. Adrenocorticotropin (ACTH), aldo-sterone. and anti-diuretic hormone (ADH) appear to be elevated with little change in the atrial natriuretic peptides (ANP). Flight results longer than 60 d show increased ADH variability with elevations in angiotensin and cortisol. Although post-flight results are influenced by reentry and recovery events, ACTH and ADH appear to be consistently elevated with variable results being reported for the other hormones. Limited in-flight data on insulin and growth hormone levels suggest they are not elevated to counteract the loss in muscle mass. Post-flight results from short- and long-term flights indicate that thyroxine and insulin are increased while growth hormone exhibits minimal change. In-flight parathyroid hormone (PTH) levels are variable for several weeks after which they remain elevated. Post-flight PTH was increased on missions that lasted either 7 or 237 d, whereas calcitonin concentrations were increased after 1 wk but decreased after longer flights. Leukocytes are elevated in flights of various durations because of an increase in neutrophils. The majority of post-flight data indicates immunoglobulin concentrations are not significantly changed from pre-flight measurements. However, the numbers of T

  12. Impact of nutrition on immune function and the inflammatory response

    USDA-ARS?s Scientific Manuscript database

    The review utilizes data on three micronutrients (vitamin A, zinc and iron), anthropometrically defined undernutrition (stunting, wasting and underweight) and obesity to evaluate the effect on immune function, recovery of immune function in response to nutritional interventions, related health outco...

  13. Anaesthetic impairment of immune function is mediated via GABA(A) receptors.

    PubMed

    Wheeler, Daniel W; Thompson, Andrew J; Corletto, Federico; Reckless, Jill; Loke, Justin C T; Lapaque, Nicolas; Grant, Andrew J; Mastroeni, Pietro; Grainger, David J; Padgett, Claire L; O'Brien, John A; Miller, Nigel G A; Trowsdale, John; Lummis, Sarah C R; Menon, David K; Beech, John S

    2011-02-24

    GABA(A) receptors are members of the Cys-loop family of neurotransmitter receptors, proteins which are responsible for fast synaptic transmission, and are the site of action of wide range of drugs. Recent work has shown that Cys-loop receptors are present on immune cells, but their physiological roles and the effects of drugs that modify their function in the innate immune system are currently unclear. We are interested in how and why anaesthetics increase infections in intensive care patients; a serious problem as more than 50% of patients with severe sepsis will die. As many anaesthetics act via GABA(A) receptors, the aim of this study was to determine if these receptors are present on immune cells, and could play a role in immunocompromising patients. We demonstrate, using RT-PCR, that monocytes express GABA(A) receptors constructed of α1, α4, β2, γ1 and/or δ subunits. Whole cell patch clamp electrophysiological studies show that GABA can activate these receptors, resulting in the opening of a chloride-selective channel; activation is inhibited by the GABA(A) receptor antagonists bicuculline and picrotoxin, but not enhanced by the positive modulator diazepam. The anaesthetic drugs propofol and thiopental, which can act via GABA(A) receptors, impaired monocyte function in classic immunological chemotaxis and phagocytosis assays, an effect reversed by bicuculline and picrotoxin. Our results show that functional GABA(A) receptors are present on monocytes with properties similar to CNS GABA(A) receptors. The functional data provide a possible explanation as to why chronic propofol and thiopental administration can increase the risk of infection in critically ill patients: their action on GABA(A) receptors inhibits normal monocyte behaviour. The data also suggest a potential solution: monocyte GABA(A) receptors are insensitive to diazepam, thus the use of benzodiazepines as an alternative anesthetising agent may be advantageous where infection is a life

  14. Standard radiotherapy but not chemotherapy impairs systemic immunity in non-small cell lung cancer

    PubMed Central

    Talebian Yazdi, Mehrdad; Schinkelshoek, Mink S.; Loof, Nikki M.; Taube, Christian; Hiemstra, Pieter S.; Welters, Marij J. P.; van der Burg, Sjoerd H.

    2016-01-01

    ABSTRACT Introduction: Advanced non-small cell lung cancer (NSCLC) is traditionally treated with platinum-based chemotherapy and radiotherapy. Since immunotherapy holds promise for treating advanced NSCLC, we assessed the systemic effects of the traditional therapies for NSCLC on immune cell composition and function. Methods: 84 pulmonary adenocarcinoma patients, treated either with chemotherapy or radiotherapy, were studied. A prospective study of 23 patients was conducted in which the myeloid and lymphoid cell compartments of peripheral blood were analyzed. Changes in cell populations were validated in a retrospective cohort of 61 adenocarcinoma patients using automated differential counts collected throughout therapy. Furthermore, the functional capacity of circulating T cells and antigen-presenting cells (APC) was studied. Blood samples of healthy individuals were used as controls. Results: In comparison to healthy controls, untreated adenocarcinoma patients display an elevated frequency of myeloid cells coinciding with relative lower frequencies of lymphocytes and dendritic cells. Standard chemotherapy had no overt effects on myeloid and lymphoid cell composition nor on T-cell and APC-function. In contrast, patients treated with radiotherapy displayed a decrease in lymphoid cells and a relative increase in monocytes/macrophages. Importantly, these changes were associated with a reduced APC function and an impaired response of T cells to recall antigens. Conclusions: Platinum-based standard of care chemotherapy for NSCLC has no profound negative effect on the immune cell composition and function. The negative effect of prolonged low-dose radiotherapy on the immune system warrants future studies on the optimal dose and fraction of radiotherapy when combined with immunotherapy. PMID:28123900

  15. The interplay between the microbiome and the adaptive immune response in cancer development

    PubMed Central

    Russo, Edda; Taddei, Antonio; Ringressi, Maria Novella; Ricci, Federica; Amedei, Amedeo

    2016-01-01

    The data from different studies suggest a bacterial role in cancer genesis/progression, often modulating the local immune response. This is particularly so at the mucosal level where the bacterial presence is strong and the immune system is highly reactive. The epithelial surfaces of the body, such as the skin and mucosa, are colonized by a vast number of microorganisms, which represent the so-called normal microbiome. Normally the microbiome does not cause a proinflammatory response because the immune system has developed different strategies for the tolerance of commensal bacteria, but when these mechanisms are impaired or new pathogenic bacteria are introduced into this balanced system, the immune system reacts to the microbiome and can trigger tumor growth in the intestine. In this review, we discuss the potential role of the bacterial microbiome in carcinogenesis, focusing on the direct and indirect immune adaptive mechanisms, that the bacteria can modulate in different ways. PMID:27366226

  16. DNase II deficiency impairs innate immune function in Drosophila.

    PubMed

    Seong, Chang-Soo; Varela-Ramirez, Armando; Aguilera, Renato J

    2006-03-01

    DNase II enzymes are highly conserved proteins that are required for the degradation of DNA within phagolysosomes. Engulfment of apoptotic cells and/or bacteria by phagocytic cells requires the function of DNase II to completely destroy ingested DNA. Mutation of the dnase II gene results in an increase of undegraded apoptotic DNA within phagocytic cells in mice and nematodes. Additionally, reduction of DNase II enzymatic activity in Drosophila melanogaster has been shown to lead to increased accumulation of DNA in the ovaries. Due to the importance of DNA clearance during infection, we hypothesized that a severe reduction of DNase II activity would result in diminished immune function and viability. To test this hypothesis, we knocked down DNase II activity in flies using RNAi. As expected, expression of a dnase II-RNAi construct in flies resulted in a dramatic reduction of DNase II activity and a significant decrease in total hemocyte numbers. Furthermore, infection of dnase II-RNAi flies with Gram negative or positive bacteria resulted in a severe reduction in fly viability. These results confirm that DNase II and the ability to clear macromolecular DNA is essential for maintaining proper immune function in Drosophila.

  17. Virus-like particle (VLP) lymphatic trafficking and immune response generation after immunization by different routes.

    PubMed

    Cubas, Rafael; Zhang, Sheng; Kwon, Sunkuk; Sevick-Muraca, Eva M; Li, Min; Chen, Changyi; Yao, Qizhi

    2009-01-01

    Virus-like particles (VLPs) have gained increasing interest for their use as vaccines due to their repetitive antigenic structure that is capable of efficiently activating the immune system. The efficacy of VLP immunization may lie in its ability to traffic into draining lymph nodes while activating antigen-presenting cells to initiate the orchestration of signals required for the development of a robust immune response. Currently, there is no comprehensive study showing the correlation of different VLP vaccination routes to immune outcome. In this study, we took an optical imaging approach to directly visualize the trafficking of simian-human immunodeficiency (SHIV) VLPs after immunization by commonly used routes and analyzed the corresponding humoral and cellular immune responses generated. We found that VLPs can easily enter the subcapsular sinus of draining lymph nodes with quantitative differences in the number of lymph node involvement depending on the immunization route used. Intradermal immunization led to the largest level of lymph node involvement for the longest period of time, which correlated with the strongest humoral and cellular immune responses. Flow cytometry analysis from extracted splenocytes showed that intradermal immunization led to the largest population of germinal center and activated B cells, which translated into higher antibody levels and antigen-specific cytotoxic T lymphocyte responses. Our results indicate that VLPs traffic into lymph nodes upon immunization and can be directly visualized by optical imaging techniques. Intradermal immunization showed improved responses and might be a preferable delivery route to use for viral and cancer immunotherapeutic studies involving VLPs.

  18. Ontogeny of the Bovine Immune Response 1

    PubMed Central

    Schultz, R. D.; Dunne, H. W.; Heist, C. E.

    1973-01-01

    The ontogenesis of the bovine immune response was studied in three embryos (<40 days) and 106 fetuses of various ages. In the absence of overt antigenic stimulation, fetuses had lymphoid development of the thymus at 42 days of gestation, the spleen was structurally present at 55 days, and certain peripheral lymph nodes were present at 60 days. Mesenteric lymph nodes were structurally present by 100 days of gestation, and lymphoid tissue of the gastrointestinal tract, particularly the lower ileum, was observed in histologic sections of a 175-day fetus with a bacterial infection. Pyroninophilic cells, plasma cells, and germinal centers were present in lymph node sections of antigenically stimulated fetuses. Lymphoid tissue developed more rapidly in fetuses with bacteria, viral antigens, or apparent maternal red-blood-cell antigens than in the normal fetus. Thymic and splenic indices reached maximal values in the 205- to 220-day fetal age group. Immunoglobulin M (IgM)-containing cells were first observed, by immunofluorescence, in a single fetus at 59 days of gestation. Immunoglobulin G (IgG)-containing cells were observed at 145 days of gestation in one fetus with a bacterial and viral infection. IgM-containing cells were observed in 36 fetuses and IgM and IgG cells were present in seven fetuses. Spleen, lymph nodes, thymus, bone marrow, and liver of one fetus from a dam with lymphosarcoma had immunoglobulin-containing cells. Hemal lymph nodes, blood (buffy coat), Peyer patches, and heart and lung sections from fetuses with immunoglobulin-containing cells in spleen or lymph node did not have immunoglobulin-containing cells. Antigens of the virus of bovine virus diarrhea-mucosal disease (BVD) were detected in one fetus, and antigens of infectious bovine rhinotracheitis (IBR) virus were detected in three fetuses; however, viruses were not isolated in primary bovine embryonic kidney cells. Two of the three fetuses with IBR virus antigens had neutralizing serum antibody

  19. Local Immune Response in Helicobacter pylori Infection

    PubMed Central

    Kivrak Salim, Derya; Sahin, Mehmet; Köksoy, Sadi; Adanir, Haydar; Süleymanlar, Inci

    2016-01-01

    Abstract There have been few studies concerning the cytokine profiles in gastric mucosa of Helicobacter pylori–infected patients with normal mucosa, chronic gastritis, and gastric carcinoma (GAC). In the present study, we aimed to elucidate the genomic expression levels and immune pathological roles of cytokines—interferon (IFN)-γ, tumor necrosis factor (TNF)-α, interleukin (IL)-4, IL-6, IL-10, transforming growth factor (TGF)-β, IL-17A, IL-32—in H pylori–infected patients with normal gastric mucosa (NGM; control), chronic active gastritis (CAG), and GAC. Genomic expression levels of these cytokines were assayed by real-time PCR analysis in gastric biopsy specimens obtained from 93 patients. We found that the genomic expression levels of IFN-γ, TNF-α, IL-6, IL-10, IL-17A mRNA were increased in the CAG group and those of TNF-α, IL-6, IL-10, IL-17A, TGF-β mRNA were increased in the GAC group with reference to H pylori–infected NGM group. This study is on the interest of cytokine profiles in gastric mucosa among individuals with normal, gastritis, or GAC. Our findings suggest that the immune response of gastric mucosa to infection of H pylori differs from patient to patient. For individual therapy, levels of genomic expression of IL-6 or other cytokines may be tracked in patients. PMID:27196487

  20. Immune response in the turtle (Chrysemys picta)

    PubMed Central

    Coe, J. E.

    1972-01-01

    The immune response of painted turtles (Chrysemys picta) to four purified protein antigens was evaluated by radioimmunoelectrophoresis. Specific antibody production was consistently detected and antigen binding was related to four immunoglobulin (Ig) precipitin lines (called Ig1, 2, 3, 4) in turtle serum. Antibody activity was detected first in the Ig1 or Ig2 and then later in the course of immunization in Ig3 and Ig4. Ig1 was about 19S in size, was not detectable after reduction and alkylation, and was the only Ig absent from turtle lymph. Ig3 and Ig4 were about 7S in size and Ig2 appeared slightly heavier by sucrose density gradient and Sephadex G-200 analysis. Haemagglutinins produced after primary inoculation were routinely sensitive to mild reduction and alkylation although antigen-binding capacity was still detectable. However, mercaptoethanol-resistant haemagglutinins were found in sera from turtles after booster injections of antigen. The electrophoretically slowest gamma globulin in turtle serum did not develop specific antigen-binding capacity, but did bind Fe59 and presumably represents a transferrin-like protein. ImagesFIG. 1FIG. 2FIG. 4 PMID:4114647

  1. Extracellular Adenosine Mediates a Systemic Metabolic Switch during Immune Response

    PubMed Central

    Bajgar, Adam; Kucerova, Katerina; Jonatova, Lucie; Tomcala, Ales; Schneedorferova, Ivana; Okrouhlik, Jan; Dolezal, Tomas

    2015-01-01

    Immune defense is energetically costly, and thus an effective response requires metabolic adaptation of the organism to reallocate energy from storage, growth, and development towards the immune system. We employ the natural infection of Drosophila with a parasitoid wasp to study energy regulation during immune response. To combat the invasion, the host must produce specialized immune cells (lamellocytes) that destroy the parasitoid egg. We show that a significant portion of nutrients are allocated to differentiating lamellocytes when they would otherwise be used for development. This systemic metabolic switch is mediated by extracellular adenosine released from immune cells. The switch is crucial for an effective immune response. Preventing adenosine transport from immune cells or blocking adenosine receptor precludes the metabolic switch and the deceleration of development, dramatically reducing host resistance. Adenosine thus serves as a signal that the “selfish” immune cells send during infection to secure more energy at the expense of other tissues. PMID:25915062

  2. Differential Impairment of Interferon-γ Responses in Two Cases of Pulmonary Nontuberculous Mycobacterial Disease

    PubMed Central

    Gao, Yifang; Eren, Efrem; Döffinger, Rainer; Marshall, Ben; Williams, Anthony P.

    2016-01-01

    Nontuberculous mycobacteria (NTMs) are weakly virulent intracellular pathogens that are common in food and water supplies. The persistent culture of these organisms in the setting of clinical infection warrants investigation of immune function. In cases of isolated pulmonary NTM (PNTM) disease, underlying immune defects have not been clearly identified. We present two patients with isolated PNTM infection who demonstrated differentially impaired IFN-γ production across a range of stimuli. These cases show that cellular IFN-γ responses may be defective in a proportion of patient suffering PNTM disease and that when assessing responses, the stimulant used in the testing is important to delineate defective cell populations. Impaired IFN-γ responses to IL-12 + BCG seem to be a poor prognostic indicator in PNTM disease and in these cases were not improved by adjuvant IFN-γ. PMID:27974980

  3. The immune response and its therapeutic modulation in bronchiectasis.

    PubMed

    Daheshia, Massoud; Prahl, James D; Carmichael, Jacob J; Parrish, John S; Seda, Gilbert

    2012-01-01

    Bronchiectasis (BC) is a chronic pulmonary disease with tremendous morbidity and significant mortality. As pathogen infection has been advocated as a triggering insult in the development of BC, a central role for the immune response in this process seems obvious. Inflammatory cells are present in both the airways as well as the lung parenchyma, and multiple mediators of immune cells including proteases and cytokines or their humoral products are increased locally or in the periphery. Interestingly, a defect in the immune system or suppression of immune response during conditions such as immunodeficiency may well predispose one to the devastating effects of BC. Thus, the outcome of an active immune response as detrimental or protective in the pathogenesis of BC may be dependent on the state of the patient's immunity, the severity of infection, and the magnitude of immune response. Here we reassess the function of the innate and acquired immunity in BC, the major sites of immune response, and the nature of the bioactive mediators. Furthermore, the potential link(s) between an ongoing immune response and structural alterations accompanying the disease and the success of therapies that can modulate the nature and extent of immune response in BC are elaborated upon.

  4. Cell-autonomous stress responses in innate immunity.

    PubMed

    Moretti, Julien; Blander, J Magarian

    2017-01-01

    The innate immune response of phagocytes to microbes has long been known to depend on the core signaling cascades downstream of pattern recognition receptors (PRRs), which lead to expression and production of inflammatory cytokines that counteract infection and induce adaptive immunity. Cell-autonomous responses have recently emerged as important mechanisms of innate immunity. Either IFN-inducible or constitutive, these processes aim to guarantee cell homeostasis but have also been shown to modulate innate immune response to microbes and production of inflammatory cytokines. Among these constitutive cell-autonomous responses, autophagy is prominent and its role in innate immunity has been well characterized. Other stress responses, such as metabolic stress, the ER stress/unfolded protein response, mitochondrial stress, or the DNA damage response, seem to also be involved in innate immunity, although the precise mechanisms by which they regulate the innate immune response are not yet defined. Of importance, these distinct constitutive cell-autonomous responses appear to be interconnected and can also be modulated by microbes and PRRs, which add further complexity to the interplay between innate immune signaling and cell-autonomous responses in the mediation of an efficient innate immune response.

  5. Intrauterine Growth Restriction Impairs Small Intestinal Mucosal Immunity in Neonatal Piglets

    PubMed Central

    Dong, Li; Zhong, Xiang; Ahmad, Hussain; Li, Wei; Wang, Yuanxiao; Zhang, Lili

    2014-01-01

    Intrauterine growth restriction (IUGR) is a very common problem in both piglet and human neonate populations. We hypothesized that IUGR neonates have impaired intestinal mucosal immunity from birth. Using neonatal piglets as IUGR models, immune organ weights, the weight and length of the small intestine (SI), intestinal morphology, intraepithelial immune cell numbers, levels of cytokines and immunoglobulins, and the relative gene expression of cytokines in the SI were investigated. IUGR neonatal piglets were observed to have lower absolute immune organ weight and SI length, decreased relative weights of the thymus, spleen, mesenteric lymph node, and thinner but longer SIs. Damaged and jagged villi, shorter microvilli, presence of autophagosomes, swelled mitochondria, and decreased villus surface areas were also found in the SIs of IUGR neonatal piglets. We also found a smaller number of epithelial goblet cells and lymphocytes in the SIs of IUGR neonates. In addition, we detected reduced levels of the cytokines TNF-α and IFN-γ and decreased gene expression of cytokines in IUGR neonates. In conclusion, IUGR was shown to impair the mucosal immunity of the SI in neonatal piglets, and the ileum was the major site of impairment. PMID:24710659

  6. Meeting report VLPNPV: Session 3: Immune responses.

    PubMed

    Morrison, Trudy G

    2014-01-01

    Virus-like particles (VLPs) and nano-particles (NP) are increasingly considered for both prophylactic and therapeutic vaccines for a wide variety of human and animal diseases. Indeed, 2 VLPs have already been licensed for use in humans, the human papilloma virus vaccine and the hepatitis B virus vaccine. (1) Reflecting this increased interest, a second international conference with a specific focus on VLPs and NP was held at the Salk Institute for Biological Studies in La Jolla, California, in June 2014. Approximately 100 attendees, hailing from many nations, came from academic institutions, research institutes, and biotech companies. A wide variety of topics were discussed, ranging from development and characterization of specific VLP and NP vaccine candidates to methods of production of these particles. Session three was focused on the general question of immune responses to VLPs.

  7. Natural selection on immune responsiveness in blue tits Parus caeruleus.

    PubMed

    Råberg, Lars; Stjernman, Martin

    2003-07-01

    What is the form of natural selection on immune responsiveness? For a population at evolutionary equilibrium, there are two different scenarios. First, it is generally assumed that immune defense has both benefits and costs. If variation in immune responsiveness is due to variation in how individuals trade off these costs and benefits, one would expect immune responsiveness to be subject to stabilizing selection. Second, it is well known that an individual's immune responsiveness is often dependent on its overall condition. If immune responsiveness is condition-dependent, one would expect immune responsiveness to be under positive directional selection. We would therefore expect that the form of natural selection on immune responsiveness depends on the relative magnitude of these two sources of variation: variation in how individuals trade off the costs and benefits of defense, and variation in condition. We measured primary and secondary antibody responsiveness to diphtheria-tetanus vaccine in blue tits during winter and investigated the relationship between responsiveness and survival to the following breeding season. We use responsiveness to these antigens as measures of an individual's ability or propensity to mount an antibody response in case of an infection. Interestingly, different measures of responsiveness were subject to different selective regimes: primary responsiveness to diphtheria was subject to stabilizing selection, whereas secondary responsiveness to tetanus was subject to positive directional selection. In contrast, there was no significant selection on primary responsiveness to tetanus or secondary responsiveness to diphtheria. The finding of stabilizing selection on a measure of responsiveness is evidence that immune defense can incur fitness costs; a central but little-tested assumption of theories of the ecology and evolution of immunological defense. The finding of directional selection on a measure of responsiveness is consistent with the

  8. Immune response of pregnant cows to bovine rotavirus immunization.

    PubMed

    Saif, L J; Smith, K L; Landmeier, B J; Bohl, E H; Theil, K W; Todhunter, D A

    1984-01-01

    Fifteen pregnant Holstein cows were freely assigned to 3 experimental groups (5 cows in each group). Cows in group I were inoculated IM and intramammarily (IMm) with Ohio Agricultural Research and Development Center (OARDC) tissue culture-propagated modified-live Nebraska calf diarrhea bovine rotavirus with added adjuvant (OARDC vaccine-immunized cows). Group II cows were given IM injections of a commercial modified-live rotavirus-coronavirus vaccine (commercial vaccine-immunized cows), and the remaining 5 cows were noninoculated controls (group III). Rotavirus antibody in colostrum and milk was mainly associated with immunoglobulin (Ig)G1, and less so with IgG2, IgA, and IgM, as analyzed by the enzyme-linked immunosorbent assay (ELISA), using monospecific anti-bovine IgG1, IgG2, IgM, and IgA sera. In serum, the rotavirus antibody was distributed almost equally between IgG1 and IgG2. The same relationships appeared in both immunized and nonvaccinated cows. All OARDC vaccine-injected cows had virus-neutralization (VN) and ELISA IgG1 rotavirus antibody titers in serum and mammary secretions at significantly increased levels (at least 100-fold; P less than 0.05) compared with the titers in groups II (commercial vaccine-immunized cows) and III (controls). Serum, colostrum, and milk antibody titers from these latter 2 groups did not differ statistically. The ELISA IgG2, IgA, and IgM rotavirus antibody titers also were significantly greater in mammary secretions from OARDC vaccine-immunized cows than in groups II and III cows. There was a high correlation between ELISA IgG1 and VN rotavirus antibody titers for all samples tested (r = 0.97, P less than 0.001), but ELISA IgG1 antibody titers were consistently higher than VN titers. The ELISA IgG1 and VN antibody titers of milk samples collected from cows 30 days after parturition were higher from the OARDC vaccine-immunized cows (ELISA IgG1, geometric mean titer (GMT) = 3,511; VN GMT = 1,689) than were titers from the

  9. Chemical agents and the immune response.

    PubMed Central

    Luster, M I; Rosenthal, G J

    1993-01-01

    Our desire to understand the potential adverse human health effects of environmental chemical exposure has coincided with an increased understanding of the immune system and an appreciation of its complex regulatory network. This has spawned a broad interest in the area of immunotoxicology within the scientific community as well as certain concerns in the public sector regarding chemical-induced hypersensitivity and immunosuppression. The incidence of alleged human sensitization to chemicals has increased, in part, due to the fact that chemical companies are moving to larger and/or different markets. It has been estimated that 35 million Americans suffer from allergic disease, of which 2-5% are from occupational exposure. Although there is not yet a clear understanding of dose-response relationships or disease predisposition, there are many well-defined examples (isocyanates, anhydrides) of chemical sensitizers in humans and experimental animals. Evidence that chemicals suppress immune responses in humans is considerably less well established, although there is a public perception that chemicals generally cause immunosuppression. This perception has been fueled by highly publicized legal cases and scientific controversies within the academic and industrial communities. As a consequence of these public and scientific concerns, many of the regulatory agencies are developing immunotoxicity testing guidelines. At the present, however, there are limitations on adequate human methodology and data that allow the extrapolation of animal data to assess human risk. The potential for human immunosuppression remains of concern, however, because of a large database generated from animal studies that demonstrates immunosuppression as well as reports of immunosuppression in humans inadvertently (e.g., halogenated aromatic hydrocarbons) or occupationally (asbestos, benzene) exposed to xenobiotics.(ABSTRACT TRUNCATED AT 250 WORDS) Images FIGURE 1. PMID:8354170

  10. Population-expression models of immune response

    NASA Astrophysics Data System (ADS)

    Stromberg, Sean P.; Antia, Rustom; Nemenman, Ilya

    2013-06-01

    The immune response to a pathogen has two basic features. The first is the expansion of a few pathogen-specific cells to form a population large enough to control the pathogen. The second is the process of differentiation of cells from an initial naive phenotype to an effector phenotype which controls the pathogen, and subsequently to a memory phenotype that is maintained and responsible for long-term protection. The expansion and the differentiation have been considered largely independently. Changes in cell populations are typically described using ecologically based ordinary differential equation models. In contrast, differentiation of single cells is studied within systems biology and is frequently modeled by considering changes in gene and protein expression in individual cells. Recent advances in experimental systems biology make available for the first time data to allow the coupling of population and high dimensional expression data of immune cells during infections. Here we describe and develop population-expression models which integrate these two processes into systems biology on the multicellular level. When translated into mathematical equations, these models result in non-conservative, non-local advection-diffusion equations. We describe situations where the population-expression approach can make correct inference from data while previous modeling approaches based on common simplifying assumptions would fail. We also explore how model reduction techniques can be used to build population-expression models, minimizing the complexity of the model while keeping the essential features of the system. While we consider problems in immunology in this paper, we expect population-expression models to be more broadly applicable.

