Identification of candidate genes associated with fibromyalgia susceptibility in southern Spanish women: the al-Ándalus project.

PubMed

Estévez-López, Fernando; Camiletti-Moirón, Daniel; Aparicio, Virginia A; Segura-Jiménez, Víctor; Álvarez-Gallardo, Inmaculada C; Soriano-Maldonado, Alberto; Borges-Cosic, Milkana; Acosta-Manzano, Pedro; Geenen, Rinie; Delgado-Fernández, Manuel; Martínez-González, Luis J; Ruiz, Jonatan R; Álvarez-Cubero, María J

2018-02-27

Candidate-gene studies on fibromyalgia susceptibility often include a small number of single nucleotide polymorphisms (SNPs), which is a limitation. Moreover, there is a paucity of evidence in Europe. Therefore, we compared genotype frequencies of candidate SNPs in a well-characterised sample of Spanish women with fibromyalgia and healthy non-fibromyalgia women. A total of 314 women with a diagnosis of fibromyalgia (cases) and 112 non-fibromyalgia healthy (controls) women participated in this candidate-gene study. Buccal swabs were collected for DNA extraction. Using TaqMan™ OpenArray™, we analysed 61 SNPs of 33 genes related to fibromyalgia susceptibility, symptoms, or potential mechanisms. We observed that the rs841 and rs1799971 GG genotype was more frequently observed in fibromyalgia than in controls (p = 0.04 and p = 0.02, respectively). The rs2097903 AT/TT genotypes were also more often present in the fibromyalgia participants than in their control peers (p = 0.04). There were no differences for the remaining SNPs. We identified, for the first time, associations of the rs841 (guanosine triphosphate cyclohydrolase 1 gene) and rs2097903 (catechol-O-methyltransferase gene) SNPs with higher risk of fibromyalgia susceptibility. We also confirmed that the rs1799971 SNP (opioid receptor μ1 gene) might confer genetic risk of fibromyalgia. We did not adjust for multiple comparisons, which would be too stringent and yield to non-significant differences in the genotype frequencies between cases and controls. Our findings may be biologically meaningful and informative, and should be further investigated in other populations. Of particular interest is to replicate the present study in a larger independent sample to confirm or refute our findings. On the other hand, by including 61 SNPs of 33 candidate-genes with a strong rationale (they were previously investigated in relation to fibromyalgia susceptibility, symptoms or potential mechanisms), the present research is the most comprehensive candidate-gene study on fibromyalgia susceptibility to date.

Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

PubMed

Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

2014-11-25

The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot be recommended as a preferred means to identify new candidate insecticide resistant genes. Instead the rich data set on in vivo sites of transcription should be consulted when designing follow up qPCR validation steps, or for screening known candidates in field populations.

Integration of QTL and bioinformatic tools to identify candidate genes for triglycerides in mice[S

PubMed Central

Leduc, Magalie S.; Hageman, Rachael S.; Verdugo, Ricardo A.; Tsaih, Shirng-Wern; Walsh, Kenneth; Churchill, Gary A.; Paigen, Beverly

2011-01-01

To identify genetic loci influencing lipid levels, we performed quantitative trait loci (QTL) analysis between inbred mouse strains MRL/MpJ and SM/J, measuring triglyceride levels at 8 weeks of age in F2 mice fed a chow diet. We identified one significant QTL on chromosome (Chr) 15 and three suggestive QTL on Chrs 2, 7, and 17. We also carried out microarray analysis on the livers of parental strains of 282 F2 mice and used these data to find cis-regulated expression QTL. We then narrowed the list of candidate genes under significant QTL using a “toolbox” of bioinformatic resources, including haplotype analysis; parental strain comparison for gene expression differences and nonsynonymous coding single nucleotide polymorphisms (SNP); cis-regulated eQTL in livers of F2 mice; correlation between gene expression and phenotype; and conditioning of expression on the phenotype. We suggest Slc25a7 as a candidate gene for the Chr 7 QTL and, based on expression differences, five genes (Polr3 h, Cyp2d22, Cyp2d26, Tspo, and Ttll12) as candidate genes for Chr 15 QTL. This study shows how bioinformatics can be used effectively to reduce candidate gene lists for QTL related to complex traits. PMID:21622629

Endeavour update: a web resource for gene prioritization in multiple species

PubMed Central

Tranchevent, Léon-Charles; Barriot, Roland; Yu, Shi; Van Vooren, Steven; Van Loo, Peter; Coessens, Bert; De Moor, Bart; Aerts, Stein; Moreau, Yves

2008-01-01

Endeavour (http://www.esat.kuleuven.be/endeavourweb; this web site is free and open to all users and there is no login requirement) is a web resource for the prioritization of candidate genes. Using a training set of genes known to be involved in a biological process of interest, our approach consists of (i) inferring several models (based on various genomic data sources), (ii) applying each model to the candidate genes to rank those candidates against the profile of the known genes and (iii) merging the several rankings into a global ranking of the candidate genes. In the present article, we describe the latest developments of Endeavour. First, we provide a web-based user interface, besides our Java client, to make Endeavour more universally accessible. Second, we support multiple species: in addition to Homo sapiens, we now provide gene prioritization for three major model organisms: Mus musculus, Rattus norvegicus and Caenorhabditis elegans. Third, Endeavour makes use of additional data sources and is now including numerous databases: ontologies and annotations, protein–protein interactions, cis-regulatory information, gene expression data sets, sequence information and text-mining data. We tested the novel version of Endeavour on 32 recent disease gene associations from the literature. Additionally, we describe a number of recent independent studies that made use of Endeavour to prioritize candidate genes for obesity and Type II diabetes, cleft lip and cleft palate, and pulmonary fibrosis. PMID:18508807

Method for determining gene knockouts

DOEpatents

Maranas, Costas D [Port Matilda, PA; Burgard, Anthony R [State College, PA; Pharkya, Priti [State College, PA

2011-09-27

A method for determining candidates for gene deletions and additions using a model of a metabolic network associated with an organism, the model includes a plurality of metabolic reactions defining metabolite relationships, the method includes selecting a bioengineering objective for the organism, selecting at least one cellular objective, forming an optimization problem that couples the at least one cellular objective with the bioengineering objective, and solving the optimization problem to yield at least one candidate.

Method for determining gene knockouts

DOEpatents

Maranas, Costa D; Burgard, Anthony R; Pharkya, Priti

2013-06-04

A method for determining candidates for gene deletions and additions using a model of a metabolic network associated with an organism, the model includes a plurality of metabolic reactions defining metabolite relationships, the method includes selecting a bioengineering objective for the organism, selecting at least one cellular objective, forming an optimization problem that couples the at least one cellular objective with the bioengineering objective, and solving the optimization problem to yield at least one candidate.

Elevated risks for amyotrophic lateral sclerosis and blood disorders in Ashkenazi schizophrenic pedigrees suggest new candidate genes in schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goodman, A.B.

1994-09-15

Among relatives of Ashkenazi schizophrenic probands the rate of amyotrophic lateral sclerosis was 3/1,000, compared to expected population rates of approximately 2/100,000. Relative risk of bleeding disorders, including hematologic cancers, was increased more than three-fold compared to controls. Co-occurrence of motor neuron disease and blood dyscrasias, accompanied by psychosis, has long been recognized. A virally-mediated autoimmune pathogenesis has been proposed. However, the familial co-occurrence of these three disease entities raises the possibility that the disease constellation be considered as a manifestation of a common underlying genetic defect. Such expansion of the spectrum of affectation might enhance the power of bothmore » candidate gene and linkage studies. Based on these findings, the loci suggested as candidate regions in schizophrenia include a potential hot spot on chromosome 21q21-q22, involving the superoxide dismutase and amyloid precursor protein genes. Alternatively, genes on other chromosomes involved in the expression, transcription, or regulation of these genes, or associated with the illnesses of high frequency in these pedigrees are suggested. Candidates include the choroid plexus transport protein, transthyretin at 18q11.2-q12.1; the t(14;18)(q22;21) characterizing B-cell lymphoma-2, the most common form of hematologic cancer; and the 14q24 locus of early onset Alzheimer`s disease, c-Fos, transforming growth factor beta 3, and heat shock protein A2. Expression of hematologic cancers and the suggested candidate genes are known to involve retinoid pathways, and retinoid disregulation has been proposed as a cause of schizophrenia. 67 refs., 2 figs., 1 tab.« less

Global Transcriptome Changes Underlying Colony Growth in the Opportunistic Human Pathogen Aspergillus fumigatus

PubMed Central

Gibbons, John G.; Beauvais, Anne; Beau, Remi; McGary, Kriston L.

2012-01-01

Aspergillus fumigatus is the most common and deadly pulmonary fungal infection worldwide. In the lung, the fungus usually forms a dense colony of filaments embedded in a polymeric extracellular matrix. To identify candidate genes involved in this biofilm (BF) growth, we used RNA-Seq to compare the transcriptomes of BF and liquid plankton (PL) growth. Sequencing and mapping of tens of millions sequence reads against the A. fumigatus transcriptome identified 3,728 differentially regulated genes in the two conditions. Although many of these genes, including the ones coding for transcription factors, stress response, the ribosome, and the translation machinery, likely reflect the different growth demands in the two conditions, our experiment also identified hundreds of candidate genes for the observed differences in morphology and pathobiology between BF and PL. We found an overrepresentation of upregulated genes in transport, secondary metabolism, and cell wall and surface functions. Furthermore, upregulated genes showed significant spatial structure across the A. fumigatus genome; they were more likely to occur in subtelomeric regions and colocalized in 27 genomic neighborhoods, many of which overlapped with known or candidate secondary metabolism gene clusters. We also identified 1,164 genes that were downregulated. This gene set was not spatially structured across the genome and was overrepresented in genes participating in primary metabolic functions, including carbon and amino acid metabolism. These results add valuable insight into the genetics of biofilm formation in A. fumigatus and other filamentous fungi and identify many relevant, in the context of biofilm biology, candidate genes for downstream functional experiments. PMID:21724936

Genes related to sex steroids, neural growth, and social-emotional behavior are associated with autistic traits, empathy, and Asperger syndrome.

PubMed

Chakrabarti, B; Dudbridge, F; Kent, L; Wheelwright, S; Hill-Cawthorne, G; Allison, C; Banerjee-Basu, S; Baron-Cohen, S

2009-06-01

Genetic studies of autism spectrum conditions (ASC) have mostly focused on the "low functioning" severe clinical subgroup, treating it as a rare disorder. However, ASC is now thought to be relatively common ( approximately 1%), and representing one end of a quasi-normal distribution of autistic traits in the general population. Here we report a study of common genetic variation in candidate genes associated with autistic traits and Asperger syndrome (AS). We tested single nucleotide polymorphisms in 68 candidate genes in three functional groups (sex steroid synthesis/transport, neural connectivity, and social-emotional responsivity) in two experiments. These were (a) an association study of relevant behavioral traits (the Empathy Quotient (EQ), the Autism Spectrum Quotient (AQ)) in a population sample (n=349); and (b) a case-control association study on a sample of people with AS, a "high-functioning" subgroup of ASC (n=174). 27 genes showed a nominally significant association with autistic traits and/or ASC diagnosis. Of these, 19 genes showed nominally significant association with AQ/EQ. In the sex steroid group, this included ESR2 and CYP11B1. In the neural connectivity group, this included HOXA1, NTRK1, and NLGN4X. In the socio-responsivity behavior group, this included MAOB, AVPR1B, and WFS1. Fourteen genes showed nominally significant association with AS. In the sex steroid group, this included CYP17A1 and CYP19A1. In the socio-emotional behavior group, this included OXT. Six genes were nominally associated in both experiments, providing a partial replication. Eleven genes survived family wise error rate (FWER) correction using permutations across both experiments, which is greater than would be expected by chance. CYP11B1 and NTRK1 emerged as significantly associated genes in both experiments, after FWER correction (P<0.05). This is the first candidate-gene association study of AS and of autistic traits. The most promising candidate genes require independent replication and fine mapping.

Integrated computational biology analysis to evaluate target genes for chronic myelogenous leukemia.

PubMed

Zheng, Yu; Wang, Yu-Ping; Cao, Hongbao; Chen, Qiusheng; Zhang, Xi

2018-06-05

Although hundreds of genes have been linked to chronic myelogenous leukemia (CML), many of the results lack reproducibility. In the present study, data across multiple modalities were integrated to evaluate 579 CML candidate genes, including literature‑based CML‑gene relation data, Gene Expression Omnibus RNA expression data and pathway‑based gene‑gene interaction data. The expression data included samples from 76 patients with CML and 73 healthy controls. For each target gene, four metrics were proposed and tested with case/control classification. The effectiveness of the four metrics presented was demonstrated by the high classification accuracy (94.63%; P<2x10‑4). Cross metric analysis suggested nine top candidate genes for CML: Epidermal growth factor receptor, tumor protein p53, catenin β 1, janus kinase 2, tumor necrosis factor, abelson murine leukemia viral oncogene homolog 1, vascular endothelial growth factor A, B‑cell lymphoma 2 and proto‑oncogene tyrosine‑protein kinase. In addition, 145 CML candidate pathways enriched with 485 out of 579 genes were identified (P<8.2x10‑11; q=0.005). In conclusion, weighted genetic networks generated using computational biology may be complementary to biological experiments for the evaluation of known or novel CML target genes.

Prioritization of candidate disease genes by topological similarity between disease and protein diffusion profiles.

PubMed

Zhu, Jie; Qin, Yufang; Liu, Taigang; Wang, Jun; Zheng, Xiaoqi

2013-01-01

Identification of gene-phenotype relationships is a fundamental challenge in human health clinic. Based on the observation that genes causing the same or similar phenotypes tend to correlate with each other in the protein-protein interaction network, a lot of network-based approaches were proposed based on different underlying models. A recent comparative study showed that diffusion-based methods achieve the state-of-the-art predictive performance. In this paper, a new diffusion-based method was proposed to prioritize candidate disease genes. Diffusion profile of a disease was defined as the stationary distribution of candidate genes given a random walk with restart where similarities between phenotypes are incorporated. Then, candidate disease genes are prioritized by comparing their diffusion profiles with that of the disease. Finally, the effectiveness of our method was demonstrated through the leave-one-out cross-validation against control genes from artificial linkage intervals and randomly chosen genes. Comparative study showed that our method achieves improved performance compared to some classical diffusion-based methods. To further illustrate our method, we used our algorithm to predict new causing genes of 16 multifactorial diseases including Prostate cancer and Alzheimer's disease, and the top predictions were in good consistent with literature reports. Our study indicates that integration of multiple information sources, especially the phenotype similarity profile data, and introduction of global similarity measure between disease and gene diffusion profiles are helpful for prioritizing candidate disease genes. Programs and data are available upon request.

Prediction of gene-phenotype associations in humans, mice, and plants using phenologs.

PubMed

Woods, John O; Singh-Blom, Ulf Martin; Laurent, Jon M; McGary, Kriston L; Marcotte, Edward M

2013-06-21

Phenotypes and diseases may be related to seemingly dissimilar phenotypes in other species by means of the orthology of underlying genes. Such "orthologous phenotypes," or "phenologs," are examples of deep homology, and may be used to predict additional candidate disease genes. In this work, we develop an unsupervised algorithm for ranking phenolog-based candidate disease genes through the integration of predictions from the k nearest neighbor phenologs, comparing classifiers and weighting functions by cross-validation. We also improve upon the original method by extending the theory to paralogous phenotypes. Our algorithm makes use of additional phenotype data--from chicken, zebrafish, and E. coli, as well as new datasets for C. elegans--establishing that several types of annotations may be treated as phenotypes. We demonstrate the use of our algorithm to predict novel candidate genes for human atrial fibrillation (such as HRH2, ATP4A, ATP4B, and HOPX) and epilepsy (e.g., PAX6 and NKX2-1). We suggest gene candidates for pharmacologically-induced seizures in mouse, solely based on orthologous phenotypes from E. coli. We also explore the prediction of plant gene-phenotype associations, as for the Arabidopsis response to vernalization phenotype. We are able to rank gene predictions for a significant portion of the diseases in the Online Mendelian Inheritance in Man database. Additionally, our method suggests candidate genes for mammalian seizures based only on bacterial phenotypes and gene orthology. We demonstrate that phenotype information may come from diverse sources, including drug sensitivities, gene ontology biological processes, and in situ hybridization annotations. Finally, we offer testable candidates for a variety of human diseases, plant traits, and other classes of phenotypes across a wide array of species.

RNA-Seq analysis and annotation of a draft blueberry genome assembly identifies candidate genes involved in fruit ripening, biosynthesis of bioactive compounds, and stage-specific alternative splicing.

PubMed

Gupta, Vikas; Estrada, April D; Blakley, Ivory; Reid, Rob; Patel, Ketan; Meyer, Mason D; Andersen, Stig Uggerhøj; Brown, Allan F; Lila, Mary Ann; Loraine, Ann E

2015-01-01

Blueberries are a rich source of antioxidants and other beneficial compounds that can protect against disease. Identifying genes involved in synthesis of bioactive compounds could enable the breeding of berry varieties with enhanced health benefits. Toward this end, we annotated a previously sequenced draft blueberry genome assembly using RNA-Seq data from five stages of berry fruit development and ripening. Genome-guided assembly of RNA-Seq read alignments combined with output from ab initio gene finders produced around 60,000 gene models, of which more than half were similar to proteins from other species, typically the grape Vitis vinifera. Comparison of gene models to the PlantCyc database of metabolic pathway enzymes identified candidate genes involved in synthesis of bioactive compounds, including bixin, an apocarotenoid with potential disease-fighting properties, and defense-related cyanogenic glycosides, which are toxic. Cyanogenic glycoside (CG) biosynthetic enzymes were highly expressed in green fruit, and a candidate CG detoxification enzyme was up-regulated during fruit ripening. Candidate genes for ethylene, anthocyanin, and 400 other biosynthetic pathways were also identified. Homology-based annotation using Blast2GO and InterPro assigned Gene Ontology terms to around 15,000 genes. RNA-Seq expression profiling showed that blueberry growth, maturation, and ripening involve dynamic gene expression changes, including coordinated up- and down-regulation of metabolic pathway enzymes and transcriptional regulators. Analysis of RNA-seq alignments identified developmentally regulated alternative splicing, promoter use, and 3' end formation. We report genome sequence, gene models, functional annotations, and RNA-Seq expression data that provide an important new resource enabling high throughput studies in blueberry.

A comprehensive meta-analysis of plant morphology, yield, stay-green, and virus disease resistance QTL in maize (Zea mays L.).

PubMed

Wang, Yijun; Xu, Jing; Deng, Dexiang; Ding, Haidong; Bian, Yunlong; Yin, Zhitong; Wu, Yarong; Zhou, Bo; Zhao, Ye

2016-02-01

The meta-QTL and candidate genes will facilitate the elucidation of molecular bases underlying agriculturally important traits and open new avenues for functional markers development and elite alleles introgression in maize breeding program. A large number of QTLs attributed to grain productivity and other agriculturally important traits have been identified and deposited in public repositories. The integration of fruitful QTL becomes a major issue in current plant genomics. To this end, we first collected QTL for six agriculturally important traits in maize, including yield, plant height, ear height, leaf angle, stay-green, and maize rough dwarf disease resistance. The meta-analysis method was then employed to retrieve 113 meta-QTL. Additionally, we also isolated candidate genes for target traits by the bioinformatic technique. Several candidates, including some well-characterized genes, GA3ox2 for plant height, lg1 and lg4 for leaf angle, zfl1 and zfl2 for flowering time, were co-localized with established meta-QTL intervals. Intriguingly, in a relatively narrow meta-QTL region, the maize ortholog of rice yield-related gene GW8/OsSPL16 was believed to be a candidate for yield. Leveraging results presented in this study will provide further insights into the genetic architecture of maize agronomic traits. Moreover, the meta-QTL and candidate genes reported here could be harnessed for the enhancement of stress tolerance and yield performance in maize and translation to other crops.

Breast Tumors with Elevated Expression of 1q Candidate Genes Confer Poor Clinical Outcome and Sensitivity to Ras/PI3K Inhibition

PubMed Central

Viveka Thangaraj, Soundara; Periasamy, Jayaprakash; Bhaskar Rao, Divya; Barnabas, Georgina D.; Raghavan, Swetha; Ganesan, Kumaresan

2013-01-01

Genomic aberrations are common in cancers and the long arm of chromosome 1 is known for its frequent amplifications in breast cancer. However, the key candidate genes of 1q, and their contribution in breast cancer pathogenesis remain unexplored. We have analyzed the gene expression profiles of 1635 breast tumor samples using meta-analysis based approach and identified clinically significant candidates from chromosome 1q. Seven candidate genes including exonuclease 1 (EXO1) are consistently over expressed in breast tumors, specifically in high grade and aggressive breast tumors with poor clinical outcome. We derived a EXO1 co-expression module from the mRNA profiles of breast tumors which comprises 1q candidate genes and their co-expressed genes. By integrative functional genomics investigation, we identified the involvement of EGFR, RAS, PI3K / AKT, MYC, E2F signaling in the regulation of these selected 1q genes in breast tumors and breast cancer cell lines. Expression of EXO1 module was found as indicative of elevated cell proliferation, genomic instability, activated RAS/AKT/MYC/E2F1 signaling pathways and loss of p53 activity in breast tumors. mRNA–drug connectivity analysis indicates inhibition of RAS/PI3K as a possible targeted therapeutic approach for the patients with activated EXO1 module in breast tumors. Thus, we identified seven 1q candidate genes strongly associated with the poor survival of breast cancer patients and identified the possibility of targeting them with EGFR/RAS/PI3K inhibitors. PMID:24147022

An integrated approach of comparative genomics and heritability analysis of pig and human on obesity trait: evidence for candidate genes on human chromosome 2.

PubMed

Kim, Jaemin; Lee, Taeheon; Kim, Tae-Hun; Lee, Kyung-Tai; Kim, Heebal

2012-12-19

Traditional candidate gene approach has been widely used for the study of complex diseases including obesity. However, this approach is largely limited by its dependence on existing knowledge of presumed biology of the phenotype under investigation. Our combined strategy of comparative genomics and chromosomal heritability estimate analysis of obesity traits, subscapular skinfold thickness and back-fat thickness in Korean cohorts and pig (Sus scrofa), may overcome the limitations of candidate gene analysis and allow us to better understand genetic predisposition to human obesity. We found common genes including FTO, the fat mass and obesity associated gene, identified from significant SNPs by association studies of each trait. These common genes were related to blood pressure and arterial stiffness (P = 1.65E-05) and type 2 diabetes (P = 0.00578). Through the estimation of variance of genetic component (heritability) for each chromosome by SNPs, we observed a significant positive correlation (r = 0.479) between genetic contributions of human and pig to obesity traits. Furthermore, we noted that human chromosome 2 (syntenic to pig chromosomes 3 and 15) was most important in explaining the phenotypic variance for obesity. Obesity genetics still awaits further discovery. Navigating syntenic regions suggests obesity candidate genes on chromosome 2 that are previously known to be associated with obesity-related diseases: MRPL33, PARD3B, ERBB4, STK39, and ZNF385B.

Single-Cell RNA-Seq of Mouse Dopaminergic Neurons Informs Candidate Gene Selection for Sporadic Parkinson Disease.

PubMed

Hook, Paul W; McClymont, Sarah A; Cannon, Gabrielle H; Law, William D; Morton, A Jennifer; Goff, Loyal A; McCallion, Andrew S

2018-03-01

Genetic variation modulating risk of sporadic Parkinson disease (PD) has been primarily explored through genome-wide association studies (GWASs). However, like many other common genetic diseases, the impacted genes remain largely unknown. Here, we used single-cell RNA-seq to characterize dopaminergic (DA) neuron populations in the mouse brain at embryonic and early postnatal time points. These data facilitated unbiased identification of DA neuron subpopulations through their unique transcriptional profiles, including a postnatal neuroblast population and substantia nigra (SN) DA neurons. We use these population-specific data to develop a scoring system to prioritize candidate genes in all 49 GWAS intervals implicated in PD risk, including genes with known PD associations and many with extensive supporting literature. As proof of principle, we confirm that the nigrostriatal pathway is compromised in Cplx1-null mice. Ultimately, this systematic approach establishes biologically pertinent candidates and testable hypotheses for sporadic PD, informing a new era of PD genetic research. Copyright © 2018 American Society of Human Genetics. All rights reserved.

Candidate Luminal B Breast Cancer Genes Identified by Genome, Gene Expression and DNA Methylation Profiling

PubMed Central

Addou-Klouche, Lynda; Finetti, Pascal; Saade, Marie-Rose; Manai, Marwa; Carbuccia, Nadine; Bekhouche, Ismahane; Letessier, Anne; Charafe-Jauffret, Emmanuelle; Jacquemier, Jocelyne; Spicuglia, Salvatore; de The, Hugues; Viens, Patrice; Bertucci, François; Birnbaum, Daniel; Chaffanet, Max

2014-01-01

Breast cancers (BCs) of the luminal B subtype are estrogen receptor-positive (ER+), highly proliferative, resistant to standard therapies and have a poor prognosis. To better understand this subtype we compared DNA copy number aberrations (CNAs), DNA promoter methylation, gene expression profiles, and somatic mutations in nine selected genes, in 32 luminal B tumors with those observed in 156 BCs of the other molecular subtypes. Frequent CNAs included 8p11-p12 and 11q13.1-q13.2 amplifications, 7q11.22-q34, 8q21.12-q24.23, 12p12.3-p13.1, 12q13.11-q24.11, 14q21.1-q23.1, 17q11.1-q25.1, 20q11.23-q13.33 gains and 6q14.1-q24.2, 9p21.3-p24,3, 9q21.2, 18p11.31-p11.32 losses. A total of 237 and 101 luminal B-specific candidate oncogenes and tumor suppressor genes (TSGs) presented a deregulated expression in relation with their CNAs, including 11 genes previously reported associated with endocrine resistance. Interestingly, 88% of the potential TSGs are located within chromosome arm 6q, and seven candidate oncogenes are potential therapeutic targets. A total of 100 candidate oncogenes were validated in a public series of 5,765 BCs and the overexpression of 67 of these was associated with poor survival in luminal tumors. Twenty-four genes presented a deregulated expression in relation with a high DNA methylation level. FOXO3, PIK3CA and TP53 were the most frequent mutated genes among the nine tested. In a meta-analysis of next-generation sequencing data in 875 BCs, KCNB2 mutations were associated with luminal B cases while candidate TSGs MDN1 (6q15) and UTRN (6q24), were mutated in this subtype. In conclusion, we have reported luminal B candidate genes that may play a role in the development and/or hormone resistance of this aggressive subtype. PMID:24416132

Identification of genes from the Treacher Collins candidate region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixon, M.; Dixon, J.; Edwards, S.

Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less

Identification of candidate transmission-blocking antigen genes in Theileria annulata and related vector-borne apicomplexan parasites.

PubMed

Lempereur, Laetitia; Larcombe, Stephen D; Durrani, Zeeshan; Karagenc, Tulin; Bilgic, Huseyin Bilgin; Bakirci, Serkan; Hacilarlioglu, Selin; Kinnaird, Jane; Thompson, Joanne; Weir, William; Shiels, Brian

2017-06-05

Vector-borne apicomplexan parasites are a major cause of mortality and morbidity to humans and livestock globally. The most important disease syndromes caused by these parasites are malaria, babesiosis and theileriosis. Strategies for control often target parasite stages in the mammalian host that cause disease, but this can result in reservoir infections that promote pathogen transmission and generate economic loss. Optimal control strategies should protect against clinical disease, block transmission and be applicable across related genera of parasites. We have used bioinformatics and transcriptomics to screen for transmission-blocking candidate antigens in the tick-borne apicomplexan parasite, Theileria annulata. A number of candidate antigen genes were identified which encoded amino acid domains that are conserved across vector-borne Apicomplexa (Babesia, Plasmodium and Theileria), including the Pfs48/45 6-cys domain and a novel cysteine-rich domain. Expression profiling confirmed that selected candidate genes are expressed by life cycle stages within infected ticks. Additionally, putative B cell epitopes were identified in the T. annulata gene sequences encoding the 6-cys and cysteine rich domains, in a gene encoding a putative papain-family cysteine peptidase, with similarity to the Plasmodium SERA family, and the gene encoding the T. annulata major merozoite/piroplasm surface antigen, Tams1. Candidate genes were identified that encode proteins with similarity to known transmission blocking candidates in related parasites, while one is a novel candidate conserved across vector-borne apicomplexans and has a potential role in the sexual phase of the life cycle. The results indicate that a 'One Health' approach could be utilised to develop a transmission-blocking strategy effective against vector-borne apicomplexan parasites of animals and humans.

Sleeping Beauty transposon mutagenesis identifies genes that cooperate with mutant Smad4 in gastric cancer development

PubMed Central

Takeda, Haruna; Rust, Alistair G.; Ward, Jerrold M.; Yew, Christopher Chin Kuan; Jenkins, Nancy A.; Copeland, Neal G.

2016-01-01

Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4+/− mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC. PMID:27006499

Sleeping Beauty transposon mutagenesis identifies genes that cooperate with mutant Smad4 in gastric cancer development.

PubMed

Takeda, Haruna; Rust, Alistair G; Ward, Jerrold M; Yew, Christopher Chin Kuan; Jenkins, Nancy A; Copeland, Neal G

2016-04-05

Mutations in SMAD4 predispose to the development of gastrointestinal cancer, which is the third leading cause of cancer-related deaths. To identify genes driving gastric cancer (GC) development, we performed a Sleeping Beauty (SB) transposon mutagenesis screen in the stomach of Smad4(+/-) mutant mice. This screen identified 59 candidate GC trunk drivers and a much larger number of candidate GC progression genes. Strikingly, 22 SB-identified trunk drivers are known or candidate cancer genes, whereas four SB-identified trunk drivers, including PTEN, SMAD4, RNF43, and NF1, are known human GC trunk drivers. Similar to human GC, pathway analyses identified WNT, TGF-β, and PI3K-PTEN signaling, ubiquitin-mediated proteolysis, adherens junctions, and RNA degradation in addition to genes involved in chromatin modification and organization as highly deregulated pathways in GC. Comparative oncogenomic filtering of the complete list of SB-identified genes showed that they are highly enriched for genes mutated in human GC and identified many candidate human GC genes. Finally, by comparing our complete list of SB-identified genes against the list of mutated genes identified in five large-scale human GC sequencing studies, we identified LDL receptor-related protein 1B (LRP1B) as a previously unidentified human candidate GC tumor suppressor gene. In LRP1B, 129 mutations were found in 462 human GC samples sequenced, and LRP1B is one of the top 10 most deleted genes identified in a panel of 3,312 human cancers. SB mutagenesis has, thus, helped to catalog the cooperative molecular mechanisms driving SMAD4-induced GC growth and discover genes with potential clinical importance in human GC.

Parkinson's disease candidate gene prioritization based on expression profile of midbrain dopaminergic neurons

PubMed Central

2010-01-01

Background Parkinson's disease is the second most common neurodegenerative disorder. The pathological hallmark of the disease is degeneration of midbrain dopaminergic neurons. Genetic association studies have linked 13 human chromosomal loci to Parkinson's disease. Identification of gene(s), as part of the etiology of Parkinson's disease, within the large number of genes residing in these loci can be achieved through several approaches, including screening methods, and considering appropriate criteria. Since several of the indentified Parkinson's disease genes are expressed in substantia nigra pars compact of the midbrain, expression within the neurons of this area could be a suitable criterion to limit the number of candidates and identify PD genes. Methods In this work we have used the combination of findings from six rodent transcriptome analysis studies on the gene expression profile of midbrain dopaminergic neurons and the PARK loci in OMIM (Online Mendelian Inheritance in Man) database, to identify new candidate genes for Parkinson's disease. Results Merging the two datasets, we identified 20 genes within PARK loci, 7 of which are located in an orphan Parkinson's disease locus and one, which had been identified as a disease gene. In addition to identifying a set of candidates for further genetic association studies, these results show that the criteria of expression in midbrain dopaminergic neurons may be used to narrow down the number of genes in PARK loci for such studies. PMID:20716345

Candidate genes for idiopathic epilepsy in four dog breeds.

PubMed

Ekenstedt, Kari J; Patterson, Edward E; Minor, Katie M; Mickelson, James R

2011-04-25

Idiopathic epilepsy (IE) is a naturally occurring and significant seizure disorder affecting all dog breeds. Because dog breeds are genetically isolated populations, it is possible that IE is attributable to common founders and is genetically homogenous within breeds. In humans, a number of mutations, the majority of which are genes encoding ion channels, neurotransmitters, or their regulatory subunits, have been discovered to cause rare, specific types of IE. It was hypothesized that there are simple genetic bases for IE in some purebred dog breeds, specifically in Vizslas, English Springer Spaniels (ESS), Greater Swiss Mountain Dogs (GSMD), and Beagles, and that the gene(s) responsible may, in some cases, be the same as those already discovered in humans. Candidate genes known to be involved in human epilepsy, along with selected additional genes in the same gene families that are involved in murine epilepsy or are expressed in neural tissue, were examined in populations of affected and unaffected dogs. Microsatellite markers in close proximity to each candidate gene were genotyped and subjected to two-point linkage in Vizslas, and association analysis in ESS, GSMD and Beagles. Most of these candidate genes were not significantly associated with IE in these four dog breeds, while a few genes remained inconclusive. Other genes not included in this study may still be causing monogenic IE in these breeds or, like many cases of human IE, the disease in dogs may be likewise polygenic.

Gene expression meta-analysis identifies chromosomal regions and candidate genes involved in breast cancer metastasis.

PubMed

Thomassen, Mads; Tan, Qihua; Kruse, Torben A

2009-01-01

Breast cancer cells exhibit complex karyotypic alterations causing deregulation of numerous genes. Some of these genes are probably causal for cancer formation and local growth whereas others are causal for the various steps of metastasis. In a fraction of tumors deregulation of the same genes might be caused by epigenetic modulations, point mutations or the influence of other genes. We have investigated the relation of gene expression and chromosomal position, using eight datasets including more than 1200 breast tumors, to identify chromosomal regions and candidate genes possibly causal for breast cancer metastasis. By use of "Gene Set Enrichment Analysis" we have ranked chromosomal regions according to their relation to metastasis. Overrepresentation analysis identified regions with increased expression for chromosome 1q41-42, 8q24, 12q14, 16q22, 16q24, 17q12-21.2, 17q21-23, 17q25, 20q11, and 20q13 among metastasizing tumors and reduced gene expression at 1p31-21, 8p22-21, and 14q24. By analysis of genes with extremely imbalanced expression in these regions we identified DIRAS3 at 1p31, PSD3, LPL, EPHX2 at 8p21-22, and FOS at 14q24 as candidate metastasis suppressor genes. Potential metastasis promoting genes includes RECQL4 at 8q24, PRMT7 at 16q22, GINS2 at 16q24, and AURKA at 20q13.

Mutational Landscape of Candidate Genes in Familial Prostate Cancer

PubMed Central

Johnson, Anna M.; Zuhlke, Kimberly A.; Plotts, Chris; McDonnell, Shannon K.; Middha, Sumit; Riska, Shaun M.; Thibodeau, Stephen N.; Douglas, Julie A.; Cooney, Kathleen A.

2014-01-01

Background Family history is a major risk factor for prostate cancer (PCa), suggesting a genetic component to the disease. However, traditional linkage and association studies have failed to fully elucidate the underlying genetic basis of familial PCa. Methods Here we use a candidate gene approach to identify potential PCa susceptibility variants in whole exome sequencing data from familial PCa cases. Six hundred ninety-seven candidate genes were identified based on function, location near a known chromosome 17 linkage signal, and/or previous association with prostate or other cancers. Single nucleotide variants (SNVs) in these candidate genes were identified in whole exome sequence data from 33 PCa cases from 11 multiplex PCa families (3 cases/family). Results Overall, 4856 candidate gene SNVs were identified, including 1052 missense and 10 nonsense variants. Twenty missense variants were shared by all 3 family members in each family in which they were observed. Additionally, 15 missense variants were shared by 2 of 3 family members and predicted to be deleterious by 5 different algorithms. Four missense variants, BLM Gln123Arg, PARP2 Arg283Gln, LRCC46 Ala295Thr and KIF2B Pro91Leu, and 1 nonsense variant, CYP3A43 Arg441Ter, showed complete co-segregation with PCa status. Twelve additional variants displayed partial co-segregation with PCa. Conclusions Forty-three nonsense and shared, missense variants were identified in our candidate genes. Further research is needed to determine the contribution of these variants to PCa susceptibility. PMID:25111073

Genetic risk factors of systemic lupus erythematosus in the Malaysian population: a minireview.

PubMed

Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

2012-01-01

SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6.

Genetic Risk Factors of Systemic Lupus Erythematosus in the Malaysian Population: A Minireview

PubMed Central

Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

2012-01-01

SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6. PMID:21941582

Genomic analysis of Meckel–Gruber syndrome in Arabs reveals marked genetic heterogeneity and novel candidate genes

PubMed Central

Shaheen, Ranad; Faqeih, Eissa; Alshammari, Muneera J; Swaid, Abdulrahman; Al-Gazali, Lihadh; Mardawi, Elham; Ansari, Shinu; Sogaty, Sameera; Seidahmed, Mohammed Z; AlMotairi, Muhammed I; Farra, Chantal; Kurdi, Wesam; Al-Rasheed, Shatha; Alkuraya, Fowzan S

2013-01-01

Meckel–Gruber syndrome (MKS, OMIM #249000) is a multiple congenital malformation syndrome that represents the severe end of the ciliopathy phenotypic spectrum. Despite the relatively common occurrence of this syndrome among Arabs, little is known about its genetic architecture in this population. This is a series of 18 Arab families with MKS, who were evaluated clinically and studied using autozygome-guided mutation analysis and exome sequencing. We show that autozygome-guided candidate gene analysis identified the underlying mutation in the majority (n=12, 71%). Exome sequencing revealed a likely pathogenic mutation in three novel candidate MKS disease genes. These include C5orf42, Ellis–van-Creveld disease gene EVC2 and SEC8 (also known as EXOC4), which encodes an exocyst protein with an established role in ciliogenesis. This is the largest and most comprehensive genomic study on MKS in Arabs and the results, in addition to revealing genetic and allelic heterogeneity, suggest that previously reported disease genes and the novel candidates uncovered by this study account for the overwhelming majority of MKS patients in our population. PMID:23169490

Cost–Effective Prediction of Gender-Labeling Errors and Estimation of Gender-Labeling Error Rates in Candidate-Gene Association Studies

PubMed Central

Qu, Conghui; Schuetz, Johanna M.; Min, Jeong Eun; Leach, Stephen; Daley, Denise; Spinelli, John J.; Brooks-Wilson, Angela; Graham, Jinko

2011-01-01

We describe a statistical approach to predict gender-labeling errors in candidate-gene association studies, when Y-chromosome markers have not been included in the genotyping set. The approach adds value to methods that consider only the heterozygosity of X-chromosome SNPs, by incorporating available information about the intensity of X-chromosome SNPs in candidate genes relative to autosomal SNPs from the same individual. To our knowledge, no published methods formalize a framework in which heterozygosity and relative intensity are simultaneously taken into account. Our method offers the advantage that, in the genotyping set, no additional space is required beyond that already assigned to X-chromosome SNPs in the candidate genes. We also show how the predictions can be used in a two-phase sampling design to estimate the gender-labeling error rates for an entire study, at a fraction of the cost of a conventional design. PMID:22303327

The effects of polymorphisms in IL-2, IFN-γ, TGF-β2, IgL, TLR-4, MD-2, and iNOS genes on resistance to Salmonella enteritidis in indigenous chickens.

PubMed

Tohidi, Reza; Idris, Ismail Bin; Panandam, Jothi Malar; Bejo, Mohd Hair

2012-12-01

Salmonella Enteritidis is a major cause of food poisoning worldwide, and poultry products are the main source of S. Enteritidis contamination for humans. Among the numerous strategies for disease control, improving genetic resistance to S. Enteritidis has been the most effective approach. We investigated the association between S. Enteritidis burden in the caecum, spleen, and liver of young indigenous chickens and seven candidate genes, selected on the basis of their critical roles in immunological functions. The genes included those encoding interleukin 2 (IL-2), interferon-γ (IFN-γ), transforming growth factor β2 (TGF-β2), immunoglobulin light chain (IgL), toll-like receptor 4 (TLR-4), myeloid differentiation protein 2 (MD-2), and inducible nitric oxide synthase (iNOS). Two Malaysian indigenous chicken breeds were used as sustainable genetic sources of alleles that are resistant to salmonellosis. The polymerase chain reaction restriction fragment-length polymorphism technique was used to genotype the candidate genes. Three different genotypes were observed in all of the candidate genes, except for MD-2. All of the candidate genes showed the Hardy-Weinberg equilibrium for the two populations. The IL-2-MnlI polymorphism was associated with S. Enteritidis burden in the caecum and spleen. The TGF-β2-RsaI, TLR-4-Sau 96I, and iNOS-AluI polymorphisms were associated with the caecum S. Enteritidis load. The other candidate genes were not associated with S. Enteritidis load in any organ. The results indicate that the IL-2, TGF-β2, TLR-4, and iNOS genes are potential candidates for use in selection programmes for increasing genetic resistance against S. Enteritidis in Malaysian indigenous chickens.

Exploring Valid Reference Genes for Quantitative Real-time PCR Analysis in Plutella xylostella (Lepidoptera: Plutellidae)

PubMed Central

Fu, Wei; Xie, Wen; Zhang, Zhuo; Wang, Shaoli; Wu, Qingjun; Liu, Yong; Zhou, Xiaomao; Zhou, Xuguo; Zhang, Youjun

2013-01-01

Abstract: Quantitative real-time PCR (qRT-PCR), a primary tool in gene expression analysis, requires an appropriate normalization strategy to control for variation among samples. The best option is to compare the mRNA level of a target gene with that of reference gene(s) whose expression level is stable across various experimental conditions. In this study, expression profiles of eight candidate reference genes from the diamondback moth, Plutella xylostella, were evaluated under diverse experimental conditions. RefFinder, a web-based analysis tool, integrates four major computational programs including geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to comprehensively rank the tested candidate genes. Elongation factor 1 (EF1) was the most suited reference gene for the biotic factors (development stage, tissue, and strain). In contrast, although appropriate reference gene(s) do exist for several abiotic factors (temperature, photoperiod, insecticide, and mechanical injury), we were not able to identify a single universal reference gene. Nevertheless, a suite of candidate reference genes were specifically recommended for selected experimental conditions. Our finding is the first step toward establishing a standardized qRT-PCR analysis of this agriculturally important insect pest. PMID:23983612

Novel Biomarker Candidates for Colorectal Cancer Metastasis: A Meta-analysis of In Vitro Studies

PubMed Central

Long, Nguyen Phuoc; Lee, Wun Jun; Huy, Nguyen Truong; Lee, Seul Ji; Park, Jeong Hill; Kwon, Sung Won

2016-01-01

Colorectal cancer (CRC) is one of the most common and lethal cancers. Although numerous studies have evaluated potential biomarkers for early diagnosis, current biomarkers have failed to reach an acceptable level of accuracy for distant metastasis. In this paper, we performed a gene set meta-analysis of in vitro microarray studies and combined the results from this study with previously published proteomic data to validate and suggest prognostic candidates for CRC metastasis. Two microarray data sets included found 21 significant genes. Of these significant genes, ALDOA, IL8 (CXCL8), and PARP4 had strong potential as prognostic candidates. LAMB2, MCM7, CXCL23A, SERPINA3, ABCA3, ALDH3A2, and POLR2I also have potential. Other candidates were more controversial, possibly because of the biologic heterogeneity of tumor cells, which is a major obstacle to predicting metastasis. In conclusion, we demonstrated a meta-analysis approach and successfully suggested ten biomarker candidates for future investigation. PMID:27688707

Novel Biomarker Candidates for Colorectal Cancer Metastasis: A Meta-analysis of In Vitro Studies.

