Monte Carlo source simulation technique for solution of interference reactions in INAA experiments: a preliminary report

NASA Astrophysics Data System (ADS)

Allaf, M. Athari; Shahriari, M.; Sohrabpour, M.

2004-04-01

A new method using Monte Carlo source simulation of interference reactions in neutron activation analysis experiments has been developed. The neutron spectrum at the sample location has been simulated using the Monte Carlo code MCNP and the contributions of different elements to produce a specified gamma line have been determined. The produced response matrix has been used to measure peak areas and the sample masses of the elements of interest. A number of benchmark experiments have been performed and the calculated results verified against known values. The good agreement obtained between the calculated and known values suggests that this technique may be useful for the elimination of interference reactions in neutron activation analysis.

Fermi GBM: Highlights from the First Year

NASA Technical Reports Server (NTRS)

Wilson-Hodge, Colleen A.

2009-01-01

The Fermi Gamma ray Burst Monitor is an all-sky instrument sensitive to photons from about 8 keV to 40 MeV. I will summarize highlights from the first year, including triggered observations of gamma ray bursts, soft gamma ray repeaters, and terrestrial gamma flashes, and observations in the continuous data of X-ray binaries and accreting X-ray pulsars. GBM provides complementary observations to Swift/BAT, observing many of the same sources, but over a wider energy range.

Correlative Instrumental Neutron Activation Analysis, Light Microscopy, Transmission Electron Microscopy, and X-ray Microanalysis for Qualitative and Quantitative Detection of Colloidal Gold Spheres in Biological Specimens

NASA Astrophysics Data System (ADS)

Hillyer, Julián F.; Albrecht, Ralph M.

1998-10-01

: Colloidal gold, conjugated to ligands or antibodies, is routinely used as a label for the detection of cell structures by light (LM) and electron microscopy (EM). To date, several methods to count the number of colloidal gold labels have been employed with limited success. Instrumental neutron activation analysis (INAA), a physical method for the analysis of the elemental composition of materials, can be used to provide a quantitative index of gold accumulation in bulk specimens. Given that gold is not naturally found in biological specimens in any substantial amount and that colloidal gold and ligand conjugates can be prepared to yield uniform bead sizes, the amount of label can be calculated in bulk biological samples by INAA. Here we describe the use of INAA, LM, transmission EM, and X-ray microanalysis (EDX) in a model to determine both distribution (localization) and amount of colloidal gold at the organ, tissue, cellular, and ultrastructural levels in whole animal systems following administration. In addition, the sensitivity for gold in biological specimens by INAA is compared with that of inductively coupled plasma mass spectrometry (ICP-MS). The correlative use of INAA, LM, TEM, and EDX can be useful, for example, in the quantitative and qualitative tracking of various labeled molecular species following administration in vivo.

Unusual isothermal multimerization and amplification by the strand-displacing DNA polymerases with reverse transcription activities.

PubMed

Wang, Guoping; Ding, Xiong; Hu, Jiumei; Wu, Wenshuai; Sun, Jingjing; Mu, Ying

2017-10-24

Existing isothermal nucleic acid amplification (INAA) relying on the strand displacement activity of DNA polymerase usually requires at least two primers. However, in this paper, we report an unusual isothermal multimerization and amplification (UIMA) which only needs one primer and is efficiently initiated by the strand-displacing DNA polymerases with reverse transcription activities. On electrophoresis, the products of UIMA present a cascade-shape band and they are confirmed to be multimeric DNAs with repeated target sequences. In contrast to current methods, UIMA is simple to product multimeric DNA, due to the independent of multiple primers and rolling circle structures. Through assaying the synthesized single-stranded DNA targets, UIMA performs high sensitivity and specificity, as well as the universality. In addition, a plausible mechanism of UIMA is proposed, involving short DNA bending, mismatch extension, and template slippage. UIMA is a good explanation for why nonspecific amplification easily happens in existing INAAs. As the simplest INAA till now, UIMA provides a new insight for deeply understanding INAA and opens a new avenue for thoroughly addressing nonspecific amplification.

[Peptide Ala-Glu-Asp-Gly and interferon gamma: their role in immune response during aging].

PubMed

Lin'kova, N S; Kuznik, B I; Khavinson, V Kh

2012-01-01

The decrease of lymphocyte interferon gamma expression during aging is one of the main mechanisms leading to the immunodeficiency state in the elderly. Cell penetrating geroprotective peptide Ala-Glu-Asp-Gly has the capability to activate the proliferation of lymphocytes in thymus during its aging. The nucleotide sequence which is complementary contacted with peptide Ala-Glu-Asp-Gly was found in promoter region of interferon gamma gene. Thus, the immune protection of this peptide can be explained by its activation of the interferon gamma production in T-cells.

The Marshall Space Flight Center Development of Mirror Modules for the ART-XC Ins1rument Aboard the Spectrum-Roentgen-Gamma Mission

NASA Technical Reports Server (NTRS)

Gubarev, M.; Ramsey, B.; ODell, S. L.; Elsner, R.; Kilaru, K.; McCracken, J.; Pavlinsky, M.; Tkachenko, A.; Lapshov, I.

2012-01-01

The Spectrum-Rontgen-Gamma (SRG) mission is a Russian-German X-ray astrophysical observatory that carries two co-aligned and complementary X-ray telescope systems. The primary instrument is the German-led extended ROentgen Survey with an Imaging Telescope Array (eROSITA), a 7-module X-ray telescope system that covers the energy range from 0.2-12 keV. The complementary instrument is the Russian-led Astronomical Roentgen Telescope -- X-ray Concentrator (ART-XC or ART), a 7-module X-ray telescope system that provides higher energy coverage, up to 30 keV (with limited sensitivity above 12 keV).

A preliminary study on identification of Thai rice samples by INAA and statistical analysis

NASA Astrophysics Data System (ADS)

Kongsri, S.; Kukusamude, C.

2017-09-01

This study aims to investigate the elemental compositions in 93 Thai rice samples using instrumental neutron activation analysis (INAA) and to identify rice according to their types and rice cultivars using statistical analysis. As, Mg, Cl, Al, Br, Mn, K, Rb and Zn in Thai jasmine rice and Sung Yod rice samples were successfully determined by INAA. The accuracy and precision of the INAA method were verified by SRM 1568a Rice Flour. All elements were found to be in a good agreement with the certified values. The precisions in term of %RSD were lower than 7%. The LODs were obtained in range of 0.01 to 29 mg kg-1. The concentration of 9 elements distributed in Thai rice samples was evaluated and used as chemical indicators to identify the type of rice samples. The result found that Mg, Cl, As, Br, Mn, K, Rb, and Zn concentrations in Thai jasmine rice samples are significantly different but there was no evidence that Al is significantly different from concentration in Sung Yod rice samples at 95% confidence interval. Our results may provide preliminary information for discrimination of rice samples and may be useful database of Thai rice.

Mineralogy, petrology and geochemistry of carbonaceous chondritic clasts in the LEW 85300 polymict eucrite

NASA Technical Reports Server (NTRS)

Zolensky, M. E.; Hewins, R. H.; Mittlefehldt, D. W.; Lindstrom, M. M.; Xiao, X.; Lipschutz, M. E.

1992-01-01

We have performed a detailed petrologic and mineralogic study of two chondritic clasts from the polymict eucrite Lewis Cliff (LEW) 85300, and performed chemical analyses by INAA and RNAA on one of these. Petrologically, the clasts are identified and are composed of dispersed aggregates, chondrules, and chondrule fragments supported by matrix. The aggregates and chondrules are composed of olivine, orthopyroxene, plus some diopside. The matrix consists of fine-grained olivine, and lesser orthopyroxene and augite. Fine-grained saponite is common in the matrix. The bulk major composition of the clast studied by INAA and RNAA shows unusual abundance patterns for lithophile, siderophile and chalcophile elements but is basically chondritic. The INAA/RNAA data preclude assignment of the LEW 85300,15 clast to any commonly accepted group of carbonaceous chondrite.

Characterization of ancient glass excavated in Enez (Ancient Ainos) Turkey by combined Instrumental Neutron Activation Analysis and Fourier Transform Infrared spectrometry techniques

NASA Astrophysics Data System (ADS)

Akyuz, Sevim; Akyuz, Tanil; Mukhamedshina, Nuranya M.; Mirsagatova, A. Adiba; Basaran, Sait; Cakan, Banu

2012-05-01

Ancient glass fragments excavated in the archaeological district Enez (Ancient Ainos)-Turkey were investigated by combined Instrumental Neutron Activation Analysis (INAA) and Fourier Transform Infrared (FTIR) spectrometry techniques. Multi-elemental contents of 15 glass fragments that belong to Hellenistic, Roman, Byzantine, and Ottoman Periods, were determined by INAA. The concentrations of twenty six elements (Na, K, Ca, Sc, Cr, Mn, Fe, Co, Cu, Zn, As, Rb, Sr, Sb, Cs, Ba, Ce, Sm, Eu, Tb, Yb, Lu, Hf, Ta, Au and Th), which might be present in the samples as flux, stabilizers, colorants or opacifiers, and impurities, were examined. Chemometric treatment of the INAA data was performed and principle component analysis revealed presence of 3 distinct groups. The thermal history of the glass samples was determined by FTIR spectrometry.

Atmospheric heavy metal deposition in Northern Vietnam: Hanoi and Thainguyen case study using the moss biomonitoring technique, INAA and AAS.

PubMed

Viet, Hung Nguyen; Frontasyeva, Marina Vladimirovna; Thi, Thu My Trinh; Gilbert, Daniel; Bernard, Nadine

2010-06-01

The moss technique is widely used to monitor atmospheric deposition of heavy metals in many countries in Europe, whereas this technique is scarcely used in Asia. To implement this international reliable and cheap methodology in the Asian countries, it is necessary to find proper moss types typical for the Asian environment and suitable for the biomonitoring purposes. Such a case study was undertaken in Vietnam for assessing the environmental situation in strongly contaminated areas using local species of moss Barbula indica. The study is focused on two areas characterized by different pollution sources: the Hanoi urban area and the Thainguyen metallurgical zone. Fifty-four moss samples were collected there according to standard sampling procedure adopted in Europe. Two complementary analytical techniques, atomic absorption spectrometry (AAS) and instrumental neutron activation analysis (INAA), were used for determination of elemental concentrations in moss samples. To characterize the pollution sources, multivariate statistical analysis was applied. A total of 38 metal elements were determined in the moss by the two analytical techniques. The results of descriptive statistics of metal concentration in moss from the city center and periphery of Hanoi determined by AAS are presented. The similar results for moss from Thainguyen province determined by INAA and AAS are given also. A comparison of mean elemental concentrations in moss of this work with those in different environmental conditions of other authors provides reasonable information on heavy metal atmospheric deposition levels. Factor loadings and factor scores were used to identify and apportion contamination sources at the sampling sites. The values of percentage of total of factors show two highly different types of pollution in the two examined areas-the Hanoi pollution composition with high portion of urban-traffic activity and soil dust (62%), and the one of Thainguyen with factors related to industrial activities (75%). Besides, the scatter of factors in factor planes represents the greater diversity of activities in Hanoi than in Thainguyen. Good relationship between the result of factor analysis and the pollution sources evidences that the moss technique is a potential method to assess the air quality in Vietnam. Moss B. indica widely distributed in Vietnam and Indo-China is shown to be a reliable bryophyte for biomonitoring purposes in sub-tropic and tropic climate. However, the necessity of moss interspecies calibration is obvious for further studies in the area to provide results compatible with those for other Asian countries and Europe.

INAA of CAIs from the Maralinga CK4 chondrite: Effects of parent body thermal metamorphism

NASA Technical Reports Server (NTRS)

Lindstrom, D. J.; Keller, L. P.; Martinez, R. R.

1993-01-01

Maralinga is an anomalous CK4 carbonaceous chondrite which contains numerous Ca-, Al-rich inclusions (CAI's) unlike the other members of the CK group. These CAI's are characterized by abundant green hercynitic spinel intergrown with plagioclase and high-Ca clinopyroxene, and a total lack of melilite. Instrumental Neutron Activation Analysis (INAA) was used to further characterize the meteorite, with special focus on the CAI's. High sensitivity INAA was done on eight sample disks about 100-150 microns in diameter obtained from a normal 30 micron thin section with a diamond microcoring device. The CAI's are enriched by 60-70X bulk meteorite values in Zn, suggesting that the substantial exchange of Fe for Mg that made the spinel in the CAI's hercynitic also allowed efficient scavenging of Zn from the rest of the meteorite during parent body thermal metamorphism. Less mobile elements appear to have maintained their initial heterogeneity.

Trace elements study of high purity nanocrystalline silicon carbide (3C-SiC) using k0-INAA method

NASA Astrophysics Data System (ADS)

Huseynov, Elchin; Jazbec, Anze

2017-07-01

Silicon carbide (3C-SiC) nanoparticles have been irradiated by neutron flux (2×1013 n·cm-2·s-1) at TRIGA Mark II type research reactor. After neutron irradiation, the radioisotopes of trace elements in the nanocrystalline 3C-SiC were studied as time functions. The identification of isotopes which significantly increased the activity of the samples as a result of neutron radiation was carried out. Nanocrystalline 3C-SiC are synthesized by standard laser technique and the purity of samples was determined by the k0-based Instrumental Neutron Activation Analysis (k0-INAA) method. Trace elements concentration in the 3C-SiC nanoparticles were determined by the radionuclides of appropriate elements. The trace element isotopes concentration have been calculated in percentage according to k0-INAA method.

INAA Application for Trace Element Determination in Biological Reference Material

NASA Astrophysics Data System (ADS)

Atmodjo, D. P. D.; Kurniawati, S.; Lestiani, D. D.; Adventini, N.

2017-06-01

Trace element determination in biological samples is often used in the study of health and toxicology. Determination change to its essentiality and toxicity of trace element require an accurate determination method, which implies that a good Quality Control (QC) procedure should be performed. In this study, QC for trace element determination in biological samples was applied by analyzing the Standard Reference Material (SRM) Bovine muscle 8414 NIST using Instrumental Neutron Activation Analysis (INAA). Three selected trace element such as Fe, Zn, and Se were determined. Accuracy of the elements showed as %recovery and precision as %coefficient of variance (%CV). The result showed that %recovery of Fe, Zn, and Se were in the range between 99.4-107%, 92.7-103%, and 91.9-112%, respectively, whereas %CV were 2.92, 3.70, and 5.37%, respectively. These results showed that INAA method is precise and accurate for trace element determination in biological matrices.

k0-INAA for determining chemical elements in bird feathers

NASA Astrophysics Data System (ADS)

França, Elvis J.; Fernandes, Elisabete A. N.; Fonseca, Felipe Y.; Antunes, Alexsander Z.; Bardini Junior, Claudiney; Bacchi, Márcio A.; Rodrigues, Vanessa S.; Cavalca, Isabel P. O.

2010-10-01

The k0-method instrumental neutron activation analysis ( k0-INAA) was employed for determining chemical elements in bird feathers. A collection was obtained taking into account several bird species from wet ecosystems in diverse regions of Brazil. For comparison reason, feathers were actively sampled in a riparian forest from the Marins Stream, Piracicaba, São Paulo State, using mist nets specific for capturing birds. Biological certified reference materials were used for assessing the quality of analytical procedure. Quantification of chemical elements was performed using the k0-INAA Quantu Software. Sixteen chemical elements, including macro and micronutrients, and trace elements, have been quantified in feathers, in which analytical uncertainties varied from 2% to 40% depending on the chemical element mass fraction. Results indicated high mass fractions of Br (max=7.9 mg kg -1), Co (max=0.47 mg kg -1), Cr (max=68 mg kg -1), Hg (max=2.79 mg kg -1), Sb (max=0.20 mg kg -1), Se (max=1.3 mg kg -1) and Zn (max=192 mg kg -1) in bird feathers, probably associated with the degree of pollution of the areas evaluated. In order to corroborate the use of k0-INAA results in biomonitoring studies using avian community, different factor analysis methods were used to check chemical element source apportionment and locality clustering based on feather chemical composition.

Multianalytical determination of trace elements in atmospheric biomonitors by k0-INAA, ICP-MS and AAS

NASA Astrophysics Data System (ADS)

Freitas, M. C.; Pacheco, A. M. G.; Dionísio, I.; Sarmento, S.; Baptista, M. S.; Vasconcelos, M. T. S. D.; Cabral, J. P.

2006-08-01

Elemental contents of atmospheric biomonitors—epiphytic lichens and tree bark, exposed in continuous and discontinuous modes—have been assessed through k0-standardised instrumental neutron activation analysis ( k0-INAA) (two different institutions), inductively coupled plasma mass spectrometry (ICP-MS) and atomic absorption spectrometry (AAS). Certified reference materials—ISE-921 (river clay), NIST-1547 (peach leaves), ICHTJ-INCT-TL-1 (tea leaves; TL-1 hereinafter) and IAEA-336 (lichen material), and nonparametric statistics—rank-order correlations (Spearman RS) and enhanced-sign tests (Wilcoxon T)—were used for analytical control and data comparison, respectively. In general, quality of procedures was deemed good, except for k0-INAA in determining Br, Cu and Na, all likely affected by high counting statistics, and/or contamination issues (the latter). Results for Cu, Ni, Pb and Sr (by both ICP-MS and AAS) revealed that, despite an outstanding correlation (asymptotic p=0.000), they could be viewed as statistically equal for Cu only: AAS tended to yield higher values for Pb and Ni, and lower ones for Sr. The comparison between ICP-MS and k0-INAA data from TUDelft, for Al, Ca, Cu, Mg, Mn, Na, Ti and V, showed an excellent correlation (as above) and random (relative) magnitude for Cu, Mg, Mn and Ti only: ICP-MS tended to yield higher values for Al, Na and V, and lower ones for Ca, whereas between k0-INAA data from TUDelft and ITN, for Br, Ca and Na, resulted in systematically higher [Br] and [Ca] variates from TUDelft, even if all corresponding data sets were found to correlate at stringent significance levels. In a few cases, though—Ca, Sr in lichens; Pb in bark—matrix effects did appear to interfere in the outcome of matched-pairs, signed-rank tests, since random hierarchy of variates could be asserted just when lichen and bark data sets were processed separately.

Geochemical identification of mare-type basalt groups from a lunar highland region (by INAA and SRXFA)

NASA Astrophysics Data System (ADS)

Tarasov, L. S.; Kudryashova, A. F.; Ulyanov, A. A.; Baryshev, V. B.; Bobrov, V. A.; Shipitsyn, Yu. G.; Vertman, E. G.; Sudyko, A. F.

1989-10-01

The distribution of Rb, Sr, Y, Zr and Nb in 15 fragments of lunar mare-type basalt rocks from the Apollonius highland region has been investigated by the SRXFA method. The work has been carried out on the element analysis station of the storage ring VEPP-3. Preliminary identification of lunar rock groups was based on INAA data. Investigation by SRXFA permits to distinguish VLT-LT groups of basalts by geochemical criteria.

Interferon-gamma of the giant panda (Ailuropoda melanoleuca): complementary DNA cloning, expression, and phylogenetic analysis.

PubMed

Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong

2010-01-01

Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.

Cosmic rays, gamma rays and synchrotron radiation from the Galaxy

DOE PAGES

Orlando, Elena

2012-07-30

Galactic cosmic rays (CR), interstellar gamma-ray emission and synchrotron radiation are related topics. CR electrons propagate in the Galaxy and interact with the interstellar medium, producing inverse-Compton emission measured in gamma rays and synchrotron emission measured in radio. I present an overview of the latest results with Fermi/LAT on the gamma-ray diffuse emission induced by CR nuclei and electrons. Then I focus on the recent complementary studies of the synchrotron emission in the light of the latest gamma-ray results. Relevant observables include spectral indices and their variations, using surveys over a wide range of radio frequencies. As a result, thismore » paper emphasizes the importance of using the parallel study of gamma rays and synchrotron radiation in order to constrain the low-energy interstellar CR electron spectrum, models of propagation of CRs, and magnetic fields.« less

BOOTES and GTC observations of cosmic gamma-ray bursts and their progenitors

NASA Astrophysics Data System (ADS)

Castro-Tirado, Alberto J.

2016-07-01

We will summarize the follow-up observations of gamma-ray bursts performed worldwide by the BOOTES Network of robotic telescopes (with some of the data being contemporaneous to the prompt emission) leading to the discovery of many afterglows. Complementary data has been also obtained by the 10.4m GTC telescope in La Palma (mainly spectroscopy), with one of them being the highest extinguished afterglow detected to date.

A comparative study of neutron activation analysis and proton-induced X-ray emission analysis for the determination of heavy metals in estuarine sediments

NASA Astrophysics Data System (ADS)

Randle, K.; Al-Jundi, J.; Mamas, C. J. V.; Sokhi, R. S.; Earwaker, L. G.

1993-06-01

Our work on heavy metals in the estuarine environment has involved the use of two multielement techniques: neutron activation analysis (NAA) and proton-induced X-ray emission (PIXE) analysis. As PIXE is essentially a surface analytical technique problems may arise due to sample inhomogeneity and surface roughness. In order to assess the contribution of these effects we have compared the results from PIXE analysis with those from a technique which analyzes a larger bulk sample rather than just the surface. An obvious method was NAA. A series of sediment samples containing particles of variable diameter were compared. Pellets containing a few mg of sediment were prepared from each sample and analyzed by the PIXE technique using both an absolute and a comparitive method. For INAA the rest of the sample was then irradiated with thermal neutrons and element concentrations determined from analyses of the subsequent gamma-ray spectrum. Results from the two methods are discussed.

Gamma spectrometry and chemical characterization of ceramic seeds with samarium-153 and holmium-166 for brachytherapy proposal.

PubMed

Valente, Eduardo S; Campos, Tarcísio P R

2010-12-01

Ceramic seeds were synthesized by the sol-gel technique with Si:Sm:Ca and Si:Ho:Ca. One set of seeds was irradiated in the TRIGA type nuclear reactor IPR-R1 and submitted to instrumental neutron activation analysis (INAA), K(0) method, to determine mass percentage concentration of natural samarium and holmium in the seed as well as to determine all existing radionuclides and their activities. Attention was paid to discrimination of Si-31, Ca-40, Ca-45, Ca-47, Ca-49, Sm-145, Sm-155, Sm-153 and Ho-166. A second sample was submitted to atomic emission spectrometry (ICP-AES) also to determine samarium and holmium concentrations in weight. A third sample was submitted to X-ray fluorescence spectrometry to qualitatively determine chemical composition. The measured activity was due to Sm-153 and Ho-166 with a well-characterized gamma spectrum. The X-ray fluorescence spectrum demonstrated that there is no discrepancy in seed composition. The maximum ranges in the water of beta particles from Sm-153 and Ho-166 decay were evaluated, as well as the dose rate and total dose delivered within the volume delimited by the range of the beta particles. The results are relevant for investigation of the viability of producing Sm-153 and Ho-166 radioactive seeds for use in brachytherapy. Copyright 2010 Elsevier Ltd. All rights reserved.

An analog gamma correction scheme for high dynamic range CMOS logarithmic image sensors.

PubMed

Cao, Yuan; Pan, Xiaofang; Zhao, Xiaojin; Wu, Huisi

2014-12-15

In this paper, a novel analog gamma correction scheme with a logarithmic image sensor dedicated to minimize the quantization noise of the high dynamic applications is presented. The proposed implementation exploits a non-linear voltage-controlled-oscillator (VCO) based analog-to-digital converter (ADC) to perform the gamma correction during the analog-to-digital conversion. As a result, the quantization noise does not increase while the same high dynamic range of logarithmic image sensor is preserved. Moreover, by combining the gamma correction with the analog-to-digital conversion, the silicon area and overall power consumption can be greatly reduced. The proposed gamma correction scheme is validated by the reported simulation results and the experimental results measured for our designed test structure, which is fabricated with 0.35 μm standard complementary-metal-oxide-semiconductor (CMOS) process.

An Analog Gamma Correction Scheme for High Dynamic Range CMOS Logarithmic Image Sensors

PubMed Central

Cao, Yuan; Pan, Xiaofang; Zhao, Xiaojin; Wu, Huisi

2014-01-01

In this paper, a novel analog gamma correction scheme with a logarithmic image sensor dedicated to minimize the quantization noise of the high dynamic applications is presented. The proposed implementation exploits a non-linear voltage-controlled-oscillator (VCO) based analog-to-digital converter (ADC) to perform the gamma correction during the analog-to-digital conversion. As a result, the quantization noise does not increase while the same high dynamic range of logarithmic image sensor is preserved. Moreover, by combining the gamma correction with the analog-to-digital conversion, the silicon area and overall power consumption can be greatly reduced. The proposed gamma correction scheme is validated by the reported simulation results and the experimental results measured for our designed test structure, which is fabricated with 0.35 μm standard complementary-metal-oxide-semiconductor (CMOS) process. PMID:25517692

Radiation evaluation study of LSI RAM technologies

NASA Astrophysics Data System (ADS)

Dinger, G. L.; Knoll, M. G.

1980-01-01

Five commercial LSI static random access memory technologies having a 1 kilobit capacity were radiation characterized. Arrays from the transistor-transistor-logic (TTL), Schottky TTL, n-channel metal oxide semiconductor, complementary metal oxide semiconductor (CMOS), and CMOS/silicon on sapphire families were evaluated. Radiation failure thresholds for gamma doserate logic upset, total gamma dose survivability, and neutron fluence survivability were determined. A brief analysis of the radiation failure mechanism for each of the logic families tested is included.

Limits on dark matter annihilation signals from the Fermi LAT 4-year measurement of the isotropic gamma-ray background

DOE PAGES

Ackermann, M.

2015-09-02

We search for evidence of dark matter (DM) annihilation in the isotropic gamma-ray background (IGRB) measured with 50 months of Fermi Large Area Telescope (LAT) observations. An improved theoretical description of the cosmological DM annihilation signal, based on two complementary techniques and assuming generic weakly interacting massive particle (WIMP) properties, renders more precise predictions compared to previous work. More specifically, we estimate the cosmologically-induced gamma-ray intensity to have an uncertainty of a factor ~ 20 in canonical setups. We consistently include both the Galactic and extragalactic signals under the same theoretical framework, and study the impact of the former onmore » the IGRB spectrum derivation. We find no evidence for a DM signal and we set limits on the DM-induced isotropic gamma-ray signal. Our limits are competitive for DM particle masses up to tens of TeV and, indeed, are the strongest limits derived from Fermi LAT data at TeV energies. This is possible thanks to the new Fermi LAT IGRB measurement, which now extends up to an energy of 820 GeV. As a result, we quantify uncertainties in detail and show the potential this type of search offers for testing the WIMP paradigm with a complementary and truly cosmological probe of DM particle signals.« less

Limits on dark matter annihilation signals from the Fermi LAT 4-year measurement of the isotropic gamma-ray background

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collaboration: Fermi LAT Collaboration

2015-09-01

We search for evidence of dark matter (DM) annihilation in the isotropic gamma-ray background (IGRB) measured with 50 months of Fermi Large Area Telescope (LAT) observations. An improved theoretical description of the cosmological DM annihilation signal, based on two complementary techniques and assuming generic weakly interacting massive particle (WIMP) properties, renders more precise predictions compared to previous work. More specifically, we estimate the cosmologically-induced gamma-ray intensity to have an uncertainty of a factor ∼ 20 in canonical setups. We consistently include both the Galactic and extragalactic signals under the same theoretical framework, and study the impact of the former on themore » IGRB spectrum derivation. We find no evidence for a DM signal and we set limits on the DM-induced isotropic gamma-ray signal. Our limits are competitive for DM particle masses up to tens of TeV and, indeed, are the strongest limits derived from Fermi LAT data at TeV energies. This is possible thanks to the new Fermi LAT IGRB measurement, which now extends up to an energy of 820 GeV. We quantify uncertainties in detail and show the potential this type of search offers for testing the WIMP paradigm with a complementary and truly cosmological probe of DM particle signals.« less

GLAST and Ground-Based Gamma-Ray Astronomy

NASA Technical Reports Server (NTRS)

McEnery, Julie

2008-01-01

The launch of the Gamma-ray Large Area Space Telescope together with the advent of a new generation of ground-based gamma-ray detectors such as VERITAS, HESS, MAGIC and CANGAROO, will usher in a new era of high-energy gamma-ray astrophysics. GLAST and the ground based gamma-ray observatories will provide highly complementary capabilities for spectral, temporal and spatial studies of high energy gamma-ray sources. Joint observations will cover a huge energy range, from 20 MeV to over 20 TeV. The LAT will survey the entire sky every three hours, allowing it both to perform uniform, long-term monitoring of variable sources and to detect flaring sources promptly. Both functions complement the high-sensitivity pointed observations provided by ground-based detectors. Finally, the large field of view of GLAST will allow a study of gamma-ray emission on large angular scales and identify interesting regions of the sky for deeper studies at higher energies. In this poster, we will discuss the science returns that might result from joint GLAST/ground-based gamma-ray observations and illustrate them with detailed source simulations.

Prompt fission gamma-ray emission spectral data for 239Pu(n,f) using fast directional neutrons from the LICORNE neutron source

NASA Astrophysics Data System (ADS)

Qi, L.; Wilson, J. N.; Lebois, M.; Al-Adili, A.; Chatillon, A.; Choudhury, D.; Gatera, A.; Georgiev, G.; Göök, A.; Laurent, B.; Maj, A.; Matea, I.; Oberstedt, A.; Oberstedt, S.; Rose, S. J.; Schmitt, C.; Wasilewska, B.; Zeiser, F.

2018-03-01

Prompt fission gamma-ray spectra (PFGS) have been measured for the 239Pu(n,f) reaction using fast neutrons at Ēn=1.81 MeV produced by the LICORNE directional neutron source. The setup makes use of LaBr3 scintillation detectors and PARIS phoswich detectors to measure the emitted prompt fission gamma rays (PFG). The mean multiplicity, average total energy release per fission and average energy of photons are extracted from the unfolded PFGS. These new measurements provide complementary information to other recent work on thermal neutron induced fission of 239Pu and spontaneous fission of 252Cf.

Study of near-stability nuclei populated as fission fragments in heavy-ion fusion reactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fotiadis, Nikolaos; Nelson, Ronald O; Devlin, Matthew

2010-01-01

Examples are presented to illustrate the power of prompt {gamma}-ray spectroscopy of fission fragments from compound nuclei with A {approx} 200 formed in fusion-evaporation reactions in experiments using the Gammasphere Ge-detector array. Complementary methods, such as Coulomb excitation and deep-inelastic processes, are also discussed. In other cases (n, xn{gamma}) reactions on stable isotopes have been used to establish neutron excitation functions for {gamma}-rays using a pulsed 'white'-neutron source, coupled to a high-energy-resolution germanium-detector array. The excitation functions can unambiguously assign {gamma}-rays to a specific reaction product. Results from all these methods bridge the gaps in the systematics of high-spin statesmore » between the neutron-deficient and neutron-rich nuclei. Results near shell closures should motivate new shell model calculations.« less

Characterizing suspended sediments from the Piracicaba River Basin by means of k0-INAA

NASA Astrophysics Data System (ADS)

França, E. J.; Fernandes, E. A. N.; Cavalca, I. P. O.; Fonseca, F. Y.; Camilli, L.; Rodrigues, V. S.; Bardini Junior, C.; Ferreira, J. R.; Bacchi, M. A.

2010-10-01

The inorganic chemical characterization of suspended sediments is of utmost relevance for the knowledge of the dynamics and movement of chemical elements in the aquatic and wet ecosystems. Despite the complexity of the effective design for studying this ecological compartment, this work has tested a procedure for analyzing suspended sediments by instrumental neutron activation analysis, k0 method ( k0-INAA). The chemical elements As, Ba, Br, Ca, Ce, Co, Cr, Cs, Eu, Fe, Hf, Hg, K, La, Mo, Na, Ni, Rb, Sb, Sc, Se, Sm, Sr, Ta, Tb, Th, Yb and Zn were quantified in the suspended sediment compartment by means of k0-INAA. When compared with World Average for rivers, high mass fractions of Fe (222,900 mg/kg), Ba (4990 mg/kg), Zn (1350 mg/kg), Cr (646 mg/kg), Co (74.5 mg/kg), Br (113 mg/kg) and Mo (31.9 mg/kg) were quantified in suspended sediments from the Piracicaba River, the Piracicamirim Stream and the Marins Stream. Results of the principal component analysis for standardized chemical element mass fractions indicated an intricate correlation among chemical elements evaluated, as a response of the contribution of natural and anthropogenic sources of chemical elements for ecosystems.

Characterization of low power research reactor neutrons for the validation of k(0)-INAA standardization based on k(0)-IAEA software.

PubMed

Baidoo, I K; Nyarko, B J B; Akaho, E H K; Dampare, S B; Sogbadji, R B M; Poku, L O

2013-09-01

Channel Bsite2 of Ghana research reactor-1 has been characterized for k0-INAA application. Cadmium ratio and bare multi-monitor were used to determine flux parameters using 0.1%Au-Al, Fe, and Zr wire as flux monitors. The parameters determined were 18.36±1.91, 0.0479±0.012, 5.12×10(11)±0.42×10(11) ncm(-2)s(-1), 2.74×10(10)±0.14×10(10) ncm(-2)s(-1), 7.73×10(10)±0.16×10(10) ncm(-2)s(-1) and 16.75±1.58, -0.034±0.0028, 4.28×10(11)±1.71×10(11) ncm(-2)s(-1), 2.55×10(10)±0.15×10(10) ncm(-2)s(-1) respectively for thermal-to-epithermal flux ratio, alpha, thermal neutron, epithermal neutron and fast neutron flux using cadmium ratio and multi-monitor method accordingly. The k0-INAA performance assessment based on z-score distributions showed most results within |z|<2. Copyright © 2013 Elsevier Ltd. All rights reserved.

SR-XFA as a method of choice in the search of signals of changing palaeoclimates in the sediments of Lake Baikal, compared to INAA and ICP-MS

NASA Astrophysics Data System (ADS)

Phedorin, M. A.; Bobrov, V. A.; Goldberg, E. L.; Navez, J.; Zolotaryov, K. V.; Grachev, M. A.

2000-06-01

Sediments of Lake Baikal obtained on top of the underwater Akademichesky Ridge for reconstruction of the palaeoclimates of Holocene and Upper Pleistocene were subjected to elemental analysis with three methods: (i) synchrotron radiation X-ray fluorescent analysis (SR-XFA); (ii) instrumental neutron activation analysis (INAA); (iii) induction-coupled plasma mass-spectrometry (ICP-MS). Comparison of the results obtained is accompanied by statistical tests and shows that, due to its high sensitivity, simplicity, and non-destructive nature, SR-XFA can be recommended as a method of choice in the search of geochemical signals of changing palaeoclimates.

Trace-element analyses of core samples from the 1967-1988 drillings of Kilauea Iki lava lake, Hawaii

USGS Publications Warehouse

Helz, Rosalind Tuthill

2012-01-01

This report presents previously unpublished analyses of trace elements in drill core samples from Kilauea Iki lava lake and from the 1959 eruption that fed the lava lake. The two types of data presented were obtained by instrumental neutron-activation analysis (INAA) and energy-dispersive X-ray fluorescence analysis (EDXRF). The analyses were performed in U.S. Geological Survey (USGS) laboratories from 1989 to 1994. This report contains 93 INAA analyses on 84 samples and 68 EDXRF analyses on 68 samples. The purpose of the study was to document trace-element variation during chemical differentiation, especially during the closed-system differentiation of Kilauea Iki lava lake.

Instrumental neutron activation analysis data for cloud-water particulate samples, Mount Bamboo, Taiwan

USGS Publications Warehouse

Lin, Neng-Huei; Sheu, Guey-Rong; Wetherbee, Gregory A.; Debey, Timothy M.

2013-01-01

Cloud water was sampled on Mount Bamboo in northern Taiwan during March 22-24, 2002. Cloud-water samples were filtered using 0.45-micron filters to remove particulate material from the water samples. Filtered particulates were analyzed by instrumental neutron activation analysis (INAA) at the U.S. Geological Survey National Reactor Facility in Denver, Colorado, in February 2012. INAA elemental composition data for the particulate materials are presented. These data complement analyses of the aqueous portion of the cloud-water samples, which were performed earlier by the Department of Atmospheric Sciences, National Central University, Taiwan. The data are intended for evaluation of atmospheric transport processes and air-pollution sources in Southeast Asia.

Development and Calibration of the ART-XC Mirror Modules for the Spectrum Rontgen Gamma Mission

NASA Technical Reports Server (NTRS)

Ramsey, B.; Gubarev, M.; Elsner, R.; Kolodziejczak, J.; Odell, S.; Swartz, D.; Pavlinsky, M.; Tkachenko, A.; Lapshov, I.

2013-01-01

The Spectrum-Röntgen-Gamma (SRG) mission is a Russian-lead X-ray astrophysical observatory that carries two co-aligned X-ray telescope systems. The primary instrument is the German-led extended ROentgen Survey with an Imaging Telescope Array (eROSITA), a 7-module X-ray telescope system that covers the energy range from 0.2-12 keV. The complementary instrument is the Astronomical Roentgen Telescope -- X-ray Concentrator (ART-XC or ART), a 7-module Xray telescope system that provides higher energy coverage, up to 30 keV.

Crystal structure of chiral gammaPNA with complementary DNA strand: insights into the stability and specificity of recognition and conformational preorganization.

PubMed

Yeh, Joanne I; Shivachev, Boris; Rapireddy, Srinivas; Crawford, Matthew J; Gil, Roberto R; Du, Shoucheng; Madrid, Marcela; Ly, Danith H

2010-08-11

We have determined the structure of a PNA-DNA duplex to 1.7 A resolution by multiple-wavelength anomalous diffraction phasing method on a zinc derivative. This structure represents the first high-resolution 3D view of a hybrid duplex containing a contiguous chiral PNA strand with complete gamma-backbone modification ("gammaPNA"). Unlike the achiral counterpart, which adopts a random-fold, this particular gammaPNA is already preorganized into a right-handed helix as a single strand. The new structure illustrates the unique characteristics of this modified PNA, possessing conformational flexibility while maintaining sufficient structural integrity to ultimately adopt the preferred P-helical conformation upon hybridization with DNA. The unusual structural adaptability found in the gammaPNA strand is crucial for enabling the accommodation of backbone modifications while constraining conformational states. In conjunction with NMR analysis characterizing the structures and substructures of the individual building blocks, these results provide unprecedented insights into how this new class of chiral gammaPNA is preorganized and stabilized, before and after hybridization with a cDNA strand. Such knowledge is crucial for the future design and development of PNA for applications in biology, biotechnology, and medicine.

Copper crystal lens for medical imaging: first results

NASA Astrophysics Data System (ADS)

Roa, Dante E.; Smither, Robert K.

2001-06-01

A copper crystal lens designed to focus gamma ray energies of 100 to 200 keV has been assembled at Argonne National Laboratory. In particular, the lens has been optimized to focus the 140.6 keV gamma rays from technetium-99 m typically used in radioactive tracers. This new approach to medical imaging relies on crystal diffraction to focus incoming gamma rays in a manner similar to a simple convex lens focusing visible light. The lens is envisioned to be part of an array of lenses that can be used as a complementary technique to gamma cameras for localized scans of suspected tumor regions in the body. In addition, a 2- lens array can be used to scan a woman's breast in search of tumors with no discomfort to the patient. The incoming gamma rays are diffracted by a set of 828 copper crystal cubes arranged in 13 concentric rings, which focus the gamma rays into a very small area on a well-shielded NaI detector. Experiments performance with technetium-99 m and cobalt 57 radioactive sources indicate that a 6-lens array should be capable of detecting sources with (mu) Ci strength.

Complementary roles of different oscillatory activities in the subthalamic nucleus in coding motor effort in Parkinsonism.

PubMed

Tan, Huiling; Pogosyan, Alek; Anzak, Anam; Ashkan, Keyoumars; Bogdanovic, Marko; Green, Alexander L; Aziz, Tipu; Foltynie, Thomas; Limousin, Patricia; Zrinzo, Ludvic; Brown, Peter

2013-10-01

The basal ganglia may play an important role in the control of motor scaling or effort. Recently local field potential (LFP) recordings from patients with deep brain stimulation electrodes in the basal ganglia have suggested that local increases in the synchronisation of neurons in the gamma frequency band may correlate with force or effort. Whether this feature uniquely codes for effort and whether such a coding mechanism holds true over a range of efforts is unclear. Here we investigated the relationship between frequency-specific oscillatory activities in the subthalamic nucleus (STN) and manual grips made with different efforts. The latter were self-rated using the 10 level Borg scale ranging from 0 (no effort) to 10 (maximal effort). STN LFP activities were recorded in patients with Parkinson's Disease (PD) who had undergone functional surgery. Patients were studied while motor performance was improved by dopaminergic medication. In line with previous studies we observed power increase in the theta/alpha band (4-12 Hz), power suppression in the beta band (13-30 Hz) and power increase in the gamma band (55-90 Hz) and high frequency band (101-375 Hz) during voluntary grips. Beta suppression deepened, and then reached a floor level as effort increased. Conversely, gamma and high frequency power increases were enhanced during grips made with greater effort. Multiple regression models incorporating the four different spectral changes confirmed that the modulation of power in the beta band was the only independent predictor of effort during grips made with efforts rated <5. In contrast, increases in gamma band activity were the only independent predictor of effort during grips made with efforts ≥5. Accordingly, the difference between power changes in the gamma and beta bands correlated with effort across all effort levels. These findings suggest complementary roles for changes in beta and gamma band activities in the STN in motor effort coding. The latter function is thought to be impaired in untreated PD where task-related reactivity in these two bands is deficient. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Interleukin-12- and interferon-gamma-mediated natural killer cell activation by Agaricus blazei Murill.

PubMed

Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

2007-06-01

Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.

Air Pollution Studies in Opole Region, Poland, using the Moss Biomonitoring and INAA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Korzekwa, S.; Pankratova, Yu. S.; Frontasyeva, M.V.

Biomonitoring of heavy metal atmospheric deposition with terrestrial moss is a well established technique for environmental studies. Moss samples of Hylocomium splendens and Pleurozium schreberi have been collected around the city of Opole. A total of 34 elements including heavy metals and rare earths have been determined by instrumental neutron activation analysis (INAA) using epithermal neutrons at the IBR-2 reactor of the Joint Institute for Nuclear Research. We observe pronounced contamination of the sampled area with pollutants such as As, Sb, V, Ni, Mo, etc. at levels similar to those in the neighboring industrial regions. These results evidences long-range atmosphericmore » transport of pollutants along with the influence of local pollution sources.« less

Using complementary tools to characterize the effects of radiation in electro-optic polymeric materials

NASA Astrophysics Data System (ADS)

Perez-Moreno, Javier

2015-09-01

Understanding the fundamental mechanisms behind the radiation resistance of polymers and molecules would allow us to tailor new materials with enhanced performance in space and adverse environments. Previous studies of the radiation effects on polymer-based photonic materials indicate that they are very dependent on the choice of polymer-host and guest-chromophores. The best results have been reported from the combination of CLD1 as a guest-chromophore doped in APC as host polymer, where improvement of the performance was observed upon gamma-irradiation at moderate doses. In this paper, we report on the different complementary tools that have been tried to characterize the origin of such enhancement: characterization of the linear and nonlinear response, characterization of chemical properties, and application of an all-optical protocol. We derive some general conclusions by contrasting the results of each characterization, and propose complementary experiments based on microscopy techniques.

RBS, SY-XRF, INAA and ICP-IDMS of antimony implanted in silicon - A multi-method approach to characterize and certify a reference material

NASA Astrophysics Data System (ADS)

Ecker, K. H.; Wätjen, U.; Berger, A.; Persson, L.; Pritzkow, W.; Radtke, M.; Riesemeier, H.

2002-04-01

A layer of Sb atoms, implanted with an energy of 400 keV and a nominal dose of 5×10 16 atoms/cm 2 into a high purity silicon wafer, was certified for its areal density (atoms/cm 2) using Rutherford backscattering spectrometry (RBS), instrumental neutron activation analysis (INAA) and inductively coupled plasma isotope dilution mass spectrometry (ICP-IDMS) and for its isotope ratio using INAA and ICP-IDMS. Excellent agreement between the results of the different independent methods was found. In the present work, the measurements of the homogeneity of the areal density of Sb, previously determined with RBS in spots having 1 mm diameter, are improved with synchrotron X-ray fluorescence analysis: Higher precision in even smaller sample spots allows to estimate a reduced inhomogeneity of the whole batch of samples of the order of only 0.4%. Thus the uncertainty of the certified value can further be reduced. Down to fractions of a chip with 0.3×0.4 mm 2 area, the areal density is now certified as (4.81±0.06)×10 16 Sb atoms/cm 2, where the expanded uncertainty 0.06 (coverage factor k=2) corresponds to only 1.2%. The relative merits of the different analytical methods are discussed.

Studying the spatial variability of Cr in agricultural field using both particle induced X-ray emission (PIXE) and instrumental neutron activation analysis (INAA) technique

NASA Astrophysics Data System (ADS)

Cruvinel, Paulo E.; Crestana, Sílvio; Artaxo, Paulo; Martins, JoséV.; Armelin, Maria JoséA.

1996-04-01

In the field of soil physics, a technique which permits a non-destructive, accurate and fast elemental analysis with a minimum of sample preparation effort is often desired. Although trace elements are minor components of the solid phase, they play an important role in soil fertility. Cr is of nutritional importance because it is a required element in human and animal nutrition. The immobility of Cr may be responsible for an inadequate Cr supply to plants. This work not only demonstrates the suitability of PIXE as a fast and non-destructive technique, useful to measure Cr content in soil samples, but also outlines a study of spatial variability of that element in agricultural field. To demonstrate the capability of the method soil samples were collected in a 5000 m 2 agricultural field. The soil samples were analyzed using both PIXE and INAA techniques. Besides, a Fourier interpolation technique was used to verify the distribution of Cr along of the sampled field. INAA was carried out by means of the γ-ray emitted by 51Cr(320 keV). Results show that there is a good linear relationship between the elemental concentration of Cr obtained using those techniques, i.e. a correlation coefficient of r2 = 0.82 was achieved.

Contribution of ICP-IDMS to the certification of antimony implanted in a silicon wafer--comparison with RBS and INAA results.

PubMed

Pritzkow, W; Vogl, J; Berger, A; Ecker, K; Grötzschel, R; Klingbeil, P; Persson, L; Riebe, G; Wätjen, U

2001-11-01

A thin-layer reference material for surface and near-surface analytical methods was produced and certified. The surface density of the implanted Sb layer was determined by Rutherford backscattering spectrometry (RBS), instrumental neutron activation analysis (INAA), and inductively coupled plasma isotope dilution mass spectrometry (ICP-IDMS) equipped with a multi-collector. The isotopic abundances of Sb (121Sb and 123Sb) were determined by multi-collector ICP-MS and INAA. ICP-IDMS measurements are discussed in detail in this paper. All methods produced values traceable to the SI and are accompanied by a complete uncertainty budget. The homogeneity of the material was measured with RBS. From these measurements the standard uncertainty due to possible inhomogeneities was estimated to be less than 0.78% for fractions of the area increments down to 0.75 mm2 in size. Excellent agreement between the results of the three different methods was found. For the surface density of implanted Sb atoms the unweighted mean value of the means of four data sets is 4.81 x 10(16) cm(-2) with an expanded uncertainty (coverage factor k = 2) of 0.09 x 10(16) cm(-2). For the isotope amount ratio R (121Sb/123Sb) the unweighted mean value of the means of two data sets is 1.435 with an expanded uncertainty (coverage factor k = 2) of 0.006.

Trace-element measurements in atmospheric biomonitors—A look at the relative performance of INAA and PIXE on olive-tree bark

NASA Astrophysics Data System (ADS)

Pacheco, Adriano M. G.; Freitas, Maria do Carmo; Reis, Miguel A.

2003-06-01

As part of an ongoing evaluation of its suitability for atmospheric biomonitoring, bark from olive trees ( Olea europaea Linn.) has been collected and searched for trace elements by means of two nuclear-analytical techniques—instrumental neutron activation analysis (INAA) and proton-induced X-ray emission (PIXE). The sampling for the present study was carried out across two separate sections of an established grid for air-quality surveys in mainland Portugal. The dual location comprises 58 collection sites—littoral-north (29 sites) and littoral-centre (29 sites). Both techniques are intrinsically accurate and may be seen to complement each other in the way that, as a whole, they yield 46 elements, with an overlap of 16 elements. Among the latter, this paper focuses on four of them and looks into their joint determination. Descriptive statistics for soil-related Al and Ti, and for sea-related Cl and Br, show results for each element to be fairly comparable. The degree of association between elemental patterns by either technique, as seen through nonparametric tests (Kendall's RK), is outstanding. No statistical evidence (Wilcoxon's T) for relative bias in correlated samples—consistently higher or lower results by one technique—could be found as well. As far as this study goes, INAA and PIXE may be used interchangeably for determining the present elements in olive-tree bark.

Verification of MCNP simulation of neutron flux parameters at TRIGA MK II reactor of Malaysia.

PubMed

Yavar, A R; Khalafi, H; Kasesaz, Y; Sarmani, S; Yahaya, R; Wood, A K; Khoo, K S

2012-10-01

A 3-D model for 1 MW TRIGA Mark II research reactor was simulated. Neutron flux parameters were calculated using MCNP-4C code and were compared with experimental results obtained by k(0)-INAA and absolute method. The average values of φ(th),φ(epi), and φ(fast) by MCNP code were (2.19±0.03)×10(12) cm(-2)s(-1), (1.26±0.02)×10(11) cm(-2)s(-1) and (3.33±0.02)×10(10) cm(-2)s(-1), respectively. These average values were consistent with the experimental results obtained by k(0)-INAA. The findings show a good agreement between MCNP code results and experimental results. Copyright © 2012 Elsevier Ltd. All rights reserved.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Input-dependent frequency modulation of cortical gamma oscillations shapes spatial synchronization and enables phase coding.

PubMed

Lowet, Eric; Roberts, Mark; Hadjipapas, Avgis; Peter, Alina; van der Eerden, Jan; De Weerd, Peter

2015-02-01

Fine-scale temporal organization of cortical activity in the gamma range (∼25-80Hz) may play a significant role in information processing, for example by neural grouping ('binding') and phase coding. Recent experimental studies have shown that the precise frequency of gamma oscillations varies with input drive (e.g. visual contrast) and that it can differ among nearby cortical locations. This has challenged theories assuming widespread gamma synchronization at a fixed common frequency. In the present study, we investigated which principles govern gamma synchronization in the presence of input-dependent frequency modulations and whether they are detrimental for meaningful input-dependent gamma-mediated temporal organization. To this aim, we constructed a biophysically realistic excitatory-inhibitory network able to express different oscillation frequencies at nearby spatial locations. Similarly to cortical networks, the model was topographically organized with spatially local connectivity and spatially-varying input drive. We analyzed gamma synchronization with respect to phase-locking, phase-relations and frequency differences, and quantified the stimulus-related information represented by gamma phase and frequency. By stepwise simplification of our models, we found that the gamma-mediated temporal organization could be reduced to basic synchronization principles of weakly coupled oscillators, where input drive determines the intrinsic (natural) frequency of oscillators. The gamma phase-locking, the precise phase relation and the emergent (measurable) frequencies were determined by two principal factors: the detuning (intrinsic frequency difference, i.e. local input difference) and the coupling strength. In addition to frequency coding, gamma phase contained complementary stimulus information. Crucially, the phase code reflected input differences, but not the absolute input level. This property of relative input-to-phase conversion, contrasting with latency codes or slower oscillation phase codes, may resolve conflicting experimental observations on gamma phase coding. Our modeling results offer clear testable experimental predictions. We conclude that input-dependency of gamma frequencies could be essential rather than detrimental for meaningful gamma-mediated temporal organization of cortical activity.

Input-Dependent Frequency Modulation of Cortical Gamma Oscillations Shapes Spatial Synchronization and Enables Phase Coding

PubMed Central

Lowet, Eric; Roberts, Mark; Hadjipapas, Avgis; Peter, Alina; van der Eerden, Jan; De Weerd, Peter

2015-01-01

Fine-scale temporal organization of cortical activity in the gamma range (∼25–80Hz) may play a significant role in information processing, for example by neural grouping (‘binding’) and phase coding. Recent experimental studies have shown that the precise frequency of gamma oscillations varies with input drive (e.g. visual contrast) and that it can differ among nearby cortical locations. This has challenged theories assuming widespread gamma synchronization at a fixed common frequency. In the present study, we investigated which principles govern gamma synchronization in the presence of input-dependent frequency modulations and whether they are detrimental for meaningful input-dependent gamma-mediated temporal organization. To this aim, we constructed a biophysically realistic excitatory-inhibitory network able to express different oscillation frequencies at nearby spatial locations. Similarly to cortical networks, the model was topographically organized with spatially local connectivity and spatially-varying input drive. We analyzed gamma synchronization with respect to phase-locking, phase-relations and frequency differences, and quantified the stimulus-related information represented by gamma phase and frequency. By stepwise simplification of our models, we found that the gamma-mediated temporal organization could be reduced to basic synchronization principles of weakly coupled oscillators, where input drive determines the intrinsic (natural) frequency of oscillators. The gamma phase-locking, the precise phase relation and the emergent (measurable) frequencies were determined by two principal factors: the detuning (intrinsic frequency difference, i.e. local input difference) and the coupling strength. In addition to frequency coding, gamma phase contained complementary stimulus information. Crucially, the phase code reflected input differences, but not the absolute input level. This property of relative input-to-phase conversion, contrasting with latency codes or slower oscillation phase codes, may resolve conflicting experimental observations on gamma phase coding. Our modeling results offer clear testable experimental predictions. We conclude that input-dependency of gamma frequencies could be essential rather than detrimental for meaningful gamma-mediated temporal organization of cortical activity. PMID:25679780

Investigation of trace elements in ancient pottery from Jenini, Brong Ahafo region, Ghana by INAA and Compton suppression spectrometry

NASA Astrophysics Data System (ADS)

Nyarko, B. J. B.; Bredwa-Mensah, Y.; Serfor-Armah, Y.; Dampare, S. B.; Akaho, E. H. K.; Osae, S.; Perbi, A.; Chatt, A.

2007-10-01

Concentrations of trace elements in ancient pottery excavated from Jenini in the Brong Ahafo region of Ghana were determined using instrumental neutron activation analysis (INAA) in conjunction with both conventional and Compton suppression counting. Jenini was a slave Camp of Samory Toure during the indigenous slavery and the Trans-Atlantic slave trade. Pottery fragments found during the excavation of the grave tombs of the slaves who died in the slave camps were analysed. In all, 26 trace elements were determined in 40 pottery fragments. These elemental concentrations were processed using multivariate statistical methods, cluster, factor and discriminant analyses in order to determine similarities and correlation between the various samples. The suitability of the two counting systems for determination of trace elements in pottery objects has been evaluated.

Main atmospheric heavy metal sources in Portugal by biomonitor analysis

NASA Astrophysics Data System (ADS)

Reis, M. A.; Alves, L. C.; Wolterbeek, H. Th.; Verburg, T.; Freitas, M. C.; Gouveia, A.

1996-04-01

During the months of July and August of 1993 a lichen collection campaign was held in Portugal where about 250 samples were collected and analysed by thick target PIXE and INAA. Results for 43 different elements were obtained and a data base was built and subjected to Monte Carlo aided target transform factor analysis (MCATTFA), method developed at IRI TU Delft. 10 × 10 km coast and 50 × 50 km far from coast sampling grids were used for collection, concentration data as well as factor patterns were extrapolated to the whole country making use of an extinction rule of 1/r 3. In this work we present the results that were obtained based on a reduced data set of 22 elements measured by TTPIXE. The results for INAA data subset and the total data set are presented elsewhere.

Fine-scale traverses in cumulate rocks, Stillwater Complex: A lunar analogue study

NASA Technical Reports Server (NTRS)

Elthon, Donald

1988-01-01

The objective was to document finite-scale compositional variations in cumulate rocks from the Stillwater Complex in Montana and to interpret these data in the context of planetary magma fractionation processes such as those operative during the formation of the Earth's Moon. This research problem involved collecting samples in the Stillwater Complex and analyzing them by electron microprobe, X-ray fluorescence (XRF), and instrumental neutron activation analysis (INAA). The electron microprobe is used to determine the compositions of cumulus and intercumulus phases in the rocks, the XRF is used to determine the bulk-rock major element and trace element (Y, Sr, Rb, Zr, Ni, and Cr) abundances, and the INAA lab. is used to determine the trace element (Sc, Co, Cr, Ni, Ta, Hf, U, Th, and the REE) abundances of mineral separates and bulk rocks.

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor suppressor in hepatocellular carcinoma.

PubMed

Liu, Rui; Zhang, Haiyang; Zhang, Yan; Li, Shuang; Wang, Xinyi; Wang, Xia; Wang, Cheng; Liu, Bin; Zen, Ke; Zhang, Chen-Yu; Zhang, Chunni; Ba, Yi

2017-04-01

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha plays a crucial role in regulating the biosynthesis of mitochondria, which is closely linked to the energy metabolism in various tumors. This study investigated the regulatory role of peroxisome proliferator-activated receptor gamma coactivator-1 alpha in the pathogenesis of hepatocellular carcinoma. In this study, the changes of peroxisome proliferator-activated receptor gamma coactivator-1 alpha messenger RNA levels between normal human liver and hepatocellular carcinoma tissue were examined by quantitative reverse transcription polymerase chain reaction. Knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by RNA interference in the human liver cell line L02, while overexpression of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha complementary DNA in the human hepatocarcinoma cell line HepG2. Cellular morphological changes were observed via optical and electron microscopy. Cellular apoptosis was determined by Hoechst 33258 staining. In addition, the expression levels of 21,400 genes in tissues and cells were detected by microarray. It was shown that peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression was significantly downregulated in hepatocellular carcinoma compared with normal liver tissues. After knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression in L02 cells, cells reverted to immature and dedifferentiated morphology exhibiting cancerous tendency. Apoptosis occurred in the HepG2 cells after transfection by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha. Microarray analysis showed consistent results. The results suggest that peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor suppressor in the formation and development of hepatocellular carcinoma and that peroxisome proliferator-activated receptor gamma coactivator-1 alpha may be a potential therapeutic target for hepatocellular carcinoma.

Development of an aptamer beacon for detection of interferon-gamma.

PubMed

Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

2010-03-01

Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

Petrology and Geochemistry of the NWA 3368 Eucrite

NASA Astrophysics Data System (ADS)

Gardner, K. G.; Lauretta, D. S.; Hill, D. H.; Goreva, J. S.; Domanik, K. J.; Franchi, I. A.; Drake, M. J.

2006-03-01

We report the petrology and geochemistry of NWA 3368, a new non-cumulate, monomict eucrite breccia with a variety of clast sizes and a pink-tinted matrix. Analytical techniques include electron microprobe, INAA, and ICP-MS.

Sizing up the population of gamma-ray binaries

NASA Astrophysics Data System (ADS)

Dubus, Guillaume; Guillard, Nicolas; Petrucci, Pierre-Olivier; Martin, Pierrick

2017-12-01

Context. Gamma-ray binaries are thought to be composed of a young pulsar in orbit around a massive O or Be star with their gamma-ray emission powered by pulsar spin-down. The number of such systems in our Galaxy is not known. Aims: We aim to estimate the total number of gamma-ray binaries in our Galaxy and to evaluate the prospects for new detections in the GeV and TeV energy range, taking into account that their gamma-ray emission is modulated on the orbital period. Methods: We modelled the population of gamma-ray binaries and evaluated the fraction of detected systems in surveys with the Fermi-LAT (GeV), H.E.S.S., HAWC and CTA (TeV) using observation-based and synthetic template light curves. Results: The detected fraction depends more on the orbit-average flux than on the light-curve shape. Our best estimate for the number of gamma-ray binaries is 101-52+89 systems. A handful of discoveries are expected by pursuing the Fermi-LAT survey. Discoveries in TeV surveys are less likely. However, this depends on the relative amounts of power emitted in GeV and TeV domains. There could be as many as ≈ 200 HESS J0632+057-like systems with a high ratio of TeV to GeV emission compared to other gamma-ray binaries. Statistics allow for as many as three discoveries in five years of HAWC observations and five discoveries in the first two years of the CTA Galactic Plane survey. Conclusions: We favour continued Fermi-LAT observations over ground-based TeV surveys to find new gamma-ray binaries. Gamma-ray observations are most sensitive to short orbital period systems with a high spin-down pulsar power. Radio pulsar surveys (SKA) are likely to be more efficient in detecting long orbital period systems, providing a complementary probe into the gamma-ray binary population.

Rare earth elements in fly ashes created during the coal burning process in certain coal-fired power plants operating in Poland - Upper Silesian Industrial Region.

PubMed

Smolka-Danielowska, Danuta

2010-11-01

The subject of the study covered volatile ashes created during hard coal burning process in ash furnaces, in power plants operating in the Upper Silesian Industrial Region, Southern Poland. Coal-fired power plants are furnished with dust extracting devices, electro precipitators, with 99-99.6% combustion gas extracting efficiency. Activity concentrations ofTh-232, Ra-226, K-40, Ac-228, U-235 and U-238 were measured with gamma-ray spectrometer. Concentrations of selected rare soil elements (La, Ce, Nd, Sm, Y, Gd, Th, U) were analysed by means of instrumental neutron activation analysis (INAA). Mineral phases of individual ash particles were identified with the use of scanning electron microscope equipped with EDS attachment. Laser granulometric analyses were executed with the use of Analyssette analyser. The activity of the investigated fly-ash samples is several times higher than that of the bituminous coal samples; in the coal, the activities are: 226Ra - 85.4 Bq kg(-1), 40 K-689 Bq kg(-1), 232Th - 100.8 Bq kg(-1), 235U-13.5 Bq kg(-1), 238U-50 Bq kg(-1) and 228Ac - 82.4 Bq kg(-1).

Fast Neutron Detection Using Pixelated CdZnTe Spectrometers

NASA Astrophysics Data System (ADS)

Streicher, Michael; Goodman, David; Zhu, Yuefeng; Brown, Steven; Kiff, Scott; He, Zhong

2017-07-01

Fast neutrons are an important signature of special nuclear materials (SNMs). They have a low natural background rate and readily penetrate high atomic number materials that easily shield gamma-ray signatures. Therefore, they provide a complementary signal to gamma rays for detecting shielded SNM. Scattering kinematics dictate that a large nucleus (such as Cd or Te) will recoil with small kinetic energy after an elastic collision with a fast neutron. Charge carrier recombination and quenching further reduce the recorded energy deposited. Thus, the energy threshold of CdZnTe detectors must be very low in order to sense the small signals from these recoils. In this paper, the threshold was reduced to less than 5 keVee to demonstrate that the 5.9-keV X-ray line from 55Fe could be separated from electronic noise. Elastic scattering neutron interactions were observed as small energy depositions (less than 20 keVee) using digitally sampled pulse waveforms from pixelated CdZnTe detectors. Characteristic gamma-ray lines from inelastic neutron scattering were also observed.

Nuclear Science and Applications with the Next Generation of High-Power Lasers and Brilliant Low-Energy Gamma Beams at ELI-NP

NASA Astrophysics Data System (ADS)

Gales, S.; ELI-NP Team

2015-10-01

The development of high power lasers and the combination of such novel devices with accelerator technology has enlarged the science reach of many research fields, in particular High Energy, Nuclear and Astrophysics as well as societal applications in Material Science, Nuclear Energy and Medicine. The European Strategic Forum for Research Infrastructures (ESFRI) has selected a proposal based on these new premises called "ELI" for Extreme Light Infrastructure. ELI will be built as a network of three complementary pillars at the frontier of laser technologies. The ELI-NP pillar (NP for Nuclear Physics) is under construction near Bucharest (Romania) and will develop a scientific program using two 10 PW class lasers and a Back Compton Scattering High Brilliance and Intense Low Energy Gamma Beam, a marriage of Laser and Accelerator technology at the frontier of knowledge. In the present paper, the technical and scientific status of the project as well as the applications of the gamma source will be discussed.

First Measurement of the Ratio sigma_(t-tbar) / sigma_(Z/\\gamma*->ll) and Precise Extraction of the t-tbar Cross Section

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.

2010-04-01

We report a measurement of the ratio of the t{bar t} to Z/{gamma}* production cross sections in {radical}s = 1.96 TeV p{bar p} collisions using data corresponding to an integrated luminosity of up to 4.6 fb{sup -1}, collected by the CDF II detector. The t{bar t} cross section ratio is measured using two complementary methods, a b-jet tagging measurement and a topological approach. By multiplying the ratios by the well-known theoretical Z/{gamma}* {yields} ll cross section predicted by the standard model, the extracted t{bar t} cross sections are effectively insensitive to the uncertainty on luminosity. A best linear unbiased estimatemore » is used to combine both measurements with the result {sigma}{sub t{bar t}} = 7.70 {+-} 0.52 pb, for a top-quark mass of 172.5 GeV/c{sup 2}.« less

Frontal gamma noise power and cognitive domains in schizophrenia.

PubMed

Díez, Alvaro; Suazo, Vanessa; Casado, Pilar; Martín-Loeches, Manuel; Perea, María Victoria; Molina, Vicente

2014-01-30

The cognitive deficit profile is different among individuals with schizophrenia. We quantified the amount of electroencephalographic activity unlocked to stimuli onset (noise power) over frontal regions regarding deficit in cognitive domains. Forty-six patients with schizophrenia and 27 healthy controls underwent clinical, cognitive and electrophysiological assessments. Noise power studies may be considered complementary but not equivalent to induced power studies. We compared gamma and theta noise power magnitude during a P300 paradigm between subsets of patients divided according to cognitive deficit in key domains and controls. Patients displayed higher gamma noise power activity at Fz site and significantly lower performance in all cognitive domains when compared to controls. The subset of patients with cognitive deficit for working memory and problem solving/executive functions domains displayed significantly higher frontal-lateral noise power values in comparison to the subset of patients without cognitive deficit and controls. Patients with significant cognitive deficits in domains with greater frontal contribution are also characterized by an abnormally higher gamma band noise power over the frontal region. Our data may endorse various biological subsets within schizophrenia, characterized by the presence or absence of a significant cognitive deficit in frontal domains. © 2013 Published by Elsevier Ireland Ltd.

Simultaneous measurement of (n,{gamma}) and (n,fission) cross sections with the DANCE 4{pi} BaF2 array

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bredeweg, T. A.; Fowler, M. M.; Bond, E. M.

2006-03-13

Neutron capture cross section measurements on many of the actinides are complicated by low-energy neutron-induced fission, which competes with neutron capture to varying degrees depending on the nuclide of interest. Measurements of neutron capture on 235U using the Detector for Advanced Neutron Capture Experiments (DANCE) have shown that we can partially resolve capture from fission events based on total photon calorimetry (i.e. total {gamma}-ray energy and {gamma}-ray multiplicity per event). The addition of a fission-tagging detector to the DANCE array will greatly improve our ability to separate these two competing processes so that improved neutron capture and (n,{gamma})/(n,fission) cross sectionmore » ratio measurements can be obtained. The addition of a fission-tagging detector to the DANCE array will also provide a means to study several important issues associated with neutron-induced fission, including (n,fission) cross sections as a function of incident neutron energy, and total energy and multiplicity of prompt fission photons. We have focused on two detector designs with complementary capabilities, a parallel-plate avalanche counter and an array of solar cells.« less

Gamma-ray detectors for breast imaging

NASA Astrophysics Data System (ADS)

Williams, Mark B.; Goode, Allen R.; Majewski, Stan; Steinbach, Daniela; Weisenberger, Andrew G.; Wojcik, Randolph F.; Farzanpay, Farzin

1997-07-01

Breast cancer is the most common cancer of American women and is the leading cause of cancer-related death among women aged 15 - 54; however recent years have shown that early detection using x-ray mammography can lead to a high probability of cure. However, because of mammography's low positive predictive value, surgical or core biopsy is typically required for diagnosis. In addition, the low radiographic contrast of many nonpalpable breast masses, particularly among women with radiographically dense breasts, results in an overall rate of 10% to 25% for missed tumors. Nuclear imaging of the breast using single gamma emitters (scintimammography) such as (superscript 99m)Tc, or positron emitters such as F-18- fluorodeoxyglucose (FDG) for positron emission tomography (PET), can provide information on functional or metabolic tumor activity that is complementary to the structural information of x-ray mammography, thereby potentially reducing the number of unnecessary biopsies and missed cancers. This paper summarizes recent data on the efficacy of scintimammography using conventional gamma cameras, and describes the development of dedicated detectors for gamma emission breast imaging. The detectors use new, high density crystal scintillators and large area position sensitive photomultiplier tubes (PSPMTs). Detector design, imaging requirements, and preliminary measured imaging performance are discussed.

Computational analysis of kidney scintigrams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vrincianu, D.; Puscasu, E.; Creanga, D.

The scintigraphic investigation of normal and pathological kidneys was carried out using specialized gamma-camera device from nuclear medicine hospital department. Technetium 90m isotope with gamma radiation emission, coupled with vector molecules for kidney tissues was introduced into the subject body, its dynamics being recorded as data source for kidney clearance capacity. Two representative data series were investigated, corresponding to healthy and pathological organs respectively. The semi-quantitative tests applied for the comparison of the two distinct medical situations were: the shape of probability distribution histogram, the power spectrum, the auto-correlation function and the Lyapunov exponent. While power spectrum led to similarmore » results in both cases, significant differences were revealed by means of distribution probability, Lyapunov exponent and correlation time, recommending these numerical tests as possible complementary tools in clinical diagnosis.« less

Neutralino dark matter and the Fermi gamma-ray lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chalons, Guillaume; Dolan, Matthew J.; McCabe, Christopher, E-mail: guillaume.chalons@kit.edu, E-mail: m.j.dolan@durham.ac.uk, E-mail: christopher.mccabe@durham.ac.uk

2013-02-01

Motivated by recent claims of lines in the Fermi gamma-ray spectrum, we critically examine means of enhancing neutralino annihilation into neutral gauge bosons. The signal can be boosted while remaining consistent with continuum photon constraints if a new singlet-like pseudoscalar is present. We consider singlet extensions of the MSSM, focusing on the NMSSM, where a 'well-tempered' neutralino can explain the lines while remaining consistent with current constraints. We adopt a complementary numerical and analytic approach throughout in order to gain intuition for the underlying physics. The scenario requires a rich spectrum of light neutralinos and charginos leading to characteristic phenomenologicalmore » signatures at the LHC whose properties we explore. Future direct detection prospects are excellent, with sizeable spin-dependent and spin-independent cross-sections.« less

Global Distribution of Shallow Water on Mars: Neutron Mapping of Summer-Time Surface by HEND/Odyssey

NASA Technical Reports Server (NTRS)

Mitrofanov, I. G.; Litvak, M. L.; Kozyrev, A. S.; Sanin, A. B.; Tretyakov, V. I.; Boynton, W.; Hamara, D.; Shinohara, C.; Saunders, R. S.; Drake, D.