  11. Fetal immune response following prematurely ruptured membranes.

    PubMed

    Cederqvist, L L; Francis, L C; Zervoudakis, I A; Becker, C G; Litwin, S D

    1976-10-01

    Concentrations of immunoglobulins (Ig)A1, and IgA2, IgD, IgE, IgG, and IgM have been determined in cord blood, amniotic fluid, and maternal serum in a group of patients with a history of prematurely ruptured membranes (PRM) prior to the onset of labor and in a control group of patients undergoing normal delivery and without a history of infection during pregnancy. IgA and IgD were determined by sensitive hemagglutination-inhibition tests; IgG and IgM, by radial immunodiffusion; IgE, by a radioimmunoassay. There was evidence for an immune response in 10 of 16 cases of PRM: five of 16 had increased IgA but normal IgM; three of 16 had increased IgA and IgM; two of 16 had high IgM and normal IgA in cord blood. In patients with significantly increased levels of either IgA or IgM or both, there was a decreased level of IgD. These changes are most likely the result of the immune response to ascending infection from the maternal genitals. The sensitive testing method employed could demonstrate the presence of IgD in 53 per cent of normal cord blood samples and 72 per cent of amniotic fluid samples obtained at term. IgE was found in all normal cord blood and amniotic fluid samples tested. By concentrating the amniotic fluid up to 180-fold, IgM was demonstrated in all normal samples tested. The potential importance of IgA determinations in cord blood in addition to IgM determination for detection of intrauterine infections is stressed.

  12. The innate immune response to adjuvants dictates the adaptive immune response to autoantigens.

    PubMed

    Staykova, Maria A; Liñares, David; Fordham, Susan A; Paridaen, Judith T; Willenborg, David O

    2008-06-01

    To elucidate the role of innate immunity in susceptibility to the animal model of multiple sclerosis, experimental autoimmune encephalomyelitis (EAE), we induced EAE by immunization with spinal cord homogenate (SCH) plus complete Freund adjuvant or carbonyl iron in 3 inbred rat strains. Lewis are considered "susceptible," PVG/c-Rt7a (PVG) as "semisusceptible," and Brown Norway (BN) as "resistant" to EAE. Immunization with SCH-carbonyl iron resulted in clinical disease in all 3 strains, but the pathologic features of EAE in the resistant BN and the semisusceptible PVG rats differed from those in the Lewis and PVG model of EAE induced with SCH-complete Freund adjuvant. In BN and PVG rats, there were numerous inflammatory lesions with prominent involvement of microglia and, to a lesser extent, perivascular macrophages. These data suggest that different levels of activation of the innate immune system by different adjuvants determine whether EAE will or will not develop. Accordingly, the widely accepted scale of susceptibility to EAE development (Lewis > PVG > BN) should be revised because it does not take into account the important contribution of the composition of the adjuvant to the quality and quantity of the innate immune response and, consequently, to the generation and extent of the pathogenic T-cell-mediated, that is, adaptive, autoimmune disease.

  13. Alterations in macrophages and monocytes from tumor-bearing mice: evidence of local and systemic immune impairment.

    PubMed

    Torroella-Kouri, Marta; Rodríguez, Dayron; Caso, Raul

    2013-12-01

    Macrophages are cells of the innate immune system involved in critical activities such as maintaining tissue homeostasis and immune surveillance. Pro-inflammatory macrophages M1 are responsible for the inflammatory response, while M2 macrophages are associated with the immunosuppressive repair phase of tissue remodeling. Most cancers are associated with chronic inflammation, and a high number of macrophages in tumors have been associated with tumor progression. Much effort has been made in elucidating the mechanisms through which macrophages contribute to tumor development, yet much less is known about the initial mechanisms by which tumors modify macrophages. Our work has focused on identifying the mechanisms by which macrophages from tumor hosts are modified by tumors. We have shown that peritoneal macrophages are significantly altered in mice bearing advanced mammary tumors and are not M1 or M2 polarized, but express a mixture of both transcriptional programs. These macrophages are less differentiated and more prone to apoptosis, resulting in increased myelopoiesis as a compensation to regenerate macrophage progenitors in the marrow. Macrophages in the tumor microenvironment are also neither M1 nor M2 cells and through a display of different mechanisms are even more impaired than their peripheral counterparts. Finally, systemic blood monocytes, precursors of tissue macrophages, are also altered in tumor bearers and show a mixed program of pro- and anti-inflammatory functions. We conclude that there is evidence for local and systemic immune impairment in tumor hosts.

  14. Essential oil of clove (Eugenia caryophyllata) augments the humoral immune response but decreases cell mediated immunity.

    PubMed

    Halder, Sumita; Mehta, Ashish K; Mediratta, Pramod K; Sharma, Krishna K

    2011-08-01

    The present study was undertaken to explore the effect of the essential oil isolated from the buds of Eugenia caryophyllata on some immunological parameters. Humoral immunity was assessed by measuring the hemagglutination titre to sheep red blood cells and delayed type hypersensitivity was assessed by measuring foot pad thickness. Clove oil administration produced a significant increase in the primary as well as secondary humoral immune response. In addition, it also produced a significant decrease in foot pad thickness compared with the control group. Thus, these results suggest that clove oil can modulate the immune response by augmenting humoral immunity and decreasing cell mediated immunity.

  15. Time of appearance and distribution of cells capable of secondary immune response following primary immunization

    PubMed Central

    Vischer, T. L.; Stastny, P.

    1967-01-01

    Immunological memory was studied by measurement of tritiated thymidine incorporation in tissue culture. After primary immunization with keyhole limpet haemocyanin (KLH) secondary responsiveness could be detected as early as the 2nd day after immunization with Freund's adjuvant into the footpads and on the 4th day after injection of KLH intravenously. In each case immunological memory developed first in the area of the injection, that is, the popliteal lymph nodes after footpad immunization and the spleen after intravenous injection. The secondary response could also be detected in the lymphoid cells of the blood. Cell suspensions enriched in small lymphocytes showed a similar reactivity. Cells from the thymus, however, did not develop immunological memory. Rabbits immunized with BSA showed a relatively weaker response which was clearly detectable only when Freund's adjuvant was used for immunization. The results suggest that a response essentially of a secondary type may play an important role in what is usually considered the primary immune response. PMID:6027423

  16. Staphylococcus aureus strategies to evade the host acquired immune response.

    PubMed

    Goldmann, Oliver; Medina, Eva

    2017-09-15

    Staphylococcus aureus poses a significant public-health problem. Infection caused by S. aureus can manifest as acute or long-lasting persistent diseases that are often refractory to antibiotic and are associated with significant morbidity and mortality. To develop more effective strategies for preventing or treating these infections, it is crucial to understand why the immune response is incapable to eradicate the bacterium. When S. aureus first infect the host, there is a robust activation of the host innate immune responses. Generally, S. aureus can survive this initial interaction due to the expression of a wide array of virulence factors that interfere with the host innate immune defenses. After this initial interaction the acquired immune response is the arm of the host defenses that will try to clear the pathogen. However, S. aureus is capable of maintaining infection in the host even in the presence of a robust antigen-specific immune response. Thus, understanding the mechanisms underlying the ability of S. aureus to escape immune surveillance by the acquired immune response will help uncover potentially important targets for the development of immune-based adjunctive therapies and more efficient vaccines. There are several lines of evidence that lead us to believe that S. aureus can directly or indirectly disable the acquired immune response. This review will discuss the different immune evasion strategies used by S. aureus to modulate the different components of the acquired immune defenses. Copyright © 2017 Elsevier GmbH. All rights reserved.

  17. Foot-and-Mouth Disease Virus 3C Protease Cleaves NEMO To Impair Innate Immune Signaling

    PubMed Central

    Wang, Dang; Fang, Liurong; Li, Kui; Zhong, Huijuan; Fan, Jinxiu; Ouyang, Chao; Zhang, Huan; Duan, Erzhen; Luo, Rui; Zhang, Zhongming; Liu, Xiangtao; Chen, Huanchun

    2012-01-01

    Foot-and-mouth disease is a highly contagious viral illness of wild and domestic cloven-hoofed animals. The causative agent, foot-and-mouth disease virus (FMDV), replicates rapidly, efficiently disseminating within the infected host and being passed on to susceptible animals via direct contact or the aerosol route. To survive in the host, FMDV has evolved to block the host interferon (IFN) response. Previously, we and others demonstrated that the leader proteinase (Lpro) of FMDV is an IFN antagonist. Here, we report that another FMDV-encoded proteinase, 3Cpro, also inhibits IFN-α/β response and the expression of IFN-stimulated genes. Acting in a proteasome- and caspase-independent manner, the 3Cpro of FMDV proteolytically cleaved nuclear transcription factor kappa B (NF-κB) essential modulator (NEMO), a bridging adaptor protein essential for activating both NF-κB and interferon-regulatory factor signaling pathways. 3Cpro specifically targeted NEMO at the Gln 383 residue, cleaving off the C-terminal zinc finger domain from the protein. This cleavage impaired the ability of NEMO to activate downstream IFN production and to act as a signaling adaptor of the RIG-I/MDA5 pathway. Mutations specifically disrupting the cysteine protease activity of 3Cpro abrogated NEMO cleavage and the inhibition of IFN induction. Collectively, our data identify NEMO as a substrate for FMDV 3Cpro and reveal a novel mechanism evolved by a picornavirus to counteract innate immune signaling. PMID:22718831

  18. Antibody-mediated immunity in CFW mice infected with Mycobacterium lepraemurium. Humoral immune response in murine leprosy.

    PubMed Central

    Rojas-Espinosa, O; Casoluengo-Méndez, M; Díaz, G V

    1976-01-01

    A depression in antibody-mediated immunity (AMI) measured both in terms of circulating antibody and plaque-forming cells in the spleen was observed in CFW mice infected with M. lepraemurium when sheep red blood cells (SRBC) and human gammaglobulin (HGG) were used as antigens. The impairment in AMI was evident only after 75 days of infection thereafter the antibody response to SRBC antigen progressively decreased until the last day of experimentation (135 days). Within the first 60 days of infection no alteration in AMI was observed with the HGG antigen while the response to the SRBC antigen was significantly higher in the infected animals than in uninfected controls. PMID:795574

  19. Tumor escape from immune response: mechanisms and targets of activity.

    PubMed

    Gabrilovich, Dmitry; Pisarev, Vladimir

    2003-10-01

    Immune system plays an important role in control of tumor progression. Effective antitumor immune response depends on close interaction of several elements of immune system. They include antigen-presenting cells, different subsets of T cells, B cells and NK cells. However, tumor cells developed a number of mechanisms to escape recognition and elimination by immune system. In this review we will discuss these mechanisms and address possible approaches to correct them.

  20. Delayed immune reconstitution after cord blood transplantation is characterized by impaired thymopoiesis and late memory T-cell skewing

    PubMed Central

    St. John, Lisa S.; de Lima, Marcos; McMannis, John; Rosinski, Steven; McNiece, Ian; Bryan, Susan G.; Kaur, Indreshpal; Martin, Sean; Wieder, Eric D.; Worth, Laura; Cooper, Laurence J. N.; Petropoulos, Demetrios; Molldrem, Jeffrey J.; Champlin, Richard E.; Shpall, Elizabeth J.

    2007-01-01

    Advances in immune assessment, including the development of T-cell receptor excision circle (TREC) assays of thymopoiesis, cytokine-flow cytometry assays of T-cell function, and higher-order phenotyping of T-cell maturation subsets have improved our understanding of T-cell homeostasis. Limited data exist using these methods to characterize immune recovery in adult cord blood (CB) transplant recipients, in whom infection is a leading cause of mortality. We now report the results of a single-center prospective study of T-cell immune recovery after cord blood transplantation (CBT) in a predominantly adult population. Our primary findings include the following: (1) Prolonged T lymphopenia and compensatory expansion of B and natural killer (NK) cells was evident; (2) CB transplant recipients had impaired functional recovery, although we did observe posttransplantation de novo T-cell responses to cytomegalovirus (CMV) in a subset of patients; (3) Thymopoietic failure characterized post-CBT immune reconstitution, in marked contrast to results in other transplant recipients; and (4) Thymopoietic failure was associated with late memory T-cell skewing. Our data suggest that efforts to improve outcomes in adult CB transplant recipients should be aimed at optimizing T-cell immune recovery. Strategies that improve the engraftment of lymphoid precursors, protect the thymus during pretransplant conditioning, and/or augment the recovery of thymopoiesis may improve outcomes after CBT. PMID:17671230

  1. Delayed immune reconstitution after cord blood transplantation is characterized by impaired thymopoiesis and late memory T-cell skewing.

    PubMed

    Komanduri, Krishna V; St John, Lisa S; de Lima, Marcos; McMannis, John; Rosinski, Steven; McNiece, Ian; Bryan, Susan G; Kaur, Indreshpal; Martin, Sean; Wieder, Eric D; Worth, Laura; Cooper, Laurence J N; Petropoulos, Demetrios; Molldrem, Jeffrey J; Champlin, Richard E; Shpall, Elizabeth J

    2007-12-15

    Advances in immune assessment, including the development of T-cell receptor excision circle (TREC) assays of thymopoiesis, cytokine-flow cytometry assays of T-cell function, and higher-order phenotyping of T-cell maturation subsets have improved our understanding of T-cell homeostasis. Limited data exist using these methods to characterize immune recovery in adult cord blood (CB) transplant recipients, in whom infection is a leading cause of mortality. We now report the results of a single-center prospective study of T-cell immune recovery after cord blood transplantation (CBT) in a predominantly adult population. Our primary findings include the following: (1) Prolonged T lymphopenia and compensatory expansion of B and natural killer (NK) cells was evident; (2) CB transplant recipients had impaired functional recovery, although we did observe posttransplantation de novo T-cell responses to cytomegalovirus (CMV) in a subset of patients; (3) Thymopoietic failure characterized post-CBT immune reconstitution, in marked contrast to results in other transplant recipients; and (4) Thymopoietic failure was associated with late memory T-cell skewing. Our data suggest that efforts to improve outcomes in adult CB transplant recipients should be aimed at optimizing T-cell immune recovery. Strategies that improve the engraftment of lymphoid precursors, protect the thymus during pretransplant conditioning, and/or augment the recovery of thymopoiesis may improve outcomes after CBT.

  2. Opioid peptides and innate immune response in mollusc.

    PubMed

    Liu, Dong-Wu

    2008-01-01

    The nervous and the immune systems can exchange information through opioid peptides. Furthermore, some opioid peptides can function as endogenous messengers of the immune system, and participate in an important part in the regulation of the various components of the immune response. Since the capacity of immunocytes to release and respond to opioid neuropeptide messengers is not restricted to mammalian organisms, recent studies have indicated that invertebrate models have been particularly useful to understand the mechanisms of the immune response. Moreover, the immunocytes of molluscs resemble cells of the vertebrate monocyte/macrophage lineage and are activated by similar substances, which control the main immune responses, i.e. phagocytosis, chemotaxis, and cytotoxicity. Recently, Mytilus edulis has been the subject of recent studies to determine whether the relationship between the immune and nervous systems seen in vertebrates also exists in invertebrates. The focus of this review is to describe how the opioid peptides participate in immune processes in molluscs.

  3. GENETIC CONTROL OF THE IMMUNE RESPONSE

    PubMed Central

    McDevitt, Hugh O.; Deak, Beverly D.; Shreffler, Donald C.; Klein, Jan; Stimpfling, Jack H.; Snell, George D.

    1972-01-01

    Eleven strains of mice bearing recombinant H-2 chromosomes derived from known crossover events between known H-2 types were immunized with a series of branched, multichain, synthetic polypeptide antigens [(T,G)-A--L, (H,G)-A--L, and (Phe,G)-A--L]. Results with nine of the eleven H-2 recombinants indicated that the gene(s) controlling immune response to these synthetic polypeptides (Ir-1) is on the centromeric or H-2K part of the recombinant H-2 chromosome. Results with two of the eleven recombinant H-2 chromosomes indicated that Ir-1 was on the telomeric or H-2D part of the recombinant H-2 chromosome. Both of these recombinants were derived from crossovers between the H-2K locus and the Ss-Slp locus near the center of the H-2 region. One of these recombinants, H-2y, was derived from a known single crossover event. These results indicate that Ir-1 lies near the center of the H-2 region between the H-2K locus and the Ss-Slp locus. The results of a four-point linkage test were consistent with these results. In 484 offspring of a cross designed to detect recombinants between H-2 and Ir-1, only two putative recombinants were detected. Both of these recombinants were confirmed by progeny testing. Extensive analysis of one of them has shown that the crossover event occurred within the H-2 region. (Testing of the second recombinant is currently under way.) Thus, in the linkage test, recombinants between H-2 and Ir-1 are in fact intra-H-2 crossovers. These results permit assignment of Ir-1 to a position between the H-2K locus and the Ss-Slp locus. PMID:4554451

  4. Spaceflight and immune responses of rhesus monkeys

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald; Morton, Darla S.; Swiggett, Jeanene P.; Hakenewerth, Anne M.; Fowler, Nina A.

    1995-01-01

    The effects of restraint on immunological parameters was determined in an 18 day ARRT (adult rhesus restraint test). The monkeys were restrained for 18 days in the experimental station for the orbiting primate (ESOP), the chair of choice for Space Shuttle experiments. Several immunological parameters were determined using peripheral blood, bone marrow, and lymph node specimens from the monkeys. The parameters included: response of bone marrow cells to GM-CSF (granulocyte-macrophage colony stimulating factor), leukocyte subset distribution, and production of IFN-a (interferon-alpha) and IFN-gamma (interferon-gamma). The only parameter changed after 18 days of restraint was the percentage of CD8+ T cells. No other immunological parameters showed changes due to restraint. Handling and changes in housing prior to the restraint period did apparently result in some restraint-independent immunological changes. Handling must be kept to a minimum and the animals allowed time to recover prior to flight. All experiments must be carefully controlled. Restraint does not appear to be a major issue regarding the effects of space flight on immune responses.

  5. Spaceflight and Immune Responses of Rhesus Monkeys

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1997-01-01

    In the grant period, we perfected techniques for determination of interleukin production and leukocyte subset analysis of rhesus monkeys. These results are outlined in detail in publication number 2, appended to this report. Additionally, we participated in the ARRT restraint test to determine if restraint conditions for flight in the Space Shuttle could contribute to any effects of space flight on immune responses. All immunological parameters listed in the methods section were tested. Evaluation of the data suggests that the restraint conditions had minimal effects on the results observed, but handling of the monkeys could have had some effect. These results are outlined in detail in manuscript number 3, appended to this report. Additionally, to help us develop our rhesus monkey immunology studies, we carried out preliminary studies in mice to determine the effects of stressors on immunological parameters. We were able to show that there were gender-based differences in the response of immunological parameters to a stressor. These results are outlined in detail in manuscript number 4, appended to this report.

  6. Maternal antibodies reduce costs of an immune response during development.

    PubMed

    Grindstaff, Jennifer L

    2008-03-01

    Young vertebrates are dependent primarily on innate immunity and maternally derived antibodies for immune defense. This reliance on innate immunity and the associated inflammatory response often leads to reduced growth rates after antigenic challenge. However, if offspring have maternal antibodies that recognize an antigen, these antibodies should block stimulation of the inflammatory response and reduce growth suppression. To determine whether maternal and/or offspring antigen exposure affect antibody transmission and offspring growth, female Japanese quail (Coturnix japonica) and their newly hatched chicks were immunized. Mothers were immunized with lipopolysaccharide (LPS), killed avian reovirus vaccine (AR), or were given a control, phosphate-buffered saline, injection. Within each family, one-third of offspring were immunized with LPS, one-third were immunized with AR, and one-third were given the control treatment. Maternal immunization significantly affected the specific types of antibodies that were transmitted. In general, immunization depressed offspring growth. However, offspring immunized with the same antigen as their mother exhibited elevated growth in comparison to siblings immunized with a different antigen. This suggests that the growth suppressive effects of antigen exposure during development can be partially ameliorated by the presence of maternal antibodies, but in the absence of specific maternal antibodies, offspring are dependent on more costly innate immune defenses. Together, the results suggest that the local disease environment of mothers prior to reproduction significantly affects maternal antibody transmission and these maternal antibodies may allow offspring to partially maintain growth during infection in addition to providing passive humoral immune defense.

  7. Childhood exposure to ambient polycyclic aromatic hydrocarbons is linked to epigenetic modifications and impaired systemic immunity in T cells

    PubMed Central

    Hew, K. M.; Walker, A. I.; Kohli, A.; Garcia, M.; Syed, A.; McDonald-Hyman, C.; Noth, E. M.; Mann, J. K.; Pratt, B.; Balmes, J.; Hammond, S. Katharine; Eisen, E. A.; Nadeau, K. C.

    2015-01-01

    Summary Background Evidence suggests that exposure to polycyclic aromatic hydrocarbons (PAHs) increases atopy; it is unclear how PAH exposure is linked to increased severity of atopic diseases. Objective We hypothesized that ambient PAH exposure is linked to impairment of immunity in atopic children (defined as children with asthma and/or allergic rhinitis) from Fresno, California, an area with elevated ambient PAHs. Methods We recruited 256 subjects from Fresno, CA. Ambient PAH concentrations (ng/m3) were measured using a spatial-temporal regression model over multiple time periods. Asthma diagnosis was determined by current NHLBI criteria. Phenotyping and functional immune measurements were performed from isolated cells. For epigenetic measurements, DNA was isolated and pyrosequenced. Results We show that higher average PAH exposure was significantly associated with impaired Treg function and increased methylation in the forkhead box protein 3 (FOXP3) locus (P < 0.05), conditional on atopic status. These epigenetic modifications were significantly linked to differential protein expression of FOXP3 (P < 0.001). Methylation was associated with cellular functional changes, specifically Treg dysfunction, and an increase in total plasma IgE levels. Protein expression of IL-10 decreased and IFN-γ increased as the extent of PAH exposure increased. The strength of the associations generally increased as the time window for average PAH exposure increased from 24 hr to 1 year, suggesting more of a chronic response. Significant associations with chronic PAH exposure and immune outcomes were also observed in subjects with allergic rhinitis. Conclusions and Clinical Relevance Collectively, these results demonstrate that increased ambient PAH exposure is associated with impaired systemic immunity and epigenetic modifications in a key locus involved in atopy: FOXP3, with a higher impact on atopic children. The results suggest that increased atopic clinical symptoms in children

  8. Immune function trade-offs in response to parasite threats.

    PubMed

    Kirschman, Lucas J; Quade, Adam H; Zera, Anthony J; Warne, Robin W

    2017-04-01

    Immune function is often involved in physiological trade-offs because of the energetic costs of maintaining constitutive immunity and mounting responses to infection. However, immune function is a collection of discrete immunity factors and animals should allocate towards factors that combat the parasite threat with the highest fitness cost. For example, animals on dispersal fronts of expanding population may be released from density-dependent diseases. The costs of immunity, however, and life history trade-offs in general, are often context dependent. Trade-offs are often most apparent under conditions of unusually limited resources or when animals are particularly stressed, because the stress response can shift priorities. In this study we tested how humoral and cellular immune factors vary between phenotypes of a wing dimorphic cricket and how physiological stress influences these immune factors. We measured constitutive lysozyme activity, a humoral immune factor, and encapsulation response, a cellular immune factor. We also stressed the crickets with a sham predator in a full factorial design. We found that immune strategy could be explained by the selective pressures encountered by each morph and that stress decreased encapsulation, but not lysozyme activity. These results suggest a possible trade-off between humoral and cellular immunity. Given limited resources and the expense of immune factors, parasite pressures could play a key factor in maintaining insect polyphenism via disruptive selection.

  9. IgG4 subclass antibodies impair antitumor immunity in melanoma

    PubMed Central

    Karagiannis, Panagiotis; Gilbert, Amy E.; Josephs, Debra H.; Ali, Niwa; Dodev, Tihomir; Saul, Louise; Correa, Isabel; Roberts, Luke; Beddowes, Emma; Koers, Alexander; Hobbs, Carl; Ferreira, Silvia; Geh, Jenny L.C.; Healy, Ciaran; Harries, Mark; Acland, Katharine M.; Blower, Philip J.; Mitchell, Tracey; Fear, David J.; Spicer, James F.; Lacy, Katie E.; Nestle, Frank O.; Karagiannis, Sophia N.