PubMed

Long, Nguyen Phuoc; Lee, Wun Jun; Huy, Nguyen Truong; Lee, Seul Ji; Park, Jeong Hill; Kwon, Sung Won

2016-01-01

Colorectal cancer (CRC) is one of the most common and lethal cancers. Although numerous studies have evaluated potential biomarkers for early diagnosis, current biomarkers have failed to reach an acceptable level of accuracy for distant metastasis. In this paper, we performed a gene set meta-analysis of in vitro microarray studies and combined the results from this study with previously published proteomic data to validate and suggest prognostic candidates for CRC metastasis. Two microarray data sets included found 21 significant genes. Of these significant genes, ALDOA, IL8 (CXCL8), and PARP4 had strong potential as prognostic candidates. LAMB2, MCM7, CXCL23A, SERPINA3, ABCA3, ALDH3A2, and POLR2I also have potential. Other candidates were more controversial, possibly because of the biologic heterogeneity of tumor cells, which is a major obstacle to predicting metastasis. In conclusion, we demonstrated a meta-analysis approach and successfully suggested ten biomarker candidates for future investigation.

Clinical germline diagnostic exome sequencing for hereditary cancer: Findings within novel candidate genes are prevalent.

PubMed

Powis, Zöe; Espenschied, Carin R; LaDuca, Holly; Hagman, Kelly D; Paudyal, Tripti; Li, Shuwei; Inaba, Hiroto; Mauer, Ann; Nathanson, Katherine L; Knost, James; Chao, Elizabeth C; Tang, Sha

2018-08-01

Clinical diagnostic exome sequencing (DES) has been effective in diagnosing individuals with suspected genetic conditions; nevertheless little has been described regarding its clinical utility in individuals with a personal and family history of cancer. This study aimed to assess diagnostic yield and clinical characteristics of pediatric and adult patients undergoing germline DES for hereditary cancer. We retrospectively reviewed 2171 patients referred for DES; cases with a personal and/or family history of cancer were further studied. Of 39 cancer patients, relevant alterations were found in eight individuals (21%), including one (3%) positive pathogenic alteration within a characterized gene, two (5%) uncertain findings in characterized genes, and five (13%) alterations in novel candidate genes. Two of the 5 pediatric patients, undergoing testing, (40%) had findings in novel candidate genes, with the remainder being negative. We include brief case studies to illustrate the variety of challenging issues related to these patients. Our observations demonstrate utility of family-based exome sequencing in patients for suspected hereditary cancer, including familial co-segregation analysis, and comprehensive medical review. DES may be particularly useful when traditional approaches do not result in a diagnosis or in families with unique phenotypes. This work also highlights the importance and complexity of analysis of uncharacterized genes in exome sequencing for hereditary cancer. Copyright © 2018 Elsevier Inc. All rights reserved.

GAPD and tubulin are suitable internal controls for qPCR analysis of oral squamous cell carcinoma cell lines.

PubMed

Campos, M S; Rodini, C O; Pinto-Júnior, D S; Nunes, F D

2009-02-01

The selection of housekeeping genes is critical for gene expression studies. To address this issue, four candidate housekeeping genes, including several commonly used ones, were investigated in oral squamous cell carcinoma cell lines. A simple quantitative RT-PCR approach was employed by comparing relative expression of the four candidate genes within two cancerous cell lines (HN6 and HN31) and one noncancerous cell line (HaCaT) treated or not with EGF and TGF-beta1. Data were analyzed using ANOVA followed by the NormFinder software program. On this basis, stability of the candidate housekeeping genes was ranked and non statistical differences were found using ANOVA test. On the other hand, the NormFinder was able to show that GAPD and TUBB presented the less variable results, representing appropriated housekeeping genes for the samples and conditions analyzed. In conclusion, this study suggests that the GAPD and the TUBB represent adequate normalizers for gene profiling studies in OSCC cell lines, covering, respectively, high and low expression levels genes.

Evidence of linkage and association on chromosome 20 for late-onset Alzheimer disease.

PubMed

Goddard, Katrina A B; Olson, Jane M; Payami, Haydeh; van der Voet, Monique; Kuivaniemi, Helena; Tromp, Gerard

2004-06-01

Recently, we reported evidence of linkage on chromosome 20 for Alzheimer disease (AD) using a novel statistical approach to incorporate covariates (e.g., age, ApoE genotype) into the analysis. These results suggest that very elderly subjects (>85 years), and individuals who carry an epsilon2 allele at the ApoE locus are more likely to be linked to this candidate region. The region on chromosome 20 includes a strong candidate gene, cystatin C (CST3), which has previously been associated with AD in case-control studies. We investigated these findings further by genotyping additional markers to narrow the candidate region, and to identify evidence of linkage disequilibrium as additional support for a susceptibility locus on chromosome 20. We selected 43 elderly sibships (89 subjects) from the NIMH AD Genetics Initiative based on current age older than 84 years, and identified 129 unrelated control subjects who were older than 84 years from the Oregon Brain Aging Study to conduct linkage and association studies in this region. Fourteen additional markers were evaluated, including 4 markers located within or near CST3. We narrowed the candidate region on chromosome 20 to an 11.8-cM region between markers D20S174 and D20S471, which includes the CST3 candidate gene. In addition, we observed evidence of association for markers located near the CST3 candidate gene, with P values between 0.002 and 0.08 for two-locus haplotypes. These results support the presence of a susceptibility locus for AD in the vicinity of CST3 for very elderly subjects with AD.

Candidate-gene association study of mothers with pre-eclampsia, and their infants, analyzing 775 SNPs in 190 genes.

PubMed

Goddard, Katrina A B; Tromp, Gerard; Romero, Roberto; Olson, Jane M; Lu, Qing; Xu, Zhiying; Parimi, Neeta; Nien, Jyh Kae; Gomez, Ricardo; Behnke, Ernesto; Solari, Margarita; Espinoza, Jimmy; Santolaya, Joaquin; Chaiworapongsa, Tinnakorn; Lenk, Guy M; Volkenant, Kimberly; Anant, Madan Kumar; Salisbury, Benjamin A; Carr, Janet; Lee, Min Soeb; Vovis, Gerald F; Kuivaniemi, Helena

2007-01-01

Pre-eclampsia (PE) affects 5-7% of pregnancies in the US, and is a leading cause of maternal death and perinatal morbidity and mortality worldwide. To identify genes with a role in PE, we conducted a large-scale association study evaluating 775 SNPs in 190 candidate genes selected for a potential role in obstetrical complications. SNP discovery was performed by DNA sequencing, and genotyping was carried out in a high-throughput facility using the MassARRAY(TM) System. Women with PE (n = 394) and their offspring (n = 324) were compared with control women (n = 602) and their offspring (n = 631) from the same hospital-based population. Haplotypes were estimated for each gene using the EM algorithm, and empirical p values were obtained for a logistic regression-based score test, adjusted for significant covariates. An interaction model between maternal and offspring genotypes was also evaluated. The most significant findings for association with PE were COL1A1 (p = 0.0011) and IL1A (p = 0.0014) for the maternal genotype, and PLAUR (p = 0.0008) for the offspring genotype. Common candidate genes for PE, including MTHFR and NOS3, were not significantly associated with PE. For the interaction model, SNPs within IGF1 (p = 0.0035) and IL4R (p = 0.0036) gave the most significant results. This study is one of the most comprehensive genetic association studies of PE to date, including an evaluation of offspring genotypes that have rarely been considered in previous studies. Although we did not identify statistically significant evidence of association for any of the candidate loci evaluated here after adjusting for multiple testing using the false discovery rate, additional compelling evidence exists, including multiple SNPs with nominally significant p values in COL1A1 and the IL1A region, and previous reports of association for IL1A, to support continued interest in these genes as candidates for PE. Identification of the genetic regulators of PE may have broader implications, since women with PE are at increased risk of death from cardiovascular diseases later in life.

Secretome Characterization and Correlation Analysis Reveal Putative Pathogenicity Mechanisms and Identify Candidate Avirulence Genes in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici.

PubMed

Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming

2017-01-01

Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms underlying Pst -wheat interactions, to determine the effectiveness of resistance genes and further to develop durable resistance to stripe rust.

Screening key candidate genes and pathways involved in insulinoma by microarray analysis.

PubMed

Zhou, Wuhua; Gong, Li; Li, Xuefeng; Wan, Yunyan; Wang, Xiangfei; Li, Huili; Jiang, Bin

2018-06-01

Insulinoma is a rare type tumor and its genetic features remain largely unknown. This study aimed to search for potential key genes and relevant enriched pathways of insulinoma.The gene expression data from GSE73338 were downloaded from Gene Expression Omnibus database. Differentially expressed genes (DEGs) were identified between insulinoma tissues and normal pancreas tissues, followed by pathway enrichment analysis, protein-protein interaction (PPI) network construction, and module analysis. The expressions of candidate key genes were validated by quantitative real-time polymerase chain reaction (RT-PCR) in insulinoma tissues.A total of 1632 DEGs were obtained, including 1117 upregulated genes and 514 downregulated genes. Pathway enrichment results showed that upregulated DEGs were significantly implicated in insulin secretion, and downregulated DEGs were mainly enriched in pancreatic secretion. PPI network analysis revealed 7 hub genes with degrees more than 10, including GCG (glucagon), GCGR (glucagon receptor), PLCB1 (phospholipase C, beta 1), CASR (calcium sensing receptor), F2R (coagulation factor II thrombin receptor), GRM1 (glutamate metabotropic receptor 1), and GRM5 (glutamate metabotropic receptor 5). DEGs involved in the significant modules were enriched in calcium signaling pathway, protein ubiquitination, and platelet degranulation. Quantitative RT-PCR data confirmed that the expression trends of these hub genes were similar to the results of bioinformatic analysis.The present study demonstrated that candidate DEGs and enriched pathways were the potential critical molecule events involved in the development of insulinoma, and these findings were useful for better understanding of insulinoma genesis.

Identifying positive selection candidate loci for high-altitude adaptation in Andean populations

PubMed Central

2009-01-01

High-altitude environments (>2,500 m) provide scientists with a natural laboratory to study the physiological and genetic effects of low ambient oxygen tension on human populations. One approach to understanding how life at high altitude has affected human metabolism is to survey genome-wide datasets for signatures of natural selection. In this work, we report on a study to identify selection-nominated candidate genes involved in adaptation to hypoxia in one highland group, Andeans from the South American Altiplano. We analysed dense microarray genotype data using four test statistics that detect departures from neutrality. Using a candidate gene, single nucleotide polymorphism-based approach, we identified genes exhibiting preliminary evidence of recent genetic adaptation in this population. These included genes that are part of the hypoxia-inducible transcription factor (HIF) pathway, a biochemical pathway involved in oxygen homeostasis, as well as three other genomic regions previously not known to be associated with high-altitude phenotypes. In addition to identifying selection-nominated candidate genes, we also tested whether the HIF pathway shows evidence of natural selection. Our results indicate that the genes of this biochemical pathway as a group show no evidence of having evolved in response to hypoxia in Andeans. Results from particular HIF-targeted genes, however, suggest that genes in this pathway could play a role in Andean adaptation to high altitude, even if the pathway as a whole does not show higher relative rates of evolution. These data suggest a genetic role in high-altitude adaptation and provide a basis for genotype/phenotype association studies that are necessary to confirm the role of putative natural selection candidate genes and gene regions in adaptation to altitude. PMID:20038496

Genome-Wide Association Mapping Combined with Reverse Genetics Identifies New Effectors of Low Water Potential-Induced Proline Accumulation in Arabidopsis1[W][OPEN

PubMed Central

Verslues, Paul E.; Lasky, Jesse R.; Juenger, Thomas E.; Liu, Tzu-Wen; Kumar, M. Nagaraj

2014-01-01

Arabidopsis (Arabidopsis thaliana) exhibits natural genetic variation in drought response, including varying levels of proline (Pro) accumulation under low water potential. As Pro accumulation is potentially important for stress tolerance and cellular redox control, we conducted a genome-wide association (GWAS) study of low water potential-induced Pro accumulation using a panel of natural accessions and publicly available single-nucleotide polymorphism (SNP) data sets. Candidate genomic regions were prioritized for subsequent study using metrics considering both the strength and spatial clustering of the association signal. These analyses found many candidate regions likely containing gene(s) influencing Pro accumulation. Reverse genetic analysis of several candidates identified new Pro effector genes, including thioredoxins and several genes encoding Universal Stress Protein A domain proteins. These new Pro effector genes further link Pro accumulation to cellular redox and energy status. Additional new Pro effector genes found include the mitochondrial protease LON1, ribosomal protein RPL24A, protein phosphatase 2A subunit A3, a MADS box protein, and a nucleoside triphosphate hydrolase. Several of these new Pro effector genes were from regions with multiple SNPs, each having moderate association with Pro accumulation. This pattern supports the use of summary approaches that incorporate clusters of SNP associations in addition to consideration of individual SNP probability values. Further GWAS-guided reverse genetics promises to find additional effectors of Pro accumulation. The combination of GWAS and reverse genetics to efficiently identify new effector genes may be especially applicable for traits difficult to analyze by other genetic screening methods. PMID:24218491

Association of polymorphisms in growth hormone and leptin candidate genes with live weight traits of Brahman cattle.

PubMed

Hernández, N; Martínez-González, J C; Parra-Bracamonte, G M; Sifuentes-Rincón, A M; López-Villalobos, N; Morris, S T; Briones-Encinia, F; Ortega-Rivas, E; Pacheco-Contreras, V I; L A Meza-García, And

2016-09-02

Polymorphisms in candidate genes can produce significant and favorable changes in the phenotype, and therefore are useful for the identification of the best combination of favorable variants for marker-assisted selection. In the present study, an assessment to evaluate the effect of 11 single nucleotide polymorphisms (SNPs) in candidate genes on live weight traits of registered Brahman cattle was performed. Data from purebred bulls were used in this assessment. The dataset included birth (BW), weaning (WW), and yearling (YW) weights. A panel of 11 SNP markers, selected by their formerly reported or apparent direct and indirect association with live weight traits, was included in an assessment previously confirming their minimum allele frequency (<0.05). Live weights were adjusted BW (aBW), WW (aWW), and YW (aYW) using a generalized linear model, which included the fixed effects of herd and season of birth and the random effect of the sire and year of birth. An SNP in a growth hormone gene (GH4.1) was significantly related to aWW (P = 0.035) with an estimate substitution effect of 3.97 kg (P = 0.0210). In addition, a leptin SNP (LEPg.978) was significantly associated with aYW (P = 0.003) with an estimate substitution effect of 9.57 kg (P = 0.0007). The results suggest that markers GH4.1 and LEPg.978 can be considered as candidate loci for assisted genetic improvement programs in Mexican Brahman cattle.

Transcription map of Xq27: candidates for several X-linked diseases.

PubMed

Zucchi, I; Jones, J; Affer, M; Montagna, C; Redolfi, E; Susani, L; Vezzoni, P; Parvari, R; Schlessinger, D; Whyte, M P; Mumm, S

1999-04-15

Human Xq27 contains candidate regions for several disorders, yet is predicted to be a gene-poor cytogenetic band. We have developed a transcription map for the entire cytogenetic band to facilitate the identification of the relatively small number of expected candidate genes. Two approaches were taken to identify genes: (1) a group of 64 unique STSs that were generated during the physical mapping of the region were used in RT-PCR with RNA from human adult and fetal brain and (2) ESTs that have been broadly mapped to this region of the chromosome were finely mapped using a high-resolution yeast artificial chromosome contig. This combined approach identified four distinct regions of transcriptional activity within the Xq27 band. Among them is a region at the centromeric boundary that contains candidate regions for several rare developmental disorders (X-linked recessive hypoparathyroidism, thoracoabdominal syndrome, albinism-deafness syndrome, and Borjeson-Forssman-Lehman syndrome). Two transcriptionally active regions were identified in the center of Xq27 and include candidate regions for X-linked mental retardation syndrome 6, X-linked progressive cone dystrophy, X-linked retinitis pigmentosa 24, and a prostate cancer susceptibility locus. The fourth region of transcriptional activity encompasses the FMR1 (FRAXA) and FMR2 (FRAXE) genes. The analysis thus suggests clustered transcription in Xq27 and provides candidates for several heritable disorders for which the causative genes have not yet been found. Copyright 1999 Academic Press.

The prediction of candidate genes for cervix related cancer through gene ontology and graph theoretical approach.

PubMed

Hindumathi, V; Kranthi, T; Rao, S B; Manimaran, P

2014-06-01

With rapidly changing technology, prediction of candidate genes has become an indispensable task in recent years mainly in the field of biological research. The empirical methods for candidate gene prioritization that succors to explore the potential pathway between genetic determinants and complex diseases are highly cumbersome and labor intensive. In such a scenario predicting potential targets for a disease state through in silico approaches are of researcher's interest. The prodigious availability of protein interaction data coupled with gene annotation renders an ease in the accurate determination of disease specific candidate genes. In our work we have prioritized the cervix related cancer candidate genes by employing Csaba Ortutay and his co-workers approach of identifying the candidate genes through graph theoretical centrality measures and gene ontology. With the advantage of the human protein interaction data, cervical cancer gene sets and the ontological terms, we were able to predict 15 novel candidates for cervical carcinogenesis. The disease relevance of the anticipated candidate genes was corroborated through a literature survey. Also the presence of the drugs for these candidates was detected through Therapeutic Target Database (TTD) and DrugMap Central (DMC) which affirms that they may be endowed as potential drug targets for cervical cancer.

Exome Sequencing and Linkage Analysis Identified Novel Candidate Genes in Recessive Intellectual Disability Associated with Ataxia.

PubMed

Jazayeri, Roshanak; Hu, Hao; Fattahi, Zohreh; Musante, Luciana; Abedini, Seyedeh Sedigheh; Hosseini, Masoumeh; Wienker, Thomas F; Ropers, Hans Hilger; Najmabadi, Hossein; Kahrizi, Kimia

2015-10-01

Intellectual disability (ID) is a neuro-developmental disorder which causes considerable socio-economic problems. Some ID individuals are also affected by ataxia, and the condition includes different mutations affecting several genes. We used whole exome sequencing (WES) in combination with homozygosity mapping (HM) to identify the genetic defects in five consanguineous families among our cohort study, with two affected children with ID and ataxia as major clinical symptoms. We identified three novel candidate genes, RIPPLY1, MRPL10, SNX14, and a new mutation in known gene SURF1. All are autosomal genes, except RIPPLY1, which is located on the X chromosome. Two are housekeeping genes, implicated in transcription and translation regulation and intracellular trafficking, and two encode mitochondrial proteins. The pathogenesis of these variants was evaluated by mutation classification, bioinformatic methods, review of medical and biological relevance, co-segregation studies in the particular family, and a normal population study. Linkage analysis and exome sequencing of a small number of affected family members is a powerful new technique which can be used to decrease the number of candidate genes in heterogenic disorders such as ID, and may even identify the responsible gene(s).

Investigation of previously implicated genetic variants in chronic tic disorders: a transmission disequilibrium test approach.

PubMed

Abdulkadir, Mohamed; Londono, Douglas; Gordon, Derek; Fernandez, Thomas V; Brown, Lawrence W; Cheon, Keun-Ah; Coffey, Barbara J; Elzerman, Lonneke; Fremer, Carolin; Fründt, Odette; Garcia-Delgar, Blanca; Gilbert, Donald L; Grice, Dorothy E; Hedderly, Tammy; Heyman, Isobel; Hong, Hyun Ju; Huyser, Chaim; Ibanez-Gomez, Laura; Jakubovski, Ewgeni; Kim, Young Key; Kim, Young Shin; Koh, Yun-Joo; Kook, Sodahm; Kuperman, Samuel; Leventhal, Bennett; Ludolph, Andrea G; Madruga-Garrido, Marcos; Maras, Athanasios; Mir, Pablo; Morer, Astrid; Müller-Vahl, Kirsten; Münchau, Alexander; Murphy, Tara L; Plessen, Kerstin J; Roessner, Veit; Shin, Eun-Young; Song, Dong-Ho; Song, Jungeun; Tübing, Jennifer; van den Ban, Els; Visscher, Frank; Wanderer, Sina; Woods, Martin; Zinner, Samuel H; King, Robert A; Tischfield, Jay A; Heiman, Gary A; Hoekstra, Pieter J; Dietrich, Andrea

2018-04-01

Genetic studies in Tourette syndrome (TS) are characterized by scattered and poorly replicated findings. We aimed to replicate findings from candidate gene and genome-wide association studies (GWAS). Our cohort included 465 probands with chronic tic disorder (93% TS) and both parents from 412 families (some probands were siblings). We assessed 75 single nucleotide polymorphisms (SNPs) in 465 parent-child trios; 117 additional SNPs in 211 trios; and 4 additional SNPs in 254 trios. We performed SNP and gene-based transmission disequilibrium tests and compared nominally significant SNP results with those from a large independent case-control cohort. After quality control 71 SNPs were available in 371 trios; 112 SNPs in 179 trios; and 3 SNPs in 192 trios. 17 were candidate SNPs implicated in TS and 2 were implicated in obsessive-compulsive disorder (OCD) or autism spectrum disorder (ASD); 142 were tagging SNPs from eight monoamine neurotransmitter-related genes (including dopamine and serotonin); 10 were top SNPs from TS GWAS; and 13 top SNPs from attention-deficit/hyperactivity disorder, OCD, or ASD GWAS. None of the SNPs or genes reached significance after adjustment for multiple testing. We observed nominal significance for the candidate SNPs rs3744161 (TBCD) and rs4565946 (TPH2) and for five tagging SNPs; none of these showed significance in the independent cohort. Also, SLC1A1 in our gene-based analysis and two TS GWAS SNPs showed nominal significance, rs11603305 (intergenic) and rs621942 (PICALM). We found no convincing support for previously implicated genetic polymorphisms. Targeted re-sequencing should fully appreciate the relevance of candidate genes.

Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii.

PubMed

Ali, Muhammad Y; Pavasovic, Ana; Dammannagoda, Lalith K; Mather, Peter B; Prentis, Peter J

2017-01-01

Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na + /K + -ATPase (NKA), H + -ATPase (HAT), Na + /K + /2Cl - cotransporter (NKCC), Na + /Cl - /HCO[Formula: see text] cotransporter (NBC), Na + /H + exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca +2 -ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish , Cherax quadricarinatus, C. destructor and C. cainii , with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types.

Identification of QTN and candidate genes for Salinity Tolerance at the Germination and Seedling Stages in Rice by Genome-Wide Association Analyses.

PubMed

Naveed, Shahzad Amir; Zhang, Fan; Zhang, Jian; Zheng, Tian-Qing; Meng, Li-Jun; Pang, Yun-Long; Xu, Jian-Long; Li, Zhi-Kang

2018-04-25

To facilitate developing rice varieties tolerant to salt stress, a panel of 208 rice mini-core accessions collected from 25 countries were evaluated for 13 traits associated with salt tolerance (ST) at the germination and seedling stages. The rice panel showed tremendous variation for all measured ST traits and eight accessions showing high levels of ST at either and/or both the germination and seedling stages. Using 395,553 SNP markers covering ~372 Mb of the rice genome and multi-locus mixed linear models, 20 QTN associated with 11 ST traits were identified by GWAS, including 6 QTN affecting ST at the germination stage and 14 QTN for ST at the seedling stage. The integration of bioinformatic with haplotype analyses for the ST QTN lets us identify 22 candidate genes for nine important ST QTN (qGR3, qSNK1, qSNK12, qSNC1, qSNC6, qRNK2, qSDW9a, qSST5 and qSST9). These candidate genes included three known ST genes (SKC1, OsTZF1 and OsEATB) for QTN qSNK1 qSST5 and qSST9. Candidate genes showed significant phenotypic differences in ST traits were detected between or among 2-4 major haplotypes. Thus, our results provided useful materials and genetic information for improving rice ST in future breeding and for molecular dissection of ST in rice.

Identifying candidate genes for 2p15p16.1 microdeletion syndrome using clinical, genomic, and functional analysis

PubMed Central

Bagheri, Hani; Badduke, Chansonette; Qiao, Ying; Colnaghi, Rita; Abramowicz, Iga; Alcantara, Diana; Dunham, Christopher; Wen, Jiadi; Wildin, Robert S.; Nowaczyk, Malgorzata J.M.; Eichmeyer, Jennifer; Lehman, Anna; Maranda, Bruno; Martell, Sally; Shan, Xianghong; Lewis, Suzanne M.E.; O’Driscoll, Mark; Gregory-Evans, Cheryl Y.

2016-01-01

The 2p15p16.1 microdeletion syndrome has a core phenotype consisting of intellectual disability, microcephaly, hypotonia, delayed growth, common craniofacial features, and digital anomalies. So far, more than 20 cases of 2p15p16.1 microdeletion syndrome have been reported in the literature; however, the size of the deletions and their breakpoints vary, making it difficult to identify the candidate genes. Recent reports pointed to 4 genes (XPO1, USP34, BCL11A, and REL) that were included, alone or in combination, in the smallest deletions causing the syndrome. Here, we describe 8 new patients with the 2p15p16.1 deletion and review all published cases to date. We demonstrate functional deficits for the above 4 candidate genes using patients’ lymphoblast cell lines (LCLs) and knockdown of their orthologs in zebrafish. All genes were dosage sensitive on the basis of reduced protein expression in LCLs. In addition, deletion of XPO1, a nuclear exporter, cosegregated with nuclear accumulation of one of its cargo molecules (rpS5) in patients’ LCLs. Other pathways associated with these genes (e.g., NF-κB and Wnt signaling as well as the DNA damage response) were not impaired in patients’ LCLs. Knockdown of xpo1a, rel, bcl11aa, and bcl11ab resulted in abnormal zebrafish embryonic development including microcephaly, dysmorphic body, hindered growth, and small fins as well as structural brain abnormalities. Our multifaceted analysis strongly implicates XPO1, REL, and BCL11A as candidate genes for 2p15p16.1 microdeletion syndrome. PMID:27699255

Genomic architecture of biomass heterosis in Arabidopsis.

PubMed

Yang, Mei; Wang, Xuncheng; Ren, Diqiu; Huang, Hao; Xu, Miqi; He, Guangming; Deng, Xing Wang

2017-07-25

Heterosis is most frequently manifested by the substantially increased vigorous growth of hybrids compared with their parents. Investigating genomic variations in natural populations is essential to understand the initial molecular mechanisms underlying heterosis in plants. Here, we characterized the genomic architecture associated with biomass heterosis in 200 Arabidopsis hybrids. The genome-wide heterozygosity of hybrids makes a limited contribution to biomass heterosis, and no locus shows an obvious overdominance effect in hybrids. However, the accumulation of significant genetic loci identified in genome-wide association studies (GWAS) in hybrids strongly correlates with better-parent heterosis (BPH). Candidate genes for biomass BPH fall into diverse biological functions, including cellular, metabolic, and developmental processes and stimulus-responsive pathways. Important heterosis candidates include WUSCHEL , ARGOS , and some genes that encode key factors involved in cell cycle regulation. Interestingly, transcriptomic analyses in representative Arabidopsis hybrid combinations reveal that heterosis candidate genes are functionally enriched in stimulus-responsive pathways, including responses to biotic and abiotic stimuli and immune responses. In addition, stimulus-responsive genes are repressed to low-parent levels in hybrids with high BPH, whereas middle-parent expression patterns are exhibited in hybrids with no BPH. Our study reveals a genomic architecture for understanding the molecular mechanisms of biomass heterosis in Arabidopsis , in which the accumulation of the superior alleles of genes involved in metabolic and cellular processes improve the development and growth of hybrids, whereas the overall repressed expression of stimulus-responsive genes prioritizes growth over responding to environmental stimuli in hybrids under normal conditions.

Non-coding cancer driver candidates identified with a sample- and position-specific model of the somatic mutation rate

PubMed Central

Juul, Malene; Bertl, Johanna; Guo, Qianyun; Nielsen, Morten Muhlig; Świtnicki, Michał; Hornshøj, Henrik; Madsen, Tobias; Hobolth, Asger; Pedersen, Jakob Skou

2017-01-01

Non-coding mutations may drive cancer development. Statistical detection of non-coding driver regions is challenged by a varying mutation rate and uncertainty of functional impact. Here, we develop a statistically founded non-coding driver-detection method, ncdDetect, which includes sample-specific mutational signatures, long-range mutation rate variation, and position-specific impact measures. Using ncdDetect, we screened non-coding regulatory regions of protein-coding genes across a pan-cancer set of whole-genomes (n = 505), which top-ranked known drivers and identified new candidates. For individual candidates, presence of non-coding mutations associates with altered expression or decreased patient survival across an independent pan-cancer sample set (n = 5454). This includes an antigen-presenting gene (CD1A), where 5’UTR mutations correlate significantly with decreased survival in melanoma. Additionally, mutations in a base-excision-repair gene (SMUG1) correlate with a C-to-T mutational-signature. Overall, we find that a rich model of mutational heterogeneity facilitates non-coding driver identification and integrative analysis points to candidates of potential clinical relevance. DOI: http://dx.doi.org/10.7554/eLife.21778.001 PMID:28362259

A whole genome SNP genotyping by DNA microarray and candidate gene association study for kidney stone disease

PubMed Central

2014-01-01

Background Kidney stone disease (KSD) is a complex disorder with unknown etiology in majority of the patients. Genetic and environmental factors may cause the disease. In the present study, we used DNA microarray to genotype single nucleotide polymorphisms (SNP) and performed candidate gene association analysis to determine genetic variations associated with the disease. Methods A whole genome SNP genotyping by DNA microarray was initially conducted in 101 patients and 105 control subjects. A set of 104 candidate genes reported to be involved in KSD, gathered from public databases and candidate gene association study databases, were evaluated for their variations associated with KSD. Results Altogether 82 SNPs distributed within 22 candidate gene regions showed significant differences in SNP allele frequencies between the patient and control groups (P < 0.05). Of these, 4 genes including BGLAP, AHSG, CD44, and HAO1, encoding osteocalcin, fetuin-A, CD44-molecule and glycolate oxidase 1, respectively, were further assessed for their associations with the disease because they carried high proportion of SNPs with statistical differences of allele frequencies between the patient and control groups within the gene. The total of 26 SNPs showed significant differences of allele frequencies between the patient and control groups and haplotypes associated with disease risk were identified. The SNP rs759330 located 144 bp downstream of BGLAP where it is a predicted microRNA binding site at 3′UTR of PAQR6 – a gene encoding progestin and adipoQ receptor family member VI, was genotyped in 216 patients and 216 control subjects and found to have significant differences in its genotype and allele frequencies (P = 0.0007, OR 2.02 and P = 0.0001, OR 2.02, respectively). Conclusions Our results suggest that these candidate genes are associated with KSD and PAQR6 comes into our view as the most potent candidate since associated SNP rs759330 is located in the miRNA binding site and may affect mRNA expression level. PMID:24886237

Pivotal role of the muscle-contraction pathway in cryptorchidism and evidence for genomic connections with cardiomyopathy pathways in RASopathies.

PubMed

Cannistraci, Carlo V; Ogorevc, Jernej; Zorc, Minja; Ravasi, Timothy; Dovc, Peter; Kunej, Tanja

2013-02-14

Cryptorchidism is the most frequent congenital disorder in male children; however the genetic causes of cryptorchidism remain poorly investigated. Comparative integratomics combined with systems biology approach was employed to elucidate genetic factors and molecular pathways underlying testis descent. Literature mining was performed to collect genomic loci associated with cryptorchidism in seven mammalian species. Information regarding the collected candidate genes was stored in MySQL relational database. Genomic view of the loci was presented using Flash GViewer web tool (http://gmod.org/wiki/Flashgviewer/). DAVID Bioinformatics Resources 6.7 was used for pathway enrichment analysis. Cytoscape plug-in PiNGO 1.11 was employed for protein-network-based prediction of novel candidate genes. Relevant protein-protein interactions were confirmed and visualized using the STRING database (version 9.0). The developed cryptorchidism gene atlas includes 217 candidate loci (genes, regions involved in chromosomal mutations, and copy number variations) identified at the genomic, transcriptomic, and proteomic level. Human orthologs of the collected candidate loci were presented using a genomic map viewer. The cryptorchidism gene atlas is freely available online: http://www.integratomics-time.com/cryptorchidism/. Pathway analysis suggested the presence of twelve enriched pathways associated with the list of 179 literature-derived candidate genes. Additionally, a list of 43 network-predicted novel candidate genes was significantly associated with four enriched pathways. Joint pathway analysis of the collected and predicted candidate genes revealed the pivotal importance of the muscle-contraction pathway in cryptorchidism and evidence for genomic associations with cardiomyopathy pathways in RASopathies. The developed gene atlas represents an important resource for the scientific community researching genetics of cryptorchidism. The collected data will further facilitate development of novel genetic markers and could be of interest for functional studies in animals and human. The proposed network-based systems biology approach elucidates molecular mechanisms underlying co-presence of cryptorchidism and cardiomyopathy in RASopathies. Such approach could also aid in molecular explanation of co-presence of diverse and apparently unrelated clinical manifestations in other syndromes.

Genetics of human neural tube defects

PubMed Central

Greene, Nicholas D.E.; Stanier, Philip; Copp, Andrew J.

2009-01-01

Neural tube defects (NTDs) are common, severe congenital malformations whose causation involves multiple genes and environmental factors. Although more than 200 genes are known to cause NTDs in mice, there has been rather limited progress in delineating the molecular basis underlying most human NTDs. Numerous genetic studies have been carried out to investigate candidate genes in cohorts of patients, with particular reference to those that participate in folate one-carbon metabolism. Although the homocysteine remethylation gene MTHFR has emerged as a risk factor in some human populations, few other consistent findings have resulted from this approach. Similarly, attention focused on the human homologues of mouse NTD genes has contributed only limited positive findings to date, although an emerging association between genes of the non-canonical Wnt (planar cell polarity) pathway and NTDs provides candidates for future studies. Priorities for the next phase of this research include: (i) larger studies that are sufficiently powered to detect significant associations with relatively minor risk factors; (ii) analysis of multiple candidate genes in groups of well-genotyped individuals to detect possible gene–gene interactions; (iii) use of high throughput genomic technology to evaluate the role of copy number variants and to detect ‘private’ and regulatory mutations, neither of which have been studied to date; (iv) detailed analysis of patient samples stratified by phenotype to enable, for example, hypothesis-driven testing of candidates genes in groups of NTDs with specific defects of folate metabolism, or in groups of fetuses with well-defined phenotypes such as craniorachischisis. PMID:19808787

Candidate gene association studies in syndromic and non-syndromic cleft lip and palate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daack-Hirsch, S.; Basart, A.; Frischmeyer, P.

1994-09-01

Using ongoing case ascertainment through a birth defects registry, we have collected 219 nuclear families with non-syndromic cleft lip and/or palate and 111 families with a collection of syndromic forms. Syndromic cases include 24 with recognized forms and 72 with unrecognized syndromes. Candidate gene studies as well as genome-wide searches for evidence of microdeletions and isodisomy are currently being carried out. Candidate gene association studies, to date, have made use of PCR-based polymorphisms for TGFA, MSX1, CLPG13 (a CA repeat associated with a human homologue of a locus that results in craniofacial dysmorphogenesis in the mouse) and an STRP foundmore » in a Van der Woude syndrome microdeletion. Control tetranucleotide repeats, which insure that population-based differences are not responsible for any observed associations, are also tested. Studies of the syndromic cases have included the same list of candidate genes searching for evidence of microdeletions and a genome-wide search using tri- and tetranucleotide polymorphic markers to search for isodisomy or structural rearrangements. Significant associations have previously been identified for TGFA, and, in this report, identified for MSX1 and nonsyndromic cleft palate only (p = 0.04, uncorrected). Preliminary results of the genome-wide scan for isodisomy has returned no true positives and there has been no evidence for microdeletion cases.« less

Analysis of shared homozygosity regions in Saudi siblings with attention deficit hyperactivity disorder

PubMed Central

Al Yemni, Eman A.A.; Alnaemi, Faten M.; Abebe, Dejene; Al-Abdulaziz, Basma S.; Al Mubarak, Bashayer R.; Ghaziuddin, Mohammad; Al Tassan, Nada A.

2017-01-01

Aim Genetic and clinical complexities are common features of most psychiatric illnesses that pose a major obstacle in risk-gene identification. Attention deficit hyperactivity disorder (ADHD) is the most prevalent child-onset psychiatric illness, with high heritability. Over the past decade, numerous genetic studies utilizing various approaches, such as genome-wide association, candidate-gene association, and linkage analysis, have identified a multitude of candidate loci/genes. However, such studies have yielded diverse findings that are rarely reproduced, indicating that other genetic determinants have not been discovered yet. In this study, we carried out sib-pair analysis on seven multiplex families with ADHD from Saudi Arabia. We aimed to identify the candidate chromosomal regions and genes linked to the disease. Patients and methods A total of 41 individuals from multiplex families were analyzed for shared regions of homozygosity. Genes within these regions were prioritized according to their potential relevance to ADHD. Results We identified multiple genomic regions spanning different chromosomes to be shared among affected members of each family; these included chromosomes 3, 5, 6, 7, 8, 9, 10, 13, 17, and 18. We also found specific regions on chromosomes 8 and 17 to be shared between affected individuals from more than one family. Among the genes present in the regions reported here were involved in neurotransmission (GRM3, SIGMAR1, CHAT, and SLC18A3) and members of the HLA gene family (HLA-A, HLA-DPA1, and MICC). Conclusion The candidate regions identified in this study highlight the genetic diversity of ADHD. Upon further investigation, these loci may reveal candidate genes that enclose variants associated with ADHD. Although most ADHD studies were conducted in other populations, our study provides insight from an understudied, ethnically interesting population. PMID:28452824

Analysis of shared homozygosity regions in Saudi siblings with attention deficit hyperactivity disorder.

PubMed

Shinwari, Jameela M A; Al Yemni, Eman A A; Alnaemi, Faten M; Abebe, Dejene; Al-Abdulaziz, Basma S; Al Mubarak, Bashayer R; Ghaziuddin, Mohammad; Al Tassan, Nada A

2017-08-01

Genetic and clinical complexities are common features of most psychiatric illnesses that pose a major obstacle in risk-gene identification. Attention deficit hyperactivity disorder (ADHD) is the most prevalent child-onset psychiatric illness, with high heritability. Over the past decade, numerous genetic studies utilizing various approaches, such as genome-wide association, candidate-gene association, and linkage analysis, have identified a multitude of candidate loci/genes. However, such studies have yielded diverse findings that are rarely reproduced, indicating that other genetic determinants have not been discovered yet. In this study, we carried out sib-pair analysis on seven multiplex families with ADHD from Saudi Arabia. We aimed to identify the candidate chromosomal regions and genes linked to the disease. A total of 41 individuals from multiplex families were analyzed for shared regions of homozygosity. Genes within these regions were prioritized according to their potential relevance to ADHD. We identified multiple genomic regions spanning different chromosomes to be shared among affected members of each family; these included chromosomes 3, 5, 6, 7, 8, 9, 10, 13, 17, and 18. We also found specific regions on chromosomes 8 and 17 to be shared between affected individuals from more than one family. Among the genes present in the regions reported here were involved in neurotransmission (GRM3, SIGMAR1, CHAT, and SLC18A3) and members of the HLA gene family (HLA-A, HLA-DPA1, and MICC). The candidate regions identified in this study highlight the genetic diversity of ADHD. Upon further investigation, these loci may reveal candidate genes that enclose variants associated with ADHD. Although most ADHD studies were conducted in other populations, our study provides insight from an understudied, ethnically interesting population.

TOM: a web-based integrated approach for identification of candidate disease genes.

PubMed

Rossi, Simona; Masotti, Daniele; Nardini, Christine; Bonora, Elena; Romeo, Giovanni; Macii, Enrico; Benini, Luca; Volinia, Stefano

2006-07-01

The massive production of biological data by means of highly parallel devices like microarrays for gene expression has paved the way to new possible approaches in molecular genetics. Among them the possibility of inferring biological answers by querying large amounts of expression data. Based on this principle, we present here TOM, a web-based resource for the efficient extraction of candidate genes for hereditary diseases. The service requires the previous knowledge of at least another gene responsible for the disease and the linkage area, or else of two disease associated genetic intervals. The algorithm uses the information stored in public resources, including mapping, expression and functional databases. Given the queries, TOM will select and list one or more candidate genes. This approach allows the geneticist to bypass the costly and time consuming tracing of genetic markers through entire families and might improve the chance of identifying disease genes, particularly for rare diseases. We present here the tool and the results obtained on known benchmark and on hereditary predisposition to familial thyroid cancer. Our algorithm is available at http://www-micrel.deis.unibo.it/~tom/.

[Molecular genetics of functional articulation disorder in children].

PubMed

Zhao, Yun-Jing; Ma, Hong-Wei

2012-04-01

Genetic factors are an important cause of functional articulation disorder in children. This article reviews some genes and chromosome regions associated with a genetic susceptibility to functional articulation disorders. The forkhead box P2 (FOXP2) gene on chromosome 7 is introduced in details including its structure, expression and function. The relationship between the FOXP2 gene and developmental apraxia of speech is discussed. As a transcription factor, FOXP2 gene regulates the expression of many genes. CNTNAP2 as an important target gene of FOXP2 is a key gene influencing language development. Functional articulation disorder may be developed to dyslexia, therefore some candidate regions and genes related to dyslexia, such as 3p12-13, 15q11-21, 6p22 and 1p34-36, are also introduced. ROBO1 gene in 3p12.3, ZNF280D gene, TCF12 gene, EKN1 gene in 15q21, and KIAA0319 gene in 6p22 have been candidate genes for the study of functional articulation disorder.

An integration of genome-wide association study and gene expression profiling to prioritize the discovery of novel susceptibility Loci for osteoporosis-related traits.

PubMed

Hsu, Yi-Hsiang; Zillikens, M Carola; Wilson, Scott G; Farber, Charles R; Demissie, Serkalem; Soranzo, Nicole; Bianchi, Estelle N; Grundberg, Elin; Liang, Liming; Richards, J Brent; Estrada, Karol; Zhou, Yanhua; van Nas, Atila; Moffatt, Miriam F; Zhai, Guangju; Hofman, Albert; van Meurs, Joyce B; Pols, Huibert A P; Price, Roger I; Nilsson, Olle; Pastinen, Tomi; Cupples, L Adrienne; Lusis, Aldons J; Schadt, Eric E; Ferrari, Serge; Uitterlinden, André G; Rivadeneira, Fernando; Spector, Timothy D; Karasik, David; Kiel, Douglas P

2010-06-10

Osteoporosis is a complex disorder and commonly leads to fractures in elderly persons. Genome-wide association studies (GWAS) have become an unbiased approach to identify variations in the genome that potentially affect health. However, the genetic variants identified so far only explain a small proportion of the heritability for complex traits. Due to the modest genetic effect size and inadequate power, true association signals may not be revealed based on a stringent genome-wide significance threshold. Here, we take advantage of SNP and transcript arrays and integrate GWAS and expression signature profiling relevant to the skeletal system in cellular and animal models to prioritize the discovery of novel candidate genes for osteoporosis-related traits, including bone mineral density (BMD) at the lumbar spine (LS) and femoral neck (FN), as well as geometric indices of the hip (femoral neck-shaft angle, NSA; femoral neck length, NL; and narrow-neck width, NW). A two-stage meta-analysis of GWAS from 7,633 Caucasian women and 3,657 men, revealed three novel loci associated with osteoporosis-related traits, including chromosome 1p13.2 (RAP1A, p = 3.6x10(-8)), 2q11.2 (TBC1D8), and 18q11.2 (OSBPL1A), and confirmed a previously reported region near TNFRSF11B/OPG gene. We also prioritized 16 suggestive genome-wide significant candidate genes based on their potential involvement in skeletal metabolism. Among them, 3 candidate genes were associated with BMD in women. Notably, 2 out of these 3 genes (GPR177, p = 2.6x10(-13); SOX6, p = 6.4x10(-10)) associated with BMD in women have been successfully replicated in a large-scale meta-analysis of BMD, but none of the non-prioritized candidates (associated with BMD) did. Our results support the concept of our prioritization strategy. In the absence of direct biological support for identified genes, we highlighted the efficiency of subsequent functional characterization using publicly available expression profiling relevant to the skeletal system in cellular or whole animal models to prioritize candidate genes for further functional validation.