2003-01-01

Orbital mapping of induced neutrons and gamma-rays by Odyssey has recently successfully proven the applicability of nuclear methods for studying of the elementary composition of Martian upper-most subsurface. In particular, the suite of Gamma-Ray Spectrometer (GRS) has discovered the presence of large water-ice rich regions southward and northward on Mars. The data of neutron mapping of summer-time surface are presented below from the Russian High Energy Neutron Spectrometer (HEND), which is a part of GRS suite. These maps represent the content of water in the soil for summer season at Southern and Northern hemispheres, when the winter deposit of CO2 is absent on the surface. The seasonal evolution of CO2 coverage on Mars is the subject of the complementary paper.

Speciation of As(III) and As(V) in water and sediment using reverse-phase ion-pair high-performance liquid chromatography-neutron activation analysis (HPLC-NAA).

PubMed

Tulasi, Delali; Adotey, Dennis; Affum, Andrews; Carboo, Derick; Serfor-Armah, Yaw

2013-10-01

Total As content and the As species distribution in water and sediments from the Kwabrafo stream, a major water body draining the Obuasi gold mining community in southwestern Ghana, have been investigated. Total As content was determined by instrumental neutron activation analysis (INAA). Ion-pair reverse phase high-performance liquid chromatography-neutron activation analysis (HPLC-NAA) was used for speciation of As species. Solid phase extraction with phosphate buffer was used to extract soluble As species from lyophilized sediment. The mass balance after phosphate extraction of soluble As species in sediment varied from 89 to 96 %. Compositionally appropriate reference material International Atomic Energy Agency (IAEA)-Lake Sediment (SL)-1 was used to check the validity of INAA method for total As determination. The measured values are in good agreement with the IAEA recommended value and also within the 95 % confidence interval. The accuracy of the measurement in terms of relative deviation from the IAEA recommended value was ±0.83 %. "In-house" prepared As(III) and As(V) standards were used to validate the HPLC-INAA method used for the As species determination. Total As concentration in the water samples ranged from 1.15 to 9.20 mg/L. As(III) species in water varied from 0.13 to 0.7 mg/L, while As(V) species varied from 0.79 to 3.85 mg/L. Total As content in sediment ranged from 2,134 to 3,596 mg/kg dry mass. The levels of As(III) and As(V) species in the sediment ranges from 138 to 506 mg/kg dry mass and 156 to 385 mg/kg dry mass, respectively.

Determination of trace elements in epiphytic lichens from Bandar Baru Bangi, Selangor using INAA method

NASA Astrophysics Data System (ADS)

Khairudin, Nurshafiq Ezam; Siong, Khoo Kok; Siong, Wee Boon

2014-02-01

Lichens have been used as effective biomonitors of atmospheric pollutants as they can take up nutrients and pollutants directly from the atmosphere. In this study, trace element contents in epiphytic lichens were determined using INAA method. Samples were collected from 7 sampling locations around Bandar Baru Bangi, Selangor. The elements detected were As (1.73+0.85 mg/kg), Ce (3.65+1.91 mg/kg), Co (0.29+0.12 mg/kg), Cr (5.92+3.54 mg/kg), Cs (0.92+0.25 mg/kg), Eu (0.03+0.02 mg/kg), Fe (1280+760 mg/kg), Hf (0.37+0.18 mg/kg), La (1.52+0.89 mg/kg), Rb (27.7+4.8 mg/kg), Sc (0.33+0.19 mg/kg), Sm (0.28+0.16 mg/kg), Th (1.21+0.62 mg/kg) and Zn (116+27 mg/kg). Comparisons were then made between the elemental concentrations obtained and the baseline data from literature. Results showed that most of the elements were within the concentration range of the baseline data. Enrichment factors (EF) of the trace element in lichens showed that most of the elements were within the range of the baseline data except for As which was found to be slightly enriched (EF: 13.2 - 28.5). Regression analysis indicated significant correlation (p<0.05) with Sc for most of the elements which signifies crustal input except for Cs and Rb. The poor correlations of Cs and Rb with Sc may be due to the mobility of these elements. In summary, trace element data obtained using INAA were very useful and demonstrated that lichens were suitable biomonitors for identifying potential trace element pollutants in ambient air around the sampling area.

Implementation of k0-INAA standardisation at ITU TRIGA Mark II research reactor, Turkey based on k0-IAEA software

NASA Astrophysics Data System (ADS)

Esen, Ayse Nur; Haciyakupoglu, Sevilay

2016-02-01

The purpose of this study is to test the applicability of k0-INAA method at the Istanbul Technical University TRIGA Mark II research reactor. The neutron spectrum parameters such as epithermal neutron flux distribution parameter (α), thermal to epithermal neutron flux ratio (f) and thermal neutron flux (φth) were determined at the central irradiation channel of the ITU TRIGA Mark II research reactor using bare triple-monitor method. HPGe detector calibrations and calculations were carried out by k0-IAEA software. The α, f and φth values were calculated to be -0.009, 15.4 and 7.92·1012 cm-2 s-1, respectively. NIST SRM 1633b coal fly ash and intercomparison samples consisting of clay and sandy soil samples were used to evaluate the validity of the method. For selected elements, the statistical evaluation of the analysis results was carried out by z-score test. A good agreement between certified/reported and experimental values was obtained.

Instrumental neutron activation analysis for studying size-fractionated aerosols

NASA Astrophysics Data System (ADS)

Salma, Imre; Zemplén-Papp, Éva

1999-10-01

Instrumental neutron activation analysis (INAA) was utilized for studying aerosol samples collected into a coarse and a fine size fraction on Nuclepore polycarbonate membrane filters. As a result of the panoramic INAA, 49 elements were determined in an amount of about 200-400 μg of particulate matter by two irradiations and four γ-spectrometric measurements. The analytical calculations were performed by the absolute ( k0) standardization method. The calibration procedures, application protocol and the data evaluation process are described and discussed. They make it possible now to analyse a considerable number of samples, with assuring the quality of the results. As a means of demonstrating the system's analytical capabilities, the concentration ranges, median or mean atmospheric concentrations and detection limits are presented for an extensive series of aerosol samples collected within the framework of an urban air pollution study in Budapest. For most elements, the precision of the analysis was found to be beyond the uncertainty represented by the sampling techniques and sample variability.

Study on the elemental features of ancient Chinese white porcelain at Jingdezhen by INAA

NASA Astrophysics Data System (ADS)

Xie, Guoxi; Feng, Songlin; Feng, Xiangqian; Li, Yongqiang; Han, Hongye; Wang, Yanqing; Zhu, Jihao; Yan, Lingtong; Li, Li

2009-03-01

Shards of ancient Chinese white porcelain, which were excavated at Maojiawan in the city of Beijing, were analyzed by instrumental neutron activation analysis (INAA). These shards were fired in the period between the Yuan (AD 1271-1368) and Ming (AD 1368-1644) dynasties at Jingdezhen in southern China. According to the analytical results, different raw materials were used for making porcelain body in this period. Fe and Na are the characteristic elements which can be used for identifying the specific date of these porcelains. Furthermore, shards of Hongwu era (AD 1368-1398), Yongle-Xuande era (AD 1403-1435) and Chenghua-Zhengde era (AD 1465-1561) of the Ming dynasty can be clearly distinguished by their elemental body composition. The temporal chemical variation in the porcelain body of these eras is observed. The elemental body composition of Zhengde-Tianshun era (AD 1436-1464) is mainly similar to that of the Hongwu and Yongle-Xuande eras. The temporal chemical feature of Zhengtong-Tianshun era was not found.

Mineral content of Chinese medicinal herbs used as diuretic treatments for Taiwanese children.

PubMed

Chen, Chien-Yi

2005-01-01

Eighteen major, minor and trace elements in 12 Chinese medicinal herbs commonly consumed by Taiwanese Children as diuretics were determined by instrumental neutron activation analysis (INAA). Dried and powdered herb samples were irradiated in a neutron flux of ca. 2 x 10(12) n/cm2 s under separate short and long irradiation schemes. Lichen (IAEA-336) was used as the reference standard, and tomato leaves (NIST-SRM 1570a) were employed for cross-checking the accuracy of the results. INAA was shown to be a reliable multi-element analytical method for determining the content of both toxicologically and nutritionally important minerals in Chinese medicinal herbs. Determined elements were present in the dried herbs in concentrations ranging from 10(4) to 10(-3) microg/g. The mineral contents and the maximum daily intake values of the tested herbs were compared with published values and with the recommended daily intakes for Taiwanese children as specified by the World Health Organization.

Assessing rare earth elements in quartz rich geological samples.

PubMed

Santoro, A; Thoss, V; Ribeiro Guevara, S; Urgast, D; Raab, A; Mastrolitti, S; Feldmann, J

2016-01-01

Sodium peroxide (Na2O2) fusion coupled to Inductively Coupled Plasma Tandem Mass Spectrometry (ICP-MS/MS) measurements was used to rapidly screen quartz-rich geological samples for rare earth element (REE) content. The method accuracy was checked with a geological reference material and Instrumental Neutron Activation Analysis (INAA) measurements. The used mass-mode combinations presented accurate results (only exception being (157)Gd in He gas mode) with recovery of the geological reference material QLO-1 between 80% and 98% (lower values for Lu, Nd and Sm) and in general comparable to INAA measurements. Low limits of detection for all elements were achieved, generally below 10 pg g(-1), as well as measurement repeatability below 15%. Overall, the Na2O2/ICP-MS/MS method proved to be a suitable lab-based method to quickly and accurately screen rock samples originating from quartz-rich geological areas for rare earth element content; particularly useful if checking commercial viability. Copyright © 2015 Elsevier Ltd. All rights reserved.

Trace-Element Concentrations in Northwest Africa 032

NASA Technical Reports Server (NTRS)

Korotev, R. L.; Jolliff, B. L.; Wang, A.; Gillis, J. J.; Haskin, L. A.; Fagan, T. J.; Taylor, G. J.; Keil, K.

2001-01-01

Trace-element concentrations (INAA) are presented for four samples of the NWA 032 lunar meteorite. The mare basalt has a moderately high Th concentration (1.9 ppm) and a higher Th/REE ratio than any other known mare basalt. Additional information is contained in the original extended abstract.

A preferred method for the determination of bulk compositions of coarse-grained refractory inclusions and some implications of the results

NASA Astrophysics Data System (ADS)

Simon, S. B.; Grossman, L.

2004-10-01

Analyses of coarse-grained refractory inclusions typically do not have the solar CaO/Al 2O 3 ratio, probably reflecting nonrepresentative sampling of them in the laboratory. Many previous studies, especially those done by instrumental neutron activation analysis (INAA), were based on very small amounts of material removed from those restricted portions of inclusions that happened to be exposed on surfaces of bulk meteorite samples. Here, we address the sampling problem by studying thin sections of large inclusions, and by analyzing much larger aliquots of powders of these inclusions by INAA than has typically been done in the past. These results do show convergence toward the solar CaO/Al 2O 3 ratio of 0.792. The bulk compositions of 15 coarse-grained inclusions determined by INAA of samples >2 mg have an average CaO/Al 2O 3 ratio of 0.80 ± 0.18. When bulk compositions are obtained by modal recombination based on analysis of thin sections with cross-sections of entire, large, unbroken inclusions, the average of 11 samples (0.79 ± 0.15) also matches the solar value. Among those analyzed by INAA and by modal recombination, there were no inclusions for which both techniques agreed on a CaO/Al 2O 3 ratio deviating by >˜15% from the solar value. These results suggest that: individual inclusions may have the solar CaO/Al 2O 3 ratio; departures from this value are due to sample heterogeneity and nonrepresentative sampling in the laboratory; and it is therefore valid to correct compositions to this value. We present a method for doing so by mathematical addition or subtraction of melilite, spinel, or pyroxene. This yields a set of multiple, usually slightly different, corrected compositions for each inclusion. The best estimate of the bulk composition of an inclusion is the average of these corrected compositions, which simultaneously accounts for errors in sampling of all major phases. Results show that Type B2 inclusions tend to be more SiO 2-rich and have higher normative Anorthite/Gehlenite component ratios than Type B1s. The inclusion bulk compositions lie in a field that can result from evaporation at 1700-2000K of CMAS liquids with solar CaO/Al 2O 3, but with a wide range of initial MgO (30-60 wt%) and SiO 2 (15-50 wt%) contents.

Gamma-ray Monitoring of Active Galactic Nuclei with HAWC

NASA Astrophysics Data System (ADS)

Lauer, Robert; HAWC Collaboration

2016-03-01

Active Galactic Nuclei (AGN) are extra-galactic sources that can exhibit extreme flux variability over a wide range of wavelengths. TeV gamma rays have been observed from about 60 AGN and can help to diagnose emission models and to study cosmic features like extra-galactic background light or inter-galactic magnetic fields. The High Altitude Water Cherenkov (HAWC) observatory is a new extensive air shower array that can complement the pointed TeV observations of imaging air Cherenkov telescopes. HAWC is optimized for studying gamma rays with energies between 100 GeV and 100 TeV and has an instantaneous field of view of ~2 sr and a duty cycle >95% that allow us to scan 2/3 of the sky every day. By performing an unbiased monitoring of TeV emissions of AGN over most of the northern and part of the southern sky, HAWC can provide crucial information and trigger follow-up observations in collaborations with pointed TeV instruments. Furthermore, HAWC coverage of AGN is complementary to that provided by the Fermi satellite at lower energies. In this contribution, we will present HAWC flux light curves of TeV gamma rays from various sources, notably the bright AGN Markarian 421 and Markarian 501, and highlight recent results from multi-wavelengths and multi-instrument studies.

In-situ thermal annealing of on-membrane silicon-on-insulator semiconductor-based devices after high gamma dose irradiation.

PubMed

Amor, S; André, N; Kilchytska, V; Tounsi, F; Mezghani, B; Gérard, P; Ali, Z; Udrea, F; Flandre, D; Francis, L A

2017-05-05

In this paper, we investigate the recovery of some semiconductor-based components, such as N/P-type field-effect transistors (FETs) and a complementary metal-oxide-semiconductor (CMOS) inverter, after being exposed to a high total dose of gamma ray radiation. The employed method consists mainly of a rapid, low power and in situ annealing mitigation technique by silicon-on-insulator micro-hotplates. Due to the ionizing effect of the gamma irradiation, the threshold voltages showed an average shift of -580 mV for N-channel transistors, and -360 mV for P-MOSFETs. A 4 min double-cycle annealing of components with a heater temperature up to 465 °C, corresponding to a maximum power of 38 mW, ensured partial recovery but was not sufficient for full recovery. The degradation was completely recovered after the use of a built-in high temperature annealing process, up to 975 °C for 8 min corresponding to a maximum power of 112 mW, which restored the normal operating characteristics for all devices after their irradiation.

Fast Neutron Detection using Pixelated CdZnTe Spectrometers

DOE PAGES

Streicher, Michael; Goodman, David; Zhu, Yuefeng; ...

2017-05-29

One important important signature of special nuclear materials (SNM) are fast neutrons. Fast neutrons have a low natural background rate and readily penetrate high atomic number materials which easily shield gamma-ray signatures. Thus, fast neutrons provide a complementary signal to gamma rays for detecting shielded SNM. Scattering kinematics dictate that a large nucleus (such as Cd or Te) will recoil with small kinetic energy after an elastic collision with a fast neutron. Charge carrier recombination and quenching further reduce the recorded energy deposited. Thus, the energy threshold of CdZnTe detectors must be very low in order to sense the smallmore » signals from these recoils. Here, the threshold was reduced to less than 5 keVee to demonstrate that the 5.9 keV x-ray line from 55Fe could be separated from electronic noise. Elastic scattering neutron interactions were observed as small energy depositions (less than 20 keVee) using digitally-sampled pulse waveforms from pixelated CdZnTe detectors. Characteristic gamma-ray lines from inelastic neutron scattering were also observed.« less

In-situ thermal annealing of on-membrane silicon-on-insulator semiconductor-based devices after high gamma dose irradiation

NASA Astrophysics Data System (ADS)

Amor, S.; André, N.; Kilchytska, V.; Tounsi, F.; Mezghani, B.; Gérard, P.; Ali, Z.; Udrea, F.; Flandre, D.; Francis, L. A.

2017-05-01

In this paper, we investigate the recovery of some semiconductor-based components, such as N/P-type field-effect transistors (FETs) and a complementary metal-oxide-semiconductor (CMOS) inverter, after being exposed to a high total dose of gamma ray radiation. The employed method consists mainly of a rapid, low power and in situ annealing mitigation technique by silicon-on-insulator micro-hotplates. Due to the ionizing effect of the gamma irradiation, the threshold voltages showed an average shift of -580 mV for N-channel transistors, and -360 mV for P-MOSFETs. A 4 min double-cycle annealing of components with a heater temperature up to 465 °C, corresponding to a maximum power of 38 mW, ensured partial recovery but was not sufficient for full recovery. The degradation was completely recovered after the use of a built-in high temperature annealing process, up to 975 °C for 8 min corresponding to a maximum power of 112 mW, which restored the normal operating characteristics for all devices after their irradiation.

EFFECTS OF TRITIUM GAS EXPOSURE ON THE GLASS TRANSITION TEMPERATURE OF EPDM ELASTOMER AND ON THE CONDUCTIVITY OF POLYANILINE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clark, E; Marie Kane, M

2008-12-12

Four formulations of EPDM (ethylene-propylene diene monomer) elastomer were exposed to tritium gas initially at one atmosphere and ambient temperature for between three and four months in closed containers. Material properties that were characterized include density, volume, mass, appearance, flexibility, and dynamic mechanical properties. The glass transition temperature was determined by analysis of the dynamic mechanical property data per ASTM standards. EPDM samples released significant amounts of gas when exposed to tritium, and the glass transition temperature increased by about 3 C. during the exposure. Effects of ultraviolet and gamma irradiation on the surface electrical conductivity of two types ofmore » polyaniline films are also documented as complementary results to planned tritium exposures. Future work will determine the effects of tritium gas exposure on the electrical conductivity of polyaniline films, to demonstrate whether such films can be used as a sensor to detect tritium. Surface conductivity was significantly reduced by irradiation with both gamma rays and ultraviolet light. The results of the gamma and UV experiments will be correlated with the tritium exposure results.« less

The Portuguese gamma irradiation facility

NASA Astrophysics Data System (ADS)

Mendes, C. M.; Almeida, J. C.; Botelho, M. L.; Cavaco, M. C.; Almeida-Vara, E.; Andrade, M. E.

A Gamma Radiation Facility was built up in the National Laboratory of Industrial Technology and Engineering (LNETI), Lisbon, Portugal. This plant (UTR GAMA-Pi) is a Cobalt-60 dry storage continuous facility with a nominal capacity of 1.5X10 16 Bq. The initial activity is 1.1X10 16 Bq and the troughput capacity 10 3 ton/year for product with a bulk density of 0.2 g/cm 3 treated with a minimum absorbed dose of 25 kGy. Complementary control devices were installed: ventilation system, closed water refrigeration circuit, internal TV system, detection and extinction fire system and emergency power group. It must be emphasized that the best attention was given to the conception and efficiency of the interlock safety systems. This facility will be utilized mainly for radiosterilization of medical articles and decontamination of wine cork stoppers.

Separating astrophysical sources from indirect dark matter signals

PubMed Central

Siegal-Gaskins, Jennifer M.

2015-01-01

Indirect searches for products of dark matter annihilation and decay face the challenge of identifying an uncertain and subdominant signal in the presence of uncertain backgrounds. Two valuable approaches to this problem are (i) using analysis methods which take advantage of different features in the energy spectrum and angular distribution of the signal and backgrounds and (ii) more accurately characterizing backgrounds, which allows for more robust identification of possible signals. These two approaches are complementary and can be significantly strengthened when used together. I review the status of indirect searches with gamma rays using two promising targets, the Inner Galaxy and the isotropic gamma-ray background. For both targets, uncertainties in the properties of backgrounds are a major limitation to the sensitivity of indirect searches. I then highlight approaches which can enhance the sensitivity of indirect searches using these targets. PMID:25304638

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chatt, A.

The 60th anniversary of the discovery of neutron activation analysis (NAA) by Hevesy and Levi is being celebrated in 1996. With the availability of nuclear reactors capable of producing fluxes of the order of 10{sup 12} to 10{sup 14} n/cm{sup 2}s, the development of high-resolution and high-efficiency conventional and anticoincidence gamma-ray detectors, multichannel pulse-height analyzers, and personal computer-based softwares, NAA has become an extremely valuable analytical technique, especially for the simultaneous determinations of multielement concentrations. This technique can be used in a number of ways, depending on the nature of the matrix, the major elements in the sample, and onmore » the elements of interest. In most cases, several elements can be determined without any chemical pretreatment of the sample; the technique is then called instrumental NAA (INAA). In other cases, an element can be concentrated from an interfering matrix prior to irradiation; the technique is then termed preconcentration NAA (PNAA). In opposite instances, the irradiation is followed by a chemical separation of the desired element; the technique is then called radiochemical NAA (RNAA). All three forms of NAA can provide elemental concentrations of high accuracy and precision with excellent sensitivity. The number of research reactors in developing countries has increased steadily from 17 in 1955 through 71 in 1975 to 89 in 1995. Low flux reactors such as SLOWPOKE and the Chinese MNSR are primarily used for NAA.« less

Radiation damage in MOS integrated circuits, Part 1

NASA Technical Reports Server (NTRS)

Danchenko, V.

1971-01-01

Complementary and p-channel MOS integrated circuits made by four commercial manufacturers were investigated for sensitivity to radiation environment. The circuits were irradiated with 1.5 MeV electrons. The results are given for electrons and for the Co-60 gamma radiation equivalent. The data are presented in terms of shifts in the threshold potentials and changes in transconductances and leakages. Gate biases of -10V, +10V and zero volts were applied to individual MOS units during irradiation. It was found that, in most of circuits of complementary MOS technologies, noticable changes due to radiation appear first as increased leakage in n-channel MOSFETs somewhat before a total integrated dose 10 to the 12th power electrons/sg cm is reached. The inability of p-channel MOSFETs to turn on sets in at about 10 to the 13th power electrons/sq cm. Of the circuits tested, an RCA A-series circuit was the most radiation resistant sample.

A population of gamma-ray emitting globular clusters seen with the Fermi Large Area Telescope

DOE PAGES

Abdo, A. A.

2010-11-24

Context. Globular clusters with their large populations of millisecond pulsars (MSPs) are believed to be potential emitters of high-energy gamma-ray emission. The observation of this emission provides a powerful tool to assess the millisecond pulsar population of a cluster, is essential for understanding the importance of binary systems for the evolution of globular clusters, and provides complementary insights into magnetospheric emission processes. Aims. Our goal is to constrain the millisecond pulsar populations in globular clusters from analysis of gamma-ray observations. Methods. We use 546 days of continuous sky-survey observations obtained with the Large Area Telescope aboard the Fermi Gamma-ray Spacemore » Telescope to study the gamma-ray emission towards 13 globular clusters. Results. Steady point-like high-energy gamma-ray emission has been significantly detected towards 8 globular clusters. Five of them (47 Tucanae, Omega Cen, NGC 6388, Terzan 5, and M 28) show hard spectral power indices (0.7 < Γ < 1.4) and clear evidence for an exponential cut-off in the range 1.0 - 2.6 GeV, which is the characteristic signature of magnetospheric emission from MSPs. Three of them (M 62, NGC 6440 and NGC 6652) also show hard spectral indices (1.0 < Γ < 1.7), however the presence of an exponential cut-off can not be unambiguously established. Three of them (Omega Cen, NGC 6388, NGC 6652) have no known radio or X-ray MSPs yet still exhibit MSP spectral properties. From the observed gamma-ray luminosities, we estimate the total number of MSPs that is expected to be present in these globular clusters. We show that our estimates of the MSP population correlate with the stellar encounter rate and we estimate 2600 - 4700 MSPs in Galactic globular clusters, commensurate with previous estimates. Conclusions. The observation of high-energy gamma-ray emission from globular clusters thus provides a reliable independent method to assess their millisecond pulsar populations.« less

Emotion-elicited gamma synchrony in patients with first-episode schizophrenia: a neural correlate of social cognition outcomes

PubMed Central

Williams, Leanne M.; Whitford, Thomas J.; Nagy, Marie; Flynn, Gary; Harris, Anthony W.F.; Silverstein, Steven M.; Gordon, Evian

2009-01-01

Background Schizophrenia may be understood as a disorder of neural synchrony. There is also increasing evidence that emotional and social cognitive impairments are central to this disorder. In patients with first-episode schizophrenia, we examined whether emotion perception is associated with disruptions to high-frequency (40 Hz) gamma synchrony and whether these disruptions predict self-regulatory adaptive compensations reflected in social cognitive behaviours. Methods We obtained electroencephalography recordings from 28 patients with first-episode schizophrenia and matched healthy controls during perception of facial emotion under both conscious and nonconscious conditions. We extracted gamma-band synchrony from the electroencephalogram. We also used behavioural measures of emotion identification, emotional intelligence, negativity bias and social function, along with ratings of first-episode schizophrenia symptoms. We analyzed group differences and predicted social cognition to assess the potential contribution of medication. Results Within 200 ms poststimulus, patients with first-episode schizophrenia showed alterations in gamma synchrony during both conscious and nonconscious emotion perception. Stimulus-locked synchrony was reduced in patients, particularly over the temporal cortex, whereas complementary enhancements in absolute gamma synchrony (independent of stimuli) were more distributed over temporal and left parieto-occipital regions. This pattern of altered synchrony predicted poor performance on each measure of social cognition among these patients. Medication dosage did not correlate significantly with either gamma synchrony or behavioural measures in this group. Limitations Limitations to our study include the lack of comparison between medicated and unmedicated patients or between types of medication. Conclusion These findings suggest that disruptions in integrative processing of motivationally important stimuli show promise as a potential biological marker of social cognitive impairments, present from the first episode of schizophrenia, and their outcomes. PMID:19568482

Advanced image fusion algorithms for Gamma Knife treatment planning. Evaluation and proposal for clinical use.

PubMed

Apostolou, N; Papazoglou, Th; Koutsouris, D

2006-01-01

Image fusion is a process of combining information from multiple sensors. It is a useful tool implemented in the treatment planning programme of Gamma Knife Radiosurgery. In this paper we evaluate advanced image fusion algorithms for Matlab platform and head images. We develop nine level grayscale image fusion methods: average, principal component analysis (PCA), discrete wavelet transform (DWT) and Laplacian, filter - subtract - decimate (FSD), contrast, gradient, morphological pyramid and a shift invariant discrete wavelet transform (SIDWT) method in Matlab platform. We test these methods qualitatively and quantitatively. The quantitative criteria we use are the Root Mean Square Error (RMSE), the Mutual Information (MI), the Standard Deviation (STD), the Entropy (H), the Difference Entropy (DH) and the Cross Entropy (CEN). The qualitative are: natural appearance, brilliance contrast, presence of complementary features and enhancement of common features. Finally we make clinically useful suggestions.

Modeling dynamic beta-gamma polymorphic transition in Tin

NASA Astrophysics Data System (ADS)

Chauvin, Camille; Montheillet, Frank; Petit, Jacques; CEA Gramat Collaboration; EMSE Collaboration

2015-06-01

Solid-solid phase transitions in metals have been studied by shock waves techniques for many decades. Recent experiments have investigated the transition during isentropic compression experiments and shock-wave compression and have highlighted the strong influence of the loading rate on the transition. Complementary data obtained with velocity and temperature measurements around the polymorphic transition beta-gamma of Tin on gas gun experiments have displayed the importance of the kinetics of the transition. But, even though this phenomenon is known, modeling the kinetic remains complex and based on empirical formulations. A multiphase EOS is available in our 1D Lagrangian code Unidim. We propose to present the influence of various kinetic laws (either empirical or involving nucleation and growth mechanisms) and their parameters (Gibbs free energy, temperature, pressure) on the transformation rate. We compare experimental and calculated velocities and temperature profiles and we underline the effects of the empirical parameters of these models.

Re-evaluating reaction rates relevant to nova nucleosynthesis from a nuclear structure perspective

NASA Astrophysics Data System (ADS)

Jenkins, D. G.; Lister, C. J.; Janssens, R. V. F.; Khoo, T. L.; Moore, E. F.; Rehm, K. E.; Seweryniak, D.; Wuosmaa, A. H.; Davinson, T.; Woods, P. J.; Jokinen, A.; Penttila, H.; Martınez-Pinedo, G.; Jose, J.

2006-03-01

Conventionally, reaction rates relevant to nova nucleosynthesis are determined by performing the relevant proton capture reactions directly for stable species, or as has become possible more recently in inverse kinematics using short-lived accelerated radioactive beams with recoil separators. A secondary approach is to compile information on the properties of levels in the Gamow window using transfer reactions. We present a complementary technique where the states of interest are populated in a heavy-ion fusion reaction and their gamma decay studied with a state-of-the-art array of high-purity germanium detectors. The advantages of this approach, including the ability to determine resonance energies with high precision and the possibility of determining spins and parities from gamma-ray angular distributions are discussed. Two specific examples related to the 22Na(p,γ) and 30P(p,γ) reactions are presented.

Study of fission fragment de-excitation by gamma-ray spectrometry with the EXILL experiment

NASA Astrophysics Data System (ADS)

Materna, Thomas; a, Michal Rapał; Letourneau, Alain; Marchix, Anthony; Litaize, Olivier; Sérot, Olivier; Urban, Waldemar; Blanc, Aurélien; Jentschel, Michael; Köster, Ulli; Mutti, Paolo; Soldner, Torsten; Simpson, Gary; Ur, Călin A.; France, Gilles de

2017-09-01

A large array of Ge detectors installed at ILL, around a 235U target irradiated with cold neutrons, (EXILL) allowed measurement of prompt gamma-ray cascades occurring in fission fragments with an unambiguous determination of fragments. Here we present preliminary results of a systematic comparison between experimental γ-ray intensities and those obtained from the Monte-Carlo simulation code FIFRELIN, which is dedicated to the de-excitation of fission fragments. Major γ-ray intensities in the 142Ba and 92Kr fission products, extracted from EXILL data, were compared to FIFRELIN, as well as to reported values (when available) obtained with EUROGAM2 in the spontaneous fission of 248Cm. The evolution of γ-ray intensities in 92Kr versus the complementary partner in fission (i.e. versus the total number of evaporated neutrons by the fission pair) was then extracted and compared to FIFRELIN.

Neutron activation analysis: trends in developments and applications

NASA Astrophysics Data System (ADS)

de Goeij, J. J.; Bode, P.

1995-03-01

New developments in instrumentation for, and methodology of, Instrumental Neutron Activation Analysis (INAA) may lead to new niches for this method of elemental analysis. This paper describes the possibilities of advanced detectors, automated irradiation and counting stations, and very large sample analysis. An overview is given of some typical new fields of application.

22 CFR 41.84 - Victims of trafficking in persons.

Code of Federal Regulations, 2014 CFR

2014-04-01

... Section 41.84 Foreign Relations DEPARTMENT OF STATE VISAS VISAS: DOCUMENTATION OF NONIMMIGRANTS UNDER THE... status under INA 101(a)(15)(T)(i). (b) Visa validity. A qualifying family member may apply for a nonimmigrant visa under INA(a)(15)(T)(ii) only during the period in which the principal applicant is in status...

22 CFR 41.84 - Victims of trafficking in persons.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Section 41.84 Foreign Relations DEPARTMENT OF STATE VISAS VISAS: DOCUMENTATION OF NONIMMIGRANTS UNDER THE... status under INA 101(a)(15)(T)(i). (b) Visa validity. A qualifying family member may apply for a nonimmigrant visa under INA(a)(15)(T)(ii) only during the period in which the principal applicant is in status...

22 CFR 41.84 - Victims of trafficking in persons.

Code of Federal Regulations, 2011 CFR

2011-04-01

... Section 41.84 Foreign Relations DEPARTMENT OF STATE VISAS VISAS: DOCUMENTATION OF NONIMMIGRANTS UNDER THE... status under INA 101(a)(15)(T)(i). (b) Visa validity. A qualifying family member may apply for a nonimmigrant visa under INA(a)(15)(T)(ii) only during the period in which the principal applicant is in status...

22 CFR 41.84 - Victims of trafficking in persons.

Code of Federal Regulations, 2012 CFR

2012-04-01

... Section 41.84 Foreign Relations DEPARTMENT OF STATE VISAS VISAS: DOCUMENTATION OF NONIMMIGRANTS UNDER THE... status under INA 101(a)(15)(T)(i). (b) Visa validity. A qualifying family member may apply for a nonimmigrant visa under INA(a)(15)(T)(ii) only during the period in which the principal applicant is in status...

22 CFR 41.84 - Victims of trafficking in persons.

Code of Federal Regulations, 2013 CFR

2013-04-01

... Section 41.84 Foreign Relations DEPARTMENT OF STATE VISAS VISAS: DOCUMENTATION OF NONIMMIGRANTS UNDER THE... status under INA 101(a)(15)(T)(i). (b) Visa validity. A qualifying family member may apply for a nonimmigrant visa under INA(a)(15)(T)(ii) only during the period in which the principal applicant is in status...

Producing chondrules by recycling and volatile loss

NASA Technical Reports Server (NTRS)

Alexander, C. M. O.

1994-01-01

Interelement correlations observed in bulk chondrule INAA data, particularly between the refractory lithophiles, have led to the now generally accepted conclusion that the chondrule precursors were nebular condensates. However, it has been recently suggested that random sampling of fragments from a previous generation of chondrules could reproduce much of the observed range of bulk chondrule composition.

Human gamma band activity and perception of a gestalt.

PubMed

Keil, A; Müller, M M; Ray, W J; Gruber, T; Elbert, T

1999-08-15

Neuronal oscillations in the gamma band (above 30 Hz) have been proposed to be a possible mechanism for the visual representation of objects. The present study examined the topography of gamma band spectral power and event-related potentials in human EEG associated with perceptual switching effected by rotating ambiguous (bistable) figures. Eleven healthy human subjects were presented two rotating bistable figures: first, a face figure that allowed perception of a sad or happy face depending on orientation and therefore caused a perceptual switch at defined points in time when rotated, and, second, a modified version of the Rubin vase, allowing perception as a vase or two faces whereby the switch was orientation-independent. Nonrotating figures served as further control stimuli. EEG was recorded using a high-density array with 128 electrodes. We found a negative event-related potential associated with the switching of the sad-happy figure, which was most pronounced at central prefrontal sites. Gamma band activity (GBA) was enhanced at occipital electrode sites in the rotating bistable figures compared with the standing stimuli, being maximal at vertical stimulus orientations that allowed an easy recognition of the sad and happy face or the vase-faces, respectively. At anterior electrodes, GBA showed a complementary pattern, being maximal when stimuli were oriented horizontally. The findings support the notion that formation of a visual percept may involve oscillations in a distributed neuronal assembly.

A Correlation Between the Intrinsic Brightness and Average Decay Rate of Gamma-Ray Burst X-Ray Afterglow Light Curves

NASA Technical Reports Server (NTRS)

Racusin, J. L.; Oates, S. R.; De Pasquale, M.; Kocevski, D.

2016-01-01

We present a correlation between the average temporal decay (alpha X,avg, greater than 200 s) and early-time luminosity (LX,200 s) of X-ray afterglows of gamma-ray bursts as observed by the Swift X-ray Telescope. Both quantities are measured relative to a rest-frame time of 200 s after the gamma-ray trigger. The luminosity â€" average decay correlation does not depend on specific temporal behavior and contains one scale-independent quantity minimizing the role of selection effects. This is a complementary correlation to that discovered by Oates et al. in the optical light curves observed by the Swift Ultraviolet Optical Telescope. The correlation indicates that, on average, more luminous X-ray afterglows decay faster than less luminous ones, indicating some relative mechanism for energy dissipation. The X-ray and optical correlations are entirely consistent once corrections are applied and contamination is removed. We explore the possible biases introduced by different light-curve morphologies and observational selection effects, and how either geometrical effects or intrinsic properties of the central engine and jet could explain the observed correlation.

Measurement of Insulation Compaction in the Cryogenic Fuel Tanks at Kennedy Space Center by Fast/Thermal Neutron Techniques

NASA Technical Reports Server (NTRS)

Livingston, R. A.; Schweitzer, J. S.; Parsons, Ann M.; Arens, Ellen E.

2010-01-01

The liquid hydrogen and oxygen cryogenic storage tanks at John F. Kennedy Space Center (KSC) use expanded perlite as thermal insulation. Th ere is evidence that some of the perlite has compacted over time, com promising the thermal performance and possibly also structural integr ity of the tanks. Therefore an Non-destructive Testing (NDT) method for measuring the perlite density or void fraction is urgently needed. Methods based on neutrons are good candidates because they can readil y penetrate through the 1.75 cm outer steel shell and through the ent ire 120 cm thickness of the perlite zone. Neutrons interact with the nuclei of materials to produce characteristic gamma rays which are the n detected. The gamma ray signal strength is proportional to the atom ic number density. Consequently, if the perlite is compacted then the count rates in the individual peaks in the gamma ray spectrum will i ncrease. Perlite is a feldspathic volcanic rock made up of the major elements Si, AI, Na, K and 0 along with some water. With commercially available portable neutron generators it is possible to produce simul taneously fluxes of neutrons in two energy ranges: fast (14 MeV) and thermal (25 meV). Fast neutrons produce gamma rays by inelastic scatt ering which is sensitive to Fe and O. Thermal neutrons produce gamma rays by radiative capture in prompt gamma neutron activation (PGNA) and this is sensitive to Si, AI, Na, Kand H. Thus the two energy ranges produce complementary information. The R&D program has three phases: numerical simulations of neutron and gamma ray transport with MCNP s oftware, evaluation of the system in the laboratory on test articles and finally mapping of the perlite density in the cryogenic tanks at KSC. The preliminary MCNP calculations have shown that the fast/therma l neutron NDT method is capable of distinguishing between expanded an d compacted perlite with excellent statistics.

Observing the Non-Thermal Universe with the Highest Energy Photons

NASA Astrophysics Data System (ADS)

Dingus, Brenda L.; HAWC, VERITAS, CTA

2016-01-01

Astrophysical sources of relativistic particles radiate gamma rays to such high energies that they can be detected from the ground. The existence of high energy gamma rays implies that even higher energy particles are being accelerated placing strong constraints on these non-thermal accelerators. Within our galaxy, TeV gamma rays have been detected from supernova remnants, pulsar wind nebula, x-ray binaries and some yet to be identified sources in the Galactic plane. In addition, these gamma rays have sufficient energy to be attenuated by the interaction with infrared photons producing an electron-positron pair. Thus the spectrum of gamma rays can also constrain the infrared photon density, which for distant extragalactic sources is a direct probe of cosmology. The known extragalactic TeV sources are primarily the blazer class of active galactic nuclei. And TeV gamma rays might even be produced by annihilating dark matter.The US currently supports two ground-based gamma-ray observatories—HAWC and VERITAS—and NSF is developing a prototype for the international Cherenkov Telescope Array (CTA) observatory. The HAWC (High Altitude Water Cherenkov) observatory just began operation of the full detector in March 2015 and with its wide field of view scans ~2/3 of the sky each day for TeV sources. VERITAS (Very EneRgetic Imaging Telescope Array System) is an array of four imaging atmospheric Cherenkov telescopes that follows individual sources to produce lightcurves and spectra from 85 GeV to > 30 TeV. The combination of both a survey and pointed observatory is very complementary with a broad scientific reach that includes the study of extragalactic and Galactic objects as well as the search for astrophysical signatures of dark matter and the measurement of cosmic rays. I will present the current view of the TeV sky and the latest results from HAWC and VERITAS as well as plans for CTA.

Analysis of standard reference materials by absolute INAA

NASA Astrophysics Data System (ADS)

Heft, R. E.; Koszykowski, R. F.

1981-07-01

Three standard reference materials: flyash, soil, and ASI 4340 steel, are analyzed by a method of absolute instrumental neutron activation analysis. Two different light water pool-type reactors were used to produce equivalent analytical results even though the epithermal to thermal flux ratio in one reactor was higher than that in the other by a factor of two.

Seasonal variations of natural radionuclides, minor and trace elements in lake sediments and water in a lignite mining area of North-Western Greece.

PubMed

Noli, Fotini; Tsamos, Panagiotis

2018-05-01

The radiological and chemical pollution of a cluster of four lakes in a lignite mining area of North-Western Greece was investigated using a variety of analytical techniques. Alpha spectrometry was applied to measure the activity concentrations of the uranium radioisotopes (U-234, U-235, and U-238) in waters. The mass activities of U-238, Th-232, and K-40 in sediments were measured by high-resolution gamma spectrometry. Furthermore, the determination of the minor and trace elements was carried out by instrumental neutron activation analysis (INAA) in both water and sediments samples, respectively. Pollution levels were also evaluated by calculating enrichment factors (EFs), contamination factors (CFs) and pollution load index (PLI). The data were discussed taking into account several parameters such as the distance from the pollution source, temperature, and location and showed that the environmental impact in this region could not be considered as negligible. The deviation of the isotopic ratio of U-234/U-238 from the equilibrium value indicated waters with intensive dissolution of uranium. The activity values in both waters and sediments found to be low in cool periods and increased in warm periods. Moreover, the concentrations of the elements U, Zn, and Fe were raised in water samples indicating possible pollution as well as the CFs and PLI denoted accumulation in the sediments and moderate to severe contamination for Zn and Cr in some cases.

Evaluation of neutron flux parameters in irradiation sites of research reactor using the Westcott-formalism for the k0 neutron activation analysis method

NASA Astrophysics Data System (ADS)

Kasban, H.; Hamid, Ashraf

2015-12-01

Instrumental Neutron Activation Analysis using k0 (k0-INAA) method has been used to determine a number of elements in sediment samples collected from El-Manzala Lake in Egypt. k0-INAA according to Westcott's formalism has been implemented using the complete irradiation kit of the fast pneumatic rabbit and some selected manually loaded irradiation sites for short and long irradiation at Egypt Second Research Reactor (ETRR-2). Zr-Au and Co sets as neutron flux monitors are used to determine the neutron flux parameters (f and α) in each irradiation sites. Two reference materials IAEA Soil-7 samples have been inserted and implemented for data validation and an internal monostandard multi monitor used (k0 based IM-NAA). It was given a good agreement between the experimental analyzed values and that obtained of the certified values. The major and trace elements in the sediment samples have been evaluated with the use of Co as an internal and Au as an external monostandard comparators. The concentrations of the elements (Cr, Mn and Zn) in the sediment samples of the present work are discussed regarding to those obtained from other sites.

Occipital Alpha and Gamma Oscillations Support Complementary Mechanisms for Processing Stimulus Value Associations.

PubMed

Marshall, Tom R; den Boer, Sebastiaan; Cools, Roshan; Jensen, Ole; Fallon, Sean James; Zumer, Johanna M

2018-01-01

Selective attention is reflected neurally in changes in the power of posterior neural oscillations in the alpha (8-12 Hz) and gamma (40-100 Hz) bands. Although a neural mechanism that allows relevant information to be selectively processed has its advantages, it may lead to lucrative or dangerous information going unnoticed. Neural systems are also in place for processing rewarding and punishing information. Here, we examine the interaction between selective attention (left vs. right) and stimulus's learned value associations (neutral, punished, or rewarded) and how they compete for control of posterior neural oscillations. We found that both attention and stimulus-value associations influenced neural oscillations. Whereas selective attention had comparable effects on alpha and gamma oscillations, value associations had dissociable effects on these neural markers of attention. Salient targets (associated with positive and negative outcomes) hijacked changes in alpha power-increasing hemispheric alpha lateralization when salient targets were attended, decreasing it when they were being ignored. In contrast, hemispheric gamma-band lateralization was specifically abolished by negative distractors. Source analysis indicated occipital generators of both attentional and value effects. Thus, posterior cortical oscillations support both the ability to selectively attend while at the same time retaining the ability to remain sensitive to valuable features in the environment. Moreover, the versatility of our attentional system to respond separately to salient from merely positively valued stimuli appears to be carried out by separate neural processes reflected in different frequency bands.

Interleukin-5 regulates genes involved in B-cell terminal maturation.

PubMed

Horikawa, Keisuke; Takatsu, Kiyoshi

2006-08-01

Interleukin (IL)-5 induces CD38-activated splenic B cells to differentiate into immunoglobulin M-secreting cells and undergo micro to gamma 1 class switch recombination (CSR) at the DNA level, resulting in immunoglobulin G1 (IgG1) production. Interestingly, IL-4, a well-known IgG1-inducing factor does not induce immunoglobulin production or micro to gamma 1 CSR in CD38-activated B cells. In the present study, we implemented complementary DNA microarrays to investigate the contribution of IL-5-induced gene expression in CD38-stimulated B cells to immunoglobulin-secreting cell differentiation and micro to gamma 1 CSR. IL-5 and IL-4 stimulation of CD38-activated B cells induced the expression of 418 and 289 genes, respectively, that consisted of several clusters. Surprisingly, IL-5-inducible 78 genes were redundantly regulated by IL-4. IL-5 and IL-4 also suppressed the gene expression of 319 and 325 genes, respectively, 97 of which were overlapped. Genes critically regulated by IL-5 include immunoglobulin-related genes such as J chain and immunoglobulinkappa, and genes involved in B-cell maturation such as BCL6, activation-induced cytidine deaminase (Aid) and B lymphocyte-induced maturation protein-1 (Blimp-1) and tend to be induced slowly after IL-5 stimulation. Intriguingly, among genes, the retroviral induction of Blimp-1 and Aid in CD38-activated B cells could induce IL-4-dependent maturation to Syndecan-1+ antibody-secreting cells and micro to gamma 1 CSR, respectively, in CD38-activated B cells. Taken together, preferential Aid and Blimp-1 expression plays a critical role in IL-5-induced immunoglobulin-secreting cell differentiation and micro to gamma 1 CSR in CD38-activated B cells.

Probing Millisecond Pulsar Emission Geometry Using Light Curves From the Fermi Large Area Telescope

NASA Technical Reports Server (NTRS)

Venter, Christo; Harding, Alice; Guillemot, L.

2009-01-01

An interesting new high-energy pulsar sub-population is emerging following early discoveries of gamma-ray millisecond pulsars (MSPs) by the Fermi Large Area Telescope (LAT). We present results from 3D emission modeling, including the Special Relativistic effects of aberration and time-of-flight delays and also rotational sweepback of 13-field lines, in the geometric context of polar cap (PC), slot gap (SG), outer gap (OG), and two-pole caustic (TPC) pulsar models. In contrast to the general belief that these very old, rapidly-rotating neutron stars (NSs) should have largely pair-starved magnetospheres due to the absence of significant pair production, we find that most of the light curves are best fit by SG and OG models, which indicates the presence of narrow accelerating gaps limited by robust pair production -- even in these pulsars with very low spin-down luminosities. The gamma-ray pulse shapes and relative phase lags with respect to the radio pulses point to high-altitude emission being dominant for all geometries. We also find exclusive differentiation of the current gamma-ray MSP population into two MSP sub-classes: light curve shapes and lags across wavebands impose either pair-starved PC (PSPC) or SG / OG-type geometries. In the first case, the radio pulse has a small lag with respect to the single gamma-ray pulse, while the (first) gamma-ray peak usually trails the radio by a large phase offset in the latter case. Finally, we find that the flux correction factor as a function of magnetic inclination and observer angles is typically of order unity for all models. Our calculation of light curves and flux correction factor f(_, _, P) for the case of MSPs is therefore complementary to the "ATLAS paper" of Watters et al. for younger pulsars.

CMOS image sensor for detection of interferon gamma protein interaction as a point-of-care approach.

PubMed

Marimuthu, Mohana; Kandasamy, Karthikeyan; Ahn, Chang Geun; Sung, Gun Yong; Kim, Min-Gon; Kim, Sanghyo

2011-09-01

Complementary metal oxide semiconductor (CMOS)-based image sensors have received increased attention owing to the possibility of incorporating them into portable diagnostic devices. The present research examined the efficiency and sensitivity of a CMOS image sensor for the detection of antigen-antibody interactions involving interferon gamma protein without the aid of expensive instruments. The highest detection sensitivity of about 1 fg/ml primary antibody was achieved simply by a transmission mechanism. When photons are prevented from hitting the sensor surface, a reduction in digital output occurs in which the number of photons hitting the sensor surface is approximately proportional to the digital number. Nanoscale variation in substrate thickness after protein binding can be detected with high sensitivity by the CMOS image sensor. Therefore, this technique can be easily applied to smartphones or any clinical diagnostic devices for the detection of several biological entities, with high impact on the development of point-of-care applications.

Assessment of corneal properties based on statistical modeling of OCT speckle.

PubMed

Jesus, Danilo A; Iskander, D Robert

2017-01-01

A new approach to assess the properties of the corneal micro-structure in vivo based on the statistical modeling of speckle obtained from Optical Coherence Tomography (OCT) is presented. A number of statistical models were proposed to fit the corneal speckle data obtained from OCT raw image. Short-term changes in corneal properties were studied by inducing corneal swelling whereas age-related changes were observed analyzing data of sixty-five subjects aged between twenty-four and seventy-three years. Generalized Gamma distribution has shown to be the best model, in terms of the Akaike's Information Criterion, to fit the OCT corneal speckle. Its parameters have shown statistically significant differences (Kruskal-Wallis, p < 0.001) for short and age-related corneal changes. In addition, it was observed that age-related changes influence the corneal biomechanical behaviour when corneal swelling is induced. This study shows that Generalized Gamma distribution can be utilized to modeling corneal speckle in OCT in vivo providing complementary quantified information where micro-structure of corneal tissue is of essence.

Multi-Messenger Astronomy and Dark Matter

NASA Astrophysics Data System (ADS)

Bergström, Lars

This chapter presents the elaborated lecture notes on Multi-Messenger Astronomy and Dark Matter given by Lars Bergström at the 40th Saas-Fee Advanced Course on "Astrophysics at Very High Energies". One of the main problems of astrophysics and astro-particle physics is that the nature of dark matter remains unsolved. There are basically three complementary approaches to try to solve this problem. One is the detection of new particles with accelerators, the second is the observation of various types of messengers from radio waves to gamma-ray photons and neutrinos, and the third is the use of ingenious experiments for direct detection of dark matter particles. After giving an introduction to the particle universe, the author discusses the relic density of particles, basic cross sections for neutrinos and gamma-rays, supersymmetric dark matter, detection methods for neutralino dark matter, particular dark matter candidates, the status of dark matter detection, a detailled calculation on an hypothetical "Saas-Fee Wimp", primordial black holes, and gravitational waves.

Application of artificial neural network to search for gravitational-wave signals associated with short gamma-ray bursts

NASA Astrophysics Data System (ADS)

Kim, Kyungmin; Harry, Ian W.; Hodge, Kari A.; Kim, Young-Min; Lee, Chang-Hwan; Lee, Hyun Kyu; Oh, John J.; Oh, Sang Hoon; Son, Edwin J.

2015-12-01

We apply a machine learning algorithm, the artificial neural network, to the search for gravitational-wave signals associated with short gamma-ray bursts (GRBs). The multi-dimensional samples consisting of data corresponding to the statistical and physical quantities from the coherent search pipeline are fed into the artificial neural network to distinguish simulated gravitational-wave signals from background noise artifacts. Our result shows that the data classification efficiency at a fixed false alarm probability (FAP) is improved by the artificial neural network in comparison to the conventional detection statistic. Specifically, the distance at 50% detection probability at a fixed false positive rate is increased about 8%-14% for the considered waveform models. We also evaluate a few seconds of the gravitational-wave data segment using the trained networks and obtain the FAP. We suggest that the artificial neural network can be a complementary method to the conventional detection statistic for identifying gravitational-wave signals related to the short GRBs.

ARO - Terrestrial Research Program, Methodologies and Protocols for Characterization of Geomaterials

DTIC Science & Technology

2015-05-14

of ice involves melting, digestion, and analysis using inductively coupled plasma – mass spectrometry (ICPMS). ICP-MS analysis established elemental...4] have distinct chemical compositions. Knowledge of the chemical composition of the mineral assemblage present in a rock is critical to...activation analysis (INAA), to inductively-coupled plasma analysis and mass spectrometry (ICP & ICP-MS), mass spectrometry (MS), and laser-ablation

Occurrence modes of As, Sb, Te, Bi, Ag in sulfide assemblages of gold deposits of the Urals

NASA Astrophysics Data System (ADS)

Vikent'eva, O.; Vikentev, I.

2016-04-01

Review of occurrence modes of trace toxic elements ("potential pollutants") in ores from large gold deposits (the Urals) of different genetic types is presented. Mineral forms of these elements as well as their presence in main minerals from gold-bearing sulfide assemblages according to SEM, EPMA, INAA, ICP-MS and LA-ICP-MS are demonstrated.

Department of Defense Military Manpower Training Report, FY 1993.

DTIC Science & Technology

1992-06-01

Entrants + Graduates X Course Length^ = Load 2 1/ Training time is expressed as a fraction of a year This is the basic method for...recruiting and advertising methods , are used to attract qualified students. Scholarships are awarded to young men and women who exhibit potential ability as...data for these programs. All participants are members of the active forces. TABLE IV-IO. Training Input Output and InaA Other Enlisted

Study on the property of the production for Fengdongyan kiln in Early Ming dynasty by INAA and EDXRF

NASA Astrophysics Data System (ADS)

Li, L.; Huang, Y.; Sun, H. Y.; Yan, L. T.; Feng, S. L.; Xu, Q.; Feng, X. Q.

2016-08-01

A lot of official wares carved "Guan" or the dragon patterns were excavated on the strata of Ming dynasty of the Fengdongyan kiln site at Dayao County. The imperial porcelain was fired in Hongwu and Yongle eras. However, the emergence of this imperial porcelain has triggered academic debate about the property of Fengdongyan kiln in the Early Ming dynasty. Based on the differences of the official kiln management, some scholars have determined that the property of the production for this kiln was the civilian kiln. According to the historical textural records and typology, others preliminary confirmed that Fengdongyan kiln was the official kiln. In this paper, the elemental compositions of body and glaze in imperial and civilian porcelain are study by INAA and EDXRF for determining the property of the production for this kiln in Early Ming dynasty. After the processing of experimental data by geochemical analysis and principal component analysis, the result show that the raw materials for making body and glaze in imperial porcelain are similar with those of the civilian porcelain and the degrees of elutriation for body can be slightly different in HW-M period of Ming dynasty. The analytical results support the view that the Fengdongyan kiln is civilian not official.

The measurement of trace elements in interplanetary dust and cometary particles by ultra-high sensitivity INAA

NASA Technical Reports Server (NTRS)

Zolensky, M. E.; Lindstrom, David J.; Lindstrom, Richard M.; Lindstrom, M. M.

1989-01-01

Today the major elemental composition of interplanetary dust particles (IDPs) is routinely determined in many laboratories. These and mineralogical studies have revealed the presence of at least two major types of IDPs, chondritic and refractory. Preliminary results of a successful attempt to determine abundances of a large suite of trace elements from both chondritic and refractory IDPs are reported. The analytical procedure can be used in the grain-by-grain analysis of returned cometary samples. Chondritic and refractory IDPs are characterized by standard scanning electron microscopy and energy dispersive x ray spectroscopy (SEM-EDX) techniques. With this system, detection limits for many elements are well below picogram levels, and some approach femtogram levels. This technique is non-destructive, although some sample handling is required, so particles can be analyzed by other techniques after instrument neutron activation analysis (INAA) is completed. Data is presently being reduced from the analyses of 7 IDPs. These are U2015E10, U2015F1, W7029-A2, W7029-A3, W7013A8, LACl (all chondritic) and 705 (refractory). So far, 17 different major and trace elements were detected and measured in these particles, including rare earths and some very volatile elements (Br and Zn).

Monopole, astrophysics and cosmic ray observatory at Gran Sasso

NASA Technical Reports Server (NTRS)

Demarzo, C.; Enriquez, O.; Giglietto, N.; Posa, F.; Attolini, M.; Baldetti, F.; Giacomelli, G.; Grianti, F.; Margiotta, A.; Serra, P.

1985-01-01

A new large area detector, MACRO was approved for installation at the Gran Sasso Laboratory in Italy. The detector will be dedicated to the study of naturally penetrating radiation deep underground. It is designed with the general philosophy of covering the largest possible area with a detector having both sufficient built-in redundancy and use of complementary techniques to study very rare phenomena. The detector capabilities will include monopole investigations significantly below the Parker bound; astrophysics studies of very high energy gamma ray and neutrino point sources; cosmic ray measurements of single and multimuons; and the general observation of rare new forms of matter in the cosmic rays.

Advanced Signal Processing Analysis of Laser-Induced Breakdown Spectroscopy Data for the Discrimination of Obsidian Sources

DTIC Science & Technology

2012-02-09

different sources [12,13], but the analytical techniques needed for such analysis (XRD, INAA , & ICP-MS) are time consuming and require expensive...partial least-squares discriminant analysis (PLSDA) that used the SIMPLS solving method [33]. In the experi- ment design, a leave-one-sample-out (LOSO) para...REPORT Advanced signal processing analysis of laser-induced breakdown spectroscopy data for the discrimination of obsidian sources 14. ABSTRACT 16

Simultaneous collection of airborne particulate matter on several collection substrates with a high-volume cascade impactor

NASA Astrophysics Data System (ADS)

Chan, Y. C.; Vowles, P. D.; McTainsh, G. H.; Simpson, R. W.; Cohen, D. D.; Bailey, G. M.; McOrist, G. D.

This paper describes a method for the simultaneous collection of size-fractionated aerosol samples on several collection substrates, including glass-fibre filter, carbon tape and silver tape, with a commercially available high-volume cascade impactor. This permitted various chemical analysis procedures, including ion beam analysis (IBA), instrumental neutron activation analysis (INAA), carbon analysis and scanning electron microscopy (SEM), to be carried out on the samples.

Measuring cosmological parameters with Gamma-Ray Bursts: status and perspectives

NASA Astrophysics Data System (ADS)

Amati, L.

2017-10-01

Given their huge isotropic-equivalent radiated energies, up to more than 10^{54} erg released in a few tens of seconds, and their redshift distribution extending up to more than z = 9, Gamma-Ray Bursts (GRB) are in principle a powerful tool for measuring the geometry and expansion rate of the Universe. In the recent years, several attempts have been made to exploit the correlation between the photon energy at which the nuFnu spectrum peaks ('peak energy') and the radiated energy (or luminosity) for 'standardizing' GRBs and use them as tools (complementary to other probes like SN Ia, BAO and the CMB) for the estimate of cosmological parameters. These studies show that already with the present data set GRBs can provide a signicant and independent confirmation of Ω_{M} ˜ 0.3 for a flat ΛCDM universe and that the measurements expected from present and next GRB experiments (e.g. Swift, Fermi/GBM, SVOM, CALET/GBM, UFFO) will allow us to substantially improve the constraints on Ω_{M} and Ω_{Λ}, and, in particular, to get unique clues on dark energy properties and evolution.

Assessment of corneal properties based on statistical modeling of OCT speckle

PubMed Central

Jesus, Danilo A.; Iskander, D. Robert

2016-01-01

A new approach to assess the properties of the corneal micro-structure in vivo based on the statistical modeling of speckle obtained from Optical Coherence Tomography (OCT) is presented. A number of statistical models were proposed to fit the corneal speckle data obtained from OCT raw image. Short-term changes in corneal properties were studied by inducing corneal swelling whereas age-related changes were observed analyzing data of sixty-five subjects aged between twenty-four and seventy-three years. Generalized Gamma distribution has shown to be the best model, in terms of the Akaike’s Information Criterion, to fit the OCT corneal speckle. Its parameters have shown statistically significant differences (Kruskal-Wallis, p < 0.001) for short and age-related corneal changes. In addition, it was observed that age-related changes influence the corneal biomechanical behaviour when corneal swelling is induced. This study shows that Generalized Gamma distribution can be utilized to modeling corneal speckle in OCT in vivo providing complementary quantified information where micro-structure of corneal tissue is of essence. PMID:28101409

Extended q -Gaussian and q -exponential distributions from gamma random variables

NASA Astrophysics Data System (ADS)

Budini, Adrián A.

2015-05-01

The family of q -Gaussian and q -exponential probability densities fit the statistical behavior of diverse complex self-similar nonequilibrium systems. These distributions, independently of the underlying dynamics, can rigorously be obtained by maximizing Tsallis "nonextensive" entropy under appropriate constraints, as well as from superstatistical models. In this paper we provide an alternative and complementary scheme for deriving these objects. We show that q -Gaussian and q -exponential random variables can always be expressed as a function of two statistically independent gamma random variables with the same scale parameter. Their shape index determines the complexity q parameter. This result also allows us to define an extended family of asymmetric q -Gaussian and modified q -exponential densities, which reduce to the standard ones when the shape parameters are the same. Furthermore, we demonstrate that a simple change of variables always allows relating any of these distributions with a beta stochastic variable. The extended distributions are applied in the statistical description of different complex dynamics such as log-return signals in financial markets and motion of point defects in a fluid flow.

Assessment of dry and wet atmospheric deposits of radioactive aerosols: application to Fukushima radiocaesium fallout.

PubMed

Gonze, Marc-André; Renaud, Philippe; Korsakissok, Irène; Kato, Hiroaki; Hinton, Thomas G; Mourlon, Christophe; Simon-Cornu, Marie

2014-10-07

The Fukushima Dai-ichi nuclear accident led to massive atmospheric deposition of radioactive substances onto the land surfaces. The spatial distribution of deposits has been estimated by Japanese authorities for gamma-emitting radionuclides through either airborne monitoring surveys (since April 2011) or in situ gamma-ray spectrometry of bare soil areas (since summer 2011). We demonstrate that significant differences exist between the two surveys for radiocaesium isotopes and that these differences can be related to dry deposits through the use of physically based relationships involving aerosol deposition velocities. The methodology, which has been applied to cesium-134 and cesium-137 deposits within 80-km of the nuclear site, provides reasonable spatial estimations of dry and wet deposits that are discussed and compared to atmospheric numerical simulations from the Japanese Atomic Energy Agency and the French Institute of Radioprotection and Nuclear Safety. As a complementary approach to numerical simulations, this field-based analysis has the possibility to contribute information that can be applied to the understanding and assessment of dose impacts to human populations and the environment around Fukushima.

Nuclear Science and Applications with the Next Generation of High-Power Lasers and Brilliant Low-Energy Gamma Beams at ELI-NP

NASA Astrophysics Data System (ADS)

Gales, S.

The development of high power lasers and the combination of such novel devices with accelerator technology has enlarged the science reach of many research fields, in particular Particle and Nuclear Physics, Astrophysics as well as societal applications in Material Science, Nuclear Energy and Medicine. The European Strategic Forum for Research Infrastructures (ESFRI) has selected a proposal based on these new premises called "ELI" for Extreme Light Infrastructure. ELI will be built as a network of three complementary pillars at the frontier of laser technologies. The ELI-NP pillar (NP for Nuclear Physics) is under construction near Bucharest (Romania) and will develop a scientific program using two 10 PW lasers and a Compton back-scattering high-brilliance and intense low-energy gamma beam, a marriage of laser and accelerator technology at the frontier of knowledge. In the present paper, the technical description of the facility, the present status of the project as well as the science, applications and future perspectives will be discussed.

Nuclear Science and Applications with the Next Generation of High-Power Lasers and Brilliant Low-Energy Gamma Beams at ELI-NP

NASA Astrophysics Data System (ADS)

Gales, S.

2015-11-01

The development of high-power lasers and the combination of such novel devices with accelerator technology has enlarged the science reach of many research fields, in particular high-energy nuclear physics and astrophysics, as well as societal applications in material science, nuclear energy and medicine. The European Strategic Forum for Research Infrastructures (ESFRI) has selected a proposal based on these new premises called "ELI" for Extreme Light Infrastructure. ELI will be built as a network of three complementary pillars at the frontier of laser technologies. The ELI-NP pillar (NP for nuclear physics) is under construction near Bucharest (Romania) and will develop a scientific program using two 10-PW lasers and a Compton back-scattering high-brilliance and intense low-energy gamma beam, a marriage of laser and accelerator technology at the frontier of knowledge. In the present paper, the technical description of the facility, the present status of the project as well as the science, applications and future perspectives will be discussed.

Nonthermal processes around collapsed objects: High energy gamma ray sources in the radio sky

NASA Technical Reports Server (NTRS)

Helfand, David J.; Ruderman, Malvin; Applegate, James H.; Becker, Robert H.

1993-01-01

In our proposal responding to the initial Guest Observer NRA for the Compton Gamma Ray Observatory, 'Nonthermal Processes Around Collapsed Objects: High Energy Gamma Ray Sources in the Radio Sky', we stated that 'At high energies - the identity of the principal Galactic source population remains unknown' although the 'one certain source of high energy emission is young radio pulsars'. These two statements remain true, although at this writing, eighteen months after the beginning of the Compton allsky survey, much of the gamma-ray data required to greatly extend our knowledge of the Galaxy's high energy emission has been collected. The thrust of the program supported by our grant was to collect and analyze a complementary set of data on the Milky Way at radio wavelengths in order to help identify the dominant Pop 1 component of the Galaxy's gamma ray sources, and to pursue theoretical investigations on the origins and emission mechanisms of young pulsars, the one component of this population identified to date. We summarize here our accomplishments under the grant. In Section 2, we describe our VLA surveys of the Galactic Plane along with the current status of the radio source catalogs derived therefrom; unfortunately, owing to the TDRSS antenna problem and subsequent extension of the Sky Survey, we were not able to carry out a comparison with the EGRET data directly, although everything is now in place to do so as soon as it becomes available. In Section 2, we summarize our progress on the theoretical side, including the substantial completion of a dissertation on pulsar origins and work on the high energy emission mechanisms of isolated pulsars. We list the personnel supported by the grant in section 4 and provide a complete bibliography of publications supported in whole or in part by the grant in the final section.

Geochemistry at 4 Vesta: Observations Using Fast Neutrons

NASA Technical Reports Server (NTRS)

Lawrence, David J.; Prettyman, Thomas H.; Feldman, William C.; Bazell, David; Mittlefehldt, David W.; Peplowski, Patrick N.; Reedy, Robert C.

2012-01-01

Dawn is currently in orbit around the asteroid 4 Vesta, and one of the major objectives of the mission is to probe the relationship of Vesta to the Howardite, Eucrite, and Diogenite (HED) meteorites. As Vesta is an example of a differentiated planetary embryo, Dawn will also provide fundamental information about planetary evolution in the early solar system [1]. To help accomplish this overall goal, the Dawn spacecraft carries the Gamma-Ray and Neutron Detector (GRaND). GRaND uses planetary gamma-ray and neutron spectroscopy to measure the surface elemental composition of Vesta and will provide information that is unique and complementary to that provided by the other Dawn instruments and investigations. Gamma-ray and neutron spectroscopy is a standard technique for measuring planetary compositions [2], having successfully made measurements at near-Earth asteroids, the Moon, Mars, Mercury and now Vesta. GRaND has made the first measurements of the neutron spectrum from any asteroid (previous asteroid measurements were only made with gamma-rays). Dawn has been collecting data at Vesta since July 2011. The prime data collection period for GRaND is the Low-Altitude Mapping Orbit (LAMO), which started on 12 December 2011 and will last through spring 2012. During LAMO, the Dawn spacecraft orbits at an average altitude of 210 km above the surface of Vesta, which allows good neutron and gamma-ray signals to be detected from Vesta. A description of the overall goals of GRaND and a summary of the initial findings are given elsewhere [3,4]. The subject of this study is to present the information that will be returned from GRaND using fast neutron measurements. Here, we discuss what fast neutrons can reveal about Vesta s surface composition, how such data can address Dawn science goals, and describe fast neutron measurements made in the early portion of the Vesta LAMO phase.

Modeling of Hurricane Impacts

DTIC Science & Technology

2007-12-21

2.4 Implementation of non-uniform gridsize The numerical method has been extended to allow non-uniform gridsizes in x and y direction, though the...and the vertical excursion of the swash motion A is expressed as 0.125 / 0 inaA sT g h π = . Figure 3 and 4 compare the XBeach results with the...A. Van Gent, A. J. H. M. Reniers, and D. J. R. Walstra (2008), Analysis of dune erosion processes in large scale flume experiments, submitted to

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loyalka, Sudarshan

High and Very High Temperatures Gas Reactors (HTGRs/VHTRs) have five barriers to fission product (FP) release: the TRISO fuel coating, the fuel elements, the core graphite, the primary coolant system, and the reactor building. This project focused on measurements and computations of FP diffusion in graphite, FP adsorption on graphite and FP interactions with dust particles of arbitrary shape. Diffusion Coefficients of Cs and Iodine in two nuclear graphite were obtained by the release method and use of Inductively Coupled Plasma-Mass Spectroscopy (ICP-MS) and Instrumented Neutron Activation Analysis (INAA). A new mathematical model for fission gas release from nuclear fuelmore » was also developed. Several techniques were explored to measure adsorption isotherms, notably a Knudsen Effusion Mass Spectrometer (KEMS) and Instrumented Neutron Activation Analysis (INAA). Some of these measurements are still in progress. The results will be reported in a supplemental report later. Studies of FP interactions with dust and shape factors for both chain-like particles and agglomerates over a wide size range were obtained through solutions of the diffusion and transport equations. The Green's Function Method for diffusion and Monte Carlo technique for transport were used, and it was found that the shape factors are sensitive to the particle arrangements, and that diffusion and transport of FPs can be hindered. Several journal articles relating to the above work have been published, and more are in submission and preparation.« less

Data evaluation of trace elements determined in Nigerian coal using cluster procedures.

PubMed

Ewa, I O B

2004-05-01

Large data-sets of elements determined by instrumental neutron activation analysis (INAA) require meaningful interpretation in order to determine the pattern of their existence in host matrices. This could be achieved using cluster procedures. Element abundances (Al, As, Ba, Br, Ca, Ce, Cs, Dy, Eu, Fe, Ga, Gd, Hf, K, La, Lu, Mg, Mn, Na, O, Rb, Sb, Sc, Sm, Sr, Ta, Tb, Th, Ti, U, V, Yb, Zn and Zr) of prepared and run-of-mine coals from eight principal mines (Onyeama, Ogbete, Enugu, Gombe, Asaba-Ugwashi, Okaba, Afikpo and Lafia ) in Nigeria were determined by INAA. Quality control of the measurements was assured by the re-determination of a standard reference material, NIST 1632a. These data-sets were then tested for multi-variate statistics using METHOD = SINGLE in the cluster procedure. The computer-assisted package SAS was used to generate the dendrograms while the algorithm used was stored Euclidean distances. The results showed a recognition pattern, useful for the interpretation of coalification histories and the prediction of fuel ranking for Nigerian coals. High segregation of coal fly ash was observed, while metallurgical coal grouped together with high-ranking coals of Okaba, Enugu and Obi (Lafia). Further work revealed some of these coals as having high gross calorific value (7908 kcal kg(-1) for Enugu coal; 7200 kcal kg(-1) for Okaba) and low sulphur thereby making them efficient fuel materials.

Selected elements in major minerals from bituminous coal as determined by INAA: Implications for removing environmentally sensitive elements from coal

USGS Publications Warehouse

Palmer, C.A.; Lyons, P.C.