    2013-01-01

    Host-induced antibodies and their contributions to cancer inflammation are largely unexplored. IgG4 subclass antibodies are present in IL-10–driven Th2 immune responses in some inflammatory conditions. Since Th2-biased inflammation is a hallmark of tumor microenvironments, we investigated the presence and functional implications of IgG4 in malignant melanoma. Consistent with Th2 inflammation, CD22+ B cells and IgG4+-infiltrating cells accumulated in tumors, and IL-10, IL-4, and tumor-reactive IgG4 were expressed in situ. When compared with B cells from patient lymph nodes and blood, tumor-associated B cells were polarized to produce IgG4. Secreted B cells increased VEGF and IgG4, and tumor cells enhanced IL-10 secretion in cocultures. Unlike IgG1, an engineered tumor antigen-specific IgG4 was ineffective in triggering effector cell–mediated tumor killing in vitro. Antigen-specific and nonspecific IgG4 inhibited IgG1-mediated tumoricidal functions. IgG4 blockade was mediated through reduction of FcγRI activation. Additionally, IgG4 significantly impaired the potency of tumoricidal IgG1 in a human melanoma xenograft mouse model. Furthermore, serum IgG4 was inversely correlated with patient survival. These findings suggest that IgG4 promoted by tumor-induced Th2-biased inflammation may restrict effector cell functions against tumors, providing a previously unexplored aspect of tumor-induced immune escape and a basis for biomarker development and patient-specific therapeutic approaches. PMID:23454746

  10. IgG4 subclass antibodies impair antitumor immunity in melanoma.

    PubMed

    Karagiannis, Panagiotis; Gilbert, Amy E; Josephs, Debra H; Ali, Niwa; Dodev, Tihomir; Saul, Louise; Correa, Isabel; Roberts, Luke; Beddowes, Emma; Koers, Alexander; Hobbs, Carl; Ferreira, Silvia; Geh, Jenny L C; Healy, Ciaran; Harries, Mark; Acland, Katharine M; Blower, Philip J; Mitchell, Tracey; Fear, David J; Spicer, James F; Lacy, Katie E; Nestle, Frank O; Karagiannis, Sophia N

    2013-04-01

    Host-induced antibodies and their contributions to cancer inflammation are largely unexplored. IgG4 subclass antibodies are present in IL-10-driven Th2 immune responses in some inflammatory conditions. Since Th2-biased inflammation is a hallmark of tumor microenvironments, we investigated the presence and functional implications of IgG4 in malignant melanoma. Consistent with Th2 inflammation, CD22+ B cells and IgG4(+)-infiltrating cells accumulated in tumors, and IL-10, IL-4, and tumor-reactive IgG4 were expressed in situ. When compared with B cells from patient lymph nodes and blood, tumor-associated B cells were polarized to produce IgG4. Secreted B cells increased VEGF and IgG4, and tumor cells enhanced IL-10 secretion in cocultures. Unlike IgG1, an engineered tumor antigen-specific IgG4 was ineffective in triggering effector cell-mediated tumor killing in vitro. Antigen-specific and nonspecific IgG4 inhibited IgG1-mediated tumoricidal functions. IgG4 blockade was mediated through reduction of FcγRI activation. Additionally, IgG4 significantly impaired the potency of tumoricidal IgG1 in a human melanoma xenograft mouse model. Furthermore, serum IgG4 was inversely correlated with patient survival. These findings suggest that IgG4 promoted by tumor-induced Th2-biased inflammation may restrict effector cell functions against tumors, providing a previously unexplored aspect of tumor-induced immune escape and a basis for biomarker development and patient-specific therapeutic approaches.

  11. B cell function in the immune response to helminths

    PubMed Central

    Harris, Nicola

    2010-01-01

    Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556

  12. CIP2A Promotes T-Cell Activation and Immune Response to Listeria monocytogenes Infection

    PubMed Central

    Cvrljevic, Anna; Khan, Mohd Moin; Treise, Irina; Adler, Thure; Aguilar-Pimentel, Juan Antonio; Au-Yeung, Byron; Sittig, Eleonora; Laajala, Teemu Daniel; Chen, Yiling; Oeder, Sebastian; Calzada-Wack, Julia; Horsch, Marion; Aittokallio, Tero; Busch, Dirk H.; Ollert, Markus W.; Neff, Frauke; Beckers, Johannes; Gailus-Durner, Valerie; Fuchs, Helmut; de Angelis, Martin Hrabě; Chen, Zhi; Lahesmaa, Riitta; Westermarck, Jukka

    2016-01-01

    The oncoprotein Cancerous Inhibitor of Protein Phosphatase 2A (CIP2A) is overexpressed in most malignancies and is an obvious candidate target protein for future cancer therapies. However, the physiological importance of CIP2A-mediated PP2A inhibition is largely unknown. As PP2A regulates immune responses, we investigated the role of CIP2A in normal immune system development and during immune response in vivo. We show that CIP2A-deficient mice (CIP2AHOZ) present a normal immune system development and function in unchallenged conditions. However when challenged with Listeria monocytogenes, CIP2AHOZ mice display an impaired adaptive immune response that is combined with decreased frequency of both CD4+ T-cells and CD8+ effector T-cells. Importantly, the cell autonomous effect of CIP2A deficiency for T-cell activation was confirmed. Induction of CIP2A expression during T-cell activation was dependent on Zap70 activity. Thus, we reveal CIP2A as a hitherto unrecognized mediator of T-cell activation during adaptive immune response. These results also reveal CIP2AHOZ as a possible novel mouse model for studying the role of PP2A activity in immune regulation. On the other hand, the results also indicate that CIP2A targeting cancer therapies would not cause serious immunological side-effects. PMID:27100879

  13. CIP2A Promotes T-Cell Activation and Immune Response to Listeria monocytogenes Infection.

    PubMed

    Côme, Christophe; Cvrljevic, Anna; Khan, Mohd Moin; Treise, Irina; Adler, Thure; Aguilar-Pimentel, Juan Antonio; Au-Yeung, Byron; Sittig, Eleonora; Laajala, Teemu Daniel; Chen, Yiling; Oeder, Sebastian; Calzada-Wack, Julia; Horsch, Marion; Aittokallio, Tero; Busch, Dirk H; Ollert, Markus W; Neff, Frauke; Beckers, Johannes; Gailus-Durner, Valerie; Fuchs, Helmut; Hrabě de Angelis, Martin; Chen, Zhi; Lahesmaa, Riitta; Westermarck, Jukka

    2016-01-01

    The oncoprotein Cancerous Inhibitor of Protein Phosphatase 2A (CIP2A) is overexpressed in most malignancies and is an obvious candidate target protein for future cancer therapies. However, the physiological importance of CIP2A-mediated PP2A inhibition is largely unknown. As PP2A regulates immune responses, we investigated the role of CIP2A in normal immune system development and during immune response in vivo. We show that CIP2A-deficient mice (CIP2AHOZ) present a normal immune system development and function in unchallenged conditions. However when challenged with Listeria monocytogenes, CIP2AHOZ mice display an impaired adaptive immune response that is combined with decreased frequency of both CD4+ T-cells and CD8+ effector T-cells. Importantly, the cell autonomous effect of CIP2A deficiency for T-cell activation was confirmed. Induction of CIP2A expression during T-cell activation was dependent on Zap70 activity. Thus, we reveal CIP2A as a hitherto unrecognized mediator of T-cell activation during adaptive immune response. These results also reveal CIP2AHOZ as a possible novel mouse model for studying the role of PP2A activity in immune regulation. On the other hand, the results also indicate that CIP2A targeting cancer therapies would not cause serious immunological side-effects.

  14. The unfolded protein response in immunity and inflammation

    PubMed Central

    Grootjans, Joep; Kaser, Arthur; Kaufman, Randal J.; Blumberg, Richard S.

    2017-01-01

    The unfolded protein response (UPR) is a highly conserved pathway that allows the cell to manage endoplasmic reticulum (ER) stress that is imposed by the secretory demands associated with environmental forces. In this role, the UPR has increasingly been shown to have crucial functions in immunity and inflammation. In this Review, we discuss the importance of the UPR in the development, differentiation, function and survival of immune cells in meeting the needs of an immune response. In addition, we review current insights into how the UPR is involved in complex chronic inflammatory diseases and, through its role in immune regulation, antitumour responses. PMID:27346803

  15. Impaired synaptic development in a maternal immune activation mouse model of neurodevelopmental disorders.

    PubMed

    Coiro, Pierluca; Padmashri, Ragunathan; Suresh, Anand; Spartz, Elizabeth; Pendyala, Gurudutt; Chou, Shinnyi; Jung, Yoosun; Meays, Brittney; Roy, Shreya; Gautam, Nagsen; Alnouti, Yazen; Li, Ming; Dunaevsky, Anna

    2015-11-01

    Both genetic and environmental factors are thought to contribute to neurodevelopmental and neuropsychiatric disorders with maternal immune activation (MIA) being a risk factor for both autism spectrum disorders and schizophrenia. Although MIA mouse offspring exhibit behavioral impairments, the synaptic alterations in vivo that mediate these behaviors are not known. Here we employed in vivo multiphoton imaging to determine that in the cortex of young MIA offspring there is a reduction in number and turnover rates of dendritic spines, sites of majority of excitatory synaptic inputs. Significantly, spine impairments persisted into adulthood and correlated with increased repetitive behavior, an ASD relevant behavioral phenotype. Structural analysis of synaptic inputs revealed a reorganization of presynaptic inputs with a larger proportion of spines being contacted by both excitatory and inhibitory presynaptic terminals. These structural impairments were accompanied by altered excitatory and inhibitory synaptic transmission. Finally, we report that a postnatal treatment of MIA offspring with the anti-inflammatory drug ibudilast, prevented both synaptic and behavioral impairments. Our results suggest that a possible altered inflammatory state associated with maternal immune activation results in impaired synaptic development that persists into adulthood but which can be prevented with early anti-inflammatory treatment.

  16. Toll-Like Receptor 9 Activation Rescues Impaired Antibody Response in Needle-free Intradermal DNA Vaccination

    PubMed Central

    Arunachalam, Prabhu S.; Mishra, Ria; Badarinath, Krithika; Selvam, Deepak; Payeli, Sravan K.; Stout, Richard R.; Ranga, Udaykumar

    2016-01-01

    The delivery of plasmid DNA to the skin can target distinct subsets of dermal dendritic cells to confer a superior immune response. The needle-free immunization technology offers a reliable, safe and efficient means to administer intradermal (ID) injections. We report here that the ID injection of DNA vectors using an NF device (NF-ID) elicits a superior cell-mediated immune response, at much lesser DNA dosage, comparable in magnitude to the traditional intramuscular immunization. However, the humoral response is significantly impaired, possibly at the stage of B cell isotype switching. We found that the NF-ID administration deposits the DNA primarily on the epidermis resulting in a rapid loss of the DNA as well as the synthesized antigen due to the faster regeneration rate of the skin layers. Therefore, despite the immune-rich nature of the skin, the NF-ID immunization of DNA vectors may be limited by the impaired humoral response. Additional booster injections are required to augment the antibody response. As an alternative and a viable solution, we rescued the IgG response by coadministration of a Toll-like receptor 9 agonist, among other adjuvants examined. Our work has important implication for the optimization of the emerging needle-free technology for ID immunization. PMID:27658623

  17. Innate immune response development in nestling tree swallows

    USGS Publications Warehouse

    Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.

    2011-01-01

    We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.

  18. Probiotics and the immune response to vaccines.

    PubMed

    MacDonald, Thomas T; Bell, Iona

    2010-08-01

    Probiotics are bacteria, but sometimes fungi, which when taken by the oral route may give some health benefits. The most compelling evidence for beneficial effects of probiotics is in the prevention and reduction in the duration of symptoms related to gut infectious disease. There is also evidence to show that some specific probiotics are beneficial in Clostridium difficile diarrhoea in the elderly. As further and better controlled clinical studies have appeared, some specific probiotics also appear to have beneficial effects in perhaps preventing and reducing the duration of symptoms due to acquired upper respiratory tract infections. In an attempt to explain these effects, attention has turned to the effects of some specific probiotics on the immune system. There is evidence that some specific probiotics can alter monocyte and natural killer cell function in the blood. Evidence is also accumulating that taking some specific probiotics can boost antibody responses to oral and systemically administered vaccines. The effect when shown is modest and is not always seen in different studies to all vaccines, but there is enough of a trend to make the area worthy of further investigation, particularly to tease out the mechanisms involved.

  19. Humoral immune response to Aggregatibacter actinomycetemcomitans leukotoxin.

    PubMed

    Brage, M; Holmlund, A; Johansson, A

    2011-04-01

    Periodontal disease is an inflammatory condition caused by bacterial infections that result in loss of the tooth supporting tissue. The periodontal pathogens produce virulence factors with capacity to affect the host immune response. Aggregatibacter actinomycetemcomitans is a periodontal pathogen that produces a leukotoxin that specifically affects human leukocytes. The aims of the present study were to examine the presence and function of systemic antibodies to the leukotoxin. One hundred and ninety-seven middle-aged (57 ± 5 years) Swedes with well-documented periodontal status and medical factors related to cardiovascular diseases were studied. These data have been published previously. The serum samples were examined for the presence of leukotoxin antibodies by western blot and the capacity to neutralize leukotoxicity in an activity assay with leukotoxin and cultured leukemic cells. The results showed a high prevalence (57%) of antibodies against A. actinomycetemcomitans leukotoxin in the analyzed population. These antibodies were correlated with leukotoxin neutralizing capacity as well as with the ELISA titers of A. actinomycetemcomitans-specific IgA and IgG. In addition, high levels of leukotoxin antibodies were correlated with increasing age, but not with periodontal disease parameters or cardiovascular risk factors. Systemic antibodies against A. actionmycetemcomitans leukotoxin were common in this adult Swedish population. These antibodies might contribute to limit the systemic effects of the infection. © 2010 John Wiley & Sons A/S.

  20. Importins and exportins regulating allergic immune responses.

    PubMed

    Aggarwal, Ankita; Agrawal, Devendra K

    2014-01-01

    Nucleocytoplasmic shuttling of macromolecules is a well-controlled process involving importins and exportins. These karyopherins recognize and bind to receptor-mediated intracellular signals through specific signal sequences that are present on cargo proteins and transport into and out of the nucleus through nuclear pore complexes. Nuclear localization signals (NLS) present on cargo molecules to be imported while nuclear export signals (NES) on the molecules to be exported are recognized by importins and exportins, respectively. The classical NLS are found on many transcription factors and molecules that are involved in the pathogenesis of allergic diseases. In addition, several immune modulators, including corticosteroids and vitamin D, elicit their cellular responses by regulating the expression and activity of importin molecules. In this review article, we provide a comprehensive list of importin and exportin molecules and their specific cargo that shuttled between cytoplasm and the nucleus. We also critically review the role and regulation of specific importin and exportin involved in the transport of activated transcription factors in allergic diseases, the underlying molecular mechanisms, and the potential target sites for developing better therapeutic approaches.

  1. Linear ubiquitination signals in adaptive immune responses.

    PubMed

    Ikeda, Fumiyo

    2015-07-01

    Ubiquitin can form eight different linkage types of chains using the intrinsic Met 1 residue or one of the seven intrinsic Lys residues. Each linkage type of ubiquitin chain has a distinct three-dimensional topology, functioning as a tag to attract specific signaling molecules, which are so-called ubiquitin readers, and regulates various biological functions. Ubiquitin chains linked via Met 1 in a head-to-tail manner are called linear ubiquitin chains. Linear ubiquitination plays an important role in the regulation of cellular signaling, including the best-characterized tumor necrosis factor (TNF)-induced canonical nuclear factor-κB (NF-κB) pathway. Linear ubiquitin chains are specifically generated by an E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) and hydrolyzed by a deubiquitinase (DUB) called ovarian tumor (OTU) DUB with linear linkage specificity (OTULIN). LUBAC linearly ubiquitinates critical molecules in the TNF pathway, such as NEMO and RIPK1. The linear ubiquitin chains are then recognized by the ubiquitin readers, including NEMO, which control the TNF pathway. Accumulating evidence indicates an importance of the LUBAC complex in the regulation of apoptosis, development, and inflammation in mice. In this article, I focus on the role of linear ubiquitin chains in adaptive immune responses with an emphasis on the TNF-induced signaling pathways.

  2. Suppression of immune response to Listeria monocytogenes: mechanism(s) of immune complex suppression.

    PubMed Central

    Virgin, H W; Wittenberg, G F; Bancroft, G J; Unanue, E R

    1985-01-01

    We have investigated possible mechanisms underlying immune complex suppression of resistance to Listeria monocytogenes. Inhibition of resistance was found when immune complexes were formed in vivo in immune mice or in nonimmune mice adoptively transferred with specific antibody. Suppression was also found when nonimmune mice were injected with immune complexes preformed in vitro. We investigated the role of complement by decomplementing mice with cobra venom factor purified by high-pressure liquid chromatography. Complete depletion of serum C3 did not eliminate immune complex suppression of resistance to L. monocytogenes, suggesting that complement activation is not required for immune complex suppression. Infection-induced changes in the surface phenotype and functional properties of macrophages from normal and immune complex-suppressed mice were also investigated. Macrophage expression of both H-2K and Ia molecules increased during the response of normal mice to L. monocytogenes. However, these changes were not found in immune complex-suppressed mice. In contrast, membrane interleukin 1 expression was increased in macrophages from suppressed mice compared with macrophages from normal mice. Macrophages from L. monocytogenes-infected normal and immune complex-suppressed mice expressed cytotoxicity against tumor cells in vitro. We conclude that immune complexes do not inhibit resistance to L. monocytogenes by activation of complement or decreasing macrophage cytotoxic activity. Rather, defects in Ia expression by macrophages from suppressed mice might be one component responsible for immune complex suppression of resistance to L. monocytogenes. PMID:3932204

  3. Immune Response of Cytotoxic T Lymphocytes and Possibility of Vaccine Development for Hepatitis C Virus Infection

    PubMed Central

    Hiroishi, Kazumasa; Eguchi, Junichi; Ishii, Shigeaki; Hiraide, Ayako; Sakaki, Masashi; Doi, Hiroyoshi; Omori, Risa; Imawari, Michio

    2010-01-01

    Immune responses of cytotoxic T lymphocytes (CTLs) are implicated in viral eradication and the pathogenesis of hepatitis C. Weak CTL response against hepatitis C virus (HCV) may lead to a persistent infection. HCV infection impairs the function of HCV-specific CTLs; HCV proteins are thought to actively suppress host immune responses, including CTLs. Induction of a strong HCV-specific CTL response in HCV-infected patients can facilitate complete HCV clearance. Thus, the development of a vaccine that can induce potent CTL response against HCV is strongly expected. We investigated HCV-specific CTL responses by enzyme-linked immuno-spot assay and/or synthetic peptides and identified over 40 novel CTL epitopes in the HCV protein. Our findings may contribute to the development of the HCV vaccine. In this paper, we describe the CTL responses in HCV infection and the attempts at vaccine development based on recent scientific articles. PMID:20508848

  4. Impaired Heterologous Immunity in Aged Ferrets During Sequential Influenza A H1N1 Infection

    PubMed Central

    Paquette, Stéphane G.; Huang, Stephen S. H.; Banner, David; Xu, Luoling; León, Alberto; Kelvin, Alyson A.; Kelvin, David J.

    2014-01-01

    The major burden of influenza morbidity resides within the elderly population. The challenge managing influenza-associated illness in the elderly is the decline of immune function, where mechanisms leading to immunological senescence have not been elucidated. To better represent the immune environment, we investigated clinical morbidity and immune function during sequential homologous and heterologous H1N1 influenza infection in an aged ferret model. Our findings demonstrated experimentally that aged ferrets had significant morbidity during monosubtypic heterologous 2° challenge with significant weight loss and respiratory symptoms. Furthermore, increased clinical morbidity was associated with slower and shorter hemagglutinin antibody generation and attenuated type 1 T-cell gene responses in peripheral blood. These results revealed dampened immune activation during sequential influenza infection in aged ferrets. With the presence of an aged model, dissecting clinical morbidity, viral dynamics and immune response during influenza infection will aid the development of future prophylactics such as age specific influenza vaccines. PMID:25086242

  5. Evaluating immune responses after sipuleucel-T therapy.

    PubMed

    Strauss, Julius; Madan, Ravi A; Figg, William D

    2015-01-01

    Following FDA approval of sipuleucel-T in 2010 for metastatic castration resistant prostate cancer (mCRPC), several studies have described the effect of sipuleucel-T on peripheral immune responses. Retrospective associations have also been made with immune responses and survival. A recently published study by Fong et al. was the first to characterize the immune response of sipuleucel-T in the tumor microenvironment. The findings of this study have been hypothesis generating, yet it remains unclear whether the peri-tumor immune response described is predictive of survival. Increasing evidence suggests that radiographic or PSA progression does not accurately reflect survival with sipuleucel-T and other immunotherapies. Finding an immune biomarker which can accurately reflect clinical benefit and validating it prospectively offers the potential for a predictive indicator of response in an area where none currently exists.

  6. [Immune response and digestive cancers: Prognostic and therapeutic implications].

    PubMed

    Bibeau, Frédéric; Bazille, Céline; Svrcek, Magali; Pierson, Rémi; Lagorce-Pagès, Christine; Cohen, Romain; André, Thierry

    2017-02-01

    The aim of this article is to emphasize the impact of the immune response in digestive cancers, especially from colorectal (CRC) origin. In this setting, an adaptive lymphocytic infiltrate underlines the prognostic impact of the immune response, because it is associated to a favorable outcome. The next challenge will be to validate, in a prospective therapeutic trial, the integration of the immune response as decisional parameter for adjuvant therapy. The immune response is also a predictive parameter in microsatellite instable metastatic CRC, characterized by an adaptive lymphocytic infiltrate, leading to a very high response rate to immune therapies. However, prognostic and predictive biomarkers still need to be optimized in order to better select patients. These data are also valuable for digestive non-colorectal cancers, which are briefly analyzed. The methodology for the assessment of these prognostic and predictive biomarkers, which represents an important issue in precision medicine, is also discussed.

  7. Continuous immunotypes describe human immune variation and predict diverse responses.

    PubMed

    Kaczorowski, Kevin J; Shekhar, Karthik; Nkulikiyimfura, Dieudonné; Dekker, Cornelia L; Maecker, Holden; Davis, Mark M; Chakraborty, Arup K; Brodin, Petter

    2017-07-25

    The immune system consists of many specialized cell populations that communicate with each other to achieve systemic immune responses. Our analyses of various measured immune cell population frequencies in healthy humans and their responses to diverse stimuli show that human immune variation is continuous in nature, rather than characterized by discrete groups of similar individuals. We show that the same three key combinations of immune cell population frequencies can define an individual's immunotype and predict a diverse set of functional responses to cytokine stimulation. We find that, even though interindividual variations in specific cell population frequencies can be large, unrelated individuals of younger age have more homogeneous immunotypes than older individuals. Across age groups, cytomegalovirus seropositive individuals displayed immunotypes characteristic of older individuals. The conceptual framework for defining immunotypes suggested by our results could guide the development of better therapies that appropriately modulate collective immunotypes, rather than individual immune components.

  8. Immune response, not immune maintenance, is energetically costly in wild white-footed mice (Peromyscus leucopus).

    PubMed

    Derting, Terry L; Compton, Stephen

    2003-01-01

    Understanding the cost of immune function is essential for more accurate characterization of energy budgets of animals and better understanding of the role of immunity in the evolution of life-history strategies. We examined the energetic cost of maintaining a normally functioning immune system and mounting a mild immune response in wild male white-footed mice (Peromyscus leucopus). To evaluate the cost of maintaining immunocompetence, we compared resting and daily metabolic rates (RMR; DMR) and masses of body organs of mice whose immune systems were suppressed by cyclophosphamide with those of control mice. To evaluate the cost of mounting an immune response, we measured RMR, DMR, and organ masses in mice whose humoral and cell-mediated immune responses had been stimulated by injections of sheep red blood cells and phytohemagglutinin, respectively. Immunosuppression resulted in a significant reduction in circulating leukocytes, by 225%, but no significant effect on metabolic rates or organ masses. Immunochallenged animals showed no significant differences in metabolic rates compared with control animals but did exhibit significantly smaller dry masses of the small intestine and testes, by 74% and 22%, respectively. We concluded that the cost of maintaining the immune system was minimal. In contrast, there was a significant energetic cost of mounting an immune response that, depending on its magnitude, can be met through reductions in energy allocation to other physiological systems.