No Evidence That Schizophrenia Candidate Genes Are More Associated With Schizophrenia Than Noncandidate Genes.

PubMed

Johnson, Emma C; Border, Richard; Melroy-Greif, Whitney E; de Leeuw, Christiaan A; Ehringer, Marissa A; Keller, Matthew C

2017-11-15

A recent analysis of 25 historical candidate gene polymorphisms for schizophrenia in the largest genome-wide association study conducted to date suggested that these commonly studied variants were no more associated with the disorder than would be expected by chance. However, the same study identified other variants within those candidate genes that demonstrated genome-wide significant associations with schizophrenia. As such, it is possible that variants within historic schizophrenia candidate genes are associated with schizophrenia at levels above those expected by chance, even if the most-studied specific polymorphisms are not. The present study used association statistics from the largest schizophrenia genome-wide association study conducted to date as input to a gene set analysis to investigate whether variants within schizophrenia candidate genes are enriched for association with schizophrenia. As a group, variants in the most-studied candidate genes were no more associated with schizophrenia than were variants in control sets of noncandidate genes. While a small subset of candidate genes did appear to be significantly associated with schizophrenia, these genes were not particularly noteworthy given the large number of more strongly associated noncandidate genes. The history of schizophrenia research should serve as a cautionary tale to candidate gene investigators examining other phenotypes: our findings indicate that the most investigated candidate gene hypotheses of schizophrenia are not well supported by genome-wide association studies, and it is likely that this will be the case for other complex traits as well. Copyright © 2017 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Photoreceptor dysplasia (pd) in miniature schnauzer dogs: evaluation of candidate genes by molecular genetic analysis.

PubMed

Zhang, Q; Baldwin, V J; Acland, G M; Parshall, C J; Haskel, J; Aguirre, G D; Ray, K

1999-01-01

Photoreceptor dysplasia (pd) is one of a group of at least six distinct autosomal and one X-linked retinal disorders identified in dogs which are collectively known as progressive retinal atrophy (PRA). It is an early onset retinal disease identified in miniature schnauzer dogs, and pedigree analysis and breeding studies have established autosomal recessive inheritance of the disease. Using a gene-based approach, a number of retina-expressed genes, including some members of the phototransduction pathway, have been causally implicated in retinal diseases of humans and other animals. Here we examined seven such potential candidate genes (opsin, RDS/peripherin, ROM1, rod cGMP-gated cation channel alpha-subunit, and three subunits of transducin) for their causal association with the pd locus by testing segregation of intragenic markers with the disease locus, or, in the absence of informative polymorphisms, sequencing of the coding regions of the genes. Based on these results, we have conclusively excluded four photoreceptor-specific genes as candidates for pd by linkage analysis. For three other photoreceptor-specific genes, we did not find any mutation in the coding sequences of the genes and have excluded them provisionally. Formal exclusion would require investigation of the levels of expression of the candidate genes in pd-affected dogs relative to age-matched controls. At present we are building suitable informative pedigrees for the disease locus with a sufficient number of meiosis to be useful for genomewide screening. This should identify markers linked to the disease locus and eventually permit progress toward the identification of the photoreceptor dysplasia gene and the disease-causing mutation.

[Linkage analysis of a family with familial hypertriglyceridemia].

PubMed

Tang, Xin; Lin, Ying; Liu, Bing; Ma, Shi; Yang, Yang; Yang, Zheng-lin

2009-10-01

To perform linkage analysis and mutation screening in a Chinese family with familial hpertriglyceridemia (FHTG). Thirty-two family members including 12 hypertriglyceridemia patients participated in the study. Genotyping and haplotype analysis for 22 subjects were performed using short tandem repeat (STR) microsatellite polymorphism markers on 16 candidate genes and/or loci related to lipid metabolism. Two of the sixteen known candidate genes, APOA2 and USF1 were screened for mutation by direct DNA sequencing. No linkage was found between the candidate genes/loci of APOA5, LIPI, RP1, APOC2, ABC1, LMF1, APOA1-APOC3-APOA4, LPL, APOB, CETP, LCAT, LDLR, APOE and the phenotype in this family. The two-point Lod scores (theta =0) were all less than-1.0 for all the markers tested. Linkage analysis suggested linkage to chromosome 1q23.3-24.2 between the disease phenotype and STR marker D1S194 with a two-point maximum Lod score of 2.44 at theta =0. Fine mapping indicated that the disease gene was localized to a 5.87 cM interval between D1S104 and D1S196. No disease-causing mutation was detected in the APOA2 and USF1 genes. The above mentioned candidate genes were excluded as the disease causing genes for this family. The results implied that there might be a novel gene/locus for FHTG on chromosome 1q23.3-1q24.2.

Identification of a duplication within the GDF9 gene and novel candidate genes for primary ovarian insufficiency (POI) by a customized high-resolution array comparative genomic hybridization platform.

PubMed

Norling, A; Hirschberg, A L; Rodriguez-Wallberg, K A; Iwarsson, E; Wedell, A; Barbaro, M

2014-08-01

Can high-resolution array comparative genomic hybridization (CGH) analysis of DNA samples from women with primary ovarian insufficiency (POI) improve the diagnosis of the condition and identify novel candidate genes for POI? A mutation affecting the regulatory region of growth differentiation factor 9 (GDF9) was identified for the first time together with several novel candidate genes for POI. Most patients with POI do not receive a molecular diagnosis despite a significant genetic component in the pathogenesis. We performed a case-control study. Twenty-six patients were analyzed by array CGH for identification of copy number variants. Novel changes were investigated in 95 controls and in a separate population of 28 additional patients with POI. The experimental procedures were performed during a 1-year period. DNA samples from 26 patients with POI were analyzed by a customized 1M array-CGH platform with whole genome coverage and probe enrichment targeting 78 genes in sex development. By PCR amplification and sequencing, the breakpoint of an identified partial GDF9 gene duplication was characterized. A multiplex ligation-dependent probe amplification (MLPA) probe set for specific identification of deletions/duplications affecting GDF9 was developed. An MLPA probe set for the identification of additional cases or controls carrying novel candidate regions identified by array-CGH was developed. Sequencing of three candidate genes was performed. Eleven unique copy number changes were identified in a total of 11 patients, including a tandem duplication of 475 bp, containing part of the GDF9 gene promoter region. The duplicated region contains three NOBOX-binding elements and an E-box, important for GDF9 gene regulation. This aberration is likely causative of POI. Fifty-four patients were investigated for copy number changes within GDF9, but no additional cases were found. Ten aberrations constituting novel candidate regions were detected, including a second DNAH6 deletion in a patient with POI. Other identified candidate genes were TSPYL6, SMARCC1, CSPG5 and ZFR2. This is a descriptive study and no functional experiments were performed. The study illustrates the importance of analyzing small copy number changes in addition to sequence alterations in the genetic investigation of patients with POI. Also, promoter regions should be included in the investigation. The study was supported by grants from the Swedish Research council (project no 12198 to A.W. and project no 20324 to A.L.H.), Stockholm County Council (E.I., A.W. and K.R.W.), Foundation Frimurare Barnhuset (A.N., A.W. and M.B.), Karolinska Institutet (A.N., A.L.H., E.I., A.W. and M.B.), Novo Nordic Foundation (A.W.) and Svenska Läkaresällskapet (M.B.). The funding sources had no involvement in the design or analysis of the study. The authors have no competing interests to declare. Not applicable. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.

Exploiting Differential Gene Expression and Epistasis to Discover Candidate Genes for Drought-Associated QTLs in Arabidopsis thaliana.

PubMed

Lovell, John T; Mullen, Jack L; Lowry, David B; Awole, Kedija; Richards, James H; Sen, Saunak; Verslues, Paul E; Juenger, Thomas E; McKay, John K

2015-04-01

Soil water availability represents one of the most important selective agents for plants in nature and the single greatest abiotic determinant of agricultural productivity, yet the genetic bases of drought acclimation responses remain poorly understood. Here, we developed a systems-genetic approach to characterize quantitative trait loci (QTLs), physiological traits and genes that affect responses to soil moisture deficit in the TSUxKAS mapping population of Arabidopsis thaliana. To determine the effects of candidate genes underlying QTLs, we analyzed gene expression as a covariate within the QTL model in an effort to mechanistically link markers, RNA expression, and the phenotype. This strategy produced ranked lists of candidate genes for several drought-associated traits, including water use efficiency, growth, abscisic acid concentration (ABA), and proline concentration. As a proof of concept, we recovered known causal loci for several QTLs. For other traits, including ABA, we identified novel loci not previously associated with drought. Furthermore, we documented natural variation at two key steps in proline metabolism and demonstrated that the mitochondrial genome differentially affects genomic QTLs to influence proline accumulation. These findings demonstrate that linking genome, transcriptome, and phenotype data holds great promise to extend the utility of genetic mapping, even when QTL effects are modest or complex. © 2015 American Society of Plant Biologists. All rights reserved.

Comprehensive genomic analysis of patients with disorders of cerebral cortical development.

PubMed

Wiszniewski, Wojciech; Gawlinski, Pawel; Gambin, Tomasz; Bekiesinska-Figatowska, Monika; Obersztyn, Ewa; Antczak-Marach, Dorota; Akdemir, Zeynep Hande Coban; Harel, Tamar; Karaca, Ender; Jurek, Marta; Sobecka, Katarzyna; Nowakowska, Beata; Kruk, Malgorzata; Terczynska, Iwona; Goszczanska-Ciuchta, Alicja; Rudzka-Dybala, Mariola; Jamroz, Ewa; Pyrkosz, Antoni; Jakubiuk-Tomaszuk, Anna; Iwanowski, Piotr; Gieruszczak-Bialek, Dorota; Piotrowicz, Malgorzata; Sasiadek, Maria; Kochanowska, Iwona; Gurda, Barbara; Steinborn, Barbara; Dawidziuk, Mateusz; Castaneda, Jennifer; Wlasienko, Pawel; Bezniakow, Natalia; Jhangiani, Shalini N; Hoffman-Zacharska, Dorota; Bal, Jerzy; Szczepanik, Elzbieta; Boerwinkle, Eric; Gibbs, Richard A; Lupski, James R

2018-04-30

Malformations of cortical development (MCDs) manifest with structural brain anomalies that lead to neurologic sequelae, including epilepsy, cerebral palsy, developmental delay, and intellectual disability. To investigate the underlying genetic architecture of patients with disorders of cerebral cortical development, a cohort of 54 patients demonstrating neuroradiologic signs of MCDs was investigated. Individual genomes were interrogated for single-nucleotide variants (SNV) and copy number variants (CNV) with whole-exome sequencing and chromosomal microarray studies. Variation affecting known MCDs-associated genes was found in 16/54 cases, including 11 patients with SNV, 2 patients with CNV, and 3 patients with both CNV and SNV, at distinct loci. Diagnostic pathogenic SNV and potentially damaging variants of unknown significance (VUS) were identified in two groups of seven individuals each. We demonstrated that de novo variants are important among patients with MCDs as they were identified in 10/16 individuals with a molecular diagnosis. Three patients showed changes in known MCDs genes  and a clinical phenotype beyond the usual characteristics observed, i.e., phenotypic expansion, for a particular known disease gene clinical entity. We also discovered 2 likely candidate genes, CDH4, and ASTN1, with human and animal studies supporting their roles in brain development, and 5 potential candidate genes. Our findings emphasize genetic heterogeneity of MCDs disorders and postulate potential novel candidate genes involved in cerebral cortical development.

Integration of biological data by kernels on graph nodes allows prediction of new genes involved in mitotic chromosome condensation

PubMed Central

Hériché, Jean-Karim; Lees, Jon G.; Morilla, Ian; Walter, Thomas; Petrova, Boryana; Roberti, M. Julia; Hossain, M. Julius; Adler, Priit; Fernández, José M.; Krallinger, Martin; Haering, Christian H.; Vilo, Jaak; Valencia, Alfonso; Ranea, Juan A.; Orengo, Christine; Ellenberg, Jan

2014-01-01

The advent of genome-wide RNA interference (RNAi)–based screens puts us in the position to identify genes for all functions human cells carry out. However, for many functions, assay complexity and cost make genome-scale knockdown experiments impossible. Methods to predict genes required for cell functions are therefore needed to focus RNAi screens from the whole genome on the most likely candidates. Although different bioinformatics tools for gene function prediction exist, they lack experimental validation and are therefore rarely used by experimentalists. To address this, we developed an effective computational gene selection strategy that represents public data about genes as graphs and then analyzes these graphs using kernels on graph nodes to predict functional relationships. To demonstrate its performance, we predicted human genes required for a poorly understood cellular function—mitotic chromosome condensation—and experimentally validated the top 100 candidates with a focused RNAi screen by automated microscopy. Quantitative analysis of the images demonstrated that the candidates were indeed strongly enriched in condensation genes, including the discovery of several new factors. By combining bioinformatics prediction with experimental validation, our study shows that kernels on graph nodes are powerful tools to integrate public biological data and predict genes involved in cellular functions of interest. PMID:24943848

Genetic structure of the mating-type locus of Chlamydomonas reinhardtii.

PubMed Central

Ferris, Patrick J; Armbrust, E Virginia; Goodenough, Ursula W

2002-01-01

Portions of the cloned mating-type (MT) loci (mt(+) and mt(-)) of Chlamydomonas reinhardtii, defined as the approximately 1-Mb domains of linkage group VI that are under recombinational suppression, were subjected to Northern analysis to elucidate their coding capacity. The four central rearranged segments of the loci were found to contain both housekeeping genes (expressed during several life-cycle stages) and mating-related genes, while the sequences unique to mt(+) or mt(-) carried genes expressed only in the gametic or zygotic phases of the life cycle. One of these genes, Mtd1, is a candidate participant in gametic cell fusion; two others, Mta1 and Ezy2, are candidate participants in the uniparental inheritance of chloroplast DNA. The identified housekeeping genes include Pdk, encoding pyruvate dehydrogenase kinase, and GdcH, encoding glycine decarboxylase complex subunit H. Unusual genetic configurations include three genes whose sequences overlap, one gene that has inserted into the coding region of another, several genes that have been inactivated by rearrangements in the region, and genes that have undergone tandem duplication. This report extends our original conclusion that the MT locus has incurred high levels of mutational change. PMID:11805055

Differential Connectivity in Colorectal Cancer Gene Expression Network

PubMed

Izadi, Fereshteh

2018-05-30

Colorectal cancer (CRC) is one of the challenging types of cancers; thus, exploring effective biomarkers related to colorectal could lead to significant progresses toward the treatment of this disease. In the present study, CRC gene expression datasets have been reanalyzed. Mutual differentially expressed genes across 294 normal mucosa and adjacent tumoral samples were then utilized in order to build two independent transcriptional regulatory networks. By analyzing the networks topologically, genes with differential global connectivity related to cancer state were determined for which the potential transcriptional regulators including transcription factors were identified. The majority of differentially connected genes (DCGs) were up-regulated in colorectal transcriptome experiments. Moreover, a number of these genes have been experimentally validated as cancer or CRC-associated genes. The DCGs, including GART, TGFB1, ITGA2, SLC16A5, SOX9, and MMP7, were investigated across 12 cancer types. Functional enrichment analysis followed by detailed data mining exhibited that these candidate genes could be related to CRC by mediating in metastatic cascade in addition to shared pathways with 12 cancer types by triggering the inflammatory events Our study uncovered correlated alterations in gene expression related to CRC susceptibility and progression that the potent candidate biomarkers could provide a link to disease.

No Association between Personality and Candidate Gene Polymorphisms in a Wild Bird Population

PubMed Central

Durieux, Gillian; Burke, Terry; Dugdale, Hannah L.

2015-01-01

Consistency of between-individual differences in behaviour or personality is a phenomenon in populations that can have ecological consequences and evolutionary potential. One way that behaviour can evolve is to have a genetic basis. Identifying the molecular genetic basis of personality could therefore provide insight into how and why such variation is maintained, particularly in natural populations. Previously identified candidate genes for personality in birds include the dopamine receptor D4 (DRD4), and serotonin transporter (SERT). Studies of wild bird populations have shown that exploratory and bold behaviours are associated with polymorphisms in both DRD4 and SERT. Here we tested for polymorphisms in DRD4 and SERT in the Seychelles warbler (Acrocephalus sechellensis) population on Cousin Island, Seychelles, and then investigated correlations between personality and polymorphisms in these genes. We found no genetic variation in DRD4, but identified four polymorphisms in SERT that clustered into five haplotypes. There was no correlation between bold or exploratory behaviours and SERT polymorphisms/haplotypes. The null result was not due to lack of power, and indicates that there was no association between these behaviours and variation in the candidate genes tested in this population. These null findings provide important data to facilitate representative future meta-analyses on candidate personality genes. PMID:26473495

Mapping and Genetic Structure Analysis of the Anthracnose Resistance Locus Co-1HY in the Common Bean (Phaseolus vulgaris L.).

PubMed

Chen, Mingli; Wu, Jing; Wang, Lanfen; Mantri, Nitin; Zhang, Xiaoyan; Zhu, Zhendong; Wang, Shumin

2017-01-01

Anthracnose is a destructive disease of the common bean (Phaseolus vulgaris L.). The Andean cultivar Hongyundou has been demonstrated to possess strong resistance to anthracnose race 81. To study the genetics of this resistance, the Hongyundou cultivar was crossed with a susceptible genotype Jingdou. Segregation of resistance for race 81 was assessed in the F2 population and F2:3 lines under controlled conditions. Results indicate that Hongyundou carries a single dominant gene for anthracnose resistance. An allele test by crossing Hongyundou with another resistant cultivar revealed that the resistance gene is in the Co-1 locus (therefore named Co-1HY). The physical distance between this locus and the two flanking markers was 46 kb, and this region included four candidate genes, namely, Phvul.001G243500, Phvul.001G243600, Phvul.001G243700 and Phvul.001G243800. These candidate genes encoded serine/threonine-protein kinases. Expression analysis of the four candidate genes in the resistant and susceptible cultivars under control condition and inoculated treatment revealed that all the four candidate genes are expressed at significantly higher levels in the resistant genotype than in susceptible genotype. Phvul.001G243600 and Phvul.001G243700 are expressed nearly 15-fold and 90-fold higher in the resistant genotype than in the susceptible parent before inoculation, respectively. Four candidate genes will provide useful information for further research into the resistance mechanism of anthracnose in common bean. The closely linked flanking markers identified here may be useful for transferring the resistance allele Co-1HY from Hongyundou to elite anthracnose susceptible common bean lines.

Mapping and Genetic Structure Analysis of the Anthracnose Resistance Locus Co-1HY in the Common Bean (Phaseolus vulgaris L.)

PubMed Central

Wang, Lanfen; Mantri, Nitin; Zhang, Xiaoyan; Zhu, Zhendong; Wang, Shumin

2017-01-01

Anthracnose is a destructive disease of the common bean (Phaseolus vulgaris L.). The Andean cultivar Hongyundou has been demonstrated to possess strong resistance to anthracnose race 81. To study the genetics of this resistance, the Hongyundou cultivar was crossed with a susceptible genotype Jingdou. Segregation of resistance for race 81 was assessed in the F2 population and F2:3 lines under controlled conditions. Results indicate that Hongyundou carries a single dominant gene for anthracnose resistance. An allele test by crossing Hongyundou with another resistant cultivar revealed that the resistance gene is in the Co-1 locus (therefore named Co-1HY). The physical distance between this locus and the two flanking markers was 46 kb, and this region included four candidate genes, namely, Phvul.001G243500, Phvul.001G243600, Phvul.001G243700 and Phvul.001G243800. These candidate genes encoded serine/threonine-protein kinases. Expression analysis of the four candidate genes in the resistant and susceptible cultivars under control condition and inoculated treatment revealed that all the four candidate genes are expressed at significantly higher levels in the resistant genotype than in susceptible genotype. Phvul.001G243600 and Phvul.001G243700 are expressed nearly 15-fold and 90-fold higher in the resistant genotype than in the susceptible parent before inoculation, respectively. Four candidate genes will provide useful information for further research into the resistance mechanism of anthracnose in common bean. The closely linked flanking markers identified here may be useful for transferring the resistance allele Co-1HY from Hongyundou to elite anthracnose susceptible common bean lines. PMID:28076395

A mutation in the MATP gene causes the cream coat colour in the horse

PubMed Central

Mariat, Denis; Taourit, Sead; Guérin, Gérard

2003-01-01

In horses, basic colours such as bay or chestnut may be partially diluted to buckskin and palomino, or extremely diluted to cream, a nearly white colour with pink skin and blue eyes. This dilution is expected to be controlled by one gene and we used both candidate gene and positional cloning strategies to identify the "cream mutation". A horse panel including reference colours was established and typed for different markers within or in the neighbourhood of two candidate genes. Our data suggest that the causal mutation, a G to A transition, is localised in exon 2 of the MATP gene leading to an aspartic acid to asparagine substitution in the encoded protein. This conserved mutation was also described in mice and humans, but not in medaka. PMID:12605854

Linkage study of nonsyndromic cleft lip with or without cleft palate using candidate genes and mapped polymorphic markers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stein, J.D.; Nelson, L.D.; Conner, B.J.

1994-09-01

Nonsyndromic cleft lip with or without cleft palate (CL(P)) involves fusion or growth failure of facial primordia during development. Complex segregation analysis of clefting populations suggest that an autosomal dominant gene may play a role in this common craniofacial disorder. We have ascertained 16 multigenerational families with CL(P) and tested linkage to 29 candidate genes and 139 mapped short tandem repeat markers. The candidate genes were selected based on their expression in craniofacial development or were identified through murine models. These include: TGF{alpha}, TGF{beta}1, TGF{beta}2, TGF{beta}3, EGF, EGFR, GRAS, cMyc, FGFR, Jun, JunB, PDFG{alpha}, PDGF{beta}, IGF2R, GCR Hox7, Hox8, Hox2B,more » twirler, 5 collagen and 3 extracellular matrix genes. Linkage was tested assuming an autosomal dominant model with sex-specific decreased penetrance. Linkage to all of the candidate loci was excluded in 11 families. RARA was tested and was not informative. However, haplotype analysis of markers flanking RARA on 17q allowed exclusion of this candidate locus. We have previously excluded linkage to 61 STR markers in 11 families. Seventy-eight mapped short tandem repeat markers have recently been tested in 16 families and 30 have been excluded. The remaining are being analyzed and an exclusion map is being developed based on the entire study results.« less

Identification of quantitative trait loci and candidate genes for cadmium tolerance in Populus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Induri, Brahma R; Ellis, Danielle R; Slavov, Goncho T.

2012-01-01

Understanding genetic variation for the response of Populus to heavy metals like cadmium (Cd) is an important step in elucidating the underlying mechanisms of tolerance. In this study, a pseudo-backcross pedigree of Populus trichocarpa Torr. & Gray and Populus deltoides Bart. was characterized for growth and performance traits after Cd exposure. A total of 16 quantitative trait loci (QTL) at logarithm of odds (LOD) ratio 2.5 were detected for total dry weight, its components and root volume. Major QTL for Cd responses were mapped to two different linkage groups and the relative allelic effects were in opposing directions on themore » two chromosomes, suggesting differential mechanisms at these two loci. The phenotypic variance explained by Cd QTL ranged from 5.9 to 11.6% and averaged 8.2% across all QTL. A whole-genome microarray study led to the identification of nine Cd-responsive genes from these QTL. Promising candidates for Cd tolerance include an NHL repeat membrane-spanning protein, a metal transporter and a putative transcription factor. Additional candidates in the QTL intervals include a putative homolog of a glutamate cysteine ligase, and a glutathione-S-transferase. Functional characterization of these candidate genes should enhance our understanding of Cd metabolism and transport and phytoremediation capabilities of Populus.« less

Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

PubMed

Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

2016-01-01

In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. © 2015 John Wiley & Sons Ltd.

Transcriptome-wide characterization of candidate genes for improving the water use efficiency of energy crops grown on semiarid land.

PubMed

Fan, Yangyang; Wang, Qian; Kang, Lifang; Liu, Wei; Xu, Qin; Xing, Shilai; Tao, Chengcheng; Song, Zhihong; Zhu, Caiyun; Lin, Cong; Yan, Juan; Li, Jianqiang; Sang, Tao

2015-10-01

Understanding the genetic basis of water use efficiency (WUE) and its roles in plant adaptation to a drought environment is essential for the production of second-generation energy crops in water-deficit marginal land. In this study, RNA-Seq and WUE measurements were performed for 78 individuals of Miscanthus lutarioriparius grown in two common gardens, one located in warm and wet Central China near the native habitats of the species and the other located in the semiarid Loess Plateau, the domestication site of the energy crop. The field measurements showed that WUE of M. lutarioriparius in the semiarid location was significantly higher than that in the wet location. A matrix correlation analysis was conducted between gene expression levels and WUE to identify candidate genes involved in the improvement of WUE from the native to the domestication site. A total of 48 candidate genes were identified and assigned to functional categories, including photosynthesis, stomatal regulation, protein metabolism, and abiotic stress responses. Of these genes, nearly 73% were up-regulated in the semiarid site. It was also found that the relatively high expression variation of the WUE-related genes was affected to a larger extent by environment than by genetic variation. The study demonstrates that transcriptome-wide correlation between physiological phenotypes and expression levels offers an effective means for identifying candidate genes involved in the adaptation to environmental changes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Dehydration induced transcriptomic responses in two Tibetan hulless barley (Hordeum vulgare var. nudum) accessions distinguished by drought tolerance.

PubMed

Liang, Junjun; Chen, Xin; Deng, Guangbing; Pan, Zhifen; Zhang, Haili; Li, Qiao; Yang, Kaijun; Long, Hai; Yu, Maoqun

2017-10-11

The harsh environment on the Qinghai-Tibetan Plateau gives Tibetan hulless barley (Hordeum vulgare var. nudum) great ability to resist adversities such as drought, salinity, and low temperature, and makes it a good subject for the analysis of drought tolerance mechanism. To elucidate the specific gene networks and pathways that contribute to its drought tolerance, and for identifying new candidate genes for breeding purposes, we performed a transcriptomic analysis using two accessions of Tibetan hulless barley, namely Z772 (drought-tolerant) and Z013 (drought-sensitive). There were more up-regulated genes of Z772 than Z013 under both mild (5439-VS-2604) and severe (7203-VS-3359) dehydration treatments. Under mild dehydration stress, the pathways exclusively enriched in drought-tolerance genotype Z772 included Protein processing in endoplasmic reticulum, tricarboxylic acid (TCA) cycle, Wax biosynthesis, and Spliceosome. Under severe dehydration stress, the pathways that were mainly enriched in Z772 included Carbon fixation in photosynthetic organisms, Pyruvate metabolism, Porphyrin and chlorophyll metabolism. The main differentially expressed genes (DEGs) in response to dehydration stress and genes whose expression was different between tolerant and sensitive genotypes were presented in this study, respectively. The candidate genes for drought tolerance were selected based on their expression patterns. The RNA-Seq data obtained in this study provided an initial overview on global gene expression patterns and networks that related to dehydration shock in Tibetan hulless barley. Furthermore, these data provided pathways and a targeted set of candidate genes that might be essential for deep analyzing the molecular mechanisms of plant tolerance to drought stress.

Identification of KIF3A as a Novel Candidate Gene for Childhood Asthma Using RNA Expression and Population Allelic Frequencies Differences

PubMed Central

Butsch Kovacic, Melinda; Biagini Myers, Jocelyn M.; Wang, Ning; Martin, Lisa J.; Lindsey, Mark; Ericksen, Mark B.; He, Hua; Patterson, Tia L.; Baye, Tesfaye M.; Torgerson, Dara; Roth, Lindsey A.; Gupta, Jayanta; Sivaprasad, Umasundari; Gibson, Aaron M.; Tsoras, Anna M.; Hu, Donglei; Eng, Celeste; Chapela, Rocío; Rodríguez-Santana, José R.; Rodríguez-Cintrón, William; Avila, Pedro C.; Beckman, Kenneth; Seibold, Max A.; Gignoux, Chris; Musaad, Salma M.; Chen, Weiguo; Burchard, Esteban González; Khurana Hershey, Gurjit K.

2011-01-01

Background Asthma is a chronic inflammatory disease with a strong genetic predisposition. A major challenge for candidate gene association studies in asthma is the selection of biologically relevant genes. Methodology/Principal Findings Using epithelial RNA expression arrays, HapMap allele frequency variation, and the literature, we identified six possible candidate susceptibility genes for childhood asthma including ADCY2, DNAH5, KIF3A, PDE4B, PLAU, SPRR2B. To evaluate these genes, we compared the genotypes of 194 predominantly tagging SNPs in 790 asthmatic, allergic and non-allergic children. We found that SNPs in all six genes were nominally associated with asthma (p<0.05) in our discovery cohort and in three independent cohorts at either the SNP or gene level (p<0.05). Further, we determined that our selection approach was superior to random selection of genes either differentially expressed in asthmatics compared to controls (p = 0.0049) or selected based on the literature alone (p = 0.0049), substantiating the validity of our gene selection approach. Importantly, we observed that 7 of 9 SNPs in the KIF3A gene more than doubled the odds of asthma (OR = 2.3, p<0.0001) and increased the odds of allergic disease (OR = 1.8, p<0.008). Our data indicate that KIF3A rs7737031 (T-allele) has an asthma population attributable risk of 18.5%. The association between KIF3A rs7737031 and asthma was validated in 3 independent populations, further substantiating the validity of our gene selection approach. Conclusions/Significance Our study demonstrates that KIF3A, a member of the kinesin superfamily of microtubule associated motors that are important in the transport of protein complexes within cilia, is a novel candidate gene for childhood asthma. Polymorphisms in KIF3A may in part be responsible for poor mucus and/or allergen clearance from the airways. Furthermore, our study provides a promising framework for the identification and evaluation of novel candidate susceptibility genes. PMID:21912604

Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii

PubMed Central

Pavasovic, Ana; Dammannagoda, Lalith K.; Mather, Peter B.; Prentis, Peter J.

2017-01-01

Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na+/K+-ATPase (NKA), H+-ATPase (HAT), Na+/K+/2Cl− cotransporter (NKCC), Na+/Cl−/HCO\\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}${}_{3}^{-}$\\end{document}3− cotransporter (NBC), Na+/H+ exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca+2-ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish, Cherax quadricarinatus, C. destructor and C. cainii, with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types. PMID:28852583

Prioritization of candidate disease genes by combining topological similarity and semantic similarity.

PubMed

Liu, Bin; Jin, Min; Zeng, Pan

2015-10-01

The identification of gene-phenotype relationships is very important for the treatment of human diseases. Studies have shown that genes causing the same or similar phenotypes tend to interact with each other in a protein-protein interaction (PPI) network. Thus, many identification methods based on the PPI network model have achieved good results. However, in the PPI network, some interactions between the proteins encoded by candidate gene and the proteins encoded by known disease genes are very weak. Therefore, some studies have combined the PPI network with other genomic information and reported good predictive performances. However, we believe that the results could be further improved. In this paper, we propose a new method that uses the semantic similarity between the candidate gene and known disease genes to set the initial probability vector of a random walk with a restart algorithm in a human PPI network. The effectiveness of our method was demonstrated by leave-one-out cross-validation, and the experimental results indicated that our method outperformed other methods. Additionally, our method can predict new causative genes of multifactor diseases, including Parkinson's disease, breast cancer and obesity. The top predictions were good and consistent with the findings in the literature, which further illustrates the effectiveness of our method. Copyright © 2015 Elsevier Inc. All rights reserved.

Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguineous families.

PubMed

Harripaul, R; Vasli, N; Mikhailov, A; Rafiq, M A; Mittal, K; Windpassinger, C; Sheikh, T I; Noor, A; Mahmood, H; Downey, S; Johnson, M; Vleuten, K; Bell, L; Ilyas, M; Khan, F S; Khan, V; Moradi, M; Ayaz, M; Naeem, F; Heidari, A; Ahmed, I; Ghadami, S; Agha, Z; Zeinali, S; Qamar, R; Mozhdehipanah, H; John, P; Mir, A; Ansar, M; French, L; Ayub, M; Vincent, J B

2018-04-01

Approximately 1% of the global population is affected by intellectual disability (ID), and the majority receive no molecular diagnosis. Previous studies have indicated high levels of genetic heterogeneity, with estimates of more than 2500 autosomal ID genes, the majority of which are autosomal recessive (AR). Here, we combined microarray genotyping, homozygosity-by-descent (HBD) mapping, copy number variation (CNV) analysis, and whole exome sequencing (WES) to identify disease genes/mutations in 192 multiplex Pakistani and Iranian consanguineous families with non-syndromic ID. We identified definite or candidate mutations (or CNVs) in 51% of families in 72 different genes, including 26 not previously reported for ARID. The new ARID genes include nine with loss-of-function mutations (ABI2, MAPK8, MPDZ, PIDD1, SLAIN1, TBC1D23, TRAPPC6B, UBA7 and USP44), and missense mutations include the first reports of variants in BDNF or TET1 associated with ID. The genes identified also showed overlap with de novo gene sets for other neuropsychiatric disorders. Transcriptional studies showed prominent expression in the prenatal brain. The high yield of AR mutations for ID indicated that this approach has excellent clinical potential and should inform clinical diagnostics, including clinical whole exome and genome sequencing, for populations in which consanguinity is common. As with other AR disorders, the relevance will also apply to outbred populations.

A Gene-Oriented Haplotype Comparison Reveals Recently Selected Genomic Regions in Temperate and Tropical Maize Germplasm

PubMed Central

Zhang, Jie; Li, Yongxiang; Zheng, Jun; Zhang, Hongwei; Yang, Xiaohong; Wang, Jianhua; Wang, Guoying

2017-01-01

The extensive genetic variation present in maize (Zea mays) germplasm makes it possible to detect signatures of positive artificial selection that occurred during temperate and tropical maize improvement. Here we report an analysis of 532,815 polymorphisms from a maize association panel consisting of 368 diverse temperate and tropical inbred lines. We developed a gene-oriented approach adapting exonic polymorphisms to identify recently selected alleles by comparing haplotypes across the maize genome. This analysis revealed evidence of selection for more than 1100 genomic regions during recent improvement, and included regulatory genes and key genes with visible mutant phenotypes. We find that selected candidate target genes in temperate maize are enriched in biosynthetic processes, and further examination of these candidates highlights two cases, sucrose flux and oil storage, in which multiple genes in a common pathway can be cooperatively selected. Finally, based on available parallel gene expression data, we hypothesize that some genes were selected for regulatory variations, resulting in altered gene expression. PMID:28099470

Transcriptome and proteome data reveal candidate genes for pollinator attraction in sexually deceptive orchids.

PubMed

Sedeek, Khalid E M; Qi, Weihong; Schauer, Monica A; Gupta, Alok K; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P; Schlüter, Philipp M

2013-01-01

Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of floral morphology. These data will serve as an invaluable resource for research in orchid floral biology, enabling studies into the molecular mechanisms of pollinator attraction and speciation.

Transcriptome and Proteome Data Reveal Candidate Genes for Pollinator Attraction in Sexually Deceptive Orchids

PubMed Central

Sedeek, Khalid E. M.; Qi, Weihong; Schauer, Monica A.; Gupta, Alok K.; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P.; Schlüter, Philipp M.

2013-01-01

Background Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. Results We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Conclusion Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of floral morphology. These data will serve as an invaluable resource for research in orchid floral biology, enabling studies into the molecular mechanisms of pollinator attraction and speciation. PMID:23734209

RNAi screening of developmental toolkit genes: a search for novel wing genes in the red flour beetle, Tribolium castaneum.

PubMed

Linz, David M; Tomoyasu, Yoshinori

2015-01-01

The amazing array of diversity among insect wings offers a powerful opportunity to study the mechanisms guiding morphological evolution. Studies in Drosophila (the fruit fly) have identified dozens of genes important for wing development. These genes are often called candidate genes, serving as an ideal starting point to study wing development in other insects. However, we also need to explore beyond the candidate genes to gain a more comprehensive view of insect wing evolution. As a first step away from the traditional candidate genes, we utilized Tribolium (the red flour beetle) as a model and assessed the potential involvement of a group of developmental toolkit genes (embryonic patterning genes) in beetle wing development. We hypothesized that the highly pleiotropic nature of these developmental genes would increase the likelihood of finding novel wing genes in Tribolium. Through the RNA interference screening, we found that Tc-cactus has a less characterized (but potentially evolutionarily conserved) role in wing development. We also found that the odd-skipped family genes are essential for the formation of the thoracic pleural plates, including the recently discovered wing serial homologs in Tribolium. In addition, we obtained several novel insights into the function of these developmental genes, such as the involvement of mille-pattes and Tc-odd-paired in metamorphosis. Despite these findings, no gene we examined was found to have novel wing-related roles unique in Tribolium. These results suggest a relatively conserved nature of developmental toolkit genes and highlight the limited degree to which these genes are co-opted during insect wing evolution.

Nucleotide polymorphisms in a pine ortholog of the Arabidopsis degrading enzyme cellulase KORRIGAN are associated with early growth performance in Pinus pinaster.

PubMed

Cabezas, José Antonio; González-Martínez, Santiago C; Collada, Carmen; Guevara, María Angeles; Boury, Christophe; de María, Nuria; Eveno, Emmanuelle; Aranda, Ismael; Garnier-Géré, Pauline H; Brach, Jean; Alía, Ricardo; Plomion, Christophe; Cervera, María Teresa

2015-09-01

We have carried out a candidate-gene-based association genetic study in Pinus pinaster Aiton and evaluated the predictive performance for genetic merit gain of the most significantly associated genes and single nucleotide polymorphisms (SNPs). We used a second generation 384-SNP array enriched with candidate genes for growth and wood properties to genotype mother trees collected in 20 natural populations covering most of the European distribution of the species. Phenotypic data for total height, polycyclism, root-collar diameter and biomass were obtained from a replicated provenance-progeny trial located in two sites with contrasting environments (Atlantic vs Mediterranean climate). General linear models identified strong associations between growth traits (total height and polycyclism) and four SNPs from the korrigan candidate gene, after multiple testing corrections using false discovery rate. The combined genomic breeding value predictions assessed for the four associated korrigan SNPs by ridge regression-best linear unbiased prediction (RR-BLUP) and cross-validation accounted for up to 8 and 15% of the phenotypic variance for height and polycyclic growth, respectively, and did not improve adding SNPs from other growth-related candidate genes. For root-collar diameter and total biomass, they accounted for 1.6 and 1.1% of the phenotypic variance, respectively, but increased to 15 and 4.1% when other SNPs from lp3.1, lp3.3 and cad were included in RR-BLUP models. These results point towards a desirable integration of candidate-gene studies as a means to pre-select relevant markers, and aid genomic selection in maritime pine breeding programs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Gene expression factor analysis to differentiate pathways linked to fibromyalgia, chronic fatigue syndrome, and depression in a diverse patient sample

PubMed Central

Iacob, Eli; Light, Alan R.; Donaldson, Gary W.; Okifuji, Akiko; Hughen, Ronald W.; White, Andrea T.; Light, Kathleen C.

2015-01-01

Objective To determine if independent candidate genes can be grouped into meaningful biological factors and if these factors are associated with the diagnosis of chronic fatigue syndrome (CFS) and fibromyalgia (FMS) while controlling for co-morbid depression, sex, and age. Methods We included leukocyte mRNA gene expression from a total of 261 individuals including healthy controls (n=61), patients with FMS only (n=15), CFS only (n=33), co-morbid CFS and FMS (n=79), and medication-resistant (n=42) or medication-responsive (n=31) depression. We used Exploratory Factor Analysis (EFA) on 34 candidate genes to determine factor scores and regression analysis to examine if these factors were associated with specific diagnoses. Results EFA resulted in four independent factors with minimal overlap of genes between factors explaining 51% of the variance. We labeled these factors by function as: 1) Purinergic and cellular modulators; 2) Neuronal growth and immune function; 3) Nociception and stress mediators; 4) Energy and mitochondrial function. Regression analysis predicting these biological factors using FMS, CFS, depression severity, age, and sex revealed that greater expression in Factors 1 and 3 was positively associated with CFS and negatively associated with depression severity (QIDS score), but not associated with FMS. Conclusion Expression of candidate genes can be grouped into meaningful clusters, and CFS and depression are associated with the same 2 clusters but in opposite directions when controlling for co-morbid FMS. Given high co-morbid disease and interrelationships between biomarkers, EFA may help determine patient subgroups in this population based on gene expression. PMID:26097208

An Integration of Genome-Wide Association Study and Gene Expression Profiling to Prioritize the Discovery of Novel Susceptibility Loci for Osteoporosis-Related Traits

PubMed Central

Demissie, Serkalem; Soranzo, Nicole; Bianchi, Estelle N.; Grundberg, Elin; Liang, Liming; Richards, J. Brent; Estrada, Karol; Zhou, Yanhua; van Nas, Atila; Moffatt, Miriam F.; Zhai, Guangju; Hofman, Albert; van Meurs, Joyce B.; Pols, Huibert A. P.; Price, Roger I.; Nilsson, Olle; Pastinen, Tomi; Cupples, L. Adrienne; Lusis, Aldons J.; Schadt, Eric E.; Ferrari, Serge; Uitterlinden, André G.

2010-01-01

Osteoporosis is a complex disorder and commonly leads to fractures in elderly persons. Genome-wide association studies (GWAS) have become an unbiased approach to identify variations in the genome that potentially affect health. However, the genetic variants identified so far only explain a small proportion of the heritability for complex traits. Due to the modest genetic effect size and inadequate power, true association signals may not be revealed based on a stringent genome-wide significance threshold. Here, we take advantage of SNP and transcript arrays and integrate GWAS and expression signature profiling relevant to the skeletal system in cellular and animal models to prioritize the discovery of novel candidate genes for osteoporosis-related traits, including bone mineral density (BMD) at the lumbar spine (LS) and femoral neck (FN), as well as geometric indices of the hip (femoral neck-shaft angle, NSA; femoral neck length, NL; and narrow-neck width, NW). A two-stage meta-analysis of GWAS from 7,633 Caucasian women and 3,657 men, revealed three novel loci associated with osteoporosis-related traits, including chromosome 1p13.2 (RAP1A, p = 3.6×10−8), 2q11.2 (TBC1D8), and 18q11.2 (OSBPL1A), and confirmed a previously reported region near TNFRSF11B/OPG gene. We also prioritized 16 suggestive genome-wide significant candidate genes based on their potential involvement in skeletal metabolism. Among them, 3 candidate genes were associated with BMD in women. Notably, 2 out of these 3 genes (GPR177, p = 2.6×10−13; SOX6, p = 6.4×10−10) associated with BMD in women have been successfully replicated in a large-scale meta-analysis of BMD, but none of the non-prioritized candidates (associated with BMD) did. Our results support the concept of our prioritization strategy. In the absence of direct biological support for identified genes, we highlighted the efficiency of subsequent functional characterization using publicly available expression profiling relevant to the skeletal system in cellular or whole animal models to prioritize candidate genes for further functional validation. PMID:20548944

Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.

PubMed

Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin

2016-10-15

Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve  = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Multi-gene panel testing in Korean patients with common genetic generalized epilepsy syndromes.

PubMed

Lee, Cha Gon; Lee, Jeehun; Lee, Munhyang

2018-01-01

Genetic heterogeneity of common genetic generalized epilepsy syndromes is frequently considered. The present study conducted a focused analysis of potential candidate or susceptibility genes for common genetic generalized epilepsy syndromes using multi-gene panel testing with next-generation sequencing. This study included patients with juvenile myoclonic epilepsy, juvenile absence epilepsy, and epilepsy with generalized tonic-clonic seizures alone. We identified pathogenic variants according to the American College of Medical Genetics and Genomics guidelines and identified susceptibility variants using case-control association analyses and family analyses for familial cases. A total of 57 patients were enrolled, including 51 sporadic cases and 6 familial cases. Twenty-two pathogenic and likely pathogenic variants of 16 different genes were identified. CACNA1H was the most frequently observed single gene. Variants of voltage-gated Ca2+ channel genes, including CACNA1A, CACNA1G, and CACNA1H were observed in 32% of variants (n = 7/22). Analyses to identify susceptibility variants using case-control association analysis indicated that KCNMA1 c.400G>C was associated with common genetic generalized epilepsy syndromes. Only 1 family (family A) exhibited a candidate pathogenic variant p.(Arg788His) on CACNA1H, as determined via family analyses. This study identified candidate genetic variants in about a quarter of patients (n = 16/57) and an average of 2.8 variants was identified in each patient. The results reinforced the polygenic disorder with very high locus and allelic heterogeneity of common GGE syndromes. Further, voltage-gated Ca2+ channels are suggested as important contributors to common genetic generalized epilepsy syndromes. This study extends our comprehensive understanding of common genetic generalized epilepsy syndromes.