1996-01-01

The four most abundant minerals generally found in Euramerican bituminous coals are quartz, kaolinite, illite and pyrite. These four minerals were isolated by density separation and handpicking from bituminous coal samples collected in the Ruhr Basin, Germany and the Appalachian basin, U.S.A. Trace-element concentrations of relatively pure (??? 99+%) separates of major minerals from these coals were determined directly by using instrumental neutron activation analysis (INAA). As expected, quartz contributes little to the trace-element mass balance. Illite generally has higher trace-element concentrations than kaolinite, but, for the concentrates analyzed in this study, Hf, Ta, W, Th and U are in lower concentrations in illite than in kaolinite. Pyrite has higher concentrations of chalcophile elements (e.g., As and Se) and is considerably lower in lithophile elements as compared to kaolinite and illite. Our study provides a direct and sensitive method of determining trace-element relationships with minerals in coal. Mass-balance calculations suggest that the trace-element content of coal can be explained mainly by three major minerals: pyrite, kaolinite and illite. This conclusion indicates that the size and textural relationships of these major coal minerals may be a more important consideration as to whether coal cleaning can effectively remove the most environmentally sensitive trace elements in coal than what trace minerals are present.

A new method for geochemical characterization of atmospheric mineral dust from polar ice cores: preliminary results from Talos Dome ice core (East Antarctica, Pacific-Ross Sea sector)

NASA Astrophysics Data System (ADS)

Baccolo, Giovanni; Delmonte, Barbara; Clemenza, Massimiliano; Previtali, Ezio; Maggi, Valter

2015-04-01

Assessing the elemental composition of atmospheric dust entrapped in polar ice cores is important for the identification of the potential dust sources and thus for the reconstruction of past atmospheric circulation, at local, regional and global scale. Accurate determination of major and trace elements in the insoluble fraction of dust extracted from ice cores is also useful to better understand some geochemical and biogeochemical mechanisms which are linked with the climate system. The extremely reduced concentration of dust in polar ice (typical Antarctic concentrations during interglacials are in the range of 10 ppb), the limited availability of such samples and the high risk of contamination make these analyses a challenge. A new method based on low background Instrumental Neutron Activation Analysis (INAA) was specifically developed for this kind of samples. The method allows the determination of the concentration of up to 35 elements in extremely reduced dust samples (20-30 μg). These elements span from major to trace and ultra-trace elements. Preliminary results from TALDICE (TALos Dome Ice CorE, East Antarctica, Pacific-Ross Sea Sector) ice core are presented along with results from potential source areas in Victoria Land. A set of 5 samples from Talos Dome, corresponding to the last termination, MIS3, MIS4 and MIS6 were prepared and analyzed by INAA.

Study on ancient Chinese imitated GE ware by INAA and WDXRF

NASA Astrophysics Data System (ADS)

Xie, Guoxi; Feng, Songlin; Feng, Xiangqian; Wang, Yanqing; Zhu, Jihao; Yan, Lingtong; Li, Yongqiang; Han, Hongye

2007-11-01

Imitated GE ware was one of the most famous products of Jingdezhen porcelain field in Ming dynasty (AD 1368-1644). The exterior features of its body and glaze are very marvelous. Black foot, purple mouth and crazing glaze are the main features of imitated GE ware. Until now, the key conditions of resulting these features are not clearly identified. In order to find the critical elements for firing these features, instrumental neutron activation analysis (INAA) and wavelength-dispersive X-ray fluorescence (WDXRF) were used to determine the element abundance patterns of imitated GE ware body and glaze. The experimental data was compared with that of imitated Longquan celadon and of Longquan celadon. The analytical results indicated that Fe, Ti and Na were the critical elements. The body of imitated GE ware which contains high Fe and Ti are the basic conditions of firing its black body, black foot and purple mouth. The glaze of imitated GE ware which contains high Na is the main condition of producing its crazing glaze. Na is the critical element which enlarges the difference in expansion coefficients between the glaze and body of imitated GE ware. Furthermore, Zijin soil was added into kaolin to make the body rich in Fe and Ti. And something which was rich in Na was used to produce crazing glaze in the manufacturing process of imitated GE ware.

Round-robin study of arsenic implant dose measurement in silicon by SIMS

NASA Astrophysics Data System (ADS)

Simons, D.; Kim, K.; Benbalagh, R.; Bennett, J.; Chew, A.; Gehre, D.; Hasegawa, T.; Hitzman, C.; Ko, J.; Lindstrom, R.; MacDonald, B.; Magee, C.; Montgomery, N.; Peres, P.; Ronsheim, P.; Yoshikawa, S.; Schuhmacher, M.; Stockwell, W.; Sykes, D.; Tomita, M.; Toujou, F.; Won, J.

2006-07-01

An international round-robin study was undertaken under the auspices of ISO TC201/SC6 to determine the best analytical conditions and the level of interlaboratory agreement for the determination of the implantation dose of arsenic in silicon by secondary ion mass spectrometry (SIMS). Fifteen SIMS laboratories, as well as two laboratories that performed low energy electron-induced X-ray emission spectrometry (LEXES) and one that made measurements by instrumental neutron activation analysis (INAA) were asked to determine the implanted arsenic doses in three unknown samples using as a comparator NIST Standard Reference Material ® 2134. The use of a common reference material by all laboratories resulted in better interlaboratory agreement than was seen in a previous round-robin that lacked a common comparator. The relative standard deviation among laboratories was less than 4% for the medium-dose sample, but several percent larger for the low- and high-dose samples. The high-dose sample showed a significant difference between point-by-point and average matrix normalization because the matrix signal decreased in the vicinity of the implant peak, as observed in a previous study. The dose from point-by-point normalization was in close agreement with that determined by INAA. No clear difference in measurement repeatability was seen when comparing Si 2- and Si 3- as matrix references with AsSi -.

Radiation tolerant 1 micron CMOS technology

NASA Astrophysics Data System (ADS)

Crevel, P.; Rodde, K.

1991-03-01

Starting from a standard one micron Complementary Metal Oxide Semiconductor (CMOS) for high density, low power memory applications, the degree of radiation tolerance of the baseline process is evaluated. Implemented process modifications to improve latchup sensitivity under heavy ion irradiation as well as total dose effects without changing layout rules are described. By changing doping profiles in Metal Nitride Oxide Semiconductors (MNOS) and P-channel MOS (PMOS) device regions, it is possible to guarantee data sheet specification of a 64 K low power static RAM for total gamma dose up to 35 krad (Si) (and even higher values for the gate array family) without latch up for Linear Energy Transfer LET up to 115 MeV/(mg/cm squared).

Implementation status of the extreme light infrastructure - nuclear physics (ELI-NP) project

NASA Astrophysics Data System (ADS)

Gales, S.; Zamfir, N. V.

2015-02-01

The Project Extreme Light Infrastructure (ELI) is part of the European Strategic Forum for Research Infrastructures (ESFRI) Roadmap. ELI will be built as a network of three complementary pillars at the frontier of laser technologies. The ELI-NP pillar (NP for Nuclear Physics) is under construction near Bucharest (Romania) and will develop a scientific program using two 10 PW lasers and a Compton back-scattering high-brilliance and intense gamma beam, a marriage of laser and accelerator technology at the frontier of knowledge. In the present paper, the technical description of the facility, the present status of the project as well as the science, applications and future perspectives will be discussed.

Environmental impacts of cooling system on Abou Qir Bay.

PubMed

Mohamed, Manal A; Abd-Elaty, Magda M; El-Shall, Wafaa I; Ramadan, Abou Bakr; Tawfik, Mohamed S

2005-01-01

This study was conducted to evaluate the impacts of cooling water on cooling system of Abou Qir Power Plant and on the receiving Abou Qir Bay. Abou Qir Power Plant is a conventional steam electric power plant located in Alexandria Governorate, Egypt. Water and biota samples were collected monthly from cooling water and Abou Qir Bay over a year. Heavy metals, radionuclide, anions and total hydrocarbons were analyzed in the samples using Instrumental Neutron Activation Analysis (INAA), Gamma-ray Spectrometry (GS), Ion Selective Electrodes (ISE) and Gas Chromatography (GC). The results revealed that the characteristics of inlet cooling water had a tendency to be corrosive to the cooling system. The outlet cooling water complied with Environmental Law 4/1994 in all measured parameters except phosphate, ammonia and total petroleum hydrocarbons. On the other hand, samples from all sites had the lowest annual total count of algae in winter and highest count during summer. There are -ve correlations between algae and heavy metals, hydrocarbons, and radioactivity. Algae correlated highly significantly (p<0.01) with Pb, Cu, Ni, total petroleum hydrocarbons, dissolved petroleum hydrocarbon and uranium. Anabaena Sp. (blue green algae) and Euglina Sp.(flagellate) had highly significant (p<0.01) -ve correlation with heavy metals and natural radioactivity. The accumulation percentage of heavy metals by algae ranged from 22% to 37%, and the highest percent was for uranium and the lowest was for chromium. It is recommended to optimize the addition of polyphosphate inhibitor at inlet cooling water to inhibit corrosion in the cooling system and to avoid increase of Anabaena Sp. in the outlet, and to avoid enhancing algae growth that has a great tendency to accumulate heavy metals, and good housekeeping to avoid oil spills containing hydrocarbons from the power plant to sea water.

National Dam Safety Program. Watchung Lake Dam (NJ00767), Raritan River Basin, Stony Brook, Somerset County, New Jersey Phase I Inspection Report.

DTIC Science & Technology

1981-07-01

Safety Program Erosion Embankmients Watchung Lake Dam, N.J. Visual InspectionSeae IStructural Analysis Spillways 12M~ A0ST Acr (cathiue samvwgip @ta N...determined by a qualified professional consultant engaged by the owner using more sophisticated methods , procedures and studies within six months...be overtopped. (The SDF, in this instance, is one half of the Probable Maximum Flood). The decision to consider the spillway " inaae - quate" instead of

Development of neutron imaging beamline for NDT applications at Dhruva reactor, India

NASA Astrophysics Data System (ADS)

Shukla, Mayank; Roy, Tushar; Kashyap, Yogesh; Shukla, Shefali; Singh, Prashant; Ravi, Baribaddala; Patel, Tarun; Gadkari, S. C.

2018-05-01

Thermal neutron imaging techniques such as radiography or tomography are very useful tool for various scientific investigations and industrial applications. Neutron radiography is complementary to X-ray radiography, as neutrons interact with nucleus as compared to X-ray interaction with orbital electrons. We present here design and development of a neutron imaging beamline at 100 MW Dhruva research reactor for neutron imaging applications such as radiography, tomography and phase contrast imaging. Combinations of sapphire and bismuth single crystals have been used as thermal neutron filter/gamma absorber at the input of a specially designed collimator to maximize thermal neutron to gamma ratio. The maximum beam size of neutrons has been restricted to ∼120 mm diameter at the sample position. A cadmium ratio of ∼250 with L / D ratio of 160 and thermal neutron flux of ∼ 4 × 107 n/cm2 s at the sample position has been measured. In this paper, different aspects of the beamline design such as collimator, shielding, sample manipulator, digital imaging system are described. Nondestructive radiography/tomography experiments on hydrogen concentration in Zr-alloy, aluminium foam, ceramic metal seals etc. are also presented.

Chemical elements in common vegetable components of Portuguese diets, determined by k0-INAA

NASA Astrophysics Data System (ADS)

Pacheco, A. M. G.; Freitas, M. C.; Ventura, M. G.; Dionísio, I.; Ermakova, E.

2006-08-01

Vegetables play an important role in national diets, as a side dish to many a main-course fare the whole year round, and, especially in what concerns raw lettuce and tomato, with a higher seasonal rate of consumption during summer months, as associated to the traditional charcoal-grilled sardines. In March 2004, lettuces, tomatoes, carrots and cabbages of Portuguese origin (except for the carrots from one site) were purchased from large commercial areas or central markets of two central and southern regional hubs, respectively Coimbra and Évora. Even if from different growers, all vegetables had come from horticultural plots in the same general area of western Portugal, north of Lisboa. For lettuce plants, the inner leaves were separated from the external ones and processed as different samples for further analysis. In this work, the reactor and detector parameters were re-evaluated for the new IAEA k0-INAA software. Quality assessment was obtained through analysis of IAEA-359 (cabbage material) and BCR-679 (Bowen's kale). Traces of hazardous elements—namely, antimony, arsenic and bromine—could be found throughout, and, for lettuce samples, the overall results indicate that outer leaves feature higher concentrations than inner ones. Interestingly enough, vegetables from Coimbra and Évora appeared to differ from each other in their elemental levels, even if originally grown at relatively close range. Concentrations of trace elements are compared to available data from other countries' cultivars.

Heterogeneity in small aliquots of Apolllo 15 olivine-normative basalt: Implications for breccia clast studies

NASA Astrophysics Data System (ADS)

Lindstrom, Marilyn M.; Shervais, John W.; Vetter, Scott K.

1993-05-01

Most of the recent advances in lunar petrology are the direct result of breccia pull-apart studies, which have identified a wide array of new highland and mare basalt rock types that occur only as clasts within the breccias. These rocks show that the lunar crust is far more complex than suspected previously, and that processes such as magma mixing and wall-rock assimilation were important in its petrogenesis. These studies are based on the implicit assumption that the breccia clasts, which range in size from a few mm to several cm across, are representative of the parent rock from which they were derived. In many cases, the aliquot allocated for analysis may be only a few grain diameters across. While this problem is most acute for coarse-grained highland rocks, it can also cause considerable uncertainty in the analysis of mare basalt clasts. Similar problems arise with small aliquots of individual hand samples. Our study of sample heterogeneity in 9 samples of Apollo 15 olivine normative basalt (ONB) which exhibit a range in average grain size from coarse to fine are reported. Seven of these samples have not been analyzed previously, one has been analyzed by INAA only, and one has been analyzed by XRF+INAA. Our goal is to assess the effects of small aliquot size on the bulk chemistry of large mare basalt samples, and to extend this assessment to analyses of small breccia clasts.

Heterogeneity in small aliquots of Apolllo 15 olivine-normative basalt: Implications for breccia clast studies

NASA Technical Reports Server (NTRS)

Lindstrom, Marilyn M.; Shervais, John W.; Vetter, Scott K.

1993-01-01

Most of the recent advances in lunar petrology are the direct result of breccia pull-apart studies, which have identified a wide array of new highland and mare basalt rock types that occur only as clasts within the breccias. These rocks show that the lunar crust is far more complex than suspected previously, and that processes such as magma mixing and wall-rock assimilation were important in its petrogenesis. These studies are based on the implicit assumption that the breccia clasts, which range in size from a few mm to several cm across, are representative of the parent rock from which they were derived. In many cases, the aliquot allocated for analysis may be only a few grain diameters across. While this problem is most acute for coarse-grained highland rocks, it can also cause considerable uncertainty in the analysis of mare basalt clasts. Similar problems arise with small aliquots of individual hand samples. Our study of sample heterogeneity in 9 samples of Apollo 15 olivine normative basalt (ONB) which exhibit a range in average grain size from coarse to fine are reported. Seven of these samples have not been analyzed previously, one has been analyzed by INAA only, and one has been analyzed by XRF+INAA. Our goal is to assess the effects of small aliquot size on the bulk chemistry of large mare basalt samples, and to extend this assessment to analyses of small breccia clasts.

A provenance study of iron archaeological artefacts by Inductively Coupled Plasma-Mass Spectrometry multi-elemental analysis

NASA Astrophysics Data System (ADS)

Desaulty, Anne-Marie; Mariet, Clarisse; Dillmann, Philippe; Joron, Jean Louis; Fluzin, Philippe

2008-11-01

Raw materials and wastes (i.e. ore, slag and laitier) from ironmaking archaeological sites have been analyzed in order to understand the behavior of the trace elements in the ancient ironmaking processes and to find the significant-most elements to characterize an iron making region. The ICP-MS (Inductively Coupled Plasma Mass Spectrometry) appears to be an excellent technique for this type of studies. The comparison between the ICP-MS results obtained with the Standard Addition method and the INAA (Instrumental Neutron Activation Analyses) results proved that Sc, Co, (Ni), Rb, Cs, Ba, La, Ce, Sm, Eu, Yb, Hf, Th, U contents in the ores, slag and laitiers, and Co and Ni contents in the cast iron can be successfully determined by ICP-MS after wet acid digestion (low detection limits, good sensitivity and precision). By using significant trace element pairs (Yb/Ce, Ce/Th, La/Sc, U/Th, Nb/Y) present in the ores, laitiers and slag, it is possible to discriminate different French ironmaking regions as the Pays de Bray, Lorraine and Pays d'Ouche. These results open the way to further studies on the provenance of iron objects. The comparison between the ICP-MS results obtained with the Standard Calibration Curves method and the INAA results shows that matrices rich in iron, affect the ICP-MS analyses by suppressing the analytes signal. Further studies are necessary to improve understanding matrix effects.

Possible impact-induced refractory-lithophile fractionations in EL chondrites

NASA Astrophysics Data System (ADS)

Rubin, Alan E.; Huber, Heinz; Wasson, John T.

2009-03-01

Literature data show that refractory-lithophile elements in most chondrite groups are unfractionated relative to CI chondrites; the principal exception is the EL-chondrite group whose observed falls (all of which are type 6) are depleted in Ca and light REE. In contrast, literature data and our new INAA data on EL3 PCA 91020, EL3 MAC 88136 and EL4 Grein 002 show that some replicates of these samples have nearly flat REE patterns (unlike those of EL6 chondrites); other replicates exhibit fractionated REE patterns similar to those of EL6 chondrites. Petrographic examination shows that many EL6 (and some EL3 and EL4) chondrites are impact-melt breccias or contain impact-melted portions. We suggest that the same impact processes that formed these breccias and produced melt are responsible for the observed bulk compositional fractionations in refractory-lithophile elements, i.e., EL6 chondrites were produced from initially unequilibrated EL3 material. When large amounts of impact heat were deposited, plagioclase and/or oldhamite (CaS) (the major REE carriers in enstatite chondrites) may have been melted and then transported appreciable (>10 cm) distances. EL6 chondrites represent the residuum that is depleted in REE (particularly in LREE) and Ca. Unlike the case for EL chondrites, our new INAA data on ALH 84170, EET 87746 and SAH 97096 (all EH3) show some scatter but are consistent with the EH group having uniform refractory-lithophile abundances.

Neutron Activation Analysis of Single Grains Recovered by the Hayabusa Spacecraft

NASA Technical Reports Server (NTRS)

Ebihara, M.; Sekimoto, S.; Hamajima, Y.; Yamamoto, M.; Kumagai, K.; Oura, Y.; Shirai, N.; Ireland. T. R.; Kitajima, F.; Nagao, K.;

Improving the {sup 33}S(p,{gamma}){sup 34}Cl Reaction Rate for Models of Classical Nova Explosions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parikh, A.; Faestermann, Th.; Kruecken, R.

2011-10-28

Reduced uncertainty in the thermonuclear rate of the {sup 33}S(p,{gamma}){sup 34}Cl reaction would help to improve our understanding of nucleosynthesis in classical nova explosions. At present, models are generally in concordance with observations that nuclei up to roughly the calcium region may be produced in these explosive phenomena; better knowledge of this rate would help with the quantitative interpretation of nova observations over the S-Ca mass region, and contribute towards the firm establishment of a nucleosynthetic endpoint. As well, models find that the ejecta of nova explosions on massive oxygen-neon white dwarfs may contain as much as 150 times themore » solar abundance of {sup 33}S. This characteristic isotopic signature of a nova explosion could possibly be observed through the analysis of microscopic grains formed in the environment surrounding a nova and later embedded within primitive meteorites. An improved {sup 33}S(p,{gamma}){sup 34}Cl rate (the principal destruction mechanism for {sup 33}S in novae) would help to ensure a robust model prediction for the amount of {sup 33}S that may be produced. Finally, constraining this rate could confirm or rule out the decay of an isomeric state of {sup 34}Cl(E{sub x} = 146 keV, t{sub 1/2} = 32 m) as a source for observable gamma-rays from novae. We have performed several complementary experiments dedicated to improving our knowledge of the {sup 33}S(p,{gamma}){sup 34}Cl rate, using both indirect methods (measurement of the {sup 34}S({sup 3}He,t){sup 34}Cl and {sup 33}S({sup 3}He,d){sup 34}Cl reactions with the Munich Q3D spectrograph) and direct methods (in normal kinematics at CENPA, University of Washington, and in inverse kinematics with the DRAGON recoil mass separator at TRIUMF). Our results will be used with nova models to facilitate comparisons of model predictions with present and future nova observables.« less

MCNP Simulations of Measurement of Insulation Compaction in the Cryogenic Rocket Fuel Tanks at Kennedy Space Center by Fast/Thermal Neutron Techniques

NASA Technical Reports Server (NTRS)

Livingston, R. A.; Schweitzer, J. S.; Parsons, A. M.; Arens, E. E.

2010-01-01

MCNP simulations have been run to evaluate the feasibility of using a combination of fast and thermal neutrons as a nondestructive method to measure of the compaction of the perlite insulation in the liquid hydrogen and oxygen cryogenic storage tanks at John F. Kennedy Space Center (KSC). Perlite is a feldspathic volcanic rock made up of the major elements Si, AI, Na, K and 0 along with some water. When heated it expands from four to twenty times its original volume which makes it very useful for thermal insulation. The cryogenic tanks at Kennedy Space Center are spherical with outer diameters of 69-70 feet and lined with a layer of expanded perlite with thicknesses on the order of 120 cm. There is evidence that some of the perlite has compacted over time since the tanks were built 1965, affecting the thermal properties and possibly also the structural integrity of the tanks. With commercially available portable neutron generators it is possible to produce simultaneously fluxes of neutrons in two energy ranges: fast (14 Me V) and thermal (25 me V). The two energy ranges produce complementary information. Fast neutrons produce gamma rays by inelastic scattering, which is sensitive to Fe and O. Thermal neutrons produce gamma rays by prompt gamma neutron activation (PGNA) and this is sensitive to Si, Al, Na, K and H. The compaction of the perlite can be measured by the change in gamma ray signal strength which is proportional to the atomic number densities of the constituent elements. The MCNP simulations were made to determine the magnitude of this change. The tank wall was approximated by a I-dimensional slab geometry with an 11/16" outer carbon steel wall, an inner stainless wall and 120 cm thick perlite zone. Runs were made for cases with expanded perlite, compacted perlite or with various void fractions. Runs were also made to simulate the effect of adding a moderator. Tallies were made for decay-time analysis from t=0 to 10 ms; total detected gamma-rays; detected gamma-rays from thermal neutron reactions d. detected gamma-rays from non-thermal neutron reactions and total detected gamma-rays as a function of depth into the annulus volume. These indicated a number of possible independent metrics of perlite compaction. For example the count rate for perlite elements increased from 3600 to 8500 cps for an increase in perlite density from 6 lbs/lcf to 16.5 lbs/cf. Thus the MCNP simulations have confirmed the feasibility of using neutron methods to map the compaction of perlite in the walls of the cryogenic tanks.

Multiwavelength Opportunities for GeV and TeV Telescopes

NASA Technical Reports Server (NTRS)

Thompson, David J.

2010-01-01

With AGILE and Fermi now in orbit and TeV telescopes continuing to improve their performance, a variety of multiwavelength opportunities is increasingly available. One goal of such programs is to take advantage of the complementary capabilities of the two types of telescopes: the wide field surveys of the satellite detectors and the high sensitivity and resolution of the ground-based telescopes. Some aspects of these multiwavelength efforts will be carried out in near-real-time but must be anticipated with advance preparation. These include gamma-ray burst follow-ups and flare campaigns. Other projects such as long-term variability studies and gammaray source identification require deep observations and cooperative work with astrophysicists at longer wavelengths, along with the theoretical studies that tie the observations together.

Implementation status of the extreme light infrastructure - nuclear physics (ELI-NP) project

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gales, S., E-mail: sydney.gales@eli-np.ro; Zamfir, N. V., E-mail: sydney.gales@eli-np.ro

2015-02-24

The Project Extreme Light Infrastructure (ELI) is part of the European Strategic Forum for Research Infrastructures (ESFRI) Roadmap. ELI will be built as a network of three complementary pillars at the frontier of laser technologies. The ELI-NP pillar (NP for Nuclear Physics) is under construction near Bucharest (Romania) and will develop a scientific program using two 10 PW lasers and a Compton back-scattering high-brilliance and intense gamma beam, a marriage of laser and accelerator technology at the frontier of knowledge. In the present paper, the technical description of the facility, the present status of the project as well as themore » science, applications and future perspectives will be discussed.« less

Geology orbiter comparison study

NASA Technical Reports Server (NTRS)

Cutts, J. A. J.; Blasius, K. R.; Davis, D. R.; Pang, K. D.; Shreve, D. C.

1977-01-01

Instrument requirements of planetary geology orbiters were examined with the objective of determining the feasibility of applying standard instrument designs to a host of terrestrial targets. Within the basic discipline area of geochemistry, gamma-ray, X-ray fluorescence, and atomic spectroscopy remote sensing techniques were considered. Within the discipline area of geophysics, the complementary techniques of gravimetry and radar were studied. Experiments using these techniques were analyzed for comparison at the Moon, Mercury, Mars and the Galilean satellites. On the basis of these comparative assessments, the adaptability of each sensing technique was judged as a basic technique for many targets, as a single instrument applied to many targets, as a single instrument used in different mission modes, and as an instrument capability for nongeoscience objectives.

New method for scanning spacecraft and balloon-borne/space-based experiments

NASA Technical Reports Server (NTRS)

Polites, Michael E.

1991-01-01

A new method is presented for scanning balloon-borne experiments, free-flying spacecraft, and gimballed experiments mounted to the space shuttle or the space station. It uses rotating-unbalanced-mass (RUM) devices for generating circular, line, or raster scan patterns and an auxiliary control system for target acquisition, keeping the scan centered on the target, and producing complementary motion for raster scanning. It is ideal for applications where the only possible way to accomplish the required scan is to physically scan the entire experiment or spacecraft as in X-ray and gamma ray experiments. In such cases, this new method should have advantages over prior methods in terms of either power, weight, cost, performance, stability, or a combination of these.

Status of the prototype Pulsed Photonuclear Assessment (PPA) inspection system

NASA Astrophysics Data System (ADS)

Jones, James L.; Blackburn, Brandon W.; Norman, Daren R.; Watson, Scott M.; Haskell, Kevin J.; Johnson, James T.; Hunt, Alan W.; Harmon, Frank; Moss, Calvin

2007-08-01

The Idaho National Laboratory, in collaboration with Idaho State University's Idaho Accelerator Center and the Los Alamos National Laboratory, continues to develop the Pulsed Photonuclear Assessment (PPA) technique for shielded nuclear material detection in large volume configurations, such as cargo containers. In recent years, the Department of Homeland Security has supported the development of a prototype PPA cargo inspection system. This PPA system integrates novel neutron and gamma-ray detectors for nuclear material detection along with a complementary and unique gray scale, density mapping component for significant shield material detection. This paper will present the developmental status of the prototype system, its detection performance using several INL Calibration Pallets, and planned enhancements to further increase its nuclear material detection capability.

A fully automatic approach for multimodal PET and MR image segmentation in gamma knife treatment planning.

PubMed

Rundo, Leonardo; Stefano, Alessandro; Militello, Carmelo; Russo, Giorgio; Sabini, Maria Gabriella; D'Arrigo, Corrado; Marletta, Francesco; Ippolito, Massimo; Mauri, Giancarlo; Vitabile, Salvatore; Gilardi, Maria Carla

2017-06-01

Nowadays, clinical practice in Gamma Knife treatments is generally based on MRI anatomical information alone. However, the joint use of MRI and PET images can be useful for considering both anatomical and metabolic information about the lesion to be treated. In this paper we present a co-segmentation method to integrate the segmented Biological Target Volume (BTV), using [ 11 C]-Methionine-PET (MET-PET) images, and the segmented Gross Target Volume (GTV), on the respective co-registered MR images. The resulting volume gives enhanced brain tumor information to be used in stereotactic neuro-radiosurgery treatment planning. GTV often does not match entirely with BTV, which provides metabolic information about brain lesions. For this reason, PET imaging is valuable and it could be used to provide complementary information useful for treatment planning. In this way, BTV can be used to modify GTV, enhancing Clinical Target Volume (CTV) delineation. A novel fully automatic multimodal PET/MRI segmentation method for Leksell Gamma Knife ® treatments is proposed. This approach improves and combines two computer-assisted and operator-independent single modality methods, previously developed and validated, to segment BTV and GTV from PET and MR images, respectively. In addition, the GTV is utilized to combine the superior contrast of PET images with the higher spatial resolution of MRI, obtaining a new BTV, called BTV MRI . A total of 19 brain metastatic tumors, undergone stereotactic neuro-radiosurgery, were retrospectively analyzed. A framework for the evaluation of multimodal PET/MRI segmentation is also presented. Overlap-based and spatial distance-based metrics were considered to quantify similarity concerning PET and MRI segmentation approaches. Statistics was also included to measure correlation among the different segmentation processes. Since it is not possible to define a gold-standard CTV according to both MRI and PET images without treatment response assessment, the feasibility and the clinical value of BTV integration in Gamma Knife treatment planning were considered. Therefore, a qualitative evaluation was carried out by three experienced clinicians. The achieved experimental results showed that GTV and BTV segmentations are statistically correlated (Spearman's rank correlation coefficient: 0.898) but they have low similarity degree (average Dice Similarity Coefficient: 61.87 ± 14.64). Therefore, volume measurements as well as evaluation metrics values demonstrated that MRI and PET convey different but complementary imaging information. GTV and BTV could be combined to enhance treatment planning. In more than 50% of cases the CTV was strongly or moderately conditioned by metabolic imaging. Especially, BTV MRI enhanced the CTV more accurately than BTV in 25% of cases. The proposed fully automatic multimodal PET/MRI segmentation method is a valid operator-independent methodology helping the clinicians to define a CTV that includes both metabolic and morphologic information. BTV MRI and GTV should be considered for a comprehensive treatment planning. Copyright © 2017 Elsevier B.V. All rights reserved.

Se Concentrations in Epiphytic Lichens From the Boreal Forest of Forthern Québec

NASA Astrophysics Data System (ADS)

Marin, L.; Lhomme, J.; Carignan, J.

2004-05-01

The knowledge of Se concentration in environmental samples is important because this element may be both toxic and nutrient for live organisms. This study aims to characterise the Se concentration in lichen samples in order to document the variability of atmospheric fallout. Lichens are of particular interest because their epiphytic character makes them totally dependant of atmospheric nutrients, so that their chemical composition reflects that of atmospheric matter. Lichens hanging on tree branches were sampled in various location of the boreal forest of northern Québec. We developed a separation and pre-concentration technique for Se analysis of low mineral matrix samples by GFAAS. After mineralisation and addition of a Se-free mineral charge to the sample, total Se is reduced to Se IV and fixed onto a thiol cotton. The latter is dissolved and directly analysed by GFAAS. A limit of determination of 0.02 ppm in the solid sample and a precision (relative standard deviation) varying from 3 to 15% was found through the course of this study. Our results are very similar to the certified values of the reference materials analysed, suggesting a good accuracy of the method for organic materials. Some lichen samples were also analysed by INAA and the agreement between results obtained by both techniques is not always perfect. There is, however, no systematic bias between the methods. Some samples agree within analytical uncertainty (about 5%), whereas others differ by more than 20%. The most probable reason why such discrepancies are observed is because these lichen samples were not crushed and homogenised before analysis. Indeed, some duplicate samples analysed by INAA yielded results that differed by more than 20%, while other agreed within 2%. Considering these facts, the overall agreement between GFAAS and INAA is pretty much satisfactory. The Se concentrations measured in lichens vary from 1.2 to 0.3 ppm and decrease from the coast of Hudson Bay towards inland at the scale of hundreds of km. Normalised to Al concentrations, Se in lichens is in excess relative to crustal values by a factor of 1 to 2 order of magnitude. This suggests that atmospheric Se has another major source than mineral aerosols. Se content is also correlated with halogen elements in lichens suggesting either a common source (sea salts) or that the physico-chemistry of coastal atmosphere is favourable to the scavenging and/or to the bio-accumulation of Se by lichens.

Using Neutron Spectroscopy to Obtain Quantitative Composition Data of Ganymede's Surface from the Jupiter Ganymede Orbiter

NASA Astrophysics Data System (ADS)

Lawrence, D. J.; Maurice, S.; Patterson, G. W.; Hibbitts, C. A.

2010-05-01

Understanding the global composition of Ganymede's surface is a key goal of the Europa Jupiter System Mission (EJSM) that is being jointly planned by NASA and ESA. Current plans for obtaining surface information with the Jupiter Ganymede Orbiter (JGO) use spectral imaging measurements. While spectral imaging can provide good mineralogy-related information, quantitative data about elemental abundances can often be hindered by non-composition variations due to surface effects (e.g., space weathering, grain effects, temperature, etc.). Orbital neutron and gamma-ray spectroscopy can provide quantitative composition information that is complementary to spectral imaging measurements, as has been demonstrated with similar instrumental combinations at the Moon, Mars, and Mercury. Neutron and gamma-ray measurements have successfully returned abundance information in a hydrogen-rich environment on Mars. In regards to neutrons and gamma-rays, there are many similarities between the Mars and Ganymede hydrogen-rich environments. In this study, we present results of neutron transport models, which show that quantitative composition information from Ganymede's surface can be obtained in a realistic mission scenario. Thermal and epithermal neutrons are jointly sensitive to the abundances of hydrogen and neutron absorbing elements, such as iron and titanium. These neutron measurements can discriminate between regions that are rich or depleted in neutron absorbing elements, even in the presence of large amounts of hydrogen. Details will be presented about how the neutron composition parameters can be used to meet high-level JGO science objectives, as well as an overview of a neutron spectrometer than can meet various mission and stringent environmental requirements.

The state diagram for cell adhesion under flow: leukocyte rolling and firm adhesion.

PubMed

Chang, K C; Tees, D F; Hammer, D A

2000-10-10

Leukocyte adhesion under flow in the microvasculature is mediated by binding between cell surface receptors and complementary ligands expressed on the surface of the endothelium. Leukocytes adhere to endothelium in a two-step mechanism: rolling (primarily mediated by selectins) followed by firm adhesion (primarily mediated by integrins). Using a computational method called "Adhesive Dynamics," we have simulated the adhesion of a cell to a surface in flow, and elucidated the relationship between receptor-ligand functional properties and the dynamics of adhesion. We express this relationship in a state diagram, a one-to-one map between the biophysical properties of adhesion molecules and various adhesive behaviors. Behaviors that are observed in simulations include firm adhesion, transient adhesion (rolling), and no adhesion. We varied the dissociative properties, association rate, bond elasticity, and shear rate and found that the unstressed dissociation rate, k(r)(o), and the bond interaction length, gamma, are the most important molecular properties controlling the dynamics of adhesion. Experimental k(r)(o) and gamma values from the literature for molecules that are known to mediate rolling adhesion fall within the rolling region of the state diagram. We explain why L-selectin-mediated rolling, which has faster k(r)(o) than other selectins, is accompanied by a smaller value for gamma. We also show how changes in association rate, shear rate, and bond elasticity alter the dynamics of adhesion. The state diagram (which must be mapped for each receptor-ligand system) presents a concise and comprehensive means of understanding the relationship between bond functional properties and the dynamics of adhesion mediated by receptor-ligand bonds.

Radionuclides and heavy metals in Borovac, Southern Serbia.

PubMed

Popovic, Dragana; Todorovic, Dragana; Frontasyeva, Marina; Ajtic, Jelena; Tasic, Mirjana; Rajsic, Slavica

2008-09-01

The paper presents the complex approach to the assessment of the state of the environment in Southern Serbia, surroundings of Bujanovac, the region which is of great concern as being exposed to contamination by depleted uranium (DU) ammunition during the North Atlantic Treaty Organization (NATO) attacks in 1999. It includes studies on concentrations of radionuclides and heavy metals in different environmental samples 5 years after the military actions. In October 2004, samples of soil, grass, lichen, moss, honey, and water were collected at two sites, in the immediate vicinity of the targeted area and 5 km away from it. Radionuclide ((7)Be, (40)K, (137)Cs, (210)Pb, (226)Ra, (232)Th, (235)U, (238)U) activities in solid samples were determined by standard gamma spectrometry and total alpha and beta activity in water was determined by proportional alpha-beta counting. Concentrations of 35 elements were determined in the samples of soil, moss, grass, and lichen by instrumental neutron activation analysis (INAA). The results are discussed in the context of a possible contamination by DU that reached the environment during the attacks as well as in the context of an environmental pollution by radionuclides and heavy metals in Southern Serbia. The results are compared to the state of environment in the region and other parts of the country both prior to and following the attacks. This is the first comprehensive study of the contents of radionuclides and heavy metals in Southern Serbia and consequently highly important for the assessment of the state of environment in this part of the country concerning possible effects of DU ammunition on the environment, as well as anthropogenic source of pollution by radionuclides and heavy metals and other elements. Also, the highly sensitive method of INAA was used for the first time to analyze the environmental samples from this area. The results of the study of radionuclides in the samples of soils, leaves, grass, moss, lichen, honey, and water in Southern Serbia (Bujanovac) gave no evidence of the DU contamination of the environment 5 years after the military actions in 1999. Activities of radionuclides in soils were within the range of the values obtained in the other parts of the country and within the global average. The ratio of uranium isotopes confirmed the natural origin of uranium. In general, concentrations of heavy metals in the samples of soils, plant leaves, mosses, and lichen are found to be less or in the lower range of values found in other parts of the country, in spite of the differences in plant and moss species or soil characteristics. Possible sources of heavy metal contamination were identified as a power coal plant in the vicinity of the sampling sites and wood and waste burning processes. The collected data should provide a base for the health risk assessments on animals and humans in the near future. It should be emphasized that the sampling was carried out 5 years after the military action and that the number of samples was limited; therefore, the conclusions should be accepted only as observed tendencies and a detailed study should be recommended in the future.

The search for QCD exotica

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dzierba, A.R.

1995-10-01

One of the open questions in non-perturbative QCD has to do with the existence of meson states predicted by the theory other than qq states. These include four-quark states (q{sup 2}q{sup 2} or molecules like KK), states of pure glue (glueballs: gg or ggg) and mixed or hybrid states (qqg). The prima facie candidate for a non-qq state would be one possessing exotic quantum numbers, J{sup PC}, not consistent with a qq combination. Examples include J{sup PC}=0{sup +-},{sup 0--},{sup -+},{hor_ellipsis} Remarkably, states with exotic quantum numbers have not been found despite intensive searches. The case for a possible sighting ofmore » an exotic J{sup Jc}= 1{sup -+} state decaying into {eta}{pi}{sup O}, made a few years ago, seems to be dissolving. Yet, the evidence for non-qq states is clearly present. Conventional qq nonets are over-subscribed, states have been found with decay modes or production characteristics peculiar for qq. The experimental lesson we have learned is that information from a number of complementary processes must be brought together in order to understand the meson spectrum. Information has come from e{sup +}e{sup -},{gamma}{gamma}, {gamma}{gamma}, and pp collisions, from vector meson decays and from peripheral and central hadroproduction. This talk will review the status of the experimental search. I will especially point out how new technology is being brought to bear on the re-visit of the light quark sector. New instrumentation allows for sophisticated and selective triggers. The recent explosion in computing power allows us to analyze data with unprecedented statistics. Preliminary results from a recently completed, ultra-high statistics experiment using the Multiparticle Spectrometer at Brookhaven Lab will be presented. I will also describe the extension of the search to CEBAF, where an approved experiment there will study the sub-structure of scalar mesons via the radiative decays of the ER meson.« less

Apollo 15 yellow-brown volcanic glass - Chemistry and petrogenetic relations to green volcanic glass and olivine-normative mare basalts

NASA Technical Reports Server (NTRS)

Hughes, S. S.; Schmitt, R. A.; Delano, J. W.

1988-01-01

Electron microprobe and INAA were used to analyze forty spherules of Apollo 15 yellow-brown glass for major and trace elements. The glass is one of twenty-five high-Mg primary magmas emplaced on the lunar surface in pyroclastic eruptions. The abundances show that the magma was produced by partial melting of differentiated cumulates in the lunar mantle. Models to explain the possible source-regions of several Apollo 15 and Apollo 12 low-Ti mare magmas are presented.

Numerical Modeling of Two-Terminal Quantum Well Devices

DTIC Science & Technology

1989-04-17

transfer matrix methods . This was implemented for a perfectly symmetric resonant tunneling structure such as the one shown in figure 3. This technique has...occur for mean well widths near 0.08v or 0.09v. This situation requires further analysis . The situation for the well width of 70A, yielded low Q...WSe.4W AA L1ot. OVefol striwe Tunmelen "ers (a) (b) Figure 1: Pseudomorphic InO. 5 3 Ga 0 .4 7 As/AlA3/ InAa resonant tunneling diodes proposed in

Single-Molecule Counting of Point Mutations by Transient DNA Binding

NASA Astrophysics Data System (ADS)

Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

2017-03-01

High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

Rotating-unbalanced-mass Devices for Scanning Balloon-borne Experiments, Free-flying Spacecraft, and Space Shuttle/space Station Experiments

NASA Technical Reports Server (NTRS)

Polites, Michael E.

1990-01-01

A new method is presented for scanning balloon-borne experiments, free-flying spacecraft, and gimballed experiments mounted to the space shuttle or the space station. It uses rotating-unbalanced-mass (RUM) devices for generating circular, line, or raster scan patterns and an auxiliary control system for target acquisition, keeping the scan centered on the target, and producing complementary motion for raster scanning. It is ideal for applications where the only possible way to accomplish the required scan is to physically scan the entire experiment or spacecraft as in x ray and gamma ray experiments. In such cases, this new method should have advantages over prior methods in terms of either power, weight, cost, performance, stability, or a combination of these.

A simple {sup 197}Hg RNAA procedure for the determination of mercury in urine, blood, and tissue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blotcky, A.J.; Rack, E.P.; Meade, A.G.

1995-12-31

Mercury has been implicated as a causal agent in such central nervous system diseases as Alzheimer`s and Parkinson`s. Consequently, there has been increased interest in the determination of ultra-trace-level mercury in biological matrices, especially in tissue. While such nonnuclear techniques as cold vapor atomic absorption spectrometry and cold vapor atomic fluorescence spectrometry have been employed routinely for mercury determinations in urine and blood, there is a paucity of nonnuclear techniques for the determination of mercury in the low parts-per-billion range in biological tissue. As pointed out by Fardy and Warner, instrumental and radiochemical neutron activation analysis (INAA and RNAA) requiremore » no blank determinations in contrast to nonnuclear analytical techniques employing digestion and/or chemical operations. Therefore, INAA and RNAA become the obvious choices for determination of ultra-trace levels of mercury in tissue. Most separation methods reported in the literature require different and separate methodologies for mercury determinations in urine, blood, or tissue. The purposes of this study are to develop a single methodology for the determination of low levels of mercury in all biological matrices by RNAA and to optimize parameters necessary for an efficacious trace-level determination. Previously, few studies have taken into account the effects of the Szilard-Chalmers reactions of the radioactivatable analyte within a biological matrix. It also would appear that little attention has been given to the optimum postirradiation carrier concentration of the analyte species necessary. This study discusses these various considerations.« less

Potential of SeHCAT retention as an indicator of terminal ileal involvement in inflammatory bowel disease.

PubMed

Holdstock, G; Phillips, G; Hames, T K; Condon, B R; Fleming, J S; Smith, C L; Ackery, D M

1985-01-01

The absorption of 75Se-23-selena-25-homotaurocholate (SeHCAT) was compared with vitamin-B12 absorption and conventional radiography in 44 patients with inflammatory bowel disease. The retention of SeHCAT was normal in 11 patients with ulcerative colitis but was abnormally low in 9 patients with terminal-ileal resection, 9 out of 14 patients with small-bowel Crohn's disease and in 2 out of 10 patients with Crohn's colitis. The 5 patients with small-bowel Crohn's disease and normal retention had either inactive disease or no radiological evidence of terminal ileal involvement. Measurements of the absorption of vitamin B12 did not discriminate between these groups, and there was very poor correlation between B12 and SeHCAT absorption (r = 0.506, P less than 0.05). There was extremely good correlation of SeHCAT retention measured using a wholebody counter with that measured using an uncollimated gamma camera (r = 0.96, P less than 0.001). The results suggest that SeHCAT retention may prove complementary to conventional methods of assessing small-bowel disease in patients with inflammatory bowel disease. As measurement by gamma camera is feasible, this test can be used in most departments of nuclear medicine.

Spatial variation of natural radiation and childhood leukaemia incidence in Great Britain.

PubMed

Richardson, S; Monfort, C; Green, M; Draper, G; Muirhead, C

This paper describes an analysis of the geographical variation of childhood leukaemia incidence in Great Britain over a 15 year period in relation to natural radiation (gamma and radon). Data at the level of the 459 district level local authorities in England, Wales and regional districts in Scotland are analysed in two complementary ways: first, by Poisson regressions with the inclusion of environmental covariates and a smooth spatial structure; secondly, by a hierarchical Bayesian model in which extra-Poisson variability is modelled explicitly in terms of spatial and non-spatial components. From this analysis, we deduce a strong indication that a main part of the variability is accounted for by a local neighbourhood 'clustering' structure. This structure is furthermore relatively stable over the 15 year period for the lymphocytic leukaemias which make up the majority of observed cases. We found no evidence of a positive association of childhood leukaemia incidence with outdoor or indoor gamma radiation levels. There is no consistent evidence of any association with radon levels. Indeed, in the Poisson regressions, a significant positive association was only observed for one 5-year period, a result which is not compatible with a stable environmental effect. Moreover, this positive association became clearly non-significant when over-dispersion relative to the Poisson distribution was taken into account.

Cloud Macroscopic Organization: Order Emerging from Randomness

NASA Technical Reports Server (NTRS)

Yuan, Tianle

2011-01-01

Clouds play a central role in many aspects of the climate system and their forms and shapes are remarkably diverse. Appropriate representation of clouds in climate models is a major challenge because cloud processes span at least eight orders of magnitude in spatial scales. Here we show that there exists order in cloud size distribution of low-level clouds, and that it follows a power-law distribution with exponent gamma close to 2. gamma is insensitive to yearly variations in environmental conditions, but has regional variations and land-ocean contrasts. More importantly, we demonstrate this self-organizing behavior of clouds emerges naturally from a complex network model with simple, physical organizing principles: random clumping and merging. We also demonstrate symmetry between clear and cloudy skies in terms of macroscopic organization because of similar fundamental underlying organizing principles. The order in the apparently complex cloud-clear field thus has its root in random local interactions. Studying cloud organization with complex network models is an attractive new approach that has wide applications in climate science. We also propose a concept of cloud statistic mechanics approach. This approach is fully complementary to deterministic models, and the two approaches provide a powerful framework to meet the challenge of representing clouds in our climate models when working in tandem.

GW170817 falsifies dark matter emulators

NASA Astrophysics Data System (ADS)

Boran, S.; Desai, S.; Kahya, E. O.; Woodard, R. P.

2018-02-01

On August 17, 2017 the LIGO interferometers detected the gravitational wave (GW) signal (GW170817) from the coalescence of binary neutron stars. This signal was also simultaneously seen throughout the electromagnetic (EM) spectrum from radio waves to gamma rays. We point out that this simultaneous detection of GW and EM signals rules out a class of modified gravity theories, termed "dark matter emulators," which dispense with the need for dark matter by making ordinary matter couple to a different metric from that of GW. We discuss other kinds of modified gravity theories which dispense with the need for dark matter and are still viable. This simultaneous observation also provides the first observational test of Einstein's weak equivalence principle (WEP) between gravitons and photons. We estimate the Shapiro time delay due to the gravitational potential of the total dark matter distribution along the line of sight (complementary to the calculation by Abbott et al. [Astrophys. J. Lett. 848, L13 (2017)], 10.3847/2041-8213/aa920c) to be about 400 days. Using this estimate for the Shapiro delay and from the time difference of 1.7 seconds between the GW signal and gamma rays, we can constrain violations of the WEP using the parametrized post-Newtonian parameter γ , and it is given by |γGW-γEM|<9.8 ×10-8.

Residential Exposure to Natural Background Radiation and Risk of Childhood Acute Leukemia in France, 1990-2009.

PubMed

Demoury, Claire; Marquant, Fabienne; Ielsch, Géraldine; Goujon, Stéphanie; Debayle, Christophe; Faure, Laure; Coste, Astrid; Laurent, Olivier; Guillevic, Jérôme; Laurier, Dominique; Hémon, Denis; Clavel, Jacqueline

2017-04-01

Exposures to high-dose ionizing radiation and high-dose rate ionizing radiation are established risk factors for childhood acute leukemia (AL). The risk of AL following exposure to lower doses due to natural background radiation (NBR) has yet to be conclusively determined. AL cases diagnosed over 1990-2009 (9,056 cases) were identified and their municipality of residence at diagnosis collected by the National Registry of Childhood Cancers. The Geocap study, which included the 2,763 cases in 2002-2007 and 30,000 population controls, was used for complementary analyses. NBR exposures were modeled on a fine scale (36,326 municipalities) based on measurement campaigns and geological data. The power to detect an association between AL and dose to the red bone marrow (RBM) fitting UNSCEAR (United Nations Scientific Committee on the Effects of Atomic Radiation) predictions was 92%, 45% and 99% for exposure to natural gamma radiation, radon and total radiation, respectively. AL risk, irrespective of subtype and age group, was not associated with the exposure of municipalities to radon or gamma radiation in terms of yearly exposure at age reached, cumulative exposure or RBM dose. There was no confounding effect of census-based socio-demographic indicators, or environmental factors (road traffic, high voltage power lines, vicinity of nuclear plants) related to AL in the Geocap study. Our findings do not support the hypothesis that residential exposure to NBR increases the risk of AL, despite the large size of the study, fine scale exposure estimates and wide range of exposures over France. However, our results at the time of diagnosis do not rule out a slight association with gamma radiation at the time of birth, which would be more in line with the recent findings in the UK and Switzerland.

Combining Internet monitoring processes, packaging and isotopic analyses to determine the market structure: example of Gamma Butyrolactone.

PubMed

Pazos, Diego; Giannasi, Pauline; Rossy, Quentin; Esseiva, Pierre

2013-07-10

The Internet is becoming more and more popular among drug users. The use of websites and forums to obtain illicit drugs and relevant information about the means of consumption is a growing phenomenon mainly for new synthetic drugs. Gamma Butyrolactone (GBL), a chemical precursor of Gamma Hydroxy Butyric acid (GHB), is used as a "club drug" and also in drug facilitated sexual assaults. Its market takes place mainly on the Internet through online websites but the structure of the market remains unknown. This research aims to combine digital, physical and chemical information to help understand the distribution routes and the structure of the GBL market. Based on an Internet monitoring process, thirty-nine websites selling GBL, mainly in the Netherlands, were detected between January 2010 and December 2011. Seventeen websites were categorized into six groups based on digital traces (e.g. IP addresses and contact information). In parallel, twenty-five bulk GBL specimens were purchased from sixteen websites for packaging comparisons and carbon isotopic measurements. Packaging information showed a high correlation with digital data confirming the links previously established whereas chemical information revealed undetected links and provided complementary information. Indeed, while digital and packaging data give relevant information about the retailers, the supply routes and the distribution close to the consumer, the carbon isotopic data provides upstream information about the production level and in particular the synthesis pathways and the chemical precursors. A three-level structured market has been thereby identified with a production level mainly located in China and in Germany, an online distribution level mainly hosted in the Netherlands and the customers who order on the Internet. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Nucleosynthesis in Supernovae

NASA Astrophysics Data System (ADS)

Thielemann, Friedrich-Karl; Isern, Jordi; Perego, Albino; von Ballmoos, Peter

2018-04-01

We present the status and open problems of nucleosynthesis in supernova explosions of both types, responsible for the production of the intermediate mass, Fe-group and heavier elements (with the exception of the main s-process). Constraints from observations can be provided through individual supernovae (SNe) or their remnants (e.g. via spectra and gamma-rays of decaying unstable isotopes) and through surface abundances of stars which witness the composition of the interstellar gas at their formation. With a changing fraction of elements heavier than He in these stars (known as metallicity) the evolution of the nucleosynthesis in galaxies over time can be determined. A complementary way, related to gamma-rays from radioactive decays, is the observation of positrons released in β+-decays, as e.g. from ^{26}Al, ^{44}Ti, ^{56,57}Ni and possibly further isotopes of their decay chains (in competition with the production of e+e- pairs in acceleration shocks from SN remnants, pulsars, magnetars or even of particle physics origin). We discuss (a) the role of the core-collapse supernova explosion mechanism for the composition of intermediate mass, Fe-group (and heavier?) ejecta, (b) the transition from neutron stars to black holes as the final result of the collapse of massive stars, and the relation of the latter to supernovae, faint supernovae, and gamma-ray bursts/hypernovae, (c) Type Ia supernovae and their nucleosynthesis (e.g. addressing the ^{55}Mn puzzle), plus (d) further constraints from galactic evolution, γ-ray and positron observations. This is complemented by the role of rare magneto-rotational supernovae (related to magnetars) in comparison with the nucleosynthesis of compact binary mergers, especially with respect to forming the heaviest r-process elements in galactic evolution.

Cytokine gene signatures in neural tissue of horses with equine protozoal myeloencephalitis or equine herpes type 1 myeloencephalopathy.

PubMed

Pusterla, N; Wilson, W D; Conrad, P A; Barr, B C; Ferraro, G L; Daft, B M; Leutenegger, C M

2006-09-09

This study was designed to determine the relative levels of gene transcription of selected pathogens and cytokines in the brain and spinal cord of 12 horses with equine protozoal myeloencephalitis (EPM), 11 with equine herpesvirus type 1 (EHV-1) myeloencephalopathy, and 12 healthy control horses by applying a real time pcr to the formalin-fixed and paraffin-embedded tissues. Total rna was extracted from each tissue, transcribed to complementary dna (cDNA) and assayed for Sarcocystis neurona, Neospora hughesi, EHV-1, equine GAPDH (housekeeping gene), tumour necrosis factor (TNF)-alpha, interferon (IFN)-gamma, interleukin (IL)-1beta, IL-2, IL-4, IL-6, IL-8, IL-10 AND IL-12 p40. S neurona cdna was detected in the neural tissue from all 12 horses with EPM, and two of them also had amplifiable cDNA of N hughesi. The relative levels of transcription of protozoal cdna ranged from 1 to 461 times baseline (mean 123). All the horses with ehv-1 myeloencephalopathy had positive viral signals by PCR with relative levels of transcription ranging from 1 to 1618 times baseline (mean 275). All the control horses tested negative for S neurona, N hughesi and EHV-1 cdna. The cytokine profiles of each disease indicated a balance between pro- and anti-inflammatory markers. In the horses with epm the pro-inflammatory Th1 cytokines (IL-8, TNF-alpha and IFN-gamma) were commonly expressed but the anti-inflammatory Th2 cytokines (IL-4, IL-6 AND IL-10) were absent or rare. In the horses with ehv-1 the proinflammatory cytokine IL-8 was commonly expressed, but IL-10 and IFN-gamma were not, and TNF-alpha was rare. Tissue from the control horses expressed only the gene GAPDH.

Lithogeochemistry of mineralized and altered rock samples from the northern Talkeetna Mountains, south-central Alaska

USGS Publications Warehouse

Light, Thomas D.; Schmidt, Jeanine M.

2011-01-01

Mineralized and altered rock samples collected from the northern Talkeetna Mountains, Alaska, were analyzed by two different inductively coupled plasma atomic-emission spectrometry (ICP-AES) methods for as many as 44 elements; by fire assay and either direct-coupled plasma (DCP) or atomic absorption spectrophotometry (AAS) for gold (Au); by cold vapor atomic absorption (CVAA) for mercury (Hg); and by irradiated neutron activation analysis (INAA) for tungsten (W). The analytical results showed that some samples contain high values of multiple elements and may be potential indicators of hydrothermal mineralization in the area.

Mn-Cr isotopic systematics of Chainpur chondrules and bulk ordinary chondrites

NASA Technical Reports Server (NTRS)

Nyquist, L.; Lindstrom, D.; Wiesmann, H.; Bansal, B.; Shih, C.-Y.; Mittlefehldt, D.; Martinez, R.; Wentworth, S.

1994-01-01

We report on ongoing study of the Mn-Cr systematics of individual Chainpur (LL3.4) chondrules and compare the results to those for bulk ordinary chondrites. Twenty-eight chondrules were surveyed for abundances of Mn, Cr, Na, Fe, Sc, Hf, Ir, and Zn by INAA. Twelve were chosen for SEM/EDX and high-precision Cr-isotopic studies on the basis of LL-chondrite-normalized Mn(LL), Sc(LL), (Mn/Fe)(LL), and (Sc/Fe)(LL) as well as their Mn/Cr ratios. Classification into textural types follows from SEM/EDX examination of interior surfaces.

Workshop on Analysis of Returned Comet Nucleus Samples

NASA Technical Reports Server (NTRS)

1989-01-01

This volume contains abstracts that were accepted by the Program Committee for presentation at the workshop on the analysis of returned comet nucleus samples held in Milpitas, California, January 16 to 18, 1989. The abstracts deal with the nature of cometary ices, cryogenic handling and sampling equipment, origin and composition of samples, and spectroscopic, thermal and chemical processing methods of cometary nuclei. Laboratory simulation experimental results on dust samples are reported. Some results obtained from Halley's comet are also included. Microanalytic techniques for examining trace elements of cometary particles, synchrotron x ray fluorescence and instrument neutron activation analysis (INAA), are presented.

Origin of fine dust in urban environmental zones--Evidence from element patterns received by dichotomous collection and INAA.

PubMed

Weckwerth, G

2010-10-01

In order to fulfil the EU-limitations of fine dust and traffic-produced gases Cologne installed 2008 one of the first German environmental zones, from which stepwise vehicles with too high emissions will be locked out. Verification of effectiveness and the research on further strategies to reduce fine dust are studied as promising applications of a method on discrimination of aerosol components from different origins (Weckwerth, 2001). New measurements in Cologne gave several implications on supports, especially in connection with traffic abrasion from brakes, tires and rails. Copyright 2010. Published by Elsevier Ltd.

Evaluation of neutron sources for ISAGE-in-situ-NAA for a future lunar mission.

PubMed

Li, X; Breitkreutz, H; Burfeindt, J; Bernhardt, H-G; Trieloff, M; Hopp, J; Jessberger, E K; Schwarz, W H; Hofmann, P; Hiesinger, H

2011-11-01

For a future Moon landing, a concept for an in-situ NAA involving age determination using the (40)Ar-(39)Ar method is developed. A neutron source (252)Cf is chosen for sample irradiation on the Moon. A special sample-in-source irradiation geometry is designed to provide a homogeneous distribution of neutron flux at the irradiation position. Using reflector, the neutron flux is likely to increase by almost 200%. Sample age of 1Ga could be determined. Elemental analysis using INAA is discussed. Copyright © 2011 Elsevier Ltd. All rights reserved.

Completely non-destructive elemental analysis of bulky samples by PGAA

NASA Astrophysics Data System (ADS)

Oura, Y.; Nakahara, H.; Sueki, K.; Sato, W.; Saito, A.; Tomizawa, T.; Nishikawa, T.

1999-01-01

NBAA (neutron beam activation analysis), which is a combination of PGAA and INAA by a single neutron irradiation, using an internal monostandard method is proposed as a very unique and promising method for the elemental analysis of voluminous and invaluable archaeological samples which do not allow even a scrape of the surface. It was applied to chinawares, Sueki ware, and bronze mirrors, and proved to be a very effective method for nondestructive analysis of not only major elements but also some minor elements such as boron that help solve archaeological problems of ears and sites of their production.

Quantitative Evaluation of Ion-implanted Arsenic in Silicon by Instrumental Neutron Activation Analysis

NASA Astrophysics Data System (ADS)

Takatsuka, Toshiko; Hirata, Kouichi; Kobayashi, Yoshinori; Kuroiwa, Takayoshi; Miura, Tsutomu; Matsue, Hideaki

2008-11-01

Certified reference materials (CRMs) of shallow arsenic implants in silicon are now under development at the National Metrology Institute of Japan (NMIJ). The amount of ion-implanted arsenic atoms is quantified by Instrumental Neutron Activation Analysis (INAA) using research reactor JRR-3 in Japan Atomic Energy Agency (JAEA). It is found that this method can evaluate arsenic amounts of 1015 atoms/cm2 with small uncertainties, and is adaptable to shallower dopants. The estimated uncertainties can satisfy the industrial demands for reference materials to calibrate the implanted dose of arsenic at shallow junctions.

Computer graphics for quality control in the INAA of geological samples

USGS Publications Warehouse

Grossman, J.N.; Baedecker, P.A.

1987-01-01

A data reduction system for the routine instrumental activation analysis of samples is described, with particular emphasis on interactive graphics capabilities for evaluating analytical quality. Graphics procedures have been developed to interactively control the analysis of selected photopeaks during spectral analysis, and to evaluate detector performance during a given counting cycle. Graphics algorithms are also used to compare the data on reference samples with accepted values, to prepare quality control charts to evaluate long term precision and to search for systematic variations in data on reference samples as a function of time. ?? 1987 Akade??miai Kiado??.

Fluorescence Microspectroscopy for Testing the Dimerization Hypothesis of BACE1 Protein in Cultured HEK293 Cells

NASA Astrophysics Data System (ADS)

Gardeen, Spencer; Johnson, Joseph L.; Heikal, Ahmed A.

2016-06-01

Alzheimer's Disease (AD) is a neurodegenerative disorder that results from the formation of beta-amyloid plaques in the brain that trigger the known symptoms of memory loss in AD patients. The beta-amyloid plaques are formed by the proteolytic cleavage of the amyloid precursor protein (APP) by the proteases BACE1 and gamma-secretase. These enzyme-facilitated cleavages lead to the production of beta-amyloid fragments that aggregate to form plaques, which ultimately lead to neuronal cell death. Recent detergent protein extraction studies suggest that BACE1 protein forms a dimer that has significantly higher catalytic activity than its monomeric counterpart. In this contribution, we examine the dimerization hypothesis of BACE1 in cultured HEK293 cells using complementary fluorescence spectroscopy and microscopy methods. Cells were transfected with a BACE1-EGFP fusion protein construct and imaged using confocal, and differential interference contrast to monitor the localization and distribution of intracellular BACE1. Complementary fluorescence lifetime and anisotropy measurements enabled us to examine the conformational and environmental changes of BACE1 as a function of substrate binding. Using fluorescence correlation spectroscopy, we also quantified the diffusion coefficient of BACE1-EGFP on the plasma membrane as a means to test the dimerization hypothesis as a fucntion of substrate-analog inhibitition. Our results represent an important first towards examining the substrate-mediated dimerization hypothesis of BACE1 in live cells.

Distinct and complementary roles for Aspergillus fumigatus-specific Tr1 and Foxp3+ regulatory T cells in humans and mice

PubMed Central

Bedke, Tanja; Iannitti, Rossana G; De Luca, Antonella; Giovannini, Gloria; Fallarino, Francesca; Berges, Carsten; Latgé, Jean-Paul; Einsele, Hermann; Romani, Luigina; Topp, Max S

2014-01-01

Unlike induced Foxp3+ regulatory T cells (Foxp3+ iTreg) that have been shown to play an essential role in the development of protective immunity to the ubiquitous mold Aspergillus fumigatus, type-(1)-regulatory T cells (Tr1) cells have, thus far, not been implicated in this process. Here, we evaluated the role of Tr1 cells specific for an epitope derived from the cell wall glucanase Crf-1 of A. fumigatus (Crf-1/p41) in antifungal immunity. We identified Crf-1/p41-specific latent-associated peptide+ Tr1 cells in healthy humans and mice after vaccination with Crf-1/p41+zymosan. These cells produced high amounts of interleukin (IL)-10 and suppressed the expansion of antigen-specific T cells in vitro and in vivo. In mice, in vivo differentiation of Tr1 cells was dependent on the presence of the aryl hydrocarbon receptor, c-Maf and IL-27. Moreover, in comparison to Tr1 cells, Foxp3+ iTreg that recognize the same epitope were induced in an interferon gamma-type inflammatory environment and more potently suppressed innate immune cell activities. Overall, our data show that Tr1 cells are involved in the maintenance of antifungal immune homeostasis, and most likely play a distinct, yet complementary, role compared with Foxp3+ iTreg. PMID:24820384

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

PubMed

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-12-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

The Multidimensional Integrated Intelligent Imaging project (MI-3)

NASA Astrophysics Data System (ADS)

Allinson, N.; Anaxagoras, T.; Aveyard, J.; Arvanitis, C.; Bates, R.; Blue, A.; Bohndiek, S.; Cabello, J.; Chen, L.; Chen, S.; Clark, A.; Clayton, C.; Cook, E.; Cossins, A.; Crooks, J.; El-Gomati, M.; Evans, P. M.; Faruqi, W.; French, M.; Gow, J.; Greenshaw, T.; Greig, T.; Guerrini, N.; Harris, E. J.; Henderson, R.; Holland, A.; Jeyasundra, G.; Karadaglic, D.; Konstantinidis, A.; Liang, H. X.; Maini, K. M. S.; McMullen, G.; Olivo, A.; O'Shea, V.; Osmond, J.; Ott, R. J.; Prydderch, M.; Qiang, L.; Riley, G.; Royle, G.; Segneri, G.; Speller, R.; Symonds-Tayler, J. R. N.; Triger, S.; Turchetta, R.; Venanzi, C.; Wells, K.; Zha, X.; Zin, H.

2009-06-01

MI-3 is a consortium of 11 universities and research laboratories whose mission is to develop complementary metal-oxide semiconductor (CMOS) active pixel sensors (APS) and to apply these sensors to a range of imaging challenges. A range of sensors has been developed: On-Pixel Intelligent CMOS (OPIC)—designed for in-pixel intelligence; FPN—designed to develop novel techniques for reducing fixed pattern noise; HDR—designed to develop novel techniques for increasing dynamic range; Vanilla/PEAPS—with digital and analogue modes and regions of interest, which has also been back-thinned; Large Area Sensor (LAS)—a novel, stitched LAS; and eLeNA—which develops a range of low noise pixels. Applications being developed include autoradiography, a gamma camera system, radiotherapy verification, tissue diffraction imaging, X-ray phase-contrast imaging, DNA sequencing and electron microscopy.

MeV dark matter complementarity and the dark photon portal

NASA Astrophysics Data System (ADS)

Dutra, Maíra; Lindner, Manfred; Profumo, Stefano; Queiroz, Farinaldo S.; Rodejohann, Werner; Siqueira, Clarissa

2018-03-01

We discuss the phenomenology of an MeV-scale Dirac fermion coupled to the Standard Model through a dark photon with kinetic mixing with the electromagnetic field. We compute the dark matter relic density and explore the interplay of direct detection and accelerator searches for dark photons. We show that precise measurements of the temperature and polarization power spectra of the Cosmic Microwave Background Radiation lead to stringent constraints, leaving a small window for the thermal production of this MeV dark matter candidate. The forthcoming MeV gamma-ray telescope e-ASTROGAM will offer important and complementary opportunities to discover dark matter particles with masses below ~ 10 MeV . Lastly, we discuss how a late-time inflation episode and freeze-in production could conspire to yield the correct relic density while being consistent with existing and future constraints.

Geochemical evidence for mixing of three components in martian orthopyroxenite ALH 84001. [Abstract only

NASA Technical Reports Server (NTRS)

Mittlefehldt, D. W.; Lindstrom, M. M.

1994-01-01

ALH 84001, a ferroan martian orthopyroxenite, originally consisted of three petrographically defined components: a cumulus assemblage of orthopyroxene + chromite, a trapped melt assemblage of orthopyroxene(?) + chromite + maskelynite + apatite + augite +/- pyrite, and a metasomatic assemblage of carbonate +/- pyrite. We present the results of Instrumental Neutron Activation Analysis (INAA) study of five bulk samples of ALH 84001, combined with Scanning Ion Mass Spectrometer (SIMS) data on the orthopyroxene, in order to attempt to set limits on the geochemical characteristics of the latter two components, and therefore on the petrogenesis of ALH 84001. The INAA data support the petrographic observations, suggesting that there are at least three components in ALH 84001. We will assume that each of the three geochemically required components can be equated with one of the petrographically observed components. Both trapped melt and metasomatic components in ALH 84001 have higher Na than orthopyroxene based on compositions of maskelynite, apatite, and carbonate. For the metasomatic component, we will assume its Na content is that of carbonate, while for a trapped melt component, we will use a typical Na content inferred for martian meteorite parent melts, approximately 1 wt% Na2O. Under these assumptions, we can set limits on the Light Rare Earth Elements/Heavy Rare Earth Elements (LREE/HREE) ratios of the components, and use this information to compare the petrogenesis of ALH 84001 with other martian meteorites. The above calculations assume that the bulk samples are representative of different portions of ALH 84001. We will also evaluate the possible heterogeneous distribution of mineral phases in the bulk samples as the cause of compositional heterogeneity in our samples.

Element distributions in metallic fractions of ordinary chondrites

NASA Astrophysics Data System (ADS)

Kong, P.; Ebihara, M.; Endo, K.

1994-07-01

Kamacite and taenite are the major metallic phases in ordinary chondrite, in individual grains of pure alloy. Wood interpreted the concentration gradients of Ni found in two metal phases as a result of exsolution of kamacite from taenite followed by sluggish diffusion of Ni into the taenite crystals upon cooling through approximately 500 C. A selective chemical dissolution method was developed to separated taenite from kamacite and this method was applied to several ordinary chondrites. Based on Instrumental Neutron Activation Analysis (INAA) data and Mossbauer spectra for the metal separates, we evaluated the distribution of various elements between taenite and kamacite. The magnetic fraction separated from ALH 77231 (L6) was boiled in HF for 2 min and named M-1. The M-1 fraction was further treated for 5, 10, and 15 min and the remaining fractions were designed as M-2, M-3, and M-4 respectively. Mossbauer spectrum showed that M-1 was composed almost of alpha-phase kamacite. Mossbauer spectra of the M-2, M-3, and M-4 showed each having similar intensities of kamacite, taenite, and tetrataenite. On the basis of different leaching rate with concentrated HF acid between kamacite and taenite, we can determine element distributions in these different fractions. INAA analyses show that the M-1 is composed of 10% Ni. Contents of Ni in the M-2, M-3, and M-4 show that these three metal fractions are mainly composed of Ni-rich metals with a mean value of 36% Ni. Based on different proportions of kamacite and taenite in these metal fractions, we calculated siderophile-element contents in taenite and kamacite.

Eruption histories and hypotheses of magma genesis of Mt. Baegdu volcano

NASA Astrophysics Data System (ADS)

Lim, C.; Lee, I.