  9. Gain-of-function human STAT1 mutations impair IL-17 immunity and underlie chronic mucocutaneous candidiasis

    PubMed Central

    Liu, Luyan; Okada, Satoshi; Kong, Xiao-Fei; Kreins, Alexandra Y.; Cypowyj, Sophie; Abhyankar, Avinash; Toubiana, Julie; Itan, Yuval; Audry, Magali; Nitschke, Patrick; Masson, Cécile; Toth, Beata; Flatot, Jérome; Migaud, Mélanie; Chrabieh, Maya; Kochetkov, Tatiana; Bolze, Alexandre; Borghesi, Alessandro; Toulon, Antoine; Hiller, Julia; Eyerich, Stefanie; Eyerich, Kilian; Gulácsy, Vera; Chernyshova, Ludmyla; Chernyshov, Viktor; Bondarenko, Anastasia; María Cortés Grimaldo, Rosa; Blancas-Galicia, Lizbeth; Madrigal Beas, Ileana Maria; Roesler, Joachim; Magdorf, Klaus; Engelhard, Dan; Thumerelle, Caroline; Burgel, Pierre-Régis; Hoernes, Miriam; Drexel, Barbara; Seger, Reinhard; Kusuma, Theresia; Jansson, Annette F.; Sawalle-Belohradsky, Julie; Belohradsky, Bernd; Jouanguy, Emmanuelle; Bustamante, Jacinta; Bué, Mélanie; Karin, Nathan; Wildbaum, Gizi; Bodemer, Christine; Lortholary, Olivier; Fischer, Alain; Blanche, Stéphane; Al-Muhsen, Saleh; Reichenbach, Janine; Kobayashi, Masao; Rosales, Francisco Espinosa; Lozano, Carlos Torres; Kilic, Sara Sebnem; Oleastro, Matias; Etzioni, Amos; Traidl-Hoffmann, Claudia; Renner, Ellen D.; Abel, Laurent; Picard, Capucine; Maródi, László; Boisson-Dupuis, Stéphanie

    2011-01-01

    Chronic mucocutaneous candidiasis disease (CMCD) may be caused by autosomal dominant (AD) IL-17F deficiency or autosomal recessive (AR) IL-17RA deficiency. Here, using whole-exome sequencing, we identified heterozygous germline mutations in STAT1 in 47 patients from 20 kindreds with AD CMCD. Previously described heterozygous STAT1 mutant alleles are loss-of-function and cause AD predisposition to mycobacterial disease caused by impaired STAT1-dependent cellular responses to IFN-γ. Other loss-of-function STAT1 alleles cause AR predisposition to intracellular bacterial and viral diseases, caused by impaired STAT1-dependent responses to IFN-α/β, IFN-γ, IFN-λ, and IL-27. In contrast, the 12 AD CMCD-inducing STAT1 mutant alleles described here are gain-of-function and increase STAT1-dependent cellular responses to these cytokines, and to cytokines that predominantly activate STAT3, such as IL-6 and IL-21. All of these mutations affect the coiled-coil domain and impair the nuclear dephosphorylation of activated STAT1, accounting for their gain-of-function and dominance. Stronger cellular responses to the STAT1-dependent IL-17 inhibitors IFN-α/β, IFN-γ, and IL-27, and stronger STAT1 activation in response to the STAT3-dependent IL-17 inducers IL-6 and IL-21, hinder the development of T cells producing IL-17A, IL-17F, and IL-22. Gain-of-function STAT1 alleles therefore cause AD CMCD by impairing IL-17 immunity. PMID:21727188

  10. Impaired Cytokine Responses to Epstein-Barr Virus Antigens in Systemic Lupus Erythematosus Patients.

    PubMed

    Draborg, Anette Holck; Sandhu, Noreen; Larsen, Nanna; Lisander Larsen, Janni; Jacobsen, Søren; Houen, Gunnar

    2016-01-01

    We analyzed cytokine responses against latent and lytic Epstein-Barr virus (EBV) antigens in systemic lupus erythematosus (SLE) patients and healthy controls (HCs) to obtain an overview of the distinctive immune regulatory response in SLE patients and to expand the previously determined impaired EBV-directed T-cell response. The concentrations of 14 cytokines (IL2, IL4, IL5, IL6, IL10, IL12, IL17, IL18, IL1β, IFNγ, TNFα, TNFβ, TGFβ, and GM-CSF) were quantified upon stimulation of whole blood with latent state antigen EBNA1, lytic cycle antigen EBV-EA/D, and the superantigen SEB. To avoid results affected by lack of lymphocytes, we focused on SLE patients with normal levels. Decreased induction of IL12, IFNγ, IL17, and IL6 upon EBNA1 stimulation and that of IFNγ, IL6, TNFβ, IL1β, and GM-CSF upon EBV-EA/D stimulation were detected in SLE patients compared to HCs. IFNγ responses, especially, were shown to be reduced. Induction of several cytokines was furthermore impaired in SLE patients upon SEB stimulation, but no difference was observed in basic levels. Results substantiate the previously proposed impaired regulation of the immune response against latent and lytic cycle EBV infection in SLE patients without lymphopenia. Furthermore, results indicate general dysfunction of leukocytes and their cytokine regulations in SLE patients.

  11. Biomimetic and synthetic interfaces to tune immune responses (Review)

    PubMed Central

    Garapaty, Anusha; Champion, Julie A.

    2015-01-01

    Organisms depend upon complex intercellular communication to initiate, maintain, or suppress immune responses during infection or disease. Communication occurs not only between different types of immune cells, but also between immune cells and nonimmune cells or pathogenic entities. It can occur directly at the cell–cell contact interface, or indirectly through secreted signals that bind cell surface molecules. Though secreted signals can be soluble, they can also be particulate in nature and direct communication at the cell–particle interface. Secreted extracellular vesicles are an example of native particulate communication, while viruses are examples of foreign particulates. Inspired by communication at natural immunological interfaces, biomimetic materials and designer molecules have been developed to mimic and direct the type of immune response. This review describes the ways in which native, biomimetic, and designer materials can mediate immune responses. Examples include extracellular vesicles, particles that mimic immune cells or pathogens, and hybrid designer molecules with multiple signaling functions, engineered to target and bind immune cell surface molecules. Interactions between these materials and immune cells are leading to increased understanding of natural immune communication and function, as well as development of immune therapeutics for the treatment of infection, cancer, and autoimmune disease. PMID:26178262

  12. Assessment of the immune response to duck plague vaccinations.

    PubMed

    Kulkarni, D D; James, P C; Sulochana, S

    1998-01-01

    An experiment was conducted to assess the immune responses of ducks to duck plague (DP) vaccinations employing one commercial and one laboratory-adapted (LA) DP vaccines. Virus neutralisation and leucocyte migration-inhibition tests were conducted at regular intervals before and after vaccinations. Similarly, ducks in vaccinated and control groups were subjected to challenge infection with virulent DP virus. The commercial vaccine yielded a poor immune response and partial protection on challenge whereas satisfactory responses were obtained in ducks receiving two doses of LA vaccine. The humoral as well as cellular factors were stimulated indicating possible involvement of both the immune responses in the protection from duck plague.

  13. Salicylic Acid Activates DNA Damage Responses to Potentiate Plant Immunity

    PubMed Central

    Yan, Shunping; Wang, Wei; Marqués, Jorge; Mohan, Rajinikanth; Saleh, Abdelaty; Durrant, Wendy E.; Song, Junqi; Dong, Xinnian

    2013-01-01

    SUMMARY DNA damage is normally detrimental to living organisms. Here we show that it can also serve as a signal to promote immune responses in plants. We found that the plant immune hormone salicylic acid (SA) can trigger DNA damage in the absence of a genotoxic agent. The DNA damage sensor proteins, RAD17 and ATR, are required for effective immune responses. These sensor proteins are negatively regulated by a key immune regulator SNI1 (suppressor of npr1-1, inducible 1), which we discovered as a missing subunit of the Structural Maintenance of Chromosome (SMC) 5/6 complex required for controlling DNA damage. Elevated DNA damage caused by the sni1 mutation or treatment with a DNA-damaging agent markedly enhances SA-mediated defense gene expression. Our study suggests that activation of DNA damage responses is an intrinsic component of the plant immune responses. PMID:24207055

  14. Immune responses and disease enhancement during respiratory syncytial virus infection.

    PubMed

    Openshaw, Peter J M; Tregoning, John S

    2005-07-01

    Respiratory syncytial virus (RSV) is one of the commonest and most troublesome viruses of infancy. It causes most cases of bronchiolitis, which is associated with wheezing in later childhood. In primary infection, the peak of disease typically coincides with the development of specific T- and B-cell responses, which seem, in large part, to be responsible for disease. Animal models clearly show that a range of immune responses can enhance disease severity, particularly after vaccination with formalin-inactivated RSV. Prior immune sensitization leads to exuberant chemokine production, an excessive cellular influx, and an overabundance of cytokines during RSV challenge. Under different circumstances, specific mediators and T-cell subsets and antibody-antigen immune complex deposition are incriminated as major factors in disease. Animal models of immune enhancement permit a deep understanding of the role of specific immune responses in RSV disease, assist in vaccine design, and indicate which immunomodulatory therapy might be beneficial to children with bronchiolitis.

  15. The innate immune response during urinary tract infection and pyelonephritis.

    PubMed

    Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S

    2014-07-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.

  16. The innate immune response during urinary tract infection and pyelonephritis

    PubMed Central

    Spencer, John David; Schwaderer, Andrew L.; Becknell, Brian; Watson, Joshua; Hains, David S.

    2013-01-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides – a ubiquitous component of the innate immune response. PMID:23732397

  17. Psychoneuroendocrine stress response may impair neutrophil function in complex regional pain syndrome.

    PubMed

    Kaufmann, Ines; Eisner, Christoph; Richter, Peter; Huge, Volker; Beyer, Antje; Chouker, Alexander; Schelling, Gustav; Thiel, Manfred

    2007-10-01

    In order to elucidate the interaction between pain, stress and innate immunity in complex regional pain syndrome (CRPS), we assessed pain and stress levels in CRPS patients and compared ex vivo functions of neutrophils between patients with CRPS and healthy volunteers. As compared with healthy volunteers, the following major alterations in CRPS patients were found: (I) elevated stress score (PTSS-10) and stress hormone concentrations, (II) decreased expression of the CD62L and CD11b/CD18 on neutrophils, (III) impaired ability of autologous plasma to enhance the capability of neutrophils to phagocytose zymosan particles, and (IV) a negative correlation between PTSS-10 values and autologous plasma enhanced phagocytosis. In vitro incubation of neutrophils with catecholamines decreased phagocytosis of zymosan. In conclusion, CRPS patients exhibit signs of impaired innate immunity which might reflect the immunological consequence of an immunosuppressive neuroendocrine stress response.

  18. Serological response to immunization with tetanus toxoid.

    PubMed

    Setarunnahar; Hossain, A; Khatun, R; Parveen, S; Ahmad, Z; Haleem, A; Alam, S K

    2000-04-01

    A total of two hundred women were immunized with tetanus toxoid vaccine. Two batches of toxoid prepared at the Institute of Public Health (IPH), Dhaka and one batch of imported vaccines, were being used by the EPI in Bangladesh for immunization. Each hundred women were immunized by IPH and imported vaccine. Two human doses were given in one month interval. Blood samples from all the study subjects were collected on the day of 1st dose and one month after second dose. Both the preimmunized sera and the sera after vaccination were tested to determine the antibody titre against tetanus toxoid by the haemagglutination method. The preimmunized sera showed the presence of protective antibody in 50(25%) subjects who had the history of previous immunization. Including these initial antitoxin positive cases the seroconversions found among 95% and 96% of the study population respectively after immunization with IPH and imported toxoids, which were 93.05% and 94.87% when these 50 subjects were excluded. No significant difference (p = 1.0) was observed between the immunity of the subjects after receiving IPH and imported vaccine. Antibody titre of initial tetanus-antitoxin positive cases raised eight folds after getting more doses. The result gave fair indication of the antigenicity of all the toxoids used in the study.

  19. Immune recovery in HIV-infected patients after Candida esophagitis is impaired despite long-term antiretroviral therapy

    PubMed Central

    Stuehler, Claudia; Bernardini, Claudia; Elzi, Luigia; Stoeckle, Marcel; Zimmerli, Stefan; Furrer, Hansjakob; Günthard, Huldrych F.; Leibundgut-Landmann, Salomé; Battegay, Manuel; Khanna, Nina

    2016-01-01

    Objective: Candida esophagitis belongs to the most common AIDS-defining diseases; however, a comprehensive immune pathogenic concept is lacking. Design: We investigated the immune status of 37 HIV-1-infected patients from the Swiss HIV cohort study at diagnosis of Candida esophagitis, 1 year before, 1 year later and after 2 years of suppressed HIV RNA. We compared these patients with three groups: 37 HIV-1-infected patients without Candida esophagitis but similar CD4+ cell counts as the patients at diagnosis (advanced HIV group), 15 HIV-1-infected patients with CD4+ cell counts higher than 500 cells/μl, CD4+ cell nadirs higher than 350 cells/μl and suppressed HIV RNA under combination antiretroviral therapy (cART) (early cART group) and 20 healthy individuals. Methods: We investigated phenotype, cytokine production and proliferative capacity of different immune cells by flow cytometry and enzyme-linked immunosorbent spot. Results: We found that patients with Candida esophagitis had nearly abolished CD4+ cell proliferation in response to Candida albicans, significantly increased percentages of dysfunctional CD4+ cells, significantly decreased cytotoxic natural killer cell counts and peripheral innate lymphoid cell counts and significantly reduced IFN-γ and IL-17 production compared with the early cART group and healthy individuals. Most of these defects remained for more than 2 years despite viral suppression. The advanced HIV group without opportunistic infection showed partly improved immune recovery. Conclusion: Our data indicate that Candida esophagitis in HIV-1-infected patients is caused by an accumulation of multiple, partly Candida-specific immunological defects. Long-term immune recovery is impaired, illustrating that specific immunological gaps persist despite cART. These data also support the rationale for early cART initiation to prevent irreversible immune defects. PMID:27149086

  20. Serum immune responses predict rapid disease progression among children with Crohn's disease: immune responses predict disease progression.

    PubMed

    Dubinsky, Marla C; Lin, Ying-Chao; Dutridge, Debra; Picornell, Yoana; Landers, Carol J; Farrior, Sharmayne; Wrobel, Iwona; Quiros, Antonio; Vasiliauskas, Eric A; Grill, Bruce; Israel, David; Bahar, Ron; Christie, Dennis; Wahbeh, Ghassan; Silber, Gary; Dallazadeh, Saied; Shah, Praful; Thomas, Danny; Kelts, Drew; Hershberg, Robert M; Elson, Charles O; Targan, Stephan R; Taylor, Kent D; Rotter, Jerome I; Yang, Huiying

    2006-02-01

    Crohn's disease (CD) is a heterogeneous disorder characterized by diverse clinical phenotypes. Childhood-onset CD has been described as a more aggressive phenotype. Genetic and immune factors may influence disease phenotype and clinical course. We examined the association of immune responses to microbial antigens with disease behavior and prospectively determined the influence of immune reactivity on disease progression in pediatric CD patients. Sera were collected from 196 pediatric CD cases and tested for immune responses: anti-I2, anti-outer membrane protein C (anti-OmpC), anti-CBir1 flagellin (anti-CBir1), and anti-Saccharomyces-cerevisiae (ASCA) using ELISA. Associations between immune responses and clinical phenotype were evaluated. Fifty-eight patients (28%) developed internal penetrating and/or stricturing (IP/S) disease after a median follow-up of 18 months. Both anti-OmpC (p < 0.0006) and anti-I2 (p < 0.003) were associated with IP/S disease. The frequency of IP/S disease increased with increasing number of immune responses (p trend = 0.002). The odds of developing IP/S disease were highest in patients positive for all four immune responses (OR (95% CI): 11 (1.5-80.4); p = 0.03). Pediatric CD patients positive for > or =1 immune response progressed to IP/S disease sooner after diagnosis as compared to those negative for all immune responses (p < 0.03). The presence and magnitude of immune responses to microbial antigens are significantly associated with more aggressive disease phenotypes among children with CD. This is the first study to prospectively demonstrate that the time to develop a disease complication in children is significantly faster in the presence of immune reactivity, thereby predicting disease progression to more aggressive disease phenotypes among pediatric CD patients.

  1. Serum Immune Responses Predict Rapid Disease Progression among Children with Crohn’s Disease: Immune Responses Predict Disease Progression

    PubMed Central

    Dubinsky, Marla C.; Lin, Ying-Chao; Dutridge, Debra; Picornell, Yoana; Landers, Carol J.; Farrior, Sharmayne; Wrobel, Iwona; Quiros, Antonio; Vasiliauskas, Eric A.; Grill, Bruce; Israel, David; Bahar, Ron; Christie, Dennis; Wahbeh, Ghassan; Silber, Gary; Dallazadeh, Saied; Shah, Praful; Thomas, Danny; Kelts, Drew; Hershberg, Robert M.; Elson, Charles O.; Targan, Stephan R.; Taylor, Kent D.; Rotter, Jerome I.; Yang, Huiying

    2007-01-01

    BACKGROUND AND AIM Crohn’s disease (CD) is a heterogeneous disorder characterized by diverse clinical phenotypes. Childhood-onset CD has been described as a more aggressive phenotype. Genetic and immune factors may influence disease phenotype and clinical course. We examined the association of immune responses to microbial antigens with disease behavior and prospectively determined the influence of immune reactivity on disease progression in pediatric CD patients. METHODS Sera were collected from 196 pediatric CD cases and tested for immune responses: anti-I2, anti-outer membrane protein C (anti-OmpC), anti-CBir1 flagellin (anti-CBir1), and anti-Saccharomyces-cerevisiae (ASCA) using ELISA. Associations between immune responses and clinical phenotype were evaluated. RESULTS Fifty-eight patients (28%) developed internal penetrating and/or stricturing (IP/S) disease after a median follow-up of 18 months. Both anti-OmpC (p < 0.0006) and anti-I2 (p < 0.003) were associated with IP/S disease. The frequency of IP/S disease increased with increasing number of immune responses (p trend = 0.002). The odds of developing IP/S disease were highest in patients positive for all four immune responses (OR (95% CI): 11 (1.5–80.4); p = 0.03). Pediatric CD patients positive for ≥1 immune response progressed to IP/S disease sooner after diagnosis as compared to those negative for all immune responses (p < 0.03). CONCLUSIONS The presence and magnitude of immune responses to microbial antigens are significantly associated with more aggressive disease phenotypes among children with CD. This is the first study to prospectively demonstrate that the time to develop a disease complication in children is significantly faster in the presence of immune reactivity, thereby predicting disease progression to more aggressive disease phenotypes among pediatric CD patients. PMID:16454844

  2. Transcutaneous DNA immunization following waxing-based hair depilation elicits both humoral and cellular immune responses

    PubMed Central

    Xiao, Gang; Li, Xinran; Kumar, Amit; Cui, Zhengrong

    2012-01-01

    Previously, we showed that transcutaneous (TC) DNA immunization by applying plasmid DNA onto a mouse skin area wherein the hair follicles were induced into growth stage by plucking the hair using warm waxing induced strong and functional antigen-specific antibody responses. In the present study, using plasmids that encode β-galactosidase gene or ovalbumin (OVA) gene, we showed that this mode of TC DNA immunization not only induced specific antibody responses, but also induced antigen-specific cytotoxic T lymphocyte responses. In fact, TC DNA immunization using a plasmid that encodes OVA gene prevented the growth of OVA-expressing B16-OVA tumor cells in the immunized mice. Moreover, we provided additional evidence supporting that hair follicles are essential for this mode of TC DNA immunization. PMID:22771558

  3. Sexual dimorphism in immunity: improving our understanding of vaccine immune responses in men.

    PubMed

    Furman, David

    2015-03-01

    Weaker immune responses are often observed in males compared to females. Since female hormones have proinflammatory properties and androgens have potent immunomodulatory effects, this sexual dimorphism in the immune response seems to be hormone dependent. Despite our current knowledge about the effect of sex hormones on immune cells, definition of the factors driving the sex differences in immunoclinical outcomes, such as the diminished response to infection and vaccination observed in men or the higher rates of autoimmunity observed in females, remains elusive. Recently, systems approaches to immune function have started to suggest a way toward establishing this connection. Such studies promise to improve our understanding of the mechanisms underlying the sexual dimorphism observed in the human immune system.

  4. The X-files in immunity: sex-based differences predispose immune responses.

    PubMed

    Fish, Eleanor N

    2008-09-01

    Despite accumulating evidence in support of sex-based differences in innate and adaptive immune responses, in the susceptibility to infectious diseases and in the prevalence of autoimmune diseases, health research and clinical practice do not address these distinctions, and most research studies of immune responses do not stratify by sex. X-linked genes, hormones and societal context are among the many factors that contribute to disparate immune responses in males and females. It is crucial to address sex-based differences in disease pathogenesis and in the pharmacokinetics and pharmacodynamics of therapeutic medications to provide optimal disease management for both sexes.

  5. Innate and adaptive immune responses in neurodegeneration and repair.

    PubMed

    Amor, Sandra; Woodroofe, M Nicola

    2014-03-01

    Emerging evidence suggests important roles of the innate and adaptive immune responses in the central nervous system (CNS) in neurodegenerative diseases. In this special review issue, five leading researchers discuss the evidence for the beneficial as well as the detrimental impact of the immune system in the CNS in disorders including Alzheimer's disease, multiple sclerosis and CNS injury. Several common pathological mechanisms emerge indicating that these pathways could provide important targets for manipulating the immune reposes in neurodegenerative disorders. The articles highlight the role of the traditional resident immune cell of the CNS - the microglia - as well as the role of other glia astrocytes and oligodendrocytes in immune responses and their interplay with other immune cells including, mast cells, T cells and B cells. Future research should lead to new discoveries which highlight targets for therapeutic interventions which may be applicable to a range of neurodegenerative diseases.

  6. Innate and adaptive immune responses in neurodegeneration and repair

    PubMed Central

    Amor, Sandra; Woodroofe, M Nicola

    2014-01-01

    Emerging evidence suggests important roles of the innate and adaptive immune responses in the central nervous system (CNS) in neurodegenerative diseases. In this special review issue, five leading researchers discuss the evidence for the beneficial as well as the detrimental impact of the immune system in the CNS in disorders including Alzheimer's disease, multiple sclerosis and CNS injury. Several common pathological mechanisms emerge indicating that these pathways could provide important targets for manipulating the immune reposes in neurodegenerative disorders. The articles highlight the role of the traditional resident immune cell of the CNS - the microglia - as well as the role of other glia astrocytes and oligodendrocytes in immune responses and their interplay with other immune cells including, mast cells, T cells and B cells. Future research should lead to new discoveries which highlight targets for therapeutic interventions which may be applicable to a range of neurodegenerative diseases. PMID:23758741

  7. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    SciTech Connect

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.; Ballestas, Mary E.; Elmets, Craig A.; Robbins, David J.; Matalon, Sadis; Deshane, Jessy S.; Afaq, Farrukh; Bickers, David R.; Athar, Mohammad

    2013-11-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.

  8. Mumps virus-induced innate immune responses in mouse Sertoli and Leydig cells.

    PubMed

    Wu, Han; Shi, Lili; Wang, Qing; Cheng, Lijing; Zhao, Xiang; Chen, Qiaoyuan; Jiang, Qian; Feng, Min; Li, Qihan; Han, Daishu

    2016-01-18

    Mumps virus (MuV) infection frequently causes orchitis and impairs male fertility. However, the mechanisms underlying the innate immune responses to MuV infection in the testis have yet to be investigated. This study showed that MuV induced innate immune responses in mouse Sertoli and Leydig cells through TLR2 and retinoic acid-inducible gene I (RIG-I) signaling, which result in the production of proinflammatory cytokines and chemokines, including TNF-α, IL-6, MCP-1, CXCL10, and type 1 interferons (IFN-α and IFN-β). By contrast, MuV did not induce the cytokine production in male germ cells. In response to MuV infection, Sertoli cells produced higher levels of proinflammatory cytokines and chemokines but lower levels of type 1 IFNs than Leydig cells did. The MuV-induced cytokine production by Sertoli and Leydig cells was significantly reduced by the knockout of TLR2 or the knockdown of RIG-I signaling. The local injection of MuV into the testis triggered the testicular innate immune responses in vivo. Moreover, MuV infection suppressed testosterone synthesis by Leydig cells. This is the first study examining the innate immune responses to MuV infection in testicular cells. The results provide novel insights into the mechanisms underlying the MuV-induced innate immune responses in the testis.

  9. Mumps virus-induced innate immune responses in mouse Sertoli and Leydig cells

    PubMed Central

    Wu, Han; Shi, Lili; Wang, Qing; Cheng, Lijing; Zhao, Xiang; Chen, Qiaoyuan; Jiang, Qian; Feng, Min; Li, Qihan; Han, Daishu

    2016-01-01

    Mumps virus (MuV) infection frequently causes orchitis and impairs male fertility. However, the mechanisms underlying the innate immune responses to MuV infection in the testis have yet to be investigated. This study showed that MuV induced innate immune responses in mouse Sertoli and Leydig cells through TLR2 and retinoic acid-inducible gene I (RIG-I) signaling, which result in the production of proinflammatory cytokines and chemokines, including TNF-α, IL-6, MCP-1, CXCL10, and type 1 interferons (IFN-α and IFN-β). By contrast, MuV did not induce the cytokine production in male germ cells. In response to MuV infection, Sertoli cells produced higher levels of proinflammatory cytokines and chemokines but lower levels of type 1 IFNs than Leydig cells did. The MuV-induced cytokine production by Sertoli and Leydig cells was significantly reduced by the knockout of TLR2 or the knockdown of RIG-I signaling. The local injection of MuV into the testis triggered the testicular innate immune responses in vivo. Moreover, MuV infection suppressed testosterone synthesis by Leydig cells. This is the first study examining the innate immune responses to MuV infection in testicular cells. The results provide novel insights into the mechanisms underlying the MuV-induced innate immune responses in the testis. PMID:26776505

  10. Impaired immunity in harbour seals (Phoca vitulina) exposed to bioaccumulated environmental contaminants: review of a long-term feeding study.

    PubMed Central

    de Swart, R L; Ross, P S; Vos, J G; Osterhaus, A D

    1996-01-01

    Mass mortalities among seals and dolphins inhabiting contaminated marine regions have led to speculation about a possible involvement of immunosuppression associated with environmental pollution. To evaluate whether contaminants at ambient environmental levels can affect immune function of seals, we carried out an immunotoxicological study under semifield conditions. Two groups of 11 harbour seals (Phoca vitulina) originating from a relatively uncontaminated area were fed herring from either the highly polluted Baltic Sea or the relatively uncontaminated Atlantic Ocean. Changes in immune function were monitored over a 2 1/2-year period. The seals that were fed contaminated Baltic herring developed significantly higher body burdens of potentially immunotoxic organochlorines and displayed impaired immune responses as demonstrated by suppression of natural killer cell activity and specific T-cell responses. During a 2-week fasting experiment performed at the end of the feeding study, mobilization of organochlorines from the blubber did not lead to a strong increase of contaminant levels in the blood, and no enhancement of the existing immunosuppression was observed. These results demonstrate that chronic exposure to environmental contaminants accumulated through the food chain affects immune function in harbour seals, whereas short-term fasting periods, which are normal for seals, do not seem to pose an additional risk. The seals of this study were not exposed perinatally to high levels of environmental chemicals, and body burdens of organochlorines measured near the end of the study were lower than those generally observed in free-ranging seals inhabiting many contaminated regions. Therefore, it may be expected that environmental contaminants adversely affect immune function of free-ranging seals inhabiting contaminated regions at least as seriously as observed in these studies. PMID:8880005

  11. Caloric Restriction reduces inflammation and improves T cell-mediated immune response in obese mice but concomitant consumption of curcumin/piperine adds no further benefit

    USDA-ARS?s Scientific Manuscript database

    Obesity is associated with low-grade inflammation and impaired immune response. Caloric restriction (CR) has been shown to inhibit inflammatory response and enhance cell-mediated immune function. Curcumin, the bioactive phenolic component of turmeric spice, is proposed to have anti-obesity and anti-...