Systems genetics: a paradigm to improve discovery of candidate genes and mechanisms underlying complex traits.

PubMed

Feltus, F Alex

2014-06-01

Understanding the control of any trait optimally requires the detection of causal genes, gene interaction, and mechanism of action to discover and model the biochemical pathways underlying the expressed phenotype. Functional genomics techniques, including RNA expression profiling via microarray and high-throughput DNA sequencing, allow for the precise genome localization of biological information. Powerful genetic approaches, including quantitative trait locus (QTL) and genome-wide association study mapping, link phenotype with genome positions, yet genetics is less precise in localizing the relevant mechanistic information encoded in DNA. The coupling of salient functional genomic signals with genetically mapped positions is an appealing approach to discover meaningful gene-phenotype relationships. Techniques used to define this genetic-genomic convergence comprise the field of systems genetics. This short review will address an application of systems genetics where RNA profiles are associated with genetically mapped genome positions of individual genes (eQTL mapping) or as gene sets (co-expression network modules). Both approaches can be applied for knowledge independent selection of candidate genes (and possible control mechanisms) underlying complex traits where multiple, likely unlinked, genomic regions might control specific complex traits. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

A direct molecular link between the autism candidate gene RORa and the schizophrenia candidate MIR137

NASA Astrophysics Data System (ADS)

Devanna, Paolo; Vernes, Sonja C.

2014-02-01

Retinoic acid-related orphan receptor alpha gene (RORa) and the microRNA MIR137 have both recently been identified as novel candidate genes for neuropsychiatric disorders. RORa encodes a ligand-dependent orphan nuclear receptor that acts as a transcriptional regulator and miR-137 is a brain enriched small non-coding RNA that interacts with gene transcripts to control protein levels. Given the mounting evidence for RORa in autism spectrum disorders (ASD) and MIR137 in schizophrenia and ASD, we investigated if there was a functional biological relationship between these two genes. Herein, we demonstrate that miR-137 targets the 3'UTR of RORa in a site specific manner. We also provide further support for MIR137 as an autism candidate by showing that a large number of previously implicated autism genes are also putatively targeted by miR-137. This work supports the role of MIR137 as an ASD candidate and demonstrates a direct biological link between these previously unrelated autism candidate genes.

Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.

PubMed

Jespersen, David; Belanger, Faith C; Huang, Bingru

2017-01-01

Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.

Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass

PubMed Central

Jespersen, David; Belanger, Faith C.; Huang, Bingru

2017-01-01

Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection. PMID:28187136

Submicroscopic deletions at the WAGR locus, revealed by nonradioactive in situ hybridization.

PubMed

Fantes, J A; Bickmore, W A; Fletcher, J M; Ballesta, F; Hanson, I M; van Heyningen, V

1992-12-01

Fluorescence in situ hybridization (FISH) with biotin-labeled probes mapping to 11p13 has been used for the molecular analysis of deletions of the WAGR (Wilms tumor, aniridia, genitourinary abnormalities, and mental retardation) locus. We have detected a submicroscopic 11p13 deletion in a child with inherited aniridia who subsequently presented with Wilms tumor in a horseshoe kidney, only revealed at surgery. The mother, who has aniridia, was also found to carry a deletion including both the aniridia candidate gene (AN2) and the Wilms tumor predisposition gene (WT1). This is therefore a rare case of an inherited WAGR deletion. Wilms tumor has so far only been associated with sporadic de novo aniridia cases. We have shown that a cosmid probe for a candidate aniridia gene, homologous to the mouse Pax-6 gene, is deleted in cell lines from aniridia patients with previously characterized deletions at 11p13, while another cosmid marker mapping between two aniridia-associated translocation breakpoints (and hence a second candidate marker) is present on both chromosomes. These results support the Pax-6 homologue as a strong candidate for the AN2 gene. FISH with cosmid probes has proved to be a fast and reliable technique for the molecular analysis of deletions. It can be used with limited amounts of material and has strong potential for clinical applications.

Xenopus as a Model Organism for Birth Defects – Congenital Heart Disease and Heterotaxy

PubMed Central

Duncan, Anna R.; Khokha, Mustafa K.

2016-01-01

Congenital heart disease is the leading cause of birth defects, affecting 9 out of 1000 newborns each year. A particularly severe form of congenital heart disease is heterotaxy, a disorder of left-right development. Despite aggressive surgical management, patients with heterotaxy have poor survival rates and severe morbidity due to their complex congenital heart disease. Recent genetic analysis of affected patients has found novel candidate genes for heterotaxy although their underlying mechanisms remain unknown. In this review, we discuss the importance and challenges of birth defects research including high locus heterogeneity and few second alleles that make defining disease causality difficult. A powerful strategy moving forward is to analyze these candidate genes in a high-throughput human disease model. Xenopus is ideal for these studies. We present multiple examples demonstrating the power of Xenopus in discovery new biology from the analysis of candidate heterotaxy genes such as GALNT11, NEK2 and BCOR. These genes have diverse roles in embryos and have led to a greater understanding of complex signaling pathways and basic developmental biology. It is our hope that the mechanistic analysis of these candidate genes in Xenopus enabled by next generation sequencing of patients will provide clinicians with a greater understanding of patient pathophysiology allowing more precise and personalized medicine, to help them more effectively in the future. PMID:26910255

A role for genetic susceptibility in sporadic focal segmental glomerulosclerosis

PubMed Central

Yu, Haiyang; Artomov, Mykyta; Brähler, Sebastian; Stander, M. Christine; Shamsan, Ghaidan; Sampson, Matthew G.; White, J. Michael; Kretzler, Matthias; Jain, Sanjay; Winkler, Cheryl A.; Mitra, Robi D.; Daly, Mark J.; Shaw, Andrey S.

2016-01-01

Focal segmental glomerulosclerosis (FSGS) is a syndrome that involves kidney podocyte dysfunction and causes chronic kidney disease. Multiple factors including chemical toxicity, inflammation, and infection underlie FSGS; however, highly penetrant disease genes have been identified in a small fraction of patients with a family history of FSGS. Variants of apolipoprotein L1 (APOL1) have been linked to FSGS in African Americans with HIV or hypertension, supporting the proposal that genetic factors enhance FSGS susceptibility. Here, we used sequencing to investigate whether genetics plays a role in the majority of FSGS cases that are identified as primary or sporadic FSGS and have no known cause. Given the limited number of biopsy-proven cases with ethnically matched controls, we devised an analytic strategy to identify and rank potential candidate genes and used an animal model for validation. Nine candidate FSGS susceptibility genes were identified in our patient cohort, and three were validated using a high-throughput mouse method that we developed. Specifically, we introduced a podocyte-specific, doxycycline-inducible transactivator into a murine embryonic stem cell line with an FSGS-susceptible genetic background that allows shRNA-mediated targeting of candidate genes in the adult kidney. Our analysis supports a broader role for genetic susceptibility of both sporadic and familial cases of FSGS and provides a tool to rapidly evaluate candidate FSGS-associated genes. PMID:26901816

Reveal genes functionally associated with ACADS by a network study.

PubMed

Chen, Yulong; Su, Zhiguang

2015-09-15

Establishing a systematic network is aimed at finding essential human gene-gene/gene-disease pathway by means of network inter-connecting patterns and functional annotation analysis. In the present study, we have analyzed functional gene interactions of short-chain acyl-coenzyme A dehydrogenase gene (ACADS). ACADS plays a vital role in free fatty acid β-oxidation and regulates energy homeostasis. Modules of highly inter-connected genes in disease-specific ACADS network are derived by integrating gene function and protein interaction data. Among the 8 genes in ACADS web retrieved from both STRING and GeneMANIA, ACADS is effectively conjoined with 4 genes including HAHDA, HADHB, ECHS1 and ACAT1. The functional analysis is done via ontological briefing and candidate disease identification. We observed that the highly efficient-interlinked genes connected with ACADS are HAHDA, HADHB, ECHS1 and ACAT1. Interestingly, the ontological aspect of genes in the ACADS network reveals that ACADS, HAHDA and HADHB play equally vital roles in fatty acid metabolism. The gene ACAT1 together with ACADS indulges in ketone metabolism. Our computational gene web analysis also predicts potential candidate disease recognition, thus indicating the involvement of ACADS, HAHDA, HADHB, ECHS1 and ACAT1 not only with lipid metabolism but also with infant death syndrome, skeletal myopathy, acute hepatic encephalopathy, Reye-like syndrome, episodic ketosis, and metabolic acidosis. The current study presents a comprehensible layout of ACADS network, its functional strategies and candidate disease approach associated with ACADS network. Copyright © 2015 Elsevier B.V. All rights reserved.

SZGR 2.0: a one-stop shop of schizophrenia candidate genes

PubMed Central

Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming

2017-01-01

SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. PMID:27733502

A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

PubMed Central

Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

2010-01-01

A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

A small number of candidate gene SNPs reveal continental ancestry in African Americans

PubMed Central

KODAMAN, NURI; ALDRICH, MELINDA C.; SMITH, JEFFREY R.; SIGNORELLO, LISA B.; BRADLEY, KEVIN; BREYER, JOAN; COHEN, SARAH S.; LONG, JIRONG; CAI, QIUYIN; GILES, JUSTIN; BUSH, WILLIAM S.; BLOT, WILLIAM J.; MATTHEWS, CHARLES E.; WILLIAMS, SCOTT M.

2013-01-01

SUMMARY Using genetic data from an obesity candidate gene study of self-reported African Americans and European Americans, we investigated the number of Ancestry Informative Markers (AIMs) and candidate gene SNPs necessary to infer continental ancestry. Proportions of African and European ancestry were assessed with STRUCTURE (K=2), using 276 AIMs. These reference values were compared to estimates derived using 120, 60, 30, and 15 SNP subsets randomly chosen from the 276 AIMs and from 1144 SNPs in 44 candidate genes. All subsets generated estimates of ancestry consistent with the reference estimates, with mean correlations greater than 0.99 for all subsets of AIMs, and mean correlations of 0.99±0.003; 0.98± 0.01; 0.93±0.03; and 0.81± 0.11 for subsets of 120, 60, 30, and 15 candidate gene SNPs, respectively. Among African Americans, the median absolute difference from reference African ancestry values ranged from 0.01 to 0.03 for the four AIMs subsets and from 0.03 to 0.09 for the four candidate gene SNP subsets. Furthermore, YRI/CEU Fst values provided a metric to predict the performance of candidate gene SNPs. Our results demonstrate that a small number of SNPs randomly selected from candidate genes can be used to estimate admixture proportions in African Americans reliably. PMID:23278390

Human Chromosome 7: DNA Sequence and Biology

PubMed Central

Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.; Fernandez, Bridget A.; Kanematsu, Emiko; Gentles, Simone; Christopoulos, Constantine C.; Choufani, Sanaa; Kwasnicka, Dorota; Zheng, Xiangqun H.; Lai, Zhongwu; Nusskern, Deborah; Zhang, Qing; Gu, Zhiping; Lu, Fu; Zeesman, Susan; Nowaczyk, Malgorzata J.; Teshima, Ikuko; Chitayat, David; Shuman, Cheryl; Weksberg, Rosanna; Zackai, Elaine H.; Grebe, Theresa A.; Cox, Sarah R.; Kirkpatrick, Susan J.; Rahman, Nazneen; Friedman, Jan M.; Heng, Henry H. Q.; Pelicci, Pier Giuseppe; Lo-Coco, Francesco; Belloni, Elena; Shaffer, Lisa G.; Pober, Barbara; Morton, Cynthia C.; Gusella, James F.; Bruns, Gail A. P.; Korf, Bruce R.; Quade, Bradley J.; Ligon, Azra H.; Ferguson, Heather; Higgins, Anne W.; Leach, Natalia T.; Herrick, Steven R.; Lemyre, Emmanuelle; Farra, Chantal G.; Kim, Hyung-Goo; Summers, Anne M.; Gripp, Karen W.; Roberts, Wendy; Szatmari, Peter; Winsor, Elizabeth J. T.; Grzeschik, Karl-Heinz; Teebi, Ahmed; Minassian, Berge A.; Kere, Juha; Armengol, Lluis; Pujana, Miguel Angel; Estivill, Xavier; Wilson, Michael D.; Koop, Ben F.; Tosi, Sabrina; Moore, Gudrun E.; Boright, Andrew P.; Zlotorynski, Eitan; Kerem, Batsheva; Kroisel, Peter M.; Petek, Erwin; Oscier, David G.; Mould, Sarah J.; Döhner, Hartmut; Döhner, Konstanze; Rommens, Johanna M.; Vincent, John B.; Venter, J. Craig; Li, Peter W.; Mural, Richard J.; Adams, Mark D.; Tsui, Lap-Chee

2010-01-01

DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate genes for developmental diseases including autism. PMID:12690205

EnRICH: Extraction and Ranking using Integration and Criteria Heuristics.

PubMed

Zhang, Xia; Greenlee, M Heather West; Serb, Jeanne M

2013-01-15

High throughput screening technologies enable biologists to generate candidate genes at a rate that, due to time and cost constraints, cannot be studied by experimental approaches in the laboratory. Thus, it has become increasingly important to prioritize candidate genes for experiments. To accomplish this, researchers need to apply selection requirements based on their knowledge, which necessitates qualitative integration of heterogeneous data sources and filtration using multiple criteria. A similar approach can also be applied to putative candidate gene relationships. While automation can assist in this routine and imperative procedure, flexibility of data sources and criteria must not be sacrificed. A tool that can optimize the trade-off between automation and flexibility to simultaneously filter and qualitatively integrate data is needed to prioritize candidate genes and generate composite networks from heterogeneous data sources. We developed the java application, EnRICH (Extraction and Ranking using Integration and Criteria Heuristics), in order to alleviate this need. Here we present a case study in which we used EnRICH to integrate and filter multiple candidate gene lists in order to identify potential retinal disease genes. As a result of this procedure, a candidate pool of several hundred genes was narrowed down to five candidate genes, of which four are confirmed retinal disease genes and one is associated with a retinal disease state. We developed a platform-independent tool that is able to qualitatively integrate multiple heterogeneous datasets and use different selection criteria to filter each of them, provided the datasets are tables that have distinct identifiers (required) and attributes (optional). With the flexibility to specify data sources and filtering criteria, EnRICH automatically prioritizes candidate genes or gene relationships for biologists based on their specific requirements. Here, we also demonstrate that this tool can be effectively and easily used to apply highly specific user-defined criteria and can efficiently identify high quality candidate genes from relatively sparse datasets.

Degrees of separation as a statistical tool for evaluating candidate genes.

PubMed

Nelson, Ronald M; Pettersson, Mats E

2014-12-01

Selection of candidate genes is an important step in the exploration of complex genetic architecture. The number of gene networks available is increasing and these can provide information to help with candidate gene selection. It is currently common to use the degree of connectedness in gene networks as validation in Genome Wide Association (GWA) and Quantitative Trait Locus (QTL) mapping studies. However, it can cause misleading results if not validated properly. Here we present a method and tool for validating the gene pairs from GWA studies given the context of the network they co-occur in. It ensures that proposed interactions and gene associations are not statistical artefacts inherent to the specific gene network architecture. The CandidateBacon package provides an easy and efficient method to calculate the average degree of separation (DoS) between pairs of genes to currently available gene networks. We show how these empirical estimates of average connectedness are used to validate candidate gene pairs. Validation of interacting genes by comparing their connectedness with the average connectedness in the gene network will provide support for said interactions by utilising the growing amount of gene network information available. Copyright © 2014 Elsevier Ltd. All rights reserved.

Search for sarcoidosis candidate genes by integration of data from genomic, transcriptomic and proteomic studies.

PubMed

Maver, Ales; Medica, Igor; Peterlin, Borut

2009-12-01

The search for gene candidates in multifactorial diseases such as sarcoidosis can be based on the integration of linkage association data, gene expression data, and protein profile data from genomic, transcriptomic and proteomic studies, respectively. In this study we performed a literature-based search for studies reporting such data, followed by integration of collected information. Different databases were examined--Medline, HugGE Navigator, ArrayExpress and Gene Expression Omnibus (GEO). Candidate genes were defined as genes which were reported in at least 2 different types of omics studies. Genes previously investigated in sarcoidosis were excluded from further analyses. We identified 177 genes associated with sarcoidosis as potential new candidate genes. Subsequently, 9 gene candidates identified to overlap in 2 different types of studies (genomic, transcriptomic and/or proteomic) were consistently reported in at least 3 studies: SERPINB1, FABP4, S100A8, HBEGF, IL7R, LRIG1, PTPN23, DPM2 and NUP214. These genes are involved in regulation of immune response, cellular proliferation, apoptosis, inhibition of protease activity, lipid metabolism. Exact biological functions of HBEGF, LRIG1, PTPN23, DPM2 and NUP214 remain to be completely elucidated. We propose 9 candidate genes: SERPINB1, FABP4, S100A8, HBEGF, IL7R, LRIG1, PTPN23, DPM2 and NUP214, as genes with high potential for association with sarcoidosis.

Genetics of alcoholism.

PubMed

Edenberg, Howard J; Foroud, Tatiana

2014-01-01

Multiple lines of evidence strongly indicate that genetic factors contribute to the risk for alcohol use disorders (AUD). There is substantial heterogeneity in AUD, which complicates studies seeking to identify specific genetic factors. To identify these genetic effects, several different alcohol-related phenotypes have been analyzed, including diagnosis and quantitative measures related to AUDs. Study designs have used candidate gene analyses, genetic linkage studies, genomewide association studies (GWAS), and analyses of rare variants. Two genes that encode enzymes of alcohol metabolism have the strongest effect on AUD: aldehyde dehydrogenase 2 and alcohol dehydrogenase 1B each has strongly protective variants that reduce risk, with odds ratios approximately 0.2-0.4. A number of other genes important in AUD have been identified and replicated, including GABRA2 and alcohol dehydrogenases 1B and 4. GWAS have identified additional candidates. Rare variants are likely also to play a role; studies of these are just beginning. A multifaceted approach to gene identification, targeting both rare and common variations and assembling much larger datasets for meta-analyses, is critical for identifying the key genes and pathways important in AUD. © 2014 Elsevier B.V. All rights reserved.

Systematic analysis of copy number variation associated with congenital diaphragmatic hernia.

PubMed

Zhu, Qihui; High, Frances A; Zhang, Chengsheng; Cerveira, Eliza; Russell, Meaghan K; Longoni, Mauro; Joy, Maliackal P; Ryan, Mallory; Mil-Homens, Adam; Bellfy, Lauren; Coletti, Caroline M; Bhayani, Pooja; Hila, Regis; Wilson, Jay M; Donahoe, Patricia K; Lee, Charles

2018-05-15

Congenital diaphragmatic hernia (CDH), characterized by malformation of the diaphragm and hypoplasia of the lungs, is one of the most common and severe birth defects, and is associated with high morbidity and mortality rates. There is growing evidence demonstrating that genetic factors contribute to CDH, although the pathogenesis remains largely elusive. Single-nucleotide polymorphisms have been studied in recent whole-exome sequencing efforts, but larger copy number variants (CNVs) have not yet been studied on a large scale in a case control study. To capture CNVs within CDH candidate regions, we developed and tested a targeted array comparative genomic hybridization platform to identify CNVs within 140 regions in 196 patients and 987 healthy controls, and identified six significant CNVs that were either unique to patients or enriched in patients compared with controls. These CDH-associated CNVs reveal high-priority candidate genes including HLX , LHX1 , and HNF1B We also discuss CNVs that are present in only one patient in the cohort but have additional evidence of pathogenicity, including extremely rare large and/or de novo CNVs. The candidate genes within these predicted disease-causing CNVs form functional networks with other known CDH genes and play putative roles in DNA binding/transcription regulation and embryonic development. These data substantiate the importance of CNVs in the etiology of CDH, identify CDH candidate genes and pathways, and highlight the importance of ongoing analysis of CNVs in the study of CDH and other structural birth defects. Copyright © 2018 the Author(s). Published by PNAS.

Genetic Variation and Recent Positive Selection in Worldwide Human Populations: Evidence from Nearly 1 Million SNPs

PubMed Central

Theunert, Christoph; Pugach, Irina; Li, Jing; Nandineni, Madhusudan R.; Gross, Arnd; Scholz, Markus; Stoneking, Mark

2009-01-01

Background Genome-wide scans of hundreds of thousands of single-nucleotide polymorphisms (SNPs) have resulted in the identification of new susceptibility variants to common diseases and are providing new insights into the genetic structure and relationships of human populations. Moreover, genome-wide data can be used to search for signals of recent positive selection, thereby providing new insights into the genetic adaptations that occurred as modern humans spread out of Africa and around the world. Methodology We genotyped approximately 500,000 SNPs in 255 individuals (5 individuals from each of 51 worldwide populations) from the Human Genome Diversity Panel (HGDP-CEPH). When merged with non-overlapping SNPs typed previously in 250 of these same individuals, the resulting data consist of over 950,000 SNPs. We then analyzed the genetic relationships and ancestry of individuals without assigning them to populations, and we also identified candidate regions of recent positive selection at both the population and regional (continental) level. Conclusions Our analyses both confirm and extend previous studies; in particular, we highlight the impact of various dispersals, and the role of substructure in Africa, on human genetic diversity. We also identified several novel candidate regions for recent positive selection, and a gene ontology (GO) analysis identified several GO groups that were significantly enriched for such candidate genes, including immunity and defense related genes, sensory perception genes, membrane proteins, signal receptors, lipid binding/metabolism genes, and genes involved in the nervous system. Among the novel candidate genes identified are two genes involved in the thyroid hormone pathway that show signals of selection in African Pygmies that may be related to their short stature. PMID:19924308

SNP-by-fitness and SNP-by-BMI interactions from seven candidate genes and incident hypertension after 20 years of follow-up: the CARDIA Fitness Study.

PubMed

Sarzynski, M A; Rankinen, T; Sternfeld, B; Fornage, M; Sidney, S; Bouchard, C

2011-08-01

The association of single nucleotide polymorphisms (SNPs) from seven candidate genes, including genotype-by-baseline fitness and genotype-by-baseline body mass index (BMI) interactions, with incident hypertension over 20 years was investigated in 2663 participants (1301 blacks, 1362 whites) of the Coronary Artery Risk Development in Young Adults Study (CARDIA). Baseline cardiorespiratory fitness was determined from duration of a modified Balke treadmill test. A total of 98 SNPs in blacks and 89 SNPs in whites from seven candidate genes were genotyped. Participants that became hypertensive (295 blacks and 146 whites) had significantly higher blood pressure and BMI (both races), and lower fitness (blacks only) at baseline than those who remained normotensive. Markers at the peroxisome proliferative activated receptor gamma coactivator 1α (PPARGC1A) and bradykinin β2 receptor (BDKRB2) genes were nominally associated with greater risk of hypertension, although one marker each at the BDKRB2 and endothelial nitric oxide synthase-3 (NOS3) genes were nominally associated with lower risk. The association of baseline fitness with risk of hypertension was nominally modified by genotype at markers within the angiotensin converting enzyme, angiotensinogen, BDKRB2 and NOS3 genes in blacks and the BDKRB2, endothelin-1 and PPARGC1A genes in whites. BDKRB2 rs4900318 showed nominal interactions with baseline fitness on the risk of hypertension in both races. The association of baseline BMI with risk of hypertension was nominally modified by GNB3 rs2301339 genotype in whites. None of the above associations were statistically significant after correcting for multiple testing. We found that SNPs in these candidate genes did not modify the association between baseline fitness or BMI and risk of hypertension in CARDIA participants.

Molecular evolution of candidate male reproductive genes in the brown algal model Ectocarpus.

PubMed

Lipinska, Agnieszka P; Van Damme, Els J M; De Clerck, Olivier

2016-01-05

Evolutionary studies of genes that mediate recognition between sperm and egg contribute to our understanding of reproductive isolation and speciation. Surface receptors involved in fertilization are targets of sexual selection, reinforcement, and other evolutionary forces including positive selection. This observation was made across different lineages of the eukaryotic tree from land plants to mammals, and is particularly evident in free-spawning animals. Here we use the brown algal model species Ectocarpus (Phaeophyceae) to investigate the evolution of candidate gamete recognition proteins in a distant major phylogenetic group of eukaryotes. Male gamete specific genes were identified by comparing transcriptome data covering different stages of the Ectocarpus life cycle and screened for characteristics expected from gamete recognition receptors. Selected genes were sequenced in a representative number of strains from distant geographical locations and varying stages of reproductive isolation, to search for signatures of adaptive evolution. One of the genes (Esi0130_0068) showed evidence of selective pressure. Interestingly, that gene displayed domain similarities to the receptor for egg jelly (REJ) protein involved in sperm-egg recognition in sea urchins. We have identified a male gamete specific gene with similarity to known gamete recognition receptors and signatures of adaptation. Altogether, this gene could contribute to gamete interaction during reproduction as well as reproductive isolation in Ectocarpus and is therefore a good candidate for further functional evaluation.

LOD score exclusion analyses for candidate QTLs using random population samples.

PubMed

Deng, Hong-Wen

2003-11-01

While extensive analyses have been conducted to test for, no formal analyses have been conducted to test against, the importance of candidate genes as putative QTLs using random population samples. Previously, we developed an LOD score exclusion mapping approach for candidate genes for complex diseases. Here, we extend this LOD score approach for exclusion analyses of candidate genes for quantitative traits. Under this approach, specific genetic effects (as reflected by heritability) and inheritance models at candidate QTLs can be analyzed and if an LOD score is < or = -2.0, the locus can be excluded from having a heritability larger than that specified. Simulations show that this approach has high power to exclude a candidate gene from having moderate genetic effects if it is not a QTL and is robust to population admixture. Our exclusion analysis complements association analysis for candidate genes as putative QTLs in random population samples. The approach is applied to test the importance of Vitamin D receptor (VDR) gene as a potential QTL underlying the variation of bone mass, an important determinant of osteoporosis.

Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

Treesearch

Xiaoqing Yu; Guihua Bai; Shuwei Liu; Na Luo; Ying Wang; Douglas S. Richmond; Paula M. Pijut; Scott A. Jackson; Jianming Yu; Yiwei Jiang

2013-01-01

Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse...

Targeted Resequencing of 29 Candidate Genes and Mouse Expression Studies Implicate ZIC3 and FOXF1 in Human VATER/VACTERL Association.

PubMed

Hilger, Alina C; Halbritter, Jan; Pennimpede, Tracie; van der Ven, Amelie; Sarma, Georgia; Braun, Daniela A; Porath, Jonathan D; Kohl, Stefan; Hwang, Daw-Yang; Dworschak, Gabriel C; Hermann, Bernhard G; Pavlova, Anna; El-Maarri, Osman; Nöthen, Markus M; Ludwig, Michael; Reutter, Heiko; Hildebrandt, Friedhelm

2015-12-01

The VATER/VACTERL association describes the combination of congenital anomalies including vertebral defects, anorectal malformations, cardiac defects, tracheoesophageal fistula with or without esophageal atresia, renal malformations, and limb defects. As mutations in ciliary genes were observed in diseases related to VATER/VACTERL, we performed targeted resequencing of 25 ciliary candidate genes as well as disease-associated genes (FOXF1, HOXD13, PTEN, ZIC3) in 123 patients with VATER/VACTERL or VATER/VACTERL-like phenotype. We detected no biallelic mutation in any of the 25 ciliary candidate genes; however, identified an identical, probably disease-causing ZIC3 missense mutation (p.Gly17Cys) in four patients and a FOXF1 de novo mutation (p.Gly220Cys) in a further patient. In situ hybridization analyses in mouse embryos between E9.5 and E14.5 revealed Zic3 expression in limb and prevertebral structures, and Foxf1 expression in esophageal, tracheal, vertebral, anal, and genital tubercle tissues, hence VATER/VACTERL organ systems. These data provide strong evidence that mutations in ZIC3 or FOXF1 contribute to VATER/VACTERL. © 2015 WILEY PERIODICALS, INC.

Genomic analysis of human lung fibroblasts exposed to vanadium pentoxide to identify candidate genes for occupational bronchitis

PubMed Central

Ingram, Jennifer L; Antao-Menezes, Aurita; Turpin, Elizabeth A; Wallace, Duncan G; Mangum, James B; Pluta, Linda J; Thomas, Russell S; Bonner, James C

2007-01-01

Background Exposure to vanadium pentoxide (V2O5) is a cause of occupational bronchitis. We evaluated gene expression profiles in cultured human lung fibroblasts exposed to V2O5 in vitro in order to identify candidate genes that could play a role in inflammation, fibrosis, and repair during the pathogenesis of V2O5-induced bronchitis. Methods Normal human lung fibroblasts were exposed to V2O5 in a time course experiment. Gene expression was measured at various time points over a 24 hr period using the Affymetrix Human Genome U133A 2.0 Array. Selected genes that were significantly changed in the microarray experiment were validated by RT-PCR. Results V2O5 altered more than 1,400 genes, of which ~300 were induced while >1,100 genes were suppressed. Gene ontology categories (GO) categories unique to induced genes included inflammatory response and immune response, while GO catogories unique to suppressed genes included ubiquitin cycle and cell cycle. A dozen genes were validated by RT-PCR, including growth factors (HBEGF, VEGF, CTGF), chemokines (IL8, CXCL9, CXCL10), oxidative stress response genes (SOD2, PIPOX, OXR1), and DNA-binding proteins (GAS1, STAT1). Conclusion Our study identified a variety of genes that could play pivotal roles in inflammation, fibrosis and repair during V2O5-induced bronchitis. The induction of genes that mediate inflammation and immune responses, as well as suppression of genes involved in growth arrest appear to be important to the lung fibrotic reaction to V2O5. PMID:17459161

A novel homozygous mutation in G6PC3 presenting as cyclic neutropenia and severe congenital neutropenia in the same family.

PubMed

Alangari, Abdullah A; Alsultan, Abdulrahman; Osman, Mohamed Elfaki; Anazi, Shamsa; Alkuraya, Fowzan S

2013-11-01

Patients with autosomal recessive cyclic neutropenia have no known causative genetic defect yet. Autozygosity mapping on two branches of an extended multiplex consanguineous family presenting with cyclic neutropenia or severe congenital neutropenia to look for candidate gene, followed by candidate gene selection and sequencing. A single autozygous interval on Chr17:33,901,938-45,675,414 that is exclusively shared by the affected members was identified. This interval spans 11.8 Mb and contains 30 genes. Review of these genes highlighted G6PC3 as the most likely candidate given its known role in neutrophil biology. Direct sequencing revealed a novel homozygous mutation (NM_138387.3, c.974T > G, p.Leu325Arg). Two of our patients had associated congenital defects that are known to occur in patients with G6PC3 mutations, including congenital heart disease and intermittent thrombocytopenia. Biallelic G6PC3 defects should be considered in patients with autosomal recessive cyclic neutropenia, especially those with typical associated congenital defects.

IFRD1 Is a Candidate Gene for SMNA on Chromosome 7q22-q23

PubMed Central

Brkanac, Zoran; Spencer, David; Shendure, Jay; Robertson, Peggy D.; Matsushita, Mark; Vu, Tiffany; Bird, Thomas D.; Olson, Maynard V.; Raskind, Wendy H.

2009-01-01

We have established strong linkage evidence that supports mapping autosomal-dominant sensory/motor neuropathy with ataxia (SMNA) to chromosome 7q22-q32. SMNA is a rare neurological disorder whose phenotype encompasses both the central and the peripheral nervous system. In order to identify a gene responsible for SMNA, we have undertaken a comprehensive genomic evaluation of the region of linkage, including evaluation for repeat expansion and small deletions or duplications, capillary sequencing of candidate genes, and massively parallel sequencing of all coding exons. We excluded repeat expansion and small deletions or duplications as causative, and through microarray-based hybrid capture and massively parallel short-read sequencing, we identified a nonsynonymous variant in the human interferon-related developmental regulator gene 1 (IFRD1) as a disease-causing candidate. Sequence conservation, animal models, and protein structure evaluation support the involvement of IFRD1 in SMNA. Mutation analysis of IFRD1 in additional patients with similar phenotypes is needed for demonstration of causality and further evaluation of its importance in neurological diseases. PMID:19409521

Candidate gene biodosimetry markers of exposure to external ionizing radiation in human blood: A systematic review

PubMed Central

Sima, Chao; Amundson, Sally A.; Zenhausern, Frederic

2018-01-01

Purpose To compile a list of genes that have been reported to be affected by external ionizing radiation (IR) and to assess their performance as candidate biomarkers for individual human radiation dosimetry. Methods Eligible studies were identified through extensive searches of the online databases from 1978 to 2017. Original English-language publications of microarray studies assessing radiation-induced changes in gene expression levels in human blood after external IR were included. Genes identified in at least half of the selected studies were retained for bio-statistical analysis in order to evaluate their diagnostic ability. Results 24 studies met the criteria and were included in this study. Radiation-induced expression of 10,170 unique genes was identified and the 31 genes that have been identified in at least 50% of studies (12/24 studies) were selected for diagnostic power analysis. Twenty-seven genes showed a significant Spearman’s correlation with radiation dose. Individually, TNFSF4, FDXR, MYC, ZMAT3 and GADD45A provided the best discrimination of radiation dose < 2 Gy and dose ≥ 2 Gy according to according to their maximized Youden’s index (0.67, 0.55, 0.55, 0.55 and 0.53 respectively). Moreover, 12 combinations of three genes display an area under the Receiver Operating Curve (ROC) curve (AUC) = 1 reinforcing the concept of biomarker combinations instead of looking for an ideal and unique biomarker. Conclusion Gene expression is a promising approach for radiation dosimetry assessment. A list of robust candidate biomarkers has been identified from analysis of the studies published to date, confirming for example the potential of well-known genes such as FDXR and TNFSF4 or highlighting other promising gene such as ZMAT3. However, heterogeneity in protocols and analysis methods will require additional studies to confirm these results. PMID:29879226

Genome-wide association study identifies Loci and candidate genes for body composition and meat quality traits in Beijing-You chickens.

PubMed

Liu, Ranran; Sun, Yanfa; Zhao, Guiping; Wang, Fangjie; Wu, Dan; Zheng, Maiqing; Chen, Jilan; Zhang, Lei; Hu, Yaodong; Wen, Jie

2013-01-01

Body composition and meat quality traits are important economic traits of chickens. The development of high-throughput genotyping platforms and relevant statistical methods have enabled genome-wide association studies in chickens. In order to identify molecular markers and candidate genes associated with body composition and meat quality traits, genome-wide association studies were conducted using the Illumina 60 K SNP Beadchip to genotype 724 Beijing-You chickens. For each bird, a total of 16 traits were measured, including carcass weight (CW), eviscerated weight (EW), dressing percentage, breast muscle weight (BrW) and percentage (BrP), thigh muscle weight and percentage, abdominal fat weight and percentage, dry matter and intramuscular fat contents of breast and thigh muscle, ultimate pH, and shear force of the pectoralis major muscle at 100 d of age. The SNPs that were significantly associated with the phenotypic traits were identified using both simple (GLM) and compressed mixed linear (MLM) models. For nine of ten body composition traits studied, SNPs showing genome wide significance (P<2.59E-6) have been identified. A consistent region on chicken (Gallus gallus) chromosome 4 (GGA4), including seven significant SNPs and four candidate genes (LCORL, LAP3, LDB2, TAPT1), were found to be associated with CW and EW. Another 0.65 Mb region on GGA3 for BrW and BrP was identified. After measuring the mRNA content in beast muscle for five genes located in this region, the changes in GJA1 expression were found to be consistent with that of breast muscle weight across development. It is highly possible that GJA1 is a functional gene for breast muscle development in chickens. For meat quality traits, several SNPs reaching suggestive association were identified and possible candidate genes with their functions were discussed.

Functional profiles of orphan membrane transporters in the life cycle of the malaria parasite

PubMed Central

Kenthirapalan, Sanketha; Waters, Andrew P.; Matuschewski, Kai; Kooij, Taco W. A.

2016-01-01

Assigning function to orphan membrane transport proteins and prioritizing candidates for detailed biochemical characterization remain fundamental challenges and are particularly important for medically relevant pathogens, such as malaria parasites. Here we present a comprehensive genetic analysis of 35 orphan transport proteins of Plasmodium berghei during its life cycle in mice and Anopheles mosquitoes. Six genes, including four candidate aminophospholipid transporters, are refractory to gene deletion, indicative of essential functions. We generate and phenotypically characterize 29 mutant strains with deletions of individual transporter genes. Whereas seven genes appear to be dispensable under the experimental conditions tested, deletion of any of the 22 other genes leads to specific defects in life cycle progression in vivo and/or host transition. Our study provides growing support for a potential link between heavy metal homeostasis and host switching and reveals potential targets for rational design of new intervention strategies against malaria. PMID:26796412

Using Drosophila melanogaster as a Model for Genotoxic Chemical Mutational Studies with a New Program, SnpSift

PubMed Central

Cingolani, Pablo; Patel, Viral M.; Coon, Melissa; Nguyen, Tung; Land, Susan J.; Ruden, Douglas M.; Lu, Xiangyi

2012-01-01

This paper describes a new program SnpSift for filtering differential DNA sequence variants between two or more experimental genomes after genotoxic chemical exposure. Here, we illustrate how SnpSift can be used to identify candidate phenotype-relevant variants including single nucleotide polymorphisms, multiple nucleotide polymorphisms, insertions, and deletions (InDels) in mutant strains isolated from genome-wide chemical mutagenesis of Drosophila melanogaster. First, the genomes of two independently isolated mutant fly strains that are allelic for a novel recessive male-sterile locus generated by genotoxic chemical exposure were sequenced using the Illumina next-generation DNA sequencer to obtain 20- to 29-fold coverage of the euchromatic sequences. The sequencing reads were processed and variants were called using standard bioinformatic tools. Next, SnpEff was used to annotate all sequence variants and their potential mutational effects on associated genes. Then, SnpSift was used to filter and select differential variants that potentially disrupt a common gene in the two allelic mutant strains. The potential causative DNA lesions were partially validated by capillary sequencing of polymerase chain reaction-amplified DNA in the genetic interval as defined by meiotic mapping and deletions that remove defined regions of the chromosome. Of the five candidate genes located in the genetic interval, the Pka-like gene CG12069 was found to carry a separate pre-mature stop codon mutation in each of the two allelic mutants whereas the other four candidate genes within the interval have wild-type sequences. The Pka-like gene is therefore a strong candidate gene for the male-sterile locus. These results demonstrate that combining SnpEff and SnpSift can expedite the identification of candidate phenotype-causative mutations in chemically mutagenized Drosophila strains. This technique can also be used to characterize the variety of mutations generated by genotoxic chemicals. PMID:22435069

Candidate gene identification of ovulation-inducing genes by RNA sequencing with an in vivo assay in zebrafish.

PubMed

Klangnurak, Wanlada; Fukuyo, Taketo; Rezanujjaman, M D; Seki, Masahide; Sugano, Sumio; Suzuki, Yutaka; Tokumoto, Toshinobu

2018-01-01

We previously reported the microarray-based selection of three ovulation-related genes in zebrafish. We used a different selection method in this study, RNA sequencing analysis. An additional eight up-regulated candidates were found as specifically up-regulated genes in ovulation-induced samples. Changes in gene expression were confirmed by qPCR analysis. Furthermore, up-regulation prior to ovulation during natural spawning was verified in samples from natural pairing. Gene knock-out zebrafish strains of one of the candidates, the starmaker gene (stm), were established by CRISPR genome editing techniques. Unexpectedly, homozygous mutants were fertile and could spawn eggs. However, a high percentage of unfertilized eggs and abnormal embryos were produced from these homozygous females. The results suggest that the stm gene is necessary for fertilization. In this study, we selected additional ovulation-inducing candidate genes, and a novel function of the stm gene was investigated.

Reference gene selection for quantitative real-time PCR in Solanum lycopersicum L. inoculated with the mycorrhizal fungus Rhizophagus irregularis.

PubMed

Fuentes, Alejandra; Ortiz, Javier; Saavedra, Nicolás; Salazar, Luis A; Meneses, Claudio; Arriagada, Cesar

2016-04-01

The gene expression stability of candidate reference genes in the roots and leaves of Solanum lycopersicum inoculated with arbuscular mycorrhizal fungi was investigated. Eight candidate reference genes including elongation factor 1 α (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), phosphoglycerate kinase (PGK), protein phosphatase 2A (PP2Acs), ribosomal protein L2 (RPL2), β-tubulin (TUB), ubiquitin (UBI) and actin (ACT) were selected, and their expression stability was assessed to determine the most stable internal reference for quantitative PCR normalization in S. lycopersicum inoculated with the arbuscular mycorrhizal fungus Rhizophagus irregularis. The stability of each gene was analysed in leaves and roots together and separated using the geNorm and NormFinder algorithms. Differences were detected between leaves and roots, varying among the best-ranked genes depending on the algorithm used and the tissue analysed. PGK, TUB and EF1 genes showed higher stability in roots, while EF1 and UBI had higher stability in leaves. Statistical algorithms indicated that the GAPDH gene was the least stable under the experimental conditions assayed. Then, we analysed the expression levels of the LePT4 gene, a phosphate transporter whose expression is induced by fungal colonization in host plant roots. No differences were observed when the most stable genes were used as reference genes. However, when GAPDH was used as the reference gene, we observed an overestimation of LePT4 expression. In summary, our results revealed that candidate reference genes present variable stability in S. lycopersicum arbuscular mycorrhizal symbiosis depending on the algorithm and tissue analysed. Thus, reference gene selection is an important issue for obtaining reliable results in gene expression quantification. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Deep Sequencing of 71 Candidate Genes to Characterize Variation Associated with Alcohol Dependence.

PubMed

Clark, Shaunna L; McClay, Joseph L; Adkins, Daniel E; Kumar, Gaurav; Aberg, Karolina A; Nerella, Srilaxmi; Xie, Linying; Collins, Ann L; Crowley, James J; Quackenbush, Corey R; Hilliard, Christopher E; Shabalin, Andrey A; Vrieze, Scott I; Peterson, Roseann E; Copeland, William E; Silberg, Judy L; McGue, Matt; Maes, Hermine; Iacono, William G; Sullivan, Patrick F; Costello, Elizabeth J; van den Oord, Edwin J

2017-04-01

Previous genomewide association studies (GWASs) have identified a number of putative risk loci for alcohol dependence (AD). However, only a few loci have replicated and these replicated variants only explain a small proportion of AD risk. Using an innovative approach, the goal of this study was to generate hypotheses about potentially causal variants for AD that can be explored further through functional studies. We employed targeted capture of 71 candidate loci and flanking regions followed by next-generation deep sequencing (mean coverage 78X) in 806 European Americans. Regions included in our targeted capture library were genes identified through published GWAS of alcohol, all human alcohol and aldehyde dehydrogenases, reward system genes including dopaminergic and opioid receptors, prioritized candidate genes based on previous associations, and genes involved in the absorption, distribution, metabolism, and excretion of drugs. We performed single-locus tests to determine if any single variant was associated with AD symptom count. Sets of variants that overlapped with biologically meaningful annotations were tested for association in aggregate. No single, common variant was significantly associated with AD in our study. We did, however, find evidence for association with several variant sets. Two variant sets were significant at the q-value <0.10 level: a genic enhancer for ADHFE1 (p = 1.47 × 10 -5 ; q = 0.019), an alcohol dehydrogenase, and ADORA1 (p = 5.29 × 10 -5 ; q = 0.035), an adenosine receptor that belongs to a G-protein-coupled receptor gene family. To our knowledge, this is the first sequencing study of AD to examine variants in entire genes, including flanking and regulatory regions. We found that in addition to protein coding variant sets, regulatory variant sets may play a role in AD. From these findings, we have generated initial functional hypotheses about how these sets may influence AD. Copyright © 2017 by the Research Society on Alcoholism.