2017-12-01

The tephra or cryptotephra are principally composed of alkaline glass shards, and INAA of individual grains offers a way of distinguishing chemical characteristics. That may be used to discriminate different events age and to correlate separate deposits of the same source volcanoes. The identification of tephra or cryptotephra layers presents an opportunity to define time-parallel marker horizons. With using INAA scanning method three newly identified tephras (named B-J, B-Sado and B-Ym) were detected and eruption ages identified between AT (29.24 cal. ka) and Aso-4 (88 ka) in five cores based on microscopic observation and the stratigraphic correlations between cores of the Holocene sediments in the southeastern East Sea/Japan Sea. By the correlation with TL (dark layer) data, the approximate age of B-J, B-Sado and B-Ym tephras were calculated as to be 50.6 ka, 67.6 ka, 86.8 ka, respectively. The intraplate Baegdusan (Changbai) volcanoes located on the border of China and North Korea have been explained by either hotspots by mantle plumes or asthenospheric mantle upwelling (wet plume) caused by stagnation slab of the subducted Pacific plate. To understand the origin of the Baegdusan volcanism, we performed geochemical analyses on the volcanic rocks and tephra deposits erupted from the Baegdusan volcanoes. We propose that the intraplate alkaline volcanism associated with Baekdusan volcanic region is fed by a mantle upwelling originating below the discontinuity subducting slab. The upwelling is a result of a slab neck into the subducting slabs. The Baekdusan volcano relies on a slab neck within subducting slab at depth to allow for a focused upwelling. Therefore, the magmatic progression of back-arc magmatism in Baekdusan volcanoes can be explained by the interaction of this Philippine Sea Plate Slab and upwelling mantle.

Effective coating of titania nanoparticles with alumina via atomic layer deposition

NASA Astrophysics Data System (ADS)

Azizpour, H.; Talebi, M.; Tichelaar, F. D.; Sotudeh-Gharebagh, R.; Guo, J.; van Ommen, J. R.; Mostoufi, N.

2017-12-01

Alumina films were deposited on titania nanoparticles via atomic layer deposition (ALD) in a fluidized bed reactor at 180 °C and 1 bar. Online mass spectrometry was used for real time monitoring of effluent gases from the reactor during each reaction cycle in order to determine the optimal dosing time of precursors. Different oxygen sources were used to see which oxygen source, in combination with trimethyl aluminium (TMA), provides the highest alumina growth per cycle (GPC). Experiments were carried out in 4, 7 and 10 cycles using the optimal dosing time of precursors. Several characterization methods, such as high resolution transmission electron microscopy (HRTEM), Brunauer-Emmett-Teller (BET), energy dispersive X-ray spectroscopy (EDX), Fourier transform infrared (FTIR), X-ray diffraction (XRD) and instrumental neutron activation analysis (INAA), were conducted on the products. Formation of the alumina film was confirmed by EDX mapping and EDX line profiling, FTIR and TEM. When using either water or deuterium oxide as the oxygen source, the thickness of the alumina film was greater than that of ozone. The average GPC measured by TEM for the ALD of TMA with water, deuterium oxide and ozone was about 0.16 nm, 0.15 nm and 0.11 nm, respectively. The average GPC calculated using the mass fraction of aluminum from INAA was close to those measured from TEM images. Excess amounts of precursors lead to a higher average growth of alumina film per cycle due to insufficient purging time. XRD analysis demonstrated that amorphous alumina was coated on titania nanoparticles. This amorphous layer was easily distinguished from the crystalline core in the TEM images. Decrease in the photocatalytic activity of titania nanoparticles after alumina coating was confirmed by measuring degradation of Rhodamine B by ultraviolet irradiation.

Geochemistry of HASP, VLT, and other glasses from double drive tube 79001/2

NASA Technical Reports Server (NTRS)

Lindstrom, D. J.; Wentworth, S. J.; Martinez, R. R.; Mckay, D. S.

1992-01-01

The Apollo 17 double drive tube 79001/2 (station 9, Van Serg Crater) is distinctive because of its extreme maturity, abundance, and variety of glass clasts. It contains mare glasses of both high Ti and very low Ti (VLT) compositions, and highland glasses of all compositions common in lunar regolith samples: highland basalt (feldspathic; Al2O3 greater than 23 wt percent), KREEP (Al2O3 less than 23 wt percent, K2O greater than 0.25 wt percent), and low-K Fra Mauro (LKFM; Al2O3 less than 23 wt percent, K2O less than 0.25 wt percent). It also contains rare specimens of high-alumina, silica-poor (HASP), and ultra Mg glasses. HASP glasses contain insufficient SiO2 to permit the calculation of a standard norm, and are thought to be the product of volatilization during impact melting. They have been studied by electron microprobe major-element analysis techniques but have not previously been analyzed for trace elements. The samples analyzed for this study were polished grain mounts of the 90-160 micron fraction of four sieved samples from the 79001/2 core (depth range 2.3-11.5 cm). A total of 80 glasses were analyzed by SEM/EDS and electron microprobe, and a subset of 33 of the glasses, representing a wide range of compositional types, was chosen for high-sensitivity INAA. A microdrilling device removed disks (mostly 50-100 micron diameter, weighing approx. 0.1-0.5 micro-g) for INAA. Preliminary data reported here are based only on short counts done within two weeks of irradiation.

Elemental analyses of modern dust in southern Nevada and California

USGS Publications Warehouse

Reheis, M.C.; Budahn, J.R.; Lamothe, P.J.

1999-01-01

Selected samples of modern dust collected in marble traps at sites in southern Nevada and California (Reheis and Kihl, 1995; Reheis, 1997) have been analyzed for elemental composition using instrumental neutron activation analysis (INAA) and inductively coupled plasma atomic emission spectroscopy (ICP-AES) and inductively coupled plasma mass spectroscopy (ICP-MS). For information on these analytical techniques and their levels of precision and accuracy, refer to Baedecker and McKown (1987) for INAA, to Briggs (1996) for ICP-AES, and to Briggs and Meier (1999) for ICP-MS. This report presents the elemental compositions obtained using these techniques on dust samples collected from 1991 through 1997.The dust-trap sites were established at varying times; some have been maintained since 1984, others since 1991. For details on site location, dust-trap construction, and collection techniques, see Reheis and Kihl (1995) and Reheis (1997). Briefly, the trap consists of a coated angel-food cake pan painted black on the outside and mounted on a post about 2 m above the ground. Glass marbles rest on a circular piece of galvanized hardware cloth (now replaced by stainless-steel mesh), which is fitted into the pan so that it rests 3-4 cm below the rim. The 2-m height eliminates most saltating sand-sized particles. The marbles simulate the effect of a gravelly fan surface and prevent dust that has filtered or washed into the bottom of the pan from being blown back out. The dust traps are fitted with two metal straps looped in an inverted basket shape; the top surfaces of the straps are coated with a sticky material that effectively discourages birds from roosting.

MR Elastography and Diffusion-Weighted Imaging of ex-vivo Prostate Cancer: quantitative comparison to histopathology

PubMed Central

Nir, Guy; Gagnon, Louis O.; Ischia, Joseph; Jones, Edward C.; Chang, Silvia; Yung, Andrew; Honarvar, Mohammad; Fazli, Ladan; Goldenberg, Larry; Rohling, Robert; Sinkus, Ralph; Kozlowski, Piotr

2017-01-01

Purpose 1) to develop a Magnetic Resonance Elastography (MRE) system for imaging of the ex-vivo human prostate, 2) to assess the diagnostic power of mono-frequency and multi-frequency MRE and diffusion weighted imaging (DWI) alone and combined as correlated with histopathology in a patient study. Materials and Methods An electromagnetic driver was designed specifically for MRE studies in small-bore MR scanners. Ex-vivo prostate specimens (post-fixation) of fourteen patients who underwent radical prostatectomy were imaged with MRE at 7 T (nine cases had DWI). In six patients, the MRE examination was performed at three frequencies (600, 800, 1000 Hz) to extract the power-law exponent Gamma. The images were registered to wholemount pathology slides marked with the Gleason score. The areas under the Receiver-Operator-Characteristic curves (AUC) were calculated. Results The methods were validated in a phantom study and demonstrated that (i) the driver does not interfere with the acquisition process, (ii) the driver can generate amplitudes greater than 100 μm for frequencies <1kHz. In the quantitative study, cancerous tissue with Gleason score at least 3+3 was distinguished from normal tissue in the peripheral zone with an average AUC of 0.75 (Gd), 0.75 (Gl), 0.70 (Gamma-Gd), 0.68 (ADC), and 0.82 (Gd+Gl+ADC). The differentiation between PZ and CG was modest for Gd (p<0.07), Gl (p<0.06) but not significant for Gamma (p<0.2). A correlation of 0.4 kPa/h was found between fixation time of the prostate specimen to the stiffness of the tissue which could affect the diagnostic power results. Conclusion DWI and MRE may provide complementary information; in fact MRE performed better than ADC in distinguishing normal from cancerous tissue in some cases. Multi-frequency (Gamma) analysis did not appear to improve the results. However, in light of effect of tissue fixation, the clinical implication of our results may be inconclusive and more experiments are needed. PMID:25382459

In situ characterization of N-carboxy anhydride polymerization in nanoporous anodic alumina.

PubMed

Lau, K H Aaron; Duran, Hatice; Knoll, Wolfgang

2009-03-12

Poly(gamma-benzyl-L-glutamate) (PBLG) has been a popular model polypeptide for a range of physicochemical studies, and its modifiable ester side chains make it an attractive platform for various potential applications. Thin films of Poly(gamma-benzyl-L-glutamate) PBLG were surface grafted within nanoporous anodic alumina (AAO) by surface-initiated polymerization of the N-carboxy anhydride of benzyl-L-glutamate (BLG-NCA). The grafting process was characterized by optical waveguide spectroscopy (OWS), infrared spectroscopy (FT-IR), and scanning electron microscopy (SEM). OWS was able to track the PBLG layer thickness increase in situ, and ex situ FT-IR gave complementary information on the PBLG chain's secondary structure. Transitions in the PBLG growth rate could be correlated with transitions in the polypeptide secondary structure. The emergence of a three-dimensional, anisotropic PBLG morphology within the cylindrical pores of the AAO membrane was also identified as the grafted PBLG average layer thickness increased. Comparison of the PBLG/AAO results with those on a planar silicon dioxide surface indicated that both the conformational transitions and the PBLG nanostructure development could be attributed to the confining geometry within the pores of the nanoporous AAO matrix. The use of a nanoporous AAO matrix, combined with the surface grafting of a thin film of PBLG chains with multiple modifiable side chains, could potentially offer a nanoporous platform with a very high density of functional sites.

Microphysics in the Gamma-Ray Burst Central Engine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Janiuk, Agnieszka, E-mail: agnes@cft.edu.pl

We calculate the structure and evolution of a gamma-ray burst central engine where an accreting torus has formed around the newly born black hole. We study the general relativistic, MHD models and we self-consistently incorporate the nuclear equation of state. The latter accounts for the degeneracy of relativistic electrons, protons, and neutrons, and is used in the dynamical simulation, instead of a standard polytropic γ -law. The EOS provides the conditions for the nuclear pressure in the function of density and temperature, which evolve with time according to the conservative MHD scheme. We analyze the structure of the torus andmore » outflowing winds, and compute the neutrino flux emitted through the nuclear reaction balance in the dense and hot matter. We also estimate the rate of transfer of the black-hole rotational energy to the bipolar jets. Finally, we elaborate on the nucleosynthesis of heavy elements in the accretion flow and the wind, through computations of the thermonuclear reaction network. We discuss the possible signatures of the radioactive element decay in the accretion flow. We suggest that further detailed modeling of the accretion flow in the GRB engine, together with its microphysics, may be a valuable tool to constrain the black-hole mass and spin. It can be complementary to the gravitational wave analysis if the waves are detected with an electromagnetic counterpart.« less

Principles and status of neutron-based inspection technologies

NASA Astrophysics Data System (ADS)

Gozani, Tsahi

2011-06-01

Nuclear based explosive inspection techniques can detect a wide range of substances of importance for a wide range of objectives. For national and international security it is mainly the detection of nuclear materials, explosives and narcotic threats. For Customs Services it is also cargo characterization for shipment control and customs duties. For the military and other law enforcement agencies it could be the detection and/or validation of the presence of explosive mines, improvised explosive devices (IED) and unexploded ordnances (UXO). The inspection is generally based on the nuclear interactions of the neutrons (or high energy photons) with the various nuclides present and the detection of resultant characteristic emissions. These can be discrete gamma lines resulting from the thermal neutron capture process (n,γ) or inelastic neutron scattering (n,n'γ) occurring with fast neutrons. The two types of reactions are generally complementary. The capture process provides energetic and highly penetrating gamma rays in most inorganic substances and in hydrogen, while fast neutron inelastic scattering provides relatively strong gamma-ray signatures in light elements such as carbon and oxygen. In some specific important cases unique signatures are provided by the neutron capture process in light elements such as nitrogen, where unusually high-energy gamma ray is produced. This forms the basis for key explosive detection techniques. In some cases the elastically scattered source (of mono-energetic) neutrons may provide information on the atomic weight of the scattering elements. The detection of nuclear materials, both fissionable (e.g., 238U) and fissile (e.g., 235U), are generally based on the fissions induced by the probing neutrons (or photons) and detecting one or more of the unique signatures of the fission process. These include prompt and delayed neutrons and gamma rays. These signatures are not discrete in energy (typically they are continua) but temporally and energetically significantly different from the background, thus making them readily distinguishable. The penetrability of neutrons as probes and signatures as well as the gamma ray signatures make neutron interrogation applicable to the inspection of large conveyances such as cars, trucks, marine containers and also smaller objects like explosive mines concealed in the ground. The application of nuclear interrogation techniques greatly depends on operational requirements. For example explosive mines and IED detection clearly require one-sided inspection, which excludes transmission based inspection (e.g., transmission radiography) and greatly limits others. The technologies developed over the last decades are now being implemented with good results. Further advances have been made over the last several years that increase the sensitivity, applicability and robustness of these systems. The principle, applications and status of neutron-based inspection techniques will be reviewed.

Elemental depletions in Antarctic micrometeorites and Arctic cosmic spherules: Comparison and relationships

NASA Technical Reports Server (NTRS)

Presper, T.; Kurat, G.; Koeberl, C.; Palme, H.; Maurette, Michel

1993-01-01

Antarctic micrometeorites (MM's) and Arctic cosmic spherules (CS's) have bulk compositions comparable to those of chondritic meteorites. However, abundance of Na, Ca, Mn, Ni, Co, and S are commonly lower in MM's and CS's as compared to chondrites. Our SEM, EMP, and INAA studies suggest that these elemental depletions in unmelted MM's are likely to be due to leaching of soluble components from the MM's in the upper atmosphere and the melt ice water. Depletions in CS's appear to be mainly due to volatilization during melting in the atmosphere or to sampling bias during aggregate formation or parent rock break-up.

Development of a complex of instrumental nuclear-physical methods to detect PGE, Re, Au, and Ag in hard-to-analyze rocks and complex ores

NASA Astrophysics Data System (ADS)

Kolmogorov, Yu. P.; Mezentsev, N. A.; Mironov, A. G.; Parkhomenko, V. S.; Spiridonov, A. M.; Shaporenko, A. D.; Yusupov, T. S.; Zhmodik, S. M.; Zolotarev, K. V.; Anoshin, G. N.

2009-05-01

A system of methods to detect platinum group elements (PGE): Re, Au, and Ag in hard-to-analyze rocks and complex ores has been developed. It applies the SRXRF for Ru, Rh, Pd, and Ag and the INAA method for Os, Ir, Pt and Ag and implies mechanoactivation of probes to study. The results of measurement of standard samples of carbonaceous rocks and ores in order to PGE, gold, and silver confirm the possibility of detecting some of the above-listed elements with a detection limit of 10 ppb.

Thermochromatography and activation analysis

NASA Astrophysics Data System (ADS)

Stattarov, G. S.; Kist, A. A.

1999-01-01

Gas thermochromatography is a promising method in combination with neutron activation analysis. The procedure includes heating of irradiated samples in a stream of reacting gas carrier (air, chlorine, etc.) or heating in presence of compounds evolving gas at high temperatures. Gaseous products are passed through a tube with certain temperature gradient filled with various sorbents and the gases condense in different parts of the column. Studies of the processes of producing and trapping of volatile compounds allowed to work out various set-ups of apparatus with sorption tubes of various length and various temperature gradients, various filters, sorbents, etc. Sensitivity of these methods is sufficiently better then in INAA.

Selenium, tellurium and precious metal mineralogy in Uchalinsk copper-zinc-pyritic district, the Urals

NASA Astrophysics Data System (ADS)

Vikentev, I.

2016-04-01

During processing the most of Au, Ag, Se, Te, Pb, Bi, Sb, Hg as well as notable part of Cu, Zn and Cd fail for tailings and became heavy metal pollutants. Modes of occurrence of Au, Ag, Te and Se covers two giant VMS deposits: Uchaly (intensively deformed) and Uzelginsk (altered by late hydrothermal processes) as well as middle-sized Molodezn and West Ozern deposits (nondeformed) have been studied. Mineral forms of these elements as well as their presence in disperse mode in common ore minerals (pyrite, chalcopyrite, sphalerite) have been studied using SEM, EPMA, INAA, ICP-MS and LA-ICP-MS.

Targeted Analysis of KLF6/KLF6-SV1 Regulating Pathways in Prostate Cancer Development and Metastasis

DTIC Science & Technology

2011-09-01

and KLF6-SV1 it will be important to define the functionality of the putative NLS, the 5BR, as well as the role of nucleo-cytoplasmic shuttling in...aa EGFP -56 aa -16 aa KLF6 KLF6-SV1 5BR ZF,ZF~F3 ZF, ZF2 ZF3 l29KLF6 57KLF6 17KLF6 located near or within other important domains that...the transporter protein Crm1/Xpo1, first discovered in yeast [33–36]. Subcellular localization and protein turnover are two related events that are

Iodine-xenon studies of petrographically and chemically characterized Chainpur chondrules

NASA Technical Reports Server (NTRS)

Swindle, T. D.; Caffee, M. W.; Hohenberg, C. M.; Lindstrom, M. M.; Taylor, G. J.

1991-01-01

INAA, noble gas, and petrographic studies conducted on samples of 18 chondrules and matric material from the Chainpur (LL3) indicate that the I-129/I-127 ratio, R(0), varies by a factor of more than 10 among the chondrules. This corresponds to a greater-than-50 Ma span in apparent I-Xe ages. Models which invoke either gas-dust mixing or nebular heterogeneity cannot satisfactorily explain these data, any more than can hypotheses which attribute the variations to differences in formation age, metamorphic rate, or time of aqueous alteration. It is alternatively suggested that the variations represent periods of low-grade shock events.

The TAROT Suspected Variable Star Catalog

NASA Astrophysics Data System (ADS)

Damerdji, Y.; Klotz, A.; Boër, M.

2007-04-01

TAROT (Télescope à Action Rapide pour les Objets Transitoires) is a robotic observatory designed to observe very early optical transients of gamma-ray bursts (GRBs). As GRBs do not often occur, we use TAROT for various other celestial targets spread over the sky. For every field observed by TAROT, we computed the magnitudes of every star. From this work, we found 1175 new variable stars brighter than 17 mag. We selected the best variable star candidates and compiled them in the TSVSC1 (TAROT Suspected Variable Star Catalog, ver. 1), which also contains Fourier-series coefficients that fit the light curves. Based on observations collected with the TAROT instrument at the Calern Observatory, France. Complementary observations were carried out with the T80 telescope at the Observatoire de Haute-Provence, France. Additional material described in § 5 is available in electronic format at the CDS at http://cdsweb.u-strasbg.fr/cgi-bin/qcat?J/AJ/.

The Swift GRB Host Galaxy Legacy Survey

NASA Astrophysics Data System (ADS)

Perley, Daniel A.

2015-01-01

I introduce the Swift Host Galaxy Legacy Survey (SHOALS), a comprehensive multiwavelength program to characterize the demographics of the GRB host population across its entire redshift range. Using unbiased selection criteria we have designated a subset of 130 Swift gamma-ray bursts which are now being targeted with intensive observational follow-up. Deep Spitzer imaging of every field has already been obtained and analyzed, with major programs ongoing at Keck, GTC, and Gemini to obtain complementary optical/NIR photometry to enable full SED modeling and derivation of fundamental physical parameters such as mass, extinction, and star-formation rate. Using these data I will present an unbiased measurement of the GRB host-galaxy luminosity and mass functions and their evolution with redshift between z=0 and z=5, compare GRB hosts to other star-forming galaxy populations, and discuss implications for the nature of the GRB progenitor and the ability of GRBs to probe cosmic star-formation.

Constraints on dark matter models from a Fermi LAT search for high-energy cosmic-ray electrons from the Sun

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ajello, M.; Atwood, W. B.; Baldini, L.

During its first year of data taking, the Large Area Telescope (LAT) onboard the Fermi Gamma-Ray Space Telescope has collected a large sample of high-energy cosmic-ray electrons and positrons (CREs). We present the results of a directional analysis of the CRE events, in which we searched for a flux excess correlated with the direction of the Sun. Two different and complementary analysis approaches were implemented, and neither yielded evidence of a significant CRE flux excess from the Sun. Here, we derive upper limits on the CRE flux from the Sun’s direction, and use these bounds to constrain two classes ofmore » dark matter models which predict a solar CRE flux: (1) models in which dark matter annihilates to CREs via a light intermediate state, and (2) inelastic dark matter models in which dark matter annihilates to CREs.« less

Constraints on dark matter models from a Fermi LAT search for high-energy cosmic-ray electrons from the Sun

DOE PAGES

Ajello, M.; Atwood, W. B.; Baldini, L.; ...

2011-08-15

During its first year of data taking, the Large Area Telescope (LAT) onboard the Fermi Gamma-Ray Space Telescope has collected a large sample of high-energy cosmic-ray electrons and positrons (CREs). We present the results of a directional analysis of the CRE events, in which we searched for a flux excess correlated with the direction of the Sun. Two different and complementary analysis approaches were implemented, and neither yielded evidence of a significant CRE flux excess from the Sun. Here, we derive upper limits on the CRE flux from the Sun’s direction, and use these bounds to constrain two classes ofmore » dark matter models which predict a solar CRE flux: (1) models in which dark matter annihilates to CREs via a light intermediate state, and (2) inelastic dark matter models in which dark matter annihilates to CREs.« less

Jet Mixing Enhancement by Feedback Control

NASA Technical Reports Server (NTRS)

Glauser, Mark; Taylor, Jeffrey

1999-01-01

The objective of this work has been to produce methodologies for high speed jet noise reduction based on natural mechanisms and enhanced feedback control to affect frequencies and structures in a prescribed manner. In this effort the two-point hot wire measurements obtained in the Langley jet facility by Ukeiley were used in conjuction with linear stochastic estimation (LSE) to implement the LSE component of the complementary technique. This method combines the Proper Orthogonal Decomposition (POD) and LSE to provide an experimental low dimensional time dependent description of the flow field. From such a description it should be possible to identify short time high strain rate events in the jet which contribute to the noise. The main task completed for this effort is summarized: LSE experiments were performed at the downstream locations where the two point hot wire measurements have been obtained by Ukeiley. These experiments involved sampling simultaneously hot wire signals from a relatively course spatial grid in gamma and theta. From this simultaneous data, coupled with the two-point measurements of Ukeiley via the LSE components of the complementary technique, an experimental low dimensional description of the jet at 4, 5, 6, 7 and 8 diameters downstream was obtained for Mach numbers of 0.3 and 0.6. We first present an overview of the theory involved. We finish up with a statement of the work performed and finally provide charts from a 1999 APS talk which summarizes the results.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

PubMed Central

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-01-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

Comparing the birth rate of stellar black holes in binary black hole mergers and long gamma-ray bursts

NASA Astrophysics Data System (ADS)

Atteia, J.-L.; Dezalay, J.-P.; Godet, O.; Klotz, A.; Turpin, D.; Bernardini, M. G.

2018-02-01

Context. Gravitational wave interferometers have proven the existence of a new class of binary black hole (BBH) weighing tens of solar masses, and have provided the first reliable measurement of the rate of coalescing black holes (BHs) in the local Universe. Furthermore, long gamma-ray bursts (GRBs) detected with gamma-ray satellites are believed to be associated with the birth of stellar-mass BHs, providing a measure of the rate of these events across the history of the Universe, thanks to the measure of their cosmological redshift. These two types of sources, which are subject to different detection biases and involve BHs born in different environments with potentially different characteristics, provide complementary information on the birth rate of stellar BHs. Aim. We compare the birth rates of BHs found in BBH mergers and in long GRBs. Methods: We construct a simple model that makes reasonable assumptions on the history of GRB formation, and takes into account some major uncertainties, like the beaming angle of GRBs or the delay between the formation of BBHs and their coalescence. We use this model to evaluate the ratio of the number of stellar mass BHs formed in BBH mergers to those formed in GRBs. Results: We find that in our reference model the birth rate of stellar BHs in BBH mergers represents a significant fraction of the rate of long GRBs and that comparable birth rates are favored by models with moderate beaming angles. These numbers, however, do not consider subluminous GRBs, which may represent another population of sources associated with the birth of stellar mass BHs. We briefly discuss this result in view of our understanding of the progenitors of GRBs and BBH mergers, and we emphasize that this ratio, which will be better constrained in the coming years, can be directly compared with the prediction of stellar evolution models if a single model is used to produce GRBs and BBH mergers with the same assumptions.

Results and prospects in multi-messenger particle astrophysics

NASA Astrophysics Data System (ADS)

Mostafa, Miguel

2017-01-01

In high-energy particle astrophysics the old days were certainly not better than these. Our field has thrived in the past decade with experiments covering thousands of square kilometers to measure the suppression in the flux of the highest energy cosmic rays ever observed, instrumenting a cubic kilometer of Antarctic ice to discover astrophysical neutrinos, and measuring a change in arm length as small as 10-19 m for the ground-breaking direct observation of gravitational waves. Additionally, the current generation of space-borne and ground-based gamma-ray experiments have revealed a plethora of gamma-ray sources, including pulsars, compact binaries, the galactic center, and extragalactic sources such as starburst galaxies and radio galaxies. Before the next generation of instruments bring us yet another order of magnitude in sensitivity, we can combine current observations to probe physics beyond the standard model, and to extend the high-energy frontier well above the energies accessible to laboratory accelerators. One example of this potential is the search for dark-matter annihilation and decay products. To use the multi-messenger approach effectively for probing dark-matter signatures and physics beyond the LHC energy requires understanding the origin (or acceleration mechanism) and the propagation processes. High energy protons and nuclei, neutrinos, gamma-rays, X-rays, and gravitational waves bring new and complementary views of the astrophysical sources. By comparing observations through different windows, we can use the sites of violent phenomena as a laboratory to probe the physical processes under extreme conditions throughout the Universe, and to test the fundamental laws of particle physics and gravitation. As a community we need to engage in a bold synergistic approach to understanding the violent processes that give rise to the high-energy cosmic phenomena in the Universe. In this invited talk, I will present on-going multi-messenger studies to obtain new information about cosmic sources, and I will discuss the prospects of combining data from the electromagnetic, particle, and gravitational windows to advance high energy astrophysics into a new era.

Preliminary report on geophysical well-logging activity on the Salton Sea Scientific Drilling Project, Imperial Valley, California

USGS Publications Warehouse

Paillet, Frederick L.; Morin, R.H.; Hodges, H.E.

1986-01-01

The Salton Sea Scientific Drilling Project has culminated in a 10,564-ft deep test well, State 2-14 well, in the Imperial Valley of southern California. A comprehensive scientific program of drilling, coring, and downhole measurements, which was conducted for about 5 months, has obtained much scientific information concerning the physical and chemical processes associated with an active hydrothermal system. This report primarily focuses on the geophysical logging activities at the State 2-14 well and provides early dissemination of geophysical data to other investigators working on complementary studies. Geophysical-log data were obtained by a commercial logging company and by the U.S. Geological Survey (USGS). Most of the commercial logs were obtained during three visits to the site; only one commercial log was obtained below a depth of 6,000 ft. The commercial logs obtained were dual induction, natural gamma, compensated neutron formation density, caliper and sonic. The USGS logging effort consisted of four primary periods, with many logs extending below a depth of 6,000 ft. The USGS logs obtained were temperature, caliper, natural gamma, gamma spectral, epithermal neutron, acoustic velocity, full-waveform, and acoustic televiewer. Various problems occurred throughout the drilling phase of the Salton Sea Scientific Drilling Project that made successful logging difficult: (1) borehole constrictions, possibly resulting from mud coagulation, (2) maximum temperatures of about 300 C, and (3) borehole conditions unfavorable for logging because of numerous zones of fluid loss, cement plugs, and damage caused by repeated trips in and out of the hole. These factors hampered and compromised logging quality at several open-hole intervals. The quality of the logs was dependent on the degree of probe sophistication and sensitivity to borehole-wall conditions. Digitized logs presented were processed on site and are presented in increments of 1,000 ft. A summary of the numerous factors that may be relevant to this interpretation also is presented. (Lantz-PTT)

s-process nucleosynthesis in massive stars: new results on {sup 60}Fe, {sup 62}Ni and {sup 64}Ni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Domingo-Pardo, C.; Forschungszentrum Karlsruhe, Institut fuer Kernphysik, 76021 Karlsruhe; Dillmann, I.

2009-01-28

The s process synthesizes the elements between Fe and Sr in massive stars during two major evolutionary stages, convective core He burning and C shell burning. This scenario implies fascinating consequences for the chemical evolution of the star. For instance, the neutron capture rate at each isotope can have a big influence on the production of many of the subsequent higher mass isotopes. Correspondingly, one needs to know the (n,{gamma}) cross sections of the involved isotopes with high accuracy in order to determine the abundance pattern reliably and to obtain a consistent picture of this stage. This contribution gives anmore » overview on recent and future experiments for the Fe/Ni nucleosynthesis in massive stars. New results on {sup 60}Fe, {sup 62}Ni and {sup 64}Ni are reported. {sup 60}Fe is mostly produced during the short convective C shell burning phase, where peak densities of {approx}10{sup 11} cm{sup -3} are reached, prior to the SN explosion. The stellar (n,{gamma}) cross section of {sup 60}Fe could be measured with a 1 {mu}g sample obtained at PSI (Switzerland), which was sufficient for an activation measurement using the intense, quasi-stellar neutron field for a thermal energy of 25 keV at the Karlsruhe Van de Graaff accelerator. The FZK accelerator was also used for an activation of {sup 62}Ni, whereas in this case, the number of {sup 63}Ni nuclei produced were determined via accelerator mass spectroscopy at the Maier-Leibnitz-Laboratorium in Garching/Munich. The (n,{gamma}) cross section of {sup 64}Ni at a stellar temperature equivalent to 50 keV has been measured in a collaboration between FZK Karlsruhe and PTB Braunschweig. Finally, complementary time of flight measurements on the Fe and Ni isotopes over a broad energy range are planned at the white neutron source n lowbar TOF of CERN for the future campaign in 2009.« less

SU-E-T-205: Improving Quality Assurance of HDR Brachytherapy: Verifying Agreement Between Planned and Delivered Dose Distributions Using DICOM RTDose and Advanced Film Dosimetry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palmer, A L; University of Surrey, Guildford, Surrey; Bradley, D A

Purpose: HDR brachytherapy is undergoing significant development, and quality assurance (QA) checks must keep pace. Current recommendations do not adequately verify delivered against planned dose distributions: This is particularly relevant for new treatment planning system (TPS) calculation algorithms (non TG-43 based), and an era of significant patient-specific plan optimisation. Full system checks are desirable in modern QA recommendations, complementary to device-centric individual tests. We present a QA system incorporating TPS calculation, dose distribution export, HDR unit performance, and dose distribution measurement. Such an approach, more common in external beam radiotherapy, has not previously been reported in the literature for brachytherapy.more » Methods: Our QA method was tested at 24 UK brachytherapy centres. As a novel approach, we used the TPS DICOM RTDose file export to compare planned dose distribution with that measured using Gafchromic EBT3 films placed around clinical brachytherapy treatment applicators. Gamma analysis was used to compare the dose distributions. Dose difference and distance to agreement were determined at prescription Point A. Accurate film dosimetry was achieved using a glass compression plate at scanning to ensure physically-flat films, simultaneous scanning of known dose films with measurement films, and triple-channel dosimetric analysis. Results: The mean gamma pass rate of RTDose compared to film-measured dose distributions was 98.1% at 3%(local), 2 mm criteria. The mean dose difference, measured to planned, at Point A was -0.5% for plastic treatment applicators and -2.4% for metal applicators, due to shielding not accounted for in TPS. The mean distance to agreement was 0.6 mm. Conclusion: It is recommended to develop brachytherapy QA to include full-system verification of agreement between planned and delivered dose distributions. This is a novel approach for HDR brachytherapy QA. A methodology using advanced film dosimetry and gamma comparison to DICOM RTDose files has been demonstrated as suitable to fulfil this need.« less

Downhole logs of natural gamma radiation and magnetic susceptibility and their use in interpreting lithostratigraphy in AND-1B, Antarctica

NASA Astrophysics Data System (ADS)

Williams, T.; Morin, R. H.; Jarrard, R. D.; Jackolski, C. L.; Henrys, S. A.; Niessen, F.; Magens, D.; Kuhn, G.; Monien, D.; Powell, R. D.

2010-12-01

The ANDRILL McMurdo Ice Shelf (MIS) project drilled 1285 metres of sediment representing the last 14 million years of glacial history. Downhole geophysical logs were acquired to a depth of 1018 metres, and are complementary to data acquired from the core itself. We describe here the natural gamma radiation (NGR) and magnetic susceptibility logs, and their application to understanding lithological and paleoenvironmental change at ANDRILL McMurdo Ice Shelf Hole AND-1B. Natural gamma radiation logs cover the whole interval from the sea floor to 1018 metres, and magnetic susceptibility and other logs covered the open-hole intervals between 692-1018 and 237-342 metres. NGR logs were stacked and corrected for signal attenuation through the drill pipe, and magnetic susceptibility logs were corrected for drift. In the upper part of AND-1B, clear alternations between low and high NGR values distinguish between diatomite (lacking minerals containing naturally radioactive K, U, and Th) and diamict (containing K-bearing clays, K-feldspar, and heavy minerals). In the lower open-hole logged section, NGR and magnetic susceptibility can also distinguish claystones (rich in K-bearing clay minerals, relatively low in magnetite) and diamicts (relatively high in magnetite), while sandstones generally have high resistivity log values at AND-1B. On the basis of these three downhole logs, three sets of facies can be predicted correctly for 74% of the 692-1018m interval. The logs were then used to predict facies for the 7% of this interval that was unrecovered by coring. Similarly, the NGR log provides the best information on the lithology of the poorly recovered top 25m of AND-1B. Given the understanding of the physical property characteristics of different facies, it is also possible to identify subtle changes in lithology from the physical properties, and help refine parts of the lithostratigraphy (for example, the varying terrigenous content of diatomites).

Sudbury project (University of Muenster-Ontario Geological Survey): Petrology, chemistry, and origin of breccia formations

NASA Technical Reports Server (NTRS)

Stoeffler, D.; Deutsch, A.; Avermann, M.; Brockmeyer, P.; Lakomy, R.; Mueller-Mohr, V.

1992-01-01

Within the Sudbury Project of the University of Muenster and the Ontario Geological Survey special emphasis was put on the breccia formations exposed at the Sudbury structure (SS) because of their crucial role for the impact hypothesis. They were mapped and sampled in selected areas of the north, east, and south ranges of the SS. The relative stratigraphic positions of these units are summarized. Selected samples were analyzed by optical microscopy, SEM, microprobe, XRF and INAA, Rb-Sr and SM-Nd-isotope geochemistry, and carbon isotope analysis. The results of petrographic and chemical analysis for those stratigraphic units that were considered the main structural elements of a large impact basin are summarized.

Bullet identification: a case of a fatal hunting accident resolved by comparison of lead shot using instrumental neutron activation analysis.

PubMed

Capannesi, G; Sedda, A F

1992-03-01

Bullet identification by chemical analysis often provides a powerful clue in forensic science. A case is reported in which a hunting accident was resolved by using instrumental neutron activation analysis (INAA) for direct comparison of the trace element content in lead shot. Different preparation batches of lead shot appear to have a high within-group composition homogeneity, and good differentiation is achieved between different batches. Determination of the nickel and antimony content on a bush branch demonstrated that the branch had been perforated by one of the shot pellets, and this helped the detectives in reconstruction of the crime scene.

Elemental contents in Napoleon's hair cut before and after his death: did Napoleon die of arsenic poisoning?

PubMed

Lin, Xilei; Alber, D; Henkelmann, R

2004-05-01

Whether or not Napoleon died of arsenic poisoning is an open question on which debate has been active since 1960. This work examined several of his hairs, cut at different times and in different places: two pieces cut the day after his death on the island of St. Helena (1821) and two pieces cut seven years earlier (1814) during his first exile on the island of Elba. INAA results show that all of the samples of Napoleon's hair have an elevated arsenic concentration. These results disfavor the arsenic poisoning theory. Aside from arsenic, 18 other elements are reported, providing additional information for examining the arsenic poisoning theory.

Large scale intercomparison of aerosol trace element analysis by different analytical methods

NASA Astrophysics Data System (ADS)

Bombelka, E.; Richter, F.-W.; Ries, H.; Wätjen, U.

1984-04-01

The general agreement of PIXE analysis with other methods (INAA, XRF, AAS, OES-ICP, and PhAA) is very good based on the analysis of filter pieces taken from 250 aerosol samples. It is better than 5% for Pb and Zn, better than 10% for V, Cr, and Mn, indicating that the accuracy of PIXE analysis can be within 10%. For elements such as Cd and Sb, difficult to analyze by PIXE because of their low mass content in the sample, the agreement is given mainly by the reproducibility of the method (20% to 30%). Similar agreement is found for sulfur, after taking account of the depth distribution of the aerosol in the filter.

Different techniques for characterizing single-walled carbon nanotube purity

NASA Astrophysics Data System (ADS)

Yuca, Neslihan; Camtakan, Zeyneb; Karatepe, Nilgün

2013-09-01

Transition-metal catalysts, fullerenes, graphitic carbon, amorphous carbon, and graphite flakes are the main impurities in carbon nanotubes. In this study, we demonstrate an easy and optimum method of cleaning SWCNTs and evaluating their purity. The purification method, which employed oxidative heat treatment followed by 6M HNO3, H2SO4, HNO3:H2SO4 and HCl acid reflux for 6h at 120°C and microwave digestion with 1.5M HNO3 for 0.5h at 210°C which was straightforward, inexpensive, and fairly effective. The purified materials were characterized by thermogravimetric analysis and nuclear techniques such as INAA, XRF and XRD.

Bulk and rare earth abundances in the Luna 16 soil levels A and D.

NASA Technical Reports Server (NTRS)

Gillum, D. E.; Ehmann, W. D.; Wakita, H.; Schmitt, R. A.

1972-01-01

Determination of the abundances of major, minor, and trace elements by means of sequential INAA (instrumental neutron activation analysis) in two Luna 16 soils, at levels A (about 7 cm depth) and D (about 30 cm depth). Abundances of the bulk elements in Luna 16 soils generally agree with the values reported by Vinogradov (1971). Elemental abundances of both bulk and trace elements are nearly the same for the two A and D soil levels. Overall, the chemical compositions of the two Luna 16 soils are more closely related to Apollo 11 soil 10084 than to Apollo 12 and 14 soils, with the exception of TiO2 abundances.-

Low background screening capability in the UK

NASA Astrophysics Data System (ADS)

Ghag, Chamkaur

2015-08-01

Low background rare event searches in underground laboratories seeking observation of direct dark matter interactions or neutrino-less double beta decay have the potential to profoundly advance our understanding of the physical universe. Successful results from these experiments depend critically on construction from extremely radiologically clean materials and accurate knowledge of subsequent low levels of expected background. The experiments must conduct comprehensive screening campaigns to reduce radioactivity from detector components, and these measurements also inform detailed characterisation and quantification of background sources and their impact, necessary to assign statistical significance to any potential discovery. To provide requisite sensitivity for material screening and characterisation in the UK to support our rare event search activities, we have re-developed our infrastructure to add ultra-low background capability across a range of complementary techniques that collectively allow complete radioactivity measurements. Ultra-low background HPGe and BEGe detectors have been installed at the Boulby Underground Laboratory, itself undergoing substantial facility re-furbishment, to provide high sensitivity gamma spectroscopy in particular for measuring the uranium and thorium decay series products. Dedicated low-activity mass spectrometry instrumentation has been developed at UCL for part per trillion level contaminant identification to complement underground screening with direct U and Th measurements, and meet throughput demands. Finally, radon emanation screening at UCL measures radon background inaccessible to gamma or mass spectrometry techniques. With this new capability the UK is delivering half of the radioactivity screening for the LZ dark matter search experiment.

Constraints on Lorentz Invariance Violation from Fermi -Large Area Telescope Observations of Gamma-Ray Bursts

NASA Technical Reports Server (NTRS)

Vasileiou, V.; Jacholkowska, A.; Piron, F.; Bolmont, J.; Courturier, C.; Granot, J.; Stecker, Floyd William; Cohen-Tanugi, J.; Longo, F.

2013-01-01

We analyze the MeV/GeV emission from four bright Gamma-Ray Bursts (GRBs) observed by the Fermi-Large Area Telescope to produce robust, stringent constraints on a dependence of the speed of light in vacuo on the photon energy (vacuum dispersion), a form of Lorentz invariance violation (LIV) allowed by some Quantum Gravity (QG) theories. First, we use three different and complementary techniques to constrain the total degree of dispersion observed in the data. Additionally, using a maximally conservative set of assumptions on possible source-intrinsic spectral-evolution effects, we constrain any vacuum dispersion solely attributed to LIV. We then derive limits on the "QG energy scale" (the energy scale that LIV-inducing QG effects become important, E(sub QG)) and the coefficients of the Standard Model Extension. For the subluminal case (where high energy photons propagate more slowly than lower energy photons) and without taking into account any source-intrinsic dispersion, our most stringent limits (at 95% CL) are obtained from GRB 090510 and are E(sub QG,1) > 7.6 times the Planck energy (E(sub Pl)) and E(sub QG,2) > 1.3×10(exp 11) GeV for linear and quadratic leading order LIV-induced vacuum dispersion, respectively. These limits improve the latest constraints by Fermi and H.E.S.S. by a factor of approx. 2. Our results disfavor any class of models requiring E(sub QG,1) < or approx. E(sub Pl)

Prospects for compact high-intensity laser synchrotron x-ray and gamma sources

NASA Astrophysics Data System (ADS)

Pogorelsky, I. V.

1997-03-01

A laser interacting with a relativistic electron beam behaves like a virtual wiggler of an extremely short period equal to half of the laser wavelength. This approach opens a route to relatively compact, high-brightness x-ray sources alternative or complementary to conventional synchrotron light sources. Although not new, the laser synchrotron source (LSS) concept is still waiting for a convincing demonstration. Available at the BNL Accelerator Test Facility (ATF), a high-brightness electron beam and the high-power CO2 laser may be used for prototype LSS demonstration. In a feasible demonstration experiment, 10-GW, 100-ps CO2 laser beam will be brought to a head-on collision with a 10-ps, 0.5-nC, 50 MeV electron bunch. Flashes of collimated 4.7 keV (2.6 Å) x-rays of 10-ps pulse duration, with a flux of ˜1019photons/sec, will be produced via linear Compton backscattering. The x-ray spectrum is tunable proportionally to the e-beam energy. A rational short-term extension of the proposed experiment would be further enhancement of the x-ray flux to the 1022 photons/sec level, after the ongoing ATF CO2 laser upgrade to 5 TW peak power and electron bunch shortening to 3 ps is realized. In the future, exploiting the promising approach of a high-gradient laser wake field accelerator, a compact "table-top" LSS of monochromatic gamma radiation may become feasible.

Constraints on Lorentz invariance violation from Fermi -Large Area Telescope observations of gamma-ray bursts

DOE PAGES

Vasileiou, V.; Jacholkowska, A.; Piron, F.; ...

2013-06-04

For this research, we analyze the MeV/GeV emission from four bright gamma-ray bursts (GRBs) observed by the Fermi Large Area Telescope to produce robust, stringent constraints on a dependence of the speed of light in vacuo on the photon energy (vacuum dispersion), a form of Lorentz invariance violation (LIV) allowed by some quantum gravity (QG) theories. First, we use three different and complementary techniques to constrain the total degree of dispersion observed in the data. Additionally, using a maximally conservative set of assumptions on possible source-intrinsic, spectral-evolution effects, we constrain any vacuum dispersion solely attributed to LIV. We then derivemore » limits on the QG energy scale (the energy scale where LIV-inducing QG effects become strong, E QG) and the coefficients of the Standard Model Extension. For the subluminal case (where high-energy photons propagate more slowly than lower-energy photons) and without taking into account any source-intrinsic dispersion, our most stringent limits (at 95% C.L.) are obtained from GRB 090510 and are E QG,1 > 7.6 times the Planck energy (E Pl) and E QG,2 > 1.3 × 10 11 GeV for linear and quadratic leading-order LIV-induced vacuum dispersion, respectively. In conclusion, these limits improve the latest constraints by Fermi and H.E.S.S. by a factor of ~2 . Our results disfavor any class of models requiring E QG,1 ≲ E Pl .« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghag, Chamkaur

Low background rare event searches in underground laboratories seeking observation of direct dark matter interactions or neutrino-less double beta decay have the potential to profoundly advance our understanding of the physical universe. Successful results from these experiments depend critically on construction from extremely radiologically clean materials and accurate knowledge of subsequent low levels of expected background. The experiments must conduct comprehensive screening campaigns to reduce radioactivity from detector components, and these measurements also inform detailed characterisation and quantification of background sources and their impact, necessary to assign statistical significance to any potential discovery. To provide requisite sensitivity for material screeningmore » and characterisation in the UK to support our rare event search activities, we have re-developed our infrastructure to add ultra-low background capability across a range of complementary techniques that collectively allow complete radioactivity measurements. Ultra-low background HPGe and BEGe detectors have been installed at the Boulby Underground Laboratory, itself undergoing substantial facility re-furbishment, to provide high sensitivity gamma spectroscopy in particular for measuring the uranium and thorium decay series products. Dedicated low-activity mass spectrometry instrumentation has been developed at UCL for part per trillion level contaminant identification to complement underground screening with direct U and Th measurements, and meet throughput demands. Finally, radon emanation screening at UCL measures radon background inaccessible to gamma or mass spectrometry techniques. With this new capability the UK is delivering half of the radioactivity screening for the LZ dark matter search experiment.« less

Recent Improvement of Measurement Instrumentation to Supervise Nuclear Operations and to Contribute Input Data to 3D Simulation Code - 13289

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mahe, Charly; Chabal, Caroline

2013-07-01

The CEA has developed many compact characterization tools to follow sensitive operations in a nuclear environment. Usually, these devices are made to carry out radiological inventories, to prepare nuclear interventions or to supervise some special operations. These in situ measurement techniques mainly take place at different stages of clean-up operations and decommissioning projects, but they are also in use to supervise sensitive operations when the nuclear plant is still operating. In addition to this, such tools are often associated with robots to access very highly radioactive areas, and thus can be used in accident situations. Last but not least, themore » radiological data collected can be entered in 3D calculation codes used to simulate the doses absorbed by workers in real time during operations in a nuclear environment. Faced with these ever-greater needs, nuclear measurement instrumentation always has to involve on-going improvement processes. Firstly, this paper will describe the latest developments and results obtained in both gamma and alpha imaging techniques. The gamma camera has been used by the CEA since the 1990's and several changes have made this device more sensitive, more compact and more competitive for nuclear plant operations. It is used to quickly identify hot spots, locating irradiating sources from 50 keV to 1500 keV. Several examples from a wide field of applications will be presented, together with the very latest developments. The alpha camera is a new camera used to see invisible alpha contamination on several kinds of surfaces. The latest results obtained allow real time supervision of a glove box cleaning operation (for {sup 241}Am contamination). The detection principle as well as the main trials and results obtained will be presented. Secondly, this paper will focus on in situ gamma spectrometry methods developed by the CEA with compact gamma spectrometry probes (CdZnTe, LaBr{sub 3}, NaI, etc.). The radiological data collected is used to quantify the activity of hot spots and can also then be entered in 3D models of nuclear plants to simulate intervention scenarios. Recent developments and results will be presented regarding this. Finally, thanks to a large amount of feedback, the interest of using complementary measurements will be discussed. In fact, the recent use of 3D simulation codes requires very accurate knowledge of nuclear plant radiological data. The use of coupled devices such as imaging devices, (gamma and alpha cameras), gamma spectrometry, dose rate mapping, collimated / un-collimated measurements and many other physical values gives an approach to the radiological knowledge of a process or plant with the lowest possible uncertainty. In line with this, the paper will conclude with the future developments and trials that could be assessed in that field of application. (authors)« less

MR elastography and diffusion-weighted imaging of ex vivo prostate cancer: quantitative comparison to histopathology.

PubMed

Sahebjavaher, Ramin S; Nir, Guy; Gagnon, Louis O; Ischia, Joseph; Jones, Edward C; Chang, Silvia D; Yung, Andrew; Honarvar, Mohammad; Fazli, Ladan; Goldenberg, S Larry; Rohling, Robert; Sinkus, Ralph; Kozlowski, Piotr; Salcudean, Septimiu E

2015-01-01

The purpose of this work was (1) to develop a magnetic resonance elastography (MRE) system for imaging of the ex vivo human prostate and (2) to assess the diagnostic power of mono-frequency and multi-frequency MRE and diffusion weighted imaging (DWI) alone and combined as correlated with histopathology in a patient study. An electromagnetic driver was designed specifically for MRE studies in small-bore MR scanners. Ex vivo prostate specimens (post-fixation) of 14 patients who underwent radical prostatectomy were imaged with MRE at 7 T (nine cases had DWI). In six patients, the MRE examination was performed at three frequencies (600, 800, 1000 Hz) to extract the power-law exponent Gamma. The images were registered to wholemount pathology slides marked with the Gleason score. The areas under the receiver-operator-characteristic curves (AUC) were calculated. The methods were validated in a phantom study and it was demonstrated that (i) the driver does not interfere with the acquisition process and (ii) the driver can generate amplitudes greater than 100 µm for frequencies less than 1 kHz. In the quantitative study, cancerous tissue with Gleason score at least 3 + 3 was distinguished from normal tissue in the peripheral zone (PZ) with an average AUC of 0.75 (Gd ), 0.75 (Gl ), 0.70 (Gamma-Gd ), 0.68 (apparent diffusion coefficient, ADC), and 0.82 (Gd  + Gl  + ADC). The differentiation between PZ and central gland was modest for Gd (p < 0.07), Gl (p < 0.06) but not significant for Gamma (p < 0.2). A correlation of 0.4 kPa/h was found between the fixation time of the prostate specimen and the stiffness of the tissue, which could affect the diagnostic power results. DWI and MRE may provide complementary information; in fact MRE performed better than ADC in distinguishing normal from cancerous tissue in some cases. Multi-frequency (Gamma) analysis did not appear to improve the results. However, in light of the effect of tissue fixation, the clinical implication of our results may be inconclusive and more experiments are needed. Copyright © 2014 John Wiley & Sons, Ltd.

The abrupt installation of the euxinic environment as reflected by the unconsolidated sediments of the western slope of the Black Sea off the Romanian shore

NASA Astrophysics Data System (ADS)

Duliu, Octavian G.; Oaie, Gheorghe; Bojar, Ana-Voica; Zinicovscaia, Inga; Culicov, Otilia-Ana; Frontasyeva, Marina V.; Gradinaru, Janet

2016-04-01

A 4,5 m long core containing unconsolidated sediments collected at a depth of 500 m on the western slope of the Black Sea, off Romanian shore was analyzed by Computed Tomography (CT), X-ray Diffraction (XRD), X-ray Fluorescence (XRF) and Instrumental Neutron Activation Analysis (INAA) in order to investigate the changes in the Black Sea environment during the past 10.5 - 12 ky. The most relevant information regarding unconsolidated sediments was furnished by the CT images, clearly indicating the moment when the euxinic environment settled on this sector of the Black Sea, presumably 2.7 ky ago. This event is represented by the sedimentation of a coccolithic mud consisting of alternation of dark and light thin laminae composed of terigenous and respectively coccoliths rich material. This type of mud is characteristic for the sedimentary unit 1, filling the uppermost 50 cm of the core. The observation was confirmed by subsequent XRF and INAA determinations, which show a high content of calcium carbonate related to accumulation of Emilliania huxley coccoliths as well as of minor elements such as iron, molybdenum and uranium, a typical characteristic of euxinic environment. For instance, the average content of Mo and U is 28 and respectively 4 time higher than the corresponding content of the Upper Continental Core (UCC), while the Fe/Al ratio is around 0.52. Moreover, the average chondrite normalized Ce content of sedimentary unite 1 is 1.37 ± 0.17, slightly higher than 1.22, the characteristic value for the UCC. The Ce data indicate a weak positive anomaly, characteristic also for an euxinic reducing environment. All these investigations confirm the abrupt installation at a depth of 500 m of an euxinic environment on the western slope of the Black Sea, euxinic environment persisting to present time.

Modal gating of muscle nicotinic acetylcholine receptors

NASA Astrophysics Data System (ADS)

Vij, Ridhima

Many ion channels exhibit multiple patterns of kinetic activity in single-channel currents. This behavior is rare in WT mouse muscle nicotinic acetylcholine receptors (AChRs), where A2C↔A2O gating events are well-described by single exponentials. Also, single-channel open probability (PO) is essentially homogeneous at a given agonist concentration in the WT receptors. Here I report that perturbations of almost all the residues in loop C (alpha188-alpha199, at the agonist binding site) generate heterogeneity in PO ('modes'). Such unsettled activity was apparent with an alanine substitution at all positions in loop C (except alphaY190 and alphaY198) and with different side chain substitutions at alphaP197 for both adult- and fetal-type AChRs. I used single channel electrophysiology along with site-directed mutagenesis to study modal gating in AChRs consequent to mutations/deletions in loop C. The multiple patterns of kinetic activity arose from the difference in agonist affinity rather than in intrinsic AChR gating. Out of the four different agonists used to study the modal behavior, acetylcholine (ACh) showed a higher degree of kinetic heterogeneity compared to others. The time constant for switching between modes was long (~mins), suggesting that they arise from alternative, stable protein conformations. By studying AChRs having only 1 functional binding site, I attempted to find the source of the affinity difference, which was traced mainly to the alphadelta agonist site. Affinity at the neurotransmitter binding site is mainly determined by a core of five aromatic residues (alphaY93, alphaW149, alphaY190, alphaY198 and deltaW57). Phenylalanine substitutions at all aromatic residues except alphaY93 resulted in elimination of modes. Modes were also eliminated by alanine mutation at deltaW57 on the complementary side but not at other aromatics. Also, by substituting four gamma subunit residues into the delta subunit on the complementary beta sheet, I found that modes were reduced. Based on our results, we propose that WT loop C has an important role in determining resting affinity, in part by making stable interactions with the complementary surface of the alphadelta binding pocket. We suggest a possible structural basis for the fluctuations caused by loop C perturbations and propose that at the alphadelta agonist binding site, both loop C and the complementary subunit surface can adopt alternative conformations and interact with each other with respect to the aromatic core, to cause the variations in affinity.

A multimodal approach to estimating vigilance using EEG and forehead EOG.

PubMed

Zheng, Wei-Long; Lu, Bao-Liang

2017-04-01

Covert aspects of ongoing user mental states provide key context information for user-aware human computer interactions. In this paper, we focus on the problem of estimating the vigilance of users using EEG and EOG signals. The PERCLOS index as vigilance annotation is obtained from eye tracking glasses. To improve the feasibility and wearability of vigilance estimation devices for real-world applications, we adopt a novel electrode placement for forehead EOG and extract various eye movement features, which contain the principal information of traditional EOG. We explore the effects of EEG from different brain areas and combine EEG and forehead EOG to leverage their complementary characteristics for vigilance estimation. Considering that the vigilance of users is a dynamic changing process because the intrinsic mental states of users involve temporal evolution, we introduce continuous conditional neural field and continuous conditional random field models to capture dynamic temporal dependency. We propose a multimodal approach to estimating vigilance by combining EEG and forehead EOG and incorporating the temporal dependency of vigilance into model training. The experimental results demonstrate that modality fusion can improve the performance compared with a single modality, EOG and EEG contain complementary information for vigilance estimation, and the temporal dependency-based models can enhance the performance of vigilance estimation. From the experimental results, we observe that theta and alpha frequency activities are increased, while gamma frequency activities are decreased in drowsy states in contrast to awake states. The forehead setup allows for the simultaneous collection of EEG and EOG and achieves comparative performance using only four shared electrodes in comparison with the temporal and posterior sites.

Segmentation and intensity estimation of microarray images using a gamma-t mixture model.

PubMed

Baek, Jangsun; Son, Young Sook; McLachlan, Geoffrey J

2007-02-15

We present a new approach to the analysis of images for complementary DNA microarray experiments. The image segmentation and intensity estimation are performed simultaneously by adopting a two-component mixture model. One component of this mixture corresponds to the distribution of the background intensity, while the other corresponds to the distribution of the foreground intensity. The intensity measurement is a bivariate vector consisting of red and green intensities. The background intensity component is modeled by the bivariate gamma distribution, whose marginal densities for the red and green intensities are independent three-parameter gamma distributions with different parameters. The foreground intensity component is taken to be the bivariate t distribution, with the constraint that the mean of the foreground is greater than that of the background for each of the two colors. The degrees of freedom of this t distribution are inferred from the data but they could be specified in advance to reduce the computation time. Also, the covariance matrix is not restricted to being diagonal and so it allows for nonzero correlation between R and G foreground intensities. This gamma-t mixture model is fitted by maximum likelihood via the EM algorithm. A final step is executed whereby nonparametric (kernel) smoothing is undertaken of the posterior probabilities of component membership. The main advantages of this approach are: (1) it enjoys the well-known strengths of a mixture model, namely flexibility and adaptability to the data; (2) it considers the segmentation and intensity simultaneously and not separately as in commonly used existing software, and it also works with the red and green intensities in a bivariate framework as opposed to their separate estimation via univariate methods; (3) the use of the three-parameter gamma distribution for the background red and green intensities provides a much better fit than the normal (log normal) or t distributions; (4) the use of the bivariate t distribution for the foreground intensity provides a model that is less sensitive to extreme observations; (5) as a consequence of the aforementioned properties, it allows segmentation to be undertaken for a wide range of spot shapes, including doughnut, sickle shape and artifacts. We apply our method for gridding, segmentation and estimation to cDNA microarray real images and artificial data. Our method provides better segmentation results in spot shapes as well as intensity estimation than Spot and spotSegmentation R language softwares. It detected blank spots as well as bright artifact for the real data, and estimated spot intensities with high-accuracy for the synthetic data. The algorithms were implemented in Matlab. The Matlab codes implementing both the gridding and segmentation/estimation are available upon request. Supplementary material is available at Bioinformatics online.

Distribution of siderophile and other trace elements in melt rock at the Chicxulub impact structure

NASA Technical Reports Server (NTRS)

Schuraytz, B. C.; Lindstrom, D. J.; Martinez, R. R.; Sharpton, V. L.; Marin, L. E.

1994-01-01

Recent isotopic and mineralogical studies have demonstrated a temporal and chemical link between the Chicxulub multiring impact basin and ejecta at the Cretaceous-Tertiary boundary. A fundamental problem yet to be resolved, however, is identification of the projectile responsible for this cataclysmic event. Drill core samples of impact melt rock from the Chichxulub structure contain Ir and Os abundances and Re-Os isotopic ratios indicating the presence of up to approx. 3 percent meteoritic material. We have used a technique involving microdrilling and high sensitivity instrumental neutron activation analysis (INAA) in conjunction with electron microprobe analysis to characterize further the distribution of siderophile and other trace elements among phases within the C1-N10 melt rock.

Petrology and geochemistry of VLT glasses from double drive tube 79001/2

NASA Technical Reports Server (NTRS)

Wentworth, Susan J.; Lindstrom, D. J.; Martinez, R. R.; Mckay, D. S.

1993-01-01

As a part of more general studies of soils from Apollo 17 double drive tube 79001/2, glasses from the 79001/2 core are being analyzed by a multidisciplinary approach including SEM/EDS and INAA. Efforts are currently focused on VLT (very low-Ti; TiO2 less than 1 wt%) mare glasses, which are common in 79001/2 and have also been found in other Apollo 17 soils. One of the primary objectives is to determine whether any or all of the Apollo 17 VLT glasses represent pristine volcanic compositions. In addition, the range of VLT glass compositions and possible relationships between the glasses and VLT lithic samples, for which some geochemical data have been obtained previously, is being defined.

Pituitary gland levels of mercury, selenium, iron, and zinc in an Alzheimer`s disease study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cornett, C.R.; Markesbery, W.R.; Wekstein, D.R.

1996-12-31

Mercury, iron, selenium, and zinc imbalances have been observed in comparisons between Alzheimer`s disease (AD) and control subject brains. Analyses of the pituitary gland have demonstrated that this organ retains relatively high concentrations of trace elements, including mercury, iron, and zinc. Our previous work has shown that the pituitary glands of AD and control subjects are typically higher in these trace elements than brain samples from the same subject. Instrumental neutron activation analysis (INAA) was used to compare the pituitary trace element levels of AD and control subjects. This study also describes the intrasubject relationships of brain trace element levelsmore » to those in the pituitary gland of AD and control subjects.« less

Tetraodon nigroviridis as a nonlethal model of infectious spleen and kidney necrosis virus (ISKNV) infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu Xiaopeng; Huang Lichao; Weng Shaoping

Infectious spleen and kidney necrosis virus (ISKNV) is the type species of the genus Megalocytivirus, family Iridoviridae. We have previously established a high mortality ISKNV infection model of zebrafish (Danio rerio). In this study, a nonlethal Tetraodon nigroviridis model of ISKNV infection was established. ISKNV infection did not cause lethal disease in Tetraodon but could infect almost all the organs of this species. Electron microscopy showed ISKNV particles were present in infected tissues. Immunofluorescence and quantitative real-time PCR analysis showed that nearly all the virions and infected cells were cleared at 14 d postinfection. The expression profiles of interferon-{gamma} andmore » tumor necrosis factor-{alpha} gene in response to ISKNV infection were significantly different in Tetraodon and zebrafish. The establishment of the nonlethal Tetraodon model of ISKNV infection can offer a valuable tool complementary to the zebrafish infection model for studying megalocytivirus disease, fish immune systems, and viral tropism.« less

Presence of an SH2 domain in the actin-binding protein tensin.

PubMed

Davis, S; Lu, M L; Lo, S H; Lin, S; Butler, J A; Druker, B J; Roberts, T M; An, Q; Chen, L B

1991-05-03

The molecular cloning of the complementary DNA coding for a 90-kilodalton fragment of tensin, an actin-binding component of focal contacts and other submembraneous cytoskeletal structures, is reported. The derived amino acid sequence revealed the presence of a Src homology 2 (SH2) domain. This domain is shared by a number of signal transduction proteins including nonreceptor tyrosine kinases such as Abl, Fps, Src, and Src family members, the transforming protein Crk, phospholipase C-gamma 1, PI-3 (phosphatidylinositol) kinase, and guanosine triphosphatase-activating protein (GAP). Like the SH2 domain found in Src, Crk, and Abl, the SH2 domain of tensin bound specifically to a number of phosphotyrosine-containing proteins from v-src-transformed cells. Tensin was also found to be phosphorylated on tyrosine residues. These findings suggest that by possessing both actin-binding and phosphotyrosine-binding activities and being itself a target for tyrosine kinases, tensin may link signal transduction pathways with the cytoskeleton.

Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

PubMed

Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

2009-08-01

Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

Radiation dosimetry properties of smartphone CMOS sensors.

PubMed

Van Hoey, Olivier; Salavrakos, Alexia; Marques, Antonio; Nagao, Alexandre; Willems, Ruben; Vanhavere, Filip; Cauwels, Vanessa; Nascimento, Luana F

2016-03-01

During the past years, several smartphone applications have been developed for radiation detection. These applications measure radiation using the smartphone camera complementary metal-oxide-semiconductor sensor. They are potentially useful for data collection and personal dose assessment in case of a radiological incident. However, it is important to assess these applications. Six applications were tested by means of irradiations with calibrated X-ray and gamma sources. It was shown that the measurement stabilises only after at least 10-25 min. All applications exhibited a flat dose rate response in the studied ambient dose equivalent range from 2 to 1000 μSv h(-1). Most applications significantly over- or underestimate the dose rate or are not calibrated in terms of dose rate. A considerable energy dependence was observed below 100 keV but not for the higher energy range more relevant for incident scenarios. Photon impact angle variation gave a measured signal variation of only about 10 %. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

EEG based topography analysis in string recognition task

NASA Astrophysics Data System (ADS)

Ma, Xiaofei; Huang, Xiaolin; Shen, Yuxiaotong; Qin, Zike; Ge, Yun; Chen, Ying; Ning, Xinbao

2017-03-01

Vision perception and recognition is a complex process, during which different parts of brain are involved depending on the specific modality of the vision target, e.g. face, character, or word. In this study, brain activities in string recognition task compared with idle control state are analyzed through topographies based on multiple measurements, i.e. sample entropy, symbolic sample entropy and normalized rhythm power, extracted from simultaneously collected scalp EEG. Our analyses show that, for most subjects, both symbolic sample entropy and normalized gamma power in string recognition task are significantly higher than those in idle state, especially at locations of P4, O2, T6 and C4. It implies that these regions are highly involved in string recognition task. Since symbolic sample entropy measures complexity, from the perspective of new information generation, and normalized rhythm power reveals the power distributions in frequency domain, complementary information about the underlying dynamics can be provided through the two types of indices.

Design and application of process control charting methodologies to gamma irradiation practices

NASA Astrophysics Data System (ADS)

Saylor, M. C.; Connaghan, J. P.; Yeadon, S. C.; Herring, C. M.; Jordan, T. M.

2002-12-01

The relationship between the contract irradiation facility and the customer has historically been based upon a "PASS/FAIL" approach with little or no quality metrics used to gage the control of the irradiation process. Application of process control charts, designed in coordination with mathematical simulation of routine radiation processing, can provide a basis for understanding irradiation events. By using tools that simulate the physical rules associated with the irradiation process, end-users can explore process-related boundaries and the effects of process changes. Consequently, the relationship between contractor and customer can evolve based on the derived knowledge. The resulting level of mutual understanding of the irradiation process and its resultant control benefits both the customer and contract operation, and provides necessary assurances to regulators. In this article we examine the complementary nature of theoretical (point kernel) and experimental (dosimetric) process evaluation, and the resulting by-product of improved understanding, communication and control generated through the implementation of effective process control charting strategies.

The Swift GRB Host Galaxy Legacy Survey

NASA Astrophysics Data System (ADS)

Perley, Daniel

2015-08-01

I will describe the Swift Host Galaxy Legacy Survey (SHOALS), a comprehensive multiwavelength program to characterize the demographics of the GRB host population and its redshift evolution from z=0 to z=7. Using unbiased selection criteria we have designated a subset of 119 Swift gamma-ray bursts which are now being targeted with intensive observational follow-up. Deep Spitzer imaging of every field has already been obtained and analyzed, with major programs ongoing at Keck, GTC, Gemini, VLT, and Magellan to obtain complementary optical/NIR photometry and spectroscopy to enable full SED modeling and derivation of fundamental physical parameters such as mass, extinction, and star-formation rate. Using these data I will present an unbiased measurement of the GRB host-galaxy luminosity and mass distributions and their evolution with redshift, compare GRB hosts to other star-forming galaxy populations, and discuss implications for the nature of the GRB progenitor and the ability of GRBs to serve as tools for measuring and studying cosmic star-formation in the distant universe.

Extreme Light Infrastructure - Nuclear Physics Eli-Np Project

NASA Astrophysics Data System (ADS)

Gales, S.

2015-06-01

The development of high power lasers and the combination of such novel devices with accelerator technology has enlarged the science reach of many research fields, in particular High energy, Nuclear and Astrophysics as well as societal applications in Material Science, Nuclear Energy and Medicine. The European Strategic Forum for Research Infrastructures (ESFRI) has selected a proposal based on these new premises called "ELI" for Extreme Light Infrastructure. ELI will be built as a network of three complementary pillars at the frontier of laser technologies. The ELI-NP pillar (NP for Nuclear Physics) is under construction near Bucharest (Romania) and will develop a scientific program using two 10 PW class lasers and a Back Compton Scattering High Brilliance and Intense Low Energy Gamma Beam , a marriage of Laser and Accelerator technology at the frontier of knowledge. In the present paper, the technical description of the facility, the present status of the project as well as the science, applications and future perspectives will be discussed.

Spatially-resolved HPGe Gamma-ray Spectroscopy of Swipe Samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

McDonald, Benjamin S.; VanDevender, Brent A.; Wood, Lynn S.

Measurement of swipe samples is a critical element of the National Technical Nuclear Forensics (NTNF) mission. A unique, portable, germanium gamma imager (GeGI-s) from PHDS Co may provide complementary information to current techniques for swipe sample screening. The GeGI-s is a modified version of the commercial GeGI-4, a planar HPGe detector, capable of several million counts per second across the whole detector. The GeGI-s detector is a prototype of a commercial off-the-shelf high rate GeGI. The high rate capability allows high-activity samples be placed directly on the face of the detector. Utilizing the high energy resolution and pixelization of themore » detector, the GeGI-s can generate isotope specific spatial maps of the materials on the swipe sample. To prove this technology is viable for such mapping, the GeGI-s detector response to spatially distributed events must be well characterized. The detection efficiency as a function of location has been characterized to understand the non-uniformities presented as a collimated photon beam was rastered vertically and horizontally across the face of the detector. The detection efficiency as a function of location has been characterized to understand the non-uniformities presented as a collimated photon beam was rastered vertically and horizontally across the face of the detector. The response was found to be primarily uniform and symmetric, however two causes of non-uniformity were found. Both of these causes can ultimately be corrected for in off-line data analysis.« less

Electroacupuncture promotes a decrease in inflammatory response associated with Th1/Th2 cytokines, nitric oxide and leukotriene B4 modulation in experimental asthma.

PubMed

Carneiro, E R; Xavier, R A N; De Castro, M A Pedreira; Do Nascimento, C M Oller; Silveira, V L F

2010-06-01

Previously, we have shown that electroacupuncture (EA) in rats decreased eosinophil infiltration into the pulmonary tissue (PT) and in the bronchoalveolar lavage (BAL) in an experimental model of asthma. Th2 cytokines, leukotriene B4 (LTB4) and nitric oxide (NO) are involved in the asthma inflammatory process. The aim of this study was to verify the effects of EA on these asthma mediators. Male Wistar rats were divided into control (C), immobilized (I), sham acupuncture (SA), and acupuncture (A) groups. All rats were sensitized, and EA treatment using clinical acupuncture points was started 24h after antigen priming. EA was done every other day for 2weeks. Subsequently, animals were challenged by inhalation and sacrificed 24h later. At this time, the BAL and lungs were collected and used to analyze cytokine production, LTB4 and NO. The EA increased IL-1 and IFN-gamma and decreased IL-4, IL-10, NO and LTB4 in the BAL and PT compared to the C and SA groups. The presence of eosinophils in the BAL negatively correlated with IL-1 and IFN-gamma production and positively correlated with IL-4 and IL-10 production. Our results show that the beneficial anti-inflammatory action of EA on asthma is related to the balance of the Thl/Th2 response and the reduction of LTB4 and NO. These results suggest that EA therapy could be an important complementary treatment for asthma. Copyright 2010. Published by Elsevier Ltd.