  12. High-dose dexamethasone corrects impaired myeloid-derived suppressor cell function via Ets1 in immune thrombocytopenia.

    PubMed

    Hou, Yu; Feng, Qi; Xu, Miao; Li, Guo-Sheng; Liu, Xue-Na; Sheng, Zi; Zhou, Hai; Ma, Ji; Wei, Yu; Sun, Yuan-Xin; Yu, Ying-Yi; Qiu, Ji-Hua; Shao, Lin-Lin; Liu, Xin-Guang; Hou, Ming; Peng, Jun

    2016-03-24

    Myeloid-derived suppressor cells (MDSCs) are heterogeneous immature cells and natural inhibitors of adaptive immunity. In this study, the MDSC population was evaluated in adult patients with primary immune thrombocytopenia (ITP), where cell-mediated immune mechanisms are involved in platelet destruction. Our data demonstrated that both the numbers and suppressive functions of MDSCs were impaired in the peripheral blood and spleens of patients with ITP compared with healthy control patients. High-dose dexamethasone (HD-DXM) treatment rescued MDSC numbers in patients with ITP. And DXM modulation promoted the suppressive function of MDSCs induced in vitro. Moreover, the expression of interleukin 10 and transforming growth factor β was significantly upregulated in DXM-modulated MDSCs compared with the unmodulated cultures. DXM-modulated MDSCs inhibited autologous CD4(+)T-cell proliferation and significantly attenuated cytotoxic T lymphocyte-mediated platelet lysis, further indicating enhanced control over T-cell responses. Elevated expression of the transcription factor Ets1 was identified in DXM-modulated MDSCs. Transfection of Ets-1 small interfering RNA efficiently blocked regulatory effects of MDSCs, which almost offset the augmentation of MDSC function by DXM. Meanwhile, splenocytes from CD61 knockout mice immunized with CD61(+)platelets were transferred into severe combined immunodeficient (SCID) mouse recipients (C57/B6 background) to induce a murine model of severe ITP. We passively transferred the DXM-modulated MDSCs induced from bone marrow of wild-type C57/B6 mice into the SCID mouse recipients, which significantly increased platelet counts in vivo compared with those receiving splenocyte engraftment alone. These findings suggested that impaired MDSCs are involved in the pathogenesis of ITP, and that HD-DXM corrected MDSC functions via a mechanism underlying glucocorticoid action and Ets1.

  13. Transcriptional analysis of the innate immune response using the avian innate immunity microarray

    USDA-ARS?s Scientific Manuscript database

    The avian innate immunity microarray (AIIM) is a genomics tool designed to study the transcriptional activity of the avian immune response (Cytogenet. Genome Res. 117:139-145, 2007). It is an avian cDNA microarray representing 4,959 avian genes spotted in triplicate. The AIIM contains 25 avian int...

  14. Interplay between behavioural thermoregulation and immune response in mealworms.

    PubMed

    Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco

    2012-11-01

    Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Immune Response in Thyroid Cancer: Widening the Boundaries

    PubMed Central

    Ward, Laura Sterian

    2014-01-01

    The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756

  16. Immunomodulator-based enhancement of anti smallpox immune responses.

    PubMed

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  17. Immune-responsiveness of CD4+ T cells during Streptococcus suis serotype 2 infection

    PubMed Central

    Lecours, Marie-Pier; Letendre, Corinne; Clarke, Damian; Lemire, Paul; Galbas, Tristan; Benoit-Biancamano, Marie-Odile; Thibodeau, Jacques; Gottschalk, Marcelo; Segura, Mariela

    2016-01-01

    The pathogenesis of Streptococcus suis infection, a major swine and human pathogen, is only partially understood and knowledge on the host adaptive immune response is critically scarce. Yet, S. suis virulence factors, particularly its capsular polysaccharide (CPS), enable this bacterium to modulate dendritic cell (DC) functions and potentially impair the immune response. This study aimed to evaluate modulation of T cell activation during S. suis infection and the role of DCs in this response. S. suis-stimulated total mouse splenocytes readily produced TNF-α, IL-6, IFN-γ, CCL3, CXCL9, and IL-10. Ex vivo and in vivo analyses revealed the involvement of CD4+ T cells and a Th1 response. Nevertheless, during S. suis infection, levels of the Th1-derived cytokines TNF-α and IFN-γ were very low. A transient splenic depletion of CD4+ T cells and a poor memory response were also observed. Moreover, CD4+ T cells secreted IL-10 and failed to up-regulate optimal levels of CD40L and CD69 in coculture with DCs. The CPS hampered release of several T cell-derived cytokines in vitro. Finally, a correlation was established between severe clinical signs of S. suis disease and impaired antibody responses. Altogether, these results suggest S. suis interferes with the adaptive immune response. PMID:27905502

  18. PDT-apoptotic tumor cells induce macrophage immune response

    NASA Astrophysics Data System (ADS)

    Zhou, Fei-fan; Xing, Da; Chen, Wei R.

    2008-02-01

    Photodynamic therapy (PDT) functions as a cancer therapy through two major cell death mechanisms: apoptosis and necrosis. Immunological responses induced by PDT has been mainly associated with necrosis while apoptosis associated immune responses have not fully investigated. Heat shock proteins (HSPs) play an important role in regulating immune responses. In present study, we studied whether apoptotic tumor cells could induce immune response and how the HSP70 regulates immune response. The endocytosis of tumor cells by the activated macrophages was observed at single cell level by LSM. The TNF-α release of macrophages induced by co-incubated with PDT-apoptotic tumor cells was detected by ELISA. We found that apoptotic tumor cells treated by PDT could activate the macrophages, and the immune effect decreased evidently when HSP70 was blocked. These findings not only show that apoptosis can induce immunological responses, but also show HSP70 may serves as a danger signal for immune cells and induce immune responses to regulate the efficacy of PDT.

  19. Innate immune responses in raccoons after raccoon rabies virus infection.

    PubMed

    Srithayakumar, Vythegi; Sribalachandran, Hariharan; Rosatte, Rick; Nadin-Davis, Susan A; Kyle, Christopher J

    2014-01-01

    Zoonotic wildlife diseases pose significant health risks not only to their primary vectors but also to humans and domestic animals. Rabies is a lethal encephalitis caused by rabies virus (RV). This RNA virus can infect a range of terrestrial mammals but each viral variant persists in a particular reservoir host. Active management of these host vectors is needed to minimize the negative impacts of this disease, and an understanding of the immune response to RV infection aids strategies for host vaccination. Current knowledge of immune responses to RV infection comes primarily from rodent models in which an innate immune response triggers activation of several genes and signalling pathways. It is unclear, however, how well rodent models represent the immune response of natural hosts. This study investigates the innate immune response of a primary host, the raccoon, to a peripheral challenge using the raccoon rabies virus (RRV). The extent and temporal course of this response during RRV infection was analysed using genes predicted to be upregulated during infection (IFNs; IFN regulatory factors; IL-6; Toll like receptor-3; TNF receptor). We found that RRV activated components of the innate immune system, with changes in levels of transcripts correlated with presence of viral RNA. Our results suggest that natural reservoirs of rabies may not mimic the immune response triggered in rodent models, highlighting the need for further studies of infection in primary hosts.

  20. [Immune response in the pathogenesis of hepatitis C virus infection].

    PubMed

    Chalupa, P; Holub, M; Davidová, A; Arientová, S; Beran, O

    2015-10-01

    The pathogenesis of hepatitis C virus (HCV) infection is regulated by the host immunity and several metabolic factors affecting liver metabolism, including oxidative stress, insulin resistance, and hepatic steatosis. Both innate and adaptive immunity play an important role in HCV infection. Cytotoxic lymphocytes have a crucial role in viral eradication or viral persistence. Major cause of viral persistence during HCV infection could be the development of a weak antiviral immune response to the viral antigens, with corresponding inability to eradicate infected cells.

  1. Nifurtimox-induced alterations in the cell-mediated immune response to PPD tin guinea-pigs.

    PubMed Central

    Lelchuk, R; Cardoni, R L; Levis, S

    1977-01-01

    Positive skin reactions to PPD in guinea-pigs immunized with Freund's complete adjuvant (FCA) were reversed after treatment with 10 mg/kg/day nifurtimox for 12 days. The in vitro migration of peripheral blood leucocytes from FCA-immunized guinea-pigs was inhibited with PPD, but it returned to normal values after nifurtimox treatment. Furthermore, the cell-free supernatant from PPD-stimulated lymphocytes from FCA-immunized nifurtimox-treated guinea-pigs did not inhibit the migration of normal cells. Thus the administration of nifurtimox impaired the specific cell-mediated immune response to PPD both in vivo and in vitro. PMID:414870

  2. Inhibition of viral replication reduces regulatory T cells and enhances the antiviral immune response in chronic hepatitis B

    SciTech Connect

    Stoop, Jeroen N. . E-mail: j.n.stoop@erasmusmc.nl; Molen, Renate G. van der . E-mail: r.vandermolen@erasmusmc.nl; Kuipers, Ernst J. . E-mail: e.j.kuipers@erasmusmc.nl; Kusters, Johannes G. . E-mail: j.g.kusters@erasmusmc.nl; Janssen, Harry L.A. . E-mail: h.janssen@erasmusmc.nl

    2007-04-25

    Regulatory T cells (Treg) play a key role in the impaired immune response that is typical for a chronic Hepatitis B virus (HBV) infection. To gain more insight in the mechanism that is responsible for this impaired immune response, the effect of viral load reduction resulting from treatment with the nucleotide analogue adefovir dipivoxil on the percentages of Treg and HBV-specific T-cell responses was analyzed. Peripheral blood mononuclear cells (PBMC) of 12 patients were collected at baseline and during treatment. In parallel to the decline in viral load, we found a decline in circulating Treg, combined with an increase in HBV core antigen-specific IFN-{gamma} production and proliferation. The production of IL10 did not decrease during therapy. In conclusion, adefovir induced viral load reduction results in a decline of circulating Treg together with a partial recovery of the immune response.

  3. Immune Response in Microgravity: Genetic Basis and Countermeasure Development Implications

    NASA Technical Reports Server (NTRS)

    Risin, Diana; Ward, Nancy E.; Risin, Semyon A.; Pellis, Neal R.

    2006-01-01

    Impairment of the immunity in astronauts and cosmonauts even in shortterm flights is a recognized risk. Longterm orbital space missions and anticipated interplanetary flights increase the concern for more pronounced effects on the immune system with potential clinical consequences. Studies in true and modeled microgravity (MG) have demonstrated that MG directly affects numerous lymphocyte functions. The purpose of this study was to screen for genes involved in lymphocytes response to modeled microgravity (MMG) that could explain the functional and structural changes observed earlier. The microgravity-induced changes in gene expression were analyzed by microarray DNA chip technology. CD3and IL2activated Tcells were cultured in 1g (static) and modeled microgravity (NASA Rotating Wall Vessel bioreactor) conditions for 24 hours. Total RNA was extracted using the RNeasy isolation kit (Qiagen, Valencia, CA). Microarray experiments were performed utilizing Affymetrix Gene Chips (U133A), allowing testing for 18,400 human genes. To decrease the biological variation and aid in detecting microgravity-associated changes, experiments were performed in triplicate using cells obtained from three different donors. Exposure to modeled microgravity resulted in alteration of 89 genes, 10 of which were upregulated and 79 down-regulated. Altered genes were categorized by their function, structural role and by association with metabolic and regulatory pathways. A large proportion was found to be involved in fundamental cellular processes: signal transduction, DNA repair, apoptosis, and multiple metabolic pathways. There was a group of genes directly related to immune and inflammatory responses (IL7R, granulysin, proteasome activator subunit 2, peroxiredoxin 4, HLADRA, lymphocyte antigen 75, IL18R and DOCK2 genes). Among these genes only one (IL7R) was upregulated, the rest were downregulated. The upregulation of the IL7 receptor gene was confirmed by RT PCR. Three genes with altered

  4. Immune Response in Microgravity: Genetic Basis and Countermeasure Development Implications

    NASA Technical Reports Server (NTRS)

    Risin, Diana; Ward, Nancy E.; Risin, Semyon A.; Pellis, Neal R.

    2006-01-01

    Impairment of the immunity in astronauts and cosmonauts even in shortterm flights is a recognized risk. Longterm orbital space missions and anticipated interplanetary flights increase the concern for more pronounced effects on the immune system with potential clinical consequences. Studies in true and modeled microgravity (MG) have demonstrated that MG directly affects numerous lymphocyte functions. The purpose of this study was to screen for genes involved in lymphocytes response to modeled microgravity (MMG) that could explain the functional and structural changes observed earlier. The microgravity-induced changes in gene expression were analyzed by microarray DNA chip technology. CD3and IL2activated Tcells were cultured in 1g (static) and modeled microgravity (NASA Rotating Wall Vessel bioreactor) conditions for 24 hours. Total RNA was extracted using the RNeasy isolation kit (Qiagen, Valencia, CA). Microarray experiments were performed utilizing Affymetrix Gene Chips (U133A), allowing testing for 18,400 human genes. To decrease the biological variation and aid in detecting microgravity-associated changes, experiments were performed in triplicate using cells obtained from three different donors. Exposure to modeled microgravity resulted in alteration of 89 genes, 10 of which were upregulated and 79 down-regulated. Altered genes were categorized by their function, structural role and by association with metabolic and regulatory pathways. A large proportion was found to be involved in fundamental cellular processes: signal transduction, DNA repair, apoptosis, and multiple metabolic pathways. There was a group of genes directly related to immune and inflammatory responses (IL7R, granulysin, proteasome activator subunit 2, peroxiredoxin 4, HLADRA, lymphocyte antigen 75, IL18R and DOCK2 genes). Among these genes only one (IL7R) was upregulated, the rest were downregulated. The upregulation of the IL7 receptor gene was confirmed by RT PCR. Three genes with altered

  5. Chemical Tools To Monitor and Manipulate Adaptive Immune Responses.

    PubMed

    Doran, Todd M; Sarkar, Mohosin; Kodadek, Thomas

    2016-05-18

    Methods to monitor and manipulate the immune system are of enormous clinical interest. For example, the development of vaccines represents one of the earliest and greatest accomplishments of the biomedical research enterprise. More recently, drugs capable of "reawakening" the immune system to cancer have generated enormous excitement. But, much remains to be done. All drugs available today that manipulate the immune system cannot distinguish between "good" and "bad" immune responses and thus drive general and systemic immune suppression or activation. Indeed, with the notable exception of vaccines, our ability to monitor and manipulate antigen-specific immune responses is in its infancy. Achieving this finer level of control would be highly desirable. For example, it might allow the pharmacological editing of pathogenic immune responses without restricting the ability of the immune system to defend against infection. On the diagnostic side, a method to comprehensively monitor the circulating, antigen-specific antibody population could provide a treasure trove of clinically useful biomarkers, since many diseases expose the immune system to characteristic molecules that are deemed foreign and elicit the production of antibodies against them. This Perspective will discuss the state-of-the-art of this area with a focus on what we consider seminal opportunities for the chemistry community to contribute to this important field.

  6. Global analysis of the immune response

    NASA Astrophysics Data System (ADS)

    Ribeiro, Leonardo C.; Dickman, Ronald; Bernardes, Américo T.

    2008-10-01

    The immune system may be seen as a complex system, characterized using tools developed in the study of such systems, for example, surface roughness and its associated Hurst exponent. We analyze densitometric (Panama blot) profiles of immune reactivity, to classify individuals into groups with similar roughness statistics. We focus on a population of individuals living in a region in which malaria endemic, as well as a control group from a disease-free region. Our analysis groups individuals according to the presence, or absence, of malaria symptoms and number of malaria manifestations. Applied to the Panama blot data, our method proves more effective at discriminating between groups than principal-components analysis or super-paramagnetic clustering. Our findings provide evidence that some phenomena observed in the immune system can be only understood from a global point of view. We observe similar tendencies between experimental immune profiles and those of artificial profiles, obtained from an immune network model. The statistical entropy of the experimental profiles is found to exhibit variations similar to those observed in the Hurst exponent.

  7. Augmenting Antitumor Immune Responses with Epigenetic Modifying Agents

    PubMed Central

    Héninger, Erika; Krueger, Timothy E. G.; Lang, Joshua M.

    2015-01-01

    Epigenetic silencing of immune-related genes is a striking feature of the cancer genome that occurs in the process of tumorigenesis. This phenomena impacts antigen processing and antigen presentation by tumor cells and facilitates evasion of immunosurveillance. Further modulation of the tumor microenvironment by altered expression of immunosuppressive cytokines impairs antigen-presenting cells and cytolytic T-cell function. The potential reversal of immunosuppression by epigenetic modulation is therefore a promising and versatile therapeutic approach to reinstate endogenous immune recognition and tumor lysis. Pre-clinical studies have identified multiple elements of the immune system that can be modulated by epigenetic mechanisms and result in improved antigen presentation, effector T-cell function, and breakdown of suppressor mechanisms. Recent clinical studies are utilizing epigenetic therapies prior to, or in combination with, immune therapies to improve clinical outcomes. PMID:25699047

  8. Fallen Angels or Risen Apes? A Tale of the Intricate Complexities of Imbalanced Immune Responses in the Pathogenesis and Progression of Immune-Mediated and Viral Cancers

    PubMed Central

    Ondondo, Beatrice Omusiro

    2014-01-01

    Excessive immune responses directed against foreign pathogens, self-antigens, or commensal microflora can cause cancer establishment and progression if the execution of tight immuno-regulatory mechanisms fails. On the other hand, induction of potent tumor antigen-specific immune responses together with stimulation of the innate immune system is a pre-requisite for effective anti-tumor immunity, and if suppressed by the strong immuno-regulatory mechanisms can lead to cancer progression. Therefore, it is crucial that the inevitable co-existence of these fundamental, yet conflicting roles of immune-regulatory cells is carefully streamlined as imbalances can be detrimental to the host. Infection with chronic persistent viruses is characterized by severe immune dysfunction resulting in T cell exhaustion and sometimes deletion of antigen-specific T cells. More often, this is due to increased immuno-regulatory processes, which are triggered to down-regulate immune responses and limit immunopathology. However, such heightened levels of immune disruption cause a concomitant loss of tumor immune-surveillance and create a permissive microenvironment for cancer establishment and progression, as demonstrated by increased incidences of cancer in immunosuppressed hosts. Paradoxically, while some cancers arise as a consequence of increased immuno-regulatory mechanisms that inhibit protective immune responses and impinge on tumor surveillance, other cancers arise due to impaired immuno-regulatory mechanisms and failure to limit pathogenic inflammatory responses. This intricate complexity, where immuno-regulatory cells can be beneficial in certain immune settings but detrimental in other settings underscores the need for carefully formulated interventions to equilibrate the balance between immuno-stimulatory and immuno-regulatory processes. PMID:24639678

  9. Fallen angels or risen apes? A tale of the intricate complexities of imbalanced immune responses in the pathogenesis and progression of immune-mediated and viral cancers.

    PubMed

    Ondondo, Beatrice Omusiro

    2014-01-01

    Excessive immune responses directed against foreign pathogens, self-antigens, or commensal microflora can cause cancer establishment and progression if the execution of tight immuno-regulatory mechanisms fails. On the other hand, induction of potent tumor antigen-specific immune responses together with stimulation of the innate immune system is a pre-requisite for effective anti-tumor immunity, and if suppressed by the strong immuno-regulatory mechanisms can lead to cancer progression. Therefore, it is crucial that the inevitable co-existence of these fundamental, yet conflicting roles of immune-regulatory cells is carefully streamlined as imbalances can be detrimental to the host. Infection with chronic persistent viruses is characterized by severe immune dysfunction resulting in T cell exhaustion and sometimes deletion of antigen-specific T cells. More often, this is due to increased immuno-regulatory processes, which are triggered to down-regulate immune responses and limit immunopathology. However, such heightened levels of immune disruption cause a concomitant loss of tumor immune-surveillance and create a permissive microenvironment for cancer establishment and progression, as demonstrated by increased incidences of cancer in immunosuppressed hosts. Paradoxically, while some cancers arise as a consequence of increased immuno-regulatory mechanisms that inhibit protective immune responses and impinge on tumor surveillance, other cancers arise due to impaired immuno-regulatory mechanisms and failure to limit pathogenic inflammatory responses. This intricate complexity, where immuno-regulatory cells can be beneficial in certain immune settings but detrimental in other settings underscores the need for carefully formulated interventions to equilibrate the balance between immuno-stimulatory and immuno-regulatory processes.

  10. Interferon regulatory factor 3 in adaptive immune responses.

    PubMed

    Ysebrant de Lendonck, Laure; Martinet, Valerie; Goriely, Stanislas

    2014-10-01

    Interferon regulatory factor (IRF) 3 plays a key role in innate responses against viruses. Indeed, activation of this transcription factor triggers the expression of type I interferons and downstream interferon-stimulated genes in infected cells. Recent evidences indicate that this pathway also modulates adaptive immune responses. This review focuses on the different mechanisms that are implicated in this process. We discuss the role of IRF3 within antigen-presenting cells and T lymphocytes in the polarization of the cellular immune response and its implication in the pathogenesis of immune disorders.

  11. Outsmarting the host: bacteria modulating the immune response.

    PubMed

    Woolard, Matthew D; Frelinger, Jeffrey A

    2008-01-01

    Pathogenic bacteria and their hosts have had a two-way conversation for millions of years. This interaction has led to many measure/counter-measure responses by the host and bacteria. The host immune response has developed many mechanisms to neutralize and remove pathogen bacteria. In turn pathogenic bacteria have developed mechanisms to alter and evade the host immune response. We will review some of the mechanisms utilized by bacteria to accomplish this goal. We will also examine the current state of understanding of Francisella tularensis mediated immune evasion.

  12. Apoptosis and other immune biomarkers predict influenza vaccine responsiveness

    PubMed Central

    Furman, David; Jojic, Vladimir; Kidd, Brian; Shen-Orr, Shai; Price, Jordan; Jarrell, Justin; Tse, Tiffany; Huang, Huang; Lund, Peder; Maecker, Holden T; Utz, Paul J; Dekker, Cornelia L; Koller, Daphne; Davis, Mark M

    2013-01-01

    Despite the importance of the immune system in many diseases, there are currently no objective benchmarks of immunological health. In an effort to identifying such markers, we used influenza vaccination in 30 young (20–30 years) and 59 older subjects (60 to >89 years) as models for strong and weak immune responses, respectively, and assayed their serological responses to influenza strains as well as a wide variety of other parameters, including gene expression, antibodies to hemagglutinin peptides, serum cytokines, cell subset phenotypes and in vitro cytokine stimulation. Using machine learning, we identified nine variables that predict the antibody response with 84% accuracy. Two of these variables are involved in apoptosis, which positively associated with the response to vaccination and was confirmed to be a contributor to vaccine responsiveness in mice. The identification of these biomarkers provides new insights into what immune features may be most important for immune health. PMID:23591775

  13. Cervical Carcinogenesis and Immune Response Gene Polymorphisms: A Review

    PubMed Central

    Mooij, Merel

    2017-01-01

    The local immune response is considered a key determinant in cervical carcinogenesis after persistent infection with oncogenic, high-risk human papillomavirus (HPV) infections. Genetic variation in various immune response genes has been shown to influence risk of developing cervical cancer, as well as progression and survival among cervical cancer patients. We reviewed the literature on associations of immunogenetic single nucleotide polymorphism, allele, genotype, and haplotype distributions with risk and progression of cervical cancer. Studies on HLA and KIR gene polymorphisms were excluded due to the abundance on literature on that subject. We show that multiple genes and loci are associated with variation in risk of cervical cancer. Rather than one single gene being responsible for cervical carcinogenesis, we postulate that variations in the different immune response genes lead to subtle differences in the effectiveness of the antiviral and antitumour immune responses, ultimately leading to differences in risk of developing cervical cancer and progressive disease after HPV infection. PMID:28280748

  14. Subversion of the Immune Response by Rabies Virus.

    PubMed

    Scott, Terence P; Nel, Louis H

    2016-08-19

    Rabies has affected mankind for several centuries and is one of the oldest known zoonoses. It is peculiar how little is known regarding the means by which rabies virus (RABV) evades the immune response and kills its host. This review investigates the complex interplay between RABV and the immune system, including the various means by which RABV evades, or advantageously utilizes, the host immune response in order to ensure successful replication and spread to another host. Different factors that influence immune responses-including age, sex, cerebral lateralization and temperature-are discussed, with specific reference to RABV and the effects on host morbidity and mortality. We also investigate the role of apoptosis and discuss whether it is a detrimental or beneficial mechanism of the host's response to infection. The various RABV proteins and their roles in immune evasion are examined in depth with reference to important domains and the downstream effects of these interactions. Lastly, an overview of the means by which RABV evades important immune responses is provided. The research discussed in this review will be important in determining the roles of the immune response during RABV infections as well as to highlight important therapeutic target regions and potential strategies for rabies treatment.

  15. Tissue engineering tools for modulation of the immune response

    PubMed Central

    Boehler, Ryan M.; Graham, John G.; Shea, Lonnie D.

    2012-01-01

    Tissue engineering scaffolds have emerged as a powerful tool within regenerative medicine. These materials are being designed to create environments that promote regeneration through a combination of: (i) scaffold architecture, (ii) the use of scaffolds as vehicles for transplanting progenitor cells, and/or (iii) localized delivery of inductive factors or genes encoding for these inductive factors. This review describes the techniques associated with each of these components. Additionally, the immune response is increasingly recognized as a factor influencing regeneration. The immune reaction to an implant begins with an acute response to the injury and innate recognition of foreign materials, with the subsequent chronic immune response involving specific recognition of antigens (e.g., transplanted cells) by the adaptive immune response, which can eventually lead to rejection of the implant. Thus, we also describe the impact of each component on the immune response, and strategies (e.g., material design, anti-inflammatory cytokine delivery, and immune cell recruitment/transplantation) to modulate, yet not eliminate, the local immune response in order to promote regeneration, which represents another important tool for regenerative medicine. PMID:21988690

  16. Immune and stress responses in oysters with insights on adaptation.

    PubMed

    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

    2015-09-01

    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments.