Common genetic variants related to genomic integrity and risk of papillary thyroid cancer

PubMed Central

Neta, Gila; Brenner, Alina V.; Sturgis, Erich M.; Pfeiffer, Ruth M.; Hutchinson, Amy A.; Aschebrook-Kilfoy, Briseis; Yeager, Meredith; Xu, Li; Wheeler, William; Abend, Michael; Ron, Elaine; Tucker, Margaret A.; Chanock, Stephen J.; Sigurdson, Alice J.

2011-01-01

DNA damage is an important mechanism in carcinogenesis, so genes related to maintaining genomic integrity may influence papillary thyroid cancer (PTC) risk. Candidate gene studies targeting some of these genes have identified only a few polymorphisms associated with risk of PTC. Here, we expanded the scope of previous candidate studies by increasing the number and coverage of genes related to maintenance of genomic integrity. We evaluated 5077 tag single-nucleotide polymorphisms (SNPs) from 340 candidate gene regions hypothesized to be involved in DNA repair, epigenetics, tumor suppression, apoptosis, telomere function and cell cycle control and signaling pathways in a case–control study of 344 PTC cases and 452 matched controls. We estimated odds ratios for associations of single SNPs with PTC risk and combined P values for SNPs in the same gene region or pathway to obtain gene region-specific or pathway-specific P values using adaptive rank-truncated product methods. Nine SNPs had P values <0.0005, three of which were in HDAC4 and were inversely related to PTC risk. After multiple comparisons adjustment, no SNPs remained associated with PTC risk. Seven gene regions were associated with PTC risk at P < 0.01, including HUS1, ALKBH3, HDAC4, BAK1, FAF1_CDKN2C, DACT3 and FZD6. Our results suggest a possible role of genes involved in maintenance of genomic integrity in relation to risk of PTC. PMID:21642358

Synteny analysis of genes and distribution of loci controlling oil content and fatty acid profile based on QTL alignment map in Brassica napus.

PubMed

Raboanatahiry, Nadia; Chao, Hongbo; Guo, Liangxing; Gan, Jianping; Xiang, Jun; Yan, Mingli; Zhang, Libin; Yu, Longjiang; Li, Maoteng

2017-10-12

Deciphering the genetic architecture of a species is a good way to understand its evolutionary history, but also to tailor its profile for breeding elite cultivars with desirable traits. Aligning QTLs from diverse population in one map and utilizing it for comparison, but also as a basis for multiple analyses assure a stronger evidence to understand the genetic system related to a given phenotype. In this study, 439 genes involved in fatty acid (FA) and triacylglycerol (TAG) biosyntheses were identified in Brassica napus. B. napus genome showed mixed gene loss and insertion compared to B. rapa and B. oleracea, and C genome had more inserted genes. Identified QTLs for oil (OC-QTLs) and fatty acids (FA-QTLs) from nine reported populations were projected on the physical map of the reference genome "Darmor-bzh" to generate a map. Thus, 335 FA-QTLs and OC-QTLs could be highlighted and 82 QTLs were overlapping. Chromosome C3 contained 22 overlapping QTLs with all trait studied except for C18:3. In total, 218 candidate genes which were potentially involved in FA and TAG were identified in 162 QTLs confidence intervals and some of them might affect many traits. Also, 76 among these candidate genes were found inside 57 overlapping QTLs, and candidate genes for oil content were in majority (61/76 genes). Then, sixteen genes were found in overlapping QTLs involving three populations, and the remaining 60 genes were found in overlapping QTLs of two populations. Interaction network and pathway analysis of these candidate genes indicated ten genes that might have strong influence over the other genes that control fatty acids and oil formation. The present results provided new information for genetic basis of FA and TAG formation in B. napus. A map including QTLs from numerous populations was built, which could serve as reference to study the genome profile of B. napus, and new potential genes emerged which might affect seed oil. New useful tracks were showed for the selection of population or/and selection of interesting genes for breeding improvement purpose.

Quantitative trait loci affecting the 3D skull shape and size in mouse and prioritization of candidate genes in-silico

PubMed Central

Maga, A. Murat; Navarro, Nicolas; Cunningham, Michael L.; Cox, Timothy C.

2015-01-01

We describe the first application of high-resolution 3D micro-computed tomography, together with 3D landmarks and geometric morphometrics, to map QTL responsible for variation in skull shape and size using a backcross between C57BL/6J and A/J inbred strains. Using 433 animals, 53 3D landmarks, and 882 SNPs from autosomes, we identified seven QTL responsible for the skull size (SCS.qtl) and 30 QTL responsible for the skull shape (SSH.qtl). Size, sex, and direction-of-cross were all significant factors and included in the analysis as covariates. All autosomes harbored at least one SSH.qtl, sometimes up to three. Effect sizes of SSH.qtl appeared to be small, rarely exceeding 1% of the overall shape variation. However, they account for significant amount of variation in some specific directions of the shape space. Many QTL have stronger effect on the neurocranium than expected from a random vector that will parcellate uniformly across the four cranial regions. On the contrary, most of QTL have an effect on the palate weaker than expected. Combined interval length of 30 SSH.qtl was about 315 MB and contained 2476 known protein coding genes. We used a bioinformatics approach to filter these candidate genes and identified 16 high-priority candidates that are likely to play a role in the craniofacial development and disorders. Thus, coupling the QTL mapping approach in model organisms with candidate gene enrichment approaches appears to be a feasible way to identify high-priority candidates genes related to the structure or tissue of interest. PMID:25859222

Mapping eQTLs in the Norfolk Island Genetic Isolate Identifies Candidate Genes for CVD Risk Traits

PubMed Central

Benton, Miles C.; Lea, Rod A.; Macartney-Coxson, Donia; Carless, Melanie A.; Göring, Harald H.; Bellis, Claire; Hanna, Michelle; Eccles, David; Chambers, Geoffrey K.; Curran, Joanne E.; Harper, Jacquie L.; Blangero, John; Griffiths, Lyn R.

2013-01-01

Cardiovascular disease (CVD) affects millions of people worldwide and is influenced by numerous factors, including lifestyle and genetics. Expression quantitative trait loci (eQTLs) influence gene expression and are good candidates for CVD risk. Founder-effect pedigrees can provide additional power to map genes associated with disease risk. Therefore, we identified eQTLs in the genetic isolate of Norfolk Island (NI) and tested for associations between these and CVD risk factors. We measured genome-wide transcript levels of blood lymphocytes in 330 individuals and used pedigree-based heritability analysis to identify heritable transcripts. eQTLs were identified by genome-wide association testing of these transcripts. Testing for association between CVD risk factors (i.e., blood lipids, blood pressure, and body fat indices) and eQTLs revealed 1,712 heritable transcripts (p < 0.05) with heritability values ranging from 0.18 to 0.84. From these, we identified 200 cis-acting and 70 trans-acting eQTLs (p < 1.84 × 10−7) An eQTL-centric analysis of CVD risk traits revealed multiple associations, including 12 previously associated with CVD-related traits. Trait versus eQTL regression modeling identified four CVD risk candidates (NAAA, PAPSS1, NME1, and PRDX1), all of which have known biological roles in disease. In addition, we implicated several genes previously associated with CVD risk traits, including MTHFR and FN3KRP. We have successfully identified a panel of eQTLs in the NI pedigree and used this to implicate several genes in CVD risk. Future studies are required for further assessing the functional importance of these eQTLs and whether the findings here also relate to outbred populations. PMID:24314549

New candidate loci identified by array-CGH in a cohort of 100 children presenting with syndromic obesity.

PubMed

Vuillaume, Marie-Laure; Naudion, Sophie; Banneau, Guillaume; Diene, Gwenaelle; Cartault, Audrey; Cailley, Dorothée; Bouron, Julie; Toutain, Jérôme; Bourrouillou, Georges; Vigouroux, Adeline; Bouneau, Laurence; Nacka, Fabienne; Kieffer, Isabelle; Arveiler, Benoit; Knoll-Gellida, Anja; Babin, Patrick J; Bieth, Eric; Jouret, Béatrice; Julia, Sophie; Sarda, Pierre; Geneviève, David; Faivre, Laurence; Lacombe, Didier; Barat, Pascal; Tauber, Maithé; Delrue, Marie-Ange; Rooryck, Caroline

2014-08-01

Syndromic obesity is defined by the association of obesity with one or more feature(s) including developmental delay, dysmorphic traits, and/or congenital malformations. Over 25 syndromic forms of obesity have been identified. However, most cases remain of unknown etiology. The aim of this study was to identify new candidate loci associated with syndromic obesity to find new candidate genes and to better understand molecular mechanisms involved in this pathology. We performed oligonucleotide microarray-based comparative genomic hybridization in a cohort of 100 children presenting with syndromic obesity of unknown etiology, after exhaustive clinical, biological, and molecular studies. Chromosomal copy number variations were detected in 42% of the children in our cohort, with 23% of patients with potentially pathogenic copy number variants. Our results support that chromosomal rearrangements are frequently associated with syndromic obesity with a variety of contributory genes having relevance to either obesity or developmental delay. A list of inherited or apparently de novo duplications and deletions including their enclosed genes and not previously linked to syndromic obesity was established. Proteins encoded by several of these genes are involved in lipid metabolism (ACOXL, MSMO1, MVD, and PDZK1) linked with nervous system function (BDH1 and LINGO2), neutral lipid storage (PLIN2), energy homeostasis and metabolic processes (CDH13, CNTNAP2, CPPED1, NDUFA4, PTGS2, and SOCS6). © 2014 Wiley Periodicals, Inc.

Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

PubMed

Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

2018-03-01

A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

Chemosensory Gene Families in Ectropis grisescens and Candidates for Detection of Type-II Sex Pheromones.

PubMed

Li, Zhao-Qun; Luo, Zong-Xiu; Cai, Xiao-Ming; Bian, Lei; Xin, Zhao-Jun; Liu, Yan; Chu, Bo; Chen, Zong-Mao

2017-01-01

Tea grey geometrid ( Ectropis grisescens ), a devastating chewing pest in tea plantations throughout China, produces Type-II pheromone components. Little is known about the genes encoding proteins involved in the perception of Type-II sex pheromone components. To investigate the olfaction genes involved in E . grisescens sex pheromones and plant volatiles perception, we sequenced female and male antennae transcriptomes of E . grisescens . After assembly and annotation, we identified 153 candidate chemoreception genes in E. grisescens , including 40 odorant-binding proteins (OBPs), 30 chemosensory proteins (CSPs), 59 odorant receptors (ORs), and 24 ionotropic receptors (IRs). The results of phylogenetic, qPCR, and mRNA abundance analyses suggested that three candidate pheromone-binding proteins (EgriOBP2, 3, and 25), two candidate general odorant-binding proteins (EgriOBP1 and 29), six pheromone receptors (EgriOR24, 25, 28, 31, 37, and 44), and EgriCSP8 may be involved in the detection of Type-II sex pheromone components. Functional investigation by heterologous expression in Xenopus oocytes revealed that EgriOR31 was robustly tuned to the E . grisescens sex pheromone component (Z,Z,Z)-3,6,9-octadecatriene and weakly to the other sex pheromone component (Z,Z)-3,9-6,7-epoxyoctadecadiene. Our results represent a systematic functional analysis of the molecular mechanism of olfaction perception in E . grisescens with an emphasis on gene encoding proteins involved in perception of Type-II sex pheromones, and provide information that will be relevant to other Lepidoptera species.

Chemosensory Gene Families in Ectropis grisescens and Candidates for Detection of Type-II Sex Pheromones

PubMed Central

Li, Zhao-Qun; Luo, Zong-Xiu; Cai, Xiao-Ming; Bian, Lei; Xin, Zhao-Jun; Liu, Yan; Chu, Bo; Chen, Zong-Mao

2017-01-01

Tea grey geometrid (Ectropis grisescens), a devastating chewing pest in tea plantations throughout China, produces Type-II pheromone components. Little is known about the genes encoding proteins involved in the perception of Type-II sex pheromone components. To investigate the olfaction genes involved in E. grisescens sex pheromones and plant volatiles perception, we sequenced female and male antennae transcriptomes of E. grisescens. After assembly and annotation, we identified 153 candidate chemoreception genes in E. grisescens, including 40 odorant-binding proteins (OBPs), 30 chemosensory proteins (CSPs), 59 odorant receptors (ORs), and 24 ionotropic receptors (IRs). The results of phylogenetic, qPCR, and mRNA abundance analyses suggested that three candidate pheromone-binding proteins (EgriOBP2, 3, and 25), two candidate general odorant-binding proteins (EgriOBP1 and 29), six pheromone receptors (EgriOR24, 25, 28, 31, 37, and 44), and EgriCSP8 may be involved in the detection of Type-II sex pheromone components. Functional investigation by heterologous expression in Xenopus oocytes revealed that EgriOR31 was robustly tuned to the E. grisescens sex pheromone component (Z,Z,Z)-3,6,9-octadecatriene and weakly to the other sex pheromone component (Z,Z)-3,9-6,7-epoxyoctadecadiene. Our results represent a systematic functional analysis of the molecular mechanism of olfaction perception in E. grisescens with an emphasis on gene encoding proteins involved in perception of Type-II sex pheromones, and provide information that will be relevant to other Lepidoptera species. PMID:29209233

Database of cattle candidate genes and genetic markers for milk production and mastitis

PubMed Central

Ogorevc, J; Kunej, T; Razpet, A; Dovc, P

2009-01-01

A cattle database of candidate genes and genetic markers for milk production and mastitis has been developed to provide an integrated research tool incorporating different types of information supporting a genomic approach to study lactation, udder development and health. The database contains 943 genes and genetic markers involved in mammary gland development and function, representing candidates for further functional studies. The candidate loci were drawn on a genetic map to reveal positional overlaps. For identification of candidate loci, data from seven different research approaches were exploited: (i) gene knockouts or transgenes in mice that result in specific phenotypes associated with mammary gland (143 loci); (ii) cattle QTL for milk production (344) and mastitis related traits (71); (iii) loci with sequence variations that show specific allele-phenotype interactions associated with milk production (24) or mastitis (10) in cattle; (iv) genes with expression profiles associated with milk production (207) or mastitis (107) in cattle or mouse; (v) cattle milk protein genes that exist in different genetic variants (9); (vi) miRNAs expressed in bovine mammary gland (32) and (vii) epigenetically regulated cattle genes associated with mammary gland function (1). Fourty-four genes found by multiple independent analyses were suggested as the most promising candidates and were further in silico analysed for expression levels in lactating mammary gland, genetic variability and top biological functions in functional networks. A miRNA target search for mammary gland expressed miRNAs identified 359 putative binding sites in 3′UTRs of candidate genes. PMID:19508288

Genome-wide association study identifies loci influencing concentrations of liver enzymes in plasma

PubMed Central

Chambers, John C; Zhang, Weihua; Sehmi, Joban; Li, Xinzhong; Wass, Mark N; Van der Harst, Pim; Holm, Hilma; Sanna, Serena; Kavousi, Maryam; Baumeister, Sebastian E; Coin, Lachlan J; Deng, Guohong; Gieger, Christian; Heard-Costa, Nancy L; Hottenga, Jouke-Jan; Kühnel, Brigitte; Kumar, Vinod; Lagou, Vasiliki; Liang, Liming; Luan, Jian’an; Vidal, Pedro Marques; Leach, Irene Mateo; O’Reilly, Paul F; Peden, John F; Rahmioglu, Nilufer; Soininen, Pasi; Speliotes, Elizabeth K; Yuan, Xin; Thorleifsson, Gudmar; Alizadeh, Behrooz Z; Atwood, Larry D; Borecki, Ingrid B; Brown, Morris J; Charoen, Pimphen; Cucca, Francesco; Das, Debashish; de Geus, Eco J C; Dixon, Anna L; Döring, Angela; Ehret, Georg; Eyjolfsson, Gudmundur I; Farrall, Martin; Forouhi, Nita G; Friedrich, Nele; Goessling, Wolfram; Gudbjartsson, Daniel F; Harris, Tamara B; Hartikainen, Anna-Liisa; Heath, Simon; Hirschfield, Gideon M; Hofman, Albert; Homuth, Georg; Hyppönen, Elina; Janssen, Harry L A; Johnson, Toby; Kangas, Antti J; Kema, Ido P; Kühn, Jens P; Lai, Sandra; Lathrop, Mark; Lerch, Markus M; Li, Yun; Liang, T Jake; Lin, Jing-Ping; Loos, Ruth J F; Martin, Nicholas G; Moffatt, Miriam F; Montgomery, Grant W; Munroe, Patricia B; Musunuru, Kiran; Nakamura, Yusuke; O’Donnell, Christopher J; Olafsson, Isleifur; Penninx, Brenda W; Pouta, Anneli; Prins, Bram P; Prokopenko, Inga; Puls, Ralf; Ruokonen, Aimo; Savolainen, Markku J; Schlessinger, David; Schouten, Jeoffrey N L; Seedorf, Udo; Sen-Chowdhry, Srijita; Siminovitch, Katherine A; Smit, Johannes H; Spector, Timothy D; Tan, Wenting; Teslovich, Tanya M; Tukiainen, Taru; Uitterlinden, Andre G; Van der Klauw, Melanie M; Vasan, Ramachandran S; Wallace, Chris; Wallaschofski, Henri; Wichmann, H-Erich; Willemsen, Gonneke; Würtz, Peter; Xu, Chun; Yerges-Armstrong, Laura M; Abecasis, Goncalo R; Ahmadi, Kourosh R; Boomsma, Dorret I; Caulfield, Mark; Cookson, William O; van Duijn, Cornelia M; Froguel, Philippe; Matsuda, Koichi; McCarthy, Mark I; Meisinger, Christa; Mooser, Vincent; Pietiläinen, Kirsi H; Schumann, Gunter; Snieder, Harold; Sternberg, Michael J E; Stolk, Ronald P; Thomas, Howard C; Thorsteinsdottir, Unnur; Uda, Manuela; Waeber, Gérard; Wareham, Nicholas J; Waterworth, Dawn M; Watkins, Hugh; Whitfield, John B; Witteman, Jacqueline C M; Wolffenbuttel, Bruce H R; Fox, Caroline S; Ala-Korpela, Mika; Stefansson, Kari; Vollenweider, Peter; Völzke, Henry; Schadt, Eric E; Scott, James; Järvelin, Marjo-Riitta; Elliott, Paul; Kooner, Jaspal S

2012-01-01

Concentrations of liver enzymes in plasma are widely used as indicators of liver disease. We carried out a genome-wide association study in 61,089 individuals, identifying 42 loci associated with concentrations of liver enzymes in plasma, of which 32 are new associations (P = 10−8 to P = 10−190). We used functional genomic approaches including metabonomic profiling and gene expression analyses to identify probable candidate genes at these regions. We identified 69 candidate genes, including genes involved in biliary transport (ATP8B1 and ABCB11), glucose, carbohydrate and lipid metabolism (FADS1, FADS2, GCKR, JMJD1C, HNF1A, MLXIPL, PNPLA3, PPP1R3B, SLC2A2 and TRIB1), glycoprotein biosynthesis and cell surface glycobiology (ABO, ASGR1, FUT2, GPLD1 and ST3GAL4), inflammation and immunity (CD276, CDH6, GCKR, HNF1A, HPR, ITGA1, RORA and STAT4) and glutathione metabolism (GSTT1, GSTT2 and GGT), as well as several genes of uncertain or unknown function (including ABHD12, EFHD1, EFNA1, EPHA2, MICAL3 and ZNF827). Our results provide new insight into genetic mechanisms and pathways influencing markers of liver function. PMID:22001757

Genome-wide association study identifies loci influencing concentrations of liver enzymes in plasma.

PubMed

Chambers, John C; Zhang, Weihua; Sehmi, Joban; Li, Xinzhong; Wass, Mark N; Van der Harst, Pim; Holm, Hilma; Sanna, Serena; Kavousi, Maryam; Baumeister, Sebastian E; Coin, Lachlan J; Deng, Guohong; Gieger, Christian; Heard-Costa, Nancy L; Hottenga, Jouke-Jan; Kühnel, Brigitte; Kumar, Vinod; Lagou, Vasiliki; Liang, Liming; Luan, Jian'an; Vidal, Pedro Marques; Mateo Leach, Irene; O'Reilly, Paul F; Peden, John F; Rahmioglu, Nilufer; Soininen, Pasi; Speliotes, Elizabeth K; Yuan, Xin; Thorleifsson, Gudmar; Alizadeh, Behrooz Z; Atwood, Larry D; Borecki, Ingrid B; Brown, Morris J; Charoen, Pimphen; Cucca, Francesco; Das, Debashish; de Geus, Eco J C; Dixon, Anna L; Döring, Angela; Ehret, Georg; Eyjolfsson, Gudmundur I; Farrall, Martin; Forouhi, Nita G; Friedrich, Nele; Goessling, Wolfram; Gudbjartsson, Daniel F; Harris, Tamara B; Hartikainen, Anna-Liisa; Heath, Simon; Hirschfield, Gideon M; Hofman, Albert; Homuth, Georg; Hyppönen, Elina; Janssen, Harry L A; Johnson, Toby; Kangas, Antti J; Kema, Ido P; Kühn, Jens P; Lai, Sandra; Lathrop, Mark; Lerch, Markus M; Li, Yun; Liang, T Jake; Lin, Jing-Ping; Loos, Ruth J F; Martin, Nicholas G; Moffatt, Miriam F; Montgomery, Grant W; Munroe, Patricia B; Musunuru, Kiran; Nakamura, Yusuke; O'Donnell, Christopher J; Olafsson, Isleifur; Penninx, Brenda W; Pouta, Anneli; Prins, Bram P; Prokopenko, Inga; Puls, Ralf; Ruokonen, Aimo; Savolainen, Markku J; Schlessinger, David; Schouten, Jeoffrey N L; Seedorf, Udo; Sen-Chowdhry, Srijita; Siminovitch, Katherine A; Smit, Johannes H; Spector, Timothy D; Tan, Wenting; Teslovich, Tanya M; Tukiainen, Taru; Uitterlinden, Andre G; Van der Klauw, Melanie M; Vasan, Ramachandran S; Wallace, Chris; Wallaschofski, Henri; Wichmann, H-Erich; Willemsen, Gonneke; Würtz, Peter; Xu, Chun; Yerges-Armstrong, Laura M; Abecasis, Goncalo R; Ahmadi, Kourosh R; Boomsma, Dorret I; Caulfield, Mark; Cookson, William O; van Duijn, Cornelia M; Froguel, Philippe; Matsuda, Koichi; McCarthy, Mark I; Meisinger, Christa; Mooser, Vincent; Pietiläinen, Kirsi H; Schumann, Gunter; Snieder, Harold; Sternberg, Michael J E; Stolk, Ronald P; Thomas, Howard C; Thorsteinsdottir, Unnur; Uda, Manuela; Waeber, Gérard; Wareham, Nicholas J; Waterworth, Dawn M; Watkins, Hugh; Whitfield, John B; Witteman, Jacqueline C M; Wolffenbuttel, Bruce H R; Fox, Caroline S; Ala-Korpela, Mika; Stefansson, Kari; Vollenweider, Peter; Völzke, Henry; Schadt, Eric E; Scott, James; Järvelin, Marjo-Riitta; Elliott, Paul; Kooner, Jaspal S

2011-10-16

Concentrations of liver enzymes in plasma are widely used as indicators of liver disease. We carried out a genome-wide association study in 61,089 individuals, identifying 42 loci associated with concentrations of liver enzymes in plasma, of which 32 are new associations (P = 10(-8) to P = 10(-190)). We used functional genomic approaches including metabonomic profiling and gene expression analyses to identify probable candidate genes at these regions. We identified 69 candidate genes, including genes involved in biliary transport (ATP8B1 and ABCB11), glucose, carbohydrate and lipid metabolism (FADS1, FADS2, GCKR, JMJD1C, HNF1A, MLXIPL, PNPLA3, PPP1R3B, SLC2A2 and TRIB1), glycoprotein biosynthesis and cell surface glycobiology (ABO, ASGR1, FUT2, GPLD1 and ST3GAL4), inflammation and immunity (CD276, CDH6, GCKR, HNF1A, HPR, ITGA1, RORA and STAT4) and glutathione metabolism (GSTT1, GSTT2 and GGT), as well as several genes of uncertain or unknown function (including ABHD12, EFHD1, EFNA1, EPHA2, MICAL3 and ZNF827). Our results provide new insight into genetic mechanisms and pathways influencing markers of liver function.

SZGR 2.0: a one-stop shop of schizophrenia candidate genes.

PubMed

Jia, Peilin; Han, Guangchun; Zhao, Junfei; Lu, Pinyi; Zhao, Zhongming

2017-01-04

SZGR 2.0 is a comprehensive resource of candidate variants and genes for schizophrenia, covering genetic, epigenetic, transcriptomic, translational and many other types of evidence. By systematic review and curation of multiple lines of evidence, we included almost all variants and genes that have ever been reported to be associated with schizophrenia. In particular, we collected ∼4200 common variants reported in genome-wide association studies, ∼1000 de novo mutations discovered by large-scale sequencing of family samples, 215 genes spanning rare and replication copy number variations, 99 genes overlapping with linkage regions, 240 differentially expressed genes, 4651 differentially methylated genes and 49 genes as antipsychotic drug targets. To facilitate interpretation, we included various functional annotation data, especially brain eQTL, methylation QTL, brain expression featured in deep categorization of brain areas and developmental stages and brain-specific promoter and enhancer annotations. Furthermore, we conducted cross-study, cross-data type and integrative analyses of the multidimensional data deposited in SZGR 2.0, and made the data and results available through a user-friendly interface. In summary, SZGR 2.0 provides a one-stop shop of schizophrenia variants and genes and their function and regulation, providing an important resource in the schizophrenia and other mental disease community. SZGR 2.0 is available at https://bioinfo.uth.edu/SZGR/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Mutation analysis of genes within the dynactin complex in a cohort of hereditary peripheral neuropathies.

PubMed

Tey, S; Ahmad-Annuar, A; Drew, A P; Shahrizaila, N; Nicholson, G A; Kennerson, M L

2016-08-01

The cytoplasmic dynein-dynactin genes are attractive candidates for neurodegenerative disorders given their functional role in retrograde transport along neurons. The cytoplasmic dynein heavy chain (DYNC1H1) gene has been implicated in various neurodegenerative disorders, and dynactin 1 (DCTN1) genes have been implicated in a wide spectrum of disorders including motor neuron disease, Parkinson's disease, spinobulbar muscular atrophy and hereditary spastic paraplegia. However, the involvement of other dynactin genes with inherited peripheral neuropathies (IPN) namely, hereditary sensory neuropathy, hereditary motor neuropathy and Charcot-Marie-Tooth disease is under reported. We screened eight genes; DCTN1-6 and ACTR1A and ACTR1B in 136 IPN patients using whole-exome sequencing and high-resolution melt (HRM) analysis. Eight non-synonymous variants (including one novel variant) and three synonymous variants were identified. Four variants have been reported previously in other studies, however segregation analysis within family members excluded them from causing IPN in these families. No variants of disease significance were identified in this study suggesting the dynactin genes are unlikely to be a common cause of IPNs. However, with the ease of querying gene variants from exome data, these genes remain worthwhile candidates to assess unsolved IPN families for variants that may affect the function of the proteins. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Identifying metabolic enzymes with multiple types of association evidence

PubMed Central

Kharchenko, Peter; Chen, Lifeng; Freund, Yoav; Vitkup, Dennis; Church, George M

2006-01-01

Background Existing large-scale metabolic models of sequenced organisms commonly include enzymatic functions which can not be attributed to any gene in that organism. Existing computational strategies for identifying such missing genes rely primarily on sequence homology to known enzyme-encoding genes. Results We present a novel method for identifying genes encoding for a specific metabolic function based on a local structure of metabolic network and multiple types of functional association evidence, including clustering of genes on the chromosome, similarity of phylogenetic profiles, gene expression, protein fusion events and others. Using E. coli and S. cerevisiae metabolic networks, we illustrate predictive ability of each individual type of association evidence and show that significantly better predictions can be obtained based on the combination of all data. In this way our method is able to predict 60% of enzyme-encoding genes of E. coli metabolism within the top 10 (out of 3551) candidates for their enzymatic function, and as a top candidate within 43% of the cases. Conclusion We illustrate that a combination of genome context and other functional association evidence is effective in predicting genes encoding metabolic enzymes. Our approach does not rely on direct sequence homology to known enzyme-encoding genes, and can be used in conjunction with traditional homology-based metabolic reconstruction methods. The method can also be used to target orphan metabolic activities. PMID:16571130

Meta-review of protein network regulating obesity between validated obesity candidate genes in the white adipose tissue of high-fat diet-induced obese C57BL/6J mice.

PubMed

Kim, Eunjung; Kim, Eun Jung; Seo, Seung-Won; Hur, Cheol-Goo; McGregor, Robin A; Choi, Myung-Sook

2014-01-01

Worldwide obesity and related comorbidities are increasing, but identifying new therapeutic targets remains a challenge. A plethora of microarray studies in diet-induced obesity models has provided large datasets of obesity associated genes. In this review, we describe an approach to examine the underlying molecular network regulating obesity, and we discuss interactions between obesity candidate genes. We conducted network analysis on functional protein-protein interactions associated with 25 obesity candidate genes identified in a literature-driven approach based on published microarray studies of diet-induced obesity. The obesity candidate genes were closely associated with lipid metabolism and inflammation. Peroxisome proliferator activated receptor gamma (Pparg) appeared to be a core obesity gene, and obesity candidate genes were highly interconnected, suggesting a coordinately regulated molecular network in adipose tissue. In conclusion, the current network analysis approach may help elucidate the underlying molecular network regulating obesity and identify anti-obesity targets for therapeutic intervention.

Whole exome sequencing identifies novel candidate genes that modify chronic obstructive pulmonary disease susceptibility.

PubMed

Bruse, Shannon; Moreau, Michael; Bromberg, Yana; Jang, Jun-Ho; Wang, Nan; Ha, Hongseok; Picchi, Maria; Lin, Yong; Langley, Raymond J; Qualls, Clifford; Klensney-Tait, Julia; Zabner, Joseph; Leng, Shuguang; Mao, Jenny; Belinsky, Steven A; Xing, Jinchuan; Nyunoya, Toru

2016-01-07

Chronic obstructive pulmonary disease (COPD) is characterized by an irreversible airflow limitation in response to inhalation of noxious stimuli, such as cigarette smoke. However, only 15-20 % smokers manifest COPD, suggesting a role for genetic predisposition. Although genome-wide association studies have identified common genetic variants that are associated with susceptibility to COPD, effect sizes of the identified variants are modest, as is the total heritability accounted for by these variants. In this study, an extreme phenotype exome sequencing study was combined with in vitro modeling to identify COPD candidate genes. We performed whole exome sequencing of 62 highly susceptible smokers and 30 exceptionally resistant smokers to identify rare variants that may contribute to disease risk or resistance to COPD. This was a cross-sectional case-control study without therapeutic intervention or longitudinal follow-up information. We identified candidate genes based on rare variant analyses and evaluated exonic variants to pinpoint individual genes whose function was computationally established to be significantly different between susceptible and resistant smokers. Top scoring candidate genes from these analyses were further filtered by requiring that each gene be expressed in human bronchial epithelial cells (HBECs). A total of 81 candidate genes were thus selected for in vitro functional testing in cigarette smoke extract (CSE)-exposed HBECs. Using small interfering RNA (siRNA)-mediated gene silencing experiments, we showed that silencing of several candidate genes augmented CSE-induced cytotoxicity in vitro. Our integrative analysis through both genetic and functional approaches identified two candidate genes (TACC2 and MYO1E) that augment cigarette smoke (CS)-induced cytotoxicity and, potentially, COPD susceptibility.

The genomic architecture and association genetics of adaptive characters using a candidate SNP approach in boreal black spruce

PubMed Central

2013-01-01

Background The genomic architecture of adaptive traits remains poorly understood in non-model plants. Various approaches can be used to bridge this gap, including the mapping of quantitative trait loci (QTL) in pedigrees, and genetic association studies in non-structured populations. Here we present results on the genomic architecture of adaptive traits in black spruce, which is a widely distributed conifer of the North American boreal forest. As an alternative to the usual candidate gene approach, a candidate SNP approach was developed for association testing. Results A genetic map containing 231 gene loci was used to identify QTL that were related to budset timing and to tree height assessed over multiple years and sites. Twenty-two unique genomic regions were identified, including 20 that were related to budset timing and 6 that were related to tree height. From results of outlier detection and bulk segregant analysis for adaptive traits using DNA pool sequencing of 434 genes, 52 candidate SNPs were identified and subsequently tested in genetic association studies for budset timing and tree height assessed over multiple years and sites. A total of 34 (65%) SNPs were significantly associated with budset timing, or tree height, or both. Although the percentages of explained variance (PVE) by individual SNPs were small, several significant SNPs were shared between sites and among years. Conclusions The sharing of genomic regions and significant SNPs between budset timing and tree height indicates pleiotropic effects. Significant QTLs and SNPs differed quite greatly among years, suggesting that different sets of genes for the same characters are involved at different stages in the tree’s life history. The functional diversity of genes carrying significant SNPs and low observed PVE further indicated that a large number of polymorphisms are involved in adaptive genetic variation. Accordingly, for undomesticated species such as black spruce with natural populations of large effective size and low linkage disequilibrium, efficient marker systems that are predictive of adaptation should require the survey of large numbers of SNPs. Candidate SNP approaches like the one developed in the present study could contribute to reducing these numbers. PMID:23724860

Genome-wide transcriptome study in wheat identified candidate genes related to processing quality, majority of them showing interaction (quality x development) and having temporal and spatial distributions.

PubMed

Singh, Anuradha; Mantri, Shrikant; Sharma, Monica; Chaudhury, Ashok; Tuli, Rakesh; Roy, Joy

2014-01-16

The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT-PCR. Therefore, this study identified several quality related key genes including many other genes, their interactions (quality x development) and temporal and spatial distributions. The candidate genes identified for processing quality and information on temporal and spatial distributions of their expressions would be useful for designing wheat improvement programs for processing quality either by changing their expression or development of single nucleotide polymorphisms (SNPs) markers.

Genome-wide transcriptome study in wheat identified candidate genes related to processing quality, majority of them showing interaction (quality x development) and having temporal and spatial distributions

PubMed Central

2014-01-01

Background The cultivated bread wheat (Triticum aestivum L.) possesses unique flour quality, which can be processed into many end-use food products such as bread, pasta, chapatti (unleavened flat bread), biscuit, etc. The present wheat varieties require improvement in processing quality to meet the increasing demand of better quality food products. However, processing quality is very complex and controlled by many genes, which have not been completely explored. To identify the candidate genes whose expressions changed due to variation in processing quality and interaction (quality x development), genome-wide transcriptome studies were performed in two sets of diverse Indian wheat varieties differing for chapatti quality. It is also important to understand the temporal and spatial distributions of their expressions for designing tissue and growth specific functional genomics experiments. Results Gene-specific two-way ANOVA analysis of expression of about 55 K transcripts in two diverse sets of Indian wheat varieties for chapatti quality at three seed developmental stages identified 236 differentially expressed probe sets (10-fold). Out of 236, 110 probe sets were identified for chapatti quality. Many processing quality related key genes such as glutenin and gliadins, puroindolines, grain softness protein, alpha and beta amylases, proteases, were identified, and many other candidate genes related to cellular and molecular functions were also identified. The ANOVA analysis revealed that the expression of 56 of 110 probe sets was involved in interaction (quality x development). Majority of the probe sets showed differential expression at early stage of seed development i.e. temporal expression. Meta-analysis revealed that the majority of the genes expressed in one or a few growth stages indicating spatial distribution of their expressions. The differential expressions of a few candidate genes such as pre-alpha/beta-gliadin and gamma gliadin were validated by RT-PCR. Therefore, this study identified several quality related key genes including many other genes, their interactions (quality x development) and temporal and spatial distributions. Conclusions The candidate genes identified for processing quality and information on temporal and spatial distributions of their expressions would be useful for designing wheat improvement programs for processing quality either by changing their expression or development of single nucleotide polymorphisms (SNPs) markers. PMID:24433256

GraphTeams: a method for discovering spatial gene clusters in Hi-C sequencing data.

PubMed

Schulz, Tizian; Stoye, Jens; Doerr, Daniel

2018-05-08

Hi-C sequencing offers novel, cost-effective means to study the spatial conformation of chromosomes. We use data obtained from Hi-C experiments to provide new evidence for the existence of spatial gene clusters. These are sets of genes with associated functionality that exhibit close proximity to each other in the spatial conformation of chromosomes across several related species. We present the first gene cluster model capable of handling spatial data. Our model generalizes a popular computational model for gene cluster prediction, called δ-teams, from sequences to graphs. Following previous lines of research, we subsequently extend our model to allow for several vertices being associated with the same label. The model, called δ-teams with families, is particular suitable for our application as it enables handling of gene duplicates. We develop algorithmic solutions for both models. We implemented the algorithm for discovering δ-teams with families and integrated it into a fully automated workflow for discovering gene clusters in Hi-C data, called GraphTeams. We applied it to human and mouse data to find intra- and interchromosomal gene cluster candidates. The results include intrachromosomal clusters that seem to exhibit a closer proximity in space than on their chromosomal DNA sequence. We further discovered interchromosomal gene clusters that contain genes from different chromosomes within the human genome, but are located on a single chromosome in mouse. By identifying δ-teams with families, we provide a flexible model to discover gene cluster candidates in Hi-C data. Our analysis of Hi-C data from human and mouse reveals several known gene clusters (thus validating our approach), but also few sparsely studied or possibly unknown gene cluster candidates that could be the source of further experimental investigations.

Evaluating Reported Candidate Gene Associations with Polycystic Ovary Syndrome

PubMed Central

Pau, Cindy; Saxena, Richa; Welt, Corrine Kolka

2013-01-01

Objective To replicate variants in candidate genes associated with PCOS in a population of European PCOS and control subjects. Design Case-control association analysis and meta-analysis. Setting Major academic hospital Patients Women of European ancestry with PCOS (n=525) and controls (n=472), aged 18 to 45 years. Intervention Variants previously associated with PCOS in candidate gene studies were genotyped (n=39). Metabolic, reproductive and anthropomorphic parameters were examined as a function of the candidate variants. All genetic association analyses were adjusted for age, BMI and ancestry and were reported after correction for multiple testing. Main Outcome Measure Association of candidate gene variants with PCOS. Results Three variants, rs3797179 (SRD5A1), rs12473543 (POMC), and rs1501299 (ADIPOQ), were nominally associated with PCOS. However, they did not remain significant after correction for multiple testing and none of the variants replicated in a sufficiently powered meta-analysis. Variants in the FBN3 gene (rs17202517 and rs73503752) were associated with smaller waist circumferences and variant rs727428 in the SHBG gene was associated with lower SHBG levels. Conclusion Previously identified variants in candidate genes do not appear to be associated with PCOS risk. PMID:23375202

Sarcoidosis Related Novel Candidate Genes Identified by Multi-Omics Integrative Analyses.

PubMed

Hočevar, Keli; Maver, Aleš; Kunej, Tanja; Peterlin, Borut

2018-05-01

Sarcoidosis is a multifactorial systemic disease characterized by granulomatous inflammation and greatly impacting on global public health. The etiology and mechanisms of sarcoidosis are not fully understood. Recent high-throughput biological research has generated vast amounts of multi-omics big data on sarcoidosis, but their significance remains to be determined. We sought to identify novel candidate regions, and genes consistently altered in heterogeneous omics studies so as to reveal the underlying molecular mechanisms. We conducted a comprehensive integrative literature analysis on global data on sarcoidosis, including genomic, transcriptomic, proteomic, and phenomic studies. We performed positional integration analysis of 38 eligible datasets originating from 17 different biological layers. Using the integration interval length of 50 kb, we identified 54 regions reaching significance value p ≤ 0.0001 and 15 regions with significance value p ≤ 0.00001, when applying more stringent criteria. Secondary literature analysis of the top 20 regions, with the most significant accumulation of signals, revealed several novel candidate genes for which associations with sarcoidosis have not yet been established, but have considerable support for their involvement based on omic data. These new plausible candidate genes include NELFE, CFB, EGFL7, AGPAT2, FKBPL, NRC3, and NEU1. Furthermore, annotated data were prepared to enable custom visualization and browsing of these sarcoidosis related omics evidence in the University of California Santa Cruz (UCSC) Genome Browser. Further multi-omics approaches are called for sarcoidosis biomarkers and diagnostic and therapeutic innovation. Our approach for harnessing multi-omics data and the findings presented herein reflect important steps toward understanding the etiology and underlying pathological mechanisms of sarcoidosis.

Reranking candidate gene models with cross-species comparison for improved gene prediction

PubMed Central

Liu, Qian; Crammer, Koby; Pereira, Fernando CN; Roos, David S

2008-01-01

Background Most gene finders score candidate gene models with state-based methods, typically HMMs, by combining local properties (coding potential, splice donor and acceptor patterns, etc). Competing models with similar state-based scores may be distinguishable with additional information. In particular, functional and comparative genomics datasets may help to select among competing models of comparable probability by exploiting features likely to be associated with the correct gene models, such as conserved exon/intron structure or protein sequence features. Results We have investigated the utility of a simple post-processing step for selecting among a set of alternative gene models, using global scoring rules to rerank competing models for more accurate prediction. For each gene locus, we first generate the K best candidate gene models using the gene finder Evigan, and then rerank these models using comparisons with putative orthologous genes from closely-related species. Candidate gene models with lower scores in the original gene finder may be selected if they exhibit strong similarity to probable orthologs in coding sequence, splice site location, or signal peptide occurrence. Experiments on Drosophila melanogaster demonstrate that reranking based on cross-species comparison outperforms the best gene models identified by Evigan alone, and also outperforms the comparative gene finders GeneWise and Augustus+. Conclusion Reranking gene models with cross-species comparison improves gene prediction accuracy. This straightforward method can be readily adapted to incorporate additional lines of evidence, as it requires only a ranked source of candidate gene models. PMID:18854050

Prioritizing chronic obstructive pulmonary disease (COPD) candidate genes in COPD-related networks

PubMed Central

Zhang, Yihua; Li, Wan; Feng, Yuyan; Guo, Shanshan; Zhao, Xilei; Wang, Yahui; He, Yuehan; He, Weiming; Chen, Lina

2017-01-01

Chronic obstructive pulmonary disease (COPD) is a multi-factor disease, which could be caused by many factors, including disturbances of metabolism and protein-protein interactions (PPIs). In this paper, a weighted COPD-related metabolic network and a weighted COPD-related PPI network were constructed base on COPD disease genes and functional information. Candidate genes in these weighted COPD-related networks were prioritized by making use of a gene prioritization method, respectively. Literature review and functional enrichment analysis of the top 100 genes in these two networks suggested the correlation of COPD and these genes. The performance of our gene prioritization method was superior to that of ToppGene and ToppNet for genes from the COPD-related metabolic network or the COPD-related PPI network after assessing using leave-one-out cross-validation, literature validation and functional enrichment analysis. The top-ranked genes prioritized from COPD-related metabolic and PPI networks could promote the better understanding about the molecular mechanism of this disease from different perspectives. The top 100 genes in COPD-related metabolic network or COPD-related PPI network might be potential markers for the diagnosis and treatment of COPD. PMID:29262568

Prioritizing chronic obstructive pulmonary disease (COPD) candidate genes in COPD-related networks.