Combining Radiography and Passive Measurements for Radiological Threat Localization in Cargo

NASA Astrophysics Data System (ADS)

Miller, Erin A.; White, Timothy A.; Jarman, Kenneth D.; Kouzes, Richard T.; Kulisek, Jonathan A.; Robinson, Sean M.; Wittman, Richard A.

2015-10-01

Detecting shielded special nuclear material (SNM) in a cargo container is a difficult problem, since shielding reduces the amount of radiation escaping the container. Radiography provides information that is complementary to that provided by passive gamma-ray detection systems: while not directly sensitive to radiological materials, radiography can reveal highly shielded regions that may mask a passive radiological signal. Combining these measurements has the potential to improve SNM detection, either through improved sensitivity or by providing a solution to the inverse problem to estimate source properties (strength and location). We present a data-fusion method that uses a radiograph to provide an estimate of the radiation-transport environment for gamma rays from potential sources. This approach makes quantitative use of radiographic images without relying on image interpretation, and results in a probabilistic description of likely source locations and strengths. We present results for this method for a modeled test case of a cargo container passing through a plastic-scintillator-based radiation portal monitor and a transmission-radiography system. We find that a radiograph-based inversion scheme allows for localization of a low-noise source placed randomly within the test container to within 40 cm, compared to 70 cm for triangulation alone, while strength estimation accuracy is improved by a factor of six. Improvements are seen in regions of both high and low shielding, but are most pronounced in highly shielded regions. The approach proposed here combines transmission and emission data in a manner that has not been explored in the cargo-screening literature, advancing the ability to accurately describe a hidden source based on currently-available instrumentation.

Analysis of autoimmune bone marrow by antibody-phage display: somatic mutations and third complementarity-determining region arginines in anti-DNA gamma and kappa V genes.

PubMed

Seal, S N; Hoet, R M; Raats, J M; Radic, M Z

2000-09-01

To examine anti-double-stranded DNA (anti-dsDNA) IgG autoantibodies from the bone marrow of individuals with systemic lupus erythematosus (SLE). A library of single-chain variable fragments (scFv) was constructed from SLE bone marrow complementary DNA of gamma, kappa, and lambda isotype by cloning into the pHENIX phagemid vector. The library was screened with dsDNA in solution, and 2 anti-DNA phage, DNA1 and DNA4, were isolated and their Ig V genes sequenced. Soluble scFv corresponding to DNA1 and DNA4, and their heavy (H)- and light (L)-chain recombinants, were prepared, purified, and analyzed for binding to DNA by enzyme-linked immunosorbent assay. DNA1 and DNA4 used different Ig H-chain (3-30 and 5-51, respectively) and L-chain (DPK15 and DPK22, respectively) V genes. The ratios of replacement mutations to silent mutations in DNA1 and DNA4 suggest that their V genes were selected for improved antigen binding in vivo. The recombinant between DNA4VH and DNA1VL showed the highest relative affinity for both single-stranded DNA and dsDNA. These 2 Ig subunits contained third complementarity-determining region arginines and had acquired the majority of replacement mutations. Anti-dsDNA IgG autoantibodies from the bone marrow of SLE patients exploit diverse V genes and cationic V-D-J and V-J junctions for DNA binding, and accumulate replacement mutations that enhance binding.

Real-time functional mapping: potential tool for improving language outcome in pediatric epilepsy surgery

PubMed Central

Korostenskaja, Milena; Chen, Po-Ching; Salinas, Christine M.; Westerveld, Michael; Brunner, Peter; Schalk, Gerwin; Cook, Jane C.; Baumgartner, James; Lee, Ki H.

2015-01-01

Accurate language localization expands surgical treatment options for epilepsy patients and reduces the risk of postsurgery language deficits. Electrical cortical stimulation mapping (ESM) is considered to be the clinical gold standard for language localization. While ESM affords clinically valuable results, it can be poorly tolerated by children, requires active participation and compliance, carries a risk of inducing seizures, is highly time consuming, and is labor intensive. Given these limitations, alternative and/or complementary functional localization methods such as analysis of electrocorticographic (ECoG) activity in high gamma frequency band in real time are needed to precisely identify eloquent cortex in children. In this case report, the authors examined 1) the use of real-time functional mapping (RTFM) for language localization in a high gamma frequency band derived from ECoG to guide surgery in an epileptic pediatric patient and 2) the relationship of RTFM mapping results to postsurgical language outcomes. The authors found that RTFM demonstrated relatively high sensitivity (75%) and high specificity (90%) when compared with ESM in a “next-neighbor” analysis. While overlapping with ESM in the superior temporal region, RTFM showed a few other areas of activation related to expressive language function, areas that were eventually resected during the surgery. The authors speculate that this resection may be associated with observed postsurgical expressive language deficits. With additional validation in more subjects, this finding would suggest that surgical planning and associated assessment of the risk/benefit ratio would benefit from information provided by RTFM mapping. PMID:24995815

Attitudes toward and education about complementary and alternative medicine among adult patients with depression in Taiwan.

PubMed

Hsu, Mei-Chi; Moyle, Wendy; Creedy, Debra; Venturato, Lorraine; Ouyang, Wen-Chen; Sun, Gwo-Ching

2010-04-01

To investigate patients' attitudes toward complementary and alternative medicine, the education nurses provided about complementary and alternative medicine for treating depression and to test whether such education mediates the effect of complementary and alternative medicine use and attitudes toward complementary and alternative medicine. Although we know that attitudes influence behaviour, very few studies simultaneously explore the relationship between attitudes, education and complementary and alternative medicine use. Survey. This study was conducted as part of a larger survey, using face-to-face survey interviews with 206 adult patients aged 50 years or over and hospitalised in conventional hospitals in Taiwan for treatment of depression. The attitudes toward complementary and alternative medicine and patient education about complementary and alternative medicine instruments were specially developed for the study. Participants expressed slightly favourable attitudes toward complementary and alternative medicine. Many participants (50%) expressed that they were willing to try any potential treatment for depression. They believed that complementary and alternative medicine helped them to feel better and to live a happier life. However, 66.5% of participants reported that they had inadequate knowledge of complementary and alternative medicine. Participants with a higher monthly income, longer depression duration and religious beliefs hold more positive attitudes toward complementary and alternative medicine. Most participants were not satisfied with the education they received about complementary and alternative medicine. Patient education about complementary and alternative medicine was found to be a mediator for the use of complementary and alternative medicine. Patient education from nurses may predict patients' attitudes toward complementary and alternative medicine. Continuing nursing education is needed to enable nurses to respond knowledgeably to concerns patients may have about complementary and alternative medicine and treatment options. This study highlights the potential role of patient education about complementary and alternative medicine as an effective way of adjusting patients' attitudes toward complementary and alternative medicine and to link both patients' preferences for complementary and alternative medicine and health professionals' concerns about the proper use of complementary and alternative medicine for depression management and adverse drug interactions.

Integral -tracking extreme radiation across the Universe

NASA Astrophysics Data System (ADS)

2002-10-01

Gamma rays are released by the most violent events in the Universe. Unlike the serene beauty of the stars that we can see with our own eyes, the gamma-ray Universe is a place of wild explosions, cosmic collisions, and matter being sucked into black holes or trapped in super-strong magnetic fields. So far, astronomers have only had glimpses of this violence; Integral will bring it into sharp focus. Exploring the turbulent Universe Gamma rays carry large quantities of energy away from the violent events where they are created, such as supernova explosions, black holes, and the mysterious gamma-ray bursts. Integral will find a lot more out about these powerful gamma-ray sources. Very massive stars end their lives in big explosions called supernovae. These outbursts liberate more energy than the combined light of millions upon millions of stars, much of it in the form of gamma rays. New chemical elements are created as results of such explosions. In fact, all atoms heavier than iron are created due to such explosions. For this reason, we call supernovae the chemical factories” of the Universe. However, we do not know completely how new atoms are created when a star explodes. Integral will look into it as one of its first scientific objectives. After the explosion, each supernova leaves behind a dead 'heart'. This heart is incredibly dense and can be either a neutron star or a black hole. Both can generate gamma rays because they possess incredibly strong gravitational fields that can capture passing dust, gas and, possibly, larger celestial objects. When matter falls through a gravitational field, it heats up and releases energy. In the case of neutron stars and black holes, the energy released is very intense and is given off in the form of x-rays and gamma rays. As well as black holes from supernovae, called stellar black holes, the Universe contains a variety of far more massive black holes that are found at the core of some galaxies, the galactic black holes. Galactic black holes also give off gamma rays, and with such awesome power that you can detect them almost halfway across the known Universe. As well as making the most accurate studies of these objects to date, Integral will also investigate the mysterious blasts of gamma rays that explode across the Universe about once a day, the gamma-ray bursts. They can last just a few seconds and can come from any direction in space. The origin of gamma-ray bursts has remained unexplained for years, from their first observation in the late 1960s. Today, many scientists think that gamma ray bursts could be linked to the death throes of the very first stars. Alternatively, they could be generated by colliding neutron stars, or could be caused by the explosion of supermassive stars at the end of their lives, the hypernovae. Integral's instruments will study gamma-ray bursts with the highest accuracy ever and may discover something about their origins. Integral’s instruments Integral has four instruments to give the spacecraft maximum versatility in its task of studying the gamma-ray Universe. Designed to complement each other, their combined observations will allow scientists to get a very complete and accurate picture of each celestial target at different wavelengths. The first two are dedicated gamma-ray instruments. Imager on Board the Integral Satellite (IBIS) is the sharpest-resolution gamma-ray camera ever built. Spectrometer on Integral (SPI) will measure the energy of gamma rays with exceptional accuracy. In particular, it will be more sensitive to fainter radiation than any previous gamma-ray spectrometer. The other two instruments are designed to provide complementary scientific data about Integral’s targets. The Joint European X-Ray Monitor (JEM-X) will make observations simultaneously with the main gamma-ray instruments and will provide images at X-ray wavelengths. The Optical Monitoring Camera (OMC) will do the same but at visible-light wavelengths. The total weight of the four instruments is about 2 tonnes, roughly half the launch weight of Integral. Integral's orbit and operations After launch, Integral will follow an elliptical orbit that is inclined by 51.6° to the Earth’s equator. In this orbit, it will cycle between 9000 kilometres and 153 000 kilometres above Earth, completing one revolution of the Earth every 72 hours. This eccentric orbit is necessary because there are ‘radiation belts’ that surround the Earth and these would interfere with Integral’s ability to see gamma rays. It is important for Integral to be outside these belts. Its elliptical orbit is designed to keep it outside the radiation belts for 90% of its trajectory around Earth. Once Integral is in orbit, it must communicate with Earth to download its scientific data and to receive commands. Communicating with and controlling Integral is a task spread over a number of different sites. Firstly, astronomers submit proposals for observations to the Integral Science Operations Centre (ISOC) at Noordwijk, The Netherlands. Experts at ISOC evaluate the proposals and draw up a list of targets and detailed observation schedules for Integral. The schedules are sent to the Mission Operations Centre (MOC) at the European Space Operations Centre (ESOC) in Darmstadt, Germany. There everything is transformed into commands that Integral will understand. Signals to and from Integral go through two tracking stations, one at Redu in Belgium, the second at Goldstone in California, United States. The MOC also ensures the correct performance of the spacecraft. After Integral has collected observations, the raw science data is forwarded to the Integral Science Data Centre (ISDC) in Versoix near Geneva, Switzerland. There it is converted into usable data files, archived, and distributed to the astronomical community. A worldwide network of space science institutes and observatories will receive the data very quickly. This is essential especially when sudden and short-lasting phenomena such as gamma-ray bursts occur. In this case, all observatories need to receive the information within one minute to be able to point their telescopes immediately at the area of the sky where the gamma-ray burst has been detected. Building Integral Integral was selected as a mission by ESA in June 1993. The prime contractor for the spacecraft was Alenia Aerospazio, Turin, Italy. Alenia involved 26 subcontracting companies from 12 European countries to build the spacecraft’s service module. This provides the essentials for the spacecraft such as power (via solar panels), satellite control, and the communications link to the ground. Alenia was also responsible for integrating the four science instruments on-board the spacecraft, known collectively as the payload module. Four consortia of academic and industrial partners, variously located throughout Europe, built the instruments. Integral has faced many technological challenges. However, the greatest was finding a way to focus gamma rays, which are so powerful they pass through ordinary mirrors. To overcome this, Integral’s gamma-ray instruments and its X-ray monitor use a technique called coded-mask imaging. Instead of focusing, the coded mask blocks some gamma rays, creating a recognisable shadow on the detector beneath. Ground computer systems process the data coming from the gamma-ray detector looking for this shadow. Once it finds the shadow pattern, it groups the gamma rays together, forming an image. Gamma rays from different astronomical objects enter the instruments at different angles and so cast different shadows, allowing gamma rays from multiple sources to be separated. Integral has been developed and built at a cost of 330 million Euros. This price does not include the cost of launch, which Russia is providing free in exchange for observing time on Integral. Neither does the cost include the price of the science instruments, which have been provided by academic and industrial consortia. To reduce costs, the design for the service module was reused from ESA’s XMM-Newton satellite. Note to editors: historical perspective on gamma-ray astronomy Scientists have placed small gamma-ray detectors on satellites since the early 1960s. However, the most extraordinary discovery came in the late 1960s from a series of military satellites designed to monitor the ban on nuclear bombs being tested on Earth. These satellites detected the appropriately named gamma-ray bursts, which explode without warning about once a day, from random directions in the sky. In 1972, the NASA probe SAS-2 confirmed that the Universe is bathed in a perpetual shower of gamma rays. In 1975, ESA launched the gamma-ray satellite COS-B, that worked until being switched off in 1982. COS-B produced the first map of the gamma-ray sky and identified a number of bright gamma ray sources. It was followed by the Russian-French mission GRANAT, in 1989-1998, and NASA’s Compton Gamma-ray Observatory (CGRO), in 1991-2000. The CGRO satellite greatly increased our understanding of gamma-ray astronomy. Soon we can expect Integral to dazzle the world with the next leap in technology.

Complementary and conventional providers in cancer care: experience of communication with patients and steps to improve communication with other providers.

PubMed

Stub, Trine; Quandt, Sara A; Arcury, Thomas A; Sandberg, Joanne C; Kristoffersen, Agnete E

2017-06-08

Effective interdisciplinary communication is important to achieve better quality in health care. The aims of this study were to compare conventional and complementary providers' experience of communication about complementary therapies and conventional medicine with their cancer patients, and to investigate how they experience interdisciplinary communication and cooperation. This study analyzed data from a self-administrated questionnaire. A total of 606 different health care providers, from four counties in Norway, completed the questionnaire. The survey was developed to describe aspects of the communication pattern among oncology doctors, nurses, family physicians and complementary therapists (acupuncturists, massage therapists and reflexologists/zone-therapists). Between-group differences were analyzed using chi-square, ANOVA and Fisher's exact tests. Significance level was defined as p < 0.05 without adjustment for multiple comparisons. Conventional providers and complementary therapists had different patterns of communication with their cancer patients regarding complementary therapies. While complementary therapists advised their patients to apply both complementary and conventional modalities, medical doctors were less supportive of their patients' use of complementary therapies. Of conventional providers, nurses expressed more positive attitudes toward complementary therapies. Opportunities to improve communication between conventional and complementary providers were most strongly supported by complementary providers and nurses; medical doctors were less supportive of such attempts. A number of doctors showed lack of respect for complementary therapists, but asked for more research, guidelines for complementary modalities and training in conventional medicine for complementary therapists. For better quality of care, greater communication about complementary therapy use is needed between cancer patients and their conventional and complementary providers. In addition, more communication between conventional and complementary providers is needed. Nurses may have a crucial role in facilitating communication, as they are positive toward complementary therapies and they have more direct communication with patients about their treatment preferences.

Combined Photoneutron And X Ray Interrogation Of Containers For Nuclear Materials

NASA Astrophysics Data System (ADS)

Gozani, Tsahi; Shaw, Timothy; King, Michael J.; Stevenson, John; Elsalim, Mashal; Brown, Craig; Condron, Cathie

2011-06-01

Effective cargo inspection systems for nuclear material detection require good penetration by the interrogating radiation, generation of a sufficient number of fissions, and strong and penetrating detection signatures. Inspection systems need also to be sensitive over a wide range of cargo types and densities encountered in daily commerce. Thus they need to be effective with highly hydrogenous cargo, where neutron attenuation is a major limitation, as well as with dense metallic cargo, where x-ray penetration is low. A system that interrogates cargo with both neutrons and x-rays can, in principle, achieve high performance over the widest range of cargos. Moreover, utilizing strong prompt-neutron (˜3 per fission) and delayed-gamma ray (˜7 per fission) signatures further strengthens the detection sensitivity across all cargo types. The complementary nature of x-rays and neutrons, used as both probing radiation and detection signatures, alleviates the need to employ exceedingly strong sources, which would otherwise be required to achieve adequate performance across all cargo types, if only one type of radiation probe were employed. A system based on the above principles, employing a commercially-available 9 MV linac was developed and designed. Neutrons are produced simultaneously with x-rays by the photonuclear interaction of the x-ray beam with a suitable converter. A total neutron yield on the order of 1011 n/s is achieved with an average electron beam current of 100 μA. If fissionable material is present, fissions are produced both by the high-energy x-ray beam and by the photoneutrons. Photofission and neutron fission dominate in hydrogenous and metallic cargos, respectively. Neutron-capture gamma rays provide information on the cargo composition. The prompt neutrons resulting from fission are detected by two independent detector systems: by very efficient Differential Die Away Analysis (DDAA) detectors, and by direct detection of neutrons with energies higher than 3 MeV using a recently developed fluorine-based threshold activation detector (TAD). The delayed gamma-ray signals are measured with high efficiency with the same TAD and with additional lower-cost plastic scintillators.

Prevention and Treatment of Influenza, Influenza-Like Illness, and Common Cold by Herbal, Complementary, and Natural Therapies.

PubMed

Mousa, Haider Abdul-Lateef

2017-01-01

In recent years viral respiratory tract infections, especially influenza viruses, have had a major impact on communities worldwide as a result of unavailability of effective treatment or vaccine. The frequent alterations in the antigenic structures of respiratory viruses, particularly for RNA viruses, pose difficulties in production of effective vaccines. The unavailability of optimal medication and shortage of effective vaccines suggests the requirement for alternative natural therapies. Several herbal remedies were used for prevention and treatment viral respiratory illnesses. Among those that were found effective included maoto, licorice roots, antiwei, North American ginseng, berries, Echinacea, plants extracted carnosic acid, pomegranate, guava tea, and Bai Shao. There is scientific evidence regarding the effectiveness of several complementary therapies for colds. Oral zinc may reduce the length and severity of a cold. Taking vitamin C supplements on a regular basis only slightly reduces the length and severity of colds. Probiotics were found better than placebo in reducing the number episodes of acute upper respiratory tract infections, the rate of episodes of acute upper respiratory tract infection and reducing antibiotic use. Alkaline diets or drinks might have antiviral properties as in vitro studies demonstrated inactivation effect of alkaline medium on respiratory virus. Earthing might have a natural anti-inflammatory effect for human body. It is now accepted that an overwhelming inflammatory response is the cause of human deaths from avian H5N1 influenza infection. Earthing accelerates immune response following vaccination, as demonstrated by increases of gamma globulin concentration. No in vivo or clinical studies were found that investigate the role of alkalization or earthing on respiratory viral infections. Thus, future studies are recommended to reveal any potential curative effects. © The Author(s) 2016.

PIXE and PGAA - Complementary methods for studies on ancient glass artefacts (from Byzantine, late medieval to modern Murano glass)

NASA Astrophysics Data System (ADS)

Constantinescu, Bogdan; Cristea-Stan, Daniela; Szőkefalvi-Nagy, Zoltán; Kovács, Imre; Harsányi, Ildikó; Kasztovszky, Zsolt

2018-02-01

Combined external milli-beam Particle Induced X-ray Emission (PIXE) and Prompt Gamma Activation Analysis (PGAA) analysis was applied to characterize the composition of paste and colorants from some fragments of Byzantine bracelets (10th-12th Centuries AD), late medieval (17th-18th Centuries AD) and modern Murano glass pieces. As fluxes, PGAA revealed the samples are soda-lime glass, except four samples - two medieval vessel white shards and two dark Byzantine fragments of bracelets - which have potash flux. Aluminium was detected in various proportions in all samples indicating different sources for the added sand. The presence of Magnesium is relevant only in one bracelet fragment suggesting the use of plant (wood?) ash and confirming that the Byzantine bracelet is manufactured from the mixture of both types of glass (natron and plant ash based). PGAA also indicated the presence of low quantities of Cadmium, high level of Arsenic and Lead (possibly lead arsenate) in one medieval sample and of ZnO in Murano glass, and of CoO traces (maximum 0.1%) in all blue-colored Byzantine, late medieval to modern Murano glass artefacts. PIXE confirmed the use of small quantities of CoO for blue color, indicated Manganese combined with Iron for dark glass, Copper for green, Lead, Tin and an Arsenic compound (orpiment?) for yellow and in the case of modern Murano glass Selenium and Cadmium to obtain a reddish color. Despite PIXE - PIGE combination is probably the best one for glass analysis, our external milli-PIXE - PGAA methods proved to be adequate complementary tools to determine many chemical elements from glass composition - Si, Na, K, Ca, Al, Mg, various metallic oxides.

Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression.

PubMed

Sin, Jeong-Im

2009-09-01

Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-gamma and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested.

A multimodal approach to estimating vigilance using EEG and forehead EOG

NASA Astrophysics Data System (ADS)

Zheng, Wei-Long; Lu, Bao-Liang

2017-04-01

Objective. Covert aspects of ongoing user mental states provide key context information for user-aware human computer interactions. In this paper, we focus on the problem of estimating the vigilance of users using EEG and EOG signals. Approach. The PERCLOS index as vigilance annotation is obtained from eye tracking glasses. To improve the feasibility and wearability of vigilance estimation devices for real-world applications, we adopt a novel electrode placement for forehead EOG and extract various eye movement features, which contain the principal information of traditional EOG. We explore the effects of EEG from different brain areas and combine EEG and forehead EOG to leverage their complementary characteristics for vigilance estimation. Considering that the vigilance of users is a dynamic changing process because the intrinsic mental states of users involve temporal evolution, we introduce continuous conditional neural field and continuous conditional random field models to capture dynamic temporal dependency. Main results. We propose a multimodal approach to estimating vigilance by combining EEG and forehead EOG and incorporating the temporal dependency of vigilance into model training. The experimental results demonstrate that modality fusion can improve the performance compared with a single modality, EOG and EEG contain complementary information for vigilance estimation, and the temporal dependency-based models can enhance the performance of vigilance estimation. From the experimental results, we observe that theta and alpha frequency activities are increased, while gamma frequency activities are decreased in drowsy states in contrast to awake states. Significance. The forehead setup allows for the simultaneous collection of EEG and EOG and achieves comparative performance using only four shared electrodes in comparison with the temporal and posterior sites.

Geochemistry of polymict ureilite EET83309, and a partially-disruptive impact model for ureilite origin

NASA Technical Reports Server (NTRS)

Warren, Paul H.; Kallemeyn, Gregory W.

1989-01-01

Bulk-compositional data for the EET83309 polymict ureilite were obtained using INAA and radiochemistry procedures and electron probe analysis. It was found that the EET83309 has a bulk composition indistinguishable from ordinary ('monomict') ureilites for all elements except light-middle REEs (which are present in much higher concentrations), suggesting that polymict ureilites are mixtures of ordinary ureilites which were mixed on a very small number of parent bodies. Despite the light-REE enrichments, polymict ureilites are nearly devoid of basaltic (Al-rich) material. It is suggested that the missing basalt may have been blown off the parent body by a partially disruptive collision with a large C-rich projectile. This impact model of ureilite origin reconciles many paradoxical aspects of ureilite composition.

Nature of the H chondrite parent body regolith - Evidence from the Dimmitt breccia

NASA Technical Reports Server (NTRS)

Rubin, A. E.; Scott, E. R. D.; Taylor, G. J.; Keil, K.; Allen, J. S. B.; Mayeda, T. K.; Clayton, R. N.; Bogard, D. D.

1983-01-01

Meteorite regolith breccias are clastic rocks which formed by lithification of fragmental regolith material that once resided at the surface of a meteorite parent body. A study is reported of the matrix and 21 clasts of various sizes (0.2-24 mm) in the Dimmitt H chondrite regolith breccia using petrographic and electron microprobe techniques. In addition, oxygen isotope studies of three clasts and instrumental neutron activation analysis (INAA) and Ar-39/Ar-40 age dating of one clast are reported. The Dimmitt meteorite was found about 1942 near Dimmitt, Texas. Attention is given to analytical procedures, the clastic matrix, equilibrated clasts, poikilitic melt-rock clast, clasts of different chondrite groups, graphite-magnetite aggregates, the origin of exotic clasts, and the complexity of parent body surfaces processes.

Some methodical peculiarities of analysis of small-mass samples by SRXFA

NASA Astrophysics Data System (ADS)

Kudryashova, A. F.; Tarasov, L. S.; Ulyanov, A. A.; Baryshev, V. B.

1989-10-01

The stability of work of the element analysis station on the storage rings VEPP-3 and VEPP-4 in INP (Novosibirsk, USSR) was demonstrated on the example of three sets of rare element analyses carried out by SRXFA in May 1985, January and May-June 1988. These data show that there are some systematic deviations in the results of measurements of Zr and La contents. SRXFA and INAA data have been compared for the latter element. A false linear correlation on the Rb-Sr plot in one set of analyses has been attributed to an overlapping artificial Sr peak on a Rb peak. The authors proposed sequences of registration of spectra and computer treatment for samples and standards. Such sequences result in better final concentration data.

Application of epithermal neutron activation in multielement analysis of silicate rocks employing both coaxial Ge(Li) and low energy photon detector systems

USGS Publications Warehouse

Baedecker, P.A.; Rowe, J.J.; Steinnes, E.

1977-01-01

The instrumental activation analysis of silicate rocks using epithermal neutrons has been studied using both high resolution coaxial Ge(Li) detectors and low energy photon detectors, and applied to the determination of 23 elements in eight new U.S.G.S. standard rocks. The analytical use X-ray peaks associated with electron capture or internal conversion processes has been evaluated. Of 28 elements which can be considered to be determinable by instrumental means, the epithermal activation approach is capable of giving improved sensitivity and precision in 16 cases, over the normal INAA procedure. In eleven cases the use of the low energy photon detector is thought to show advantages over convertional coaxial Ge(Li) spectroscopy. ?? 1977 Akade??miai Kiado??.

Pristine moon rocks - Apollo 17 anorthosites

NASA Technical Reports Server (NTRS)

Warren, P. H.; Jerde, E. A.; Kallemeyn, G. W.

1991-01-01

New chemical analyses and petrographic descriptions for 10 previously unanalyzed Apollo 17 rock samples are provided. Attention is focused on several that appear to be pristine. All samples were analyzed in INAA using a procedure based on that of Kallemeyn et al. (1989). One sample was found to be unambiguously pristine, and is the first pristine ferroan-anorthositic suite (FAS) sample from Apollo 17. It exhibits extremely low-mg(asterisk) mafic silicates, coupled with relatively sodic plagioclase. It has an unusually high augite/low-Ca pyroxene ratio and contains incompatible trace elements at levels unprecedentedly high compared to FAS anorthosites from the Apollo 14, 15, 16 sites. It is inferred that 74114.5, and Apollo 17 anorthosites in general, formed at a relatively late stage in the evolution of the primordial magmasphere.

Apollo 15 yellow-brown volcanic glass: Chemistry and petrogenetic relations to green volcanic glass and olivine-normative mare basalts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hughes, S.S.; Schmitt, R.A.; Oregon State Univ., Corvallis

1988-10-01

Apollo 15 yellow-brown glass is one of twenty-five, high Mg, primary magmas emplaced on the lunar surface in pyroclastic eruptions. Forty spherules of this glass were individually analyzed by electron microprobe and INAA for major- and trace-elements. The abundances demonstrate that this primary magma was produced by partial melting of differentiated cumulates in the lunar mantle. Models are developed to explain the possible source-regions of several Apollo 15 and Apollo 12 low-Ti mare magmas as being products of hybridization involving three ancient differentiated components of a primordial lunar magma ocean: (a) early olivine {plus minus} orthopyroxene cumulates; (b) late-stage clinopyroxenemore » + pigeonite + ilmenite + plagioclase cumulates; and (c) late-stage inter-cumulus liquid.« less

Use of complementary and alternative medicine by pediatric patients with functional and organic gastrointestinal diseases: results from a multicenter survey.

PubMed

Vlieger, Arine M; Blink, Marjolein; Tromp, Ellen; Benninga, Marc A

2008-08-01

Many pediatric patients use complementary and alternative medicine, especially when facing a chronic illness for which treatment options are limited. So far, research on the use of complementary and alternative medicine in patients with functional gastrointestinal disease has been scarce. This study was designed to assess complementary and alternative medicine use in children with different gastrointestinal diseases, including functional disorders, to determine which factors predicted complementary and alternative medicine use and to assess the willingness of parents to participate in future studies on complementary and alternative medicine efficacy and safety. The prevalence of complementary and alternative medicine use was assessed by using a questionnaire for 749 children visiting pediatric gastroenterology clinics of 9 hospitals in the Netherlands. The questionnaire consisted of 35 questions on the child's gastrointestinal disease, medication use, health status, past and future complementary and alternative medicine use, reasons for its use, and the necessity of complementary and alternative medicine research. In this study population, the frequency of complementary and alternative medicine use was 37.6%. A total of 60.3% of this group had used complementary and alternative medicine specifically for their gastrointestinal disease. This specific complementary and alternative medicine use was higher in patients with functional disorders than organic disorders (25.3% vs 17.2%). Adverse effects of allopathic medication, school absenteeism, age

The detection of gunshot residues in the nasal mucus of suspected shooters.

PubMed

Merli, Daniele; Brandone, Alberto; Amadasi, Alberto; Cattaneo, Cristina; Profumo, Antonella

2016-07-01

The identification and quantification of metallic residues produced by gunshots, called gunshot residues (GSR), provide crucial elements in forensic investigations. The research has been largely focused on their collection onto the hands of suspected shooters, but the method is often burdened by risks of contamination. This research was focused on the possibility of sampling GSR trapped inside the nasal mucus of consenting shooters. Samples of the nasal mucus of "blank" control subjects and shooters were chemically analysed by Instrumental Neutron Activation Analysis (INAA), for residues of antimony (Sb) and barium (Ba), while lead (Pb) was excluded as ubiquitously environmental contaminant and due to high instrumental quantification limit (IQL) of INAA for this element. Shots were fired using two types of weapons (pistols and revolvers) and different firing sequences. The mucus was sampled at different times: immediately after the shots, after 30-60-120 and 180 min. Different amounts of Sb and Ba were detected between controls and shooters, witnessing the ability of the nasal mucus to retain GSR at concentrations significantly different even from the highest basal levels. Moreover, in order to simulate actual cases, nasal mucus from five groups of shooters was sampled after different shots with the same weapon and cartridges, immediately and after 1, 3, 12, and 24 h. The highest values were always found in the first 3 h from firing, for both weapons. Interestingly, for all the weapons, significant Sb and Ba concentrations were also found up to 12 h after firing, contrary to what occurs on hands, even though a progressive decrease was detected, with values below the detection threshold only after 24 h, thus demonstrating that GSR are persistent in nasal mucus. These first results proving that both Sb and Ba were qualitatively detectable in the nasal mucus of shooters indicate that the chemical analysis of the nasal mucus of suspected shooters may represent a promising tool in the forensic field since it is less burdened by problems related to sampling or contamination than the usual sampling on hand, providing that ammunitions employed contain Ba and Sb.

Instrumental nuclear activation techniques and applications to biomedical problems

NASA Astrophysics Data System (ADS)

Akanle, Olufunso Akinbode

The principles and practice of instrumental neutron activation analysis (INAA) which serves as the basis of this work is described. The various irradiation and counting conditions used are also described. As sampling and sample preparation has a large effect on the accuracy of analytical techniques for trace element work, some of the problems faced by the analyst during these processes are identified and ways of minimising these problems are described. A method of obtaining the representative mass for various elements in standard material, Bowen's Kale is described and values for a number of elements in this material have been determined. The application of INAA in the determination of the concentrations of a range of elements in hair and blood samples, whole blood, erythrocytes and plasma obtained from two groups of women, senile demented and depressives and their respective controls is described. The results suggest that the senile dements have significantly higher concentrations of Na, Al, Cl, I and Hg in blood and hair relative to that of the controls whereas, V, Fe, Zn, Cu, Se and Rb were found at higher concentrations in the controls. In the depressives, Na, Al, S, Cl, K, V, Mn, Br, Sc, Ag, I and Hg were found to be significantly elevated in their blood and hair relative to that of controls while Mg, Ca, Zn, Cu, Se, Sb and Au were found at higher concentrations in the controls. The statistical methods used in the interpretation of these results are also described. The effect of Se supplementation on the concentration of Se in whole blood and blood components, collected from three groups of healthy adults given as a supplement to their usual diet, is described. The results indicate that the level of selenium in whole blood and its components increases with dose and time and the concentration of the element is maintained for at least 45 days following cessation of supplementation. The influence of the supplement on some electrolytes was also investigated. The usefulness of the K[0] factor in multielemental analysis is demonstrated by application to a standard material. The method employed for the determination of the parameters needed for accurate determination of the K[0] factor is described.

Mechanism of degradation of immunogenic gluten epitopes from Triticum turgidum L. var. durum by sourdough lactobacilli and fungal proteases.

PubMed

De Angelis, Maria; Cassone, Angela; Rizzello, Carlo G; Gagliardi, Francesca; Minervini, Fabio; Calasso, Maria; Di Cagno, Raffaella; Francavilla, Ruggero; Gobbetti, Marco

2010-01-01

As shown by R5 antibody-based sandwich and competitive enzyme-linked immunosorbent assay (ELISA), selected sourdough lactobacilli, in combination with fungal proteases, hydrolyzed gluten (72 h at 37 degrees C) of various cultivars of Triticum turgidum L. var. durum to less than 20 ppm. Complementary electrophoretic, chromatography, and mass spectrometry techniques were used to characterize the gluten and epitope hydrolysis. Nine peptidases were partially purified from the pooled cytoplasmic extract of the sourdough lactobacilli and used to hydrolyze the 33-mer epitope, the most immunogenic peptide generated during digestion of Triticum species. At least three peptidases (general aminopeptidase type N [PepN], X-prolyl dipeptidyl aminopeptidase [PepX], and endopeptidase PepO) were necessary to detoxify the 33-mer without generation of related immunogenic epitopes. After 14 h of incubation, the combination of all or at least six different peptidases totally hydrolyzed the 33-mer (200 mM) into free amino acids. The same results were found for other immunogenic epitopes, such as fragments 57-68 of alpha 9-gliadin, 62-75 of A-gliadin, and 134-153 of gamma-gliadin. When peptidases were used for fermentation of durum wheat semolina, they caused the hydrolysis of gluten to ca. 2 ppm. The in vivo digestion was simulated, and proteins/peptides extracted from pepsin-trypsin (PT) digestion of durum wheat semolina fermented with selected sourdough lactobacilli induced the expression of gamma interferon and interleukin 2 at levels comparable to those of the negative control. Durum wheat semolina fermented with sourdough lactobacilli was freeze-dried and used for making Italian-type pasta. The scores for cooking and sensory properties for this pasta were higher that those of conventional gluten-free pasta.

How and when predictability interacts with accentuation in temporally selective attention during speech comprehension.

PubMed

Li, Xiaoqing; Lu, Yong; Zhao, Haiyan

2014-11-01

The present study used EEG to investigate how and when top-down prediction interacts with bottom-up acoustic signals in temporally selective attention during speech comprehension. Mandarin Chinese spoken sentences were used as stimuli. We systematically manipulated the predictability and de/accentuation of the critical words in the sentence context. Meanwhile, a linguistic attention probe 'ba' was presented concurrently with the critical words or not. The results showed that, first, words with a linguistic attention probe elicited a larger N1 than those without a probe. The latency of this N1 effect was shortened for accented or lowly predictable words, indicating more attentional resources allocated to these words. Importantly, prediction and accentuation showed a complementary interplay on the latency of this N1 effect, demonstrating that when the words had already attracted attention due to low predictability or due to the presence of pitch accent, the other factor did not modulate attention allocation anymore. Second, relative to the lowly predictable words, the highly predictable words elicited a reduced N400 and enhanced gamma-band power increases, especially under the accented conditions; moreover, under the accented conditions, shorter N1 peak-latency was found to correlate with larger gamma-band power enhancement, which indicates that a close relationship might exist between early selective attention and later semantic integration. Finally, the interaction between top-down selective attention (driven by prediction) and bottom-up selective attention (driven by accentuation) occurred before lexical-semantic processing, namely before the N400 effect evoked by predictability, which was discussed with regard to the language comprehension models. Copyright © 2014 Elsevier Ltd. All rights reserved.

Protective Role of Hsp27 Protein Against Gamma Radiation-Induced Apoptosis and Radiosensitization Effects of Hsp27 Gene Silencing in Different Human Tumor Cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aloy, Marie-Therese; Hospices Civils de Lyon, Service de Radiotherapie, Centre Hospitalier Lyon-Sud, Pierre-Benite; Hadchity, Elie

Purpose: The ability of heat shock protein 27 (Hsp27) to protect cells from stressful stimuli and its increased levels in tumors resistant to anticancer therapeutics suggest that it may represent a target for sensitization to radiotherapy. In this study, we investigate the protective role of Hsp27 against radiation-induced apoptosis and the effect of its attenuation in highly expressing radioresistant cancer cell lines. Methods and Materials: We examined clonogenic death and the kinetics of apoptotic events in different tumor cell lines overexpressing or underexpressing Hsp27 protein irradiated with photons. The radiosensitive Jurkat cell line, which does not express Hsp27 constitutively ormore » in response to {gamma}-rays, was stably transfected with Hsp27 complementary DNA. Attenuation of Hsp27 expression was accomplished by antisense or RNAi (interfering RNA) strategies in SQ20B head-and-neck squamous carcinoma, PC3 prostate cancer, and U87 glioblastoma radioresistant cells. Results: We measured concentration-dependent protection against the cytotoxic effects of radiation in Jurkat-Hsp27 cells, which led to a 50% decrease in apoptotic cells at 48 hours in the highest expressing cells. Underlying mechanisms leading to radiation resistance involved a significant increase in glutathione levels associated with detoxification of reactive oxygen species, a delay in mitochondrial collapse, and caspase activation. Conversely, attenuation of Hsp27 in SQ20B cells, characterized by their resistance to apoptosis, sensitizes cells to irradiation. This was emphasized by increased apoptosis, decreased glutathione basal level, and clonogenic cell death. Sensitization to irradiation was confirmed in PC3 and U87 radioresistant cells. Conclusion: Hsp27 gene therapy offers a potential adjuvant to radiation-based therapy of resistant tumors.« less

Combining Radiography and Passive Measurements for Radiological Threat Localization in Cargo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Erin A.; White, Timothy A.; Jarman, Kenneth D.

Detecting shielded special nuclear material (SNM) in a cargo container is a difficult problem, since shielding reduces the amount of radiation escaping the container. Radiography provides information that is complementary to that provided by passive gamma-ray detection systems: while not directly sensitive to radiological materials, radiography can reveal highly shielded regions that may mask a passive radiological signal. Combining these measurements has the potential to improve SNM detection, either through improved sensitivity or by providing a solution to the inverse problem to estimate source properties (strength and location). We present a data-fusion method that uses a radiograph to provide anmore » estimate of the radiation-transport environment for gamma rays from potential sources. This approach makes quantitative use of radiographic images without relying on image interpretation, and results in a probabilistic description of likely source locations and strengths. We present results for this method for a modeled test case of a cargo container passing through a plastic-scintillator-based radiation portal monitor and a transmission-radiography system. We find that a radiograph-based inversion scheme allows for localization of a low-noise source placed randomly within the test container to within 40 cm, compared to 70 cm for triangulation alone, while strength estimation accuracy is improved by a factor of six. Improvements are seen in regions of both high and low shielding, but are most pronounced in highly shielded regions. The approach proposed here combines transmission and emission data in a manner that has not been explored in the cargo-screening literature, advancing the ability to accurately describe a hidden source based on currently-available instrumentation.« less

Single- and double-strand break formation in DNA irradiated in aqueous solution: dependence on dose and OH radical scavenger concentration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siddiqi, M.A.; Bothe, E.

The yields of single- and double-strand breaks (SSB and DSB) in calf thymus DNA, after /sup 60/Co gamma irradiation in dilute aqueous solution, have been determined via molecular weight measurements using a low-angle laser light scattering technique. The irradiations were administered to N/sub 2/O-containing solutions of DNA in the absence and presence of oxygen and with different concentrations of the OH radical scavengers phenol, tertiary butanol, and methanol. OH radicals were found to produce SSB linearly with dose with a G value of 55 nmol J-1 and 54 nmol J-1 in deoxygenated and oxygenated solutions, respectively. DSB were formed accordingmore » to a linear-quadratic dose relationship and the G value of linearly formed DSB were GDSB alpha(r.t.) = 3.5 nmol J-1 in deoxygenated and 3.2 nmol J-1 in oxygenated solution. The ratio of GSSB/GDSB alpha(r.t.) = gamma of 19 +/- 6 was independent of the scavenger concentration in the case of tertiary butanol and methanol-containing solutions. GDSB alpha(r.t.) is interpreted to result from a radical site transferred from a sugar moiety of the cleaved strand to the complementary intact strand. This process of radical transfer and subsequent cleavage of the second strand occurs with a probability of about 6 +/- 2% in the presence of oxygen at all scavenger concentrations studied. These data on scavenging capacity on GDSB alpha(r.t.) suggest that the double-strand breakage produced via radical transfer remains higher than that resulting from direct effect, up to scavenging capacities of about 10(9) s-1.« less

Radicals produced by gamma-irradiation of hyperquenched glassy water containing 2'-deoxyguanosine-5'-monophosphate.

PubMed

Staluszka, Justyna; Steblecka, Malgorzata; Szajdzinska-Pietek, Ewa; Kohl, Ingrid; Salzmann, Christoph G; Hallbrucker, Andreas; Mayer, Erwin

2008-09-18

Hyperquenched glassy water (HGW) has been suggested as the best model for liquid water, to be used in low-temperature studies of indirect radiation effects on dissolved biomolecules (Bednarek et al. J. Am. Chem. Soc. 1996, 118, 9387). In the present work, these effects are examined by X-band electron spin resonance spectroscopy (ESR) in gamma-irradiated HGW matrix containing 2'-deoxyguanosine-5'-monophosphate. Analysis of the complex ESR spectra indicates that, in addition to OH(*) and HO2(*) radicals generated by water radiolysis, three species are trapped at 77 K:(i) G(C8)H(*) radical, the H-adduct to the double bond at C8; (ii) G(- *) radical anion, the product of electron scavenging by the aromatic ring of the base; and (iii) dR(-H)(*) radicals formed by H abstraction from the sugar moiety, predominantly at the C'5 position. We discuss the yields of the radicals, their thermal stability and transformations, as well as the effect of photobleaching. This study confirms our earlier suggestion that in HGW the H atom addition/abstraction products are created at 77 K in competition with HO2(*) radicals, in a concerted process following ionization of water molecule at L-type defect sites of the H-bonded matrix. The lack of OH(*) reactivity toward the solute suggests that the H-bonded structure in HGW is much more effective in recombining OH(*) radicals than that of aqueous glasses obtained from highly concentrated electrolyte solutions. Furthermore, complementary experiments for the neat matrix have provided evidence that HO2(*) radicals are not the product of H atom reaction with molecular oxygen, possibly generated by ultrasounds used in the process of sample preparation.

Attitudes towards and personal use of complementary and alternative medicine amongst clinicians working in audiovestibular disciplines.

PubMed

Crundwell, G; Baguley, D M

2016-08-01

Literature indicates that complementary and alternative medicine is used by patients with auditory and vestibular symptoms. This study sought to determine the prevalence of complementary and alternative medicine uptake, and examine attitudes towards complementary and alternative medicine in clinicians working with audiovestibular disorder patients. The Holistic Complementary and Alternative Medicine Questionnaire and a devised questionnaire about recent and lifetime use of complementary and alternative medicine were used. Fifty-four individuals, including audiologists, ENT surgeons, nurses and rehabilitationists, completed the questionnaires (67 per cent response rate). Lifetime prevalence of complementary and alternative medicine uptake was 44 per cent, and 12-month prevalence was 22 per cent. Uptake was more common in females, but there was no significant difference in use when comparing age, seniority or profession. Attitudes towards complementary and alternative medicine were mildly adverse, but sizeable standard deviation indicates wide-ranging attitudes. Clinicians working with patients with audiovestibular disorders have a range of attitudes towards complementary and alternative medicine. Personal uptake of complementary and alternative medicine was lower than that of the general UK population, but remains sizeable.

D/sup 0/*. -->. D/sup 0/. gamma. and other radiative decays of vector mesons. [SU-4 groups, decay widths

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bohm, A.; Teese, R.B.

1976-01-01

Using SU(4) as a spectrum generating group the radiative decay rates of the charmed vector mesons and of J(psi) are calculated. With the known decay rates of the old mesons GAMMA(..omega.. ..-->.. ..pi gamma..), GAMMA(phi ..-->.. eta ..gamma..), GAMMA(rho ..-->.. ..pi gamma..), GAMMA(K/sup 0/* ..-->.. K/sup 0/..gamma..) as input one obtains GAMMA(K/sup +/* ..-->.. K/sup +/..gamma..) = 2.6 keV, GAMMA(..omega.. ..-->.. eta ..gamma..) = 220 eV, GAMMA(rho ..-->.. eta ..gamma..) = 4.8 keV, GAMMA(psi ..-->.. chi ..gamma..) = 1.6 keV, GAMMA(D/sup 0/* ..-->.. D/sup 0/..gamma..) = 350 eV and GAMMA(D/sup +/* ..-->.. D/sup +/..gamma..) = 22 eV.

Use of complementary and alternative medicine by patients with cancer in northern Turkey: analysis of cost and satisfaction.

PubMed

Aydin Avci, Ilknur; Koç, Zeliha; Sağlam, Zeynep

2012-03-01

The aims of this study were to determine (1) the prevalence of complementary and alternative medicine use among patients with cancer, (2) the method of use of the particular therapy, (3) the reasons for using complementary and alternative medicine therapies, (4) the benefits experienced by the use of complementary and alternative medicine, (5) the source of information about complementary and alternative medicine therapies and, (6) the satisfaction and cost of complementary and alternative medicine. Complementary and alternative medicine consists of diverse medical and healthcare systems, practices and products that are not considered at present to be a part of conventional medicine. The majority of patients who use complementary and alternative medicine use more than one method. Complementary and alternative medicine use is more common in cases of advanced disease or poor prognosis. This is a descriptive study of complementary and alternative medicine. This study was conducted in the Chemotherapy Unit at Ondokuz Mayıs University, Faculty of Medicine, Samsun, Turkey, between 18 March 2008-30 June 2008. Two hundred fifty-three patients with cancer, among 281 patients who applied to the chemotherapy clinic between these dates, agreed to take part in the study with whom contact could be made were included. A questionnaire including descriptive characteristics in collecting data, characteristics about diseases and their treatments, complementary and alternative medicine information and implementation situations and a control list about complementary and alternative medicine implementations were given. The collected data were evaluated by computer using descriptive statistics, the chi-square test and Student's t-test. In this study, 94·1% of the patients were content with medical treatment, 58·9% of them used complementary and alternative medicine treatments, 41·1% did not use any complementary and alternative medicine treatments. The satisfaction level of the patients with complementary and alternative medicine methods was slightly above mediocre (2·33 SD 0·64, on a scale of 1-3). The average cost per capita spent by the patients using complementary and alternative medicine for all the different methods was US$288·26. It was determined that although patients did not have enough knowledge about complementary and alternative medicine methods, the prevalence of complementary and alternative medicine and satisfaction levels are high that complementary and alternative medicine users spend substantial sums of money for these methods. To sustain medical treatment and prognosis of cancer, it is important for nurses to consult with their patients regarding the use and potential risks of some complementary and alternative medicine. © 2011 Blackwell Publishing Ltd.

American Academy of Pediatrics. The use of complementary and alternative medicine in pediatrics.

PubMed

Kemper, Kathi J; Vohra, Sunita; Walls, Richard

2008-12-01

The American Academy of Pediatrics is dedicated to optimizing the well-being of children and advancing family-centered health care. Related to these goals, the American Academy of Pediatrics recognizes the increasing use of complementary and alternative medicine in children and, as a result, the need to provide information and support for pediatricians. From 2000 to 2002, the American Academy of Pediatrics convened and charged the Task Force on Complementary and Alternative Medicine to address issues related to the use of complementary and alternative medicine in children and to develop resources to educate physicians, patients, and families. One of these resources is this report describing complementary and alternative medicine services, current levels of utilization and financial expenditures, and associated legal and ethical considerations. The subject of complementary and alternative medicine is large and diverse, and consequently, an in-depth discussion of each method of complementary and alternative medicine is beyond the scope of this report. Instead, this report will define terms; describe epidemiology; outline common types of complementary and alternative medicine therapies; review medicolegal, ethical, and research implications; review education and training for complementary and alternative medicine providers; provide resources for learning more about complementary and alternative medicine; and suggest communication strategies to use when discussing complementary and alternative medicine with patients and families.

A new single-photon avalanche diode in 90nm standard CMOS technology.

PubMed

Karami, Mohammad Azim; Gersbach, Marek; Yoon, Hyung-June; Charbon, Edoardo

2010-10-11

We report on the first implementation of a single-photon avalanche diode (SPAD) in 90nm complementary metal oxide semiconductor (CMOS) technology. The detector features an octagonal multiplication region and a guard ring to prevent premature edge breakdown using a standard mask set exclusively. The proposed structure emerged from a systematic study aimed at miniaturization, while optimizing overall performance. The guard ring design is the result of an extensive modeling effort aimed at constraining the multiplication region within a well-defined area where the electric field exceeds the critical value for impact ionization. The device exhibits a dark count rate of 8.1 kHz, a maximum photon detection probability of 9% and the jitter of 398ps at a wavelength of 637nm, all of them measured at room temperature and 0.13V of excess bias voltage. An afterpulsing probability of 32% is achieved at the nominal dead time. Applications include time-of-flight 3D vision, fluorescence lifetime imaging microscopy, fluorescence correlation spectroscopy, and time-resolved gamma/X-ray imaging. Standard characterization of the SPAD was performed in different bias voltages and temperatures.

Wet deposition of fission-product isotopes to North America from the Fukushima Dai-ichi incident, March 2011

USGS Publications Warehouse

Wetherbee, Gregory A.; Gay, David A.; Debey, Timothy M.; Lehmann, Christopher M.B.; Nilles, Mark A.

2012-01-01

Using the infrastructure of the National Atmospheric Deposition Program (NADP), numerous measurements of radionuclide wet deposition over North America were made for 167 NADP sites before and after the Fukushima Dai-ichi Nuclear Power Station incident of March 12, 2011. For the period from March 8 through April 5, 2011, wet-only precipitation samples were collected by NADP and analyzed for fission-product isotopes within whole-water and filterable solid samples by the United States Geological Survey using gamma spectrometry. Variable amounts of 131I, 134Cs, or 137Cs were measured at approximately 21% of sampled NADP sites distributed widely across the contiguous United States and Alaska. Calculated 1- to 2-week individual radionuclide deposition fluxes ranged from 0.47 to 5100 Becquerels per square meter during the sampling period. Wet deposition activity was small compared to measured activity already present in U.S. soil. NADP networks responded to this complex disaster, and provided scientifically valid measurements that are comparable and complementary to other networks in North America and Europe.

Modulation of PPAR-γ by Nutraceutics as Complementary Treatment for Obesity-Related Disorders and Inflammatory Diseases

PubMed Central

Ortuño Sahagún, D.; Márquez-Aguirre, A. L.; Quintero-Fabián, S.; López-Roa, R. I.; Rojas-Mayorquín, A. E.

2012-01-01

A direct correlation between adequate nutrition and health is a universally accepted truth. The Western lifestyle, with a high intake of simple sugars, saturated fat, and physical inactivity, promotes pathologic conditions. The main adverse consequences range from cardiovascular disease, type 2 diabetes, and metabolic syndrome to several cancers. Dietary components influence tissue homeostasis in multiple ways and many different functional foods have been associated with various health benefits when consumed. Natural products are an important and promising source for drug discovery. Many anti-inflammatory natural products activate peroxisome proliferator-activated receptors (PPAR); therefore, compounds that activate or modulate PPAR-gamma (PPAR-γ) may help to fight all of these pathological conditions. Consequently, the discovery and optimization of novel PPAR-γ agonists and modulators that would display reduced side effects is of great interest. In this paper, we present some of the main naturally derived products studied that exert an influence on metabolism through the activation or modulation of PPAR-γ, and we also present PPAR-γ-related diseases that can be complementarily treated with nutraceutics from functional foods. PMID:23251142

Results of a laboratory experiment that tests rotating unbalanced-mass devices for scanning gimbaled payloads and free-flying spacecraft

NASA Technical Reports Server (NTRS)

Alhorn, D. C.; Polites, M. E.

1994-01-01

Rotating unbalanced-mass (RUM) devices are a new way to scan space-based, balloon-borne, and ground-based gimbaled payloads, like x-ray and gamma-ray telescopes. They can also be used to scan free-flying spacecraft. Circular scans, linear scans, and raster scans can be generated. A pair of RUM devices generates the basic scan motion and an auxiliary control system using torque motors, control moment gyros, or reaction wheels keeps the scan centered on the target and produces some complementary motion for raster scanning. Previous analyses and simulation results show that this approach offers significant power savings compared to scanning only with the auxiliary control system, especially with large payloads and high scan frequencies. However, these claims have never been proven until now. This paper describes a laboratory experiment which tests the concept of scanning a gimbaled payload with RUM devices. A description of the experiment is given and test results that prove the concept are presented. The test results are compared with those from a computer simulation model of the experiment and the differences are discussed.

Effect of γ-irradiation on structure and nutraceutical potential of β-D-glucan from barley (Hordeum vulgare).

PubMed

Shah, Asima; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Gani, Adil; Masoodi, Farooq Ahmad; Wani, Idrees Ahmed; Wani, Sajad Mohd; Gani, Asir

2015-01-01

This paper reports the characterization and potential antioxidant activity of β-D-glucan isolated from barley treated with γ-rays. The β-D-glucan was irradiated with 0, 2, 4 and 8 kGy by gamma ray. The samples were characterized by Fourier transform-infrared spectroscopy, gel permeation chromatography (GPC) and quantitative estimation by Megazyme β-D-glucan assay kit. The average molecular weight of non-irradiated β-D-glucan was 177 kDa that decreased to 79 kDa at 8 kGy. Antioxidant activity was evaluated by five complementary assays including DPPH, lipid peroxidation, reducing power, metal chelating ability and oxidative DNA damage assays. Further, the antiproliferative potential of irradiated β-D-glucan was tested against three human cancer cell lines including Colo-205, T47D and MCF7 using MTT assay. Irradiated β-D-glucan exhibited dose dependent cancer cell growth inhibition. In conclusion, the present study demonstrates that irradiation leads to the formation of low molecular weight β-D-glucan with enhanced antioxidant and antiproliferative activities. Copyright © 2014 Elsevier B.V. All rights reserved.

Anti-inflammatory protection afforded by cyanidin-3-glucoside and resveratrol in human intestinal cells via Nrf2 and PPAR-γ: Comparison with 5-aminosalicylic acid.

PubMed

Serra, Diana; Almeida, Leonor M; Dinis, Teresa C P

2016-12-25

This study investigated the involvement of nuclear factor erythroid 2 (Nrf2) and peroxisome proliferator-activated receptor-gamma (PPAR-γ) pathways in the protection afforded by two polyphenols abundant in diet, cyanidin-3-glucoside and resveratrol, against cytokine-induced inflammation and oxidative insult in HT-29 intestinal cells, in comparison with the drug 5-aminosalicylic acid (5-ASA). Our data show for the first time that in cytokine-challenged cells, cyanidin-3-glucoside and resveratrol induced Nrf2 activation, increased hemoxygenase-1 and glutamate cysteine ligase mRNA expression, enhanced reduced glutathione to oxidized glutathione ratio and inhibited reactive species production, at much lower concentrations than 5-ASA. Unlike cyanidin-3-glucoside, resveratrol and 5-ASA also increased nuclear levels of PPAR-γ in cytokine-stimulated cells. In conclusion, both polyphenols might be interesting as nutraceuticals, giving complementary benefits to conventional drugs against intestinal inflammation, typically present in patients with inflammatory bowel disease. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

A proteomics approach to study synergistic and antagonistic interactions of the fungal-bacterial consortium Fusarium oxysporum wild-type MSA 35.

PubMed

Moretti, Marino; Grunau, Alexander; Minerdi, Daniela; Gehrig, Peter; Roschitzki, Bernd; Eberl, Leo; Garibaldi, Angelo; Gullino, Maria Lodovica; Riedel, Kathrin

2010-09-01

Fusarium oxysporum is an important plant pathogen that causes severe damage of many economically important crop species. Various microorganisms have been shown to inhibit this soil-borne plant pathogen, including non-pathogenic F. oxysporum strains. In this study, F. oxysporum wild-type (WT) MSA 35, a biocontrol multispecies consortium that consists of a fungus and numerous rhizobacteria mainly belonging to gamma-proteobacteria, was analyzed by two complementary metaproteomic approaches (2-DE combined with MALDI-Tof/Tof MS and 1-D PAGE combined with LC-ESI-MS/MS) to identify fungal or bacterial factors potentially involved in antagonistic or synergistic interactions between the consortium members. Moreover, the proteome profiles of F. oxysporum WT MSA 35 and its cured counter-part CU MSA 35 (WT treated with antibiotics) were compared with unravel the bacterial impact on consortium functioning. Our study presents the first proteome mapping of an antagonistic F. oxysporum strain and proposes candidate proteins that might play an important role for the biocontrol activity and the close interrelationship between the fungus and its bacterial partners.

Implementation of the TDCR liquid scintillation method at CNEA-LMR, Argentina.

PubMed

Arenillas, Pablo; Cassette, Philippe

2006-01-01

During the last two years, a triple-to-double coincidence ratio (TDCR) system was assembled and adjusted at the CNEA-LMR, Argentina. The new counting system will add complementary capabilities to the absolute measurements section of the CNEA-LMR. This work describes its implementation and validation. Several checks and a set of beta-emitting standard solutions were used in order to perform the validation experiments. In preliminary measurements, a 3H LNHB solution with reference activity concentration of (119.7+/-0.9) kBq/g on 11 November 2003 was used. The CNEA-LMR TDCR counter gave, at the same reference date, an activity concentration of (120+/-1) kBq/g. Results and improvements are presented in detail. Concerning the asymmetry of the system, the quantum efficiency of the three photomultiplier tubes was studied for different operating conditions of the focusing voltage. The counter also includes an automatic system to change the efficiency by defocusing the photomultipliers and on the other hand, it was coupled to a HPGe detector to also measure beta-gamma coincidences.

Monitoring of occupational exposure in manufacturing of stainless steel constructions. Part I: Chromium, iron, manganese, molybdenum, nickel and vanadium in the workplace air of stainless steel welders.

PubMed

Kucera, J; Bencko, V; Pápayová, A; Saligová, D; Tejral, J; Borská, L

2001-11-01

Exposure to workplace airborne pollutants was examined in a group of 20 workers dealing mainly with welding, polishing, drilling and assembling of stainless steel constructions. Airborne particulate matter (APM) collected using both personal and stationary samplers was analyzed by instrumental neutron activation analysis (INAA). Quality assurance procedures of both sampling and analytical stages are described. Of the elements determined, results are presented for chromium, iron, manganese, molybdenum, nickel and vanadium. The median values of element concentrations exceeded the maximum admissible limits for workplace pollutants only for chromium, while for nickel the limit was exceeded in several individual cases. Sampling of hair, nails, blood, urine and saliva to be used for biological monitoring of the exposed and control groups is also described.

Ion probe determinations of the rare earth concentrations of individual meteoritic phosphate grains

NASA Technical Reports Server (NTRS)

Crozaz, G.; Zinner, E.

1985-01-01

A new ion probe method for quantitative measurements of the concentrations of all the REE down to the ppm level in 5-20 micron spots is presented. The first application of the method is the determination of REE abundances in meteoritic phosphates. Results are shown to be in good agreement with previous INAA and ion probe determinations. The merrillites in the St. Severin amphoterite are richer in REE than the apatites (the enrichment factors, for various REE, range from 2.3 to 14.2) in contradiction with the results of Ebihara and Honda (1983). Provided good standards for other mineral phases are found or implanted marker ion techniques are used, the method should find a wide range of applications for the study of both terrestrial and extraterrestrial crystals at the microscopic level.

Petrology, Mineralogy, and Trace Element Geochemistry of Yuanyang

NASA Astrophysics Data System (ADS)

Wang, H. Y.; Xu, W. B.

2016-09-01

Yuanyang was found in Yunnan in 2010. Yuanyang has a rusted surface, and there are also some corroded materials inside. The major phases in Yuanyang are kamacite (Ni 4.88-6.21 wt%) and taenite (Ni 26.13-50.27 wt%). The minor ones are schreibersite, sphalerite, and carlsbergite. Yuanyang is a coarse octahedrite with a high content of kamacite (80 vol%). No silicate inclusions are found in Yuanyang. The instrumental neutron activation analysis (INAA) of Yuanyang reveals that it is a low-Ni (7 wt%) and low-Au (1.565 ppm) iron. Yuanyang is an IAB-MG iron. The Ir content (1.00 ppm) of Yuanyang is relatively low compared to other IAB-MG irons. This is probably due to the partial melting of Ir-rich phase in its parent body during an impact event.

Cancer and Complementary Health Approaches

MedlinePlus

... Cancer Institute's activities in research on complementary health approaches. Toll-free in the U.S.: 1-800-4-CANCER (1-800-422-6237) Web ... complementary health approaches. Information on complementary health approaches in cancer treatment: ...

Complementary and Alternative Medicine for Patients

MedlinePlus

... Ask about Your Treatment Research Complementary and Alternative Medicine for Patients Complementary and alternative medicine (CAM) is ... based on scientific evidence from research studies. Complementary medicine refers to treatments that are used with standard ...

Patient Use of Complementary and Alternative Medicines in an Outpatient Pediatric Neurology Clinic.

PubMed

Kenney, Daniel; Jenkins, Sarah; Youssef, Paul; Kotagal, Suresh

2016-05-01

This article describes the use of complementary and alternative medicines in an outpatient pediatric neurology clinic, and assesses family attitudes toward the efficacy of complementary and alternative medicines versus prescription medications. Complementary and alternative medicine is an important element of the modern health care landscape. There is limited information about whether, and to what extent, families perceive its utility in childhood neurological disorders. Surveys were distributed to 500 consecutive patients at a child neurology clinic in Rochester, Minnesota. Questions pertained to the child's diagnoses, use of complementary and alternative medicines, and the specific complementary and alternative medicine modalities that were used. Opinions were also gathered on the perceived efficacy of complementary and alternative medicines and prescription medications. Data were compared using χ(2) or Fisher exact tests as indicated. A total of 484 surveys were returned, of which 327 were usable. Only 17.4% admitted to use of complementary and alternative medicine to treat neurological problems. However, in follow-up questioning, actually 41.6% of patients recognized that they were using one or more types of complementary and alternative medicines. Disorders associated with a statistically significant increased prevalence of complementary and alternative medicine use were headache (50.8% with headache used complementary and alternative medicine versus 35.7% without headache; P = 0.008, Fisher exact test), chronic fatigue (63.2% vs 38.8%; P = 0.005, Fisher exact test), and sleep disorders (77.1% vs 37.3%; P < 0.0001, Fisher exact test). A large proportion of pediatric neurology patients in our clinic are also using complementary and alternative medicine. Only 38.5% of these recognize themselves as using complementary and alternative medicine, underlining the need to inquire in-depth about its use. Patients who are less satisfied with their prescription medications are more likely to use complementary and alternative medicine, perhaps reflecting the less tractable nature of their disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

Length and weight of very low birth weight infants in Germany at 2 years of age: does it matter at what age they start complementary food?

PubMed

Spiegler, J; Eisemann, N; Ehlers, S; Orlikowsky, T; Kannt, O; Herting, E; Göpel, W

2015-06-01

We analysed at what age parents start complementary food in very low birth weight infants, determined risk factors for early introduction of complementary food (post-term age) and analysed whether the age at introduction of complementary food influences height or weight at 2 years of age. Parents of premature infants born in 2009-2011 answered questionnaires regarding introduction of complementary food in the first year of life (N=2262) and were followed up at a post-term age of 2 years (N=981). Length and weight were compared with full-term infants from the KiGGs study. Logistic and linear regression analyses were conducted to study predictors for early introduction of complementary food and the influence of age at introduction of complementary food on later height and weight. Average age at introduction of complementary food was 3.5 months post-term age. The lower the gestational age at birth, the earlier (post-term age) vegetables and meat were introduced. Age at introduction of complementary food was influenced by intrauterine growth restriction, gestational age at birth, maternal education and a developmental delay perceived by the parents. Length and weight at a post-term age of 2 years was not negatively influenced by early introduction of complementary food. VLBW infants are introduced to complementary food on average before a post-term age of 4 months. There was no negative effect of early introduction of complementary food on height and weight at 2 years of age.

Special Section: Complementary and Alternative Medicine (CAM):Quiz on Complementary and Alternative Medicine

MedlinePlus

... Special Section CAM Quiz on Complementary and Alternative Medicine Past Issues / Winter 2009 Table of Contents For ... low back pain. True False Complementary and alternative medicine (CAM) includes: Meditation Chiropractic Use of natural products, ...

Tracing back the nascence of a new sex-determination pathway to the ancestor of bees and ants

PubMed Central

Schmieder, Sandra; Colinet, Dominique; Poirié, Marylène

2012-01-01

In several Hymenoptera, sexual fate is determined by the allelic composition at the complementary sex-determiner locus, a sex-determination mechanism that can strongly affect population dynamics. To date, the molecular identification of complementary sex determiner has only been achieved in the honeybee, where the complementary sex-determiner gene was reported to have arisen from duplication of the feminizer gene. Strikingly, the complementary sex-determiner gene was also proposed to be unique to the honeybee lineage. Here we identify feminizer and complementary sex-determiner orthologues in bumble bees and ants. We further demonstrate that the duplication of feminizer that produced complementary sex determiner occurred before the divergence of Aculeata species (~120 Myr ago). Finally, we provide evidence that the two genes evolved concertedly through gene conversion, complementary sex-determiner evolution being additionally shaped by mosaic patterns of selection. Thus, the complementary sex-determiner gene likely represents the molecular basis for single locus-complementary sex determination in the Aculeata infra-order, and possibly, in the entire Hymenoptera order. PMID:22692538

A new measurement of the rare decay eta -> pi^0 gamma gamma with the Crystal Ball/TAPS detectors at the Mainz Microtron

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nefkens, B M; Prakhov, S; Aguar-Bartolom��, P

2014-08-01

A new measurement of the rare, doubly radiative decay eta->pi^0 gamma gamma was conducted with the Crystal Ball and TAPS multiphoton spectrometers together with the photon tagging facility at the Mainz Microtron MAMI. New data on the dependence of the partial decay width, Gamma(eta->pi^0 gamma gamma), on the two-photon invariant mass squared, m^2(gamma gamma), as well as a new, more precise value for the decay width, Gamma(eta->pi^0 gamma gamma) = (0.33+/-0.03_tot) eV, are based on analysis of 1.2 x 10^3 eta->pi^0 gamma gamma decays from a total of 6 x 10^7 eta mesons produced in the gamma p -> etamore » p reaction. The present results for dGamma(eta->pi^0 gamma gamma)/dm^2(gamma gamma) are in good agreement with previous measurements and recent theoretical calculations for this dependence.« less

Two-photon widths of the {chi}{sub cJ} states of charmonium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ecklund, K. M.; Love, W.; Savinov, V.

2008-11-01

Using a data sample of 24.5x10{sup 6} {psi}(2S) the reactions {psi}(2S){yields}{gamma}{chi}{sub cJ}, {chi}{sub cJ}{yields}{gamma}{gamma} have been studied for the first time to determine the two-photon widths of the {chi}{sub cJ} states of charmonium in their decay into two photons. The measured quantities are B({psi}(2S){yields}{gamma}{chi}{sub c0})xB({chi}{sub c0}{yields}{gamma}{gamma})=(2.17{+-}0.32{+-}0.10)x10{sup -5} and B({psi}(2S){yields}{gamma}{chi}{sub c2})xB({chi}{sub c2}{yields}{gamma}{gamma})=(2.68{+-}0.28{+-}0.15)x10{sup -5}. Using values for B({psi}(2S){yields}{gamma}{chi}{sub c0,c2}) and {gamma}({chi}{sub c0,c2}) from the literature the two-photon widths are derived to be {gamma}{sub {gamma}}{sub {gamma}}({chi}{sub c0})=(2.36{+-}0.35{+-}0.22) keV, {gamma}{sub {gamma}}{sub {gamma}}({chi}{sub c2})=(0.66{+-}0.07{+-}0.06) keV, and R{identical_to}{gamma}{sub {gamma}}{sub {gamma}}({chi}{sub c2})/{gamma}{sub {gamma}}{sub {gamma}}({chi}{sub c0})=0.278{+-}0.050{+-}0.036. The importance of the measurement of R is emphasized. For the forbiddenmore » transition, {chi}{sub c1}{yields}{gamma}{gamma}, an upper limit of {gamma}{sub {gamma}}{sub {gamma}}({chi}{sub c1})<0.03 keV is established.« less

The Z {yields} cc-bar {yields} {gamma}{gamma}*, Z {yields} bb-bar {yields} {gamma}{gamma}* triangle diagrams and the Z {yields} {gamma}{psi}, Z {yields} {gamma}Y decays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Achasov, N. N., E-mail: achasov@math.nsc.ru

2011-03-15

The approach to the Z {yields} {gamma}{psi} and Z {yields} {gamma}Y decay study is presented in detail, based on the sum rules for the Z {yields} cc-bar {yields} {gamma}{gamma}* and Z {yields} bb-bar {yields} {gamma}{gamma}* amplitudes and their derivatives. The branching ratios of the Z {yields} {gamma}{psi} and Z {yields} {gamma}Y decays are calculated for different hypotheses on saturation of the sum rules. The lower bounds of {Sigma}{sub {psi}} BR(Z {yields} {gamma}{psi}) = 1.95 Multiplication-Sign 10{sup -7} and {Sigma}{sub {upsilon}} BR(Z {yields} {gamma}Y) = 7.23 Multiplication-Sign 10{sup -7} are found. Deviations from the lower bounds are discussed, including the possibilitymore » of BR(Z {yields} {gamma}J/{psi}(1S)) {approx} BR(Z {yields} {gamma}Y(1S)) {approx} 10{sup -6}, that could be probably measured in LHC. The angular distributions in the Z {yields} {gamma}{psi} and Z {yields} {gamma}Y decays are also calculated.« less

Factors related to complementary/alternative medicine use among cancer patients in central Anatolia.