  17. Photodynamic therapy and immune response in tumor-bearing mice

    NASA Astrophysics Data System (ADS)

    Canti, Gianfranco L.; Cubeddu, Rinaldo; Taroni, Paola; Valentini, Gianluca

    1999-06-01

    Since immune response of the host is important in the control of tumor growth and spreading, and the Photodynamic therapy (PDT) is able to increase the antitumor immunity, in our laboratory we examine the effect of PDT on immune compartment of tumor bearing mice. Lymphocytes and macrophages collected from tumor bearing mice pretreated with PDT are cytotoxic in vitro and in vivo against the parental tumor lines, in contrast the same immune cells population collected from tumor bearing mice pretreated only with laser light are unable to lyse the parental tumor cells. In adoptive immunotherapy experiments, treatment of mice bearing MS-2 tumor with adoptive transfer of immune lymphocytes collected from mice pretreated with PDT is able to significantly increase the survival time; in contrast the lymphocytes collected from mice pretreated only with laser light were not able to modify the survival time suggesting that the laser treatment alone did not increase the immune response of the host. In conclusion these results demonstrate that the PDT induce a strong immune response on the host and the stimulated lymphocytes generated could be used for an adoptive immunotherapy approach; moreover laser treatment alone (thermal effect) is unable to modulate the immune response of the host.

  18. Impairing loyalty: corporate responsibility for clinical misadventure.

    PubMed

    Kipnis, Kenneth

    2011-09-01

    A medical device manufacturer pays a surgeon to demonstrate a novel medical instrument in a live broadcast to an audience of specialists in another city. The surgical patient is unaware of the broadcast and unaware of the doctor's relationship with the manufacturer. It turns out that the patient required a different surgical approach to her condition-one that would not have allowed a demonstration of the instrument--and she later dies. The paper is an exploration of whether the manufacturer shares, along with the doctor, responsibility for the death of the patient. Three arguments for corporate responsibility are considered; two are criticized and the third is offered as sound.

  19. Cigarette smoke impairs cytokine responses and BCG containment in alveolar macrophages

    PubMed Central

    van Zyl-Smit, Richard N; Binder, Anke; Meldau, Richard; Semple, Patricia L; Evans, Alicia; Smith, Peter; Bateman, Eric D; Dheda, Keertan

    2017-01-01

    Background There is a strong epidemiological link between smoking and tuberculosis (TB), but the association is confounded by socioeconomic and other factors. A direct relationship between cigarette smoke and poor treatment-related outcomes in patients with TB is therefore questionable. We investigated whether constituents of tobacco smoke impair mycobacterial host immune responses in vitro. Methodology Preparation of a cigarette smoke extract (CSE) from Marlboro Red cigarettes was standardised and reproducibility verified by mass spectroscopy. Macrophages were derived from peripheral blood monocytes (MDM) and alveolar macrophages from bronchoalveolar lavage fluid from healthy non-smoking volunteers. Mycobacterial uptake (flow cytometric detection of fluorescence using green fluorescent protein-labelled BCG), cytokine responses (ELISA) and mycobacterial containment (colony forming units) was evaluated in both macrophage populations with and without co-culture with CSE, nicotine and a nicotine receptor blocker. Results Cigarette smoke failed to impair the uptake of mycobacteria by monocyte-derived or alveolar macrophages. CSE (vs no CSE) reduced the mean (SD) BCG-driven macrophage (MDM) interferon γ (IFN-γ), tumour necrosis factor α (TNF-α) and interleukin 10 (IL-10) responses by 56.4 (18.6)%, 67.0 (33.4)% and 77.7 (27.7)%, respectively (p<0.001). Nicotine alone impaired IL-10 and TNF-α production by 48.8 (37)% and 49 (50)%, respectively (p<0.05) through an α-7 nicotine receptor-independent mechanism. In 5-day cultures, CSE impaired mycobacterial (BCG) containment in both monocyte-derived and alveolar macrophages. Conclusions Cigarette smoke attenuates effector cytokine responses and impairs mycobacterial containment within infected human macrophages derived from the peripheral blood and alveolar compartments, thus supporting the hypothesis that cigarette smoke subverts mycobacteria-related immunity. PMID:24287167

  20. Suppressive effect of O,O-dimethyl, S-ethyl phosphorothioate on immune response.

    PubMed

    Thomas, I K; Koizumi, A; Imamura, T

    1986-01-01

    The effect of O,O-dimethyl, S-ethyl phosphorothioate (OO-Me S-Et) on macrophage function and the responses of T- and B-cells of the immune system were investigated using an in vitro model. The role of glutathione (GSH) enhancement of OO-Me S-Et suppression of immune responses was studied after either direct culturing with spleen or B-cells alone or coculture of B-cells with either B- or T-cells with or without preincubation with OO-Me S-Et and glutathione enriched cytosol. The results indicated that OO-Me S-Et, when preincubated with GSH, suppresses immune responses through an inhibition of B- and T-cell functions. Both cytotoxic T-lymphocyte (CTL) generation and antibody production were impaired. In mixing experiments of pretreated and normal cells, the inhibitory effect was also observed on macrophages and helper T-cells responding to a T-dependent antigen. It appears that the immunosuppressive effect of OO-Me S-Et is due to impairment of collaboration of T- and B-cells, i.e., mainly due to impairment of T-cell functions. The immunotoxic effect was only detectable when glutathione was present in the preincubation mixture.

  1. Incomplete immune response to coxsackie B viruses associates with early autoimmunity against insulin

    PubMed Central

    Ashton, Michelle P.; Eugster, Anne; Walther, Denise; Daehling, Natalie; Riethausen, Stephanie; Kuehn, Denise; Klingel, Karin; Beyerlein, Andreas; Zillmer, Stephanie; Ziegler, Anette-Gabriele; Bonifacio, Ezio

    2016-01-01

    Viral infections are associated with autoimmunity in type 1 diabetes. Here, we asked whether this association could be explained by variations in host immune response to a putative type 1 etiological factor, namely coxsackie B viruses (CVB). Heterogeneous antibody responses were observed against CVB capsid proteins. Heterogeneity was largely defined by different binding to VP1 or VP2. Antibody responses that were anti-VP2 competent but anti-VP1 deficient were unable to neutralize CVB, and were characteristic of children who developed early insulin-targeting autoimmunity, suggesting an impaired ability to clear CVB in early childhood. In contrast, children who developed a GAD-targeting autoimmunity had robust VP1 and VP2 antibody responses to CVB. We further found that 20% of memory CD4+ T cells responding to the GAD65247-266 peptide share identical T cell receptors to T cells responding to the CVB4 p2C30-51 peptide, thereby providing direct evidence for the potential of molecular mimicry as a mechanism for GAD autoimmunity. Here, we highlight functional immune response differences between children who develop insulin-targeting and GAD-targeting autoimmunity, and suggest that children who lose B cell tolerance to insulin within the first years of life have a paradoxical impaired ability to mount humoral immune responses to coxsackie viruses. PMID:27604323

  2. Provider response to different formats of the adult immunization schedule.

    PubMed

    Davis, Matthew M; Halasyamani, Lakshmi K; Sneller, Vishnu-Priya; Bishop, Kathy R; Clark, Sarah J

    2005-07-01

    Providers' failure to administer vaccines in accordance with established recommendations is a well-recognized barrier to national immunization efforts. This study evaluated the ease of use of two different formats of the Centers for Disease Control and Prevention's (CDC) adult immunization schedule by physicians in private practice, where the majority of adult immunizations are administered. A series of focus groups was conducted with 94 physicians and other clinical staff in 11 private practices (family medicine and internal medicine) in six U.S. cities. Each session was based on a structured set of questions that explored barriers to adult immunizations, followed by three mock clinical scenarios to examine how each of two graphical depictions of the 2003-2004 adult immunization schedule (one from the CDC's Advisory Committee on Immunization Practices, and the other from the Immunization Action Coalition) might facilitate assessments of recommended immunizations. Group dialogue and individual participants' written responses to the scenarios and the alternate schedule formats were analyzed. Providers perceived multiple barriers to adult immunization independent of immunization schedule formats, chiefly patients' low interest in immunization and refusal of vaccines. Most participants were not familiar with either format of CDC's adult immunization schedule before the study, but quickly developed strong preferences for one versus the other (usually the second format that they encountered). About half of the providers changed their vaccine recommendations for clinical scenarios when they consulted either schedule format, although some of the changes were not clinically appropriate. Participants suggested several ways to enhance the availability of the information contained in the schedule formats, especially through electronic means. This qualitative study suggests ways in which graphic depictions of an adult immunization schedule may address adult immunization

  3. Immune activation alters cellular and humoral responses to yellow fever 17D vaccine.

    PubMed

    Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S; Rowe, Dawne K; Smith, Michaela J; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie; Gaucher, Denis

    2014-07-01

    Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. We showed that YF-17D-induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D-neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Registration is not required for observational studies. This study was funded by Canada's Global Health Research Initiative, Defense Threat Reduction Agency, National Institute of Allergy and Infectious Diseases

  4. Immune activation alters cellular and humoral responses to yellow fever 17D vaccine

    PubMed Central

    Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S.; Rowe, Dawne K.; Smith, Michaela J.; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H.; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K.; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie

    2014-01-01

    Background. Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. Methods. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. Results. We showed that YF-17D–induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D–neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Conclusion. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Trial registration. Registration is not required for observational studies. Funding. This study was funded by Canada’s Global Health Research Initiative, Defense

  5. Radiation Induced Immune Response in Prostate Cancer

    DTIC Science & Technology

    2014-12-01

    immune effector cells. Glucose Regulated Protein-78 (GRP78), and Tax interacting protein-1 (TIP1) are overexpressed in cancer and participate in the...vivo. KEY WORDS: Glucose Regulated Protein-78 (GRP78) Tax interacting protein-1 (TIP1) IgG antibody dependent cell mediated cytotoxicity (ADCC

  6. Social Behavior, Prolactin and the Immune Response

    DTIC Science & Technology

    1989-04-01

    treated with neomycin for diarrhea during the last week of July. Some of the fluctuations in SI’s during late July and early August might be due to...Behavior, and immunity, 1987, 1, 7-20. Gross, W. B. Effect ot social stress on occurrence of Marek’s disease in chickens . Am. J. Vet. Res., 1972, 933, 2275

  7. DNA-mediated immunization and the energetic immune response to hepatitis B surface antigen.

    PubMed

    Whalen, R G; Davis, H L

    1995-04-01

    A new and unusual approach for evoking an immune response has recently been introduced--that of DNA-based immunization. Purified plasmid DNA, containing protein coding sequences and the necessary regulatory elements to express them, can be introduced into tissues of the organism by means of a parenteral injection or by particle bombardment. The number of cells transfected and the amount of protein produced is sufficient to produce a remarkably strong and broad-based immune response to a wide variety of foreign proteins. The absence of an exogenous infectious agent or immunogen results in the abrupt appearance of a foreign protein within the normal cells of an immunologically mature and healthy animal and provokes an energetic and efficient reaction to this form of antigen presentation. This review summarizes the results obtained with the various experimental models that have been described to date and considers in greater depth the immune response to the surface antigen of the human hepatitis B virus that has been achieved using DNA-based immunization. Several issues are addressed in a prospective manner in order to anticipate some future developments and to point out topics likely to be pertinent to this field. DNA-mediated induction of immune responses may soon be applied as a form of therapeutic treatment. Although this method may constitute a revolution for vaccination, many issues must first be dealt with, especially concerning the safety of using DNA as an immunizing molecule.

  8. Taenia solium: immune response against oral or systemic immunization with purified recombinant calreticulin in mice.

    PubMed

    Fonseca-Coronado, Salvador; Ruiz-Tovar, Karina; Pérez-Tapia, Mayra; Mendlovic, Fela; Flisser, Ana

    2011-01-01

    Recombinant functional Taenia solium calreticulin (rTsCRT) confers different degrees of protection in the experimental model of intestinal taeniosis in hamsters. The aim of this study was to evaluate the immune response induced after oral or systemic immunization with an electroeluted rTsCRT in BALB/c mice. Oral immunization elicited high fecal IgA and the production of IL-4 and IL-5 by mesenteric lymph node cells after in vitro stimulation with rTSCRT, indicating a Th2 response. Mice subcutaneously immunized produced high amounts of serum IgG, being IgG1 (Th2-related) the predominant isotype, while in vitro stimulated spleen cells synthesized IL-4, IL-5 and also IFN-γ, indicating a mixed Th1/Th2 cellular response after systemic immunization. Our data show that purified rTsCRT induces polarized Th2 responses after oral immunization of mice, a common characteristic of protective immunity against helminths and, consequently, a desirable hallmark in the search for a vaccine.

  9. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    PubMed Central

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas

    2011-01-01

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses. PMID:24213131

  10. Subversion of the Immune Response by Rabies Virus

    PubMed Central

    Scott, Terence P.; Nel, Louis H.

    2016-01-01

    Rabies has affected mankind for several centuries and is one of the oldest known zoonoses. It is peculiar how little is known regarding the means by which rabies virus (RABV) evades the immune response and kills its host. This review investigates the complex interplay between RABV and the immune system, including the various means by which RABV evades, or advantageously utilizes, the host immune response in order to ensure successful replication and spread to another host. Different factors that influence immune responses—including age, sex, cerebral lateralization and temperature—are discussed, with specific reference to RABV and the effects on host morbidity and mortality. We also investigate the role of apoptosis and discuss whether it is a detrimental or beneficial mechanism of the host’s response to infection. The various RABV proteins and their roles in immune evasion are examined in depth with reference to important domains and the downstream effects of these interactions. Lastly, an overview of the means by which RABV evades important immune responses is provided. The research discussed in this review will be important in determining the roles of the immune response during RABV infections as well as to highlight important therapeutic target regions and potential strategies for rabies treatment. PMID:27548204

  11. Virus-like nanostructures for tuning immune response

    NASA Astrophysics Data System (ADS)

    Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.

    2015-11-01

    Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.

  12. Virus-like nanostructures for tuning immune response

    PubMed Central

    Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.

    2015-01-01

    Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system. PMID:26577983

  13. Transcriptional Profiling of the Immune Response to Marburg Virus Infection

    PubMed Central

    Yen, Judy; Caballero, Ignacio S.; Garamszegi, Sara; Malhotra, Shikha; Lin, Kenny; Hensley, Lisa; Goff, Arthur J.

    2015-01-01

    ABSTRACT Marburg virus is a genetically simple RNA virus that causes a severe hemorrhagic fever in humans and nonhuman primates. The mechanism of pathogenesis of the infection is not well understood, but it is well accepted that pathogenesis is appreciably driven by a hyperactive immune response. To better understand the overall response to Marburg virus challenge, we undertook a transcriptomic analysis of immune cells circulating in the blood following aerosol exposure of rhesus macaques to a lethal dose of Marburg virus. Using two-color microarrays, we analyzed the transcriptomes of peripheral blood mononuclear cells that were collected throughout the course of infection from 1 to 9 days postexposure, representing the full course of the infection. The response followed a 3-stage induction (early infection, 1 to 3 days postexposure; midinfection, 5 days postexposure; late infection, 7 to 9 days postexposure) that was led by a robust innate immune response. The host response to aerosolized Marburg virus was evident at 1 day postexposure. Analysis of cytokine transcripts that were overexpressed during infection indicated that previously unanalyzed cytokines are likely induced in response to exposure to Marburg virus and further suggested that the early immune response is skewed toward a Th2 response that would hamper the development of an effective antiviral immune response early in disease. Late infection events included the upregulation of coagulation-associated factors. These findings demonstrate very early host responses to Marburg virus infection and provide a rich data set for identification of factors expressed throughout the course of infection that can be investigated as markers of infection and targets for therapy. IMPORTANCE Marburg virus causes a severe infection that is associated with high mortality and hemorrhage. The disease is associated with an immune response that contributes to the lethality of the disease. In this study, we investigated how the

  14. Proteomic contributions to our understanding of vaccine and immune responses

    PubMed Central

    Galassie, Allison C.; Link, Andrew J.

    2015-01-01

    Vaccines are one of the greatest public health successes; yet, due to the empirical nature of vaccine design, we have an incomplete understanding of how the genes and proteins induced by vaccines contribute to the development of both protective innate and adaptive immune responses. While the advent of genomics has enabled new vaccine development and facilitated understanding of the immune response, proteomics identifies potentially new vaccine antigens with increasing speed and sensitivity. In addition, as proteomics is complementary to transcriptomic approaches, a combination of both approaches provides a more comprehensive view of the immune response after vaccination via systems vaccinology. This review details the advances that proteomic strategies have made in vaccine development and reviews how proteomics contributes to the development of a more complete understanding of human vaccines and immune responses. PMID:26172619

  15. Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease

    NASA Astrophysics Data System (ADS)

    Sun, Jun; Earl, David J.; Deem, Michael W.

    2005-09-01

    The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self-antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely, gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system’s search for antibodies, a balance has evolved between binding affinity and specificity.

  16. DNA Damage Response and Immune Defense: Links and Mechanisms.

    PubMed

    Nakad, Rania; Schumacher, Björn

    2016-01-01

    DNA damage plays a causal role in numerous human pathologies including cancer, premature aging, and chronic inflammatory conditions. In response to genotoxic insults, the DNA damage response (DDR) orchestrates DNA damage checkpoint activation and facilitates the removal of DNA lesions. The DDR can also arouse the immune system by for example inducing the expression of antimicrobial peptides as well as ligands for receptors found on immune cells. The activation of immune signaling is triggered by different components of the DDR including DNA damage sensors, transducer kinases, and effectors. In this review, we describe recent advances on the understanding of the role of DDR in activating immune signaling. We highlight evidence gained into (i) which molecular and cellular pathways of DDR activate immune signaling, (ii) how DNA damage drives chronic inflammation, and (iii) how chronic inflammation causes DNA damage and pathology in humans.

  17. DNA Damage Response and Immune Defense: Links and Mechanisms

    PubMed Central

    Nakad, Rania; Schumacher, Björn

    2016-01-01

    DNA damage plays a causal role in numerous human pathologies including cancer, premature aging, and chronic inflammatory conditions. In response to genotoxic insults, the DNA damage response (DDR) orchestrates DNA damage checkpoint activation and facilitates the removal of DNA lesions. The DDR can also arouse the immune system by for example inducing the expression of antimicrobial peptides as well as ligands for receptors found on immune cells. The activation of immune signaling is triggered by different components of the DDR including DNA damage sensors, transducer kinases, and effectors. In this review, we describe recent advances on the understanding of the role of DDR in activating immune signaling. We highlight evidence gained into (i) which molecular and cellular pathways of DDR activate immune signaling, (ii) how DNA damage drives chronic inflammation, and (iii) how chronic inflammation causes DNA damage and pathology in humans. PMID:27555866

  18. [Defects in immune system response by our organisms].

    PubMed

    Español, Teresa

    2005-09-01

    When some of the mechanisms in our immune response system fail, this can be due to external problems such as infections or transplants or due to congenital errors, known as Primary Immunologic Deficiencies. Dr. Español briefly reviews the most important characteristics of our immune response system, and then continues with an analysis of the defects of this system, especially those defects which are classified as Primary Immunologic Deficiencies.

  19. Galectin-8 activates dendritic cells and stimulates antigen-specific immune response elicitation.

    PubMed

    Carabelli, Julieta; Quattrocchi, Valeria; D'Antuono, Alejandra; Zamorano, Patricia; Tribulatti, María Virginia; Campetella, Oscar

    2017-08-15

    Galectin-8 (Gal-8) is a mammalian β-galactoside-binding lectin, endowed with proinflammatory properties. Given its capacity to enhance antigen-specific immune responses in vivo, we investigated whether Gal-8 was also able to promote APC activation to sustain T cell activation after priming. Both endogenous [dendritic cells (DCs)] and bone marrow-derived DCs (BMDCs) treated with exogenous Gal-8 exhibited a mature phenotype characterized by increased MHC class II (MHCII), CD80, and CD86 surface expression. Moreover, Gal-8-treated BMDCs (Gal-8-BMDCs) stimulated antigen-specific T cells more efficiently than immature BMDCs (iBMDCs). Proinflammatory cytokines IL-3, IL-2, IL-6, TNF, MCP-1, and MCP-5, as well as growth factor G-CSF, were augmented in Gal-8-BMDC conditioned media, with IL-6 as the most prominent. Remarkably, BMDCs from Gal-8-deficient mice (Lgals8(-/-) BMDC) displayed reduced CD86 and IL-6 expression and an impaired ability to promote antigen-specific CD4 T cell activation. To test if Gal-8-induced activation correlates with the elicitation of an effective immune response, soluble Gal-8 was coadministrated with antigen during immunization of BALB/cJ mice in the experimental foot-and-mouth disease virus (FMDV) model. When a single dose of Gal-8 was added to the antigen formulation, an increased specific and neutralizing humoral response was developed, sufficient to enhance animal protection upon viral challenge. IL-6 and IFN-γ, as well as lymphoproliferative responses, were also incremented in Gal-8/antigen-immunized animals only at 48 h after immunization, suggesting that Gal-8 induces the elicitation of an inflammatory response at an early stage. Taking together, these findings argue in favor of the use of Gal-8 as an immune-stimulator molecule to enhance the adaptive immune response. © Society for Leukocyte Biology.

  20. Impaired Leukocyte Trafficking and Skin Inflammatory Responses in Hamsters Lacking a Functional Circadian System

    PubMed Central

    Prendergast, Brian J.; Cable, Erin J.; Patel, Priyesh N.; Pyter, Leah M.; Onishi, Kenneth G.; Stevenson, Tyler J.; Ruby, Norman F.; Bradley, Sean P.

    2013-01-01

    The immune system is under strong circadian control, and circadian desynchrony is a risk factor for metabolic disorders, inflammatory responses and cancer. Signaling pathways that maintain circadian rhythms (CRs) in immune function in vivo, and the mechanisms by which circadian desynchrony impairs immune function, remain to be fully-identified. These experiments tested the hypothesis that the hypothalamic circadian pacemaker in the suprachiasmatic nucleus (SCN) drives CRs in the immune system, using a non-invasive model of SCN circadian arrhythmia. Robust CRs in blood leukocyte trafficking, with a peak during the early light phase (ZT4) and nadir in the early dark phase (ZT18), were absent in arrhythmic hamsters, as were CRs in spleen clock gene (per1, bmal1) expression, indicating that a functional pacemaker in the SCN is required for the generation of CRs in leukocyte trafficking and for driving peripheral clocks in secondary lymphoid organs. Pinealectomy was without effect on CRs in leukocyte trafficking, but abolished CRs in spleen clock gene expression, indicating that nocturnal melatonin secretion is necessary for communicating circadian time information to the spleen. CRs in trafficking of antigen presenting cells (CD11c+ dendritic cells) in the skin were abolished, and antigen-specific delayed-type hypersensitivity skin inflammatory responses were markedly impaired in arrhythmic hamsters. The SCN drives robust CRs in leukocyte trafficking and lymphoid clock gene expression; the latter of which is not expressed in the absence of melatonin. Robust entrainment of the circadian pacemaker provides a signal critical to diurnal rhythms in immunosurveilliance and optimal memory T-cell dependent immune responses. PMID:23474187

  1. Impaired leukocyte trafficking and skin inflammatory responses in hamsters lacking a functional circadian system.

    PubMed

    Prendergast, Brian J; Cable, Erin J; Patel, Priyesh N; Pyter, Leah M; Onishi, Kenneth G; Stevenson, Tyler J; Ruby, Norman F; Bradley, Sean P

    2013-08-01

    The immune system is under strong circadian control, and circadian desynchrony is a risk factor for metabolic disorders, inflammatory responses and cancer. Signaling pathways that maintain circadian rhythms (CRs) in immune function in vivo, and the mechanisms by which circadian desynchrony impairs immune function, remain to be fully identified. These experiments tested the hypothesis that the hypothalamic circadian pacemaker in the suprachiasmatic nucleus (SCN) drives CRs in the immune system, using a non-invasive model of SCN circadian arrhythmia. Robust CRs in blood leukocyte trafficking, with a peak during the early light phase (ZT4) and nadir in the early dark phase (ZT18), were absent in arrhythmic hamsters, as were CRs in spleen clock gene (per1, bmal1) expression, indicating that a functional pacemaker in the SCN is required for the generation of CRs in leukocyte trafficking and for driving peripheral clocks in secondary lymphoid organs. Pinealectomy was without effect on CRs in leukocyte trafficking, but abolished CRs in spleen clock gene expression, indicating that nocturnal melatonin secretion is necessary for communicating circadian time information to the spleen. CRs in trafficking of antigen presenting cells (CD11c(+) dendritic cells) in the skin were abolished, and antigen-specific delayed-type hypersensitivity skin inflammatory responses were markedly impaired in arrhythmic hamsters. The SCN drives robust CRs in leukocyte trafficking and lymphoid clock gene expression; the latter of which is not expressed in the absence of melatonin. Robust entrainment of the circadian pacemaker provides a signal critical to diurnal rhythms in immunosurveilliance and optimal memory T-cell dependent immune responses. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Maternal antibodies and infant immune responses to vaccines.

    PubMed

    Edwards, Kathryn M

    2015-11-25

    Infants are born with immature immune systems, making it difficult for them to effectively respond to the infectious pathogens encountered shortly after birth. Maternal antibody is actively transported across the placenta and serves to provide protection to the newborn during the first weeks to months of life. However, maternal antibody has been shown repeatedly to inhibit the immune responses of young children to vaccines. The mechanisms for this inhibition are presented and the impact on ultimate immune responses is discussed. Copyright © 2015 The Author. Published by Elsevier Ltd.. All rights reserved.