PubMed

Zhang, Yihua; Li, Wan; Feng, Yuyan; Guo, Shanshan; Zhao, Xilei; Wang, Yahui; He, Yuehan; He, Weiming; Chen, Lina

2017-11-28

Chronic obstructive pulmonary disease (COPD) is a multi-factor disease, which could be caused by many factors, including disturbances of metabolism and protein-protein interactions (PPIs). In this paper, a weighted COPD-related metabolic network and a weighted COPD-related PPI network were constructed base on COPD disease genes and functional information. Candidate genes in these weighted COPD-related networks were prioritized by making use of a gene prioritization method, respectively. Literature review and functional enrichment analysis of the top 100 genes in these two networks suggested the correlation of COPD and these genes. The performance of our gene prioritization method was superior to that of ToppGene and ToppNet for genes from the COPD-related metabolic network or the COPD-related PPI network after assessing using leave-one-out cross-validation, literature validation and functional enrichment analysis. The top-ranked genes prioritized from COPD-related metabolic and PPI networks could promote the better understanding about the molecular mechanism of this disease from different perspectives. The top 100 genes in COPD-related metabolic network or COPD-related PPI network might be potential markers for the diagnosis and treatment of COPD.

EBF proteins participate in transcriptional regulation of Xenopus muscle development.

PubMed

Green, Yangsook Song; Vetter, Monica L

2011-10-01

EBF proteins have diverse functions in the development of multiple lineages, including neurons, B cells and adipocytes. During Drosophila muscle development EBF proteins are expressed in muscle progenitors and are required for muscle cell differentiation, but there is no known function of EBF proteins in vertebrate muscle development. In this study, we examine the expression of ebf genes in Xenopus muscle tissue and show that EBF activity is necessary for aspects of Xenopus skeletal muscle development, including somite organization, migration of hypaxial muscle anlagen toward the ventral abdomen, and development of jaw muscle. From a microarray screen, we have identified multiple candidate targets of EBF activity with known roles in muscle development. The candidate targets we have verified are MYOD, MYF5, M-Cadherin and SEB-4. In vivo overexpression of the ebf2 and ebf3 genes leads to ectopic expression of these candidate targets, and knockdown of EBF activity causes downregulation of the endogenous expression of the candidate targets. Furthermore, we found that MYOD and MYF5 are likely to be direct targets. Finally we show that MYOD can upregulate the expression of ebf genes, indicating the presence of a positive feedback loop between EBF and MYOD that we find to be important for maintenance of MYOD expression in Xenopus. These results suggest that EBF activity is important for both stabilizing commitment and driving aspects of differentiation in Xenopus muscle cells. Copyright © 2010 Elsevier Inc. All rights reserved.

Candidate gene prioritization by network analysis of differential expression using machine learning approaches

PubMed Central

2010-01-01

Background Discovering novel disease genes is still challenging for diseases for which no prior knowledge - such as known disease genes or disease-related pathways - is available. Performing genetic studies frequently results in large lists of candidate genes of which only few can be followed up for further investigation. We have recently developed a computational method for constitutional genetic disorders that identifies the most promising candidate genes by replacing prior knowledge by experimental data of differential gene expression between affected and healthy individuals. To improve the performance of our prioritization strategy, we have extended our previous work by applying different machine learning approaches that identify promising candidate genes by determining whether a gene is surrounded by highly differentially expressed genes in a functional association or protein-protein interaction network. Results We have proposed three strategies scoring disease candidate genes relying on network-based machine learning approaches, such as kernel ridge regression, heat kernel, and Arnoldi kernel approximation. For comparison purposes, a local measure based on the expression of the direct neighbors is also computed. We have benchmarked these strategies on 40 publicly available knockout experiments in mice, and performance was assessed against results obtained using a standard procedure in genetics that ranks candidate genes based solely on their differential expression levels (Simple Expression Ranking). Our results showed that our four strategies could outperform this standard procedure and that the best results were obtained using the Heat Kernel Diffusion Ranking leading to an average ranking position of 8 out of 100 genes, an AUC value of 92.3% and an error reduction of 52.8% relative to the standard procedure approach which ranked the knockout gene on average at position 17 with an AUC value of 83.7%. Conclusion In this study we could identify promising candidate genes using network based machine learning approaches even if no knowledge is available about the disease or phenotype. PMID:20840752

EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

PubMed

Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

2014-11-01

The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

[Stability analysis of reference gene based on real-time PCR in Artemisia annua under cadmium treatment].

PubMed

Zhou, Liang-Yun; Mo, Ge; Wang, Sheng; Tang, Jin-Fu; Yue, Hong; Huang, Lu-Qi; Shao, Ai-Juan; Guo, Lan-Ping

2014-03-01

In this study, Actin, 18S rRNA, PAL, GAPDH and CPR of Artemisia annua were selected as candidate reference genes, and their gene-specific primers for real-time PCR were designed, then geNorm, NormFinder, BestKeeper, Delta CT and RefFinder were used to evaluate their expression stability in the leaves of A. annua under treatment of different concentrations of Cd, with the purpose of finding a reliable reference gene to ensure the reliability of gene-expression analysis. The results showed that there were some significant differences among the candidate reference genes under different treatments and the order of expression stability of candidate reference gene was Actin > 18S rRNA > PAL > GAPDH > CPR. These results suggested that Actin, 18S rRNA and PAL could be used as ideal reference genes of gene expression analysis in A. annua and multiple internal control genes were adopted for results calibration. In addition, differences in expression stability of candidate reference genes in the leaves of A. annua under the same concentrations of Cd were observed, which suggested that the screening of candidate reference genes was needed even under the same treatment. To our best knowledge, this study for the first time provided the ideal reference genes under Cd treatment in the leaves of A. annua and offered reference for the gene expression analysis of A. annua under other conditions.

Transcriptome Profiling of Khat (Catha edulis) and Ephedra sinica Reveals Gene Candidates Potentially Involved in Amphetamine-Type Alkaloid Biosynthesis

PubMed Central

Groves, Ryan A.; Hagel, Jillian M.; Zhang, Ye; Kilpatrick, Korey; Levy, Asaf; Marsolais, Frédéric; Lewinsohn, Efraim; Sensen, Christoph W.; Facchini, Peter J.

2015-01-01

Amphetamine analogues are produced by plants in the genus Ephedra and by khat (Catha edulis), and include the widely used decongestants and appetite suppressants (1S,2S)-pseudoephedrine and (1R,2S)-ephedrine. The production of these metabolites, which derive from L-phenylalanine, involves a multi-step pathway partially mapped out at the biochemical level using knowledge of benzoic acid metabolism established in other plants, and direct evidence using khat and Ephedra species as model systems. Despite the commercial importance of amphetamine-type alkaloids, only a single step in their biosynthesis has been elucidated at the molecular level. We have employed Illumina next-generation sequencing technology, paired with Trinity and Velvet-Oases assembly platforms, to establish data-mining frameworks for Ephedra sinica and khat plants. Sequence libraries representing a combined 200,000 unigenes were subjected to an annotation pipeline involving direct searches against public databases. Annotations included the assignment of Gene Ontology (GO) terms used to allocate unigenes to functional categories. As part of our functional genomics program aimed at novel gene discovery, the databases were mined for enzyme candidates putatively involved in alkaloid biosynthesis. Queries used for mining included enzymes with established roles in benzoic acid metabolism, as well as enzymes catalyzing reactions similar to those predicted for amphetamine alkaloid metabolism. Gene candidates were evaluated based on phylogenetic relationships, FPKM-based expression data, and mechanistic considerations. Establishment of expansive sequence resources is a critical step toward pathway characterization, a goal with both academic and industrial implications. PMID:25806807

DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

PubMed

González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

2006-03-01

Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.

snoSeeker: an advanced computational package for screening of guide and orphan snoRNA genes in the human genome.

PubMed

Yang, Jian-Hua; Zhang, Xiao-Chen; Huang, Zhan-Peng; Zhou, Hui; Huang, Mian-Bo; Zhang, Shu; Chen, Yue-Qin; Qu, Liang-Hu

2006-01-01

Small nucleolar RNAs (snoRNAs) represent an abundant group of non-coding RNAs in eukaryotes. They can be divided into guide and orphan snoRNAs according to the presence or absence of antisense sequence to rRNAs or snRNAs. Current snoRNA-searching programs, which are essentially based on sequence complementarity to rRNAs or snRNAs, exist only for the screening of guide snoRNAs. In this study, we have developed an advanced computational package, snoSeeker, which includes CDseeker and ACAseeker programs, for the highly efficient and specific screening of both guide and orphan snoRNA genes in mammalian genomes. By using these programs, we have systematically scanned four human-mammal whole-genome alignment (WGA) sequences and identified 54 novel candidates including 26 orphan candidates as well as 266 known snoRNA genes. Eighteen novel snoRNAs were further experimentally confirmed with four snoRNAs exhibiting a tissue-specific or restricted expression pattern. The results of this study provide the most comprehensive listing of two families of snoRNA genes in the human genome till date.

Inheritance of partial resistance against Colletotrichum lindemuthianum in Phaseolus vulgaris and co-localization of quantitative trait loci with genes involved in specific resistance.

PubMed

Geffroy, V; Sévignac, M; De Oliveira, J C; Fouilloux, G; Skroch, P; Thoquet, P; Gepts, P; Langin, T; Dron, M

2000-03-01

Anthracnose, one of the most important diseases of common bean (Phaseolus vulgaris), is caused by the fungus Colletotrichum lindemuthianum. A "candidate gene" approach was used to map anthracnose resistance quantitative trait loci (QTL). Candidate genes included genes for both pathogen recognition (resistance genes and resistance gene analogs [RGAs]) and general plant defense (defense response genes). Two strains of C. lindemuthianum, identified in a world collection of 177 strains, displayed a reproducible and differential aggressiveness toward BAT93 and JaloEEP558, two parental lines of P. vulgaris representing the two major gene pools of this crop. A reliable test was developed to score partial resistance in aerial organs of the plant (stem, leaf, petiole) under controlled growth chamber conditions. BAT93 was more resistant than JaloEEP558 regardless of the organ or strain tested. With a recombinant inbred line (RIL) population derived from a cross between these two parental lines, 10 QTL were located on a genetic map harboring 143 markers, including known defense response genes, anthracnose-specific resistance genes, and RGAs. Eight of the QTL displayed isolate specificity. Two were co-localized with known defense genes (phenylalanine ammonia-lyase and hydroxyproline-rich glycoprotein) and three with anthracnose-specific resistance genes and/or RGAs. Interestingly, two QTL, with different allelic contribution, mapped on linkage group B4 in a 5.0 cM interval containing Andean and Mesoamerican specific resistance genes against C. lindemuthianum and 11 polymorphic fragments revealed with a RGA probe. The possible relationship between genes underlying specific and partial resistance is discussed.

Large-scale identification of wheat genes resistant to cereal cyst nematode Heterodera avenae using comparative transcriptomic analysis.

PubMed

Kong, Ling-An; Wu, Du-Qing; Huang, Wen-Kun; Peng, Huan; Wang, Gao-Feng; Cui, Jiang-Kuan; Liu, Shi-Ming; Li, Zhi-Gang; Yang, Jun; Peng, De-Liang

2015-10-16

Cereal cyst nematode Heterodera avenae, an important soil-borne pathogen in wheat, causes numerous annual yield losses worldwide, and use of resistant cultivars is the best strategy for control. However, target genes are not readily available for breeding resistant cultivars. Therefore, comparative transcriptomic analyses were performed to identify more applicable resistance genes for cultivar breeding. The developing nematodes within roots were stained with acid fuchsin solution. Transcriptome assemblies and redundancy filteration were obtained by Trinity, TGI Clustering Tool and BLASTN, respectively. Gene Ontology annotation was yielded by Blast2GO program, and metabolic pathways of transcripts were analyzed by Path_finder. The ROS levels were determined by luminol-chemiluminescence assay. The transcriptional gene expression profiles were obtained by quantitative RT-PCR. The RNA-sequencing was performed using an incompatible wheat cultivar VP1620 and a compatible control cultivar WEN19 infected with H. avenae at 24 h, 3 d and 8 d. Infection assays showed that VP1620 failed to block penetration of H. avenae but disturbed the transition of developmental stages, leading to a significant reduction in cyst formation. Two types of expression profiles were established to predict candidate resistance genes after developing a novel strategy to generate clean RNA-seq data by removing the transcripts of H. avenae within the raw data before assembly. Using the uncoordinated expression profiles with transcript abundance as a standard, 424 candidate resistance genes were identified, including 302 overlapping genes and 122 VP1620-specific genes. Genes with similar expression patterns were further classified according to the scales of changed transcript abundances, and 182 genes were rescued as supplementary candidate resistance genes. Functional characterizations revealed that diverse defense-related pathways were responsible for wheat resistance against H. avenae. Moreover, phospholipase was involved in many defense-related pathways and localized in the connection position. Furthermore, strong bursts of reactive oxygen species (ROS) within VP1620 roots infected with H. avenae were induced at 24 h and 3 d, and eight ROS-producing genes were significantly upregulated, including three class III peroxidase and five lipoxygenase genes. Large-scale identification of wheat resistance genes were processed by comparative transcriptomic analysis. Functional characterization showed that phospholipases associated with ROS production played vital roles in early defense responses to H. avenae via involvement in diverse defense-related pathways as a hub switch. This study is the first to investigate the early defense responses of wheat against H. avenae, not only provides applicable candidate resistance genes for breeding novel wheat cultivars, but also enables a better understanding of the defense mechanisms of wheat against H. avenae.

De novo Transcriptome Assembly of Floral Buds of Pineapple and Identification of Differentially Expressed Genes in Response to Ethephon Induction

PubMed Central

Liu, Chuan-He; Fan, Chao

2016-01-01

A remarkable characteristic of pineapple is its ability to undergo floral induction in response to external ethylene stimulation. However, little information is available regarding the molecular mechanism underlying this process. In this study, the differentially expressed genes (DEGs) in plants exposed to 1.80 mL·L−1 (T1) or 2.40 mL·L−1 ethephon (T2) compared with Ct plants (control, cleaning water) were identified using RNA-seq and gene expression profiling. Illumina sequencing generated 65,825,224 high-quality reads that were assembled into 129,594 unigenes with an average sequence length of 1173 bp. Of these unigenes, 24,775 were assigned to specific KEGG pathways, of which metabolic pathways and biosynthesis of secondary metabolites were the most highly represented. Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority were involved in metabolic and cellular processes, cell and cell part, catalytic activity and binding. Gene expression profiling analysis revealed 3788, 3062, and 758 DEGs in the comparisons of T1 with Ct, T2 with Ct, and T2 with T1, respectively. GO analysis indicated that these DEGs were predominantly annotated to metabolic and cellular processes, cell and cell part, catalytic activity, and binding. KEGG pathway analysis revealed the enrichment of several important pathways among the DEGs, including metabolic pathways, biosynthesis of secondary metabolites and plant hormone signal transduction. Thirteen DEGs were identified as candidate genes associated with the process of floral induction by ethephon, including three ERF-like genes, one ETR-like gene, one LTI-like gene, one FT-like gene, one VRN1-like gene, three FRI-like genes, one AP1-like gene, one CAL-like gene, and one AG-like gene. qPCR analysis indicated that the changes in the expression of these 13 candidate genes were consistent with the alterations in the corresponding RPKM values, confirming the accuracy and credibility of the RNA-seq and gene expression profiling results. Ethephon-mediated induction likely mimics the process of vernalization in the floral transition in pineapple by increasing LTI, FT, and VRN1 expression and promoting the up-regulation of floral meristem identity genes involved in flower development. The candidate genes screened can be used in investigations of the molecular mechanisms of the flowering pathway and of various other biological mechanisms in pineapple. PMID:26955375

Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis

PubMed Central

Grassi, Elena; Damasco, Christian; Silengo, Lorenzo; Oti, Martin; Provero, Paolo; Di Cunto, Ferdinando

2008-01-01

Background Even in the post-genomic era, the identification of candidate genes within loci associated with human genetic diseases is a very demanding task, because the critical region may typically contain hundreds of positional candidates. Since genes implicated in similar phenotypes tend to share very similar expression profiles, high throughput gene expression data may represent a very important resource to identify the best candidates for sequencing. However, so far, gene coexpression has not been used very successfully to prioritize positional candidates. Methodology/Principal Findings We show that it is possible to reliably identify disease-relevant relationships among genes from massive microarray datasets by concentrating only on genes sharing similar expression profiles in both human and mouse. Moreover, we show systematically that the integration of human-mouse conserved coexpression with a phenotype similarity map allows the efficient identification of disease genes in large genomic regions. Finally, using this approach on 850 OMIM loci characterized by an unknown molecular basis, we propose high-probability candidates for 81 genetic diseases. Conclusion Our results demonstrate that conserved coexpression, even at the human-mouse phylogenetic distance, represents a very strong criterion to predict disease-relevant relationships among human genes. PMID:18369433

Regional Heritability Mapping Provides Insights into Dry Matter Content in African White and Yellow Cassava Populations.

PubMed

Okeke, Uche Godfrey; Akdemir, Deniz; Rabbi, Ismail; Kulakow, Peter; Jannink, Jean-Luc

2018-03-01

The HarvestPlus program for cassava ( Crantz) fortifies cassava with β-carotene by breeding for carotene-rich tubers (yellow cassava). However, a negative correlation between yellowness and dry matter (DM) content has been identified. We investigated the genetic control of DM in white and yellow cassava. We used regional heritability mapping (RHM) to associate DM with genomic segments in both subpopulations. Significant segments were subjected to candidate gene analysis and candidates were validated with prediction accuracies. The RHM procedure was validated via a simulation approach and revealed significant hits for white cassava on chromosomes 1, 4, 5, 10, 17, and 18, whereas hits for the yellow were on chromosome 1. Candidate gene analysis revealed genes in the carbohydrate biosynthesis pathway including plant serine-threonine protein kinases (SnRKs), UDP (uridine diphosphate)-glycosyltransferases, UDP-sugar transporters, invertases, pectinases, and regulons. Validation using 1252 unique identifiers from the SnRK gene family genome-wide recovered 50% of the predictive accuracy of whole-genome single nucleotide polymorphisms for DM, whereas validation using 53 likely genes (extracted from the literature) from significant segments recovered 32%. Genes including an acid invertase, a neutral or alkaline invertase, and a glucose-6-phosphate isomerase were validated on the basis of an a priori list for the cassava starch pathway, and also a fructose-biphosphate aldolase from the Calvin cycle pathway. The power of the RHM procedure was estimated as 47% when the causal quantitative trait loci generated 10% of the phenotypic variance (sample size = 451). Cassava DM genetics are complex and RHM may be useful for complex traits. Copyright © 2018 Crop Science Society of America.

Exome sequencing of oral squamous cell carcinoma in users of Arabian snuff reveals novel candidates for driver genes.

PubMed

Al-Hebshi, Nezar Noor; Li, Shiyong; Nasher, Akram Thabet; El-Setouhy, Maged; Alsanosi, Rashad; Blancato, Jan; Loffredo, Christopher

2016-07-15

The study sought to identify genetic aberrations driving oral squamous cell carcinoma (OSCC) development among users of shammah, an Arabian preparation of smokeless tobacco. Twenty archival OSCC samples, 15 of which with a history of shammah exposure, were whole-exome sequenced at an average depth of 127×. Somatic mutations were identified using a novel, matched controls-independent filtration algorithm. CODEX and Exomedepth coupled with a novel, Database of Genomic Variant-based filter were employed to call somatic gene-copy number variations. Significantly mutated genes were identified with Oncodrive FM and the Youn and Simon's method. Candidate driver genes were nominated based on Gene Set Enrichment Analysis. The observed mutational spectrum was similar to that reported by the TCGA project. In addition to confirming known genes of OSCC (TP53, CDKNA2, CASP8, PIK3CA, HRAS, FAT1, TP63, CCND1 and FADD) the analysis identified several candidate novel driver events including mutations of NOTCH3, CSMD3, CRB1, CLTCL1, OSMR and TRPM2, amplification of the proto-oncogenes FOSL1, RELA, TRAF6, MDM2, FRS2 and BAG1, and deletion of the recently described tumor suppressor SMARCC1. Analysis also revealed significantly altered pathways not previously implicated in OSCC including Oncostatin-M signalling pathway, AP-1 and C-MYB transcription networks and endocytosis. There was a trend for higher number of mutations, amplifications and driver events in samples with history of shammah exposure particularly those that tested EBV positive, suggesting an interaction between tobacco exposure and EBV. The work provides further evidence for the genetic heterogeneity of oral cancer and suggests shammah-associated OSCC is characterized by extensive amplification of oncogenes. © 2016 UICC.

Identification of Inherited Retinal Disease-Associated Genetic Variants in 11 Candidate Genes.

PubMed

Astuti, Galuh D N; van den Born, L Ingeborgh; Khan, M Imran; Hamel, Christian P; Bocquet, Béatrice; Manes, Gaël; Quinodoz, Mathieu; Ali, Manir; Toomes, Carmel; McKibbin, Martin; El-Asrag, Mohammed E; Haer-Wigman, Lonneke; Inglehearn, Chris F; Black, Graeme C M; Hoyng, Carel B; Cremers, Frans P M; Roosing, Susanne

2018-01-10

Inherited retinal diseases (IRDs) display an enormous genetic heterogeneity. Whole exome sequencing (WES) recently identified genes that were mutated in a small proportion of IRD cases. Consequently, finding a second case or family carrying pathogenic variants in the same candidate gene often is challenging. In this study, we searched for novel candidate IRD gene-associated variants in isolated IRD families, assessed their causality, and searched for novel genotype-phenotype correlations. Whole exome sequencing was performed in 11 probands affected with IRDs. Homozygosity mapping data was available for five cases. Variants with minor allele frequencies ≤ 0.5% in public databases were selected as candidate disease-causing variants. These variants were ranked based on their: (a) presence in a gene that was previously implicated in IRD; (b) minor allele frequency in the Exome Aggregation Consortium database (ExAC); (c) in silico pathogenicity assessment using the combined annotation dependent depletion (CADD) score; and (d) interaction of the corresponding protein with known IRD-associated proteins. Twelve unique variants were found in 11 different genes in 11 IRD probands. Novel autosomal recessive and dominant inheritance patterns were found for variants in Small Nuclear Ribonucleoprotein U5 Subunit 200 ( SNRNP200 ) and Zinc Finger Protein 513 ( ZNF513 ), respectively. Using our pathogenicity assessment, a variant in DEAH-Box Helicase 32 ( DHX32 ) was the top ranked novel candidate gene to be associated with IRDs, followed by eight medium and lower ranked candidate genes. The identification of candidate disease-associated sequence variants in 11 single families underscores the notion that the previously identified IRD-associated genes collectively carry > 90% of the defects implicated in IRDs. To identify multiple patients or families with variants in the same gene and thereby provide extra proof for pathogenicity, worldwide data sharing is needed.

Demographically-Based Evaluation of Genomic Regions under Selection in Domestic Dogs

PubMed Central

Freedman, Adam H.; Schweizer, Rena M.; Ortega-Del Vecchyo, Diego; Han, Eunjung; Davis, Brian W.; Gronau, Ilan; Silva, Pedro M.; Galaverni, Marco; Fan, Zhenxin; Marx, Peter; Lorente-Galdos, Belen; Ramirez, Oscar; Hormozdiari, Farhad; Alkan, Can; Vilà, Carles; Squire, Kevin; Geffen, Eli; Kusak, Josip; Boyko, Adam R.; Parker, Heidi G.; Lee, Clarence; Tadigotla, Vasisht; Siepel, Adam; Bustamante, Carlos D.; Harkins, Timothy T.; Nelson, Stanley F.; Marques-Bonet, Tomas; Ostrander, Elaine A.; Wayne, Robert K.; Novembre, John

2016-01-01

Controlling for background demographic effects is important for accurately identifying loci that have recently undergone positive selection. To date, the effects of demography have not yet been explicitly considered when identifying loci under selection during dog domestication. To investigate positive selection on the dog lineage early in the domestication, we examined patterns of polymorphism in six canid genomes that were previously used to infer a demographic model of dog domestication. Using an inferred demographic model, we computed false discovery rates (FDR) and identified 349 outlier regions consistent with positive selection at a low FDR. The signals in the top 100 regions were frequently centered on candidate genes related to brain function and behavior, including LHFPL3, CADM2, GRIK3, SH3GL2, MBP, PDE7B, NTAN1, and GLRA1. These regions contained significant enrichments in behavioral ontology categories. The 3rd top hit, CCRN4L, plays a major role in lipid metabolism, that is supported by additional metabolism related candidates revealed in our scan, including SCP2D1 and PDXC1. Comparing our method to an empirical outlier approach that does not directly account for demography, we found only modest overlaps between the two methods, with 60% of empirical outliers having no overlap with our demography-based outlier detection approach. Demography-aware approaches have lower-rates of false discovery. Our top candidates for selection, in addition to expanding the set of neurobehavioral candidate genes, include genes related to lipid metabolism, suggesting a dietary target of selection that was important during the period when proto-dogs hunted and fed alongside hunter-gatherers. PMID:26943675

Looking into flowering time in almond (Prunus dulcis (Mill) D. A. Webb): the candidate gene approach.

PubMed

Silva, C; Garcia-Mas, J; Sánchez, A M; Arús, P; Oliveira, M M

2005-03-01

Blooming time is one of the most important agronomic traits in almond. Biochemical and molecular events underlying flowering regulation must be understood before methods to stimulate late flowering can be developed. Attempts to elucidate the genetic control of this process have led to the identification of a major gene (Lb) and quantitative trait loci (QTLs) linked to observed phenotypic differences, but although this gene and these QTLs have been placed on the Prunus reference genetic map, their sequences and specific functions remain unknown. The aim of our investigation was to associate these loci with known genes using a candidate gene approach. Two almond cDNAs and eight Prunus expressed sequence tags were selected as candidate genes (CGs) since their sequences were highly identical to those of flowering regulatory genes characterized in other species. The CGs were amplified from both parental lines of the mapping population using specific primers. Sequence comparison revealed DNA polymorphisms between the parental lines, mainly of the single nucleotide type. Polymorphisms were used to develop co-dominant cleaved amplified polymorphic sequence markers or length polymorphisms based on insertion/deletion events for mapping the candidate genes on the Prunus reference map. Ten candidate genes were assigned to six linkage groups in the Prunus genome. The positions of two of these were compatible with the regions where two QTLs for blooming time were detected. One additional candidate was localized close to the position of the Evergrowing gene, which determines a non-deciduous behaviour in peach.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

NASA Astrophysics Data System (ADS)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Familial autosomal dominant severe ankyloglossia with tooth abnormalities.

PubMed

Lenormand, Anaëlle; Khonsari, Roman; Corre, Pierre; Perrin, Jean Philippe; Boscher, Cécile; Nizon, Mathilde; Pichon, Olivier; David, Albert; Le Caignec, Cedric; Bertin, Helios; Isidor, Bertrand

2018-04-28

Ankyloglossia is a congenital oral anomaly characterized by the presence of a hypertrophic and short lingual frenulum. Mutations in the gene encoding the transcription factor TBX22 have been involved in isolated ankyloglossia and X-linked cleft palate. The knockout of Lgr5 in mice results in ankyloglossia. Here, we report a five-generation family including patients with severe ankyloglossia and missing lower central incisors. Two members of this family also exhibited congenital anorectal malformations. In this report, male-to-male transmission was in favor of an autosomal dominant inheritance, which allowed us to exclude the X-linked TBX22 gene. Linkage analysis using short tandem repeat markers located in the vicinity of LGR5 excluded this gene as a potential candidate. These results indicate genetic heterogeneity for ankyloglossia. Further investigations with additional families are required in order to identify novel candidate genes. © 2018 Wiley Periodicals, Inc.

Pharmacogenetic study focused on fluoxetine pharmacodynamics in children and adolescent patients: impact of the serotonin pathway.

PubMed

Mas, Sergi; Blázquez, Ana; Rodríguez, Natalia; Boloc, Daniel; Lafuente, Amalia; Arnaiz, Joan A; Lázaro, Luisa; Gassó, Patricia

2016-11-01

Pharmacogenetic studies of fluoxetine in children and adolescents are scarce. After reporting the effect of genetic variants in genes related to the fluoxetine pharmacokinetics on clinical response in a pediatric population, we now evaluate the impact of genetic markers involved in its pharmacodynamics. The assessment was performed in 83 patients after 12 weeks of fluoxetine treatment. The genetic association analysis included a total of 316 validated single nucleotide polymorphisms in 45 candidate genes involved in six different pathways. Clinical improvement after treatment with fluoxetine in our pediatric population was associated significantly with two polymorphisms located in genes related to the serotonergic system: the 5-hydroxytryptamine receptor 1B (HTR1B) and the tryptophan 5-hydroxylase 2 (TPH2). Although a wide range of candidate genes related to different pathways were assessed, the results show that genetic markers directly related to serotonin have an important effect on fluoxetine response.

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

PubMed

Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

2017-01-01

The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

Characterization of a gene cluster responsible for the biosynthesis of anticancer agent FK228 in Chromobacterium violaceum No. 968.

PubMed

Cheng, Yi-Qiang; Yang, Min; Matter, Andrea M

2007-06-01

A gene cluster responsible for the biosynthesis of anticancer agent FK228 has been identified, cloned, and partially characterized in Chromobacterium violaceum no. 968. First, a genome-scanning approach was applied to identify three distinctive C. violaceum no. 968 genomic DNA clones that code for portions of nonribosomal peptide synthetase and polyketide synthase. Next, a gene replacement system developed originally for Pseudomonas aeruginosa was adapted to inactivate the genomic DNA-associated candidate natural product biosynthetic genes in vivo with high efficiency. Inactivation of a nonribosomal peptide synthetase-encoding gene completely abolished FK228 production in mutant strains. Subsequently, the entire FK228 biosynthetic gene cluster was cloned and sequenced. This gene cluster is predicted to encompass a 36.4-kb DNA region that includes 14 genes. The products of nine biosynthetic genes are proposed to constitute an unusual hybrid nonribosomal peptide synthetase-polyketide synthase-nonribosomal peptide synthetase assembly line including accessory activities for the biosynthesis of FK228. In particular, a putative flavin adenine dinucleotide-dependent pyridine nucleotide-disulfide oxidoreductase is proposed to catalyze disulfide bond formation between two sulfhydryl groups of cysteine residues as the final step in FK228 biosynthesis. Acquisition of the FK228 biosynthetic gene cluster and acclimation of an efficient genetic system should enable genetic engineering of the FK228 biosynthetic pathway in C. violaceum no. 968 for the generation of structural analogs as anticancer drug candidates.

Novel candidate genes for alcoholism--transcriptomic analysis of prefrontal medial cortex, hippocampus and nucleus accumbens of Warsaw alcohol-preferring and non-preferring rats.

PubMed

Stankiewicz, Adrian M; Goscik, Joanna; Dyr, Wanda; Juszczak, Grzegorz R; Ryglewicz, Danuta; Swiergiel, Artur H; Wieczorek, Marek; Stefanski, Roman

2015-12-01

Animal models provide opportunity to study neurobiological aspects of human alcoholism. Changes in gene expression have been implicated in mediating brain functions, including reward system and addiction. The current study aimed to identify genes that may underlie differential ethanol preference in Warsaw High Preferring (WHP) and Warsaw Low Preferring (WLP) rats. Microarray analysis comparing gene expression in nucleus accumbens (NAc), hippocampus (HP) and medial prefrontal cortex (mPFC) was performed in male WHP and WLP rats bred for differences in ethanol preference. Differential and stable between biological repeats expression of 345, 254 and 129 transcripts in NAc, HP and mPFC was detected. Identified genes and processes included known mediators of ethanol response (Mx2, Fam111a, Itpr1, Gabra4, Agtr1a, LTP/LTD, renin-angiotensin signaling pathway), toxicity (Sult1c2a, Ces1, inflammatory response), as well as genes involved in regulation of important addiction-related brain systems such as dopamine, tachykinin or acetylcholine (Gng7, Tac4, Slc5a7). The identified candidate genes may underlie differential ethanol preference in an animal model of alcoholism. Names of genes are written in italics, while names of proteins are written in standard font. Names of human genes/proteins are written in all capital letters. Names of rodent genes/proteins are written in capital letter followed by small letters. Copyright © 2015 Elsevier Inc. All rights reserved.

Noncoding copy-number variations are associated with congenital limb malformation.

PubMed

Flöttmann, Ricarda; Kragesteen, Bjørt K; Geuer, Sinje; Socha, Magdalena; Allou, Lila; Sowińska-Seidler, Anna; Bosquillon de Jarcy, Laure; Wagner, Johannes; Jamsheer, Aleksander; Oehl-Jaschkowitz, Barbara; Wittler, Lars; de Silva, Deepthi; Kurth, Ingo; Maya, Idit; Santos-Simarro, Fernando; Hülsemann, Wiebke; Klopocki, Eva; Mountford, Roger; Fryer, Alan; Borck, Guntram; Horn, Denise; Lapunzina, Pablo; Wilson, Meredith; Mascrez, Bénédicte; Duboule, Denis; Mundlos, Stefan; Spielmann, Malte

2017-10-12

PurposeCopy-number variants (CNVs) are generally interpreted by linking the effects of gene dosage with phenotypes. The clinical interpretation of noncoding CNVs remains challenging. We investigated the percentage of disease-associated CNVs in patients with congenital limb malformations that affect noncoding cis-regulatory sequences versus genes sensitive to gene dosage effects.MethodsWe applied high-resolution copy-number analysis to 340 unrelated individuals with isolated limb malformation. To investigate novel candidate CNVs, we re-engineered human CNVs in mice using clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing.ResultsOf the individuals studied, 10% harbored CNVs segregating with the phenotype in the affected families. We identified 31 CNVs previously associated with congenital limb malformations and four novel candidate CNVs. Most of the disease-associated CNVs (57%) affected the noncoding cis-regulatory genome, while only 43% included a known disease gene and were likely to result from gene dosage effects. In transgenic mice harboring four novel candidate CNVs, we observed altered gene expression in all cases, indicating that the CNVs had a regulatory effect either by changing the enhancer dosage or altering the topological associating domain architecture of the genome.ConclusionOur findings suggest that CNVs affecting noncoding regulatory elements are a major cause of congenital limb malformations.Genetics in Medicine advance online publication, 12 October 2017; doi:10.1038/gim.2017.154.

Association and linkage studies of candidate genes involved in GABAergic neurotransmission in lithium-responsive bipolar disorder.

PubMed Central

Duffy, A; Turecki, G; Grof, P; Cavazzoni, P; Grof, E; Joober, R; Ahrens, B; Berghöfer, A; Müller-Oerlinghausen, B; Dvoráková, M; Libigerová, E; Vojtĕchovský, M; Zvolský, P; Nilsson, A; Licht, R W; Rasmussen, N A; Schou, M; Vestergaard, P; Holzinger, A; Schumann, C; Thau, K; Robertson, C; Rouleau, G A; Alda, M

2000-01-01

OBJECTIVE: To test for genetic linkage and association with GABAergic candidate genes in lithium-responsive bipolar disorder. DESIGN: Polymorphisms located in genes that code for GABRA3, GABRA5 and GABRB3 subunits of the GABAA receptor were investigated using association and linkage strategies. PARTICIPANTS: A total of 138 patients with bipolar 1 disorder with a clear response to lithium prophylaxis, selected from specialized lithium clinics in Canada and Europe that are part of the International Group for the Study of Lithium-Treated Patients, and 108 psychiatrically healthy controls. Families of 24 probands were suitable for linkage analysis. OUTCOME MEASURES: The association between the candidate genes and patients with bipolar disorder versus that of controls and genetic linkage within families. RESULTS: There was no significant association or linkage found between lithium-responsive bipolar disorder and the GABAergic candidate genes investigated. CONCLUSIONS: This study does not support a major role for the GABAergic candidate genes tested in lithium-responsive bipolar disorder. PMID:11022400

[Genetics of bipolar affective disorders. Current status of research for identification of susceptibility genes].

PubMed

Schumacher, J; Cichon, S; Rietschel, M; Nöthen, M M; Propping, P

2002-07-01

Bipolar affective disorder is a highly heritable condition, as evidenced by twin, family, and adoption studies. However, the mode of inheritance is complex and linkage findings have been difficult to replicate. Despite these limitations, consistent linkage findings have emerged for several chromosomes, notably 3p12-p14, 4p16, 10q25-q26, and 12q23-q24. Three additional areas, 13q32-q33, 18p11-q11, and 22q12-q13, have shown linkage in regions that appear to overlap with linkage findings in schizophrenia. These chromosomal regions might harbour genes that contribute to the development of bipolar affective disorder. Recent candidate gene studies include some positive results for the serotonin transporter gene (5-HTT) on 17q11-q12 and the catechol-O-methyltransferase gene (COMT) on 22q11. New methods are being developed for linkage disequilibrium mapping and candidate gene approaches. One can be optimistic that over the next few years bipolar susceptibility genes will be identified.

mRNA expression pattern of selected candidate genes differs in bovine oviductal epithelial cells in vitro compared with the in vivo state and during cell culture passages.

PubMed

Danesh Mesgaran, Sadjad; Sharbati, Jutta; Einspanier, Ralf; Gabler, Christoph

2016-08-15

The mammalian oviduct provides the optimal environment for gamete maturation including sperm capacitation, fertilization, and development of the early embryo. Various cell culture models for primary bovine oviductal epithelial cells (BOEC) were established to reveal such physiological events. The aim of this study was to evaluate 17 candidate mRNA expression patterns in oviductal epithelial cells (1) in transition from in vivo cells to in vitro cells; (2) during three consecutive cell culture passages; (3) affected by the impact of LOW or HIGH glucose content media; and (4) influenced by different phases of the estrous cycle in vivo and in vitro. In addition, the release of a metabolite and proteins from BOEC at two distinct cell culture passage numbers was estimated to monitor the functionality. BOEC from 8 animals were isolated and cultured for three consecutive passages. Total RNA was extracted from in vivo and in vitro samples and subjected to reverse transcription quantitative polymerase chain reaction to reveal mRNA expression of selected candidate genes. The release of prostaglandin E2 (PGE2), oviduct-specific glycoprotein 1 (OVGP1) and interleukin 8 (IL8) by BOEC was measured by EIA or ELISA after 24 h. Almost all candidate genes (prostaglandin synthases, enzymes of cellular metabolism and mucins) mRNA expression pattern differed compared in vivo with in vitro state. In addition, transcription of most candidate genes was influenced by the number of cell culture passages. Different glucose medium content did not affect mRNA expression of most candidate genes. The phase of the estrous cycle altered some candidate mRNA expression in BOEC in vitro at later passages. The release of PGE2 and OVGP1 between passages did not differ. However, BOEC in passage 3 released significantly higher amount of IL8 compared with cells in passage 0. This study supports the hypothesis that candidate mRNA expression in BOEC was influenced by transition from the in vivo situation to the new in vitro environment and during consecutive passages. The consequence of cell culture passaging on BOEC ability to release bioactive compounds should be considered.

Transcriptome profiling of the whitefly Bemisia tabaci reveals stage-specific gene expression signatures for thiamethoxam resistance

PubMed Central

Yang, N; Xie, W; Jones, CM; Bass, C; Jiao, X; Yang, X; Liu, B; Li, R; Zhang, Y

2013-01-01

Bemisia tabaci has developed high levels of resistance to many insecticides including the neonicotinoids and there is strong evidence that for some compounds resistance is stage-specific. To investigate the molecular basis of B. tabaci resistance to the neonicotinoid thiamethoxam we used a custom whitefly microarray to compare gene expression in the egg, nymph and adult stages of a thiamethoxam-resistant strain (TH-R) with a susceptible strain (TH-S). Gene ontology and bioinformatic analyses revealed that in all life stages many of the differentially expressed transcripts encoded enzymes involved in metabolic processes and/or metabolism of xenobiotics. Several of these are candidate resistance genes and include the cytochrome P450 CYP6CM1, which has been shown to confer resistance to several neonicotinoids previously, a P450 belonging to the Cytochrome P450s 4 family and a glutathione S-transferase (GST) belonging to the sigma class. Finally several ATP-binding cassette transporters of the ABCG subfamily were highly over-expressed in the adult stage of the TH-R strain and may play a role in resistance by active efflux. Here, we evaluated both common and stage-specific gene expression signatures and identified several candidate resistance genes that may underlie B. tabaci resistance to thiamethoxam. PMID:23889345

A family-based association study identified CYP17 as a candidate gene for obesity susceptibility in Caucasians.

PubMed

Yan, H; Guo, Y; Yang, T-L; Zhao, L-J; Deng, H-W

2012-08-06

The cytochrome P450c17α gene (CYP17) encodes a key biosynthesis enzyme of estrogen, which is critical in regulating adipogenesis and adipocyte development in humans. We therefore hypothesized that CYP17 is a candidate gene for predicting obesity. In order to test this hypothesis, we performed a family-based association test to investigate the relationship between the CYP17 gene and obesity phenotypes in a large sample comprising 1873 subjects from 405 Caucasian nuclear families of European origin recruited by the Osteoporosis Research Center of Creighton University, USA. Both single SNPs and haplotypes were tested for associations with obesity-related phenotypes, including body mass index (BMI) and fat mass. We identified three SNPs to be significantly associated with BMI, including rs3740397, rs6163, and rs619824. We further characterized the linkage disequilibrium structure for CYP17 and found that the whole CYP17 gene was located in a single-linkage disequilibrium block. This block was observed to be significantly associated with BMI. A major haplotype in this block was significantly associated with both BMI and fat mass. In conclusion, we suggest that the CYP17 gene has an effect on obesity in the Caucasian population. Further independent studies will be needed to confirm our findings.

A human functional protein interaction network and its application to cancer data analysis

PubMed Central

2010-01-01

Background One challenge facing biologists is to tease out useful information from massive data sets for further analysis. A pathway-based analysis may shed light by projecting candidate genes onto protein functional relationship networks. We are building such a pathway-based analysis system. Results We have constructed a protein functional interaction network by extending curated pathways with non-curated sources of information, including protein-protein interactions, gene coexpression, protein domain interaction, Gene Ontology (GO) annotations and text-mined protein interactions, which cover close to 50% of the human proteome. By applying this network to two glioblastoma multiforme (GBM) data sets and projecting cancer candidate genes onto the network, we found that the majority of GBM candidate genes form a cluster and are closer than expected by chance, and the majority of GBM samples have sequence-altered genes in two network modules, one mainly comprising genes whose products are localized in the cytoplasm and plasma membrane, and another comprising gene products in the nucleus. Both modules are highly enriched in known oncogenes, tumor suppressors and genes involved in signal transduction. Similar network patterns were also found in breast, colorectal and pancreatic cancers. Conclusions We have built a highly reliable functional interaction network upon expert-curated pathways and applied this network to the analysis of two genome-wide GBM and several other cancer data sets. The network patterns revealed from our results suggest common mechanisms in the cancer biology. Our system should provide a foundation for a network or pathway-based analysis platform for cancer and other diseases. PMID:20482850

Signature of genetic associations in oral cancer.

PubMed

Sharma, Vishwas; Nandan, Amrita; Sharma, Amitesh Kumar; Singh, Harpreet; Bharadwaj, Mausumi; Sinha, Dhirendra Narain; Mehrotra, Ravi

2017-10-01

Oral cancer etiology is complex and controlled by multi-factorial events including genetic events. Candidate gene studies, genome-wide association studies, and next-generation sequencing identified various chromosomal loci to be associated with oral cancer. There is no available review that could give us the comprehensive picture of genetic loci identified to be associated with oral cancer by candidate gene studies-based, genome-wide association studies-based, and next-generation sequencing-based approaches. A systematic literature search was performed in the PubMed database to identify the loci associated with oral cancer by exclusive candidate gene studies-based, genome-wide association studies-based, and next-generation sequencing-based study approaches. The information of loci associated with oral cancer is made online through the resource "ORNATE." Next, screening of the loci validated by candidate gene studies and next-generation sequencing approach or by two independent studies within candidate gene studies or next-generation sequencing approaches were performed. A total of 264 loci were identified to be associated with oral cancer by candidate gene studies, genome-wide association studies, and next-generation sequencing approaches. In total, 28 loci, that is, 14q32.33 (AKT1), 5q22.2 (APC), 11q22.3 (ATM), 2q33.1 (CASP8), 11q13.3 (CCND1), 16q22.1 (CDH1), 9p21.3 (CDKN2A), 1q31.1 (COX-2), 7p11.2 (EGFR), 22q13.2 (EP300), 4q35.2 (FAT1), 4q31.3 (FBXW7), 4p16.3 (FGFR3), 1p13.3 (GSTM1-GSTT1), 11q13.2 (GSTP1), 11p15.5 (H-RAS), 3p25.3 (hOGG1), 1q32.1 (IL-10), 4q13.3 (IL-8), 12p12.1 (KRAS), 12q15 (MDM2), 12q13.12 (MLL2), 9q34.3 (NOTCH1), 17p13.1 (p53), 3q26.32 (PIK3CA), 10q23.31 (PTEN), 13q14.2 (RB1), and 5q14.2 (XRCC4), were validated to be associated with oral cancer. "ORNATE" gives a snapshot of genetic loci associated with oral cancer. All 28 loci were validated to be linked to oral cancer for which further fine-mapping followed by gene-by-gene and gene-environment interaction studies is needed to confirm their involvement in modifying oral cancer.