PubMed

Er, Ozlem; Mistik, Selcuk; Ozkan, Metin; Ozturk, Ahmet; Altinbas, Mustafa

2008-01-01

We aimed to evaluate the prevalence of and factors related to the use of complementary/alternative medicine among cancer patients undergoing or following conventional treatment at the Erciyes University Oncology Hospital in Central Anatolia. Face-to-face interview and a questionnaire were carried out with cancer patients attending the outpatient clinic of Medical Oncology. Questionnaire items included patients' demographic data, treatment, use of complementary/alternative medicine and possible related factors. Multivariate analysis was performed to compare the factors related to use of complementary/alternative medicine. A total of 268 consecutive cancer patients were enrolled in the study. Overall, 43% of the patients were using or had used complementary/alternative medicine. Totally, 90% of the patients using complementary/alternative medicine utilized herbs, and most of the herbs used were stinging nettle. Nearly half of the patients using complementary/alternative medicine (46.1%) were aiming to fight the disease. Among users, nearly half of them regarded the method used as effective and 54 (50.5%) suggested the use of complementary/alternative medicine to other patients. Only 23.1% of the patients discussed the use of complementary/alternative medicine with their physician. In logistic regression analysis, younger age, higher educational status, advanced stage of the disease, longer duration of the disease and current treatment status were significantly associated with the use of complementary/alternative medicine. In our regression model, the predictivity rate of these variables was 72.2% for use of complementary/alternative medicine according to the backward Wald test. Use of complementary/alternative medicine among cancer patients in our center is modestly high, and the most common method is herbal therapy. Communication between the patient and the physician should be improved on this subject.

Use of complementary and alternative medicines during the third trimester.

PubMed

Pallivalapila, Abdul Rouf; Stewart, Derek; Shetty, Ashalatha; Pande, Binita; Singh, Rajvir; McLay, James S

2015-01-01

To estimate the prevalence, indications, and associated factors for complementary and alternative medicine use during the last trimester of pregnancy. A questionnaire survey was conducted of women with a live birth (N=700) admitted to the postnatal unit at the Royal Aberdeen Maternity Hospital, northeast Scotland. Outcome measures included: complementary and alternative medicine used; vitamins and minerals used; reasons for complementary and alternative medicine use; independent associated factors for use; views; and experiences. Descriptive and inferential statistical analysis was performed. The response rate was 79.6% of eligible women. Two thirds of respondents (61.4%) reported using complementary and alternative medicine, excluding vitamins and minerals, during the third trimester. Respondents reported using a total of 30 different complementary and alternative medicine modalities, of which oral herbal products were the most common (38% of respondents, 40 different products). The independent associated factors for complementary and alternative medicine use identified were: complementary and alternative medicine use before pregnancy (odds ratio [OR] 4.36, 95% confidence interval [CI] 2.39-7.95, P<.001); a university education (OR 2.41, 95% CI 1.46-4.0, P=.001), and complementary and alternative medicine use by family or friends (OR 2.36, 95% CI 1.61-3.47, P<.001). There was no association with health care professional recommendations. Users were significantly more likely than nonusers to agree that complementary and alternative medicines were safer than prescribed medicines (P=.006), less likely to be associated with side effects (P≤.001), and could interfere with conventional medicines (P≤.001). Despite the majority of respondents, and notably users, being uncertain about their safety and effectiveness, complementary and alternative medicine modalities and complementary and alternative medicine products are widely used during the third trimester of pregnancy in this study population. Although prior use was the most significant independent associated factor, the role of family and friends, rather than health professionals, in the decision to use complementary and alternative medicine may be of concern. III.

Age of Complementary Foods Introduction and Risk of Anemia in Children Aged 4-6 years: A Prospective Birth Cohort in China.

PubMed

Wang, Fenglei; Liu, Huijuan; Wan, Yi; Li, Jing; Chen, Yu; Zheng, Jusheng; Huang, Tao; Li, Duo

2017-03-23

Age of complementary foods introduction is associated with childhood anemia, but the ideal age for the introduction of complementary foods to infants is a continuing topic of debate. We examined the longitudinal association between complementary foods introduction age and risk of anemia in 18,446 children from the Jiaxing Birth Cohort, who had detailed complementary feeding records at 3 and 6 months of age and had hemoglobin concentrations measured at 4-6 years. Early introduction of complementary foods at 3-6 months of age was significantly associated with a higher risk of anemia (odds ratio = 1.14; 95% confidence interval: 1.01-1.28) and a lower hemoglobin concentration of -0.84 g/L (95% confidence interval: -1.33 to -0.35) in children aged 4-6 years, compared with those fed complementary foods starting at 6 months of age. When it comes to the specific type of complementary foods, early introduction of all plant-based foods was associated with increased anemia risks and lower hemoglobin concentrations, while early introduction of most animal-based foods was not. These findings may be informative regarding the appropriate time to introduce complementary foods in infants.

Residential Exposure to Natural Background Radiation and Risk of Childhood Acute Leukemia in France, 1990–2009

PubMed Central

Demoury, Claire; Marquant, Fabienne; Ielsch, Géraldine; Goujon, Stéphanie; Debayle, Christophe; Faure, Laure; Coste, Astrid; Laurent, Olivier; Guillevic, Jérôme; Laurier, Dominique; Hémon, Denis; Clavel, Jacqueline

2016-01-01

Background: Exposures to high-dose ionizing radiation and high-dose rate ionizing radiation are established risk factors for childhood acute leukemia (AL). The risk of AL following exposure to lower doses due to natural background radiation (NBR) has yet to be conclusively determined. Methods: AL cases diagnosed over 1990–2009 (9,056 cases) were identified and their municipality of residence at diagnosis collected by the National Registry of Childhood Cancers. The Geocap study, which included the 2,763 cases in 2002–2007 and 30,000 population controls, was used for complementary analyses. NBR exposures were modeled on a fine scale (36,326 municipalities) based on measurement campaigns and geological data. The power to detect an association between AL and dose to the red bone marrow (RBM) fitting UNSCEAR (United Nations Scientific Committee on the Effects of Atomic Radiation) predictions was 92%, 45% and 99% for exposure to natural gamma radiation, radon and total radiation, respectively. Results: AL risk, irrespective of subtype and age group, was not associated with the exposure of municipalities to radon or gamma radiation in terms of yearly exposure at age reached, cumulative exposure or RBM dose. There was no confounding effect of census-based socio-demographic indicators, or environmental factors (road traffic, high voltage power lines, vicinity of nuclear plants) related to AL in the Geocap study. Conclusions: Our findings do not support the hypothesis that residential exposure to NBR increases the risk of AL, despite the large size of the study, fine scale exposure estimates and wide range of exposures over France. However, our results at the time of diagnosis do not rule out a slight association with gamma radiation at the time of birth, which would be more in line with the recent findings in the UK and Switzerland. Citation: Demoury C, Marquant F, Ielsch G, Goujon S, Debayle C, Faure L, Coste A, Laurent O, Guillevic J, Laurier D, Hémon D, Clavel J. 2017. Residential exposure to natural background radiation and risk of childhood acute leukemia in France, 1990–2009. Environ Health Perspect 125:714–720; http://dx.doi.org/10.1289/EHP296 PMID:27483500

A method based on Monte Carlo simulations and voxelized anatomical atlases to evaluate and correct uncertainties on radiotracer accumulation quantitation in beta microprobe studies in the rat brain

NASA Astrophysics Data System (ADS)

Pain, F.; Dhenain, M.; Gurden, H.; Routier, A. L.; Lefebvre, F.; Mastrippolito, R.; Lanièce, P.

2008-10-01

The β-microprobe is a simple and versatile technique complementary to small animal positron emission tomography (PET). It relies on local measurements of the concentration of positron-labeled molecules. So far, it has been successfully used in anesthetized rats for pharmacokinetics experiments and for the study of brain energetic metabolism. However, the ability of the technique to provide accurate quantitative measurements using 18F, 11C and 15O tracers is likely to suffer from the contribution of 511 keV gamma rays background to the signal and from the contribution of positrons from brain loci surrounding the locus of interest. The aim of the present paper is to provide a method of evaluating several parameters, which are supposed to affect the quantification of recordings performed in vivo with this methodology. We have developed realistic voxelized phantoms of the rat whole body and brain, and used them as input geometries for Monte Carlo simulations of previous β-microprobe reports. In the context of realistic experiments (binding of 11C-Raclopride to D2 dopaminergic receptors in the striatum; local glucose metabolic rate measurement with 18F-FDG and H2O15 blood flow measurements in the somatosensory cortex), we have calculated the detection efficiencies and corresponding contribution of 511 keV gammas from peripheral organs accumulation. We confirmed that the 511 keV gammas background does not impair quantification. To evaluate the contribution of positrons from adjacent structures, we have developed β-Assistant, a program based on a rat brain voxelized atlas and matrices of local detection efficiencies calculated by Monte Carlo simulations for several probe geometries. This program was used to calculate the 'apparent sensitivity' of the probe for each brain structure included in the detection volume. For a given localization of a probe within the brain, this allows us to quantify the different sources of beta signal. Finally, since stereotaxic accuracy is crucial for quantification in most microprobe studies, the influence of stereotaxic positioning error was studied for several realistic experiments in favorable and unfavorable experimental situations (binding of 11C-Raclopride to D2 dopaminergic receptors in the striatum; binding of 18F-MPPF to 5HT1A receptors in the dorsal raphe nucleus).

M1 muscarinic agonists can modulate some of the hallmarks in Alzheimer's disease: implications in future therapy.

PubMed

Fisher, Abraham; Pittel, Zipora; Haring, Rachel; Bar-Ner, Nira; Kliger-Spatz, Michal; Natan, Niva; Egozi, Inbal; Sonego, Hagar; Marcovitch, Itzhak; Brandeis, Rachel

2003-01-01

M1 muscarinic receptors (M1 mAChRs) play a role in an apparent linkage of three major hallmarks of Alzheimer's disease (AD): beta-amyloid (Abeta) peptide; tau hyperphosphorylation and paired helical filaments (PHFs); and loss of cholinergic function conducive to cognitive impairments. We evaluated the M1 muscarinic agonists AF102B (Cevimeline, EVOXAC trade mark : prescribed for Sjøgren's syndrome), AF150(S), and AF267B on some of these hallmarks of AD. Activation of M1 mAChRs with these agonists leads, inter alia, to enhanced secretion of amyloid precursor protein (alpha-APP), (via alpha-secretase activation), to decreased Abeta (via gamma-secretase inhibition), and to inhibition of Abeta- and/or oxidative stress-induced cell death. In several animal models mimicking different aspects of AD, these drugs restored cognitive impairments, and in select cases induced a decrease in brain Abeta elevation, with a high safety margin, following po administration. Notably, in mice with small hippocampi, unlike rivastigmine and nicotine, AF150(S) and AF267B restored cognitive impairments also on escape latency in a Morris water maze paradigm, in reversal learning. Studies from other labs showed that AF102B and talsaclidine (another M1 agonist) decreased cerbrospinal fluid (CSF) Abeta in AD patients following chronic treatment, being the first reported drugs with such a profile. The clinical significance of these studies remains to be elucidated, yet based on in vivo (rabbits) and in vitro studies (cell cultures), our M1 agonists can decrease brain Abeta, owing to a novel and dual complementary effect (e.g., inhibition of gamma-secretase and activation of alpha-secretase). Remarkably, although M1 agonists can decrease CSF Abeta in AD patients, an increased AD-type pathology in Parkinson's disease was recently been associated with chronic antimuscarinic treatment. In another aspect, these agonists decreased tau hyperphosphorylation in vitro and in vivo. Notably, nicotinic agonists or cholinesterase inhibitors increased tau hyperphosphorylation. In summary, the M1 agonists tested are effective on cognition and behavior and show unique disease-modifying properties owing to beneficial effects on major hallmarks of AD. This may place such drugs in the first line of modern AD therapies (e.g., beta- or gamma-secretase inhibitors, vaccines against Abeta, statins, and inhibitors of tau hyperphosphorylation).

Intraoperative gamma probe guidance with 99mTc-pertechnetate in the completion thyroidectomy.

PubMed

Aras, Gülseren; Gültekin, Salih Sinan; Küçük, Nuriye Ozlem; Demirer, Seher; Tuğ, Tuğbay

2009-07-01

Intraoperative gamma probe (GP) guidance with (99m)Tc-pertechnetate in the completion total thyroidectomy after a first thyroidectomy was investigated in this prospective study. The study group comprises of fourteen consecutive patients (14 females, age mean 50.2 +/- 12.0 years, age range 29-73 years). All patients underwent a second thyroidectomy due to inadequate (5/14 patients) and complementary (9/14 patients) interventions. Serum-free three iodothyronine, free thyroxin and thyroid stimulating hormone measurements, a neck ultrasonography (USG) and thyroid scintigraphy (TS) were performed in the preoperative and postoperative period. After a 185 MBq (5 mCi) injection of (99m)Tc-pertechnetate, background (BG), left thyroid lobe (LTL), right thyroid lobe (RTL) and pyramidal tyroid lobe (PTL) regions were counted in time before and after resection of thyroid remnants by intraoperative GP. All resection materials were evaluated by histopathologic examination. Preoperative TSH was less than 30 mIU/mL (mean 21 +/- 7) in all patients. Functioning thyroid remnants were shown in 13/14 patients on the preoperative TS and USG, which were diagnosed by USG in one but by TS in other one. We calculated that percentage median (minimum-maximum) values were 220.90% (56.00-411.11%) in LTL, 80.43% (11.54-471.05%) in RTL and 66.60% (-3.33 to 158.33%) in PTL for counts before resection, on the other hand, 15.96% (-20.55 to 47.62%) in LTL, 17.59% (-15.07 to 38.46%) in RTL and 17.59% (-1.96 to 57.14%) in PTL regions for counts after resection. There were statistically significant differences between these values belonging to before and after resection for LTL (p = 0.001), RTL (p = 0.001) and PTL (p = 0.008). Bilateral small foci in a patient and unilateral focus in other patient were observed in postoperative TS. Unilateral focus was detected on the RTL by GP, but not bilateral foci. Postoperative TSH levels increased to 30 mIU/mL (mean 69 +/- 26) at least. There was a statistically significant difference between preoperative and postoperative TSH values (p < 0.001). Histopathologic confirmation revealed that all removed materials were the thyroid tissues. Gamma probe guidance with (99m)Tc-pertechnetate seemed to be a good option and easy available method in patients undergoing the completion total thyroidectomy.

Sneaky Gamma-Rays: Using Gravitational Lensing to Avoid Gamma-Gamma-Absorption

NASA Astrophysics Data System (ADS)

Boettcher, Markus; Barnacka, Anna

2014-08-01

It has recently been suggested that gravitational lensing studies of gamma-ray blazars might be a promising avenue to probe the location of the gamma-ray emitting region in blazars. Motivated by these prospects, we have investigated potential gamma-gamma absorption signatures of intervening lenses in the very-high-energy gamma-ray emission from lensedblazars. We considered intervening galaxies and individual stars within these galaxies. We find that the collective radiation field of galaxies acting as sources of macrolensing are not expected to lead to significant gamma-gamma absorption. Individual stars within intervening galaxies could, in principle, cause a significant opacity to gamma-gamma absorption for VHE gamma-rays if the impact parameter (the distance of closest approach of the gamma-ray to the center of the star) is small enough. However, we find that the curvature of the photon path due to gravitational lensing will cause gamma-ray photons to maintain a sufficiently large distance from such stars to avoid significant gamma-gamma absorption. This re-inforces the prospect of gravitational-lensing studies of gamma-ray blazars without interference due to gamma-gamma absorption due to the lensing objects.

76 FR 59707 - National Center for Complementary & Alternative Medicine; Notice of Closed Meetings

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-27

... Complementary & Alternative Medicine; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... for Complementary and Alternative Medicine Special Emphasis Panel, Training and Education. Date... Complementary and Alternative Medicine Special Emphasis Panel, Clinical Studies of CAM Therapies. Date: November...

Use of complementary and alternative medicine in children and adolescents with autism spectrum disorder: A systematic review.

PubMed

Höfer, Juliana; Hoffmann, Falk; Bachmann, Christian

2017-05-01

Despite limited evidence, complementary and alternative medicine treatments are popular in autism spectrum disorder. The aim of this review was to summarize the available evidence on complementary and alternative medicine use frequency in autism spectrum disorder. A systematic search of three electronic databases was performed. All research studies in English or German reporting data on the frequency of complementary and alternative medicine use in individuals with autism spectrum disorder were included. Two independent reviewers searched the literature, extracted information on study design and results, and assessed study quality using an established quality assessment tool. Twenty studies with a total of 9540 participants were included. The prevalence of any complementary and alternative medicine use ranged from 28% to 95% (median: 54%). Special diets or dietary supplements (including vitamins) were the most frequent complementary and alternative medicine treatments, ranking first in 75% of studies. There was some evidence for a higher prevalence of complementary and alternative medicine use in autism spectrum disorder compared to other psychiatric disorders and the general population. Approximately half of children and adolescents with autism spectrum disorder use complementary and alternative medicine. Doctors should be aware of this and should discuss complementary and alternative medicine use with patients and their carers, especially as the evidence is mixed and some complementary and alternative medicine treatments are potentially harmful.

Ethical responsibilities of pharmacists when selling complementary medicines: a systematic review.

PubMed

Salman Popattia, Amber; Winch, Sarah; La Caze, Adam

2018-04-01

The widespread sale of complementary medicines in community pharmacy raises important questions regarding the responsibilities of pharmacists when selling complementary medicines. This study reviews the academic literature that explores a pharmacist's responsibilities when selling complementary medicines. International Pharmaceutical Abstracts, Embase, PubMed, Cinahl, PsycINFO and Philosopher's index databases were searched for articles written in English and published between 1995 and 2017. Empirical studies discussing pharmacists' practices or perceptions, consumers' expectations and normative studies discussing ethical perspectives or proposing ethical frameworks related to pharmacists' responsibilities in selling complementary medicines were included in the review. Fifty-eight studies met the inclusion criteria. The majority of the studies discussing the responsibilities of pharmacists selling complementary medicines had an empirical focus. Pharmacists and consumers identified counselling and ensuring safe use of complementary medicines as the primary responsibilities of pharmacists. No formal ethical framework is explicitly employed to describe the responsibilities of pharmacists selling complementary medicines. To the degree any ethical framework is employed, a number of papers implicitly rely on principlism. The studies discussing the ethical perspectives of selling complementary medicines mainly describe the ethical conflict between a pharmacist's business and health professional role. No attempt is made to provide guidance on appropriate ways to resolve the conflict. There is a lack of explicit normative advice in the existing literature regarding the responsibilities of pharmacists selling complementary medicines. This review identifies the need to develop a detailed practice-specific ethical framework to guide pharmacists regarding their responsibilities when selling complementary medicines. © 2018 Royal Pharmaceutical Society.

Expectations and responsibilities regarding the sale of complementary medicines in pharmacies: perspectives of consumers and pharmacy support staff.

PubMed

Iyer, Priya; McFarland, Reanna; La Caze, Adam

2017-08-01

Most sales of complementary medicines within pharmacies are conducted by pharmacy support staff. The absence of rigorous evidence for the effectiveness of many complementary medicines raises a number of ethical questions regarding the sale of complementary medicines in pharmacies. Explore (1) what consumers expect from pharmacists/pharmacies with regard to the sale of complementary medicines, and (2) how pharmacy support staff perceive their responsibilities when selling complementary medicines. One-on-one semi-structured interviews were conducted with a convenience sample of pharmacy support staff and consumers in pharmacies in Brisbane. Consumers were asked to describe their expectations when purchasing complementary medicines. Pharmacy support staff were asked to describe their responsibilities when selling complementary medicines. Interviews were conducted and analysed using the techniques developed within Grounded Theory. Thirty-three consumers were recruited from three pharmacies. Consumers described complementary medicine use as a personal health choice. Consumer expectations on the pharmacist included: select the right product for the right person, expert product knowledge and maintaining a wide range of good quality stock. Twenty pharmacy support staff were recruited from four pharmacies. Pharmacy support staff employed processes to ensure consumers receive the right product for the right person. Pharmacy support staff expressed a commitment to aiding consumers, but few evaluated the reliability of effectiveness claims regarding complementary medicines. Pharmacists need to respect the personal health choices of consumers while also putting procedures in place to ensure safe and appropriate use of complementary medicines. This includes providing appropriate support to pharmacy support staff. © 2016 Royal Pharmaceutical Society.

75 FR 11186 - National Center for Complementary and Alternative Medicine Announcement of Workshop on Natural...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-10

... Complementary and Alternative Medicine Announcement of Workshop on Natural Products ACTION: Notice. SUMMARY: As part of its strategic planning process, the National Center for Complementary and Alternative Medicine... attend. Seating is limited. Background: The National Center for Complementary and Alternative Medicine...

75 FR 19979 - National Center for Complementary and Alternative Medicine Announcement of Workshop on the...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-16

... Complementary and Alternative Medicine Announcement of Workshop on the Deconstruction of Back Pain ACTION: Notice. SUMMARY: The National Center for Complementary and Alternative Medicine (NCCAM) invites the... Alternative Medicine (NCCAM) was established in 1999 with the mission of exploring complementary and...

75 FR 30039 - National Center for Complementary and Alternative Medicine; Notice of Closed Meetings

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-28

... Complementary and Alternative Medicine; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... Complementary and Alternative Medicine Special Emphasis Panel; Education Panel. Date: June 24-25, 2010. Time: 5... of Committee: National Center for Complementary and Alternative Medicine Special Emphasis Panel; RFA...

75 FR 57970 - National Center for Complementary & Alternative Medicine; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-23

... Complementary & Alternative Medicine; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory... Complementary and Alternative Medicine Special Emphasis Panel, Centers of Excellence for Research on CAM (CERC... Complementary, & Alternative Medicine, NIH, 6707 Democracy Blvd., Suite 401, Bethesda, MD 20892, 301-594-3456...

77 FR 73036 - National Center for Complementary & Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-07

... Complementary & Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Council for Complementary and Alternative Medicine. The meeting will be open to the public as indicated... privacy. Name of Committee: National Advisory Council for Complementary and Alternative Medicine. Date...

77 FR 52750 - National Center for Complementary & Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-30

... Complementary & Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Council for Complementary and Alternative Medicine. The meeting will be open to the public as indicated... privacy. Name of Committee: National Advisory Council for Complementary and Alternative Medicine. Date...

78 FR 76635 - National Center for Complementary and Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-18

... Complementary and Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Council for Complementary and Alternative Medicine. The meeting will be open to the public as indicated... privacy. Name of Committee: National Advisory Council for Complementary and Alternative Medicine; NCCAM...

75 FR 43994 - National Center for Complementary and Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-27

... Complementary and Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Complementary and Alternative Medicine (NACCAM) meeting. The meeting will be open to the public as indicated... privacy. Name of Committee: National Advisory Council for Complementary and Alternative Medicine. Date...

77 FR 25185 - National Center for Complementary and Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-27

... Complementary and Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Council for Complementary and Alternative Medicine. The meeting will be open to the public as indicated... privacy. Name of Committee: National Advisory Council for Complementary and Alternative Medicine. Date...

Microprobe studies of microtomed particles of white druse salts in shergottite EETA 79001

NASA Technical Reports Server (NTRS)

Lindstrom, D. J.

1991-01-01

The white druse material in Antarctic shergottite EETA 79001 has attracted much attention as a possible sample fo Martian aqueous deposits. Instrumental Neutron Activation Analysis (INAA) was used to determine trace element analyses of small particles of this material obtained by handpicking of likely grains from broken surfaces of the meteorite. Electron microprobe work was attempted on grain areas as large as 150x120 microns. Backscattered electron images show considerable variations in brightness, and botryoidal structures were observed. Microprobe analyses showed considerable variability both within single particles and between different particles. Microtomed surfaces of small selected particles were shown to be very useful in obtaining information on the texture and composition of rare lithologies like the white druse of EETA 79001. This material is clearly heterogeneous on all distance scales, so a large number of further analyses will be required to characterize it.

Chemical Analyses of Pre-Holocene Rocks from Medicine Lake Volcano and Vicinity, Northern California

USGS Publications Warehouse

Donnelly-Nolan, Julie M.

2008-01-01

Chemical analyses are presented in an accompanying table (Table 1) for more than 600 pre-Holocene rocks collected at and near Medicine Lake Volcano, northern California. The data include major-element X-ray fluorescence (XRF) analyses for all of the rocks plus XRF trace element data for most samples, and instrumental neutron activation analysis (INAA) trace element data for many samples. In addition, a limited number of analyses of Na2O and K2O by flame photometry (FP) are included as well assome wet chemical analyses of FeO, H2O+/-, and CO2. Latitude and longitude location information is provided for all samples. This data set is intended to accompany the geologic map of Medicine Lake Volcano (Donnelly-Nolan, in press); map unit designations are given for each sample collected from the map area.

Apollo 16 - Impact melt sheets, contrasting nature of the Cayley plains and Descartes mountains, and geologic history

NASA Technical Reports Server (NTRS)

Mckinley, J. P.; Taylor, G. J.; Keil, K.; Ma, M.-S.; Schmitt, R. A.

1984-01-01

Apollo 16 stations four and five rake samples have been examined petrographically and by electron microprobe and INAA. Lithologic abundances support the idea (Korontev, 1981) that the variation of soil composition at Apollo 16 results from mixing between a component represented by station five and components much like either the dimict breccias or feldspathic fragmental breccias in composition. Pyroxene, olivine, and coexisting plagioclase compositions from within the anorthosite portions of dimict breccias bridge the gap between the Mg-rich and ferroan anorthosite fields. Analyses from associated cumulate and granulitic clasts indicate that they are the source of the intermediate material. Dimict breccias formed about 3.92 b.y. ago, the nectaris event occurred 3.84-3.92 b.y. ago, and the Cayley plains were deposited as a result of the Imbrium event sometime later than 3.84 b.y.

Chemical composition of HAL, an isotopically-unusual Allende inclusion

NASA Astrophysics Data System (ADS)

Davis, A. M.; Tanaka, T.; Grossman, L.; Lee, T.; Wasserburg, G. J.

1982-09-01

Samples of hibonite, black rim, and portions of friable rim from an unusual Allende inclusion, named HAL, were analyzed by INAA and RNAA for 37 major, minor, and trace elements. An unusually low amount of Ce was found in HAL, although it otherwise was highly enriched in REE compared to C1 chondrites. HAL is also depleted in Sr, Ba, U, V, Ru, Os, and Ir relative to other refractory elements. It is concluded that the distribution of REE between hibonite and rims was established when hibonite and other refractory minerals were removed at slightly different temperatures from a hot, oxidizing gas in which they previously coexisted as separate grains. Possible locations for the chemical and mass dependent isotopic fractionation are considered to be in ejecta from the low temperature helium-burning zone of a supernova and in the locally oxidizing environment generated by evaporation of interstellar grains of near-chondritic chemical composition.

The trace element chemistry of CaS in enstatite chondrites and some implications regarding its origin

NASA Technical Reports Server (NTRS)

Larimer, John W.; Ganapathy, R.

1987-01-01

The trace element distribution in oldhamite (CaS) extracted from enstatite chondrites was determined by INAA. Prior to extraction, the petrologic setting of the grains was studied microscopically, and their minor element contents determined by microprobe analysis; samples that displayed a wide range of minor element contents were selected for detailed elementary analysis. Those samples of CaS suspected to be more primitive on the basis of their minor element and petrologic siting contain the entire inventory of the host meteorite's light REE (LREE) and Eu, plus 30-50 percent of the heavy-REE inventory. In less primitive samples, the LREE are less enriched although Eu remains highly concentrated. Several other elements, including lithophiles and chalcophiles, are most enriched in the most primitive CaS. It is suggested that oldhamite played a key role in the redistribution of these elements during the metamorphism and evolution of enstatite-rich material.

Metal distribution in sediment cores from São Paulo State Coast, Brazil.

PubMed

Silva, Paulo S C; Damatto, Sandra R; Maldonado, Caio; Fávaro, Deboráh I T; Mazzilli, Barbara P

2011-05-01

Ten sediment core samples with lengths ranging from 35 to 100 cm were collected in the Baixada Santista region and analyzed to determine As, Br, Co, Cr, Cs, Fe, Rb, Sb, Ta, Th, U, Zn and rare earths (Sc, Ce, Eu, La, Lu, Nd, Sm, Tb and Yb) level concentrations using instrumental neutron activation analysis (INAA). The studied region is located in the southeastern coast of São Paulo State and is comprised of a densely urbanized area, the largest industrial complex of the country, with a predominance of petrochemical and fertilizer plants. It is also home to Brazil's most important and busiest port. The conclusions found that the As, La, Sm, Ne, Ce, Eu, Hf, Ta, Th, and U elements have a high background level in the region and that Fe and Zn were the main indicators of anthropogenic contribution in the sediments. Copyright © 2011 Elsevier Ltd. All rights reserved.

Trace element measurement for assessment of dog food safety.

PubMed

De Nadai Fernandes, Elisabete A; Elias, Camila; Bacchi, Márcio Arruda; Bode, Peter

2018-01-01

The quality of dog diets depends on adequate ingredients capable of providing optimal nutrition and free of contaminants, for promoting long-term health. Trace elements in 95 samples of dry food for dog puppies (n = 32) and adults (n = 63) of various brands were measured using instrumental neutron activation analysis (INAA). The mass fractions of most elements were within the permissible limits for dogs. Aluminum, antimony, and uranium presented fairly high levels in some samples, which may imply health risks. Aluminum mass fractions ranged from <21 to 11,900 mg/kg, in same brand, super-premium dog food. Antimony mass fractions ranged up to 5.14 mg/kg, with the highest values measured in six samples of dog food from the same producer. The mass fractions of uranium was found up to 4 mg/kg in commercial brands from five different producers.

Investigation of therapeutic potentials of some selected medicinal plants using neutron activation analysis

NASA Astrophysics Data System (ADS)

Abubakar, Sani; Usman, Ahmed Rufa'i.; Isa, Nasiru Fage; Khandaker, Mayeen Uddin; Abubakar, Nuraddeen

2015-04-01

Series of attempts were made to investigate concentrations of trace elements and their therapeutic properties in various medicinal plants. In this study, samples of some commonly used plants were collected from Bauchi State, Nigeria. They includes leaves of azadirachta indica (neem), Moringa Oleifera (moringa), jatropha curcas (purgin Nut), guiera senegalensis (custard apple) and anogeissus leiocarpus (African birch). These samples were analyzed for their trace elements contents with both short and long irradiation protocols of Instrumental Neutron Activation Analysis (INAA) at Nigerian Research Reactor-1 (NIRR-1) of Ahmadu Bello University, Zaria, Nigeria. The level of trace elements found varies from one sample to another, with some reported at hundreds of mg/Kg dry weight. The results have been compared with the available literature data. The presence of these trace elements indicates promising potentials of these plants for relief of certain ailments.

Chemical composition of HAL, an isotopically-unusual Allende inclusion

NASA Technical Reports Server (NTRS)

Davis, A. M.; Tanaka, T.; Grossman, L.; Lee, T.; Wasserburg, G. J.

1982-01-01

Samples of hibonite, black rim, and portions of friable rim from an unusual Allende inclusion, named HAL, were analyzed by INAA and RNAA for 37 major, minor, and trace elements. An unusually low amount of Ce was found in HAL, although it otherwise was highly enriched in REE compared to C1 chondrites. HAL is also depleted in Sr, Ba, U, V, Ru, Os, and Ir relative to other refractory elements. It is concluded that the distribution of REE between hibonite and rims was established when hibonite and other refractory minerals were removed at slightly different temperatures from a hot, oxidizing gas in which they previously coexisted as separate grains. Possible locations for the chemical and mass dependent isotopic fractionation are considered to be in ejecta from the low temperature helium-burning zone of a supernova and in the locally oxidizing environment generated by evaporation of interstellar grains of near-chondritic chemical composition.

Gold content of ectomycorrhizal and saprobic macrofungi - an update

NASA Astrophysics Data System (ADS)

Borovi ka, J.; anda, Z.; Jelínek, E.

2006-05-01

Species of macrofungi growing in the wild were collected from non-auriferous and unpolluted areas, and analyzed for gold. In addition, preliminary results of samples originated from an auriferous area are presented. Gold was determined using long-term instrumental neutron activation analysis (INAA). In total, 108 samples, including 49 species of ectomycorrhizal fungi and 30 species of terrestrial saprobes, were examined. The highest concentrations (expressed in dry weight) were found in ectomycorrhizal species Russula nigricans (235 ng g-1) and Suillus variegatus (1070 ng g-1). Among the saprobic macrofungi, an extraordinary high value 2250 ng g-1 was found in Lepiota cf. clypeolaria. Gold content of saprobic macrofungi originated from the auriferous area was obviously higher than that of macrofungi from non-auriferous areas. The highest contents were found in Agaricus silvaticus (4230 ng g-1) and in two samples of Lycoperdon perlatum (6955 and 7739 ng g-1).

Investigation of therapeutic potentials of some selected medicinal plants using neutron activation analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abubakar, Sani; Isa, Nasiru Fage; Usman, Ahmed Rufa’i

Series of attempts were made to investigate concentrations of trace elements and their therapeutic properties in various medicinal plants. In this study, samples of some commonly used plants were collected from Bauchi State, Nigeria. They includes leaves of azadirachta indica (neem), Moringa Oleifera (moringa), jatropha curcas (purgin Nut), guiera senegalensis (custard apple) and anogeissus leiocarpus (African birch). These samples were analyzed for their trace elements contents with both short and long irradiation protocols of Instrumental Neutron Activation Analysis (INAA) at Nigerian Research Reactor-1 (NIRR-1) of Ahmadu Bello University, Zaria, Nigeria. The level of trace elements found varies from one samplemore » to another, with some reported at hundreds of mg/Kg dry weight. The results have been compared with the available literature data. The presence of these trace elements indicates promising potentials of these plants for relief of certain ailments.« less

Discovering complementary colors from the perspective of steam education

NASA Astrophysics Data System (ADS)

Karabey, Burak; Yigit Koyunkaya, Melike; Enginoglu, Turan; Yurumezoglu, Kemal

2018-05-01

This study explored the theory and applications of complementary colors using a technology-based activity designed from the perspective of STEAM education. Complementary colors and their areas of use were examined from the perspective of physics, mathematics and art, respectively. The study, which benefits from technology, makes the theory of complementary colors accessible to all through practical applications and provides a multidisciplinary, integrated and innovative technique of teaching the subject of colors, which could be used to teach complementary colors.

Regulation of the steady state level of Fc gamma RI mRNA by IFN-gamma and dexamethasone in human monocytes, neutrophils, and U-937 cells.

PubMed

Pan, L Y; Mendel, D B; Zurlo, J; Guyre, P M

1990-07-01

The high affinity IgG FcR Fc gamma RI, CD64, plays important roles in the immune response. Fc gamma RI is predominantly expressed on monocytes and macrophages, and barely detectable on neutrophils. rIFN-gamma markedly increases the expression of Fc gamma RI on neutrophils, monocytes, macrophages and myeloid cell lines such as U-937, HL-60, and THP-1. Glucocorticoids inhibit the augmentation of Fc gamma RI expression by rIFN-gamma on neutrophils and myeloid cell lines, but enhance the augmentation of Fc gamma RI expression by rIFN-gamma on monocytes. In this study, we examined the effect of rIFN-gamma and dexamethasone (Dex) on the steady state level of Fc gamma RI mRNA in U-937 cells, neutrophils, and monocytes by hybridizing total RNA with the Fc gamma RI cDNA probe, p135. We found that the amount of Fc gamma RI mRNA increased within 1 h of treatment with rIFN-gamma in all three cell types. This initial induction of Fc gamma RI mRNA by rIFN-gamma was completely blocked by an inhibitor of RNA synthesis, actinomycin D, suggesting that the rIFN-gamma-mediated induction of Fc gamma RI mRNA is dependent on gene transcription. Dex, used in combination with rIFN-gamma, partially blocked the induction of Fc gamma RI mRNA by rIFN-gamma in U-937 cells and neutrophils, but caused a synergistic increase in Fc gamma RI mRNA levels in monocytes. The inhibitory effect of Dex on the steady state level of Fc gamma RI mRNA in U-937 cells was blocked by an inhibitor of protein synthesis, cycloheximide, suggesting that Dex-induced proteins were involved in the regulation of Fc gamma RI expression. This study indicates that the regulation of Fc gamma RI expression on U-937 cells, neutrophils, and monocytes by rIFN-gamma and Dex occurs, at least in part, at the mRNA level. rIFN-gamma increases the steady state level of Fc gamma RI mRNA through a common pathway among U-937 cells, neutrophils, and monocytes, whereas the effect of Dex on rIFN-gamma-induced Fc gamma RI mRNA is cell-type specific.

Complementary and alternative medicine in women's health. Developing a research agenda.

PubMed

Murphy, P A; Kronenberg, F; Wade, C

1999-01-01

Complementary and alternative medicine is becoming an established intervention modality within the contemporary health care system. Various forms of complementary and alternative medicine are used by patients and practitioners alike, including chiropractic, massage, botanical medicine, homeopathy, and energy therapies. The National Center for Complementary and Alternative Medicine was established within the National Institutes of Health to facilitate evaluation of these alternative therapies, establish an information clearinghouse, and promote research in the field. This article discusses several aspects of complementary and alternative medicine, relates them to women's health, and describes the need for a research agenda to evaluate the impact of the complementary and alternative medicine modalities used for important conditions affecting women.

High-frequency gamma oscillations coexist with low-frequency gamma oscillations in the rat visual cortex in vitro.

PubMed

Oke, Olaleke O; Magony, Andor; Anver, Himashi; Ward, Peter D; Jiruska, Premysl; Jefferys, John G R; Vreugdenhil, Martin

2010-04-01

Synchronization of neuronal activity in the visual cortex at low (30-70 Hz) and high gamma band frequencies (> 70 Hz) has been associated with distinct visual processes, but mechanisms underlying high-frequency gamma oscillations remain unknown. In rat visual cortex slices, kainate and carbachol induce high-frequency gamma oscillations (fast-gamma; peak frequency approximately 80 Hz at 37 degrees C) that can coexist with low-frequency gamma oscillations (slow-gamma; peak frequency approximately 50 Hz at 37 degrees C) in the same column. Current-source density analysis showed that fast-gamma was associated with rhythmic current sink-source sequences in layer III and slow-gamma with rhythmic current sink-source sequences in layer V. Fast-gamma and slow-gamma were not phase-locked. Slow-gamma power fluctuations were unrelated to fast-gamma power fluctuations, but were modulated by the phase of theta (3-8 Hz) oscillations generated in the deep layers. Fast-gamma was spatially less coherent than slow-gamma. Fast-gamma and slow-gamma were dependent on gamma-aminobutyric acid (GABA)(A) receptors, alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors and gap-junctions, their frequencies were reduced by thiopental and were weakly dependent on cycle amplitude. Fast-gamma and slow-gamma power were differentially modulated by thiopental and adenosine A(1) receptor blockade, and their frequencies were differentially modulated by N-methyl-D-aspartate (NMDA) receptors, GluK1 subunit-containing receptors and persistent sodium currents. Our data indicate that fast-gamma and slow-gamma both depend on and are paced by recurrent inhibition, but have distinct pharmacological modulation profiles. The independent co-existence of fast-gamma and slow-gamma allows parallel processing of distinct aspects of vision and visual perception. The visual cortex slice provides a novel in vitro model to study cortical high-frequency gamma oscillations.

75 FR 76019 - National Center for Complementary & Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-07

... Complementary & Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Complementary and Alternative Medicine (NACCAM) meeting. The meeting will be open to the public as indicated... for Complementary and Alternative Medicine. Date: February 4, 2011. Closed: February 4, 2011, 8:30 a.m...

Predictors of College Students' Use of Complementary and Alternative Medicine

ERIC Educational Resources Information Center

Chng, Chwee Lye; Neill, Kweethai; Fogle, Peggy

2003-01-01

This study assessed the use of complementary and alternative medicine among college students (N=913), the relationships between health locus of control with use of complementary and alternative medicine, and health local of control with attitudes toward complementary and alternative medicine and what predicts their use. A majority (66%, n-913) of…

78 FR 21381 - National Center for Complementary & Alternative Medicine; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-10

... Complementary & Alternative Medicine; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory... Complementary and Alternative Medicine Special Emphasis Education Panel. Date: June 21, 2013. Time: 8:00 a.m. to... Complementary and Alternative Medicine, National Institutes of Health, HHS) Dated: April 4, 2013. Michelle Trout...

76 FR 19379 - National Center for Complementary & Alternative Medicine; Notice of Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-07

... Complementary & Alternative Medicine; Notice of Meeting Pursuant to section 10(d) of the Federal Advisory... Complementary and Alternative Medicine (NACCAM) meeting. The meeting will be open to the public as indicated... for Complementary and Alternative Medicine. Date: June 3, 2011. Closed: June 3, 2011, 8:30 a.m. to 10...

An Evidence-Based Course in Complementary Medicines

PubMed Central

Hughes, Jeff

2012-01-01

Objective. To evaluate the impact of an evidence-based course in complementary medicines on the attitudes, knowledge, and professional practice behavior of undergraduate pharmacy students. Design. A required 12-week evidence-based complementary medicine course was designed and introduced into the third-year undergraduate pharmacy curriculum. The course included a combination of traditional lectures, interactive tutorial sessions, and a range of formal assessments. Assessment. Pre- and post-course survey instruments were administered to assess changes in students’ attitudes, perceptions, knowledge, and the likelihood they would recommend the use of complementary medicines in a pharmacy practice environment. Conclusion. Completion of a required evidence-based complementary medicines course resulted in a positive change in pharmacy students’ perceptions of the value of various complementary medicines as well as in their willingness to recommend them, and provided students with the required knowledge to make patient-centered recommendations for use of complementary medicines in a professional pharmacy practice setting. These findings support the need for greater evidence-based complementary medicine education within pharmacy curricula to meet consumer demand and to align with pharmacists’ professional responsibilities. PMID:23275665

The Prevalence of Complementary and Alternative Medicine Use Among Dermatology Outpatients in Shiraz, Iran

PubMed Central

Dastgheib, Ladan; Farahangiz, Saman; Adelpour, Zeinab; Salehi, Alireza

2017-01-01

The objective of this study was to assess complementary and alternative medicine use and its related factors among Iranian dermatology outpatients. In this cross-sectional study, a self-structured questionnaire was administered to 600 dermatology outpatients. Mann-Whitney U test, chi-square test, and binary logistic regression test were used. A total of 188 (31.3%) patients had used one of complementary and alternative medicine methods. The most frequent method used was herbal medicine (89.9%). The mean years of duration of the skin condition were significantly higher in complementary and alternative medicine users compared with nonusers (P = .037). Patients with acne and alopecia significantly used more complementary and alternative medicine (odds ratio: 2.48 and 3.19, respectively). There was a significant relationship between education and using complementary and alternative medicine (P < .001). Complementary and alternative medicine use is prevalent among our patients and we should think of ways of educating general population about complementary and alternative medicine methods and their potential risks and benefits and encourage our health care workers to communicate these materials with their patients. PMID:28446027

Knowledge, Attitude, and Practice of Complementary and Alternative Medicine Among Residents of Wayu Town, Western Ethiopia.

PubMed

Belachew, Negash; Tadesse, Tarekegne; Gube, Addisu Alemayehu

2017-10-01

Complementary and alternative medicine covers a wide variety of therapies and practices, which vary from country to country and region to region. The study was conducted to assess the knowledge, attitude, and practice of complementary and alternative medicine among the residents of Wayu town, Western Ethiopia. A descriptive cross-sectional study was carried out on 302 residents. A systematic sampling was used to select households. Data were entered in SPSS (version 20; IBM Corp) and descriptive statistics was carried out. Of 302 participants, 51.65% have a good knowledge, 78.6% were aware of complementary and alternative medicine, and 74.22% used it in the past 2 years. A total of 23.83% believe that complementary and alternative medicine is more effective than modern medicine and 28.8% preferred complementary and alternative medicine to modern medicine. This study revealed that in Wayu town, there is relatively high public interest in complementary and alternative medicine practices and a significant number has a good knowledge but generally the attitude toward complementary and alternative medicine is relatively low.

Knowledge, Attitude, and Practice of Complementary and Alternative Medicine Among Residents of Wayu Town, Western Ethiopia

PubMed Central

Belachew, Negash; Tadesse, Tarekegne

2017-01-01

Complementary and alternative medicine covers a wide variety of therapies and practices, which vary from country to country and region to region. The study was conducted to assess the knowledge, attitude, and practice of complementary and alternative medicine among the residents of Wayu town, Western Ethiopia. A descriptive cross-sectional study was carried out on 302 residents. A systematic sampling was used to select households. Data were entered in SPSS (version 20; IBM Corp) and descriptive statistics was carried out. Of 302 participants, 51.65% have a good knowledge, 78.6% were aware of complementary and alternative medicine, and 74.22% used it in the past 2 years. A total of 23.83% believe that complementary and alternative medicine is more effective than modern medicine and 28.8% preferred complementary and alternative medicine to modern medicine. This study revealed that in Wayu town, there is relatively high public interest in complementary and alternative medicine practices and a significant number has a good knowledge but generally the attitude toward complementary and alternative medicine is relatively low. PMID:29250965

The Prevalence of Complementary and Alternative Medicine Use Among Dermatology Outpatients in Shiraz, Iran.

PubMed

Dastgheib, Ladan; Farahangiz, Saman; Adelpour, Zeinab; Salehi, Alireza

2017-10-01

The objective of this study was to assess complementary and alternative medicine use and its related factors among Iranian dermatology outpatients. In this cross-sectional study, a self-structured questionnaire was administered to 600 dermatology outpatients. Mann-Whitney U test, chi-square test, and binary logistic regression test were used. A total of 188 (31.3%) patients had used one of complementary and alternative medicine methods. The most frequent method used was herbal medicine (89.9%). The mean years of duration of the skin condition were significantly higher in complementary and alternative medicine users compared with nonusers ( P = .037). Patients with acne and alopecia significantly used more complementary and alternative medicine (odds ratio: 2.48 and 3.19, respectively). There was a significant relationship between education and using complementary and alternative medicine ( P < .001). Complementary and alternative medicine use is prevalent among our patients and we should think of ways of educating general population about complementary and alternative medicine methods and their potential risks and benefits and encourage our health care workers to communicate these materials with their patients.

Complementary Feeding: Review of Recommendations, Feeding Practices, and Adequacy of Homemade Complementary Food Preparations in Developing Countries – Lessons from Ethiopia

PubMed Central

Abeshu, Motuma Adimasu; Lelisa, Azeb; Geleta, Bekesho

2016-01-01

Breastfeeding provides the ideal food during the first 6 months of life. Complementary feeding starts when breast milk is no longer sufficient by itself, where the target age is for 6–23 months. The gap between nutritional requirement and amount obtained from breast milk increases with age. For energy, 200, 300, and 550 kcal per day is expected to be covered by complementary foods at 6–8, 9–11, and 12–23 months, respectively. In addition, the complementary foods must provide relatively large proportions of micronutrients such as iron, zinc, phosphorus, magnesium, calcium, and vitamin B6. In several parts of the developing world, complementary feeding continues as a challenge to good nutrition in children. In Ethiopia, only 4.2% of breastfed children of 6–23 months of age have a minimum acceptable diet. The gaps are mostly attributed to either poor dietary quality or poor feeding practices, if not both. Commercial fortified foods are often beyond the reach of the poor. Thus, homemade complementary foods remain commonly used. Even when based on an improved recipe, however, unfortified plant-based complementary foods provide insufficient key micronutrients (especially, iron, zinc, and calcium) during the age of 6–23 months. Thus, this review assessed complementary feeding practice and recommendation and reviewed the level of adequacy of homemade complementary foods. PMID:27800479

Use of Complementary Health Practices in a Church-Based African American Cohort.

PubMed

Escoto, Kamisha Hamilton; Milbury, Kathrin; Nguyen, Nga; Cho, Dalnim; Roberson, Crystal; Wetter, David; McNeill, Lorna H

2018-06-08

Few studies have examined the use of complementary health practices (e.g., mind/body practices and dietary supplements) among African Americans, particularly those who identify as being spiritual and/or religious. Furthermore, research on the health and health behavior profiles of such complementary health users is scant. The purpose of this study was to explore the use of complementary health practices and their lifestyle and health indicator correlates in a large, church-based African American population. Cross-sectional analysis of 1467 African American adults drawn from a church-based cohort study. Participants reported use of complementary health practices, lifestyle behaviors (e.g., diet and smoking status), and health indicators (e.g., physical health and medical problems). Multiple logistic regressions were conducted to examine associations between lifestyle variables, health indicators, and use of complementary health practices. Outcomes included prevalence of mind/body practices (e.g., meditation and Reiki) and dietary supplements (multivitamins) along with health indicator and lifestyle correlates of use. Use of complementary health practices was high; 40% reported using any mind/body practice and 50% reported using dietary supplements. Poorer physical health was associated with use of mind/body practices, while likelihood of meeting fruit and vegetable recommendations was significantly associated with dietary supplement use. Complementary health practices were used heavily in a church-based sample of African American adults. Poorer physical health was associated with use of complementary health practices, yet users also displayed health conscious behaviors. Given the high engagement in complementary health practices, it may be prudent to consider adapting complementary health approaches for use in wellness interventions targeting African Americans in faith-based settings.

Timing and Determinants of the Introduction of Complementary Foods in Kuwait: Results of a Prospective Cohort Study.

PubMed

Scott, Jane A; Dashti, Manal; Al-Sughayer, Mona; Edwards, Christine A

2015-08-01

The early introduction of complementary foods is common in Middle Eastern countries but little is known about the determinants of this practice in this region. This prospective cohort study conducted from October 2007 to October 2008 investigated the determinants of the very early (before 17 weeks) introduction of complementary foods in Kuwait and compared rates of this practice against rates reported in the mid-1990s. A total of 373 women were recruited from maternity hospitals in Kuwait City and followed to 26 weeks postpartum. Data on complementary feeding practices were available from 303 women. Multivariate logistic regression was used to estimate the association of very early introduction of complementary foods with infant sex and maternal characteristics including age, years of education, employment intentions at 6 months postpartum, parity, prepregnancy body mass index, and prepregnancy smoking status. All infants had received complementary foods by 26 weeks of age, with 30.4% receiving complementary foods before 17 weeks of age. Women born in other Arabic countries were less likely to introduce complementary foods before 17 weeks (adjusted odds ratio [adj OR] = 0.40; 95% confidence interval [CI], 0.22-0.73) than women born in Kuwait. Women who were exclusively formula feeding at 6 weeks postpartum were less likely to introduce complementary foods before 17 weeks (adj OR = 0.40; 95% CI, 0.23-0.71) than women who were still breastfeeding. Compared to the mid-1990s, fewer infants in Kuwait were receiving complementary foods before 17 weeks. Nevertheless, all infants had received complementary foods by 6 months of age. © The Author(s) 2015.

Formation of fine {gamma} grain structure through fine {alpha}{sub 2}/{gamma} lamellar structure in Ti-rich TiAl alloy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumagai, T.; Abe, E.; Nakamura, M.

1997-12-31

Microstructural development of an extremely fine {alpha}{sub 2}-Ti{sub 32}Al/{gamma}-TiAl lamellar structure, which was formed by ice water quenching after solution-treatment in a high-temperature {alpha}-Ti phase field for a long period of time, was examined during isothermal treatment. In an as-quenched Ti-48at.%Al alloy, the massively transformed {gamma} ({gamma}{sub m}) and untransformed (meaning massively untransformed) fine {alpha}{sub 2}/{gamma} lamellar regions were observed. Fine {gamma} grains, which were similar to {gamma}{sub m}, were generated both within the fine {alpha}{sub 2}/{gamma} lamellae and at the boundary area between the {gamma}{sub m} and the fine {alpha}{sub 2}/{gamma} lamellar regions by aging at low-temperature (1,173 K)more » for a short time (180s). Further aging (1.8ks) caused the coarsening of these newly generated fine {gamma} grains. On the other hand, the coarsening of the {gamma} grains occurred by a high-temperature (1,323 K) aging treatment even for 180s. Fine {alpha}{sub 2} plates and particles, which were aligned to a particular direction, were observed in the {gamma} grain interiors, indicating that the newly generated {gamma} grains grew at the expense of the fine {alpha}{sub 2}/{gamma} lamellae. It can be considered that the {gamma} grain formation through the fine {alpha}{sub 2}/{gamma} lamellae is closely related to the {alpha}{sub 2}{yields}{gamma} reaction of the {alpha}{sub 2} plates sandwiched by the {gamma} plates, and needs the fast heating rate enough to overcome the {alpha}{sub 2}/{gamma}{yields}{gamma}/{gamma} lamellae reaction.« less

Use of complementary and alternative medicine by patients with arthritis.

PubMed

Unsal, Ayla; Gözüm, Sebahat

2010-04-01

The aims of this study were to determine the prevalence of complementary and alternative medicine use in patients with arthritis, the types of complementary and alternative medicine used, pertinent socio-demographic factors associated with complementary and alternative medicine use and its perceived efficacy. Arthritis is a major health issue, and the use of complementary and alternative medicine among patients with arthritis is common. This is a descriptive cross-sectional study. Data were obtained from 250 patients with arthritis at the physiotherapy and immunology clinics Atatürk University Hospital in eastern Turkey between May-July 2005 using a questionnaire developed specifically for this study. The instrument included questions on socio-demographic information, disease specifics and complementary and alternative medicine usage. Seventy-six per cent of participants reported use of at least one form of complementary and alternative medicine in the previous year. Complementary and alternative medicine users and non-users were not significantly different in most socio-demographic characteristics including age, gender, marital status and education level with the exception of economic status. We categorised treatment into six complementary and alternative medicine categories: 62.6% of patients used thermal therapies; 41.5% used oral herbal therapies; 40.5% used hot therapies; 32.6% used externally applied (skin) therapies; 28.4% used massage and 12.6% used cold therapies. All forms of complementary and alternative medicine except thermal and oral herbal therapies were perceived as very effective by more than half of study participants. Complementary and alternative medicine therapy is widely used by patients with arthritis and has perceived beneficial effects. It is important for nurses and other health care professionals to be knowledgeable about the use of complementary and alternative medicine therapies when providing care to patients with arthritis because of possible interactions with other treatments, delays in seeking care and the potential for poor quality products. It is also essential for health professionals to discuss treatment options with patients and to monitor treatment efficacy.

Perception of risk and communication among conventional and complementary health care providers involving cancer patients' use of complementary therapies: a literature review.

PubMed

Stub, Trine; Quandt, Sara A; Arcury, Thomas A; Sandberg, Joanne C; Kristoffersen, Agnete E; Musial, Frauke; Salamonsen, Anita

2016-09-08

Communication between different health care providers (conventional and complementary) and cancer patients about their use of complementary therapies affects the health and safety of the patients. The aim of this study was to examine the qualitative research literature on the perception of and communication about the risk of complementary therapies between different health care providers and cancer patients. Systematic searches in six medical databases covering literature from 2000 to 2015 were performed. The studies were accessed according to the level of evidence and summarized into different risk situations. Qualitative content analysis was used to analyze the text data, and the codes were defined before and during the data analysis. Twenty-nine papers were included in the primary analysis and five main themes were identified and discussed. The main risk situations identified were 1. Differences in treatment concepts and philosophical values among complementary and conventional health care providers. 2. Adverse effects from complementary products and herbs due to their contamination/toxicity and interactions with conventional cancer treatment. 3. Health care physicians and oncologists find it difficult to recommend many complementary modalities due to the lack of scientific evidence for their effect. 4. Lack of knowledge and information about complementary and conventional cancer treatments among different health care providers. The risk of consuming herbs and products containing high level of toxins is a considerable threat to patient safety (direct risk). At the same time, the lack of scientific evidence of effect for many complementary therapies and differences in treatment philosophy among complementary and conventional health care providers potentially hinder effective communication about these threats with mutual patients (indirect risk). As such, indirect risk may pose an additional risk to patients who want to combine complementary therapies with conventional treatment in cancer care. Health care providers who care for cancer patients should be aware of these risks.

Z{gamma}{gamma}{gamma} {yields} 0 Processes in SANC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bardin, D. Yu., E-mail: bardin@nu.jinr.ru; Kalinovskaya, L. V., E-mail: kalinov@nu.jinr.ru; Uglov, E. D., E-mail: corner@nu.jinr.ru

2013-11-15

We describe the analytic and numerical evaluation of the {gamma}{gamma} {yields} {gamma}Z process cross section and the Z {yields} {gamma}{gamma}{gamma} decay rate within the SANC system multi-channel approach at the one-loop accuracy level with all masses taken into account. The corresponding package for numeric calculations is presented. For checking of the results' correctness we make a comparison with the other independent calculations.

The Effects of Composition and gamma'/gamma Lattice Parameter Mismatch on the Critical Resolved Shear Stresses for Octahedral and Cube Slip in NiAlCrX Alloys

NASA Technical Reports Server (NTRS)

Miner, R. V.

1997-01-01

Prototypical single-crystal NiAlCrX superalloys were studied to examine the effects of the common major alloying elements, Co, Mo, Nb, Ta, Ti, and W, on yielding behavior. The alloys contained about 10 at. pct Cr, 60 vol pct of the gamma' phase, and about 3 at. pct of X in the gamma'. The critical resolved shear stresses (CRSSs) for octahedral and primary cube slip were measured at 760 C, which is about the peak strength temperature. The CRSS(sub oct) and CRSS(sub cube) are discussed in relation to those of Ni, (Al, X) gamma' alloys taken from the literature and the gamma'/gamma lattice mismatch. The CRSS(sub oct) of the gamma + gamma' alloys reflected a similar compositional dependence to that of both the CRSS(sub cube) of the gamma' phase and the gamma'/gamma lattice parameter mismatch. The CRSS(sub cube) of the gamma + gamma' alloys also reflected the compositional dependence of the gamma'/gamma mismatch, but bore no similarity to that of CRSS(sub cube) for gamma' alloys since it is controlled by the gamma matrix. The ratio of CRSS(sub cube)/CRSS(sub oct) was decreased by all alloying elements except Co, which increased the ratio. The decrease in CRSS(sub cube)/CRSS(sub oct) was related to the degree in which elements partition to the gamma' rather than the gamma phase.

Cosmological constraints on exotic injection of electromagnetic energy

NASA Astrophysics Data System (ADS)

Poulin, Vivian; Lesgourgues, Julien; Serpico, Pasquale D.

2017-03-01

We compute cosmic microwave background (CMB) anisotropy constraints on exotic forms of energy injection in electromagnetic (e.m.) channels over a large range of timescales. We show that these constraints are very powerful around or just after recombination, although CMB keeps some sensitivity e.g. to decaying species with lifetimes as long as 1025 s. These bounds are complementary to CMB spectral distortions and primordial nucleosynthesis ones, which dominate at earlier timescales, as we also review here. For the first time, we describe the effects of the e.m. energy injection on the CMB power spectra as a function of the injection epoch, using the lifetime of a decaying particle as proxy. We also identify a suitable on-the-spot approximation, that can be used to derive accurate constraints, and describe its differences with the most up-to-date treatment. Our results are of interest not only for early universe relics constituting (a fraction of) the dark matter, but also for other exotic injection of e.m. radiation. For illustration, we apply our formalism to: i) Primordial black holes of mass 1013.5 g lesssim M lesssim 1016.8 g, showing that the constraints are comparable to the ones obtained from gamma-ray background studies and even dominate below ~ 1014 g. ii) To a peculiar mass-mixing range in the sterile neutrino parameter space, complementary to other astrophysical and laboratory probes. iii) Finally, we provide a first estimate of the room for improvement left for forthcoming 21 cm experiments, comparing it with the reach of proposed CMB spectral distortion (PiXiE) and CMB angular power spectrum (CORE) missions. We show that the best and most realistic opportunity to look for this signal (or to improve over current constraints) in the 21 cm probe is to focus on the Cosmic Dawn epoch, 15 lesssim z lesssim 30, where the qualitatively unambiguous signature of a spectrum in emission can be expected for models that evade all current constraints.

Nutritional and sensory evaluation of a complementary food formulated from rice, faba beans, sweet potato flour, and peanut oil.

PubMed

Mahmoud, Amal H; El Anany, Ayman Mohammed

2014-12-01

Childhood malnutrition is a common disorder in developing countries. To formulate a complementary food from rice, germinated-decoated faba bean, orange-fleshed sweet potato flour, and peanut oil (RFPP formula) for infants aged 6 to 24 months. The nutritional and sensory characteristics of the RFPP complementary food in comparison with those of a commercial complementary food were determined using standard official procedures. The levels of protein (17.89 g/100 g), fat (10.35 g/100 g), carbohydrate (67.82 g/100 g), and energy (435.99 kcal/100 g) of the RFPP complementary food met the specifications of the Codex standard (1991) and the Egyptian Standard No. 3284 (2005). The essential amino acid contents of the RFPP complementary food were higher than the amino acid profile of the Food and Agriculture Organization/World Health Organization/United Nations University (2002) reference protein for children 0.5 to 1 and 1 to 2 years of age. The RFPP complementary food had high levels (54.00%) of monounsaturated fatty acids. However, the highest level of saturated fatty acids (51.10%) was recorded for the commercial complementary food. The sensory evaluation results, using a nine-point hedonic scale ranging from 1 (dislike extremely) to 9 (like extremely), show that the RFPP complementary food was acceptable in appearance (7.20), color (6.35), aroma (6.75), taste (7.25), and mouthfeel (7.10) and had an overall acceptability of 6.40. The RFPP formulated complementary food was acceptable and adequate in nutrients for weaning purposes.

[Traditional and Complementary Medicine in Brazil: inclusion in the Brazilian Unified National Health System and integration with primary care].

PubMed

Sousa, Islandia Maria Carvalho de; Tesser, Charles Dalcanale

2017-01-23

This study aimed to analyze the inclusion of Traditional and Complementary Medicine in Brazilian Unified National Health System (SUS) and its integration with primary healthcare (PHC). A qualitative study drew on institutional data, indexed articles, and case studies in selected Brazilian cities: Campinas (São Paulo State), Florianópolis (Santa Catarina State), Recife (Pernambuco State), Rio de Janeiro, and São Paulo. The analysis adopted the perspective of inclusion of Traditional and Complementary Medicine in the healthcare network and its integration with primary healthcare, based on the following dimensions: presence of Traditional and Complementary Medicine on the municipal agenda; position in the services; mode of access to Traditional and Complementary Medicine; Traditional and Complementary Medicine practitioners; types of practices; demand profile; and potential for expansion in the SUS. The authors identified and characterized four types of inclusion and integration of Traditional and Complementary Medicine, whether in association or not: Type 1 - in primary healthcare via professionals from the family health teams - Integrated; Type 2 - in primary healthcare via professionals with full-time employment - Juxtaposed; Type 3 - in primary healthcare via matrix-organized teams - Matrix Organization; Type 4 - in specialized services - Without Integration. The combination of types 1 and 3 was considered a potential guideline for the expansion of Traditional and Complementary Medicine in the SUS and can orient the growth and integration of Traditional and Complementary Medicine with primary healthcare. The growing presence of Traditional and Complementary Medicine in the SUS requires conceiving its strategic expansion, while existing experiences should not be wasted.

The neutron-gamma Feynman variance to mean approach: Gamma detection and total neutron-gamma detection (theory and practice)

NASA Astrophysics Data System (ADS)

Chernikova, Dina; Axell, Kåre; Avdic, Senada; Pázsit, Imre; Nordlund, Anders; Allard, Stefan

2015-05-01

Two versions of the neutron-gamma variance to mean (Feynman-alpha method or Feynman-Y function) formula for either gamma detection only or total neutron-gamma detection, respectively, are derived and compared in this paper. The new formulas have particular importance for detectors of either gamma photons or detectors sensitive to both neutron and gamma radiation. If applied to a plastic or liquid scintillation detector, the total neutron-gamma detection Feynman-Y expression corresponds to a situation where no discrimination is made between neutrons and gamma particles. The gamma variance to mean formulas are useful when a detector of only gamma radiation is used or when working with a combined neutron-gamma detector at high count rates. The theoretical derivation is based on the Chapman-Kolmogorov equation with the inclusion of general reactions and corresponding intensities for neutrons and gammas, but with the inclusion of prompt reactions only. A one energy group approximation is considered. The comparison of the two different theories is made by using reaction intensities obtained in MCNPX simulations with a simplified geometry for two scintillation detectors and a 252Cf-source. In addition, the variance to mean ratios, neutron, gamma and total neutron-gamma are evaluated experimentally for a weak 252Cf neutron-gamma source, a 137Cs random gamma source and a 22Na correlated gamma source. Due to the focus being on the possibility of using neutron-gamma variance to mean theories for both reactor and safeguards applications, we limited the present study to the general analytical expressions for Feynman-alpha formulas.

Percutaneous transendocardial delivery of self-complementary adeno-associated virus 6 achieves global cardiac gene transfer in canines

PubMed Central

Bish, Lawrence T.; Sleeper, Meg M.; Brainard, Benjamin; Cole, Stephen; Russell, Nicholas; Withnall, Elanor; Arndt, Jason; Reynolds, Caryn; Davison, Ellen; Sanmiguel, Julio; Wu, Di; Gao, Guangping; Wilson, James M.; Sweeney, H. Lee

2011-01-01

Achieving efficient cardiac gene transfer in a large animal model has proven to be technically challenging. Prior strategies have employed cardio-pulmonary bypass or dual catheterization with the aid of vasodilators to deliver vectors, such as adenovirus, adeno-associated virus or plasmid DNA. While single stranded adeno-associated virus vectors have shown the greatest promise, they suffer from delayed expression, which might be circumvented by using self-complementary vectors. We sought to optimize cardiac gene transfer using a percutaneous transendocardial injection catheter to deliver adeno-associated virus vectors to the canine myocardium. Four vectors were evaluated—single stranded adeno-associated virus 9, self-complementary adeno-associated virus 9, self-complementary adeno-associated virus 8, self-complementary adeno-associated virus 6—so that comparison could be made between single stranded and self complementary vectors as well as among serotypes 9, 8, and 6. We demonstrate that self-complementary adeno-associated virus is superior to single stranded adeno-associated virus and that adeno-associated virus 6 is superior to other serotypes evaluated. Biodistribution studies revealed that vector genome copies were 15 to 4000 times more abundant in the heart than in any other organ for self-complementary adeno-associated virus 6. Percutaneous transendocardial injection of self-complementary adeno-associated virus 6 is a safe, effective method for achieving efficient cardiac gene transfer. PMID:18813281

Resourcing the clinical complementary medicine information needs of Australian medical students: Results of a grounded theory study.

PubMed

Templeman, Kate; Robinson, Anske; McKenna, Lisa

2016-09-01

The aim of this study was to identify Australian medical students' complementary medicine information needs. Thirty medical students from 10 medical education faculties across Australian universities were recruited. Data were generated using in-depth semi-structured interviews and constructivist grounded theory method was used to analyze and construct data. Students sought complementary medicine information from a range of inadequate sources, such as pharmacological texts, Internet searches, peer-reviewed medical journals, and drug databases. The students identified that many complementary medicine resources may not be regarded as objective, reliable, differentiated, or comprehensive, leaving much that medical education needs to address. Most students sought succinct, easily accessible, evidence-based information to inform safe and appropriate clinical decisions about complementary medicines. A number of preferred resources were identified that can be recommended and actively promoted to medical students. Therefore, specific, evidence-based complementary medicine databases and secondary resources should be subscribed and recommended to medical schools and students, to assist meeting professional responsibilities regarding complementary medicines. These findings may help inform the development of appropriate medical information resources regarding complementary medicines. © 2016 John Wiley & Sons Australia, Ltd.

Complementary and Alternative Medicine: A Cross-Sectional Observational Study in Pediatric Inpatients

PubMed Central

Dhankar, Mukesh

2018-01-01

The aim was to study the prevalence of complementary and alternative medicine use in acutely sick hospitalized children and factors associated with it. This is a cross-sectional, hospital-based study in a tertiary care center of Delhi, India. Children admitted to a pediatric unit during the study period were assessed using a specially designed questionnaire. Out of the total 887 admitted children, 161 (18.1%) were using complementary and alternate medicine in one form or another. Of these, 113 (70.2%) were using complementary and alternate medicine for the current illness directly leading to admission and the remaining 48 (29.8%) had used complementary and alternate medicine in past. The common complementary and alternate medicine use observed in our study was combined ayurveda and spiritual approach (25.5%), ayurveda (24.8%), spiritual (21.7%), homeopathic (13%), and 47.2% of children were using spiritual approach in form of Jhada (tying piece of cloth on arm or leg or keeping a knife by the side of child). The significant factors associated with complementary and alternate medicine use were younger age, female gender, and father being employed. Complementary and alternate medicine is commonly used even in acutely sick children. PMID:29616560

Complementary and Alternative Medicine Use in Modern Obstetrics: A Survey of the Central Association of Obstetricians & Gynecologists Members.

PubMed

Babbar, Shilpa; Williams, Karen B; Maulik, Dev

2016-10-05

The use of complementary and alternative medicine during pregnancy is currently on the rise. A validated survey was conducted at the Central Association of Obstetrician and Gynecologists annual meeting to evaluate the knowledge, attitude, and practice of general obstetricians and gynecologists and maternal-fetal medicine specialists in America. We obtained 128 responses: 73 electronically (57%) and 55 via the paper survey (43%). Forty-five percent reported personally using complementary and alternative medicine and 9% of women respondents used complementary and alternative medicine during pregnancy. Overall, 62% had advised their patients to utilize some form of complementary and alternative medicine in pregnancy. Biofeedback, massage therapy, meditation, and yoga were considered the most effective modalities in pregnancy (median [semi-interquartile range] = 2 [0.5]). Maternal-fetal medicine specialists were significantly more likely to disagree on the use of complementary and alternative medicine for risk reduction of preterm birth compared to obstetricians and gynecologists (P = .03). As the use of complementary and alternative medicine continues to rise in reproductive-age women, obstetricians will play an integral role in incorporating complementary and alternative medicine use with conventional medicine. © The Author(s) 2016.