  3. Memory immune response: a major challenge in vaccination.

    PubMed

    Prisco, Antonella; De Berardinis, Piergiuseppe

    2012-10-01

    Abstract A crucial challenge for vaccine development is to design vaccines that induce a long-lasting protective immune response, i.e., immune memory. The persistence of antigen-specific antibody titers over a protective threshold, and the ability to exibit a 'recall response' to a subsequent encounter with an antigen have long been the only measurable correlates of vaccine take and immune memory development, suffering from the disadvantage of relying on long-term monitoring of the immune response. In the last few years, advances in the technologies for the identification and characterization of the cell subsets and molecular pathways involved in the immune response to vaccination have allowed innovative approaches to the identification of early correlates of immune memory. In this review, we discuss recent data and hypotheses on early correlates of the development of immune memory, with special emphasis on the gene expression signatures that underlie the self-renewal ability of some lymphocyte subsets, and their similarities with gene expression signatures in stem cells.

  4. Circadian rhythm and the immune response: a review.

    PubMed

    Habbal, O A; Al-Jabri, A A

    2009-01-01

    For long, the immune system has been thought of as an effector mechanism reacting to antigenic challenge with defensive responses designed to eliminate 'foreign' material and return to a standby or surveillance mode. However, the recent concept now supported by substantial evidence suggests that immunity is not effector biased but is also a sensory organ and forms part of an integrated homeostatic network. The bidirectional information flow between the neuroendocrine and immune systems functions to maintain and protect the internal homeostasis of the organism. The paradox of this interwined function is that homeostasis may require the neuroendocrine system to work for or against the immune system, as is the case in infection. Potential dangers necessitate activation of the immune system, and such a response may pose risks to the integrity of the host. This occurs when an overly vigorous response may be detrimental and kill the host, as is the case of toxic shock syndrome. Therefore, the constant monitoring role of the neuroendocrine system to control and, when necessary, regulate the function of the immune system is crucial for the homeostatic integrity of the host. This reciprocity of functional need determines the mode of action to determine the context of a perceived threat and the best way to respond. Any breakdown in this two-way communication may manifest itself in problems such as autoimmunity, septic shock, or chronic infection. In this article, we review our current knowledge of circadian rhythm and its relation to the immune response.

  5. Measles virus-induced suppression of immune responses

    PubMed Central

    Griffin, Diane E.

    2010-01-01

    Summary Measles is an important cause of child mortality that has a seemingly paradoxical interaction with the immune system. In most individuals, the immune response is successful in eventually clearing measles virus (MV) infection and in establishing life-long immunity. However, infection is also associated with persistence of viral RNA and several weeks of immune suppression, including loss of delayed type hypersensitivity responses and increased susceptibility to secondary infections. The initial T-cell response includes CD8+ and T-helper 1 CD4+ T cells important for control of infectious virus. As viral RNA persists, there is a shift to a T-helper 2 CD4+ T-cell response that likely promotes B-cell maturation and durable antibody responses but may suppress macrophage activation and T-helper 1 responses to new infections. Suppression of mitogen-induced lymphocyte proliferation can be induced by lymphocyte infection with MV or by lymphocyte exposure to a complex of the hemagglutinin and fusion surface glycoproteins without infection. Dendritic cells are susceptible to infection and can transmit infection to lymphocytes. MV-infected dendritic cells are unable to stimulate a mixed lymphocyte reaction and can induce lymphocyte unresponsiveness through expression of MV glycoproteins. Thus, multiple factors may contribute both to measles-induced immune suppression and to the establishment of durable protective immunity. PMID:20636817

  6. Advances in Overcoming Immune Responses following Hemophilia Gene Therapy

    PubMed Central

    Miao, Carol H.

    2012-01-01

    Both Clinical trials and pre-clinical experiments for hemophilia gene therapy showed that it is important to overcome potential immune responses against gene transfer vectors and/or transgene products to ensure the success of gene therapy. Recently various approaches have been investigated to prevent or modulate such responses. Gene transfer vectors have been specifically engineered and immunosuppressive regimens have been administered to avoid or manipulate the immune responses against the vectors. In order to prevent cytotoxic lymphocyte or antibody formation induced by transgene expression, novel approaches have been developed, including methods to manipulate antigen presentation, development of variant genes encoding less immunogenic proteins or gene transfer protocols to evade immune responses, as well as immunosuppressive strategies to target either T and/or B cell responses. Most of these successful protocols involve the induction of activated regulatory T cells to create a regulatory immune environment during tolerance induction. Recent development of these strategies to evade vector-specific immune responses and induce long-term immune tolerance specific to the transgene product will be discussed. PMID:22737594

  7. Modeling the interactions between pathogenic bacteria, bacteriophage and immune response

    NASA Astrophysics Data System (ADS)

    Leung, Chung Yin (Joey); Weitz, Joshua S.

    The prevalence of antibiotic-resistant strains of pathogenic bacteria has led to renewed interest in the use of bacteriophage (phage), or virus that infects bacteria, as a therapeutic agent against bacterial infections. However, little is known about the theoretical mechanism by which phage therapy may work. In particular, interactions between the bacteria, the phage and the host immune response crucially influences the outcome of the therapy. Few models of phage therapy have incorporated all these three components, and existing models suffer from unrealistic assumptions such as unbounded growth of the immune response. We propose a model of phage therapy with an emphasis on nonlinear feedback arising from interactions with bacteria and the immune response. Our model shows a synergistic effect between the phage and the immune response which underlies a possible mechanism for phage to catalyze the elimination of bacteria even when neither the immune response nor phage could do so alone. We study the significance of this effect for different parameters of infection and immune response, and discuss its implications for phage therapy.

  8. Protective immune responses to fungal infections.

    PubMed

    Rivera, A

    2014-09-01

    The incidence of fungal infections has been on the rise over several decades. Fungal infections threaten animals, plants and humans alike and are thus of significant concern to scientists across disciplines. Over the last decade, significant advances on fungal immunology have lead to a better understanding of important mechanisms of host protection against fungi. In this article, I review recent advances of relevant mechanisms of immune-mediated protection to fungal infections.

  9. Innate Immune Response to Burkholderia mallei

    DTIC Science & Technology

    2017-02-16

    infections. Lipopolysaccharide (LPS) is a major component of the outer membrane of gram- negative bacteria , and a potent stimulator of host innate...relapse or reinfection. Bacteria can become quiescent and subclinical to avoid host immune mechanisms of clearance. An earlier report indicated that non...autophagy correlate with intracellular persistence of bacteria with aerosol exposure not only of B. pseudomallei but also B. mallei in spleens of TR-17-034

  10. Metabolic and immune impairments induced by the endocrine disruptors benzo[a]pyrene and triclosan in Xenopus tropicalis.

    PubMed

    Regnault, Christophe; Willison, John; Veyrenc, Sylvie; Airieau, Antinéa; Méresse, Patrick; Fortier, Marlène; Fournier, Michel; Brousseau, Pauline; Raveton, Muriel; Reynaud, Stéphane

    2016-07-01

    Despite numerous studies suggesting that amphibians are highly sensitive to cumulative anthropogenic stresses, the role played by endocrine disruptors (EDs) in the decline of amphibian populations remains unclear. EDs have been extensively studied in adult amphibians for their capacity to disturb reproduction by interfering with the sexual hormone axis. Here, we studied the in vivo responses of Xenopus tropicalis males exposed to environmentally relevant concentrations of each ED, benzo[a]pyrene (BaP) and triclosan (TCS) alone (10 μg L(-1)) or a mixture of the two (10 μg L(-1) each) over a 24 h exposure period by following the modulation of the transcription of key genes involved in metabolic, sexual and immunity processes and the cellular changes in liver, spleen and testis. BaP, TCS and the mixture of the two all induced a marked metabolic disorder in the liver highlighted by insulin resistance-like and non-alcoholic fatty liver disease (NAFLD)-like phenotypes together with hepatotoxicity due to the impairment of lipid metabolism. For TCS and the mixture, these metabolic disorders were concomitant with modulation of innate immunity. These results confirmed that in addition to the reproductive effects induced by EDs in amphibians, metabolic disorders and immune system disruption should also be considered.

  11. Mucosal immune responses following intestinal nematode infection

    PubMed Central

    Zaph, C; Cooper, P J; Harris, N L

    2014-01-01

    In most natural environments, the large majority of mammals harbour parasitic helminths that often live as adults within the intestine for prolonged periods (1–2 years) 1. Although these organisms have been eradicated to a large extent within westernized human populations, those living within rural areas of developing countries continue to suffer from high infection rates. Indeed, recent estimates indicate that approximately 2·5 billion people worldwide, mainly children, currently suffer from infection with intestinal helminths (also known as geohelminths and soil-transmitted helminths) 2. Paradoxically, the eradication of helminths is thought to contribute to the increased incidence of autoimmune diseases and allergy observed in developed countries. In this review, we will summarize our current understanding of host–helminth interactions at the mucosal surface that result in parasite expulsion or permit the establishment of chronic infections with luminal dwelling adult worms. We will also provide insight into the adaptive immune mechanisms that provide immune protection against re-infection with helminth larvae, a process that is likely to be key to the future development of successful vaccination strategies. Lastly, the contribution of helminths to immune modulation and particularly to the treatment of allergy and inflammatory bowel disease will be discussed. PMID:25201407

  12. TNF Drives Monocyte Dysfunction with Age and Results in Impaired Anti-pneumococcal Immunity.

    PubMed

    Puchta, Alicja; Naidoo, Avee; Verschoor, Chris P; Loukov, Dessi; Thevaranjan, Netusha; Mandur, Talveer S; Nguyen, Phuong-Son; Jordana, Manel; Loeb, Mark; Xing, Zhou; Kobzik, Lester; Larché, Maggie J; Bowdish, Dawn M E

    2016-01-01

    Monocyte phenotype and output changes with age, but why this occurs and how it impacts anti-bacterial immunity are not clear. We found that, in both humans and mice, circulating monocyte phenotype and function was altered with age due to increasing levels of TNF in the circulation that occur as part of the aging process. Ly6C+ monocytes from old (18-22 mo) mice and CD14+CD16+ intermediate/inflammatory monocytes from older adults also contributed to this "age-associated inflammation" as they produced more of the inflammatory cytokines IL6 and TNF in the steady state and when stimulated with bacterial products. Using an aged mouse model of pneumococcal colonization we found that chronic exposure to TNF with age altered the maturity of circulating monocytes, as measured by F4/80 expression, and this decrease in monocyte maturation was directly linked to susceptibility to infection. Ly6C+ monocytes from old mice had higher levels of CCR2 expression, which promoted premature egress from the bone marrow when challenged with Streptococcus pneumoniae. Although Ly6C+ monocyte recruitment and TNF levels in the blood and nasopharnyx were higher in old mice during S. pneumoniae colonization, bacterial clearance was impaired. Counterintuitively, elevated TNF and excessive monocyte recruitment in old mice contributed to impaired anti-pneumococcal immunity since bacterial clearance was improved upon pharmacological reduction of TNF or Ly6C+ monocytes, which were the major producers of TNF. Thus, with age TNF impairs inflammatory monocyte development, function and promotes premature egress, which contribute to systemic inflammation and is ultimately detrimental to anti-pneumococcal immunity.

  13. Depressed immunity and impaired proliferation of hematopoietic progenitor cells in patients with complete spinal cord injury.

    PubMed

    Iversen, P O; Hjeltnes, N; Holm, B; Flatebo, T; Strom-Gundersen, I; Ronning, W; Stanghelle, J; Benestad, H B

    2000-09-15

    The bone marrow is supplied with both sensory and autonomic neurons, but their roles in regulating hematopoietic and immunocompetent cells are unknown. Leukocyte growth and activity in patients with stable and complete spinal cord injuries were studied. The innervation of the bone marrow below the injury level lacked normal supraspinal activity, that is, a decentralized bone marrow. Lymphocyte functions were markedly decreased in injured patients. Long-term colony formation of all hematopoietic cell lineages, including dendritic cells, by decentralized bone marrow cells was substantially reduced. It was concluded that nonspecific and adaptive lymphocyte-mediated immunity and growth of early hematopoietic progenitor cells are impaired in patients with spinal cord injuries. Possibly, this reflects cellular defects caused by the malfunctioning neuronal regulation of immune and bone marrow function.

  14. European Sea Bass (Dicentrarchus labrax) Immune Status and Disease Resistance Are Impaired by Arginine Dietary Supplementation

    PubMed Central

    Azeredo, Rita; Pérez-Sánchez, Jaume; Sitjà-Bobadilla, Ariadna; Fouz, Belén; Tort, Lluis; Aragão, Cláudia; Oliva-Teles, Aires; Costas, Benjamín

    2015-01-01

    Infectious diseases and fish feeds management are probably the major expenses in the aquaculture business. Hence, it is a priority to define sustainable strategies which simultaneously avoid therapeutic procedures and reinforce fish immunity. Currently, one preferred approach is the use of immunostimulants which can be supplemented to the fish diets. Arginine is a versatile amino acid with important mechanisms closely related to the immune response. Aiming at finding out how arginine affects the innate immune status or improve disease resistance of European seabass (Dicentrarchus labrax) against vibriosis, fish were fed two arginine-supplemented diets (1% and 2% arginine supplementation). A third diet meeting arginine requirement level for seabass served as control diet. Following 15 or 29 days of feeding, fish were sampled for blood, spleen and gut to assess cell-mediated immune parameters and immune-related gene expression. At the same time, fish from each dietary group were challenged against Vibrio anguillarum and survival was monitored. Cell-mediated immune parameters such as the extracellular superoxide and nitric oxide decreased in fish fed arginine-supplemented diets. Interleukins and immune-cell marker transcripts were down-regulated by the highest supplementation level. Disease resistance data were in accordance with a generally depressed immune status, with increased susceptibility to vibriosis in fish fed arginine supplemented diets. Altogether, these results suggest a general inhibitory effect of arginine on the immune defences and disease resistance of European seabass. Still, further research will certainly clarify arginine immunomodulation pathways thereby allowing the validation of its potential as a prophylactic strategy. PMID:26447480

  15. Airway Epithelial Orchestration of Innate Immune Function in Response to Virus Infection. A Focus on Asthma.

    PubMed

    Ritchie, Andrew I; Jackson, David J; Edwards, Michael R; Johnston, Sebastian L

    2016-03-01

    Asthma is a very common respiratory condition with a worldwide prevalence predicted to increase. There are significant differences in airway epithelial responses in asthma that are of particular interest during exacerbations. Preventing exacerbations is a primary aim when treating asthma because they often necessitate unscheduled healthcare visits and hospitalizations and are a significant cause of morbidity and mortality. The most common cause of asthma exacerbations is a respiratory virus infection, of which the most likely type is rhinovirus infection. This article focuses on the role played by the epithelium in orchestrating the innate immune responses to respiratory virus infection. Recent studies show impaired bronchial epithelial cell innate antiviral immune responses, as well as augmentation of a pro-Th2 response characterized by the epithelial-derived cytokines IL-25 and IL-33, crucial in maintaining the Th2 cytokine response to virus infection in asthma. A better understanding of the mechanisms of these abnormal immune responses has the potential to lead to the development of novel therapeutic targets for virus-induced exacerbations. The aim of this article is to highlight current knowledge regarding the role of viruses and immune modulation in the asthmatic epithelium and to discuss exciting areas for future research and novel treatments.

  16. Toll-like receptor 11-initiated innate immune response in male mouse germ cells.

    PubMed

    Chen, Qiaoyuan; Zhu, Weiwei; Liu, Zhenghui; Yan, Keqin; Zhao, Shutao; Han, Daishu

    2014-02-01

    Toxoplasma gondii and uropathogenic Escherichia coli (UPEC) may infect the testis and impair testicular function. Mechanisms underlying testicular innate immune response to these two pathogens remain to be clarified. The present study examined the function of TLR11, which can be recognized by T. gondii-derived profilin and UPEC, in initiating innate immune response in male mouse germ cells. TLR11 is predominantly expressed in spermatids. Profilin and UPEC induced the expressions of different inflammatory cytokine profiles in the germ cells. In particular, profilin induced the expressions of macrophage chemotactic protein 1 (MCP1), interleukin 12 (IL12), and interferon gamma (IFNG) through nuclear factor KB (NFKB) activation. UPEC induced the expressions of MCP1, IL12, and IFNG, as well as tumor necrosis factor alpha (TNFA), IL6, and IFNB, through the activation of NFKB, IFN regulatory factor 3, and mitogen-activated protein kinases. Evidence showed that profilin induced the innate response in male germ cells through TLR11 signaling, and UPEC triggered the response through TLR11 and other TLR-signaling pathways. We also provided evidence that local injection of profilin or UPEC induces the innate immune response in the germ cells. Data describe TLR11-mediated innate immune function of male germ cells in response to T. gondii profilin and UPEC stimulations. This system may play a role in testicular defense against T. gondii and UPEC infections in mice.

  17. Sex differences in immune responses and immune reactivity to stress in adolescents.

    PubMed

    Kang, Duck-Hee; Kim, Chun-Ja; Suh, Yeonok

    2004-04-01

    The immune system is the body's major defense mechanism against disease. However, psychosocial factors, such as stress, can modulate various immune responses. Although they have been examined in adult humans and other animals, sex differences in immune responses and immune reactivity to stress have rarely been examined in adolescents, particularly comparing healthy and asthmatic adolescents. In 151 healthy and asthmatic high school adolescents (91 females and 60 males), natural killer cell (NK) cytotoxicity, polymorphonuclear leukocyte (PMN) superoxide release, lymphocyte proliferative responses, and CD subsets were measured twice: once during mid-semester and again during final examinations. There was little difference in these measures between healthy and asthmatic adolescents. Similarly, only sex difference was noted in NK cytotoxicity at a 25:1 effector-to-target cell ratio, with males showing significantly higher responses than females. For PMN superoxide release, females significantly increased their responses during final examinations, whereas males demonstrated no changes. For lymphocyte proliferative responses, both females and males increased their responses during final examinations, but the magnitude of increase was much greater in males. Furthermore, racial comparisons indicated that African American adolescents (n = 16), as compared with Caucasian adolescents (n = 128), had significantly higher responses in PMN superoxide release to N-Formyl-Met-Leu-Phe (FMLP) activation during mid-semester and lymphocyte proliferative responses at both time points. Nevertheless, the overall findings indicate limited differences in immune responses and immune reactivity to stress in adolescents between males and females, healthy and asthmatic adolescents, and Caucasians and African Americans. However, further investigations with larger samples are warranted.

  18. Immune responses to methamphetamine by active immunization with peptide-based, molecular adjuvant-containing vaccines.

    PubMed

    Duryee, Michael J; Bevins, Rick A; Reichel, Carmela M; Murray, Jennifer E; Dong, Yuxiang; Thiele, Geoffrey M; Sanderson, Sam D

    2009-05-14

    Vaccines to methamphetamine (meth) were designed by covalently attaching a meth hapten (METH) to peptide constructs that contained a conformationally biased, response-selective molecular adjuvant, YSFKPMPLaR (EP54). Rats immunized with EP54-containing meth vaccines generated serum antibody titers to authentic meth, an immune outcome that altered meth self-administration. Immunization increased meth self-administration suggesting pharmacokinetic antagonism. The ability of immune sera to bind a METH-modified target protein dramatically decreased during and shortly after the meth self-administration assay, suggesting effective sequestration of free meth. However, the binding ability of immune sera to the METH-modified target protein was recovered 34 days after meth-free clearance time.

  19. Selenium influence in the poultry immune response--review.

    PubMed

    Saad, Marina B; Gertner, Luiz R; Bona, Tania D M M; Santin, Elizabeth

    2009-11-01

    Selenium is an essential mineral for organic function on animal and human body. This mineral is important due to its function as antioxidant in organism, it neutralizes the free radicals that are resultant from many factors but especially by immune response. Diet is the major source of selenium. In poultry, the nutritional requirements for all nutrients and even selenium was normally calculated based on experimental trial using health animal in very low challenge conditions. However, on practical way animals are continually exposed to different infection challenges and intense vaccine program increasing immune system activation. On this aspect, there are studies that show that immune activation response increases the necessity of nutrients, vitamins and minerals. The objective of this review is to present recent patents information about the influence of selenium on immune response and practices applied on poultry production.

  20. Characterization of host immune responses in Ebola virus infections.

    PubMed

    Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo

    2014-06-01

    Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.

  1. Autophagy-associated immune responses and cancer immunotherapy.

    PubMed

    Pan, Hongming; Chen, Liuxi; Xu, Yinghua; Han, Weidong; Lou, Fang; Fei, Weiqiang; Liu, Shuiping; Jing, Zhao; Sui, Xinbing

    2016-04-19

    Autophagy is an evolutionarily conserved catabolic process by which cellular components are sequestered into a double-membrane vesicle and delivered to the lysosome for terminal degradation and recycling. Accumulating evidence suggests that autophagy plays a critical role in cell survival, senescence and homeostasis, and its dysregulation is associated with a variety of diseases including cancer, cardiovascular disease, neurodegeneration. Recent studies show that autophagy is also an important regulator of cell immune response. However, the mechanism by which autophagy regulates tumor immune responses remains elusive. In this review, we will describe the role of autophagy in immune regulation and summarize the possible molecular mechanisms that are currently well documented in the ability of autophagy to control cell immune response. In addition, the scientific and clinical hurdles regarding the potential role of autophagy in cancer immunotherapy will be discussed.

  2. Sex Drives Dimorphic Immune Responses to Viral Infections.

    PubMed

    Ghosh, Soumitra; Klein, Robyn S

    2017-03-01

    New attention to sexual dimorphism in normal mammalian physiology and disease has uncovered a previously unappreciated breadth of mechanisms by which females and males differentially exhibit quantitative phenotypes. Thus, in addition to the established modifying effects of hormones, which prenatally and postpubertally pattern cells and tissues in a sexually dimorphic fashion, sex differences are caused by extragonadal and dosage effects of genes encoded on sex chromosomes. Sex differences in immune responses, especially during autoimmunity, have been studied predominantly within the context of sex hormone effects. More recently, immune response genes have been localized to sex chromosomes themselves or found to be regulated by sex chromosome genes. Thus, understanding how sex impacts immunity requires the elucidation of complex interactions among sex hormones, sex chromosomes, and immune response genes. In this Brief Review, we discuss current knowledge and new insights into these intricate relationships in the context of viral infections.

  3. Systems level immune response analysis and personalized medicine.

    PubMed

    Brodin, Petter; Valentini, Davide; Uhlin, Michael; Mattsson, Jonas; Zumla, Alimuddin; Maeurer, Markus J

    2013-04-01

    The immune system is an anatomically structured, orchestrated interaction of different cell types that communicate via a large number of receptors recognizing both soluble and cellular ligands. Recent technological advances now allow large-scale measurements for better appreciation of this complexity. Despite these advances, only a few immunological parameters are routinely measured in clinical practice. The authors believe that these measurements are insufficient to describe the immune function of individual patients and thus cannot be used to evaluate immune-mediated diseases or response to therapy. Our current knowledge of immunology comes largely from work in murine model systems where the immune system has been characterized in great detail. This impressive volume of knowledge has proven to be difficult to translate into novel therapies in humans; one reason for this is the lack of large-scale immune monitoring allowing for systems-wide analysis of the human immune system. The authors propose a systems approach to immunology, where the focus is moved from analysis of individual cell types towards more integrated studies of the entire immune system. Exercising 'systems immunology' in preclinical research, during drug development and in patients undergoing therapies affecting the immune system, will enable us to improve clinical results through personalized medicine and help to define clinically relevant patterns of immune reactivity.

  4. Charon Mediates Immune Deficiency-Driven PARP-1-Dependent Immune Responses in Drosophila.

    PubMed

    Ji, Yingbiao; Thomas, Colin; Tulin, Nikita; Lodhi, Niraj; Boamah, Ernest; Kolenko, Vladimir; Tulin, Alexei V

    2016-09-15

    Regulation of NF-κB nuclear translocation and stability is central to mounting an effective innate immune response. In this article, we describe a novel molecular mechanism controlling NF-κB-dependent innate immune response. We show that a previously unknown protein, termed as Charon, functions as a regulator of antibacterial and antifungal immune defense in Drosophila Charon is an ankyrin repeat-containing protein that mediates poly(ADP-ribose) polymerase-1 (PARP-1)-dependent transcriptional responses downstream of the innate immune pathway. Our results demonstrate that Charon interacts with the NF-κB ortholog Relish inside perinuclear particles and delivers active Relish to PARP-1-bearing promoters, thus triggering NF-κB/PARP-1-dependent transcription of antimicrobial peptides. Ablating the expression of Charon prevents Relish from targeting promoters of antimicrobial genes and effectively suppresses the innate immune transcriptional response. Taken together, these results implicate Charon as an essential mediator of PARP-1-dependent transcription in the innate immune pathway. Thus, to our knowledge, our results are the first to describe the molecular mechanism regulating translocation of the NF-κB subunit from cytoplasm to chromatin.