Genetic Determinants for Enzymatic Digestion of Lignocellulosic Biomass Are Independent of Those for Lignin Abundance in a Maize Recombinant Inbred Population

DOE PAGES

Penning, Bryan W.; Sykes, Robert W.; Babcock, Nicholas C.; ...

2014-06-27

Biotechnological approaches to reduce or modify lignin in biomass crops are predicated on the assumption that it is the principal determinant of the recalcitrance of biomass to enzymatic digestion for biofuels production. We defined quantitative trait loci (QTL) in the Intermated B73 x 3 Mo17 recombinant inbred maize (Zea mays) population using pyrolysis molecular-beam mass spectrometry to establish stem lignin content and an enzymatic hydrolysis assay to measure glucose and xylose yield. Among five multiyear QTL for lignin abundance, two for 4-vinylphenol abundance, and four for glucose and/or xylose yield, not a single QTL for aromatic abundance and sugar yieldmore » was shared. A genome-wide association study for lignin abundance and sugar yield of the 282- member maize association panel provided candidate genes in the 11 QTL of the B73 and Mo17 parents but showed that many other alleles impacting these traits exist among this broader pool of maize genetic diversity. B73 and Mo17 genotypes exhibited large differences in gene expression in developing stem tissues independent of allelic variation. Combining these complementary genetic approaches provides a narrowed list of candidate genes. A cluster of SCARECROW-LIKE9 and SCARECROW-LIKE14 transcription factor genes provides exceptionally strong candidate genes emerging from the genome-wide association study. In addition to these and genes associated with cell wall metabolism, candidates include several other transcription factors associated with vascularization and fiber formation and components of cellular signaling pathways. Finally, these results provide new insights and strategies beyond the modification of lignin to enhance yields of biofuels from genetically modified biomass.« less

Genome-wide association study of CSF biomarkers Abeta1-42, t-tau, and p-tau181p in the ADNI cohort.

PubMed

Kim, S; Swaminathan, S; Shen, L; Risacher, S L; Nho, K; Foroud, T; Shaw, L M; Trojanowski, J Q; Potkin, S G; Huentelman, M J; Craig, D W; DeChairo, B M; Aisen, P S; Petersen, R C; Weiner, M W; Saykin, A J

2011-01-04

CSF levels of Aβ1-42, t-tau, and p-tau181p are potential early diagnostic markers for probable Alzheimer disease (AD). The influence of genetic variation on these markers has been investigated for candidate genes but not on a genome-wide basis. We report a genome-wide association study (GWAS) of CSF biomarkers (Aβ1-42, t-tau, p-tau181p, p-tau181p/Aβ1-42, and t-tau/Aβ1-42). A total of 374 non-Hispanic Caucasian participants in the Alzheimer's Disease Neuroimaging Initiative cohort with quality-controlled CSF and genotype data were included in this analysis. The main effect of single nucleotide polymorphisms (SNPs) under an additive genetic model was assessed on each of 5 CSF biomarkers. The p values of all SNPs for each CSF biomarker were adjusted for multiple comparisons by the Bonferroni method. We focused on SNPs with corrected p<0.01 (uncorrected p<3.10×10(-8)) and secondarily examined SNPs with uncorrected p values less than 10(-5) to identify potential candidates. Four SNPs in the regions of the APOE, LOC100129500, TOMM40, and EPC2 genes reached genome-wide significance for associations with one or more CSF biomarkers. SNPs in CCDC134, ABCG2, SREBF2, and NFATC4, although not reaching genome-wide significance, were identified as potential candidates. In addition to known candidate genes, APOE, TOMM40, and one hypothetical gene LOC100129500 partially overlapping APOE; one novel gene, EPC2, and several other interesting genes were associated with CSF biomarkers that are related to AD. These findings, especially the new EPC2 results, require replication in independent cohorts.

Genetic analyses of bolting in bulb onion (Allium cepa L.).

PubMed

Baldwin, Samantha; Revanna, Roopashree; Pither-Joyce, Meeghan; Shaw, Martin; Wright, Kathryn; Thomson, Susan; Moya, Leire; Lee, Robyn; Macknight, Richard; McCallum, John

2014-03-01

We present the first evidence for a QTL conditioning an adaptive trait in bulb onion, and the first linkage and population genetics analyses of candidate genes involved in photoperiod and vernalization physiology. Economic production of bulb onion (Allium cepa L.) requires adaptation to photoperiod and temperature such that a bulb is formed in the first year and a flowering umbel in the second. 'Bolting', or premature flowering before bulb maturation, is an undesirable trait strongly selected against by breeders during adaptation of germplasm. To identify genome regions associated with adaptive traits we conducted linkage mapping and population genetic analyses of candidate genes, and QTL analysis of bolting using a low-density linkage map. We performed tagged amplicon sequencing of ten candidate genes, including the FT-like gene family, in eight diverse populations to identify polymorphisms and seek evidence of differentiation. Low nucleotide diversity and negative estimates of Tajima's D were observed for most genes, consistent with purifying selection. Significant population differentiation was observed only in AcFT2 and AcSOC1. Selective genotyping in a large 'Nasik Red × CUDH2150' F2 family revealed genome regions on chromosomes 1, 3 and 6 associated (LOD > 3) with bolting. Validation genotyping of two F2 families grown in two environments confirmed that a QTL on chromosome 1, which we designate AcBlt1, consistently conditions bolting susceptibility in this cross. The chromosome 3 region, which coincides with a functionally characterised acid invertase, was not associated with bolting in other environments, but showed significant association with bulb sucrose content in this and other mapping pedigrees. These putative QTL and candidate genes were placed on the onion map, enabling future comparative studies of adaptive traits.

Genetic Determinants for Enzymatic Digestion of Lignocellulosic Biomass Are Independent of Those for Lignin Abundance in a Maize Recombinant Inbred Population1[W][OPEN

PubMed Central

Penning, Bryan W.; Sykes, Robert W.; Babcock, Nicholas C.; Dugard, Christopher K.; Held, Michael A.; Klimek, John F.; Shreve, Jacob T.; Fowler, Matthew; Ziebell, Angela; Davis, Mark F.; Decker, Stephen R.; Turner, Geoffrey B.; Mosier, Nathan S.; Springer, Nathan M.; Thimmapuram, Jyothi; Weil, Clifford F.; McCann, Maureen C.; Carpita, Nicholas C.

2014-01-01

Biotechnological approaches to reduce or modify lignin in biomass crops are predicated on the assumption that it is the principal determinant of the recalcitrance of biomass to enzymatic digestion for biofuels production. We defined quantitative trait loci (QTL) in the Intermated B73 × Mo17 recombinant inbred maize (Zea mays) population using pyrolysis molecular-beam mass spectrometry to establish stem lignin content and an enzymatic hydrolysis assay to measure glucose and xylose yield. Among five multiyear QTL for lignin abundance, two for 4-vinylphenol abundance, and four for glucose and/or xylose yield, not a single QTL for aromatic abundance and sugar yield was shared. A genome-wide association study for lignin abundance and sugar yield of the 282-member maize association panel provided candidate genes in the 11 QTL of the B73 and Mo17 parents but showed that many other alleles impacting these traits exist among this broader pool of maize genetic diversity. B73 and Mo17 genotypes exhibited large differences in gene expression in developing stem tissues independent of allelic variation. Combining these complementary genetic approaches provides a narrowed list of candidate genes. A cluster of SCARECROW-LIKE9 and SCARECROW-LIKE14 transcription factor genes provides exceptionally strong candidate genes emerging from the genome-wide association study. In addition to these and genes associated with cell wall metabolism, candidates include several other transcription factors associated with vascularization and fiber formation and components of cellular signaling pathways. These results provide new insights and strategies beyond the modification of lignin to enhance yields of biofuels from genetically modified biomass. PMID:24972714

Identification of candidate genes affecting Δ9-tetrahydrocannabinol biosynthesis in Cannabis sativa

PubMed Central

Marks, M. David; Tian, Li; Wenger, Jonathan P.; Omburo, Stephanie N.; Soto-Fuentes, Wilfredo; He, Ji; Gang, David R.; Weiblen, George D.; Dixon, Richard A.

2009-01-01

RNA isolated from the glands of a Δ9-tetrahydrocannabinolic acid (THCA)-producing strain of Cannabis sativa was used to generate a cDNA library containing over 100 000 expressed sequence tags (ESTs). Sequencing of over 2000 clones from the library resulted in the identification of over 1000 unigenes. Candidate genes for almost every step in the biochemical pathways leading from primary metabolites to THCA were identified. Quantitative PCR analysis suggested that many of the pathway genes are preferentially expressed in the glands. Hexanoyl-CoA, one of the metabolites required for THCA synthesis, could be made via either de novo fatty acids synthesis or via the breakdown of existing lipids. qPCR analysis supported the de novo pathway. Many of the ESTs encode transcription factors and two putative MYB genes were identified that were preferentially expressed in glands. Given the similarity of the Cannabis MYB genes to those in other species with known functions, these Cannabis MYBs may play roles in regulating gland development and THCA synthesis. Three candidates for the polyketide synthase (PKS) gene responsible for the first committed step in the pathway to THCA were characterized in more detail. One of these was identical to a previously reported chalcone synthase (CHS) and was found to have CHS activity. All three could use malonyl-CoA and hexanoyl-CoA as substrates, including the CHS, but reaction conditions were not identified that allowed for the production of olivetolic acid (the proposed product of the PKS activity needed for THCA synthesis). One of the PKS candidates was highly and specifically expressed in glands (relative to whole leaves) and, on the basis of these expression data, it is proposed to be the most likely PKS responsible for olivetolic acid synthesis in Cannabis glands. PMID:19581347

Genetic Determinants for Enzymatic Digestion of Lignocellulosic Biomass Are Independent of Those for Lignin Abundance in a Maize Recombinant Inbred Population.

PubMed

Penning, Bryan W; Sykes, Robert W; Babcock, Nicholas C; Dugard, Christopher K; Held, Michael A; Klimek, John F; Shreve, Jacob T; Fowler, Matthew; Ziebell, Angela; Davis, Mark F; Decker, Stephen R; Turner, Geoffrey B; Mosier, Nathan S; Springer, Nathan M; Thimmapuram, Jyothi; Weil, Clifford F; McCann, Maureen C; Carpita, Nicholas C

2014-08-01

Biotechnological approaches to reduce or modify lignin in biomass crops are predicated on the assumption that it is the principal determinant of the recalcitrance of biomass to enzymatic digestion for biofuels production. We defined quantitative trait loci (QTL) in the Intermated B73 × Mo17 recombinant inbred maize (Zea mays) population using pyrolysis molecular-beam mass spectrometry to establish stem lignin content and an enzymatic hydrolysis assay to measure glucose and xylose yield. Among five multiyear QTL for lignin abundance, two for 4-vinylphenol abundance, and four for glucose and/or xylose yield, not a single QTL for aromatic abundance and sugar yield was shared. A genome-wide association study for lignin abundance and sugar yield of the 282-member maize association panel provided candidate genes in the 11 QTL of the B73 and Mo17 parents but showed that many other alleles impacting these traits exist among this broader pool of maize genetic diversity. B73 and Mo17 genotypes exhibited large differences in gene expression in developing stem tissues independent of allelic variation. Combining these complementary genetic approaches provides a narrowed list of candidate genes. A cluster of SCARECROW-LIKE9 and SCARECROW-LIKE14 transcription factor genes provides exceptionally strong candidate genes emerging from the genome-wide association study. In addition to these and genes associated with cell wall metabolism, candidates include several other transcription factors associated with vascularization and fiber formation and components of cellular signaling pathways. These results provide new insights and strategies beyond the modification of lignin to enhance yields of biofuels from genetically modified biomass. © 2014 American Society of Plant Biologists. All Rights Reserved.

Identification of reference genes for RT-qPCR in the Antarctic moss Sanionia uncinata under abiotic stress conditions

PubMed Central

Park, Mira; Hong, Soon Gyu; Park, Hyun; Lee, Byeong-ha

2018-01-01

Sanionia uncinata is a dominant moss species in the maritime Antarctic. Due to its high adaptability to harsh environments, this extremophile plant has been considered a good target for studying the molecular adaptation mechanisms of plants to a variety of environmental stresses. Despite the importance of S. uncinata as a representative Antarctic plant species for the identification and characterization of genes associated with abiotic stress tolerance, suitable reference genes, which are critical for RT-qPCR analyses, have not yet been identified. In this report, 11 traditionally used and 6 novel candidate reference genes were selected from transcriptome data of S. uncinata and the expression stability of these genes was evaluated under various abiotic stress conditions using three statistical algorithms; geNorm, NormFinder, and BestKeeper. The stability ranking analysis selected the best reference genes depending on the stress conditions. Among the 17 candidates, the most stable references were POB1 and UFD2 for cold stress, POB1 and AKB for drought treatment, and UFD2 and AKB for the field samples from a different water contents in Antarctica. Overall, novel genes POB1 and AKB were the most reliable references across all samples, irrespective of experimental conditions. In addition, 6 novel candidate genes including AKB, POB1 and UFD2, were more stable than the housekeeping genes traditionally used for internal controls, indicating that transcriptome data can be useful for identifying novel robust normalizers. The reference genes validated in this study will be useful for improving the accuracy of RT-qPCR analysis for gene expression studies of S. uncinata in Antarctica and for further functional genomic analysis of bryophytes. PMID:29920565

Mining biological databases for candidate disease genes

NASA Astrophysics Data System (ADS)

Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.

2001-07-01

The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).

Molecular cloning of the potato Gro1-4 gene conferring resistance to pathotype Ro1 of the root cyst nematode Globodera rostochiensis, based on a candidate gene approach.

PubMed

Paal, Jürgen; Henselewski, Heike; Muth, Jost; Meksem, Khalid; Menéndez, Cristina M; Salamini, Francesco; Ballvora, Agim; Gebhardt, Christiane

2004-04-01

The endoparasitic root cyst nematode Globodera rostochiensis causes considerable damage in potato cultivation. In the past, major genes for nematode resistance have been introgressed from related potato species into cultivars. Elucidating the molecular basis of resistance will contribute to the understanding of nematode-plant interactions and assist in breeding nematode-resistant cultivars. The Gro1 resistance locus to G. rostochiensis on potato chromosome VII co-localized with a resistance-gene-like (RGL) DNA marker. This marker was used to isolate from genomic libraries 15 members of a closely related candidate gene family. Analysis of inheritance, linkage mapping, and sequencing reduced the number of candidate genes to three. Complementation analysis by stable potato transformation showed that the gene Gro1-4 conferred resistance to G. rostochiensis pathotype Ro1. Gro1-4 encodes a protein of 1136 amino acids that contains Toll-interleukin 1 receptor (TIR), nucleotide-binding (NB), leucine-rich repeat (LRR) homology domains and a C-terminal domain with unknown function. The deduced Gro1-4 protein differed by 29 amino acid changes from susceptible members of the Gro1 gene family. Sequence characterization of 13 members of the Gro1 gene family revealed putative regulatory elements and a variable microsatellite in the promoter region, insertion of a retrotransposon-like element in the first intron, and a stop codon in the NB coding region of some genes. Sequence analysis of RT-PCR products showed that Gro1-4 is expressed, among other members of the family including putative pseudogenes, in non-infected roots of nematode-resistant plants. RT-PCR also demonstrated that members of the Gro1 gene family are expressed in most potato tissues.

Gene-breaking: A new paradigm for human retrotransposon-mediated gene evolution

PubMed Central

Wheelan, Sarah J.; Aizawa, Yasunori; Han, Jeffrey S.; Boeke, Jef D.

2005-01-01

The L1 retrotransposon is the most highly successful autonomous retrotransposon in mammals. This prolific genome parasite may on occasion benefit its host through genome rearrangements or adjustments of host gene expression. In examining possible effects of L1 elements on host gene expression, we investigated whether a full-length L1 element inserted in the antisense orientation into an intron of a cellular gene may actually split the gene's transcript into two smaller transcripts: (1) a transcript containing the upstream exons and terminating in the major antisense polyadenylation site (MAPS) of the L1, and (2) a transcript derived from the L1 antisense promoter (ASP) that includes the downstream exons of the gene. Bioinformatic analysis and experimental follow-up provide evidence for this L1 “gene-breaking” hypothesis. We identified three human genes apparently “broken” by L1 elements, as well as 12 more candidate genes. Most of the inserted L1 elements in our 15 candidate genes predate the human/chimp divergence. If indeed split, the transcripts of these genes may in at least one case encode potentially interacting proteins, and in another case may encode novel proteins. Gene-breaking represents a new mechanism through which L1 elements remodel mammalian genomes. PMID:16024818

Defining a new candidate gene for amelogenesis imperfecta: from molecular genetics to biochemistry.

PubMed

Urzúa, Blanca; Ortega-Pinto, Ana; Morales-Bozo, Irene; Rojas-Alcayaga, Gonzalo; Cifuentes, Víctor

2011-02-01

Amelogenesis imperfecta is a group of genetic conditions that affect the structure and clinical appearance of tooth enamel. The types (hypoplastic, hypocalcified, and hypomature) are correlated with defects in different stages of the process of enamel synthesis. Autosomal dominant, recessive, and X-linked types have been previously described. These disorders are considered clinically and genetically heterogeneous in etiology, involving a variety of genes, such as AMELX, ENAM, DLX3, FAM83H, MMP-20, KLK4, and WDR72. The mutations identified within these causal genes explain less than half of all cases of amelogenesis imperfecta. Most of the candidate and causal genes currently identified encode proteins involved in enamel synthesis. We think it is necessary to refocus the search for candidate genes using biochemical processes. This review provides theoretical evidence that the human SLC4A4 gene (sodium bicarbonate cotransporter) may be a new candidate gene.

A Strong Immune Response in Young Adult Honeybees Masks Their Increased Susceptibility to Infection Compared to Older Bees

PubMed Central

Bull, James C.; Ryabov, Eugene V.; Prince, Gill; Mead, Andrew; Zhang, Cunjin; Baxter, Laura A.; Pell, Judith K.; Osborne, Juliet L.; Chandler, Dave

2012-01-01

Honeybees, Apis mellifera, show age-related division of labor in which young adults perform maintenance (“housekeeping”) tasks inside the colony before switching to outside foraging at approximately 23 days old. Disease resistance is an important feature of honeybee biology, but little is known about the interaction of pathogens and age-related division of labor. We tested a hypothesis that older forager bees and younger “house” bees differ in susceptibility to infection. We coupled an infection bioassay with a functional analysis of gene expression in individual bees using a whole genome microarray. Forager bees treated with the entomopathogenic fungus Metarhizium anisopliae s.l. survived for significantly longer than house bees. This was concomitant with substantial differences in gene expression including genes associated with immune function. In house bees, infection was associated with differential expression of 35 candidate immune genes contrasted with differential expression of only two candidate immune genes in forager bees. For control bees (i.e. not treated with M. anisopliae) the development from the house to the forager stage was associated with differential expression of 49 candidate immune genes, including up-regulation of the antimicrobial peptide gene abaecin, plus major components of the Toll pathway, serine proteases, and serpins. We infer that reduced pathogen susceptibility in forager bees was associated with age-related activation of specific immune system pathways. Our findings contrast with the view that the immunocompetence in social insects declines with the onset of foraging as a result of a trade-off in the allocation of resources for foraging. The up-regulation of immune-related genes in young adult bees in response to M. anisopliae infection was an indicator of disease susceptibility; this also challenges previous research in social insects, in which an elevated immune status has been used as a marker of increased disease resistance and fitness without considering the effects of age-related development. PMID:23300441

An Expressed Sequence Tag collection from the male antennae of the Noctuid moth Spodoptera littoralis: a resource for olfactory and pheromone detection research

PubMed Central

2011-01-01

Background Nocturnal insects such as moths are ideal models to study the molecular bases of olfaction that they use, among examples, for the detection of mating partners and host plants. Knowing how an odour generates a neuronal signal in insect antennae is crucial for understanding the physiological bases of olfaction, and also could lead to the identification of original targets for the development of olfactory-based control strategies against herbivorous moth pests. Here, we describe an Expressed Sequence Tag (EST) project to characterize the antennal transcriptome of the noctuid pest model, Spodoptera littoralis, and to identify candidate genes involved in odour/pheromone detection. Results By targeting cDNAs from male antennae, we biased gene discovery towards genes potentially involved in male olfaction, including pheromone reception. A total of 20760 ESTs were obtained from a normalized library and were assembled in 9033 unigenes. 6530 were annotated based on BLAST analyses and gene prediction software identified 6738 ORFs. The unigenes were compared to the Bombyx mori proteome and to ESTs derived from Lepidoptera transcriptome projects. We identified a large number of candidate genes involved in odour and pheromone detection and turnover, including 31 candidate chemosensory receptor genes, but also genes potentially involved in olfactory modulation. Conclusions Our project has generated a large collection of antennal transcripts from a Lepidoptera. The normalization process, allowing enrichment in low abundant genes, proved to be particularly relevant to identify chemosensory receptors in a species for which no genomic data are available. Our results also suggest that olfactory modulation can take place at the level of the antennae itself. These EST resources will be invaluable for exploring the mechanisms of olfaction and pheromone detection in S. littoralis, and for ultimately identifying original targets to fight against moth herbivorous pests. PMID:21276261

Meta-analysis of six genes (BDNF, DRD1, DRD3, DRD4, GRIN2B and MAOA) involved in neuroplasticity and the risk for alcohol dependence.

PubMed

Forero, Diego A; López-León, Sandra; Shin, Hyoung Doo; Park, Byung Lae; Kim, Dai-Jin

2015-04-01

Alcohol-related problems have a large impact on human health, accounting for around 4% of deaths and 4.5% of disability-adjusted life-years around the world. Genetic factors could explain a significant fraction of the risk for alcohol dependence (AD). Recent meta-analyses have found significant pooled odds ratios (ORs) for variants in the ADH1B, ADH1C, DRD2 and HTR2A genes. In the present study, we carried out a meta-analysis of common variants in 6 candidate genes involved in neurotransmission and neuroplasticity: BDNF, DRD1, DRD3, DRD4, GRIN2B and MAOA. We carried out a systematic search for published association studies that analyzed the genes of interest. Relevant articles were retrieved and demographic and genetic data were extracted. Pooled ORs were calculated using a random-effects model using the Meta-Analyst program. Dominant, recessive and allelic models were tested and analyses were also stratified by ethnicity. Forty two published studies were included in the current meta-analysis: BDNF-rs6265 (nine studies), DRD1-rs4532 (four studies), DRD3-rs6280 (eleven studies), DRD4-VNTR (seven studies), GRIN2B-rs1806201 (three studies) and MAOA-uVNTR (eight studies). We did not find significant pooled ORs for any of the six genes, under different models and stratifying for ethnicity. In terms of the number of candidate genes included, this is one of the most comprehensive meta-analyses for genetics of AD. Pooled ORs did not support consistent associations with any of the six candidate genes tested. Future studies of novel genes of functional relevance and meta-analyses of quantitative endophenotypes could identify further susceptibility molecular factors for AD. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism

PubMed Central

Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry

2012-01-01

Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617

Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

PubMed

Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

2009-06-01

The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

Axon Regeneration Genes Identified by RNAi Screening in C. elegans

PubMed Central

Nix, Paola; Hammarlund, Marc; Hauth, Linda; Lachnit, Martina; Jorgensen, Erik M.

2014-01-01

Axons of the mammalian CNS lose the ability to regenerate soon after development due to both an inhibitory CNS environment and the loss of cell-intrinsic factors necessary for regeneration. The complex molecular events required for robust regeneration of mature neurons are not fully understood, particularly in vivo. To identify genes affecting axon regeneration in Caenorhabditis elegans, we performed both an RNAi-based screen for defective motor axon regeneration in unc-70/β-spectrin mutants and a candidate gene screen. From these screens, we identified at least 50 conserved genes with growth-promoting or growth-inhibiting functions. Through our analysis of mutants, we shed new light on certain aspects of regeneration, including the role of β-spectrin and membrane dynamics, the antagonistic activity of MAP kinase signaling pathways, and the role of stress in promoting axon regeneration. Many gene candidates had not previously been associated with axon regeneration and implicate new pathways of interest for therapeutic intervention. PMID:24403161

Evaluation of androgen receptor gene as a candidate gene in female androgenetic alopecia.

PubMed

el-Samahy, May H; Shaheen, Maha A; Saddik, Dina E B; Abdel-Fattah, Nermeen S A; el-Sawi, Mohammad A; Mahran, Manal Z; Shehab, Abeer A A

2009-06-01

Genetic polymorphisms of the androgen receptor (AR) gene have been studied in male androgenetic alopecia (AGA); however, little is known about gene polymorphism and female AGA. To evaluate the AR gene as a candidate gene for female AGA. Thirty premenopausal Egyptian female patients with AGA (mean age, 32.3 +/- 7 years) and 11 age- and sex-matched controls were included. All subjects underwent laboratory and pelvic ultrasound evaluation to exclude other precipitating cause(s) of hair loss. Scalp biopsy was taken and the AR gene was evaluated using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). According to Ludwig's classification, all patients had type II AGA. Statistical analysis showed no statistically significant difference in genotype (chi(2) = 5.513, P > or = 0.05) or allele frequency (chi(2) = 1.312, P > or = 0.05) between patients and controls. There was also no statistically significant difference between the genotype and allele frequency with disease duration. In contrast with male AGA, no association was found between type II AGA in Egyptian women and the AR gene. Therefore, the genetic study of this gene does not serve as a biomarker for the identification of women with a predisposition to AGA.

The cld mutation: narrowing the critical chromosomal region and selecting candidate genes.

PubMed

Péterfy, Miklós; Mao, Hui Z; Doolittle, Mark H

2006-10-01

Combined lipase deficiency (cld) is a recessive, lethal mutation specific to the tw73 haplotype on mouse Chromosome 17. While the cld mutation results in lipase proteins that are inactive, aggregated, and retained in the endoplasmic reticulum (ER), it maps separately from the lipase structural genes. We have narrowed the gene critical region by about 50% using the tw18 haplotype for deletion mapping and a recombinant chromosome used originally to map cld with respect to the phenotypic marker tf. The region now extends from 22 to 25.6 Mbp on the wild-type chromosome, currently containing 149 genes and 50 expressed sequence tags (ESTs). To identify the affected gene, we have selected candidates based on their known role in associated biological processes, cellular components, and molecular functions that best fit with the predicted function of the cld gene. A secondary approach was based on differences in mRNA levels between mutant (cld/cld) and unaffected (+/cld) cells. Using both approaches, we have identified seven functional candidates with an ER localization and/or an involvement in protein maturation and folding that could explain the lipase deficiency, and six expression candidates that exhibit large differences in mRNA levels between mutant and unaffected cells. Significantly, two genes were found to be candidates with regard to both function and expression, thus emerging as the strongest candidates for cld. We discuss the implications of our mapping results and our selection of candidates with respect to other genes, deletions, and mutations occurring in the cld critical region.

Analysis of Ethnic Admixture in Prostate Cancer

DTIC Science & Technology

2006-12-01

low penetrant genes have been identified as potential PCA suscept- ibility genes. These candidate genes include SRD5A2 (MIM 607306), CYP3A4 (MIM 124010...progression [13]. The CDH1gene is located at 16q22.1 and consists of 16 exons spanning approximately 100 kb of genomic DNA. Several polymorphisms, germline and...upstreamof theATGstart site and all 16 exons of CDH1 were screened for DNA sequence variation by denaturing high-performance liquid chro- matography

Genome-wide association study identified genetic variations and candidate genes for plant architecture component traits in Chinese upland cotton.

PubMed

Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun

2018-06-01

Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation for cultivating moderately short and compact varieties in future Chinese cotton-breeding programs.

Gene-gene interactions among genetic variants from obesity candidate genes for nonobese and obese populations in type 2 diabetes.

PubMed

Lin, Eugene; Pei, Dee; Huang, Yi-Jen; Hsieh, Chang-Hsun; Wu, Lawrence Shih-Hsin

2009-08-01

Recent studies indicate that obesity may play a key role in modulating genetic predispositions to type 2 diabetes (T2D). This study examines the main effects of both single-locus and multilocus interactions among genetic variants in Taiwanese obese and nonobese individuals to test the hypothesis that obesity-related genes may contribute to the etiology of T2D independently and/or through such complex interactions. We genotyped 11 single nucleotide polymorphisms for 10 obesity candidate genes including adrenergic beta-2-receptor surface, adrenergic beta-3-receptor surface, angiotensinogen, fat mass and obesity associated gene, guanine nucleotide binding protein beta polypeptide 3 (GNB3), interleukin 6 receptor, proprotein convertase subtilisin/kexin type 1 (PCSK1), uncoupling protein 1, uncoupling protein 2, and uncoupling protein 3. There were 389 patients diagnosed with T2D and 186 age- and sex-matched controls. Single-locus analyses showed significant main effects of the GNB3 and PCSK1 genes on the risk of T2D among the nonobese group (p = 0.002 and 0.047, respectively). Further, interactions involving GNB3 and PCSK1 were suggested among the nonobese population using the generalized multifactor dimensionality reduction method (p = 0.001). In addition, interactions among angiotensinogen, fat mass and obesity associated gene, GNB3, and uncoupling protein 3 genes were found in a significant four-locus generalized multifactor dimensionality reduction model among the obese population (p = 0.001). The results suggest that the single nucleotide polymorphisms from the obesity candidate genes may contribute to the risk of T2D independently and/or in an interactive manner according to the presence or absence of obesity.

Identification of Suitable Reference Genes for mRNA Studies in Bone Marrow in a Mouse Model of Hematopoietic Stem Cell Transplantation.

PubMed

Li, H; Chen, C; Yao, H; Li, X; Yang, N; Qiao, J; Xu, K; Zeng, L

2016-10-01

Bone marrow micro-environment changes during hematopoietic stem cell transplantation (HSCT) with subsequent alteration of genes expression. Quantitative polymerase chain reaction (q-PCR) is a reliable and reproducible technique for the analysis of gene expression. To obtain more accurate results, it is essential to find a reference during HSCT. However, which gene is suitable during HSCT remains unclear. This study aimed to identify suitable reference genes for mRNA studies in bone marrow after HSCT. C57BL/6 mice were treated with either total body irradiation (group T) or busulfan/cyclophosphamide (BU/CY) (group B) followed by infusion of bone marrow cells. Normal mice without treatments were served as a control. All samples (group T + group B + control) were defined as group G. On days 7, 14, and 21 after transplantation, transcription levels of 7 candidate genes, ACTB, B2M, GAPDH, HMBS, HPRT, SDHA, and YWHAZ, in bone marrow cells were measured by use of real-time quantitative PCR. The expression stability of these 7 candidate reference genes were analyzed by 2 statistical software programs, GeNorm and NormFinder. Our results showed that ACTB displayed the highest expression in group G, with lowest expression of PSDHA in group T and HPRT in groups B and G. Analysis of expression stability by use of GeNorm or NormFinder demonstrated that expression of B2M in bone marrow were much more stable during HSCT, compared with other candidate genes including commonly used reference genes GAPDH and ACTB. ACTB could be used as a suitable reference gene for mRNA studies in bone marrow after HSCT. Copyright © 2016 Elsevier Inc. All rights reserved.

A comprehensive approach to identify reliable reference gene candidates to investigate the link between alcoholism and endocrinology in Sprague-Dawley rats.

PubMed

Taki, Faten A; Abdel-Rahman, Abdel A; Zhang, Baohong

2014-01-01

Gender and hormonal differences are often correlated with alcohol dependence and related complications like addiction and breast cancer. Estrogen (E2) is an important sex hormone because it serves as a key protein involved in organism level signaling pathways. Alcoholism has been reported to affect estrogen receptor signaling; however, identifying the players involved in such multi-faceted syndrome is complex and requires an interdisciplinary approach. In many situations, preliminary investigations included a straight forward, yet informative biotechniques such as gene expression analyses using quantitative real time PCR (qRT-PCR). The validity of qRT-PCR-based conclusions is affected by the choice of reliable internal controls. With this in mind, we compiled a list of 15 commonly used housekeeping genes (HKGs) as potential reference gene candidates in rat biological models. A comprehensive comparison among 5 statistical approaches (geNorm, dCt method, NormFinder, BestKeeper, and RefFinder) was performed to identify the minimal number as well the most stable reference genes required for reliable normalization in experimental rat groups that comprised sham operated (SO), ovariectomized rats in the absence (OVX) or presence of E2 (OVXE2). These rat groups were subdivided into subgroups that received alcohol in liquid diet or isocalroic control liquid diet for 12 weeks. Our results showed that U87, 5S rRNA, GAPDH, and U5a were the most reliable gene candidates for reference genes in heart and brain tissue. However, different gene stability ranking was specific for each tissue input combination. The present preliminary findings highlight the variability in reference gene rankings across different experimental conditions and analytic methods and constitute a fundamental step for gene expression assays.

Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.

PubMed

Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik

2010-04-01

To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.

Characterization of reference genes for qPCR analysis in various tissues of the Fujian oyster Crassostrea angulata

NASA Astrophysics Data System (ADS)

Pu, Fei; Yang, Bingye; Ke, Caihuan

2015-07-01

Accurate quantification of transcripts using quantitative real-time polymerase chain reaction (qPCR) depends on the identification of reliable reference genes for normalization. This study aimed to identify and validate seven reference genes, including actin-2 ( ACT-2), elongation factor 1 alpha ( EF-1α), elongation factor 1 beta ( EF-1β), glyceraldehyde-3-phosphate dehydrogenase ( GAPDH), ubiquitin ( UBQ), β-tubulin ( β-TUB), and 18S ribosomal RNA, from Crassostrea angulata, a valuable marine bivalve cultured worldwide. Transcript levels of the candidate reference genes were examined using qPCR analysis and showed differential expression patterns in the mantle, gill, adductor muscle, labial palp, visceral mass, hemolymph and gonad tissues. Quantitative data were analyzed using the geNorm software to assess the expression stability of the candidate reference genes, revealing that β-TUB and UBQ were the most stable genes. The commonly used GAPDH and 18S rRNA showed low stability, making them unsuitable candidates in this system. The expression pattern of the G protein β-subunit gene ( Gβ) across tissue types was also examined and normalized to the expression of each or both of UBQ and β-TUB as internal controls. This revealed consistent trends with all three normalization approaches, thus validating the reliability of UBQ and β-TUB as optimal internal controls. The study provides the first validated reference genes for accurate data normalization in transcript profiling in Crassostrea angulata, which will be indispensable for further functional genomics studies in this economically valuable marine bivalve.

Gene-Environment Interactions in Asthma: Genetic and Epigenetic Effects.

PubMed

Lee, Jong-Uk; Kim, Jeong Dong; Park, Choon-Sik

2015-07-01

Over the past three decades, a large number of genetic studies have been aimed at finding genetic variants associated with the risk of asthma, applying various genetic and genomic approaches including linkage analysis, candidate gene polymorphism studies, and genome-wide association studies (GWAS). However, contrary to general expectation, even single nucleotide polymorphisms (SNPs) discovered by GWAS failed to fully explain the heritability of asthma. Thus, application of rare allele polymorphisms in well defined phenotypes and clarification of environmental factors have been suggested to overcome the problem of 'missing' heritability. Such factors include allergens, cigarette smoke, air pollutants, and infectious agents during pre- and post-natal periods. The first and simplest interaction between a gene and the environment is a candidate interaction of both a well known gene and environmental factor in a direct physical or chemical interaction such as between CD14 and endotoxin or between HLA and allergens. Several GWAS have found environmental interactions with occupational asthma, aspirin exacerbated respiratory disease, tobacco smoke-related airway dysfunction, and farm-related atopic diseases. As one of the mechanisms behind gene-environment interaction is epigenetics, a few studies on DNA CpG methylation have been reported on subphenotypes of asthma, pitching the exciting idea that it may be possible to intervene at the junction between the genome and the environment. Epigenetic studies are starting to include data from clinical samples, which will make them another powerful tool for re-search on gene-environment interactions in asthma.

The current state of play on the molecular genetics of depression.

PubMed

Cohen-Woods, S; Craig, I W; McGuffin, P

2013-04-01

It has been well established that both genes and non-shared environment contribute substantially to the underlying aetiology of major depressive disorder (MDD). A comprehensive overview of genetic research in MDD is presented. Method Papers were retrieved from PubMed up to December 2011, using many keywords including: depression, major depressive disorder, genetics, rare variants, gene-environment, whole genome, epigenetics, and specific candidate genes and variants. These were combined in a variety of permutations. Linkage studies have yielded some promising chromosomal regions in MDD. However, there is a continued lack of consistency in association studies, in both candidate gene and genome-wide association studies (GWAS). Numerous factors may account for variable results including the use of different diagnostic approaches, small samples in early studies, population stratification, epigenetic phenomena, copy number variation (CNV), rare variation, and phenotypic and allelic heterogeneity. The conflicting results are also probably, in part, a consequence of environmental factors not being considered or controlled for. Each research group has to identify what issues their sample may best address. We suggest that, where possible, more emphasis should be placed on the environment in molecular behavioural genetics to identify individuals at environmental high risk in addition to genetic high risk. Sequencing should be used to identify rare and alternative variation that may act as a risk factor, and a systems biology approach including gene-gene interactions and pathway analyses would be advantageous. GWAS may require even larger samples with reliably defined (sub)phenotypes.

Novel candidate genes important for asthma and hypertension comorbidity revealed from associative gene networks.

PubMed

Saik, Olga V; Demenkov, Pavel S; Ivanisenko, Timofey V; Bragina, Elena Yu; Freidin, Maxim B; Goncharova, Irina A; Dosenko, Victor E; Zolotareva, Olga I; Hofestaedt, Ralf; Lavrik, Inna N; Rogaev, Evgeny I; Ivanisenko, Vladimir A

2018-02-13

Hypertension and bronchial asthma are a major issue for people's health. As of 2014, approximately one billion adults, or ~ 22% of the world population, have had hypertension. As of 2011, 235-330 million people globally have been affected by asthma and approximately 250,000-345,000 people have died each year from the disease. The development of the effective treatment therapies against these diseases is complicated by their comorbidity features. This is often a major problem in diagnosis and their treatment. Hence, in this study the bioinformatical methodology for the analysis of the comorbidity of these two diseases have been developed. As such, the search for candidate genes related to the comorbid conditions of asthma and hypertension can help in elucidating the molecular mechanisms underlying the comorbid condition of these two diseases, and can also be useful for genotyping and identifying new drug targets. Using ANDSystem, the reconstruction and analysis of gene networks associated with asthma and hypertension was carried out. The gene network of asthma included 755 genes/proteins and 62,603 interactions, while the gene network of hypertension - 713 genes/proteins and 45,479 interactions. Two hundred and five genes/proteins and 9638 interactions were shared between asthma and hypertension. An approach for ranking genes implicated in the comorbid condition of two diseases was proposed. The approach is based on nine criteria for ranking genes by their importance, including standard methods of gene prioritization (Endeavor, ToppGene) as well as original criteria that take into account the characteristics of an associative gene network and the presence of known polymorphisms in the analysed genes. According to the proposed approach, the genes IL10, TLR4, and CAT had the highest priority in the development of comorbidity of these two diseases. Additionally, it was revealed that the list of top genes is enriched with apoptotic genes and genes involved in biological processes related to the functioning of central nervous system. The application of methods of reconstruction and analysis of gene networks is a productive tool for studying the molecular mechanisms of comorbid conditions. The method put forth to rank genes by their importance to the comorbid condition of asthma and hypertension was employed that resulted in prediction of 10 genes, playing the key role in the development of the comorbid condition. The results can be utilised to plan experiments for identification of novel candidate genes along with searching for novel pharmacological targets.

Exome-wide DNA capture and next generation sequencing in domestic and wild species.

PubMed

Cosart, Ted; Beja-Pereira, Albano; Chen, Shanyuan; Ng, Sarah B; Shendure, Jay; Luikart, Gordon

2011-07-05

Gene-targeted and genome-wide markers are crucial to advance evolutionary biology, agriculture, and biodiversity conservation by improving our understanding of genetic processes underlying adaptation and speciation. Unfortunately, for eukaryotic species with large genomes it remains costly to obtain genome sequences and to develop genome resources such as genome-wide SNPs. A method is needed to allow gene-targeted, next-generation sequencing that is flexible enough to include any gene or number of genes, unlike transcriptome sequencing. Such a method would allow sequencing of many individuals, avoiding ascertainment bias in subsequent population genetic analyses.We demonstrate the usefulness of a recent technology, exon capture, for genome-wide, gene-targeted marker discovery in species with no genome resources. We use coding gene sequences from the domestic cow genome sequence (Bos taurus) to capture (enrich for), and subsequently sequence, thousands of exons of B. taurus, B. indicus, and Bison bison (wild bison). Our capture array has probes for 16,131 exons in 2,570 genes, including 203 candidate genes with known function and of interest for their association with disease and other fitness traits. We successfully sequenced and mapped exon sequences from across the 29 autosomes and X chromosome in the B. taurus genome sequence. Exon capture and high-throughput sequencing identified thousands of putative SNPs spread evenly across all reference chromosomes, in all three individuals, including hundreds of SNPs in our targeted candidate genes. This study shows exon capture can be customized for SNP discovery in many individuals and for non-model species without genomic resources. Our captured exome subset was small enough for affordable next-generation sequencing, and successfully captured exons from a divergent wild species using the domestic cow genome as reference.

A computational approach to candidate gene prioritization for X-linked mental retardation using annotation-based binary filtering and motif-based linear discriminatory analysis

PubMed Central

2011-01-01

Background Several computational candidate gene selection and prioritization methods have recently been developed. These in silico selection and prioritization techniques are usually based on two central approaches - the examination of similarities to known disease genes and/or the evaluation of functional annotation of genes. Each of these approaches has its own caveats. Here we employ a previously described method of candidate gene prioritization based mainly on gene annotation, in accompaniment with a technique based on the evaluation of pertinent sequence motifs or signatures, in an attempt to refine the gene prioritization approach. We apply this approach to X-linked mental retardation (XLMR), a group of heterogeneous disorders for which some of the underlying genetics is known. Results The gene annotation-based binary filtering method yielded a ranked list of putative XLMR candidate genes with good plausibility of being associated with the development of mental retardation. In parallel, a motif finding approach based on linear discriminatory analysis (LDA) was employed to identify short sequence patterns that may discriminate XLMR from non-XLMR genes. High rates (>80%) of correct classification was achieved, suggesting that the identification of these motifs effectively captures genomic signals associated with XLMR vs. non-XLMR genes. The computational tools developed for the motif-based LDA is integrated into the freely available genomic analysis portal Galaxy (http://main.g2.bx.psu.edu/). Nine genes (APLN, ZC4H2, MAGED4, MAGED4B, RAP2C, FAM156A, FAM156B, TBL1X, and UXT) were highlighted as highly-ranked XLMR methods. Conclusions The combination of gene annotation information and sequence motif-orientated computational candidate gene prediction methods highlight an added benefit in generating a list of plausible candidate genes, as has been demonstrated for XLMR. Reviewers: This article was reviewed by Dr Barbara Bardoni (nominated by Prof Juergen Brosius); Prof Neil Smalheiser and Dr Dustin Holloway (nominated by Prof Charles DeLisi). PMID:21668950

A genome-wide scan for signatures of selection in Azeri and Khuzestani buffalo breeds.