Complementary and Alternative Medicine Use in Modern Obstetrics: A Survey of the Central Association of Obstetricians & Gynecologists Members

PubMed Central

Babbar, Shilpa; Williams, Karen B.; Maulik, Dev

2016-01-01

The use of complementary and alternative medicine during pregnancy is currently on the rise. A validated survey was conducted at the Central Association of Obstetrician and Gynecologists annual meeting to evaluate the knowledge, attitude, and practice of general obstetricians and gynecologists and maternal-fetal medicine specialists in America. We obtained 128 responses: 73 electronically (57%) and 55 via the paper survey (43%). Forty-five percent reported personally using complementary and alternative medicine and 9% of women respondents used complementary and alternative medicine during pregnancy. Overall, 62% had advised their patients to utilize some form of complementary and alternative medicine in pregnancy. Biofeedback, massage therapy, meditation, and yoga were considered the most effective modalities in pregnancy (median [semi-interquartile range] = 2 [0.5]). Maternal-fetal medicine specialists were significantly more likely to disagree on the use of complementary and alternative medicine for risk reduction of preterm birth compared to obstetricians and gynecologists (P = .03). As the use of complementary and alternative medicine continues to rise in reproductive-age women, obstetricians will play an integral role in incorporating complementary and alternative medicine use with conventional medicine. PMID:27707901

Design and Performance of the GAMMA-400 Gamma-Ray Telescope for Dark Matter Searches

NASA Technical Reports Server (NTRS)

Galper, A.M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A.I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Fradkin, M. I.; Gusakov, Yu. V.;

Design and Performance of the GAMMA-400 Gamma-Ray Telescope for Dark Matter Searches

NASA Technical Reports Server (NTRS)

Galper, A. M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A. I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Fradkin, M. I.; Gusakov, Yu V.;

Use of complementary and alternative medicine in head and neck cancer patients.

PubMed

Lim, C M; Ng, A; Loh, K S

2010-05-01

To determine the prevalence and profile of patients who use complementary and alternative medicine, within a cohort of head and neck cancer patients. Cross-sectional survey. Ninety-three consecutive head and neck cancer patients being followed up at the department of otolaryngology head and neck surgery were surveyed using an interviewer-administered questionnaire. The prevalence of complementary and alternative medicine use was 67.8 per cent. Patients who used complementary and alternative medicine were more likely to be female, better educated and younger, compared with non-users. A total of 82.5 per cent (52/63) perceived complementary and alternative medicine to be effective, even though they were aware of the lack of research and endorsement by their physician regarding such medicine. The use of complementary and alternative medicine by head and neck cancer patients is common, regardless of efficacy or cost. Clinicians should routinely ask patients about their use of complementary and alternative medicine, to facilitate communication and enable appropriate use of such medicine.

Paradigms for pharmacological characterization of C. elegans synaptic transmission mutants.

PubMed

Locke, Cody; Berry, Kalen; Kautu, Bwarenaba; Lee, Kyle; Caldwell, Kim; Caldwell, Guy

2008-08-18

The nematode, Caenorhabditis elegans, has become an expedient model for studying neurotransmission. C. elegans is unique among animal models, as the anatomy and connectivity of its nervous system has been determined from electron micrographs and refined by pharmacological assays. In this video, we describe how two complementary neural stimulants, an acetylcholinesterase inhibitor, called aldicarb, and a gamma-aminobutyric acid (GABA) receptor antagonist, called pentylenetetrazole (PTZ), may be employed to specifically characterize signaling at C. elegans neuromuscular junctions (NMJs) and facilitate our understanding of antagonistic neural circuits. Of 302 C. elegans neurons, nineteen GABAergic D-type motor neurons innervate body wall muscles (BWMs), while four GABAergic neurons, called RMEs, innervate head muscles. Conversely, thirty-nine motor neurons express the excitatory neurotransmitter, acetylcholine (ACh), and antagonize GABA transmission at BWMs to coordinate locomotion. The antagonistic nature of GABAergic and cholinergic motor neurons at body wall NMJs was initially determined by laser ablation and later buttressed by aldicarb exposure. Acute aldicarb exposure results in a time-course or dose-responsive paralysis in wild-type worms. Yet, loss of excitatory ACh transmission confers resistance to aldicarb, as less ACh accumulates at worm NMJs, leading to less stimulation of BWMs. Resistance to aldicarb may be observed with ACh-specific or general synaptic function mutants. Consistent with antagonistic GABA and ACh transmission, loss of GABA transmission, or a failure to negatively regulate ACh release, confers hypersensitivity to aldicarb. Although aldicarb exposure has led to the isolation of numerous worm homologs of neurotransmission genes, aldicarb exposure alone cannot efficiently determine prevailing roles for genes and pathways in specific C. elegans motor neurons. For this purpose, we have introduced a complementary experimental approach, which uses PTZ. Neurotransmission mutants display clear phenotypes, distinct from aldicarb-induced paralysis, in response to PTZ. Wild-type worms, as well as mutants with specific inabilities to release or receive ACh, do not show apparent sensitivity to PTZ. However, GABA mutants, as well as general synaptic function mutants, display anterior convulsions in a time-course or dose-responsive manner. Mutants that cannot negatively regulate general neurotransmitter release and, thus, secrete excessive amounts of ACh onto BWMs, become paralyzed on PTZ. The PTZ-induced phenotypes of discrete mutant classes indicate that a complementary approach with aldicarb and PTZ exposure paradigms in C. elegans may accelerate our understanding of neurotransmission. Moreover, videos demonstrating how we perform pharmacological assays should establish consistent methods for C. elegans research.

Contaminant and other elements in soil (CCQM-K127)

NASA Astrophysics Data System (ADS)

Rocio Arvizu Torres, M.; Manzano, J. Velina Lara; Valle Moya, Edith; Horvat, Milena; Jaćimović, Radojko; Zuliani, Tea; Vreča, Polona; Acosta, Osvaldo; Bennet, John; Snell, James; Almeida, Marcelo D.; de Sena, Rodrigo C.; Dutra, Emily S.; Yang, Lu; Li, Haifeng

2017-01-01

Non-contaminated soils contain trace and major elements at levels representing geochemical background of the region. The main sources of elements as contaminants/pollutants in soils are mining and smelting activities, fossil fuel combustion, agricultural practices, industrial activities and waste disposal. Contaminated/polluted sites are of great concern and represent serious environmental, health and economic problems. Characterization and identification of contaminated land is the first step in risk assessment and remediation activities. It is well known that soil is a complex matrix with huge variation locally and worldwide. According to the IAWG's five year plan, it is recommended to have a key comparison under the measurement service category of soils and sediments for the year 2015. Currently 13 NMI has claimed calibration and measurement capabilities (CMCs) in category 13 (sediments, soils, ores, and particulates): 29 CMCs in soil and 96 CMCs in sediments. In this regard this is a follow-up comparison in the category 13; wherein three key comparisons have been carried out during the years 2000 (CCQM-K13), 2003 (CCQM-K28) and 2004 (CCQM-K44). Since it is important to update the capabilities of NMIs in this category. CENAM and JSI proposed a key comparison in this category and a pilot study in parallel. The proposed study was agreed by IAWG members, where two soils samples were used in both CCQM-K127 representing a non-contaminated soil with low contents of elements (arsenic, cadmium, iron, lead and manganese), and a contaminated soil with much higher content of selected elements (arsenic, cadmium, iron and lead). This broadens the scope and a degree of complexity of earlier measurements in this field. National metrology institutes (NMIs)/designate institutes (DIs) should, therefore, demonstrate their measurement capabilities of trace and major elements in a wide concentration ranges, representing background/reference sites as well as highly contaminated soils by their available analytical methods. This facilitated the investigation into the core capabilities of participants to measure the mass fraction of tested elements in soil and therefore to claim their CMCs as listed in appendix C of the key comparison database (KCDB) under the mutual recognition arrangement of the International Committee for Weights and Measures (CIPM MRA). In total 19 institutes (NMIs/Dis) participated in the key comparison and the reported results of the key comparison were from 18 institutes (NMIs/DIs); 151 measurements were reported for CCQM-K127. The analytical techniques selected by the participant institutes were ICP-MS, ICP-OES, FAAS, ET-AAS and INAA (k0-method of INAA); the sample preparation methods used were based on microwave assisted digestion, except when it was used INAA. After discussions it agreed to use the median as KCRV and the MMADe as u(xKCRV). Generally most of the results of the participants were found to be consistent for all measurements according to their equivalence statements, with the exception of some extreme values, which were identified with a value of di/U(di) higher than 1. This key comparison is a means of providing evidence for practical demonstration of a CCQM comparison calibration and measurement capabilities (CMCs) claims for contaminant and others elements, in low and medium content levels in non-contaminated and contaminated matrices described in category 13. Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database kcdb.bipm.org/. The final report has been peer-reviewed and approved for publication by the CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Habs, D.; Guenther, M. M.; Jentschel, M.

With the planned new {gamma}-beam facilities like MEGa-ray at LLNL (USA) or ELI-NP at Bucharest (Romania) with 10{sup 13}{gamma}/s and a band width of {Delta}E{gamma}/E{gamma} Almost-Equal-To 10{sup -3}, a new era of {gamma} beams with energies up to 20MeV comes into operation, compared to the present world-leading HI{gamma}S facility at Duke University (USA) with 10{sup 8}{gamma}/s and {Delta}E{gamma}/E{gamma} Almost-Equal-To 3 Dot-Operator 10{sup -2}. In the long run even a seeded quantum FEL for {gamma} beams may become possible, with much higher brilliance and spectral flux. At the same time new exciting possibilities open up for focused {gamma} beams. Here wemore » describe a new experiment at the {gamma} beam of the ILL reactor (Grenoble, France), where we observed for the first time that the index of refraction for {gamma} beams is determined by virtual pair creation. Using a combination of refractive and reflective optics, efficient monochromators for {gamma} beams are being developed. Thus, we have to optimize the total system: the {gamma}-beam facility, the {gamma}-beam optics and {gamma} detectors. We can trade {gamma} intensity for band width, going down to {Delta}E{gamma}/E{gamma} Almost-Equal-To 10{sup -6} and address individual nuclear levels. The term 'nuclear photonics' stresses the importance of nuclear applications. We can address with {gamma}-beams individual nuclear isotopes and not just elements like with X-ray beams. Compared to X rays, {gamma} beams can penetrate much deeper into big samples like radioactive waste barrels, motors or batteries. We can perform tomography and microscopy studies by focusing down to {mu}m resolution using Nuclear Resonance Fluorescence (NRF) for detection with eV resolution and high spatial resolution at the same time. We discuss the dominating M1 and E1 excitations like the scissors mode, two-phonon quadrupole octupole excitations, pygmy dipole excitations or giant dipole excitations under the new facet of applications. We find many new applications in biomedicine, green energy, radioactive waste management or homeland security. Also more brilliant secondary beams of neutrons and positrons can be produced.« less

Complementary medicine.

PubMed Central

Spiegel, D; Stroud, P; Fyfe, A

1998-01-01

The widespread use of complementary and alternative medicine techniques, often explored by patients without discussion with their primary care physician, is seen as a request from patients for care as well as cure. In this article, we discuss the reasons for the growth of and interest in complementary and alternative medicine in an era of rapidly advancing medical technology. There is, for instance, evidence of the efficacy of supportive techniques such as group psychotherapy in improving adjustment and increasing survival time of cancer patients. We describe current and developing complementary medicine programs as well as opportunities for integration of some complementary techniques into standard medical care. PMID:9584661

Plane-wave scattering by self-complementary metasurfaces in terms of electromagnetic duality and Babinet's principle

NASA Astrophysics Data System (ADS)

Nakata, Yosuke; Urade, Yoshiro; Nakanishi, Toshihiro; Kitano, Masao

2013-11-01

We investigate theoretically electromagnetic plane-wave scattering by self-complementary metasurfaces. By using Babinet's principle extended to metasurfaces with resistive elements, we show that the frequency-independent transmission and reflection are realized for normal incidence of a circularly polarized plane wave onto a self-complementary metasurface, even if there is diffraction. Next, we consider two special classes of self-complementary metasurfaces. We show that self-complementary metasurfaces with rotational symmetry can act as coherent perfect absorbers, and those with translational symmetry compatible with their self-complementarity can split the incident power equally, even for oblique incidences.

GammaM23K, gammaM232K, and gammaL77K single substitutions in the TF1-ATPase lower ATPase activity by disrupting a cluster of hydrophobic side chains.

PubMed

Bandyopadhyay, Sanjay; Allison, William S

2004-07-27

In crystal structures of the bovine F(1)-ATPase (MF(1)), the side chains of gammaMet(23), gammaMet(232), and gammaLeu(77) interact in a cluster. Substitution of the corresponding residues in the alpha(3)beta(3)gamma subcomplex of TF(1) with lysine lowers the ATPase activity to 2.3, 11, and 15%, respectively, of that displayed by wild-type. In contrast, TF(1) subcomplexes containing the gammaM(23)C, gammaM(232)C, and gammaL(77)C substitutions display 36, 36, and 130%, respectively, of the wild-type ATPase activity. The ATPase activity of the gammaM(23)C/gammaM(232)C double mutant subcomplex is 36% that of the wild-type subcomplex before and after cross-linking the introduced cysteines, whereas the ATPase activity of the gammaM(23)C/L(77)C double mutant increased from 50 to 85% that of wild-type after cross-linking the introduced cysteines. Only beta-beta cross-links formed when the alpha(3)(betaE(395)C)(3)gammaM(23)C double mutant was inactivated with CuCl(2). The overall results suggest that the attenuated ATPase of the mutant subcomplexes containing the gammaM(23)K, gammaL(77)K, and gammaM(232)K substitutions is caused by disruption of the cluster of hydrophobic amino acid side chains and that the midregion of the coiled-coil comprised of the amino- and carboxyl-terminal alpha helices of the gamma subunit does not undergo unwinding or major displacement from the side chain of gammaLeu(77) during ATP-driven rotation of the gamma subunit.

An update on pharmacotherapy of autism spectrum disorder in children and adolescents.

PubMed

Goel, Ritu; Hong, Ji Su; Findling, Robert L; Ji, Na Young

2018-02-01

To date, no medication is proven to be effective in treating core symptoms of autism spectrum disorder (ASD). Psychotropic medications are widely used to target emotional and behavioural symptoms in ASD. This article reviewed evidence for pharmacotherapy, novel therapeutic agents, and Complementary and Alternative Medicine (CAM) in children and adolescents with ASD. Currently, only risperidone and aripiprazole have been approved by the US Food and Drug Administration (FDA) for treatment of irritability associated with ASD in children and adolescents. However, associated metabolic side-effects are concerning. Evidence supports use of methylphenidate and atomoxetine for attention deficit hyperactivity disorder (ADHD) symptoms and clonidine and guanfacine ER appear to be helpful. SSRIs are poorly tolerated and lack evidence in reducing restricted repetitive behaviours (RRB), anxiety, and depression. Buspirone shows promise in the treatment of RRB. The evidence is inconsistent for the effectiveness of anti-epileptic medications. Recent studies of glutamatergic, Gamma-aminobutyric acid (GABA)ergic, and cholinergic agents and oxytocin show inconsistent results. Despite wide use of CAM agents, the evidence is inconclusive. Melatonin can be helpful in reducing sleep problems. Overall, the evidence is limited for pharmacotherapy in children with ASD, and side-effects with long-term use can be burdensome.

Runaway electron generation and control

NASA Astrophysics Data System (ADS)

Esposito, B.; Boncagni, L.; Buratti, P.; Carnevale, D.; Causa, F.; Gospodarczyk Martin-Solis, M., Jr.; Popovic, Z.; Agostini, M.; Apruzzese, G.; Bin, W.; Cianfarani, C.; De Angelis, R.; Granucci, G.; Grosso, A.; Maddaluno, G.; Marocco, D.; Piergotti, V.; Pensa, A.; Podda, S.; Pucella, G.; Ramogida, G.; Rocchi, G.; Riva, M.; Sibio, A.; Sozzi, C.; Tilia, B.; Tudisco, O.; Valisa, M.; FTU Team

2017-01-01

We present an overview of FTU experiments on runaway electron (RE) generation and control carried out through a comprehensive set of real-time (RT) diagnostics/control systems and newly installed RE diagnostics. An RE imaging spectrometer system detects visible and infrared synchrotron radiation. A Cherenkov probe measures RE escaping the plasma. A gamma camera provides hard x-ray radial profiles from RE bremsstrahlung interactions in the plasma. Experiments on the onset and suppression of RE show that the threshold electric field for RE generation is larger than that expected according to a purely collisional theory, but consistent with an increase due to synchrotron radiation losses. This might imply a lower density to be targeted with massive gas injection for RE suppression in ITER. Experiments on active control of disruption-generated RE have been performed through feedback on poloidal coils by implementing an RT boundary-reconstruction algorithm evaluated on magnetic moments. The results indicate that the slow plasma current ramp-down and the simultaneous reduction of the reference plasma external radius are beneficial in dissipating the RE beam energy and population, leading to reduced RE interactions with plasma facing components. RE active control is therefore suggested as a possible alternative or complementary technique to massive gas injection.

Michel accretion of a polytropic fluid with adiabatic index \\gamma \\gt 5/3: global flows versus homoclinic orbits

NASA Astrophysics Data System (ADS)

Chaverra, Eliana; Mach, Patryk; Sarbach, Olivier

2016-05-01

We analyze the properties of a polytropic fluid that is radially accreted into a Schwarzschild black hole. The case where the adiabatic index γ lies in the range of 1\\lt γ ≤slant 5/3 has been treated in previous work. In this article, we analyze the complementary range of 5/3\\lt γ ≤slant 2. To this purpose, the problem is cast into an appropriate Hamiltonian dynamical system, whose phase flow is analyzed. While, for 1\\lt γ ≤slant 5/3, the solutions are always characterized by the presence of a unique critical saddle point, we show that, when 5/3\\lt γ ≤slant 2, an additional critical point might appear, which is a center point. For the parametrization used in this paper, we prove that, whenever this additional critical point appears, there is a homoclinic orbit. Solutions corresponding to homoclinic orbits differ from standard transonic solutions with vanishing asymptotic velocities in two aspects: they are local (i.e., they cannot be continued to arbitrarily large radii); the dependence of the density or the value of the velocity on the radius is not monotonic.

VI European Summer School on Experimental Nuclear Astrophysics

NASA Astrophysics Data System (ADS)

The European Summer School on Experimental Nuclear Astrophysics has reached the sixth edition, marking the tenth year's anniversary. The spirit of the school is to provide a very important occasion for a deep education of young researchers about the main topics of experimental nuclear astrophysics. Moreover, it should be regarded as a forum for the discussion of the last-decade research activity. Lectures are focused on various aspects of primordial and stellar nucleosynthesis, including novel experimental approaches and detectors, indirect methods and radioactive ion beams. Moreover, in order to give a wide educational offer, some lectures cover complementary subjects of nuclear astrophysics such as gamma ray astronomy, neutron-induced reactions, short-lived radionuclides, weak interaction and cutting-edge facilities used to investigate nuclear reactions of interest for astrophysics. Large room is also given to young researcher oral contributions. Traditionally, particular attention is devoted to the participation of students from less-favoured countries, especially from the southern coast of the Mediterranean Sea. The school is organised by the Catania Nuclear Astrophysics research group with the collaboration of Dipartimento di Fisica e Astromomia - Università di Catania and Laboratori Nazionali del Sud - Istituto Nazionale di Fisica Nucleare.

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed Central

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-01-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo. PMID:1534001

Increase in neutrophil Fc gamma receptor I expression following interferon gamma treatment in rheumatoid arthritis.

PubMed

Goulding, N J; Knight, S M; Godolphin, J L; Guyre, P M

1992-04-01

The therapeutic potential of interferon gamma (IFN gamma) in a number of disease states is still being explored, but progress is hampered by the lack of a suitable measure of in vivo biological activity. To assess the in vivo biological effects of recombinant human IFN gamma (rhIFN gamma), 14 patients were studied in a randomised, prospective, double blind, placebo controlled trial of this cytokine for the treatment of rheumatoid arthritis. The levels of Fc gamma receptors on peripheral blood neutrophils were measured at baseline and after 21 days of once daily, subcutaneous injections of rhIFN gamma or placebo. An induction of neutrophil Fc gamma receptor type I (Fc gamma RI) was seen in the group of patients receiving recombinant human rhIFN gamma but not in those receiving placebo. No change in the expression of Fc gamma RII or Fc gamma RIII was detected. The amount of induction of Fc gamma RI detected on the neutrophils of patients receiving rhIFN gamma did not correlate with clinical measures of response at either 21 days or at the end of the study (24 weeks). No significant clinical responses were observed in the rhIFN gamma group at these times. These data confirm that the reported in vitro effect of IFN gamma on human neutrophil Fc receptor expression can be reproduced in vivo.

Complementary and Integrative Medicine

MedlinePlus

... medical treatments that are not part of mainstream medicine. When you are using these types of care, it may be called complementary, integrative, or alternative medicine. Complementary medicine is used together with mainstream medical ...

Nurses' beliefs, experiences and practice regarding complementary and alternative medicine in Taiwan.

PubMed

Smith, Graeme D; Wu, Shu-Chen

2012-09-01

To gain an insight into this issue, this study used a qualitative approach and aims to explore and describe nurses' beliefs, experiences and practice regarding complementary and alternative medicine in Taiwan. The integration of complementary and alternative medicine with conventional medicine has become more common worldwide in recent years. An increase in patient use and an expansion of nurses using complementary and alternative medicine has spawned further investigation. Most published studies have concentrated on the usage of complementary and alternative medicine in western societies and have focused principally on physicians' attitudes and practice patterns in this regard. Despite the large amount of time and the unique relationship that nurses share with their patients, little research has investigated the nurse's attitudes and practice regarding complementary and alternative medicine. Moreover, there has been no previous research into understanding this issue from the Taiwanese nursing perspective. A qualitative research design. By using an exploratory, descriptive, qualitative approach, data were collected from 11 registered nurses. The methods of the data collection were in-depth, semi-structured interviews, field notes and memos and the data were analysed using the constant comparative method. Three major categories emerged from the data; namely, a 'lack of clear definition', 'limited experience' and 'high interest' towards complementary and alternative medicine. These results suggest that the definition of complementary and alternative medicine is often unclear for nurses in Taiwan. Due to the organisational policies and personal knowledge base, very few nurses integrate complementary and alternative medicine into their daily practice. However, the nurses in Taiwan show a great desire to participate in complementary and alternative medicine continuing education programmes. This study is not only significant in filling the gap in the existing literature, but is also important in understanding this issue from the nurses' perspective, to offer a series of recommendations for policy, nursing education, nursing practice and suggestions for further research. This study highlights the importance of nursing attitude in the use of complementary and alternative medicine. Clinical nurses have the potential to provide appropriate information to their patients to ensure safe complementary and alternative medicine use. © 2012 Blackwell Publishing Ltd.

A review of nurses' knowledge, attitudes, and ability to communicate the risks and benefits of complementary and alternative medicine.

PubMed

Chang, Hsiao-Yun; Chang, Huai-Lu

2015-06-01

This study reviewed existing literature to investigate how frequently nurses include complementary and alternative forms of medicine in their clinical practice. In so doing, we investigated nurses' knowledge of and attitudes towards complementary and alternative medicine as well as their ability to communicate the risks and benefits of these therapies with patients. Little information is available concerning nurses' knowledge and attitudes towards complementary and alternative medicine or how they incorporate these therapies into their practice. In addition, little is known about the ability of nurses to communicate the risks and benefits of complementary and alternative medicine to their patients. This study used a scoping review method to map and synthesise existing literature. Both electronic and manual searches were used to identify relevant studies published between January 2007 and January 2014. The review was conducted in five stages: (1) identification of research question(s), (2) locate studies, (3) selection of studies, (4) charting of data, and (5) collating, summarising, and reporting of results. Fifteen papers met the inclusion criteria for this review, among which 53·7% referenced how frequently nurses include complementary and alternative medicine in their practice. We found that 66·4% of nurses had positive attitudes towards complementary and alternative medicine; however, 77·4% did not possess a comprehensive understanding of the associated risks and benefits. In addition, nearly half of the respondents (47·3-67·7%) reported feeling uncomfortable discussing complementary and alternative medicine therapies with their patients. The lack of knowledge about complementary and alternative medicine among nurses is a cause for concern, particularly in light of its widespread application. Findings from this study suggest that health care professionals need to promote evidence informed decision-making in complementary and alternative medicine practice and be knowledgeable enough to discuss complementary and alternative medicine therapies. Without involvement of complementary and alternative medicine communication on the part of our profession, we may put our patients at risk of uninformed and without medical guidance. © 2015 John Wiley & Sons Ltd.

Multi-particle inspection using associated particle sources

DOEpatents

Bingham, Philip R.; Mihalczo, John T.; Mullens, James A.; McConchie, Seth M.; Hausladen, Paul A.

2016-02-16

Disclosed herein are representative embodiments of methods, apparatus, and systems for performing combined neutron and gamma ray radiography. For example, one exemplary system comprises: a neutron source; a set of alpha particle detectors configured to detect alpha particles associated with neutrons generated by the neutron source; neutron detectors positioned to detect at least some of the neutrons generated by the neutron source; a gamma ray source; a set of verification gamma ray detectors configured to detect verification gamma rays associated with gamma rays generated by the gamma ray source; a set of gamma ray detectors configured to detect gamma rays generated by the gamma ray source; and an interrogation region located between the neutron source, the gamma ray source, the neutron detectors, and the gamma ray detectors.

Effects of Correlated and Uncorrelated Gamma Rays on Neutron Multiplicity Counting

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cowles, Christian C.; Behling, Richard S.; Imel, George R.

Neutron multiplicity counting relies on time correlation between neutron events to assay the fissile mass, (α,n) to spontaneous fission neutron ratio, and neutron self-multiplication of samples. Gamma-ray sensitive neutron multiplicity counters may misidentify gamma rays as neutrons and therefore miscalculate sample characteristics. Time correlated and uncorrelated gamma-ray-like signals were added into gamma-ray free neutron multiplicity counter data to examine the effects of gamma ray signals being misidentified as neutron signals on assaying sample characteristics. Multiplicity counter measurements with and without gamma-ray-like signals were compared to determine the assay error associated with gamma-ray-like signals at various gamma-ray and neutron rates. Correlatedmore » and uncorrelated gamma-ray signals each produced consistent but different measurement errors. Correlated gamma-ray signals most strongly led to fissile mass overestimates, whereas uncorrelated gamma-ray signals most strongly lead to (α,n) neutron overestimates. Gamma-ray sensitive neutron multiplicity counters may be able to account for the effects of gamma-rays on measurements to mitigate measurement uncertainties.« less

Integrative Medicine and Complementary and Alternative Therapies

MedlinePlus

... and tai chi. Questions to Ask Your Healthcare Team Use the following questions as a guide to discuss complementary therapies with your healthcare team: Are there complementary therapies that you would recommend? ...

Complexation of tocotrienol with gamma-cyclodextrin enhances intestinal absorption of tocotrienol in rats.

PubMed

Ikeda, Saiko; Uchida, Tomono; Ichikawa, Tomio; Watanabe, Takashi; Uekaji, Yukiko; Nakata, Daisuke; Terao, Keiji; Yano, Tomohiro

2010-01-01

To determine the bioavailability of tocotrienol complex with gamma-cyclodextrin, the effects of tocotrienol/gamma-cyclodextrin complex on tocotrienol concentration in rat plasma and tissues were studied. Rats were administered by oral gavage an emulsion containing tocotrienol, tocotrienol with gamma-cyclodextrin, or tocotrienol/gamma-cyclodextrin complex. At 3 h after administration, the plasma gamma-tocotrienol concentration of the rats administered tocotrienol/gamma-cyclodextrin complex was higher than that of the rats administered tocotrienol and gamma-cyclodextrin. In order to determine the effect of complexation on tocotrienol absorption, rats were injected with Triton WR1339, which prevents the catabolism of triacylglycerol-rich lipoprotein by lipoprotein lipase, and then administered by oral gavage an emulsion containing tocotrienol, tocotrienol with gamma-cyclodextrin, or tocotrienol/gamma-cyclodextrin complex. The plasma gamma-tocotrienol concentration of the Triton-treated rats administered tocotrienol/gamma-cyclodextrin complex was higher than that of the other Triton-treated rats. These results suggest that complexation of tocotrienol with gamma-cyclodextrin elevates plasma and tissue tocotrienol concentrations by enhancing intestinal absorption.

Identification and characterization of novel peroxisome proliferator-activated receptor-gamma (PPAR-gamma) transcriptional variants in pig and human.

PubMed

Omi, T; Brenig, B; Spilar Kramer, S; Iwamoto, S; Stranzinger, G; Neuenschwander, S

2005-04-01

The peroxisome proliferator-activated receptor-gamma (PPAR-gamma) is a member of the steroid/thyroid/retinoid receptor superfamily, and is primarily expressed in fat tissue. To date, two major PPAR-gamma isoforms have been identified in pig, PPAR-gamma1 and PPAR-gamma2. Porcine PPAR-gamma1a consists of two leader exons, designated A1 and A2, followed by six exons containing the open reading frame. Here, we report the isolation and characterization of three novel PPAR-gamma1 transcripts. PPAR-gamma1b is derived from exon A1, with exon A2 spliced out. PPAR-gamma1c and PPAR-gamma1d are derived from the new exon, A', containing exon A2 (gamma1c) or without exon A2 (gamma1d). Based on PCR analysis of PAC clones that included sequences from the 5'-untranslated region of the PPAR-gamma gene, the new A' exon is located between the known exons A1 and A2. We also isolated the human homologue to exon A', as well as the two new PPAR-gamma1c and -gamma1d splice variants, from human adipose tissue. Studies of the expression of porcine PPAR-gamma by real time reverse transcription-polymerase chain reaction analysis show that transcripts derived from exon A1 were not expressed at significantly different levels in visceral fat (lamina subserosa) or subcutaneous fat (back fat, inner and outer layer). In contrast, exon A'-derived transcripts were expressed at progressively higher levels in the inner and outer layers of subcutaneous fat than in visceral fat. The same expression pattern was also observed for PPAR-gamma2. We hypothesize that there are three promoters, which differentially regulate PPAR-gamma1 and PPAR-gamma2 gene expression, depending on the specific localization of the fat tissue.

Predicting diffusion paths and interface motion in gamma/gamma + beta, Ni-Cr-Al diffusion couples

NASA Technical Reports Server (NTRS)

Nesbitt, J. A.; Heckel, R. W.

1987-01-01

A simplified model has been developed to predict Beta recession and diffusion paths in ternary gamma/gamma + beta diffusion couples (gamma:fcc, beta: NiAl structure). The model was tested by predicting beta recession and diffusion paths for four gamma/gamma + beta, Ni-Cr-Al couples annealed for 100 hours at 1200 C. The model predicted beta recession within 20 percent of that measured for each of the couples. The model also predicted shifts in the concentration of the gamma phase at the gamma/gamma + beta interface within 2 at. pct Al and 6 at. pct Cr of that measured in each of the couples. A qualitative explanation based on simple kinetic and mass balance arguments has been given which demonstrates the necessity for diffusion in the two-phase region of certain gamma/gamma + beta, Ni-Cr-Al couples.

Complementary Feeding Knowledge, Practices, and Dietary Diversity among Mothers of Under-Five Children in an Urban Community in Lagos State, Nigeria

PubMed Central

Olatona, Foluke Adenike; Adenihun, Jesupelumi Oreoluwa; Aderibigbe, Sunday Adedeji; Adeniyi, Oluwafunmilayo Funke

2017-01-01

Background and Objectives: Inappropriate complementary feeding is a major cause of child malnutrition and death. This study determined the complementary feeding knowledge, practices, minimum dietary diversity, and acceptable diet among mothers of under-five children in an urban Local Government Area of Lagos State, Southwest Nigeria. Methods: This descriptive cross-sectional study was conducted in Eti-Osa area of Lagos State, Nigeria. Multi-stage sampling technique was employed to select 355 mothers and infants. Data was collected using a pre-tested interviewer administered questionnaire and 24-hour diet recall was used to assess dietary diversity. Data was analyzed using Epi-Info. Results: Knowledge of complementary feeding was low (14.9%) and was associated with older mothers’ age, being married, and higher level of education. The prevalence of timely initiation of complementary feeding (47.9%), dietary diversity (16.0%) and minimum acceptable diet for children between 6 and 9 months (16%) were low. Overall, appropriate complementary feeding practice was low (47.0%) and associated with higher level of mothers’ education and occupation. Conclusions and Global Health Implications: Complementary feeding knowledge and practices were poor among mothers of under-5 especially the non-literate. Reduction of child malnutrition through appropriate complementary feeding remains an important global health goal. Complementary feeding education targeting behavioral change especially among young, single and uneducated mothers in developing countries is important to reduce child morbidity and mortality. PMID:28798893

Factors Associated with the Early Introduction of Complementary Feeding in Saudi Arabia.

PubMed

Alzaheb, Riyadh A

2016-07-12

Mothers' instigation of complementary feeding before their infant reaches 6 months old risks shortening their breastfeeding duration, and high morbidity and mortality for their child. Complementary feeding practices require further investigation in Saudi Arabia. The present study aims to evaluate complementary feeding practices, and to establish which factors are associated with the early introduction of complementary feeding in the Saudi Arabian context. Cross-sectional research was conducted with 632 mothers of infants aged between 4 and 24 months attending five primary health care centers (PHCCs) between July and December 2015 in Saudi Arabia. Data on participants' socio-demographic characteristics and complementary feeding practices were collected via structured questionnaires. A regression analysis identified the factors associated with the early introduction of solid foods, defined as before 17 weeks. 62.5% of the study's infants received solid foods before reaching 17 weeks old. The maternal factors at higher risk of early introduction of solids were: younger age; Saudi nationality; shorter education; employment within 6 months post-birth; caesareans; not breastfeeding fully for six weeks post-birth, and living in low-income households. Complementary feeding prior to 6 months postpartum was common in Saudi Arabia. Public health interventions are needed to reduce early complementary feeding, focusing on mothers at highest risk of giving solids too early.

Dielectron widths of the Gamma(1S,2S,3S) resonances.

PubMed

Rosner, J L; Adam, N E; Alexander, J P; Berkelman, K; Cassel, D G; Duboscq, J E; Ecklund, K M; Ehrlich, R; Fields, L; Galik, R S; Gibbons, L; Gray, R; Gray, S W; Hartill, D L; Heltsley, B K; Hertz, D; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Mahlke-Krüger, H; Meyer, T O; Onyisi, P U E; Patterson, J R; Peterson, D; Phillips, E A; Pivarski, J; Riley, D; Ryd, A; Sadoff, A J; Schwarthoff, H; Shi, X; Stroiney, S; Sun, W M; Wilksen, T; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Patel, R; Potlia, V; Stoeck, H; Yelton, J; Rubin, P; Cawlfield, C; Eisenstein, B I; Karliner, I; Kim, D; Lowrey, N; Naik, P; Sedlack, C; Selen, M; White, E J; Wiss, J; Shepherd, M R; Besson, D; Pedlar, T K; Cronin-Hennessy, D; Gao, K Y; Gong, D T; Hietala, J; Kubota, Y; Klein, T; Lang, B W; Poling, R; Scott, A W; Smith, A; Dobbs, S; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ernst, J; Arms, K; Severini, H; Dytman, S A; Love, W; Mehrabyan, S; Savinov, V; Aquines, O; Li, Z; Lopez, A; Mendez, H; Ramirez, J; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shipsey, I P J; Xin, B; Adams, G S; Anderson, M; Cummings, J P; Danko, I; Napolitano, J; He, Q; Insler, J; Muramatsu, H; Park, C S; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Stroynowski, R; Artuso, M; Blusk, S; Butt, J; Li, J; Menaa, N; Mountain, R; Nisar, S; Randrianarivony, K; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, K; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Lincoln, A; Asner, D M; Edwards, K W; Briere, R A; Chen, J; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E

2006-03-10

We determine the dielectron widths of the Gamma(1S), Gamma(2S), and Gamma(3S) resonances with better than 2% precision by integrating the cross section of e+e- -->Gamma over the e+e- center-of-mass energy. Using e+e- energy scans of the Gamma resonances at the Cornell Electron Storage Ring and measuring Gamma production with the CLEO detector, we find dielectron widths of 1.252+/-0.004(sigma(stat))+/-0.019(sigma(syst)) keV, 0.581+/-0.004+/-0.009 keV, and 0.413+/-0.004+/-0.006 keV for the Gamma(1S), Gamma(2S), and Gamma(3S), respectively.

Experimental search for radiative decays of the pentaquark baryon {Theta}{sup +}(1540)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barmin, V. V.; Asratyan, A. E.; Borisov, V. S.

2010-07-15

The data on the reactions K{sup +}Xe {sup {yields}}K{sup 0{gamma}}X and K{sup +}Xe {sup {yields}}K{sup +{gamma}}X, obtained with the bubble chamber DIANA, have been analyzed for possible radiative decays of the {Theta}{sup +}(1540) baryon: {Theta}{sup +} {sup {yields}}K{sup 0}p{gamma} and {Theta}{sup +} {sup {yields}}K{sup +}n{gamma}. No signals have been observed, and we derive the upper limits {Gamma}({Theta}{sup +} {sup {yields}}K{sup 0}p{gamma})/{Gamma}({Theta}{sup +} {sup {yields}}K{sup 0}p) < 0.032 and {Gamma}({Theta}{sup +} {sup {yields}}K{sup +}n{gamma})/{Gamma}({Theta}{sup +} {sup {yields}}K{sup +}n{gamma}) < 0.041 which, using our previous measurement of {Gamma}({Theta}{sup +} {sup {yields}}KN) = 0.39 {+-} 0.10 MeV, translate to {Gamma}({Theta}{sup +} {sup {yields}}K{supmore » 0}p{gamma}) < 8 keV and {Gamma}({Theta}{sup +} {sup {yields}}K{sup +}n{gamma}) < 11 keV at 90% confidence level. We have also measured the cross sections of K{sup +}-induced reactions involving emission of a neutral pion: {sigma}(K{sup +}n {sup {yields}}K{sup 0}p{pi}{sup 0}) = 68 {+-} 18 {mu}b and {sigma}(K{sup +}N {sup {yields}}K{sup +}N{pi}{sup 0}) = 30 {+-} 8 {mu}b for incident K{sup +} momentum of 640 MeV.« less

Complementary-encoding holographic associative memory using a photorefractive crystal

NASA Astrophysics Data System (ADS)

Yuan, ShiFu; Wu, Minxian; Yan, Yingbai; Jin, Guofan

1996-06-01

We present a holographic implementation of accurate associative memory with only one holographic memory system. In the implementation, the stored and test images are coded by using complementary-encoding method. The recalled complete image is also a coded image that can be decoded with a decoding mask to get an original image or its complement image. The experiment shows that the complementary encoding can efficiently increase the addressing accuracy in a simple way. Instead of the above complementary-encoding method, a scheme that uses complementary area-encoding method is also proposed for the holographic implementation of gray-level image associative memory with accurate addressing.

Complementary approaches to palliative oncological care.

PubMed

Zappa, Simone B; Cassileth, Barrie R

2003-01-01

The popularity of complementary and alternative medicine (CAM) has increased tremendously in recent years. Thus, it is imperative to distinguish between alternative therapies that can be dangerous and complementary therapies that are primarily palliative and augment conventional treatment. Memorial Sloan-Kettering Cancer Center's Integrative Medicine Service offers complementary therapies to patients in an attempt to improve quality of life and provide symptom management. In addition to clinical services, it also provides education to health care professionals and the public and performs clinical and laboratory research on complementary modalities and the antitumor properties of botanicals. If CAM is to be accepted by mainstream medicine, research must be done usingstandard research methodologies.

Office of Cancer Complementary and Alternative Medicine

MedlinePlus

... Information. Outreach. The Office of Cancer Complementary and Alternative Medicine (OCCAM) was established in October 1998 to coordinate ... Institute (NCI) in the arena of complementary and alternative medicine (CAM). More about us. CAM at the NCI ...

Diagnostic Evaluation of Des-Gamma-Carboxy Prothrombin versus α-Fetoprotein for Hepatitis B Virus-Related Hepatocellular Carcinoma in China: A Large-Scale, Multicentre Study

PubMed Central

Zheng, Lei; Yin, Yuepeng; Zou, Zhenzhen; Zhou, Feiguo; Zhou, Weiping; Shen, Feng; Gao, Chunfang

2016-01-01

An efficient serum marker for hepatocellular carcinoma (HCC) is currently lacking and requires intensive exploration. We aimed to evaluate the performance of des-gamma-carboxy prothrombin (DCP) for identifying hepatitis B virus-related HCC in a large, multicentre study in China. A total of 1034 subjects in three cohorts (A, B, and C) including HCC and various non-HCC controls were enrolled from 4 academic medical centers in China from January 2011 to February 2014. Blind parallel detections were conducted for DCP and AFP. The area under the receiver operating characteristic curve (AUC) was used to evaluate the diagnostic efficacies. In cohort A, which comprised 521 subjects, including patients with HCC, liver metastasis, liver cirrhosis (LC), and liver hemangiomas as well as healthy controls (HCs), the accuracy of DCP for distinguishing HCC from various controls was 6.2–9.7% higher than that of AFP. In cohort B, which comprised 447 subjects, including patients with HCC, LC, and chronic hepatitis B as well as HC, the accuracy of DCP was further elevated (12.3–20.67% higher than that of AFP). The superiority of DCP to AFP was more profound in the surveillance of early HCC [AUC 0.837 (95% CI: 0.771–0.903) vs. 0.650 (0.555–0.745)] and AFP-negative HCC [AUC: 0.856 (0.798–0.914)] and in discriminating HCC from LC (accuracy: 92.9% vs.64.71%). Higher DCP levels were associated with worse clinical behaviors and shorter disease-free survival. DCP not only is complementary to AFP in identifying AFP-negative HCC and in excluding AFP-positive non-HCC (liver cirrhosis), but also demonstrates improved performance in HCC surveillance, early diagnosis, treatment response and recurrence monitoring in the HBV-related population. PMID:27070780

Neutrino Analysis of the September 2010 Crab Nebula Flare and Time-Integrated Constraints on Neutrino Emission from the Crab Using IceCube

NASA Technical Reports Server (NTRS)

Abbasi, R.; Abdou, Y.; Abu-Zayyad, T.; Adams, J.; Aguilar, A.; Ahlers, M.; Altmann; Andeen, K.; Auffenberg, J; Bai, X.;

Neutrino Analysis of the September 2010 Crab Nebula Flare and Time-integrated Constraints on Neutrino Emission From the Crab Using IceCube

NASA Technical Reports Server (NTRS)

Stamatikos, M.; Abbasi, R.; Abdou, Y.; Abu-Zayyad, T.; Adams, J.; Aguliar, J. A.; Ahlers, M.; Altmann, D.; Andeen, K.; Auffenberg, J.;

Effects of a high fat or a balanced omega 3/omega 6 diet on cytokines levels and DNA damage in experimental colitis.

PubMed

Vieira de Barros, Karina; Gomes de Abreu, Gilclay; Xavier, Roberta Araujo Navarro; Real Martinez, Carlos Augusto; Ribeiro, Marcelo Lima; Gambero, Alessandra; de Oliveira Carvalho, Patrícia; Silveira, Vera Lúcia Flor

2011-02-01

High-fat diets have been shown to be a risk factor for ulcerative colitis (UC). Omega-6 polyunsaturated fatty acids are considered to increase lipid peroxidation, while the omega-3 polyunsaturated fatty acid exerts a chemopreventative effect. We evaluated the effect of high-fat diets (20%) enriched with fish or soybean oil on colonic inflammation and DNA damage in dextran sulfate sodium-induced colitis. Male Wistar rats (28-30 days) were fed an American Institute of Nutrition (AIN)-93 diet for 47 days and divided into five groups: control normal fat non-colitic (C) or control colitis (CC), high soybean fat group (HS) colitis, high fish fat group colitis, or high-fat soybean plus fish oil colitis. UC was induced from day 35 until day 41 by 3% dextran sulfate sodium. On day 47, the rats were anesthetized; blood samples collected for corticosterone determination, and the distal colon was excised to quantify interleukin-4 (IL-4), IL-10, and interferon-gamma levels, myeloperoxidase activity, histological analyses, and DNA damage. The disease activity index was recorded daily. The disease activity index, histological analysis, myeloperoxidase activity, IL-4, interferon-gamma, and corticosterone levels did not differ among the colitic groups. IL-10 was significantly increased by the high fish fat group diet in relation to HS, but only the high soybean-fish fat diet increased the IL-10/IL-4 ratio (anti-inflammatory/pro-inflammatory) to levels closer to the C group and reduced DNA damage compared to the HS group (P<0.05). The data show that high-fat diets did not exacerbate UC and suggest that the soybean and fish oil mixture, more than the fish oil alone, could be a complementary therapy to achieve a cytokine balance in UC. Copyright © 2011 Elsevier Inc. All rights reserved.

Anisotropies in the diffuse gamma-ray background from dark matter with Fermi LAT: A closer look

DOE PAGES

Cuoco, A.; Sellerholm, A.; Conrad, J.; ...

2011-06-21

We perform a detailed study of the sensitivity to the anisotropies related to dark matter (DM) annihilation in the isotropic gamma-ray background (IGRB) as measured by the Fermi Large Area Telescope ( Fermi LAT). For the first time, we take into account the effects of the Galactic foregrounds and use a realistic representation of the Fermi LAT. We implement an analysis pipeline which simulates Fermi LAT data sets starting from model maps of the Galactic foregrounds, the Fermi-resolved point sources, the extragalactic diffuse emission and the signal from DM annihilation. The effects of the detector are taken into account bymore » convolving the model maps with the Fermi LAT instrumental response. We then use the angular power spectrum to characterize the anisotropy properties of the simulated data and to study the sensitivity to DM. We consider DM anisotropies of extragalactic origin and of Galactic origin (which can be generated through annihilation in the Milky Way substructures) as opposed to a background of anisotropies generated by sources of astrophysical origin, blazars for example. We find that with statistics from 5 yr of observation, Fermi is sensitive to a DM contribution at the level of 1–10 per cent of the measured IGRB depending on the DM mass m χ and annihilation mode. In terms of the thermally averaged cross-section , this corresponds to ~10 –25 cm 3 s –1, i.e. slightly above the typical expectations for a thermal relic, for low values of the DM mass m χ≲ 100 GeV. As a result, the anisotropy method for DM searches has a sensitivity comparable to the usual methods based only on the energy spectrum and thus constitutes an independent and complementary piece of information in the DM puzzle.« less

Design and performance of the GAMMA-400 gamma-ray telescope for dark matter searches

NASA Astrophysics Data System (ADS)

Galper, A. M.; Adriani, O.; Aptekar, R. L.; Arkhangelskaja, I. V.; Arkhangelskiy, A. I.; Boezio, M.; Bonvicini, V.; Boyarchuk, K. A.; Fradkin, M. I.; Gusakov, Yu. V.; Kaplin, V. A.; Kachanov, V. A.; Kheymits, M. D.; Leonov, A. A.; Longo, F.; Mazets, E. P.; Maestro, P.; Marrocchesi, P.; Mereminskiy, I. A.; Mikhailov, V. V.; Moiseev, A. A.; Mocchiutti, E.; Mori, N.; Moskalenko, I. V.; Naumov, P. Yu.; Papini, P.; Picozza, P.; Rodin, V. G.; Runtso, M. F.; Sparvoli, R.; Spillantini, P.; Suchkov, S. I.; Tavani, M.; Topchiev, N. P.; Vacchi, A.; Vannuccini, E.; Yurkin, Yu. T.; Zampa, N.; Zverev, V. G.; Zirakashvili, V. N.

2013-02-01

The GAMMA-400 gamma-ray telescope is designed to measure the fluxes of gamma-rays and cosmic-ray electrons + positrons, which can be produced by annihilation or decay of the dark matter particles, as well as to survey the celestial sphere in order to study point and extended sources of gamma-rays, measure energy spectra of Galactic and extragalactic diffuse gamma-ray emission, gamma-ray bursts, and gamma-ray emission from the Sun. GAMMA-400 covers the energy range from 100 MeV to 3000 GeV. Its angular resolution is ~0.01° (Eγ > 100 GeV), the energy resolution ~1% (Eγ > 10 GeV), and the proton rejection factor ~106. GAMMA-400 will be installed on the Russian space platform Navigator. The beginning of observations is planned for 2018.

The structure, logic of operation and distinctive features of the system of triggers and counting signals formation for gamma-telescope GAMMA-400

NASA Astrophysics Data System (ADS)

Topchiev, N. P.; Galper, A. M.; Arkhangelskiy, A. I.; Arkhangelskaja, I. V.; Kheymits, M. D.; Suchkov, S. I.; Yurkin, Y. T.

2017-01-01

Scientific project GAMMA-400 (Gamma Astronomical Multifunctional Modular Apparatus) relates to the new generation of space observatories intended to perform an indirect search for signatures of dark matter in the cosmic-ray fluxes, measurements of characteristics of diffuse gamma-ray emission and gamma-rays from the Sun during periods of solar activity, gamma-ray bursts, extended and point gamma-ray sources, electron/positron and cosmic-ray nuclei fluxes up to TeV energy region by means of the GAMMA-400 gamma-ray telescope represents the core of the scientific complex. The system of triggers and counting signals formation of the GAMMA-400 gamma-ray telescope constitutes the pipelined processor structure which collects data from the gamma-ray telescope subsystems and produces summary information used in forming the trigger decision for each event. The system design is based on the use of state-of-the-art reconfigurable logic devices and fast data links. The basic structure, logic of operation and distinctive features of the system are presented.

Implications of Gamma-Ray Transparency Constraints in Blazars: Minimum Distances and Gamma-Ray Collimation

NASA Technical Reports Server (NTRS)

Becker, Peter A.; Kafatos, Menas

1995-01-01

We develop a general expression for the gamma - gamma absorption coefficient, alpha(sub gamma(gamma)) for gamma-rays propagating in an arbitrary direction at an arbitrary point in space above an X-ray-emitting accretion disk. The X-ray intensity is assumed to vary as a power law in energy and radius between the outer disk radius, R(sub 0), and the inner radius, R(sub ms) which is the radius of marginal stability for a Schwarzschild black hole. We use our result for alpha(sub gamma(gamma)) to calculate the gamma - gamma optical depth, tau(sub gamma(gamma)) for gamma - rays created at height z and propagating at angle Phi relative to the disk axis, and we show that for Phi = 0 and z greater than or approx equal to R(sub 0), tau(sub gamma(gamma)) proportional to Epsilon(sup alpha)z(sup -2(alpha) - 3), where alpha is the X-ray spectral index and Epsilon is the gamma - ray energy. As an application, we use our formalism to compute the minimum distance between the central black hole and the site of production of the gamma-rays detected by EGRET during the 1991 June flare of 3C 279. In order to obtain an upper limit, we assume that all of the X-rays observed contemporaneously by Ginga were emitted by the disk. Our results suggest that the observed gamma - rays may have originated within less than or approx equal to 45 GM/sq c from a black hole of mass greater than or approx equal to 10(exp 9) solar mass, perhaps in active plasma located above the central funnel of the accretion disk. This raises the possibility of establishing a direct connection between the production of the observed gamma - rays and the accretion of material onto the black hole. We also consider the variation of the optical depth as a function of the angle of propagation Phi. Our results indicate that the "focusing" of the gamma - rays along the disk axis due to pair production is strong enough to explain the observed degree of alignment in blazar sources. If the gamma - rays are produced isotropically in gamma - ray blazars, then these objects should appear as bright MeV sources when viewed along off-axis lines of sight.

The Gamma-ray Sky with Fermi

NASA Technical Reports Server (NTRS)

Thompson, David

2012-01-01

Gamma rays reveal extreme, nonthermal conditions in the Universe. The Fermi Gamma-ray Space Telescope has been exploring the gamma-ray sky for more than four years, enabling a search for powerful transients like gamma-ray bursts, novae, solar flares, and flaring active galactic nuclei, as well as long-term studies including pulsars, binary systems, supernova remnants, and searches for predicted sources of gamma rays such as dark matter annihilation. Some results include a stringent limit on Lorentz invariance derived from a gamma-ray burst, unexpected gamma-ray variability from the Crab Nebula, a huge gamma-ray structure associated with the center of our galaxy, surprising behavior from some gamma-ray binary systems, and a possible constraint on some WIMP models for dark matter.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

PubMed

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

gamma-Glutamyl amino acids. Transport and conversion to 5-oxoproline in the kidney

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bridges, R.J.; Meister, A.

1985-06-25

Transport of gamma-glutamyl amino acids, a step in the proposed glutathione-gamma-glutamyl transpeptidase-mediated amino acid transport pathway, was examined in mouse kidney. The transport of gamma-glutamyl amino acids was demonstrated in vitro in studies on kidney slices. Transport was followed by measuring uptake of /sup 35/S after incubation of the slices in media containing gamma-glutamyl methionine (/sup 35/S)sulfone. The experimental complication associated with extracellular conversion of the gamma-glutamyl amino acid to amino acid and uptake of the latter by slices was overcome by using 5-oxoproline formation (catalyzed by intracellular gamma-glutamyl-cyclotransferase) as an indicator of gamma-glutamyl amino acid transport. This method wasmore » also successfully applied to studies on transport of gamma-glutamyl amino acids in vivo. Transport of gamma-glutamyl amino acids in vitro and in vivo is inhibited by several inhibitors of gamma-glutamyl transpeptidase and also by high extracellular levels of glutathione. This seems to explain urinary excretion of gamma-glutamylcystine by humans with gamma-glutamyl transpeptidase deficiency and by mice treated with inhibitors of this enzyme. Mice depleted of glutathione by treatment with buthionine sulfoximine (which inhibits glutathione synthesis) or by treatment with 2,6-dimethyl-2,5-heptadiene-4-one (which effectively interacts with tissue glutathione) exhibited significantly less transport of gamma-glutamyl amino acids than did untreated controls. The findings suggest that intracellular glutathione functions in transport of gamma-glutamyl amino acids. Evidence was also obtained for transport of gamma-glutamyl gamma-glutamylphenylalanine into kidney slices.« less

The mirror neuron system is more active during complementary compared with imitative action.

PubMed

Newman-Norlund, Roger D; van Schie, Hein T; van Zuijlen, Alexander M J; Bekkering, Harold

2007-07-01

We assessed the role of the human mirror neuron system (MNS) in complementary actions using functional magnetic resonance imaging while participants prepared to execute imitative or complementary actions. The BOLD signal in the right inferior frontal gyrus and bilateral inferior parietal lobes was greater during preparation of complementary than during imitative actions, suggesting that the MNS may be essential in dynamically coupling action observation to action execution.

Reconfigurable Complementary Logic Circuits with Ambipolar Organic Transistors

PubMed Central

Yoo, Hocheon; Ghittorelli, Matteo; Smits, Edsger C. P.; Gelinck, Gerwin H.; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon

2016-01-01

Ambipolar organic electronics offer great potential for simple and low-cost fabrication of complementary logic circuits on large-area and mechanically flexible substrates. Ambipolar transistors are ideal candidates for the simple and low-cost development of complementary logic circuits since they can operate as n-type and p-type transistors. Nevertheless, the experimental demonstration of ambipolar organic complementary circuits is limited to inverters. The control of the transistor polarity is crucial for proper circuit operation. Novel gating techniques enable to control the transistor polarity but result in dramatically reduced performances. Here we show high-performance non-planar ambipolar organic transistors with electrical control of the polarity and orders of magnitude higher performances with respect to state-of-art split-gate ambipolar transistors. Electrically reconfigurable complementary logic gates based on ambipolar organic transistors are experimentally demonstrated, thus opening up new opportunities for ambipolar organic complementary electronics. PMID:27762321

Reconfigurable Complementary Logic Circuits with Ambipolar Organic Transistors.

PubMed

Yoo, Hocheon; Ghittorelli, Matteo; Smits, Edsger C P; Gelinck, Gerwin H; Lee, Han-Koo; Torricelli, Fabrizio; Kim, Jae-Joon

2016-10-20

Ambipolar organic electronics offer great potential for simple and low-cost fabrication of complementary logic circuits on large-area and mechanically flexible substrates. Ambipolar transistors are ideal candidates for the simple and low-cost development of complementary logic circuits since they can operate as n-type and p-type transistors. Nevertheless, the experimental demonstration of ambipolar organic complementary circuits is limited to inverters. The control of the transistor polarity is crucial for proper circuit operation. Novel gating techniques enable to control the transistor polarity but result in dramatically reduced performances. Here we show high-performance non-planar ambipolar organic transistors with electrical control of the polarity and orders of magnitude higher performances with respect to state-of-art split-gate ambipolar transistors. Electrically reconfigurable complementary logic gates based on ambipolar organic transistors are experimentally demonstrated, thus opening up new opportunities for ambipolar organic complementary electronics.

Anomalous diffusion associated with nonlinear fractional derivative fokker-planck-like equation: exact time-dependent solutions

PubMed

Bologna; Tsallis; Grigolini

2000-08-01

We consider the d=1 nonlinear Fokker-Planck-like equation with fractional derivatives ( partial differential/ partial differentialt)P(x,t)=D( partial differential(gamma)/ partial differentialx(gamma))[P(x,t)](nu). Exact time-dependent solutions are found for nu=(2-gamma)/(1+gamma)(-infinity

Gamma-400 Science Objectives Built on the Current HE Gamma-Ray and CR Results

NASA Technical Reports Server (NTRS)

Moiseev, Alexander; Mitchell, John; Thompson, David

2012-01-01

The main scientific interest of the Russian Gamma-400 team: Observe gamma-rays above approximately 50 GeV with excellent energy and angular resolution with the goals of: (1) Studying the fine spectral structure of the isotropic high-energy gamma-radiation, (2) Attempting to identify the many still-unidentified Fermi-LAT gamma-ray sources. Gamma-400 will likely be the only space-based gamma-ray observatory operating at the end of the decade. In our proposed Gamma-400-LE version, it will substantially improve upon the capabilities of Fermi LAT and AGILE in both LE and HE energy range. Measuring gamma-rays from approx 20 MeV to approx 1 TeV for at least 7 years, Gamma-400-LE will address the topics of dark matter, cosmic ray origin and propagation, neutron stars, flaring pulsars, black holes, AGNs, GRBs, and actively participate in multiwavelength campaigns.

Complementary and alternative medicine use in Iranian patients with diabetes mellitus.

PubMed

Hashempur, Mohammad Hashem; Heydari, Mojtaba; Mosavat, Seyed Hamdollah; Heydari, Seyyed Taghi; Shams, Mesbah

2015-09-01

There is increasing interest in complementary and alternative medicine generally, and especially by those affected by chronic diseases, such as diabetes mellitus. We aimed to determine the prevalence and pattern of complementary and alternative medicine use among patients suffering from diabetes mellitus in Shiraz, southern Iran. Another objective was to explore associated factors for use of complementary and alternative medicine among patients with diabetes mellitus. A 19-item semi-structured questionnaire (open- and close-ended) was administered to 239 patients with diabetes mellitus in this cross-sectional study. It was carried out in two outpatient diabetes clinics affiliated with the Shiraz University of Medical Sciences, Shiraz, Iran. One hundred and eighty patients (75.3%) used at least one type of complementary and alternative medicine in the last year prior to the interview. Patients with diabetes mellitus who were living in a large family (≥5 members), not taking insulin, and believed that complementary and alternative medicine have synergistic effects with conventional medicine, were independently and significantly (P values: 0.02, 0.04, and 0.01, respectively) more likely to use complementary and alternative medicine. Most of the users (97.7%) reported use of herbal preparations, and 89.4% of users did not change their medication, neither in medication schedule nor its dosage. The use of complementary and alternative medicine, especially herbal remedies, is popular among diabetes patients in Shiraz, Iran. This use is associated with patients' family size, type of conventional medications and their view about concomitant use of complementary and conventional medicine.

Absence of Fc epsilonRI alpha chain results in upregulation of Fc gammaRIII-dependent mast cell degranulation and anaphylaxis. Evidence of competition between Fc epsilonRI and Fc gammaRIII for limiting amounts of FcR beta and gamma chains.

PubMed Central

Dombrowicz, D; Flamand, V; Miyajima, I; Ravetch, J V; Galli, S J; Kinet, J P

1997-01-01

In mouse mast cells, both Fc epsilonRI and Fc gammaRIII are alpha beta gamma2 tetrameric complexes in which different alpha chains confer IgE or IgG ligand recognition while the signaling FcR beta and gamma chains are identical. We used primarily noninvasive techniques (changes in body temperature, dye extravasation) to assess systemic anaphylactic responses in nonanesthetized wild-type, Fc epsilonRI alpha chain -/- and FcR gamma chain -/- mice. We confirm that systemic anaphylaxis in mice can be mediated largely through IgG1 and Fc gammaRIII and we provide direct evidence that these responses reflect activation of Fc gammaRIII rather than Fc gammaRI. Furthermore, we show that Fc gammaRIII-dependent responses are more intense in normal than in congenic mast cell-deficient KitW/KitW-v mice, indicating that Fc gammaRIII responses have mast cell-dependent and -independent components. Finally, we demonstrate that the upregulation of cell surface expression of Fc gammaRIII seen in Fc epsilonRI alpha chain -/- mice corresponds to an increased association of Fc gammaRIII alpha chains with FcR beta and gamma chains and is associated with enhanced Fc gammaRIII-dependent mast cell degranulation and systemic anaphylactic responses. Therefore, the phenotype of the Fc epsilonRI alpha chain -/- mice suggests that expression of Fc epsilonRI and Fc gammaRIII is limited by availability of the FcR beta and gamma chains and that, in normal mice, changes in the expression of one receptor (Fc epsilonRI) may influence the expression of functional responses dependent on the other (Fc gammaRIII). PMID:9062349

Special Section: Complementary and Alternative Medicine (CAM): Time to Talk

MedlinePlus

... with your health care providers any complementary and alternative medicines you take or are thinking about starting. Photo: ... and older use some form of complementary and alternative medicine (CAM). But less than one-third who use ...

Investigation into the use of complementary and alternative medicine and affecting factors in Turkish asthmatic patients.

PubMed

Tokem, Yasemin; Aytemur, Zeynep Ayfer; Yildirim, Yasemin; Fadiloglu, Cicek

2012-03-01

The purpose of this study was to examine the frequency of complementary and alternative medicine usage in asthmatic patients living in the west of Turkey, the most frequently used complementary and alternative medicine methods and socio-demographic factors affecting this and factors related to the disease. While the rate of complementary and alternative medicine usage in asthmatic patients and the reasons for using it vary, practices specific to different countries and regions are of interest. Differing cultural and social factors even in geographically similar regions can affect the type of complementary and alternative medicine used. Two hundred asthmatic patients registered in the asthma outpatient clinic of a large hospital in Turkey and who had undergone pulmonary function tests within the previous six months were included in this study, which was planned according to a descriptive design. The patients filled out a questionnaire on their demographic characteristics and complementary and alternative medicine usage. The proportion of patients who reported using one or more of the complementary and alternative medicine methods was 63·0%. Of these patients, 61·9% were using plants and herbal treatments, 53·2% were doing exercises and 36·5% said that they prayed. The objectives of their use of complementary and alternative medicine were to reduce asthma-related complaints (58%) and to feel better (37·8%). The proportion of people experiencing adverse effects was 3·3% (n = 4). Factors motivating asthmatic patients to use complementary and alternative medicine were the existence of comorbid diseases and a long period since diagnosis (p < 0·05). No statistically significant difference was found between the use of complementary and alternative medicine and the severity of the disease, pulmonary function test parameters, the number of asthma attacks or hospitalisations because of asthma within the last year (p > 0·05). Understanding by nurses of the causes and patterns of the use of complementary and alternative medicine in asthmatic patients helps them in directing patient care and patient safety. Nurses should conduct comprehensive diagnostics in the light of complementary and alternative medicine use, and they should be aware of the potential risks. © 2011 Blackwell Publishing Ltd.

Measurements of the $$\\mathrm{ pp \\to W \\gamma\\gamma }$$ and $$\\mathrm{ pp \\to Z \\gamma\\gamma }$$ cross sections and limits on anomalous quartic gauge couplings at $$\\sqrt{s} =$$ 8 TeV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sirunyan, A. M.; Tumasyan, A.; Adam, W.

Here, measurements are presented ofmore » $$ \\mathrm{ W \\gamma\\gamma } $$ and $$ \\mathrm{ Z \\gamma\\gamma } $$ production in proton-proton collisions. Fiducial cross sections are reported based on a data sample corresponding to an integrated luminosity of 19.4 fb$$^{-1}$$ collected with the CMS detector at a center-of-mass energy of 8 TeV. Signal is identified through the $$\\mathrm{ W } \\to \\ell\

Measurements of the $$\\mathrm{ pp \\to W \\gamma\\gamma }$$ and $$\\mathrm{ pp \\to Z \\gamma\\gamma }$$ cross sections and limits on anomalous quartic gauge couplings at $$\\sqrt{s} =$$ 8 TeV

DOE PAGES

Sirunyan, A. M.; Tumasyan, A.; Adam, W.; ...

2017-10-11

Here, measurements are presented ofmore » $$ \\mathrm{ W \\gamma\\gamma } $$ and $$ \\mathrm{ Z \\gamma\\gamma } $$ production in proton-proton collisions. Fiducial cross sections are reported based on a data sample corresponding to an integrated luminosity of 19.4 fb$$^{-1}$$ collected with the CMS detector at a center-of-mass energy of 8 TeV. Signal is identified through the $$\\mathrm{ W } \\to \\ell\

Wetting characteristics and blood clotting on surfaces of copoly(gamma-Benzyl-L-glutamate, gamma-hydroxyethyl-L-glutamine).

PubMed

Yano, E; Komai, T; Kawasaki, T; Kaifu, K; Atsuta, T; Kubo, Y; Fujiwara, Y

1985-09-01

The film surface of poly(gamma-benzyl-L-glutamate) (PBLG) was modified with 2-aminoethanol to enhance its hydrophilicity. Controlling the reaction conditions of PBLG and 2-aminoethanol, various types of copoly(gamma-benzyl-L-glutamate, gamma-hydroxyethyl-L-glutamine) film surfaces were obtained. Surface free energy (gamma sv), the dispersive component of gamma sv (gamma dsv), the nondispersive component of gamma sv (gamma psv), and the interfacial free energy of polymer surface with water (gamma sw), which were obtained by using the contact angle measurement and calculation method proposed by Andrade et al., were changed remarkably by the aminolysis. The gamma sv value increased after 2 h of aminolysis from 48.2 (PBLG) to 65.3 dyn/cm and gradually increased to around 70 dyn/cm after 12 h reaction. (gamma dsv) and (gamma psv) changed from 31.0 and 17.2 dyn/cm (PBLG) to 26.5 and 44.3 dyn/cm, respectively. These parameters of the material surfaces, modified over 12 h reaction, were found to be similar to those of the surfaces of canine aorta, vein, and human fibrin membrane. Blood clotting times on these polymer surfaces were comparatively longer than on siliconized glass surfaces.

The Differential Interactions of Peroxisome Proliferator-Activated Receptor [gamma] Ligands with Tyr473 Is a Physical Basis for Their Unique Biological Activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Einstein, Monica; Akiyama, Taro E.; Castriota, Gino A.

2008-08-01

Despite their proven antidiabetic efficacy, widespread use of peroxisome proliferator-activated receptor (PPAR){gamma} agonists has been limited by adverse cardiovascular effects. To overcome this shortcoming, selective PPAR{gamma} modulators (SPPAR{gamma}Ms) have been identified that have antidiabetic efficacy comparable with full agonists with improved tolerability in preclinical species. The results of structural studies support the proposition that SPPAR{gamma}Ms interact with PPAR{gamma} differently from full agonists, thereby providing a physical basis for their novel activities. Herein, we describe a novel PPAR{gamma} ligand, SPPAR{gamma}M2. This compound was a partial agonist in a cell-based transcriptional activity assay, with diminished adipogenic activity and an attenuated gene signaturemore » in cultured human adipocytes. X-ray cocrystallography studies demonstrated that, unlike rosiglitazone, SPPAR{gamma}M2 did not interact with the Tyr473 residue located within helix 12 of the ligand binding domain (LBD). Instead, SPPAR{gamma}M2 was found to bind to and activate human PPAR{gamma} in which the Tyr473 residue had been mutated to alanine (hPPAR{gamma}Y473A), with potencies similar to those observed with the wild-type receptor (hPPAR{gamma}WT). In additional studies, we found that the intrinsic binding and functional potencies of structurally distinct SPPAR{gamma}Ms were not diminished by the Y473A mutation, whereas those of various thiazolidinedione (TZD) and non-TZD PPAR{gamma} full agonists were reduced in a correlative manner. These results directly demonstrate the important role of Tyr473 in mediating the interaction of full agonists but not SPPAR{gamma}Ms with the PPAR{gamma} LBD, thereby providing a precise molecular determinant for their differing pharmacologies.« less

Complementary and alternative medicine for multiple sclerosis.

PubMed

Schwarz, S; Knorr, C; Geiger, H; Flachenecker, P

2008-09-01

We analyzed characteristics, motivation, and effectiveness of complementary and alternative medicine in a large sample of people with multiple sclerosis. A 53-item survey was mailed to the members of the German Multiple Sclerosis Society, chapter of Baden-Wuerttemberg. Surveys of 1573 patients (48.5 +/- 11.7 years, 74% women, duration of illness 18.1 +/- 10.5 years) were analyzed. In comparison with conventional medicine, more patients displayed a positive attitude toward complementary and alternative medicine (44% vs 38%, P < 0.05), with 70% reporting lifetime use of at least one method. Among a wide variety of complementary and alternative medicine, diet modification (41%), Omega-3 fatty acids (37%), removal of amalgam fillings (28%), vitamins E (28%), B (36%), and C (28%), homeopathy (26%), and selenium (24%) were cited most frequently. Most respondents (69%) were satisfied with the effects of complementary and alternative medicine. Use of complementary and alternative medicine was associated with religiosity, functional independence, female sex, white-collar job, and higher education (P < 0.05). Compared with conventional therapies, complementary and alternative medicine rarely showed unwanted side effects (9% vs 59%, P < 0.00001). A total of 52% stated that the initial consultation with their physician lasted less than 15 min. To conclude, main reasons for the use of complementary and alternative medicine include the high rate of side effects and low levels of satisfaction with conventional treatments and brief patients/physicians contacts.

Use of complementary and alternative medicine by patients with lysosomal storage diseases.

PubMed

Balwani, Manisha; Fuerstman, Laura; Desnick, Robert J; Buckley, Brian; McGovern, Margaret M

2009-10-01

To evaluate the extent of complementary and alternative medicine use and perceived effectiveness in patients with lysosomal storage diseases. A 26-item survey was distributed to 495 patients with type 1 Gaucher, Fabry, and type B Niemann-Pick diseases who were seen at the Lysosomal Storage Disease Program at the Mount Sinai School of Medicine. Survey responses were entered into an access database and analyzed using descriptive statistics. Surveys were completed by 167 respondents with an overall response rate of 34%. Complementary and alternative medicines were used by 45% of patients with type 1 Gaucher disease, 41% of patients with Fabry disease, and 47% of patients with type B Niemann-Pick for symptoms related to their disease. Complementary and alternative medicines were used most frequently by adult females (55%), in patients who reported having one or more invasive procedures due to their disease, patients who use one or more conventional medical therapies, or those with depression and/or anxiety. Overall perceived effectiveness of complementary and alternative medicine supplements was low; however, complementary and alternative medicine therapies were perceived as effective. Complementary and alternative medicines are commonly used among patients with lysosomal storage diseases. Assessment of the effectiveness of these approaches in the lysosomal storage diseases is needed, and physicians should be aware of complementary and alternative medicine therapies used by patients to evaluate safety and possible drug interactions.