  5. Arterial Hypertension Aggravates Innate Immune Responses after Experimental Stroke

    PubMed Central

    Möller, Karoline; Pösel, Claudia; Kranz, Alexander; Schulz, Isabell; Scheibe, Johanna; Didwischus, Nadine; Boltze, Johannes; Weise, Gesa; Wagner, Daniel-Christoph

    2015-01-01

    Arterial hypertension is not only the leading risk factor for stroke, but also attributes to impaired recovery and poor outcome. The latter could be explained by hypertensive vascular remodeling that aggravates perfusion deficits and blood–brain barrier disruption. However, besides vascular changes, one could hypothesize that activation of the immune system due to pre-existing hypertension may negatively influence post-stroke inflammation and thus stroke outcome. To test this hypothesis, male adult spontaneously hypertensive rats (SHRs) and normotensive Wistar Kyoto rats (WKYs) were subjected to photothrombotic stroke. One and 3 days after stroke, infarct volume and functional deficits were evaluated by magnetic resonance imaging and behavioral tests. Expression levels of adhesion molecules and chemokines along with the post-stroke inflammatory response were analyzed by flow cytometry, quantitative real-time PCR and immunohistochemistry in rat brains 4 days after stroke. Although comparable at day 1, lesion volumes were significantly larger in SHR at day 3. The infarct volume showed a strong correlation with the amount of CD45 highly positive leukocytes present in the ischemic hemispheres. Functional deficits were comparable between SHR and WKY. Brain endothelial expression of intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and P-selectin (CD62P) was neither increased by hypertension nor by stroke. However, in SHR, brain infiltrating myeloid leukocytes showed significantly higher surface expression of ICAM-1 which may augment leukocyte transmigration by leukocyte–leukocyte interactions. The expression of chemokines that primarily attract monocytes and granulocytes was significantly increased by stroke and, furthermore, by hypertension. Accordingly, ischemic hemispheres of SHR contain considerably higher numbers of monocytes, macrophages and granulocytes. Exacerbated brain inflammation in SHR may finally be responsible for

  6. Male genital tract immune response against Chlamydia trachomatis infection.

    PubMed

    Mackern-Oberti, Juan Pablo; Motrich, Rubén Darío; Damiani, Maria Teresa; Saka, Héctor Alex; Quintero, Cristian Andrés; Sánchez, Leonardo Rodolfo; Moreno-Sosa, Tamara; Olivera, Carolina; Cuffini, Cecilia; Rivero, Virginia Elena

    2017-10-01

    Chlamydia trachomatis is the most commonly reported agent of sexually transmitted bacterial infections worldwide. This pathogen frequently leads to persistent, long-term, subclinical infections, which in turn may cause severe pathology in susceptible hosts. This is in part due to the strategies that Chlamydia trachomatis uses to survive within epithelial cells and to evade the host immune response, such as subverting intracellular trafficking, interfering signaling pathways and preventing apoptosis. Innate immune receptors such as toll-like receptors expressed on epithelial and immune cells in the genital tract mediate the recognition of chlamydial molecular patterns. After bacterial recognition, a subset of pro-inflammatory cytokines and chemokines are continuously released by epithelial cells. The innate immune response is followed by the initiation of the adaptive response against Chlamydia trachomatis, which in turn may result in T helper 1-mediated protection or in T helper 2-mediated immunopathology. Understanding the molecular mechanisms developed by Chlamydia trachomatis to avoid killing and host immune response would be crucial for designing new therapeutic approaches and developing protective vaccines. In this review, we focus on chlamydial survival strategies and the elicited immune responses in male genital tract infections. © 2017 Society for Reproduction and Fertility.

  7. Defective immune response to tetanus toxoid in hemodialysis patients and its association with diphtheria vaccination.

    PubMed

    Krüger, S; Seyfarth, M; Sack, K; Kreft, B

    1999-03-05

    The incidence of infectious diseases is increased in patients with chronic renal failure. This is thought to be due to an impaired T cell stimulation by antigen presenting cells. Immunization programs are of great significance in the prevention of infections in immunocompromised individuals. However, the immune response to various vaccinations is impaired in patients with chronic renal failure. So far only few studies have focused on seroresponse to tetanus toxoid. Therefore we measured the levels of antitetanus toxoid antibodies in 71 hemodialysis patients with unknown vaccination history. The antibody levels were detected prior to and twelve months after a single "Td" or "Td-d-d" vaccination. Initially only 31 (44%) of the patients had a sufficient protection against tetanus. Of the unprotected patients 15 (38%) seroconverted after immunization, while 25 (63%) did not respond. We found a high association (p < 0.04, Fisher's exact test) between the efficacy of vaccination against diphtheria and tetanus. Out of 38 initially unprotected patients 27 (71%) showed a similar response to both vaccines: 9 (24%) individuals seroconverted, while 18 (47%) did not. Our data clearly demonstrate the need for frequent monitoring of antibody levels after immunization against tetanus and diphtheria in hemodialysis patients.

  8. In vivo effects of deoxynivalenol (DON) on innate immune responses of carp (Cyprinus carpio L.).

    PubMed

    Pietsch, Constanze; Michel, Christian; Kersten, Susanne; Valenta, Hana; Dänicke, Sven; Schulz, Carsten; Kloas, Werner; Burkhardt-Holm, Patricia

    2014-06-01

    Deoxynivalenol (DON) is one of the most important members of Fusarium toxins since it often can be found in relevant concentrations in animal feeds. The effects of this group of toxins on fish are mostly unknown. The present study shows results from a feeding trial with carp (Cyprinus carpio L.) using three different concentrations of DON (352μgkg(-1), 619μgkg(-1), and 953μgkg(-1) final feed, respectively) which are comparable to levels found in commercial fish feeds. Effects on growth and mass of fish were not observed during this 6weeks lasting experiment. Only marginal DON concentrations were found in muscle and plasma samples. Blood parameters were not influenced although smaller erythrocytes occurred in fish treated with 352μgkg(-1) DON. Analysis of antioxidative enzymes in erythrocytes showed increased superoxid dismutase and catalase activities in fish fed the low-dose feed. Immunosuppressive effects of DON were confirmed whereby cytotoxic effects on immune cells only partly explained the impairment of innate immune responses. Exact polarization of the immune system into pro-inflammatory or anti-inflammatory responses due to DON exposure should be clarified in further experiments, especially since the current results raise concern about impaired immune function in fish raised in aquaculture. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. A cognitive computational model inspired by the immune system response.

    PubMed

    Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim

    2014-01-01

    The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective.

  10. A Cognitive Computational Model Inspired by the Immune System Response

    PubMed Central

    Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim

    2014-01-01

    The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective. PMID:25003131

  11. Modeling Systems-Level Regulation of Host Immune Responses

    PubMed Central

    Thakar, Juilee; Pilione, Mylisa; Kirimanjeswara, Girish; Harvill, Eric T; Albert, Réka

    2007-01-01

    Many pathogens are able to manipulate the signaling pathways responsible for the generation of host immune responses. Here we examine and model a respiratory infection system in which disruption of host immune functions or of bacterial factors changes the dynamics of the infection. We synthesize the network of interactions between host immune components and two closely related bacteria in the genus Bordetellae. We incorporate existing experimental information on the timing of immune regulatory events into a discrete dynamic model, and verify the model by comparing the effects of simulated disruptions to the experimental outcome of knockout mutations. Our model indicates that the infection time course of both Bordetellae can be separated into three distinct phases based on the most active immune processes. We compare and discuss the effect of the species-specific virulence factors on disrupting the immune response during their infection of naive, antibody-treated, diseased, or convalescent hosts. Our model offers predictions regarding cytokine regulation, key immune components, and clearance of secondary infections; we experimentally validate two of these predictions. This type of modeling provides new insights into the virulence, pathogenesis, and host adaptation of disease-causing microorganisms and allows systems-level analysis that is not always possible using traditional methods. PMID:17559300

  12. Methylglyoxal modulates immune responses: relevance to diabetes.

    PubMed

    Price, Claire L; Hassi, Hafid O S Al; English, Nicholas R; Blakemore, Alexandra I F; Stagg, Andrew J; Knight, Stella C

    2010-06-01

    Increased methylglyoxal (MG) concentrations and formation of advanced glycation end-products (AGEs) are major pathways of glycaemic damage in diabetes, leading to vascular and neuronal complications. Diabetes patients also suffer increased susceptibility to many common infections, the underlying causes of which remain elusive. We hypothesized that immune glycation damage may account for this increased susceptibility. We previously showed that the reaction mixture (RM) for MG glycation of peptide blocks up regulation of CD83 in myeloid cells and inhibits primary stimulation of T cells. Here, we continue to investigate immune glycation damage, assessing surface and intracellular cytokine protein expression by flow cytometry, T-cell proliferation using a carboxyfluorescein succinimidyl ester assay, and mRNA levels by RT-PCR. We show that the immunomodulatory component of this RM was MG itself, with MG alone causing equivalent block of CD83 and loss of primary stimulation. Block of CD83 expression could be reversed by MG scavenger N-acetyl cysteine. Further, MG within RM inhibited stimulated production of interleukin (IL)-10 protein from myeloid cells plus interferon (IFN)-gamma and tumour necrosis factor (TNF)-alpha from T cells. Loss of IL-10 and IFN-gamma was confirmed by RT-PCR analysis of mRNA, while TNF-alpha message was raised. Loss of TNF-alpha protein was also shown by ELISA of culture supernatants. In addition, MG reduced major histocompatibility complex (MHC) class I expression on the surface of myeloid cells and increased their propensity to apoptose. We conclude that MG is a potent suppressor of myeloid and T-cell immune function and may be a major player in diabetes-associated susceptibility to infection.

  13. [Effect of anabolic steroid on immune response].

    PubMed

    Yamagishi, H; Kobayashi, M; Konosu, H; Kurioka, H; Naito, K; Sonoyama, T; Nishimoto, T; Hashimoto, I

    1984-03-01

    Using lymphocyte, monocyte and eosinophil counts of the peripheral blood, PHA-blastoid transformation, immunoglobulin and beta 2-microglobulin, the influence of anabolic steroid on the immune reactivity of the host was dissected by administration of Deca-Durabolin ( nandrolone decanoate) to both tumor-bearing host and tumor-free host after operation for alimentary tract. The number of peripheral lymphocytes and monocytes, the PHA-blastoid transformation of peripheral lymphocytes and the IgG level were increased, and the beta 2-microglobulin level showed the tendency of decrease after the administration of Deca-Durabolin.

  14. Immune allergic response in Asperger syndrome.

    PubMed

    Magalhães, Elizabeth S; Pinto-Mariz, Fernanda; Bastos-Pinto, Sandra; Pontes, Adailton T; Prado, Evandro A; deAzevedo, Leonardo C

    2009-11-30

    Asperger's syndrome is a subgroup of autism characterized by social deficits without language delay, and high cognitive performance. The biological nature of autism is still unknown but there are controversial evidence associating an immune imbalance and autism. Clinical findings, including atopic family history, serum IgE levels as well as cutaneous tests showed that incidence of atopy was higher in the Asperger group compared to the healthy controls. These findings suggest that atopy is frequent in this subgroup of autism implying that allergic inflammation might be an important feature in Asperger syndrome.

  15. Immune Activation and Bacterial Translocation: A Link between Impaired Immune Recovery and Frequent Visceral Leishmaniasis Relapses in HIV-Infected Patients

    PubMed Central

    Machado-de-Assis, Talia S.; Giacoia-Gripp, Carmem; Rabello, Ana; Da-Cruz, Alda M.; Santos-Oliveira, Joanna R.

    2016-01-01

    The maintenance of chronic immune activation due to leishmaniasis or even due to microbial translocation is associated with immunosenescence and may contribute to frequent relapses. Our aim was to investigate whether patients with HIV-associated visceral leishmaniasis (VL/HIV) who experience a single episode of VL have different immunological behaviors in comparison to those who experience frequent relapses. VL/HIV patients were allocated to non-relapsing (NR, n = 6) and relapsing (R, n = 11) groups and were followed from the active phase of VL up to 12 months post-treatment (mpt). The patients were receiving highly active antiretroviral therapy (HAART) and secondary prophylaxis after VL therapy. During active VL, the two groups were similar in all immunological parameters, including the parasite load. At 6 and 12 mpt, the NR group showed a significant gain of CD4+ T cells, a reduction of lymphocyte activation, and lower soluble CD14 and anti-Leishmania IgG3 levels compared to the R group. The viral load remained low, without correlation with the activation. The two groups showed elevated but similar percentages of senescent T cells. These findings suggest a decreased ability of the R group to downmodulate immune activation compared to the NR group. Such functional impairment of the effector response may be a useful indicator for predicting clinical prognosis and recommending starting or stopping secondary prophylaxis. PMID:27907136

  16. Immune Activation and Bacterial Translocation: A Link between Impaired Immune Recovery and Frequent Visceral Leishmaniasis Relapses in HIV-Infected Patients.

    PubMed

    Silva-Freitas, Maria Luciana; Cota, Glaucia Fernandes; Machado-de-Assis, Talia S; Giacoia-Gripp, Carmem; Rabello, Ana; Da-Cruz, Alda M; Santos-Oliveira, Joanna R

    2016-01-01

    The maintenance of chronic immune activation due to leishmaniasis or even due to microbial translocation is associated with immunosenescence and may contribute to frequent relapses. Our aim was to investigate whether patients with HIV-associated visceral leishmaniasis (VL/HIV) who experience a single episode of VL have different immunological behaviors in comparison to those who experience frequent relapses. VL/HIV patients were allocated to non-relapsing (NR, n = 6) and relapsing (R, n = 11) groups and were followed from the active phase of VL up to 12 months post-treatment (mpt). The patients were receiving highly active antiretroviral therapy (HAART) and secondary prophylaxis after VL therapy. During active VL, the two groups were similar in all immunological parameters, including the parasite load. At 6 and 12 mpt, the NR group showed a significant gain of CD4+ T cells, a reduction of lymphocyte activation, and lower soluble CD14 and anti-Leishmania IgG3 levels compared to the R group. The viral load remained low, without correlation with the activation. The two groups showed elevated but similar percentages of senescent T cells. These findings suggest a decreased ability of the R group to downmodulate immune activation compared to the NR group. Such functional impairment of the effector response may be a useful indicator for predicting clinical prognosis and recommending starting or stopping secondary prophylaxis.

  17. The immune and inflammatory response to orf virus.

    PubMed

    Haig, D M; McInnes, C; Deane, D; Reid, H; Mercer, A

    1997-06-01

    Orf virus is a zoonotic, epitheliotropic DNA parapox virus that principally infects sheep and goats. The fact that the virus can repeatedly reinfect sheep has provoked an interest in the underlying cellular, virological and molecular mechanisms for its apparent escape from the host protective immune response. The local immune and inflammatory response in skin and the cell phenotype and cytokine response in lymph analysed around a single lymph node are characteristic of an anti-viral response. An unusual feature is the dense accumulation of MHC Class II+ dendritic cells in the skin lesion. The function of these cells is not known. Orf virus virulence genes and activities have been identified that may interfere with the development of the host protective immune and inflammatory response.

  18. Adenosine can thwart antitumor immune responses elicited by radiotherapy : Therapeutic strategies alleviating protumor ADO activities.

    PubMed

    Vaupel, Peter; Multhoff, Gabriele

    2016-05-01

    By studying the bioenergetic status we could show that the development of tumor hypoxia is accompanied, apart from myriad other biologically relevant effects, by a substantial accumulation of adenosine (ADO). ADO has been shown to act as a strong immunosuppressive agent in tumors by modulating the innate and adaptive immune system. In contrast to ADO, standard radiotherapy (RT) can either stimulate or abrogate antitumor immune responses. Herein, we present ADO-mediated mechanisms that may thwart antitumor immune responses elicited by RT. An overview of the generation, accumulation, and ADO-related multifaceted inhibition of immune functions, contrasted with the antitumor immune effects of RT, is provided. Upon hypoxic stress, cancer cells release ATP into the extracellular space where nucleotides are converted into ADO by hypoxia-sensitive, membrane-bound ectoenzymes (CD39/CD73). ADO actions are mediated upon binding to surface receptors, mainly A2A receptors on tumor and immune cells. Receptor activation leads to a broad spectrum of strong immunosuppressive properties facilitating tumor escape from immune control. Mechanisms include (1) impaired activity of CD4 (+) T and CD8 (+) T, NK cells and dendritic cells (DC), decreased production of immuno-stimulatory lymphokines, and (2) activation of Treg cells, expansion of MDSCs, promotion of M2 macrophages, and increased activity of major immunosuppressive cytokines. In addition, ADO can directly stimulate tumor proliferation and angiogenesis. ADO mechanisms described can thwart antitumor immune responses elicited by RT. Therapeutic strategies alleviating tumor-promoting activities of ADO include respiratory hyperoxia or mild hyperthermia, inhibition of CD39/CD73 ectoenzymes or blockade of A2A receptors, and inhibition of ATP-release channels or ADO transporters.

  19. Impaired immune tolerance to Porphyromonas gingivalis lipopolysaccharide promotes neutrophil migration and decreased apoptosis.

    PubMed

    Zaric, Svetislav; Shelburne, Charles; Darveau, Richard; Quinn, Derek J; Weldon, Sinéad; Taggart, Clifford C; Coulter, Wilson A

    2010-10-01

    Periodontitis, a chronic inflammatory disease of the tissues supporting the teeth, is characterized by an exaggerated host immune and inflammatory response to periopathogenic bacteria. Toll-like receptor activation, cytokine network induction, and accumulation of neutrophils at the site of inflammation are important in the host defense against infection. At the same time, induction of immune tolerance and the clearance of neutrophils from the site of infection are essential in the control of the immune response, resolution of inflammation, and prevention of tissue destruction. Using a human monocytic cell line, we demonstrate that Porphyromonas gingivalis lipopolysaccharide (LPS), which is a major etiological factor in periodontal disease, induces only partial immune tolerance, with continued high production of interleukin-8 (IL-8) but diminished secretion of tumor necrosis factor alpha (TNF-α) after repeated challenge. This cytokine response has functional consequences for other immune cells involved in the response to infection. Primary human neutrophils incubated with P. gingivalis LPS-treated naïve monocyte supernatant displayed a high migration index and increased apoptosis. In contrast, neutrophils treated with P. gingivalis LPS-tolerized monocyte supernatant showed a high migration index but significantly decreased apoptosis. Overall, these findings suggest that induction of an imbalanced immune tolerance in monocytes by P. gingivalis LPS, which favors continued secretion of IL-8 but decreased TNF-α production, may be associated with enhanced migration of neutrophils to the site of infection but also with decreased apoptosis and may play a role in the chronic inflammatory state seen in periodontal disease.

  20. Mobility Education for Students with Visual Impairments: A Shared Responsibility.

    ERIC Educational Resources Information Center

    Thomas, John E.

    This paper offers principles of mobility education for students with visual impairments, stressing that mobility training is a shared responsibility among teachers, parents, and the mobility specialist. It notes that the basis for mobility education is independent travel as a reachable goal, that the purposes include providing the child with a…

  1. Conversational Responsiveness and Assertiveness in Language-Impaired Children.

    ERIC Educational Resources Information Center

    Rosinski-McClendon, Mary Kay; Newhoff, Marilyn

    1987-01-01

    The conversational responsiveness and assertiveness of 10 language-disordered children (4:1 to 5:9 years old) was compared to that of 10 non-impaired younger children matched for language ability. Results indicated that the handicapped children responded to questions less often but were as assertive in conversation as normal children. (DB)

  2. Care Partner Responses to the Onset of Mild Cognitive Impairment

    ERIC Educational Resources Information Center

    Blieszner, Rosemary; Roberto, Karen A.

    2010-01-01

    Purpose: We examined characteristics, responses, and psychological well-being of care partners who support and assist older adults recently diagnosed with mild cognitive impairment (MCI). Design and Methods: Based on a sample of 106 care partners of community residents diagnosed with MCI at memory clinics, we conducted face-to-face interviews…

  3. Care Partner Responses to the Onset of Mild Cognitive Impairment

    ERIC Educational Resources Information Center

    Blieszner, Rosemary; Roberto, Karen A.

    2010-01-01

    Purpose: We examined characteristics, responses, and psychological well-being of care partners who support and assist older adults recently diagnosed with mild cognitive impairment (MCI). Design and Methods: Based on a sample of 106 care partners of community residents diagnosed with MCI at memory clinics, we conducted face-to-face interviews…

  4. Agouron and immune response to commercialize remune immune-based treatment.

    PubMed

    James, J S

    1998-06-19

    Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.

  5. Effector, Memory, and Dysfunctional CD8(+) T Cell Fates in the Antitumor Immune Response.

    PubMed

    Reiser, John; Banerjee, Arnob

    2016-01-01

    The adaptive immune system plays a pivotal role in the host's ability to mount an effective, antigen-specific immune response against tumors. CD8(+) tumor-infiltrating lymphocytes (TILs) mediate tumor rejection through recognition of tumor antigens and direct killing of transformed cells. In growing tumors, TILs are often functionally impaired as a result of interaction with, or signals from, transformed cells and the tumor microenvironment. These interactions and signals can lead to transcriptional, functional, and phenotypic changes in TILs that diminish the host's ability to eradicate the tumor. In addition to effector and memory CD8(+) T cells, populations described as exhausted, anergic, senescent, and regulatory CD8(+) T cells have been observed in clinical and basic studies of antitumor immune responses. In the context of antitumor immunity, these CD8(+) T cell subsets remain poorly characterized in terms of fate-specific biomarkers and transcription factor profiles. Here we discuss the current characterization of CD8(+) T cell fates in antitumor immune responses and discuss recent insights into how signals in the tumor microenvironment influence TIL transcriptional networks to promote CD8(+) T cell dysfunction.

  6. Subverting the adaptive immune resistance mechanism to improve clinical responses to immune checkpoint blockade therapy

    PubMed Central

    Kim, Young J

    2015-01-01

    The correlation between tumor-infiltrating lymphocyte (TIL)-expression of programmed cell death ligand 1 (PD-L1) and clinical responsiveness to the PD-1 blocking antibody nivolumab implicates adaptive immune evasion mechanisms in cancer. We review our findings that tumor cell PD-L1 expression is induced by interferon γ (IFNγ) producing TILs. We provide a mechanistic rationale for combining IFNγ+ T helper type 1 (Th1)-inducing cancer vaccines with PD-1 immune checkpoint blockade. PMID:25964860

  7. Modulation of Primary Immune Response by Different Vaccine Adjuvants

    PubMed Central

    Ciabattini, Annalisa; Pettini, Elena; Fiorino, Fabio; Pastore, Gabiria; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata

    2016-01-01

    Adjuvants contribute to enhancing and shaping the vaccine immune response through different modes of action. Here early biomarkers of adjuvanticity after primary immunization were investigated using four different adjuvants combined with the chimeric tuberculosis vaccine antigen H56. C57BL/6 mice were immunized by the subcutaneous route with different vaccine formulations, and the modulation of primary CD4+ T cell and B cell responses was assessed within draining lymph nodes, blood, and spleen, 7 and 12 days after priming. Vaccine formulations containing the liposome system CAF01 or a squalene-based oil-in-water emulsion (o/w squalene), but not aluminum hydroxide (alum) or CpG ODN 1826, elicited a significant primary antigen-specific CD4+ T cell response compared to antigen alone, 7 days after immunization. The effector function of activated CD4+ T cells was skewed toward a Th1/Th17 response by CAF01, while a Th1/Th2 response was elicited by o/w squalene. Differentiation of B cells in short-lived plasma cells, and subsequent early H56-specific IgG secretion, was observed in mice immunized with o/w squalene or CpG adjuvants. Tested adjuvants promoted the germinal center reaction with different magnitude. These results show that the immunological activity of different adjuvants can be characterized by profiling early immunization biomarkers after primary immunization. These data and this approach could give an important contribution to the rational development of heterologous prime–boost vaccine immunization protocols. PMID:27781036

  8. Specific immune responses in mice following subchronic exposure to acetamiprid.

    PubMed

    Marzouki, Soumaya; Dhouib, Ines Bini; Benabdessalem, Chaouki; Rekik, Raja; Doghri, Raoudha; Maroueni, Ammar; Bellasfar, Zakaria; Fazaa, Saloua; Bettaieb, Jihene; Barbouche, Mohamed Ridha; Ahmed, Melika Ben

    2017-08-23

    Acetamiprid (ACE) is an insecticide of the neonicotinoid family, the most widely used in the world. Herein, we assessed the effect of ACE on either the humoral or cellular immune responses of rodents. We also evaluated the role of curcumin in the restoration of altered immune responses after ACE treatment. Five groups of five Swiss Albino mice were immunized intraperitoneally with the recombinant form of CFP32, a virulence factor of Mycobacterium tuberculosis. One group received ACE (5mg/kg) during 61days, a second one received ACE associated with curcumin (100mg/kg). Three control groups were included; one untreated, the second received corn oil and the third received curcumin alone. The humoral immune response was assessed by ELISA testing the anti-rCFP32 antibody concentrations in the serum. The cellular immune response was assessed by analyzing the cellular proliferation of the splenocytes stimulated in vitro by a mitogen or rCFP32. The ACE-treated mice showed a significant immunosuppression of the specific humoral response with a restorative effect of curcumin when administered with ACE. Similarly, ACE significantly decreased the level of splenocyte proliferation after either a non specific or a specific activation. Curcumin partially restores the antigen specific cellular immune response. Moreover, when administered alone, curcumin significantly inhibits the proliferative responses to the mitogen confirming its anti-mitogenic effect. Histological analysis showed alteration of spleens of mice exposed to ACE. Altogether, our data indicated that ACE could potentially be harmful to the immune system. Copyright © 2017. Published by Elsevier Inc.

  9. Trachoma: Protective and Pathogenic Ocular Immune Responses to Chlamydia trachomatis

    PubMed Central

    Hu, Victor H.; Holland, Martin J.; Burton, Matthew J.

    2013-01-01

    Trachoma, caused by Chlamydia trachomatis (Ct), is the leading infectious blinding disease worldwide. Chronic conjunctival inflammation develops in childhood and leads to eyelid scarring and blindness in adulthood. The immune response to Ct provides only partial protection against re-infection, which can be frequent. Moreover, the immune response is central to the development of scarring pathology, leading to loss of vision. Here we review the current literature on both protective and pathological immune responses in trachoma. The resolution of Ct infection in animal models is IFNγ-dependent, involving Th1 cells, but whether this is the case in human ocular infection still needs to be confirmed. An increasing number of studies indicate that innate immune responses arising from the epithelium and other innate immune cells, along with changes in matrix metalloproteinase activity, are important in the development of tissue damage and scarring. Current trachoma control measures, which are centred on repeated mass antibiotic treatment of populations, are logistically challenging and have the potential to drive antimicrobial resistance. A trachoma vaccine would offer significant advantages. However, limited understanding of the mechanisms of both protective immunity and immunopathology to Ct remain barriers to vaccine development. PMID:23457650

  10. Transgenerational effects enhance specific immune response in a wild passerine.

    PubMed

    Broggi, Juli; Soriguer, Ramon C; Figuerola, Jordi

    2016-01-01

    Vertebrate mothers transfer diverse compounds to developing embryos that can affect their development and final phenotype (i.e., maternal effects). However, the way such effects modulate offspring phenotype, in particular their immunity, remains unclear. To test the impact of maternal effects on offspring development, we treated wild breeding house sparrows (Passer domesticus) in Sevilla, SE Spain with Newcastle disease virus (NDV) vaccine. Female parents were vacc