Growth kinetics of gamma-prime precipitates in a directionally solidified eutectic, gamma/gamma-prime-delta

NASA Technical Reports Server (NTRS)

Tewari, S. N.

1976-01-01

A directionally solidified eutectic alloy (DSEA), of those viewed as potential candidates for the next generation of aircraft gas turbine blade materials, is studied for the gamma-prime growth kinetics, in the system Ni-Nb-Cr-Al, specifically: Ni-20 w/o Nb-6 w/o Cr-2.5 w/o Al gamma/gamma-prime-delta DSEA. Heat treatment, polishing and etching, and preparation for electron micrography are described, and the size distribution of gamma-prime phase following various anneals is plotted, along with gamma-prime growth kinetics in this specific DSEA, and the cube of gamma-prime particle size vs anneal time. Activation energies and coarsening kinetics are studied.

Escherichia coli K-12 can utilize an exogenous gamma-glutamyl peptide as an amino acid source, for which gamma-glutamyltranspeptidase is essential.

PubMed

Suzuki, H; Hashimoto, W; Kumagai, H

1993-09-01

Escherichia coli K-12 can utilize a gamma-glutamyl peptide as an amino acid source, for which gamma-glutamyltranspeptidase (EC 2.3.2.2) is essential. We suggest that the gamma-glutamyl linkage of a gamma-glutamyl peptide is hydrolyzed by gamma-glutamyltranspeptidase located in the periplasmic space, and the released amino acid is taken up and utilized by E. coli.

US Spending On Complementary And Alternative Medicine During 2002–08 Plateaued, Suggesting Role In Reformed Health System

PubMed Central

Davis, Matthew A.; Martin, Brook I.; Coulter, Ian D.; Weeks, William B.

2013-01-01

Complementary and alternative medicine services in the United States are an approximately $9 billion market each year, equal to 3 percent of national ambulatory health care expenditures. Unlike conventional allopathic health care, complementary and alternative medicine is primarily paid for out of pocket, although some services are covered by most health insurance. Examining trends in demand for complementary and alternative medicine services in the United States reported in the Medical Expenditure Panel Survey during 2002–08, we found that use of and spending on these services, previously on the rise, have largely plateaued. The higher proportion of out-of-pocket responsibility for payment for services may explain the lack of growth. Our findings suggest that any attempt to reduce national health care spending by eliminating coverage for complementary and alternative medicine would have little impact at best. Should some forms of complementary and alternative medicine—for example, chiropractic care for back pain—be proven more efficient than allopathic and specialty medicine, the inclusion of complementary and alternative medicine providers in new delivery systems such as accountable care organizations could help slow growth in national health care spending. PMID:23297270

Complementary and alternative medicine in pregnancy: a survey of North Carolina certified nurse-midwives.

PubMed

Allaire, A D; Moos, M K; Wells, S R

2000-01-01

To determine the prevalence and types of complementary and alternative medicine therapies used by certified nurse-midwives in North Carolina. Surveys were sent to all 120 licensed certified nurse-midwives in North Carolina requesting information concerning their recommendations for use of complementary and alternative medicine for their pregnant or postpartum patients. Eighty-two responses were received (68.3%). Seventy-seven (93.9%) reported recommending complementary and alternative medicine to their pregnant patients in the past year. Forty-seven (57.3%) reported recommending complementary and alternative medicine to more than 10% of patients. The percentage of nurse-midwives who recommended each type of complementary and alternative medicine was as follows: herbal therapy (73.2%), massage therapy (67.1%), chiropractic (57.3%), acupressure (52.4%), mind-body interventions (48.8%), aromatherapy (32.9%), homeopathy (30.5%), spiritual healing (23.2%), acupuncture (19.5%), and bioelectric or magnetic applications (14.6%). The 60 respondents who reported prescribing herbal therapies gave them for the following indications: nausea and vomiting, labor stimulation, perineal discomfort, lactation disorders, postpartum depression, preterm labor, postpartum hemorrhage, labor analgesia, and malpresentation. Complementary and alternative medicine, especially herbal therapy, is commonly prescribed to pregnant women by nurse-midwives in North Carolina.

Evaluation of directionally solidified eutectic superalloys for turbine blade applications

NASA Technical Reports Server (NTRS)

Henry, M. E.; Jackson, M. R.; Walter, J. L.

1978-01-01

Alloys from the following systems were selected for property evaluation: (1) gamma/gamma-Mo (Ni-base, rods of Mo); (2) gamma-beta (Ni-base, lamellae or rods of (Ni, Fe/Co Al); and (3) gamma-gamma (Ni-base rods of Ni3Al gamma). The three alloys were subjected to longitudinal and transverse tensile and rupture tests from 750 C to 1100 C, longitudinal shear strength was measured at several temperatures, resistance to thermal cycling to 1150 C was determined, cyclic oxidation resistance was evaluated at 750 C and 1100 C, and each system was directionally solidified in an alumina shell mold turbine shape to evaluate mold/metal reactivity. The gamma/gamma Mo system has good rupture resistance, transverse properties and processability, and is a high potential system for turbine blades. The gamma-beta system has good physical properties and oxidation resistance, and is a potential system for turbine vanes. The gamma-gamma system has good high temperature rupture resistance and requires further exploratory research.

Very high-energy gamma rays from gamma-ray bursts.

PubMed

Chadwick, Paula M

2007-05-15

Very high-energy (VHE) gamma-ray astronomy has undergone a transformation in the last few years, with telescopes of unprecedented sensitivity having greatly expanded the source catalogue. Such progress makes the detection of a gamma-ray burst at the highest energies much more likely than previously. This paper describes the facilities currently operating and their chances for detecting gamma-ray bursts, and reviews predictions for VHE gamma-ray emission from gamma-ray bursts. Results to date are summarized.

Interferon-gamma promotes the survival and Fc epsilon RI-mediated histamine release in cultured human mast cells.

PubMed Central

Yanagida, M; Fukamachi, H; Takei, M; Hagiwara, T; Uzumaki, H; Tokiwa, T; Saito, H; Iikura, Y; Nakahata, T

1996-01-01

We examined the effects of interferon-gamma (IFN-gamma) on 100% pure human mast cells generated in suspension cultures of umbilical cord blood mononuclear cells in the presence of stem cell factor (SCF) and interleukin-6 (IL-6). When mast cells were suspended in serum-free medium without any cytokine after the withdrawal of SCF and IL-6, they died over a period of 5 days because of apoptosis. IFN-gamma in the cultures suppressed apoptosis and prolonged their survival in a dose-dependent manner. This survival-promoting effect of IFN-gamma was blocked by neutralizing antibodies to IFN-gamma or to IFN-gamma receptor (IFN-gamma R). When mast cells were incubated with IFN-gamma in serum-free medium for more than 4 hr during sensitization, immunoglobulin E (IgE)/anti-IgE antibody-induced histamine release was effectively enhanced. Polymerase chain reaction (PCR) amplification of the alpha-chain of IFN-gamma R (IFN-gamma R alpha) yielded products of the correct size predicted from the sequence of the receptor. In addition, flow cytometry using anti-IFN-gamma R monoclonal antibodies (mAbs) indicated that these mast cells bear IFN-gamma R on their surface. These findings suggested that IFN-gamma activates human mast cells via specific receptors in certain aspects of inflammatory reactions. Images Figure 2 Figure 4 PMID:9014819

7 CFR 3405.8 - Complementary project proposals.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 15 2014-01-01 2014-01-01 false Complementary project proposals. 3405.8 Section 3405.8 Agriculture Regulations of the Department of Agriculture (Continued) NATIONAL INSTITUTE OF FOOD AND AGRICULTURE HIGHER EDUCATION CHALLENGE GRANTS PROGRAM Program Description § 3405.8 Complementary...

7 CFR 3405.8 - Complementary project proposals.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 15 2013-01-01 2013-01-01 false Complementary project proposals. 3405.8 Section 3405.8 Agriculture Regulations of the Department of Agriculture (Continued) NATIONAL INSTITUTE OF FOOD AND AGRICULTURE HIGHER EDUCATION CHALLENGE GRANTS PROGRAM Program Description § 3405.8 Complementary...

7 CFR 3405.8 - Complementary project proposals.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 15 2012-01-01 2012-01-01 false Complementary project proposals. 3405.8 Section 3405.8 Agriculture Regulations of the Department of Agriculture (Continued) NATIONAL INSTITUTE OF FOOD AND AGRICULTURE HIGHER EDUCATION CHALLENGE GRANTS PROGRAM Program Description § 3405.8 Complementary...

7 CFR 3405.8 - Complementary project proposals.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 15 2011-01-01 2011-01-01 false Complementary project proposals. 3405.8 Section 3405.8 Agriculture Regulations of the Department of Agriculture (Continued) NATIONAL INSTITUTE OF FOOD AND AGRICULTURE HIGHER EDUCATION CHALLENGE GRANTS PROGRAM Program Description § 3405.8 Complementary...

Realization of a complementary medium using dielectric photonic crystals.

PubMed

Xu, Tao; Fang, Anan; Jia, Ziyuan; Ji, Liyu; Hang, Zhi Hong

2017-12-01

By exploiting the scaling invariance of photonic band diagrams, a complementary photonic crystal slab structure is realized by stacking two uniformly scaled double-zero-index dielectric photonic crystal slabs together. The space cancellation effect in complementary photonic crystals is demonstrated in both numerical simulations and microwave experiments. The refractive index dispersion of double-zero-index dielectric photonic crystal is experimentally measured. Using pure dielectrics, our photonic crystal structure will be an ideal platform to explore various intriguing properties related to a complementary medium.

Orthogonal Polynomials Associated with Complementary Chain Sequences

NASA Astrophysics Data System (ADS)

Behera, Kiran Kumar; Sri Ranga, A.; Swaminathan, A.

2016-07-01

Using the minimal parameter sequence of a given chain sequence, we introduce the concept of complementary chain sequences, which we view as perturbations of chain sequences. Using the relation between these complementary chain sequences and the corresponding Verblunsky coefficients, the para-orthogonal polynomials and the associated Szegő polynomials are analyzed. Two illustrations, one involving Gaussian hypergeometric functions and the other involving Carathéodory functions are also provided. A connection between these two illustrations by means of complementary chain sequences is also observed.

The 3C 279 Campaign of Winter 1999: A Gamma-Optical Correlation?

NASA Technical Reports Server (NTRS)

Hartman, R. C.; Villata, M.; Raiteri, C. M.; Sobrito, M.; DeFrancesco, G.; Ostorero, L.; Tosti, G.; Kurtanidze, O.; Nikolashvili, M.; Takalo, L.

2000-01-01

Preliminary results are presented from the gamma-optical campaign of January-February 1999 on 3C 279. During this period we obtained good optical sampling of the source, the best ever for a gamma-bright OVV quasar. Its large and fast variations have been compared with the gamma-ray fluxes obtained simultaneously by Energy Gamma Ray Experiment Telescope (EGRET), on Compton Gamma Ray Observatory (CGRO). Despite rather poor counting statistics in the gamma-ray data, a fair correlation is found, with the gamma variations following those in the optical by 3-4 days. This is the first time such a significant day-scale correlation has been observed between the optical and gamma emissions from a OVV quasar. Its implications are currently under study.

The relation of Complementary-Alternative Medicine use with glomerular filtration rate and depression in patients with chronic kidney disease at predialysis stage.

PubMed

Esen, Bennur; Atay, Ahmet Engin; Gokmen, Emel Saglam; Karakoc, Ayten; Sari, Hakan; Sarisakal, Samprie; Kahvecioglu, Serdar; Kayabasi, Hasan; Sit, Dede

2015-05-08

Complementary and alternative medicine is a broad field of health including all health care practices and methods; and their accompanying theories and beliefs. In the present study, we aimed to examine the frequency of complementary-alternative medicine use, and its relation with glomerular filtration rate and depression in patients with chronic kidney disease at predialysis stage. A total of 1053 predialysis patients; 518 female and 535 male, that were followed up with chronic kidney disease for at least 3 months were enrolled into the study. Demographic features, biochemical parameters and findings of physical examination were recorded. Their compliance to diet, and knowledge about disease were questioned. Beck depression inventory and questionnaire regarding to complementary-alternative medicine use were performed. The overall frequency of complementary-alternative medicine use was 40.3% . Total ratio of herbal products was 46%. Complementary-alternative medicine use was significantly more frequent in female or single patients, and patients that informed about chronic kidney disease or under strict diet (p:0.007, p:0.016, p:0.02, p:0.016; respectively). When glomerular filtration rate of participants were considered, complementary-alternative medicine use was similar in different stages of kidney disease. Depression was observed in 41.9% of patients and significantly frequent in patients with alternative method use (p:0.002). Depression score was higher as creatinine increases and glomerular filtration rate decreases (p:0.002; r: 0,093). We determined that complementary-alternative medicine use gradually increases at predialysis stage as glomerular filtration rate decreases and there is a strict relation between complementary-alternative medicine use and depression or female gender. Disorder related stressors may lead to seeking of alternative methods. This article is protected by copyright. All rights reserved.

[Standards, options, and recommendations for initial management of patients with malignant ovarian epithelial tumors].

PubMed

Kerbrat, P; Lhommé, C; Fervers, B; Guastalla, J P; Thomas, L; Basuyau, J P; Duvillard, P; Cohen-Solal, C; Dauplat, J; Tournemaine, N

2000-12-09

Suprapubic and transvaginal pelvic ultrasound exploration is indicated for suspected ovarian tumor (standard). Diagnosis and search for extension require surgery and pathology examination. Systematic preoperative computed tomography is not recommended (standard). Surgery for cancer of the ovary is a specialized procedure requiring skill in cancer, gynecology, visceral surgery and laparoscopic surgery. If the patient is referred to a specialized center after a primary procedure considered to be inadequate, a new procedure is recommended for staging. Residual tumor volume after the primary procedure has prognostic value. Systematic second look procedures are not recommended for routine practice (standard). For patients with grade IA G1 tumors, there is no indication for complementary treatment (standard). For patients with grade IA G2-3 or clear cell tumors, IB, IC, IIA, there is no standard. no complementary treatment, complementary chemotherapy using platinum, complementary external abdominopelvic radiotherapy. A complementary treatment is recommended for grades IC and IIA. Complementary treatment for grades IIB (no residual tissue), IIC (with residual tissue), III (no residual tissue), is based on: complementary chemotherapy with platinium, complementary external abdominopelvic radiotherapy (options). Complementary treatment for advanced forms (IIB (with residual tissue), IIC (with residual tissue), III (with residual tissue) and IV) is based on polychemotherapy with platinium (standard). platinium combined with paclitaxel (intravenous), platinium combined with cyclophosphamide and/or doxorubicin (intravenous) or intraperitoneal cisplatin combined with cyclophosphamide (intravenous). The chemotherapy work-up includes physical examination, assay of serum markers (particularly CA125) and abdominopelvic computed tomography (proof level B) (standard). Physical examination is recommended for monitoring patients in complete remission with no sign of suspected recurrence (standard). This document was reviewed in April 1977. The working group again validated the Standards, OPTIONS and Recommendations, without modifications in June 1999.

The peroxisome proliferator-activated receptor beta/delta agonist, GW501516, regulates the expression of genes involved in lipid catabolism and energy uncoupling in skeletal muscle cells.

PubMed

Dressel, Uwe; Allen, Tamara L; Pippal, Jyotsna B; Rohde, Paul R; Lau, Patrick; Muscat, George E O

2003-12-01

Lipid homeostasis is controlled by the peroxisome proliferator-activated receptors (PPARalpha, -beta/delta, and -gamma) that function as fatty acid-dependent DNA-binding proteins that regulate lipid metabolism. In vitro and in vivo genetic and pharmacological studies have demonstrated PPARalpha regulates lipid catabolism. In contrast, PPARgamma regulates the conflicting process of lipid storage. However, relatively little is known about PPARbeta/delta in the context of target tissues, target genes, lipid homeostasis, and functional overlap with PPARalpha and -gamma. PPARbeta/delta, a very low-density lipoprotein sensor, is abundantly expressed in skeletal muscle, a major mass peripheral tissue that accounts for approximately 40% of total body weight. Skeletal muscle is a metabolically active tissue, and a primary site of glucose metabolism, fatty acid oxidation, and cholesterol efflux. Consequently, it has a significant role in insulin sensitivity, the blood-lipid profile, and lipid homeostasis. Surprisingly, the role of PPARbeta/delta in skeletal muscle has not been investigated. We utilize selective PPARalpha, -beta/delta, -gamma, and liver X receptor agonists in skeletal muscle cells to understand the functional role of PPARbeta/delta, and the complementary and/or contrasting roles of PPARs in this major mass peripheral tissue. Activation of PPARbeta/delta by GW501516 in skeletal muscle cells induces the expression of genes involved in preferential lipid utilization, beta-oxidation, cholesterol efflux, and energy uncoupling. Furthermore, we show that treatment of muscle cells with GW501516 increases apolipoprotein-A1 specific efflux of intracellular cholesterol, thus identifying this tissue as an important target of PPARbeta/delta agonists. Interestingly, fenofibrate induces genes involved in fructose uptake, and glycogen formation. In contrast, rosiglitazone-mediated activation of PPARgamma induces gene expression associated with glucose uptake, fatty acid synthesis, and lipid storage. Furthermore, we show that the PPAR-dependent reporter in the muscle carnitine palmitoyl-transferase-1 promoter is directly regulated by PPARbeta/delta, and not PPARalpha in skeletal muscle cells in a PPARgamma coactivator-1-dependent manner. This study demonstrates that PPARs have distinct roles in skeletal muscle cells with respect to the regulation of lipid, carbohydrate, and energy homeostasis. Moreover, we surmise that PPARbeta/delta agonists would increase fatty acid catabolism, cholesterol efflux, and energy expenditure in muscle, and speculate selective activators of PPARbeta/delta may have therapeutic utility in the treatment of hyperlipidemia, atherosclerosis, and obesity.

Compositional Effects on Nickel-Base Superalloy Single Crystal Microstructures

NASA Technical Reports Server (NTRS)

MacKay, Rebecca A.; Gabb, Timothy P.; Garg,Anita; Rogers, Richard B.; Nathal, Michael V.

2012-01-01

Fourteen nickel-base superalloy single crystals containing 0 to 5 wt% chromium (Cr), 0 to 11 wt% cobalt (Co), 6 to 12 wt% molybdenum (Mo), 0 to 4 wt% rhenium (Re), and fixed amounts of aluminum (Al) and tantalum (Ta) were examined to determine the effect of bulk composition on basic microstructural parameters, including gamma' solvus, gamma' volume fraction, volume fraction of topologically close-packed (TCP) phases, phase chemistries, and gamma - gamma'. lattice mismatch. Regression models were developed to describe the influence of bulk alloy composition on the microstructural parameters and were compared to predictions by a commercially available software tool that used computational thermodynamics. Co produced the largest change in gamma' solvus over the wide compositional range used in this study, and Mo produced the largest effect on the gamma lattice parameter and the gamma - gamma' lattice mismatch over its compositional range, although Re had a very potent influence on all microstructural parameters investigated. Changing the Cr, Co, Mo, and Re contents in the bulk alloy had a significant impact on their concentrations in the gamma matrix and, to a smaller extent, in the gamma' phase. The gamma phase chemistries exhibited strong temperature dependencies that were influenced by the gamma and gamma' volume fractions. A computational thermodynamic modeling tool significantly underpredicted gamma' solvus temperatures and grossly overpredicted the amount of TCP phase at 982 C. Furthermore, the predictions by the software tool for the gamma - gamma' lattice mismatch were typically of the wrong sign and magnitude, but predictions could be improved if TCP formation was suspended within the software program. However, the statistical regression models provided excellent estimations of the microstructural parameters based on bulk alloy composition, thereby demonstrating their usefulness.

Phospholipase C-gamma 1 binding to intracellular receptors for activated protein kinase C.

PubMed

Disatnik, M H; Hernandez-Sotomayor, S M; Jones, G; Carpenter, G; Mochly-Rosen, D

1994-01-18

Phospholipase C-gamma 1 (PLC-gamma 1; EC 3.1.4.11) hydrolyzes phosphatidylinositol 4,5-bisphosphate to generate diacylglycerol and inositol 1,4,5-trisphosphate and is activated in response to growth factor stimulation and tyrosine phosphorylation. Concomitantly, the enzyme translocates from the cytosol to the particulate cell fraction. A similar process of activation-induced translocation from the cytosol to the cell particulate fraction has also been described for protein kinase C (PKC). We have previously shown that activated PKC binds to specific receptor proteins, receptors for activated C kinase, or RACKs, of approximately 30 kDa. Here, we show that PLC-gamma 1 bound to these RACKs and inhibited subsequent PKC binding to RACKs. However, unlike PKC, the binding of PLC-gamma 1 to RACKs did not require phospholipids and calcium. After epidermal growth factor treatment of intact A-431 cells, the binding of PLC-gamma 1 to RACKs increased as compared with PLC-gamma 1 from control cells. This increase in PLC-gamma 1 binding to RACKs was due to the phosphorylation of PLC-gamma 1. Additional data indicated that PLC-gamma 1 binds to RACKs in solution; epidermal growth factor receptor-dependent PLC-gamma 1 phosphorylation and activation decreased in the presence of RACKs. It is possible that, in vivo, PLC-gamma 1 associates with RACKs or with other PLC-gamma 1-specific anchoring proteins in the particulate cell fraction. Since a PKC C2 homologous region is present in PLC-gamma 1, the C2 region may mediate the activation-induced translocation of the enzyme to the cell particulate fraction and the anchoring protein-PLC-gamma 1 complex may be the active translocated form of PLC-gamma 1.

Production and characterization of guinea pig recombinant gamma interferon and its effect on macrophage activation.

PubMed

Jeevan, A; McFarland, C T; Yoshimura, T; Skwor, T; Cho, H; Lasco, T; McMurray, D N

2006-01-01

Gamma interferon (IFN-gamma) plays a critical role in the protective immune responses against mycobacteria. We previously cloned a cDNA coding for guinea pig IFN-gamma (gpIFN-gamma) and reported that BCG vaccination induced a significant increase in the IFN-gamma mRNA expression in guinea pig cells in response to living mycobacteria and that the virulent H37Rv strain of Mycobacterium tuberculosis stimulated less IFN-gamma mRNA than did the attenuated H37Ra strain. In this study, we successfully expressed and characterized recombinant gpIFN-gamma with a histidine tag at the N terminus (His-tagged rgpIFN-gamma) in Escherichia coli. rgpIFN-gamma was identified as an 18-kDa band in the insoluble fraction; therefore, the protein was purified under denaturing conditions and renatured. N-terminal amino acid sequencing of the recombinant protein yielded the sequence corresponding to the N terminus of His-tagged gpIFN-gamma. The recombinant protein upregulated major histocompatibility complex class II expression in peritoneal macrophages. The antiviral activity of rgpIFN-gamma was demonstrated with a guinea pig fibroblast cell line (104C1) infected with encephalomyocarditis virus. Interestingly, peritoneal macrophages treated with rgpIFN-gamma did not produce any nitric oxide but did produce hydrogen peroxide and suppressed the intracellular growth of mycobacteria. Furthermore, rgpIFN-gamma induced morphological alterations in cultured macrophages. Thus, biologically active rgpIFN-gamma has been successfully produced and characterized in our laboratory. The study of rgpIFN-gamma will further increase our understanding of the cellular and molecular responses induced by BCG vaccination in the guinea pig model of pulmonary tuberculosis.

Peroxisome proliferator-activated receptor gamma overexpression suppresses proliferation of human colon cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsukahara, Tamotsu, E-mail: ttamotsu@shinshu-u.ac.jp; Haniu, Hisao

2012-08-03

Highlights: Black-Right-Pointing-Pointer We examined the correlation between PPAR{gamma} expression and cell proliferation. Black-Right-Pointing-Pointer PPAR{gamma} overexpression reduces cell viability. Black-Right-Pointing-Pointer We show the synergistic effect of cell growth inhibition by a PPAR{gamma} agonist. -- Abstract: Peroxisome proliferator-activated receptor gamma (PPAR{gamma}) plays an important role in the differentiation of intestinal cells and tissues. Our previous reports indicate that PPAR{gamma} is expressed at considerable levels in human colon cancer cells. This suggests that PPAR{gamma} expression may be an important factor for cell growth regulation in colon cancer. In this study, we investigated PPAR{gamma} expression in 4 human colon cancer cell lines, HT-29, LOVO,more » DLD-1, and Caco-2. Real-time polymerase chain reaction (PCR) and Western blot analysis revealed that the relative levels of PPAR{gamma} mRNA and protein in these cells were in the order HT-29 > LOVO > Caco-2 > DLD-1. We also found that PPAR{gamma} overexpression promoted cell growth inhibition in PPAR{gamma} lower-expressing cell lines (Caco-2 and DLD-1), but not in higher-expressing cells (HT-29 and LOVO). We observed a correlation between the level of PPAR{gamma} expression and the cells' sensitivity for proliferation.« less

The initiation of complementary feeding among Qom indigenous people.

PubMed

Olmedo, Sofia Irene; Valeggia, Claudia

2014-06-01

As of six months of life, breastfeeding no longer covers an infant's energy or micronutrient needs, so appropriate complementary feeding should be provided. The objective of this study was to assess the time and adequacy for introducing complementary feeding in a Qom/Toba population and analyze the sociocultural concepts of families regarding complementary feeding. Quantitative and qualitative data were collected by participant observation and semistructured surveys administered to mothers of 0-2 year old infants. Qom breastfeed their infants long term and on demand. Most infants have an adequate nutritional status and start complementary feeding at around 6 months old as per the local health center and international standards. However, mostly due to socioeconomic factors, foods chosen to complement breastfeeding have a relatively scarce nutritional value.

Complementary therapies for depression: an overview.

PubMed

Ernst, E; Rand, J I; Stevinson, C

1998-11-01

Depression is one of the most common reasons for using complementary and alternative therapies. The aim of this article is to provide an overview of the evidence available on the treatment of depression with complementary therapies. Systematic literature searches were performed using several databases, reference list searching, and inquiry to colleagues. Data extraction followed a predefined protocol. The amount of rigorous scientific data to support the efficacy of complementary therapies in the treatment of depression is extremely limited. The areas with the most evidence for beneficial effects are exercise, herbal therapy (Hypericum perforatum), and, to a lesser extent, acupuncture and relaxation therapies. There is a need for further research involving randomized controlled trials into the efficacy of complementary and alternative therapies in the treatment of depression.

Gamma-ray Output Spectra from 239 Pu Fission

DOE PAGES

Ullmann, John

2015-05-25

The gamma-ray multiplicities, individual gamma-ray energy spectra, and total gamma energy spectra following neutron-induced fission of 239Pu were measured using the DANCE detector at Los Alamos. Corrections for detector response were made using a forward-modeling technique based on propagating sets of gamma rays generated from a paramaterized model through a GEANT model of the DANCE array and adjusting the parameters for best fit to the measured spectra. The results for the gamma-ray spectrum and multiplicity are in general agreement with previous results, but the measured total gamma-ray energy is about 10% higher. We found that a dependence of the gamma-raymore » spectrum on the gamma-ray multplicity was also observed. Finally, global model calculations of the multiplicity and gamma energy distributions are in good agreement with the data, but predict a slightly softer total-energy distribution.« less

The development of gamma-gamma-prime lamellar structures in a nickel-base superalloy during elevated temperature mechanical testing

NASA Technical Reports Server (NTRS)

Mackay, R. A.; Ebert, L. J.

1985-01-01

The kinetics of the formation and subsequent development of the directional coarsening of the gamma-prime precipitate in model Ni-Al-Mo-Ta superalloy single crystals are examined during tensile creep under various stress levels at 982 and 1038 C. Special attention is given to the gamma and gamma-prime relation to creep time and strain in order to trace the changing gamma-gamma-prime morphology. Directional coarsening of gamma-prime is found to begin during primary creep and its rate is shown to increase with an increase in temperature or stress level. The length of gamma-prime thickness increased linearly with time up to a plateau reached after the onset of steady state creep. The raft thickness, equal to the gamma-prime size, remained constant at this initial value up through the onset of the tertiary creep. The interlaminar spacing indicates the stability of directionally coarsened structure.

Using Complementary Learning Clusters in Studying Literature to Enhance Students' Medical Humanities Literacy, Critical Thinking, and English Proficiency.

PubMed

Liao, Hung-Chang; Wang, Ya-Huei

2016-04-01

This study examined whether students studying literature in complementary learning clusters would show more improvement in medical humanities literacy, critical thinking skills, and English proficiency compared to those in conventional learning clusters. Ninety-three students participated in the study (M age = 18.2 years, SD = 0.4; 36 men, 57 women). A quasi-experimental design was used over 16 weeks, with the control group (n = 47) working in conventional learning clusters and the experimental group (n = 46) working in complementary learning clusters. Complementary learning clusters were those in which individuals had complementary strengths enabling them to learn from and offer assistance to other cluster members, hypothetically facilitating the learning process. Measures included the Medical Humanities Literacy Scale, Critical Thinking Disposition Assessment, English proficiency tests, and Analytic Critical Thinking Scoring Rubric. The results showed that complementary learning clusters have the potential to improve students' medical humanities literacy, critical thinking skills, and English proficiency. © The Author(s) 2016.

Complementary and alternative medicine usage and its determinant factors among Iranian infertile couples.

PubMed

Dehghan, Mahlagha; Mokhtarabadi, Sima; Heidari, Fatemeh Ghaedi

2018-04-04

Background The aim of this study was to determine the status of utilizing some complementary and alternative medicine techniques in infertile couples. Methods This was a cross-sectional study conducted on 250 infertile couples referred to a hospital in Kerman using convenience sampling. A researcher-made questionnaire was used to study the prevalence and user satisfaction of complementary and alternative medicines. Results Results indicated that 49.6% of the infertile couples used at least one of the complementary and alternative medicines during the past year. Most individuals used spiritual techniques (71.8% used praying and 70.2% used Nazr) and medicinal plants (54.8%). Safety is the most important factor affecting the satisfaction of infertile couples with complementary treatments (couples think that such treatments are safe (54.8%)). Discussion Concerning high prevalence of complementary and alternative treatments in infertile couples, incorporating such treatments into the healthcare education and promoting the awareness of infertile individuals seem crucial.

Electrochemical product detection of an asymmetric convective polymerase chain reaction.

PubMed

Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

2009-10-15

For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

Basics of Gamma Ray Detection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stinnett, Jacob; Venkataraman, Ram

The objective of this training is to explain the origin of x-rays and gamma rays, gamma ray interactions with matter, detectors and electronics used in gamma ray-spectrometry, and features of a gamma-ray spectrum for nuclear material that is safeguarded.

Recent results from TRISTAN

DOE Office of Scientific and Technical Information (OSTI.GOV)

Enomoto, Ryoji

1997-01-01

TRISTAN results on {gamma}{gamma} physics from 1994 to 1995 are reviewed in this report. We have systematically investigated jet production, the {gamma}-structure function, and charm pair production in {gamma}{gamma} processes. The results are discussed, and future prospects are presented.

Kinematics of the Elastic Scattering of $gamma$ in Hydrogen (Compton Effecte Between 300 and 1500 Mev; CINEMATICA DELLA DIFFUSIONE ELASTICA DI $gamma$ IN IDROGENO (EFFETTO COMPTON) TRA 300 E 1500 MEV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salvadori, P.

1962-10-31

The proton (p ) and gamma energy and angular distributions from the elastic (Compton) interaction p + gamma -- p + gamma are calculated. The results are tabulated for 25-Mev gamma increments, from 300 to 1500 Mev. (T.F.H.)

Reaction process of {alpha} {yields} {gamma} massive transformation in Ti-rich TiAl alloy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumagai, T.; Abe, E.; Nakamura, M.

1995-08-01

Reaction sequence of the massive transformation from the high-temperature {alpha}-Ti phase to the {gamma}-TiAl phase ({gamma}{sub m}) in a Ti-48at.% Al alloy has been examined in terms of optical and transmission electron microscopes. Both transformed and untransformed regions were macroscopically observed in the sample quenched from the high-temperature {alpha} phase field, when the sample was held there for a extended period of time prior to quenching. The transformed region consists of randomly oriented fine {gamma} single phase grains, in which many thermal anti-phase domains (TAPDs), together with a number of stacking faults were observed. In contrast, the untransformed region comprisesmore » extremely fine lamellae of the {gamma} and {alpha}{sub 2}-Ti{sub 3}Al phases, and the {gamma} plates were found to run through the TAPDs caused by {alpha} {yields} {alpha}{sub 2} ordering. Subsequent aging at 1,273 K causes the microstructure change in the untransformed region from {alpha}{sub 2}/{gamma} lamellae to {gamma}/{gamma} lamellae spontaneously and expands the {gamma}{sub m} region. These observations suggest that the {alpha} {yields} {gamma}{sub m} transformation proceeds through formation of fine {gamma} plates.« less

Integrating complementary medicine and health care services into practice.

PubMed Central

LaValley, J W; Verhoef, M J

1995-01-01

Complementary medicine and health care services constitute a significant proportion of the use of health care services in Canada, despite a history of limited acceptance of these therapies by the medical profession. However, physician attitudes appear to be changing. A survey of a random sample of general practitioners in Quebec (see page 29 of this issue) shows that four out of five general practitioners perceive at least one of three complementary health care services to be useful. Similar surveys of samples in Alberta and Ontario suggest that physicians there, although somewhat less enthusiastic than their counterparts in Quebec, have also begun to be more open-minded about these types of therapies. However, physicians have reported little understanding of complementary health care services, which suggests the need for more research on and education about these services. The Medical Society of Nova Scotia has responded to this need by establishing a Section of Complementary Medicine. The authors believe that fair, accountable, scientific and rigorous research on complementary therapies will benefit physicians and patients. The problems inherent in applying reductionist analysis to a holistic approach to care can be largely circumvented by focusing on outcomes research. In light of the popularity of these therapies, inquiry into patient use of complementary health care services should become a part of a complete patient history. This measure would promote greater patient-physician communication and integration of complementary health care services into patient care. PMID:7796375

Complementary and alternative medicine used by persons with functional gastrointestinal disorders to alleviate symptom distress.

PubMed

Stake-Nilsson, Kerstin; Hultcrantz, Rolf; Unge, Peter; Wengström, Yvonne

2012-03-01

The aim of this study was to describe the complementary and alternative medicine methods most commonly used to alleviate symptom distress in persons with functional gastrointestinal disorders. People with functional gastrointestinal disorders face many challenges in their everyday lives, and each individual has his/her own way of dealing with this illness. The experience of illness often leads persons with functional gastrointestinal disorders to complementary and alternative medicine as a viable healthcare choice. Quantitative and describing design. A study-specific complementary and alternative medicine questionnaire was used, including questions about complementary and alternative medicine methods used and the perceived effects of each method. Efficacy assessments for each method were preventive effect, partial symptom relief, total symptom relief or no effect. A total of 137 persons with functional gastrointestinal disorders answered the questionnaire, 62% (n = 85) women and 38% (n = 52) men. A total of 28 different complementary and alternative medicine methods were identified and grouped into four categories: nutritional, drug/biological, psychological activity and physical activity. All persons had tried at least one method, and most methods provided partial symptom relief. Persons with functional gastrointestinal disorders commonly use complementary and alternative medicine methods to alleviate symptoms. Nurses have a unique opportunity to expand their roles in this group of patients. Increased knowledge of complementary and alternative medicine practices would enable a more comprehensive patient assessment and a better plan for meaningful interventions that meet the needs of individual patients. © 2011 Blackwell Publishing Ltd.

Educational interventions for improving primary caregiver complementary feeding practices for children aged 24 months and under.

PubMed

Arikpo, Dachi; Edet, Ededet Sewanu; Chibuzor, Moriam T; Odey, Friday; Caldwell, Deborah M

2018-05-18

Although complementary feeding is a universal practice, the methods and manner in which it is practiced vary between cultures, individuals and socioeconomic classes. The period of complementary feeding is a critical time of transition in the life of an infant, and inappropriate complementary feeding practices, with their associated adverse health consequences, remain a significant global public health problem. Educational interventions are widely acknowledged as effective in promoting public health strategy, and those aimed at improving complementary feeding practices provide information about proper complementary feeding practices to caregivers of infants/children. It is therefore important to summarise evidence on the effectiveness of educational interventions to improve the complementary feeding practices of caregivers of infants. To assess the effectiveness of educational interventions for improving the complementary feeding (weaning) practices of primary caregivers of children of complementary feeding age, and related health and growth outcomes in infants. In November 2017, we searched CENTRAL, MEDLINE, Embase, 10 other databases and two trials registers. We also searched the reference lists of relevant studies and reviews to identify any additional studies. We did not limit the searches by date, language or publication status. Randomised controlled trials (RCTs), comparing educational interventions to no intervention, usual practice, or educational interventions provided in conjunction with another intervention, so long as the educational intervention was only available in the experimental group and the adjunctive intervention was available to the control group. Study participants included caregivers of infants aged 4 to 24 months undergoing complementary feeding. Pregnant women who were expected to give birth and commence complementary feeding during the period of the study were also included. Two review authors independently extracted data on participants, settings, interventions, methodology and outcomes using a specifically-developed and piloted data extraction form. We calculated risk ratios (RR) and 95% confidence intervals (CIs) for dichotomous data, and mean differences (MD) and 95% CIs for continuous data. Where data permitted, we conducted a meta-analysis using a random-effects model. We assessed the included studies for risk of bias and also assessed the quality of evidence using the GRADE approach. We included 23 studies (from 35 reports) with a total of 11,170 caregiver-infant pairs who were randomly assigned to receive an educational intervention delivered to the caregiver or usual care. Nineteen of the included studies were community-based studies while four were facility-based studies. In addition, 13 of the included studies were cluster-randomised while the others were individually randomised. Generally, the interventions were focused on the introduction of complementary feeding at the appropriate time, the types and amount of complementary foods to be fed to infants, and hygiene. Using the GRADE criteria, we assessed the quality of the evidence as moderate, mostly due to inadequate allocation concealment and insufficient blinding.Educational interventions led to improvements in complementary feeding practices for age at introduction of complementary foods (average RR 0.88, 95% CI 0.83 to 0.94; 4 studies, 1738 children; moderate-quality evidence) and hygiene practices (average RR 1.38, 95% CI 1.23 to 1.55; 4 studies, 2029 participants; moderate-quality evidence). For duration of exclusive breastfeeding, pooled results were compatible with both a reduction and an increase in the outcome (average RR 1.58, 95% CI 0.77 to 3.22; 3 studies, 1544 children; very low-quality evidence). There was limited (low to very low-quality) evidence of an effect for all growth outcomes.Quality of evidenceThere is moderate to very low-quality evidence that educational interventions can improve complementary feeding practices but insufficient evidence to conclude that it impacts growth outcomes. Overall, we found evidence that education improves complementary feeding practices.

The Gamma-ray Universe through Fermi

NASA Technical Reports Server (NTRS)

Thompson, David J.

2012-01-01

Gamma rays, the most powerful form of light, reveal extreme conditions in the Universe. The Fermi Gamma-ray Space Telescope and its smaller cousin AGILE have been exploring the gamma-ray sky for several years, enabling a search for powerful transients like gamma-ray bursts, novae, solar flares, and flaring active galactic nuclei, as well as long-term studies including pulsars, binary systems, supernova remnants, and searches for predicted sources of gamma rays such as dark matter annihilation. Some results include a stringent limit on Lorentz invariance derived from a gamma-ray burst, unexpected gamma-ray variability from the Crab Nebula, a huge ga.nuna-ray structure associated with the center of our galaxy, surprising behavior from some gamma-ray binary systems, and a possible constraint on some WIMP models for dark matter.

Regulation of PPAR{gamma} function by TNF-{alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ye Jianping

2008-09-26

The nuclear receptor PPAR{gamma} is a lipid sensor that regulates lipid metabolism through gene transcription. Inhibition of PPAR{gamma} activity by TNF-{alpha} is involved in pathogenesis of insulin resistance, atherosclerosis, inflammation, and cancer cachexia. PPAR{gamma} activity is regulated by TNF-{alpha} at pre-translational and post-translational levels. Activation of serine kinases including IKK, ERK, JNK, and p38 may be involved in the TNF-regulation of PPAR{gamma}. Of the four kinases, IKK is a dominant signaling molecule in the TNF-regulation of PPAR{gamma}. IKK acts through at least two mechanisms: inhibition of PPAR{gamma} expression and activation of PPAR{gamma} corepressor. In this review article, literature is reviewedmore » with a focus on the mechanisms of PPAR{gamma} inhibition by TNF-{alpha}.« less

Homeostasis of Complementary Pair Theory: Ecological Comparisons in Diverse Universal Design for Learning Environments

ERIC Educational Resources Information Center

Ianneo, Brittany

2014-01-01

Accommodation~assimilation relations were theorized by Kelso and Engstrom (2006) as independent and dependent complementary pairs. This study defined relationships between organisms that experienced complementary interactions of accommodation~assimilation in diverse ecologies designed with universal design for learning environments (UDLE) compared…

ICT, complementary investment, and firm performance in China

NASA Astrophysics Data System (ADS)

Sun, Linlin; Ding, Juan; Fan, Maoqing

2011-12-01

Using China firm data about ICT, we provide some insight into the link between ICT, productivity and complementary investment. The results show that the contribution of ICT capital deepening is raised when firms combine ICT use and some complementary investment (human capital, innovation and organization change).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prendez, M.; Ortiz, J.L.; Cortes, E.

In Chile, the State Public Health Office (Ministerio de Salud Publica) is responsible for pollution control and for air quality. This office has been monitoring only toxic gases and total suspended particulate matter. The present work is the first study in Chile designed to determine trace elements and their concentrations in particulate matter in the air. By use of enrichment factors, 25 trace elements were classified according to natural or anthropogenic origin. There were two sampling periods: July (winter) and September (spring) 1976. Four sites were studied, located about 6 km north, south, west and east of downtown Santiago. Themore » south, north and west sites are urban and 55 m above sea level. The east site is suburban and approximately 270 m higher than the others. Twenty-four-hour samples were collected on Whatman-41 cellulose filter paper, in a modified stainless steel Buchner funnel. Approximately 10 m/sup 3/ were used at the urban sites and 200 m/sup 3/ at the suburban site. Instrumental neutron activation analysis (INAA) was used as the analytical technique.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parrado, G., E-mail: gparrado@sgc.gov.co; Cañón, Y.; Peña, M., E-mail: mlpena@sgc.gov.co

The Neutron Activation Analysis (NAA) laboratory at the Colombian Geological Survey has developed a technique for multi-elemental analysis of soil and plant matrices, based on Instrumental Neutron Activation Analysis (INAA) using the comparator method. In order to evaluate the analytical capabilities of the technique, the laboratory has been participating in inter-comparison tests organized by Wepal (Wageningen Evaluating Programs for Analytical Laboratories). In this work, the experimental procedure and results for the multi-elemental analysis of four soil and four plant samples during participation in the first round on 2015 of Wepal proficiency test are presented. Only elements with radioactive isotopes withmore » medium and long half-lives have been evaluated, 15 elements for soils (As, Ce, Co, Cr, Cs, Fe, K, La, Na, Rb, Sb, Sc, Th, U and Zn) and 7 elements for plants (Br, Co, Cr, Fe, K, Na and Zn). The performance assessment by Wepal based on Z-score distributions showed that most results obtained |Z-scores| ≤ 3.« less

Applications of neutron activation analysis in determination of natural and man-made radionuclides, including PA-231

NASA Astrophysics Data System (ADS)

Byrne, A. R.; Benedik, L.

1999-01-01

Neutron activation analysis (NAA), being essentially an isotopic and not an elemental method of analysis, is capable of determining a number of important radionuclides of radioecological interest by transformation into another, more easily quantifiable radionuclide. The nuclear characteristics which favour this technique may be summarized in an advantage factor relative to radiometric analysis of the original radioanalyte. Well known or hardly known examples include235U,238U,232Th,230Th,129I,99Tc,237Np and231Pa; a number of these are discussed and illustrated in analysis of real samples of environmental and biological origin. In particular, determination of231Pa by RNAA was performed using both postirradiation and preseparation methods. Application of INAA to enable the use of238U and232Th as endogenous (internal) radiotracers in alpha spectrometric analyses of uranium and thorium radioisotopes in radioecological studies is described, also allowing independent data sets to be obtained for quality control.

In quest of lunar regolith breccias of exotic provenance - A uniquely anorthositic sample from the Fra Mauro (Apollo 14) highlands

NASA Technical Reports Server (NTRS)

Jerde, Eric A.; Warren, Paul H.; Morris, Richard V.

1990-01-01

Bulk compositions of 21 Apollo regolith breccias were determined using an INAA procedure modified from that of Kallemeyn et al. (1989). With one major exception, namely, the 14076,1 sample, the regolith breccias analyzed were found to be not significantly different from the surfaces from which they were collected. In contrast, the 14076,1 sample from the Fra Mauro (Apollo 14) region is a highly anorthositic regolith breccia from a site where anorthosites are extremely scarce. The sample's composition resembles soils from the Descartes (Apollo 16) highlands. However, the low statistical probability for long-distance horizontal transport by impact cratering, together with the relatively high contents of imcompatible elements in 14076,1 suggest that this regolith breccia originated within a few hundred kilometers of the Apollo 14 site. Its compositional resemblance to ferroan anorthosite strengthens the hypothesis that ferroan anorthosite originated as the flotation crust of a global magmasphere.

Basaltic volcanism on the eucrite parent body - Petrology and chemistry of the polymict eucrite ALHA80102

NASA Technical Reports Server (NTRS)

Treiman, A. H.; Drake, M. J.

1985-01-01

The polymict eucrite meteorite ALHA80102 is an unequilibrated breccia of basaltic and gabbroic clasts in a fragmental matrix. Clasts include basalts of many textural types, cumulate gabbro, black 'glass', and ferroan troctolite (plagioclase, silica, Fe-rich olivine, ilmenite, mesostasis). Ferroan troctolite has not been previously reported from eucrites or howardites; it is interpreted as the end-product of fractional crystallization of eucritic magmas. Bulk and trace element compositions (by electron microprobe and INAA) of clasts and matrix from ALHA80102 are similar to those of other eucrites; the meteorite contains clasts similar to Juvinas and to Stannern. A clast of cumulate eucrite gabbro is enriched in the light rare earths (La/Lu = 2XCI). This clast is interpreted as an unrepresentative sample of metamorphically equilibrated gabbro; LREE-enriched magmas need not be invoked. ALHA80102 is similar to other polymict eucrites from the Allan Hills and may be paired with ALHA76005, ALHA77302, and ALHA78040.

Preliminary study on the mode of occurrence of arsenic in high arsenic coals from southwest Guizhou Province

USGS Publications Warehouse

Ding, Z.; Zheng, B.; Zhang, Jiahua; Belkin, H.E.; Finkelman, R.B.; Zhao, F.; Zhou, D.; Zhou, Y.; Chen, C.

1999-01-01

Coal samples from high arsenic coal areas have been analyzed by electron microprobe analyzer (EMPA), scanning electron microscopy with an energy dispersive X-ray analyzer (SEM-EDX), X-ray diffraction analysis (XRD), low temperature ashing (LTA), transmission electron microscopy (TEM), X-ray absorption fine structure (XAFS), instrument neutron activation analysis (INAA) and wet chemical analysis. Although some As-bearing minerals such as pyrite, arsenopyrite, realgar (?), As-bearing sulfate, and As-bearing clays are found in the high arsenic coals, their contents do not account for the abundance of arsenic in the some coals. Analysis of the coal indicates that arsenic exists mainly in the form of As5+ and As3+, combined with compounds in the organic matrix. The occurrence of such exceptionally high arsenic contents in coal and the fact that the arsenic is dominantly organically associated are unique observations. The modes of occurrence of arsenic in high As-coals are discussed.

Chemical systematics of the Shergotty meteorite and the composition of its parent body (Mars)

NASA Technical Reports Server (NTRS)

Laul, J. C.; Smith, M. R.; Waenke, H.; Jagoutz, E.; Dreibus, G.

1986-01-01

Sixty elements in two bulk samples of Shergotty meteorite and 30 elements in various mineral separates of Shergotty were identified, using mainly INAA and RNAA techniques. In addition, elements leached out from powdered samples of Shergotty and EETA 79001 meteorites by 0.1 N HCl, as well as the elements of their residues, were analyzed. The results have indicated that Shergotty meteorite is homogeneous in its major element composition, but heterogeneous with respect to large-ion lithophile elements, such as K, Ba, Sr, Zr, Hf, Ta, Th, and rare-earth elements (REEs). It is even more heterogeneous with respect to volatile elements, such as Cd, Te, Tl, and Bi, and the siderophiles Au and Ag. The REE patterns of the Shergotty and EETA 79001 residues are identical, indicating that the parent magmas of both meteorites are compositionally similar. However, their leachate (phosphate) patterns are different, suggesting two components for the Shergotty, one of which is similar to the EETA 79001 leachate.

Characterization of Archaeological Sediments Using Fourier Transform Infrared (FT-IR) and Portable X-ray Fluorescence (pXRF): An Application to Formative Period Pyro-Industrial Sites in Pacific Coastal Southern Chiapas, Mexico.

PubMed

Neff, Hector; Bigney, Scott J; Sakai, Sachiko; Burger, Paul R; Garfin, Timothy; George, Richard G; Culleton, Brendan J; Kennett, Douglas J

2016-01-01

Archaeological sediments from mounds within the mangrove zone of far-southern Pacific coastal Chiapas, Mexico, are characterized in order to test the hypothesis that specialized pyro-technological activities of the region's prehistoric inhabitants (salt and ceramic production) created the accumulations visible today. Fourier transform infrared spectroscopy (FT-IR) is used to characterize sediment mineralogy, while portable X-ray fluorescence (pXRF) is used to determine elemental concentrations. Elemental characterization of natural sediments by both instrumental neutron activation analysis (INAA) and pXRF also contribute to understanding of processes that created the archaeological deposits. Radiocarbon dates combined with typological analysis of ceramics indicate that pyro-industrial activity in the mangrove zone peaked during the Late Formative and Terminal Formative periods, when population and monumental activity on the coastal plain and piedmont were also at their peaks. © The Author(s) 2015.

Geochemistry and genesis of the angrites

NASA Technical Reports Server (NTRS)

Mittlefehldt, David W.; Lindstrom, Marilyn M.

1990-01-01

The major and trace elements were analyzed in samples of LEW86010, LEW87051, and Angra dos Reis angrites were analyzed using INAA and fused-bead EMP techniques. Results suggest that all three angrites originated on a volatile-depleted (Na-poor) but oxidized parent body or on several bodies. The combination of low Na and high FeO/MnO found in these samples suggests that the extreme Na depletion was caused by parent-body outgassing during differentiation, rather than by nebular processes. It was also found that the refractory-element abundances observed in LEW86010 and LEW87051 are related via olivine control; it is suggested that LEW86010 may be a residual melt from a LEW87051-like precursor or that LEW87051 formed from a LEW86010-like precursor via olivine accumulation. On the other hand, the Angra dos Reis displayed an unusual refractory element pattern suggesting that either the angrite parent body was heterogeneous or that Angra dos Reis was formed on a parent body different from that of the other two angrites.

Single agglutinates: A comparative study of compositions of agglutinitic glass, whole-grain, bulk soil, and FMR

NASA Technical Reports Server (NTRS)

Basu, A.; Robinson, R.; Mckay, D. S.; Blanchard, D. P.; Morris, R. V.; Wentworth, Susan J.

1994-01-01

Previous workers on single agglutinates have variously interpreted the composition of agglutinitic glass to represent impact melts of (1) bulk soil, (2) mixed components in finer sizes, and (3) microtargets. Separately, Papike has argued in favor of fusion of the finest fraction of bulk soils. Thirty-four single agglutinates were hand-picked from the mature Apollo 16 soil 61181 (I(sub s)/FeO = 82) and the FMR and chemical composition (INAA for Fe, Sc, Sm, Co, Ni, and Cr) of each agglutinate particle were measured. Thirteen of these single agglutinates were selected for electron beam microanalysis and imaging. Less than 1 micron spots were analyzed (for Na, Mg, Al, Si, P, S, K, Ca, Ti, Cr, Mn, Fe, Ni, and Ba) on pure glassy areas (approximately ten in each particle) selected on the basis of optical and BSE images (avoiding all clasts and inclusions) with an electron microprobe to obtain average glass compositions of each single agglutinate.

Improvement of analytical capabilities of neutron activation analysis laboratory at the Colombian Geological Survey

NASA Astrophysics Data System (ADS)

Parrado, G.; Cañón, Y.; Peña, M.; Sierra, O.; Porras, A.; Alonso, D.; Herrera, D. C.; Orozco, J.

2016-07-01

The Neutron Activation Analysis (NAA) laboratory at the Colombian Geological Survey has developed a technique for multi-elemental analysis of soil and plant matrices, based on Instrumental Neutron Activation Analysis (INAA) using the comparator method. In order to evaluate the analytical capabilities of the technique, the laboratory has been participating in inter-comparison tests organized by Wepal (Wageningen Evaluating Programs for Analytical Laboratories). In this work, the experimental procedure and results for the multi-elemental analysis of four soil and four plant samples during participation in the first round on 2015 of Wepal proficiency test are presented. Only elements with radioactive isotopes with medium and long half-lives have been evaluated, 15 elements for soils (As, Ce, Co, Cr, Cs, Fe, K, La, Na, Rb, Sb, Sc, Th, U and Zn) and 7 elements for plants (Br, Co, Cr, Fe, K, Na and Zn). The performance assessment by Wepal based on Z-score distributions showed that most results obtained |Z-scores| ≤ 3.

Applications of nuclear analytical techniques to environmental studies

NASA Astrophysics Data System (ADS)

Freitas, M. C.; Pacheco, A. M. G.; Marques, A. P.; Barros, L. I. C.; Reis, M. A.

2001-07-01

A few examples of application of nuclear-analytical techniques to biological monitors—natives and transplants—are given herein. Parmelia sulcata Taylor transplants were set up in a heavily industrialized area of Portugal—the Setúbal peninsula, about 50 km south of Lisbon—where indigenous lichens are rare. The whole area was 10×15 km around an oil-fired power station, and a 2.5×2.5 km grid was used. In north-western Portugal, native thalli of the same epiphytes (Parmelia spp., mostly Parmelia sulcata Taylor) and bark from olive trees (Olea europaea) were sampled across an area of 50×50 km, using a 10×10 km grid. This area is densely populated and features a blend of rural, urban-industrial and coastal environments, together with the country's second-largest metro area (Porto). All biomonitors have been analyzed by INAA and PIXE. Results were put through nonparametric tests and factor analysis for trend significance and emission sources, respectively.

DNA Repair Mechanism Gene, XRCC1A ( Arg194Trp) but not XRCC3 ( Thr241Met) Polymorphism Increased the Risk of Breast Cancer in Premenopausal Females: A Case-Control Study in Northeastern Region of India.

PubMed

Devi, K Rekha; Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C

2017-12-01

X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case-control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case-control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes.

DNA Repair Mechanism Gene, XRCC1A (Arg194Trp) but not XRCC3 (Thr241Met) Polymorphism Increased the Risk of Breast Cancer in Premenopausal Females: A Case–Control Study in Northeastern Region of India

PubMed Central

Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C.

2017-01-01

X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case–control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case–control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes. PMID:29332455

Chromosomal localization and partial genomic structure of the human peroxisome proliferator activated receptor-gamma (hPPAR gamma) gene.

PubMed

Beamer, B A; Negri, C; Yen, C J; Gavrilova, O; Rumberger, J M; Durcan, M J; Yarnall, D P; Hawkins, A L; Griffin, C A; Burns, D K; Roth, J; Reitman, M; Shuldiner, A R

1997-04-28

We determined the chromosomal localization and partial genomic structure of the coding region of the human PPAR gamma gene (hPPAR gamma), a nuclear receptor important for adipocyte differentiation and function. Sequence analysis and long PCR of human genomic DNA with primers that span putative introns revealed that intron positions and sizes of hPPAR gamma are similar to those previously determined for the mouse PPAR gamma gene[13]. Fluorescent in situ hybridization localized hPPAR gamma to chromosome 3, band 3p25. Radiation hybrid mapping with two independent primer pairs was consistent with hPPAR gamma being within 1.5 Mb of marker D3S1263 on 3p25-p24.2. These sequences of the intron/exon junctions of the 6 coding exons shared by hPPAR gamma 1 and hPPAR gamma 2 will facilitate screening for possible mutations. Furthermore, D3S1263 is a suitable polymorphic marker for linkage analysis to evaluate PPAR gamma's potential contribution to genetic susceptibility to obesity, lipoatrophy, insulin resistance, and diabetes.

High energy gamma-ray astronomy; Proceedings of the International Conference, ANN Arbor, MI, Oct. 2-5, 1990

NASA Astrophysics Data System (ADS)

Matthews, James

The present volume on high energy gamma-ray astronomy discusses the composition and properties of heavy cosmic rays greater than 10 exp 12 eV, implications of the IRAS Survey for galactic gamma-ray astronomy, gamma-ray emission from young neutron stars, and high-energy diffuse gamma rays. Attention is given to observations of TeV photons at the Whipple Observatory, TeV gamma rays from millisecond pulsars, recent data from the CYGNUS experiment, and recent results from the Woomera Telescope. Topics addressed include bounds on a possible He/VHE gamma-ray line signal of Galactic dark matter, albedo gamma rays from cosmic ray interactions on the solar surface, source studies, and the CANGAROO project. Also discussed are neural nets and other methods for maximizing the sensitivity of a low-threshold VHE gamma-ray telescope, a prototype water-Cerenkov air-shower detector, detection of point sources with spark chamber gamma-ray telescopes, and real-time image parameterization in high energy gamma-ray astronomy using transputers. (For individual items see A93-25002 to A93-25039)

Quantification of 235U and 238U activity concentrations for undeclared nuclear materials by a digital gamma-gamma coincidence spectroscopy.

PubMed

Zhang, Weihua; Yi, Jing; Mekarski, Pawel; Ungar, Kurt; Hauck, Barry; Kramer, Gary H

2011-06-01

The purpose of this study is to investigate the possibility of verifying depleted uranium (DU), natural uranium (NU), low enriched uranium (LEU) and high enriched uranium (HEU) by a developed digital gamma-gamma coincidence spectroscopy. The spectroscopy consists of two NaI(Tl) scintillators and XIA LLC Digital Gamma Finder (DGF)/Pixie-4 software and card package. The results demonstrate that the spectroscopy provides an effective method of (235)U and (238)U quantification based on the count rate of their gamma-gamma coincidence counting signatures. The main advantages of this approach over the conventional gamma spectrometry include the facts of low background continuum near coincident signatures of (235)U and (238)U, less interference from other radionuclides by the gamma-gamma coincidence counting, and region-of-interest (ROI) imagine analysis for uranium enrichment determination. Compared to conventional gamma spectrometry, the method offers additional advantage of requiring minimal calibrations for (235)U and (238)U quantification at different sample geometries. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Evaluation of gamma interferon (IFN-gamma)-induced protein 10 (IP-10) responses for detection of cattle infected with Mycobacterium bovis: comparisons to IFN-gamma responses

USDA-ARS?s Scientific Manuscript database

Gamma interferon (IFN-gamma)-induced protein 10 (IP-10) has recently shown promise as a diagnostic biomarker of Mycobacterium tuberculosis infection of humans. The aim of the current study was to compare IP-10 and IFN-gamma responses upon Mycobacterium bovis infection in cattle using archived sample...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aranda, J. I.; Tututi, E. S.; Flores-Tlalpa, A.

Higgs mediated flavor violating electromagnetic interactions, induced at the one-loop level by a nondiagonal Hf{sub i}f{sub j} vertex, with f{sub i} and f{sub j} charged leptons or quarks, are studied within the context of a completely general effective Yukawa sector that comprises SU{sub L}(2)xU{sub Y}(1)-invariant operators of up to dimension-six. Exact formulae for the one-loop {gamma}f{sub i}f{sub j} and {gamma}{gamma}f{sub i}f{sub j} couplings are presented and their related processes used to study the phenomena of Higgs mediated lepton flavor violation. The experimental limit on the {mu}{yields}e{gamma} decay is used to derive a bound on the branching ratio of the {mu}{yields}e{gamma}{gamma}more » transition, which is 6 orders of magnitude stronger than the current experimental limit. Previous results on the {tau}{yields}{mu}{gamma} and {tau}{yields}{mu}{gamma}{gamma} decays are reproduced. The possibility of detecting signals of lepton flavor violation at {gamma}{gamma} colliders is explored through the {gamma}{gamma}{yields}l{sub i}l{sub j} reaction, putting special emphasis on the {tau}{mu} final state. Using the bound imposed on the H{tau}{mu} vertex by the current experimental data on the muon anomalous magnetic moment, it is found that about half a hundred events may be produced in the International Linear Collider.« less

Alopecia of IFN-gamma knockout mouse as a model for disturbance of the hair cycle: a unique arrest of the hair cycle at the anagen phase accompanied by mitosis.

PubMed

Hirota, Ryuichiro; Tajima, Sadao; Yoneda, Yukio; Tamayama, Takumi; Watanabe, Masahito; Ueda, Kouichi; Kubota, Takahiro; Yoshida, Ryotaro

2002-09-01

Interferon-gamma(-/-) (IFN-gamma(-/-)) and IFN-gamma(+/+) C57BL/6 mice (3 weeks of age) completed the production of morphogenesis-derived hair. Around 6 weeks of age, however, most of the IFN-gamma(-/-) but none of the IFN-gamma(+/+) mice began to lose hairs in the dorsal and occipital areas in the absence of inflammatory reactions, and the alopecia was sustained for at least several 10-week periods of observation. A single subcutaneous injection of IFN-gamma to IFN-gamma(-/-) mice at 3, but not 4, 5, or 8 weeks of age could protect all the mice from alopecia, revealing that the lack of IFN-gamma around 3 weeks of age is directly responsible for the alopecia. Histologic features showed that the hair follicles of the IFN-gamma(+/+) mice passed through the anagen (4-5 weeks of age) and catagen/telogen ( approximately 6 weeks of age) phases, whereas those of IFN-gamma(-/-) mice (5 weeks of age or older) stayed in the anagen phase. TUNEL and bromodeoxyuridine experiments suggested that an arrest with unlimited DNA synthesis of the hair cycle in the anagen phase by the lack of IFN-gamma-dependent apoptosis in the midfollicle region and diffuse shedding of previously formed hair induced alopecia in IFN-gamma(-/-) mice.

Equine interferon gamma synthesis in lymphocytes after in vivo infection and in vitro stimulation with EHV-1.

PubMed

Paillot, R; Daly, J M; Juillard, V; Minke, J M; Hannant, D; Kydd, J H

2005-08-22

Equine cytotoxic T lymphocyte (CTL) responses to equine herpesvirus-1 (EHV-1) are well characterised but little is known about the cytokine response after infection or vaccination. EHV-1 is common in horses and infects lymphocytes in vivo. This virus was used as a model to measure the synthesis of interferon gamma (IFN-gamma) by equine peripheral blood mononuclear cells (PBMC) after in vivo infection and/or in vitro stimulation with EHV-1. Both flow cytometry and ELISPOT assays were used to quantify equine IFN-gamma using a mouse anti-bovine IFN-gamma monoclonal antibody (clone CC302; shown to cross-react with recombinant equine IFN-gamma) and a rabbit anti-canine IFN-gamma polyclonal antibody. The percentage of PBMC synthesising IFN-gamma after in vitro stimulation with EHV-1 increased with age. In yearlings infected experimentally with EHV-1, PBMC showed two peaks of IFN-gamma synthesis, 11 and 56 days after infection. The IFN-gamma synthesis was principally associated with CD8(+) cells. The patterns of IFN-gamma synthesis detected by intracellular IFN-gamma staining or ELISPOT were compared with CTL data and shown to be similar. These methods were also applied successfully to frozen samples of PBMC. Measurement of equine IFN-gamma using these simple techniques can now be applied to future studies on protective cellular immune responses following virus infection and/or vaccination of horses.

High resolution mapping of the binding site on human IgG1 for Fc gamma RI, Fc gamma RII, Fc gamma RIII, and FcRn and design of IgG1 variants with improved binding to the Fc gamma R.

PubMed

Shields, R L; Namenuk, A K; Hong, K; Meng, Y G; Rae, J; Briggs, J; Xie, D; Lai, J; Stadlen, A; Li, B; Fox, J A; Presta, L G

2001-03-02

Immunoglobulin G (IgG) Fc receptors play a critical role in linking IgG antibody-mediated immune responses with cellular effector functions. A high resolution map of the binding site on human IgG1 for human Fc gamma RI, Fc gamma RIIA, Fc gamma RIIB, Fc gamma RIIIA, and FcRn receptors has been determined. A common set of IgG1 residues is involved in binding to all Fc gamma R; Fc gamma RII and Fc gamma RIII also utilize residues outside this common set. In addition to residues which, when altered, abrogated binding to one or more of the receptors, several residues were found that improved binding only to specific receptors or simultaneously improved binding to one type of receptor and reduced binding to another type. Select IgG1 variants with improved binding to Fc gamma RIIIA exhibited up to 100% enhancement in antibody-dependent cell cytotoxicity using human effector cells; these variants included changes at residues not found at the binding interface in the IgG/Fc gamma RIIIA co-crystal structure (Sondermann, P., Huber, R., Oosthuizen, V., and Jacob, U. (2000) Nature 406, 267-273). These engineered antibodies may have important implications for improving antibody therapeutic efficacy.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ryan, Q.C.

There are two nonallelic human {gamma} globin genes located on the short arm of chromosome No. 11 in the order 5{prime}-{sup G}{sub {gamma}}-{sup A}{sub {gamma}}-3{prime}. Various modifications of the two {gamma} genes have been reported and include: deletions, triplications, quadruplications and recently a quintuplication. These are generally created by one or more unequal crossovers in the {gamma} globin gene regions on adjacent chromosomes. During the course of looking for a {gamma}{sup {degree}} thalassemia, which might be due to a crossover of looking for a {gamma} genes, two cases were found in the family W. Bgl II mapping studies showed amore » 5 kb deletion at the {gamma} gene loci in these individuals. The Bgl II fragment from the {gamma} gene loci of R.W. was cloned into the phage vector QR1. Phage mapping showed that two out of the three Pst I sites within the Bgl II fragment were missing which suggested that the crossover might have occurred within the {gamma} gene, possibly within the {gamma}IVS II region. Sequence analysis of the cloned fragment revealed an unusual sequence which had no sequence homology with the {gamma} gene region except for a small 264 bp region near the 3{prime} end. The orientation of the 264 bp fragment is inverted relative to homologous sequences in the {sup G}{sub {gamma}} and {sup A}{sub {gamma}} IVS II. The unusual sequence was computer analyzed for homology with every DNA sequence file in the EMBL database and GenBank and did not show any significant homologies to all the available DNA sequences except for the 264 bp {gamma}IVS II homology.« less

Localization of MEG pathologic gamma oscillations in adult epilepsy patients with focal cortical dysplasia☆

PubMed Central

Jeong, Woorim; Kim, June Sic; Chung, Chun Kee

2013-01-01

We aimed to evaluate the clinical value of gamma oscillations in MEG for intractable neocortical epilepsy patients with cortical dysplasia by comparing gamma and interictal spike events. A retrospective analysis of MEG recordings of 30 adult neocortical epilepsy patients was performed. Gamma (30–70 Hz) and interictal spike events were independently identified, their independent or concurrent presence determined, and their source localization rates compared. Of 30 patients, gamma activities were detected in 28 patients and interictal spikes in 24 patients. Gamma events alone appeared in 5 patients, interictal spikes alone in 1 patient, and no events in 1 patient. Gamma co-occurred with interictal spikes in 20.1 ± 22.1% and interictal spikes co-occurred with gamma in 15.0 ± 19.2%. Rates of event localization within the resection cavity were significantly different (p = 0.042) between gamma (63.3 ± 32.6%) and interictal spike (47.0 ± 41.3%) events. In 4 of the 5 gamma-only patients the mean localization rate was 42.5%. Compared with the interictal spike localization rate, 4 of 9 seizure-free patients had higher gamma localization rates, 4 had the same rate, and 1 had a lower rate. Individual gamma events can be detected independently from interictal spike presence. Gamma can be localized to the resection cavity at least comparably to or more frequently than that from interictal spikes. Even when interictal spikes were undetected, gamma sources were localized to the resection cavity. Gamma oscillations may be a useful indicator of epileptogenic focus. PMID:24273733

Highlights of GeV Gamma-Ray Astronomy

NASA Technical Reports Server (NTRS)

Thompson, David J.

2010-01-01

Because high-energy gamma rays are primarily produced by high-energy particle interactions, the gamma-ray survey of the sky by the Fermi Gamma-ray Space Telescope offers a view of sites of cosmic ray production and interactions. Gamma-ray bursts, pulsars, pulsar wind nebulae, binary sources, and Active Galactic Nuclei are all phenomena that reveal particle acceleration through their gamma-ray emission. Diffuse Galactic gamma radiation, Solar System gamma-ray sources, and energetic radiation from supernova remnants are likely tracers of high-energy particle interactions with matter and photon fields. This paper will present a broad overview of the constantly changing sky seen with the Large Area Telescope (LAT) on the Fermi spacecraft.

Glycine facilitates gamma-glutamylcysteinylethyl ester-mediated increase in liver glutathione level.

PubMed

Nishida, K; Ohta, Y; Ishiguro, I

1997-08-27

gamma-Glutamylcysteinylethyl ester (gamma-GCE) increases reduced glutathione (GSH) levels in GSH-depleted rat hepatocytes. Because glycine, a constituent of GSH, exists at 0.3 to 0.4 mM in rat plasma, we examined the influence of glycine added to the medium on the action of gamma-GCE to increase GSH levels in the rat hepatocytes. Glycine (0.2-0.8 mM) dose-dependently enhanced gamma-GCE-mediated increase in intracellular GSH levels with an increase in intracellular gamma-GCE levels. These results indicate that exogenous glycine facilitates gamma-GCE-mediated increase in intracellular GSH levels in rat hepatocytes possibly by enhancing the uptake of gamma-GCE into the cells.

75 FR 1796 - National Center for Complementary and Alternative Medicine; Notice of Closed Meetings

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-13

... Complementary and Alternative Medicine; Notice of Closed Meetings Pursuant to section 10(d) of the Federal... Alternative Medicine Special Emphasis Panel, Clinical Science-- Review of NCCAM Clinical R21 and K..., National Center for Complementary, and Alternative Medicine, NIH, 6707 Democracy Blvd., Suite 401, Bethesda...

78 FR 66755 - National Center for Complementary & Alternative Medicine; Notice of Closed Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-06

... Complementary & Alternative Medicine; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory... Alternative Medicine Special Emphasis Panel; RFA-AT14-001 and AT14- 002: SBIR Methods Development for Natural... Scientific Review, National Center for Complementary, & Alternative Medicine, NIH, 6707 Democracy Blvd...