PubMed

Mokhber, Mahdi; Moradi-Shahrbabak, Mohammad; Sadeghi, Mostafa; Moradi-Shahrbabak, Hossein; Stella, Alessandra; Nicolzzi, Ezequiel; Rahmaninia, Javad; Williams, John L

2018-06-11

Identification of genomic regions that have been targets of selection may shed light on the genetic history of livestock populations and help to identify variation controlling commercially important phenotypes. The Azeri and Kuzestani buffalos are the most common indigenous Iranian breeds which have been subjected to divergent selection and are well adapted to completely different regions. Examining the genetic structure of these populations may identify genomic regions associated with adaptation to the different environments and production goals. A set of 385 water buffalo samples from Azeri (N = 262) and Khuzestani (N = 123) breeds were genotyped using the Axiom® Buffalo Genotyping 90 K Array. The unbiased fixation index method (F ST ) was used to detect signatures of selection. In total, 13 regions with outlier F ST values (0.1%) were identified. Annotation of these regions using the UMD3.1 Bos taurus Genome Assembly was performed to find putative candidate genes and QTLs within the selected regions. Putative candidate genes identified include FBXO9, NDFIP1, ACTR3, ARHGAP26, SERPINF2, BOLA-DRB3, BOLA-DQB, CLN8, and MYOM2. Candidate genes identified in regions potentially under selection were associated with physiological pathways including milk production, cytoskeleton organization, growth, metabolic function, apoptosis and domestication-related changes include immune and nervous system development. The QTL identified are involved in economically important traits in buffalo related to milk composition, udder structure, somatic cell count, meat quality, and carcass and body weight.

The Wright stuff: reimagining path analysis reveals novel components of the sex determination hierarchy in Drosophila melanogaster.

PubMed

Fear, Justin M; Arbeitman, Michelle N; Salomon, Matthew P; Dalton, Justin E; Tower, John; Nuzhdin, Sergey V; McIntyre, Lauren M

2015-09-04

The Drosophila sex determination hierarchy is a classic example of a transcriptional regulatory hierarchy, with sex-specific isoforms regulating morphology and behavior. We use a structural equation modeling approach, leveraging natural genetic variation from two studies on Drosophila female head tissues--DSPR collection (596 F1-hybrids from crosses between DSPR sub-populations) and CEGS population (75 F1-hybrids from crosses between DGRP/Winters lines to a reference strain w1118)--to expand understanding of the sex hierarchy gene regulatory network (GRN). This approach is completely generalizable to any natural population, including humans. We expanded the sex hierarchy GRN adding novel links among genes, including a link from fruitless (fru) to Sex-lethal (Sxl) identified in both populations. This link is further supported by the presence of fru binding sites in the Sxl locus. 754 candidate genes were added to the pathway, including the splicing factors male-specific lethal 2 and Rm62 as downstream targets of Sxl which are well-supported links in males. Independent studies of doublesex and transformer mutants support many additions, including evidence for a link between the sex hierarchy and metabolism, via Insulin-like receptor. The genes added in the CEGS population were enriched for genes with sex-biased splicing and components of the spliceosome. A common goal of molecular biologists is to expand understanding about regulatory interactions among genes. Using natural alleles we can not only identify novel relationships, but using supervised approaches can order genes into a regulatory hierarchy. Combining these results with independent large effect mutation studies, allows clear candidates for detailed molecular follow-up to emerge.

Autism genes are selectively targeted by environmental pollutants including pesticides, heavy metals, bisphenol A, phthalates and many others in food, cosmetics or household products.

PubMed

Carter, C J; Blizard, R A

2016-10-27

The increasing incidence of autism suggests a major environmental influence. Epidemiology has implicated many candidates and genetics many susceptibility genes. Gene/environment interactions in autism were analysed using 206 autism susceptibility genes (ASG's) from the Autworks database to interrogate ∼1 million chemical/gene interactions in the comparative toxicogenomics database. Any bias towards ASG's was statistically determined for each chemical. Many suspect compounds identified in epidemiology, including tetrachlorodibenzodioxin, pesticides, particulate matter, benzo(a)pyrene, heavy metals, valproate, acetaminophen, SSRI's, cocaine, bisphenol A, phthalates, polyhalogenated biphenyls, flame retardants, diesel constituents, terbutaline and oxytocin, inter alia showed a significant degree of bias towards ASG's, as did relevant endogenous agents (retinoids, sex steroids, thyroxine, melatonin, folate, dopamine, serotonin). Numerous other suspected endocrine disruptors (over 100) selectively targeted ASG's including paraquat, atrazine and other pesticides not yet studied in autism and many compounds used in food, cosmetics or household products, including tretinoin, soy phytoestrogens, aspartame, titanium dioxide and sodium fluoride. Autism polymorphisms influence the sensitivity to some of these chemicals and these same genes play an important role in barrier function and control of respiratory cilia sweeping particulate matter from the airways. Pesticides, heavy metals and pollutants also disrupt barrier and/or ciliary function, which is regulated by sex steroids and by bitter/sweet taste receptors. Further epidemiological studies and neurodevelopmental and behavioural research is warranted to determine the relevance of large number of suspect candidates whose addition to the environment, household, food and cosmetics might be fuelling the autism epidemic in a gene-dependent manner. Copyright © 2016. Published by Elsevier Ltd.

Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors

PubMed Central

Bii, Victor M.; Trobridge, Grant D.

2016-01-01

Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types. PMID:27792127

The CanOE strategy: integrating genomic and metabolic contexts across multiple prokaryote genomes to find candidate genes for orphan enzymes.

PubMed

Smith, Adam Alexander Thil; Belda, Eugeni; Viari, Alain; Medigue, Claudine; Vallenet, David

2012-05-01

Of all biochemically characterized metabolic reactions formalized by the IUBMB, over one out of four have yet to be associated with a nucleic or protein sequence, i.e. are sequence-orphan enzymatic activities. Few bioinformatics annotation tools are able to propose candidate genes for such activities by exploiting context-dependent rather than sequence-dependent data, and none are readily accessible and propose result integration across multiple genomes. Here, we present CanOE (Candidate genes for Orphan Enzymes), a four-step bioinformatics strategy that proposes ranked candidate genes for sequence-orphan enzymatic activities (or orphan enzymes for short). The first step locates "genomic metabolons", i.e. groups of co-localized genes coding proteins catalyzing reactions linked by shared metabolites, in one genome at a time. These metabolons can be particularly helpful for aiding bioanalysts to visualize relevant metabolic data. In the second step, they are used to generate candidate associations between un-annotated genes and gene-less reactions. The third step integrates these gene-reaction associations over several genomes using gene families, and summarizes the strength of family-reaction associations by several scores. In the final step, these scores are used to rank members of gene families which are proposed for metabolic reactions. These associations are of particular interest when the metabolic reaction is a sequence-orphan enzymatic activity. Our strategy found over 60,000 genomic metabolons in more than 1,000 prokaryote organisms from the MicroScope platform, generating candidate genes for many metabolic reactions, of which more than 70 distinct orphan reactions. A computational validation of the approach is discussed. Finally, we present a case study on the anaerobic allantoin degradation pathway in Escherichia coli K-12.

Transcriptome analysis of Brassica napus pod using RNA-Seq and identification of lipid-related candidate genes.

PubMed

Xu, Hai-Ming; Kong, Xiang-Dong; Chen, Fei; Huang, Ji-Xiang; Lou, Xiang-Yang; Zhao, Jian-Yi

2015-10-24

Brassica napus is an important oilseed crop. Dissection of the genetic architecture underlying oil-related biological processes will greatly facilitates the genetic improvement of rapeseed. The differential gene expression during pod development offers a snapshot on the genes responsible for oil accumulation in. To identify candidate genes in the linkage peaks reported previously, we used RNA sequencing (RNA-Seq) technology to analyze the pod transcriptomes of German cultivar Sollux and Chinese inbred line Gaoyou. The RNA samples were collected for RNA-Seq at 5-7, 15-17 and 25-27 days after flowering (DAF). Bioinformatics analysis was performed to investigate differentially expressed genes (DEGs). Gene annotation analysis was integrated with QTL mapping and Brassica napus pod transcriptome profiling to detect potential candidate genes in oilseed. Four hundred sixty five and two thousand, one hundred fourteen candidate DEGs were identified, respectively, between two varieties at the same stages and across different periods of each variety. Then, 33 DEGs between Sollux and Gaoyou were identified as the candidate genes affecting seed oil content by combining those DEGs with the quantitative trait locus (QTL) mapping results, of which, one was found to be homologous to Arabidopsis thaliana lipid-related genes. Intervarietal DEGs of lipid pathways in QTL regions represent important candidate genes for oil-related traits. Integrated analysis of transcriptome profiling, QTL mapping and comparative genomics with other relative species leads to efficient identification of most plausible functional genes underlying oil-content related characters, offering valuable resources for bettering breeding program of Brassica napus. This study provided a comprehensive overview on the pod transcriptomes of two varieties with different oil-contents at the three developmental stages.

Identification of Candidate B-Lymphoma Genes by Cross-Species Gene Expression Profiling

PubMed Central

Tompkins, Van S.; Han, Seong-Su; Olivier, Alicia; Syrbu, Sergei; Bair, Thomas; Button, Anna; Jacobus, Laura; Wang, Zebin; Lifton, Samuel; Raychaudhuri, Pradip; Morse, Herbert C.; Weiner, George; Link, Brian; Smith, Brian J.; Janz, Siegfried

2013-01-01

Comparative genome-wide expression profiling of malignant tumor counterparts across the human-mouse species barrier has a successful track record as a gene discovery tool in liver, breast, lung, prostate and other cancers, but has been largely neglected in studies on neoplasms of mature B-lymphocytes such as diffuse large B cell lymphoma (DLBCL) and Burkitt lymphoma (BL). We used global gene expression profiles of DLBCL-like tumors that arose spontaneously in Myc-transgenic C57BL/6 mice as a phylogenetically conserved filter for analyzing the human DLBCL transcriptome. The human and mouse lymphomas were found to have 60 concordantly deregulated genes in common, including 8 genes that Cox hazard regression analysis associated with overall survival in a published landmark dataset of DLBCL. Genetic network analysis of the 60 genes followed by biological validation studies indicate FOXM1 as a candidate DLBCL and BL gene, supporting a number of studies contending that FOXM1 is a therapeutic target in mature B cell tumors. Our findings demonstrate the value of the “mouse filter” for genomic studies of human B-lineage neoplasms for which a vast knowledge base already exists. PMID:24130802

Integrative Assessment of Chlorine-Induced Acute Lung Injury in Mice

PubMed Central

Pope-Varsalona, Hannah; Concel, Vincent J.; Liu, Pengyuan; Bein, Kiflai; Berndt, Annerose; Martin, Timothy M.; Ganguly, Koustav; Jang, An Soo; Brant, Kelly A.; Dopico, Richard A.; Upadhyay, Swapna; Di, Y. P. Peter; Hu, Zhen; Vuga, Louis J.; Medvedovic, Mario; Kaminski, Naftali; You, Ming; Alexander, Danny C.; McDunn, Jonathan E.; Prows, Daniel R.; Knoell, Daren L.

2012-01-01

The genetic basis for the underlying individual susceptibility to chlorine-induced acute lung injury is unknown. To uncover the genetic basis and pathophysiological processes that could provide additional homeostatic capacities during lung injury, 40 inbred murine strains were exposed to chlorine, and haplotype association mapping was performed. The identified single-nucleotide polymorphism (SNP) associations were evaluated through transcriptomic and metabolomic profiling. Using ≥ 10% allelic frequency and ≥ 10% phenotype explained as threshold criteria, promoter SNPs that could eliminate putative transcriptional factor recognition sites in candidate genes were assessed by determining transcript levels through microarray and reverse real-time PCR during chlorine exposure. The mean survival time varied by approximately 5-fold among strains, and SNP associations were identified for 13 candidate genes on chromosomes 1, 4, 5, 9, and 15. Microarrays revealed several differentially enriched pathways, including protein transport (decreased more in the sensitive C57BLKS/J lung) and protein catabolic process (increased more in the resistant C57BL/10J lung). Lung metabolomic profiling revealed 95 of the 280 metabolites measured were altered by chlorine exposure, and included alanine, which decreased more in the C57BLKS/J than in the C57BL/10J strain, and glutamine, which increased more in the C57BL/10J than in the C57BLKS/J strain. Genetic associations from haplotype mapping were strengthened by an integrated assessment using transcriptomic and metabolomic profiling. The leading candidate genes associated with increased susceptibility to acute lung injury in mice included Klf4, Sema7a, Tns1, Aacs, and a gene that encodes an amino acid carrier, Slc38a4. PMID:22447970

Integrative strategies to identify candidate genes in rodent models of human alcoholism.

PubMed

Treadwell, Julie A

2006-01-01

The search for genes underlying alcohol-related behaviours in rodent models of human alcoholism has been ongoing for many years with only limited success. Recently, new strategies that integrate several of the traditional approaches have provided new insights into the molecular mechanisms underlying ethanol's actions in the brain. We have used alcohol-preferring C57BL/6J (B6) and alcohol-avoiding DBA/2J (D2) genetic strains of mice in an integrative strategy combining high-throughput gene expression screening, genetic segregation analysis, and mapping to previously published quantitative trait loci to uncover candidate genes for the ethanol-preference phenotype. In our study, 2 genes, retinaldehyde binding protein 1 (Rlbp1) and syntaxin 12 (Stx12), were found to be strong candidates for ethanol preference. Such experimental approaches have the power and the potential to greatly speed up the laborious process of identifying candidate genes for the animal models of human alcoholism.

Identification of candidate genes for drought tolerance in coffee by high-throughput sequencing in the shoot apex of different Coffea arabica cultivars.

PubMed

Mofatto, Luciana Souto; Carneiro, Fernanda de Araújo; Vieira, Natalia Gomes; Duarte, Karoline Estefani; Vidal, Ramon Oliveira; Alekcevetch, Jean Carlos; Cotta, Michelle Guitton; Verdeil, Jean-Luc; Lapeyre-Montes, Fabienne; Lartaud, Marc; Leroy, Thierry; De Bellis, Fabien; Pot, David; Rodrigues, Gustavo Costa; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães; Andrade, Alan Carvalho; Marraccini, Pierre

2016-04-19

Drought is a widespread limiting factor in coffee plants. It affects plant development, fruit production, bean development and consequently beverage quality. Genetic diversity for drought tolerance exists within the coffee genus. However, the molecular mechanisms underlying the adaptation of coffee plants to drought are largely unknown. In this study, we compared the molecular responses to drought in two commercial cultivars (IAPAR59, drought-tolerant and Rubi, drought-susceptible) of Coffea arabica grown in the field under control (irrigation) and drought conditions using the pyrosequencing of RNA extracted from shoot apices and analysing the expression of 38 candidate genes. Pyrosequencing from shoot apices generated a total of 34.7 Mbp and 535,544 reads enabling the identification of 43,087 clusters (41,512 contigs and 1,575 singletons). These data included 17,719 clusters (16,238 contigs and 1,575 singletons) exclusively from 454 sequencing reads, along with 25,368 hybrid clusters assembled with 454 sequences. The comparison of DNA libraries identified new candidate genes (n = 20) presenting differential expression between IAPAR59 and Rubi and/or drought conditions. Their expression was monitored in plagiotropic buds, together with those of other (n = 18) candidates genes. Under drought conditions, up-regulated expression was observed in IAPAR59 but not in Rubi for CaSTK1 (protein kinase), CaSAMT1 (SAM-dependent methyltransferase), CaSLP1 (plant development) and CaMAS1 (ABA biosynthesis). Interestingly, the expression of lipid-transfer protein (nsLTP) genes was also highly up-regulated under drought conditions in IAPAR59. This may have been related to the thicker cuticle observed on the abaxial leaf surface in IAPAR59 compared to Rubi. The full transcriptome assembly of C. arabica, followed by functional annotation, enabled us to identify differentially expressed genes related to drought conditions. Using these data, candidate genes were selected and their differential expression profiles were confirmed by qPCR experiments in plagiotropic buds of IAPAR59 and Rubi under drought conditions. As regards the genes up-regulated under drought conditions, specifically in the drought-tolerant IAPAR59, several corresponded to orphan genes but also to genes coding proteins involved in signal transduction pathways, as well as ABA and lipid metabolism, for example. The identification of these genes should help advance our understanding of the genetic determinism of drought tolerance in coffee.

Gene expression profiles of fin regeneration in loach (Paramisgurnus dabryanu).

PubMed

Li, Li; He, Jingya; Wang, Linlin; Chen, Weihua; Chang, Zhongjie

2017-11-01

Teleost fins can regenerate accurate position-matched structure and function after amputation. However, we still lack systematic transcriptional profiling and methodologies to understand the molecular basis of fin regeneration. After histological analysis, we established a suppression subtraction hybridization library containing 418 distinct sequences expressed differentially during the process of blastema formation and differentiation in caudal fin regeneration. Genome ontology and comparative analysis of differential distribution of our data and the reference zebrafish genome showed notable subcategories, including multi-organism processes, response to stimuli, extracellular matrix, antioxidant activity, and cell junction function. KEGG pathway analysis allowed the effective identification of relevant genes in those pathways involved in tissue morphogenesis and regeneration, including tight junction, cell adhesion molecules, mTOR and Jak-STAT signaling pathway. From relevant function subcategories and signaling pathways, 78 clones were examined for further Southern-blot hybridization. Then, 17 genes were chosen and characterized using semi-quantitative PCR. Then 4 candidate genes were identified, including F11r, Mmp9, Agr2 and one without a match to any database. After real-time quantitative PCR, the results showed obvious expression changes in different periods of caudal fin regeneration. We can assume that the 4 candidates, likely valuable genes associated with fin regeneration, deserve additional attention. Thus, our study demonstrated how to investigate the transcript profiles with an emphasis on bioinformatics intervention and how to identify potential genes related to fin regeneration processes. The results also provide a foundation or knowledge for further research into genes and molecular mechanisms of fin regeneration. Copyright © 2017 Elsevier B.V. All rights reserved.

LOD score exclusion analyses for candidate genes using random population samples.

PubMed

Deng, H W; Li, J; Recker, R R

2001-05-01

While extensive analyses have been conducted to test for, no formal analyses have been conducted to test against, the importance of candidate genes with random population samples. We develop a LOD score approach for exclusion analyses of candidate genes with random population samples. Under this approach, specific genetic effects and inheritance models at candidate genes can be analysed and if a LOD score is < or = - 2.0, the locus can be excluded from having an effect larger than that specified. Computer simulations show that, with sample sizes often employed in association studies, this approach has high power to exclude a gene from having moderate genetic effects. In contrast to regular association analyses, population admixture will not affect the robustness of our analyses; in fact, it renders our analyses more conservative and thus any significant exclusion result is robust. Our exclusion analysis complements association analysis for candidate genes in random population samples and is parallel to the exclusion mapping analyses that may be conducted in linkage analyses with pedigrees or relative pairs. The usefulness of the approach is demonstrated by an application to test the importance of vitamin D receptor and estrogen receptor genes underlying the differential risk to osteoporotic fractures.

Gene Network Construction from Microarray Data Identifies a Key Network Module and Several Candidate Hub Genes in Age-Associated Spatial Learning Impairment

PubMed Central

Uddin, Raihan; Singh, Shiva M.

2017-01-01

As humans age many suffer from a decrease in normal brain functions including spatial learning impairments. This study aimed to better understand the molecular mechanisms in age-associated spatial learning impairment (ASLI). We used a mathematical modeling approach implemented in Weighted Gene Co-expression Network Analysis (WGCNA) to create and compare gene network models of young (learning unimpaired) and aged (predominantly learning impaired) brains from a set of exploratory datasets in rats in the context of ASLI. The major goal was to overcome some of the limitations previously observed in the traditional meta- and pathway analysis using these data, and identify novel ASLI related genes and their networks based on co-expression relationship of genes. This analysis identified a set of network modules in the young, each of which is highly enriched with genes functioning in broad but distinct GO functional categories or biological pathways. Interestingly, the analysis pointed to a single module that was highly enriched with genes functioning in “learning and memory” related functions and pathways. Subsequent differential network analysis of this “learning and memory” module in the aged (predominantly learning impaired) rats compared to the young learning unimpaired rats allowed us to identify a set of novel ASLI candidate hub genes. Some of these genes show significant repeatability in networks generated from independent young and aged validation datasets. These hub genes are highly co-expressed with other genes in the network, which not only show differential expression but also differential co-expression and differential connectivity across age and learning impairment. The known function of these hub genes indicate that they play key roles in critical pathways, including kinase and phosphatase signaling, in functions related to various ion channels, and in maintaining neuronal integrity relating to synaptic plasticity and memory formation. Taken together, they provide a new insight and generate new hypotheses into the molecular mechanisms responsible for age associated learning impairment, including spatial learning. PMID:29066959

Gene Network Construction from Microarray Data Identifies a Key Network Module and Several Candidate Hub Genes in Age-Associated Spatial Learning Impairment.

PubMed

Uddin, Raihan; Singh, Shiva M

2017-01-01

As humans age many suffer from a decrease in normal brain functions including spatial learning impairments. This study aimed to better understand the molecular mechanisms in age-associated spatial learning impairment (ASLI). We used a mathematical modeling approach implemented in Weighted Gene Co-expression Network Analysis (WGCNA) to create and compare gene network models of young (learning unimpaired) and aged (predominantly learning impaired) brains from a set of exploratory datasets in rats in the context of ASLI. The major goal was to overcome some of the limitations previously observed in the traditional meta- and pathway analysis using these data, and identify novel ASLI related genes and their networks based on co-expression relationship of genes. This analysis identified a set of network modules in the young, each of which is highly enriched with genes functioning in broad but distinct GO functional categories or biological pathways. Interestingly, the analysis pointed to a single module that was highly enriched with genes functioning in "learning and memory" related functions and pathways. Subsequent differential network analysis of this "learning and memory" module in the aged (predominantly learning impaired) rats compared to the young learning unimpaired rats allowed us to identify a set of novel ASLI candidate hub genes. Some of these genes show significant repeatability in networks generated from independent young and aged validation datasets. These hub genes are highly co-expressed with other genes in the network, which not only show differential expression but also differential co-expression and differential connectivity across age and learning impairment. The known function of these hub genes indicate that they play key roles in critical pathways, including kinase and phosphatase signaling, in functions related to various ion channels, and in maintaining neuronal integrity relating to synaptic plasticity and memory formation. Taken together, they provide a new insight and generate new hypotheses into the molecular mechanisms responsible for age associated learning impairment, including spatial learning.

Lack of haplotype structuring for two candidate genes for trypanotolerance in cattle.

PubMed

Álvarez, I; Pérez-Pardal, L; Traoré, A; Fernández, I; Goyache, F

2016-04-01

Bovine trypanotolerance is a heritable trait associated to the ability of the individuals to control parasitaemia and anaemia. The INHBA (BTA4) and TICAM1 (BTA7) genes are strong candidates for trypanotolerance-related traits. The coding sequence of both genes (3951 bp in total) were analysed in a panel including 79 Asian, African and European cattle (Bos taurus and B. indicus) to identify naturally occurring polymorphisms on both genes. In general, the genetic diversity was low. Nineteen of the 33 mutations identified were found just one time. Seventeen different haplotypes were defined for the TICAM1 gene, and 9 and 12 were defined for the exon 1 and the exon 2 of the INHBA gene, respectively. There was no clear separation between cattle groups. The most frequent haplotypes identified in West African taurine samples were also identified in other cattle groups including Asian zebu and European cattle. Phylogenetic trees and principal component analysis confirmed that divergence among the cattle groups analysed was poor, particularly for the INHBA sequences. The European cattle subset had the lowest values of haplotype diversity for both the exon1 (monomorphic) and the exon2 (0.077 ± 0.066) of the INHBA gene. Neutrality tests, in general, did not suggest that the analysed genes were under positive selection. The assessed scenario would be consistent with the identification of recent mutations in evolutionary terms. © 2015 Blackwell Verlag GmbH.

Phenoscape: Identifying Candidate Genes for Evolutionary Phenotypes

PubMed Central

Edmunds, Richard C.; Su, Baofeng; Balhoff, James P.; Eames, B. Frank; Dahdul, Wasila M.; Lapp, Hilmar; Lundberg, John G.; Vision, Todd J.; Dunham, Rex A.; Mabee, Paula M.; Westerfield, Monte

2016-01-01

Phenotypes resulting from mutations in genetic model organisms can help reveal candidate genes for evolutionarily important phenotypic changes in related taxa. Although testing candidate gene hypotheses experimentally in nonmodel organisms is typically difficult, ontology-driven information systems can help generate testable hypotheses about developmental processes in experimentally tractable organisms. Here, we tested candidate gene hypotheses suggested by expert use of the Phenoscape Knowledgebase, specifically looking for genes that are candidates responsible for evolutionarily interesting phenotypes in the ostariophysan fishes that bear resemblance to mutant phenotypes in zebrafish. For this, we searched ZFIN for genetic perturbations that result in either loss of basihyal element or loss of scales phenotypes, because these are the ancestral phenotypes observed in catfishes (Siluriformes). We tested the identified candidate genes by examining their endogenous expression patterns in the channel catfish, Ictalurus punctatus. The experimental results were consistent with the hypotheses that these features evolved through disruption in developmental pathways at, or upstream of, brpf1 and eda/edar for the ancestral losses of basihyal element and scales, respectively. These results demonstrate that ontological annotations of the phenotypic effects of genetic alterations in model organisms, when aggregated within a knowledgebase, can be used effectively to generate testable, and useful, hypotheses about evolutionary changes in morphology. PMID:26500251

Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

DOE PAGES

Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina; ...

2014-07-30

Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

Walking the interactome for candidate prioritization in exome sequencing studies of Mendelian diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smedley, Damian; Kohler, Sebastian; Czeschik, Johanna Christina

Here, whole-exome sequencing (WES) has opened up previously unheard of possibilities for identifying novel disease genes in Mendelian disorders, only about half of which have been elucidated to date. However, interpretation of WES data remains challenging. As a result, we analyze protein–protein association (PPA) networks to identify candidate genes in the vicinity of genes previously implicated in a disease. The analysis, using a random-walk with restart (RWR) method, is adapted to the setting of WES by developing a composite variant-gene relevance score based on the rarity, location and predicted pathogenicity of variants and the RWR evaluation of genes harboring themore » variants. Benchmarking using known disease variants from 88 disease-gene families reveals that the correct gene is ranked among the top 10 candidates in ≥50% of cases, a figure which we confirmed using a prospective study of disease genes identified in 2012 and PPA data produced before that date. In conclusion, we implement our method in a freely available Web server, ExomeWalker, that displays a ranked list of candidates together with information on PPAs, frequency and predicted pathogenicity of the variants to allow quick and effective searches for candidates that are likely to reward closer investigation.« less

Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques.

PubMed

Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Grand, Roger Le; Fomsgaard, Anders

2013-07-19

HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques.

Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques

PubMed Central

Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Le Grand, Roger; Fomsgaard, Anders

2013-01-01

HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques. PMID:26344115

PosMed-plus: an intelligent search engine that inferentially integrates cross-species information resources for molecular breeding of plants.

PubMed

Makita, Yuko; Kobayashi, Norio; Mochizuki, Yoshiki; Yoshida, Yuko; Asano, Satomi; Heida, Naohiko; Deshpande, Mrinalini; Bhatia, Rinki; Matsushima, Akihiro; Ishii, Manabu; Kawaguchi, Shuji; Iida, Kei; Hanada, Kosuke; Kuromori, Takashi; Seki, Motoaki; Shinozaki, Kazuo; Toyoda, Tetsuro

2009-07-01

Molecular breeding of crops is an efficient way to upgrade plant functions useful to mankind. A key step is forward genetics or positional cloning to identify the genes that confer useful functions. In order to accelerate the whole research process, we have developed an integrated database system powered by an intelligent data-retrieval engine termed PosMed-plus (Positional Medline for plant upgrading science), allowing us to prioritize highly promising candidate genes in a given chromosomal interval(s) of Arabidopsis thaliana and rice, Oryza sativa. By inferentially integrating cross-species information resources including genomes, transcriptomes, proteomes, localizomes, phenomes and literature, the system compares a user's query, such as phenotypic or functional keywords, with the literature associated with the relevant genes located within the interval. By utilizing orthologous and paralogous correspondences, PosMed-plus efficiently integrates cross-species information to facilitate the ranking of rice candidate genes based on evidence from other model species such as Arabidopsis. PosMed-plus is a plant science version of the PosMed system widely used by mammalian researchers, and provides both a powerful integrative search function and a rich integrative display of the integrated databases. PosMed-plus is the first cross-species integrated database that inferentially prioritizes candidate genes for forward genetics approaches in plant science, and will be expanded for wider use in plant upgrading in many species.

Multilocus patterns of nucleotide diversity and divergence reveal positive selection at candidate genes related to cold hardiness in coastal Douglas Fir (Pseudotsuga menziesii var. menziesii).

PubMed

Eckert, Andrew J; Wegrzyn, Jill L; Pande, Barnaly; Jermstad, Kathleen D; Lee, Jennifer M; Liechty, John D; Tearse, Brandon R; Krutovsky, Konstantin V; Neale, David B

2009-09-01

Forest trees exhibit remarkable adaptations to their environments. The genetic basis for phenotypic adaptation to climatic gradients has been established through a long history of common garden, provenance, and genecological studies. The identities of genes underlying these traits, however, have remained elusive and thus so have the patterns of adaptive molecular diversity in forest tree genomes. Here, we report an analysis of diversity and divergence for a set of 121 cold-hardiness candidate genes in coastal Douglas fir (Pseudotsuga menziesii var. menziesii). Application of several different tests for neutrality, including those that incorporated demographic models, revealed signatures of selection consistent with selective sweeps at three to eight loci, depending upon the severity of a bottleneck event and the method used to detect selection. Given the high levels of recombination, these candidate genes are likely to be closely linked to the target of selection if not the genes themselves. Putative homologs in Arabidopsis act primarily to stabilize the plasma membrane and protect against denaturation of proteins at freezing temperatures. These results indicate that surveys of nucleotide diversity and divergence, when framed within the context of further association mapping experiments, will come full circle with respect to their utility in the dissection of complex phenotypic traits into their genetic components.

Integration of genome-wide association studies with biological knowledge identifies six novel genes related to kidney function.

PubMed

Chasman, Daniel I; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C; O'Seaghdha, Conall M; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V; O'Connell, Jeffrey R; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D; Gierman, Hinco J; Feitosa, Mary F; Hwang, Shih-Jen; Atkinson, Elizabeth J; Lohman, Kurt; Cornelis, Marilyn C; Johansson, Asa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B; Launer, Lenore J; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A; de Andrade, Mariza; Turner, Stephen T; Ding, Jingzhong; Andrews, Jeanette S; Freedman, Barry I; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H; Wright, Alan F; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G; Rivadeneira, Fernando; Aulchenko, Yurii S; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K; Portas, Laura; Ford, Ian; Buckley, Brendan M; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J Wouter; Probst-Hensch, Nicole M; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S; van Duijn, Cornelia M; Borecki, Ingrid B; Kardia, Sharon L R; Liu, Yongmei; Curhan, Gary C; Rudan, Igor; Gyllensten, Ulf; Wilson, James F; Franke, Andre; Pramstaller, Peter P; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M; Kao, W H Linda; Fox, Caroline S; Köttgen, Anna

2012-12-15

In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10(-9)) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10(-4)-2.2 × 10(-7). Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general.

Integration of genome-wide association studies with biological knowledge identifies six novel genes related to kidney function

PubMed Central

Chasman, Daniel I.; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A.; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C.; O'Seaghdha, Conall M.; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V.; O'Connell, Jeffrey R.; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D.; Gierman, Hinco J.; Feitosa, Mary F.; Hwang, Shih-Jen; Atkinson, Elizabeth J.; Lohman, Kurt; Cornelis, Marilyn C.; Johansson, Åsa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G.; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y.; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B.; Launer, Lenore J.; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D.; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A.; de Andrade, Mariza; Turner, Stephen T.; Ding, Jingzhong; Andrews, Jeanette S.; Freedman, Barry I.; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E.; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H.; Wright, Alan F.; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K.; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G.; Rivadeneira, Fernando; Aulchenko, Yurii S.; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K.; Portas, Laura; Ford, Ian; Buckley, Brendan M.; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K.; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J. Wouter; Probst-Hensch, Nicole M.; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R.; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S.; van Duijn, Cornelia M.; Borecki, Ingrid B.; Kardia, Sharon L.R.; Liu, Yongmei; Curhan, Gary C.; Rudan, Igor; Gyllensten, Ulf; Wilson, James F.; Franke, Andre; Pramstaller, Peter P.; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M.; Kao, W.H. Linda; Fox, Caroline S.; Köttgen, Anna

2012-01-01

In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10−9) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10−4–2.2 × 10−7. Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general. PMID:22962313

Identification and reproducibility of diagnostic DNA markers for tuber starch and yield optimization in a novel association mapping population of potato (Solanum tuberosum L.).

PubMed

Schönhals, E M; Ortega, F; Barandalla, L; Aragones, A; Ruiz de Galarreta, J I; Liao, J-C; Sanetomo, R; Walkemeier, B; Tacke, E; Ritter, E; Gebhardt, C

2016-04-01

SNPs in candidate genes Pain - 1, InvCD141 (invertases), SSIV (starch synthase), StCDF1 (transcription factor), LapN (leucine aminopeptidase), and cytoplasm type are associated with potato tuber yield, starch content and/or starch yield. Tuber yield (TY), starch content (TSC), and starch yield (TSY) are complex characters of high importance for the potato crop in general and for industrial starch production in particular. DNA markers associated with superior alleles of genes that control the natural variation of TY, TSC, and TSY could increase precision and speed of breeding new cultivars optimized for potato starch production. Diagnostic DNA markers are identified by association mapping in populations of tetraploid potato varieties and advanced breeding clones. A novel association mapping population of 282 genotypes including varieties, breeding clones and Andean landraces was assembled and field evaluated in Northern Spain for TY, TSC, TSY, tuber number (TN) and tuber weight (TW). The landraces had lower mean values of TY, TW, TN, and TSY. The population was genotyped for 183 microsatellite alleles, 221 single nucleotide polymorphisms (SNPs) in fourteen candidate genes and eight known diagnostic markers for TSC and TSY. Association test statistics including kinship and population structure reproduced five known marker-trait associations of candidate genes and discovered new ones, particularly for tuber yield and starch yield. The inclusion of landraces increased the number of detected marker-trait associations. Integration of the present association mapping results with previous QTL linkage mapping studies for TY, TSC, TSY, TW, TN, and tuberization revealed some hot spots of QTL for these traits in the potato genome. The genomic positions of markers linked or associated with QTL for complex tuber traits suggest high multiplicity and genome wide distribution of the underlying genes.

A Genome Wide Association Study of arabinoxylan content in 2-row spring barley grain

PubMed Central

Hassan, Ali Saleh; Houston, Kelly; Lahnstein, Jelle; Shirley, Neil; Schwerdt, Julian G.; Gidley, Michael J.; Waugh, Robbie; Little, Alan

2017-01-01

In barley endosperm arabinoxylan (AX) is the second most abundant cell wall polysaccharide and in wheat it is the most abundant polysaccharide in the starchy endosperm walls of the grain. AX is one of the main contributors to grain dietary fibre content providing several health benefits including cholesterol and glucose lowering effects, and antioxidant activities. Due to its complex structural features, AX might also affect the downstream applications of barley grain in malting and brewing. Using a high pressure liquid chromatography (HPLC) method we quantified AX amounts in mature grain in 128 spring 2-row barley accessions. Amounts ranged from ~ 5.2 μg/g to ~ 9 μg/g. We used this data for a Genome Wide Association Study (GWAS) that revealed three significant quantitative trait loci (QTL) associated with grain AX levels which passed a false discovery threshold (FDR) and are located on two of the seven barley chromosomes. Regions underlying the QTLs were scanned for genes likely to be involved in AX biosynthesis or turnover, and strong candidates, including glycosyltransferases from the GT43 and GT61 families and glycoside hydrolases from the GH10 family, were identified. Phylogenetic trees of selected gene families were built based on protein translations and were used to examine the relationship of the barley candidate genes to those in other species. Our data reaffirms the roles of existing genes thought to contribute to AX content, and identifies novel QTL (and candidate genes associated with them) potentially influencing the AX content of barley grain. One potential outcome of this work is the deployment of highly associated single nucleotide polymorphisms markers in breeding programs to guide the modification of AX abundance in barley grain. PMID:28771585

Genetic research: who is at risk for alcoholism.

PubMed

Foroud, Tatiana; Edenberg, Howard J; Crabbe, John C

2010-01-01

The National Institute on Alcohol Abuse and Alcoholism (NIAAA) was founded 40 years ago to help elucidate the biological underpinnings of alcohol dependence, including the potential contribution of genetic factors. Twin, adoption, and family studies conclusively demonstrated that genetic factors account for 50 to 60 percent of the variance in risk for developing alcoholism. Case-control studies and linkage analyses have helped identify DNA variants that contribute to increased risk, and the NIAAA-sponsored Collaborative Studies on Genetics of Alcoholism (COGA) has the expressed goal of identifying contributing genes using state-of-the-art genetic technologies. These efforts have ascertained several genes that may contribute to an increased risk of alcoholism, including certain variants encoding alcohol-metabolizing enzymes and neurotransmitter receptors. Genome-wide association studies allowing the analysis of millions of genetic markers located throughout the genome will enable discovery of further candidate genes. In addition to these human studies, genetic animal models of alcohol's effects and alcohol use have greatly advanced our understanding of the genetic basis of alcoholism, resulting in the identification of quantitative trait loci and allowing for targeted manipulation of candidate genes. Novel research approaches-for example, into epigenetic mechanisms of gene regulation-also are under way and undoubtedly will further clarify the genetic basis of alcoholism.

Genetic approaches to understanding post-traumatic stress disorder

PubMed Central

Almli, Lynn M.; Fani, Negar; Smith, Alicia K.; Ressler, Kerry J.

2015-01-01

Post-traumatic stress disorder (PTSD) is increasingly recognized as both a disorder of enormous mental health and societal burden, but also as an anxiety disorder that may be particularly understandable from a scientific perspective. Specifically, PTSD can be conceptualized as a disorder of fear and stress dysregulation, and the neural circuitry underlying these pathways in both animals and humans are becoming increasingly well understood. Furthermore, PTSD is the only disorder in psychiatry in which the initiating factor, the trauma exposure, can be identified. Thus, the pathophysiology of the fear and stress response underlying PTSD can be examined and potentially interrupted. Twin studies have shown that the development of PTSD following a trauma is heritable, and that genetic risk factors may account for up to 30–40% of this heritability. A current goal is to understand the gene pathways that are associated with PTSD, and how those genes act on the fear/stress circuitry to mediate risk vs. resilience for PTSD. This review will examine gene pathways that have recently been analysed, primarily through candidate gene studies (including neuroimaging studies of candidate genes), in addition to genome-wide associations and the epigenetic regulation of PTSD. Future and on-going studies are utilizing larger and collaborative cohorts to identify novel gene candidates through genome-wide association and other powerful genomic approaches. Identification of PTSD biological pathways strengthens the hope of progress in the mechanistic understanding of a model psychiatric disorder and allows for the development of targeted treatments and interventions. PMID:24103155

Confluence of genes, environment, development, and behavior in a post Genome-Wide Association Study world.

PubMed

Vrieze, Scott I; Iacono, William G; McGue, Matt

2012-11-01

This article serves to outline a research paradigm to investigate main effects and interactions of genes, environment, and development on behavior and psychiatric illness. We provide a historical context for candidate gene studies and genome-wide association studies, including benefits, limitations, and expected payoffs. Using substance use and abuse as our driving example, we then turn to the importance of etiological psychological theory in guiding genetic, environmental, and developmental research, as well as the utility of refined phenotypic measures, such as endophenotypes, in the pursuit of etiological understanding and focused tests of genetic and environmental associations. Phenotypic measurement has received considerable attention in the history of psychology and is informed by psychometrics, whereas the environment remains relatively poorly measured and is often confounded with genetic effects (i.e., gene-environment correlation). Genetically informed designs, which are no longer limited to twin and adoption studies thanks to ever-cheaper genotyping, are required to understand environmental influences. Finally, we outline the vast amount of individual difference in structural genomic variation, most of which remains to be leveraged in genetic association tests. Although the genetic data can be massive and burdensome (tens of millions of variants per person), we argue that improved understanding of genomic structure and function will provide investigators with new tools to test specific a priori hypotheses derived from etiological psychological theory, much like current candidate gene research but with less confusion and more payoff than candidate gene research has to date.

In Silico Gene Prioritization by Integrating Multiple Data Sources

PubMed Central

Zhou, Yingyao; Shields, Robert; Chanda, Sumit K.; Elston, Robert C.; Li, Jing

2011-01-01

Identifying disease genes is crucial to the understanding of disease pathogenesis, and to the improvement of disease diagnosis and treatment. In recent years, many researchers have proposed approaches to prioritize candidate genes by considering the relationship of candidate genes and existing known disease genes, reflected in other data sources. In this paper, we propose an expandable framework for gene prioritization that can integrate multiple heterogeneous data sources by taking advantage of a unified graphic representation. Gene-gene relationships and gene-disease relationships are then defined based on the overall topology of each network using a diffusion kernel measure. These relationship measures are in turn normalized to derive an overall measure across all networks, which is utilized to rank all candidate genes. Based on the informativeness of available data sources with respect to each specific disease, we also propose an adaptive threshold score to select a small subset of candidate genes for further validation studies. We performed large scale cross-validation analysis on 110 disease families using three data sources. Results have shown that our approach consistently outperforms other two state of the art programs. A case study using Parkinson disease (PD) has identified four candidate genes (UBB, SEPT5, GPR37 and TH) that ranked higher than our adaptive threshold, all of which are involved in the PD pathway. In particular, a very recent study has observed a deletion of TH in a patient with PD, which supports the importance of the TH gene in PD pathogenesis. A web tool has been implemented to assist scientists in their genetic studies. PMID:21731658

Genome-wide Discovery of Circular RNAs in the Leaf and Seedling Tissues of Arabidopsis Thaliana

PubMed Central

Dou, Yongchao; Li, Shengjun; Yang, Weilong; Liu, Kan; Du, Qian; Ren, Guodong; Yu, Bin; Zhang, Chi

2017-01-01

Background: Recently, identification and functional studies of circular RNAs, a type of non-coding RNAs arising from a ligation of 3’ and 5’ ends of a linear RNA molecule, were conducted in mammalian cells with the development of RNA-seq technology. Method: Since compared with animals, studies on circular RNAs in plants are less thorough, a genome-wide identification of circular RNA candidates in Arabidopsis was conducted with our own developed bioinformatics tool to several existing RNA-seq datasets specifically for non-coding RNAs. Results: A total of 164 circular RNA candidates were identified from RNA-seq data, and 4 circular RNA transcripts, including both exonic and intronic circular RNAs, were experimentally validated. Interestingly, our results show that circular RNA transcripts are enriched in the photosynthesis system for the leaf tissue and correlated to the higher expression levels of their parent genes. Sixteen out of all 40 genes that have circular RNA candidates are related to the photosynthesis system, and out of the total 146 exonic circular RNA candidates, 63 are found in chloroplast. PMID:29081691

The Genetic Basis for Variation in Sensitivity to Lead Toxicity in Drosophila melanogaster.

PubMed

Zhou, Shanshan; Morozova, Tatiana V; Hussain, Yasmeen N; Luoma, Sarah E; McCoy, Lenovia; Yamamoto, Akihiko; Mackay, Trudy F C; Anholt, Robert R H

2016-07-01

Lead toxicity presents a worldwide health problem, especially due to its adverse effects on cognitive development in children. However, identifying genes that give rise to individual variation in susceptibility to lead toxicity is challenging in human populations. Our goal was to use Drosophila melanogaster to identify evolutionarily conserved candidate genes associated with individual variation in susceptibility to lead exposure. To identify candidate genes associated with variation in susceptibility to lead toxicity, we measured effects of lead exposure on development time, viability and adult activity in the Drosophila melanogaster Genetic Reference Panel (DGRP) and performed genome-wide association analyses to identify candidate genes. We used mutants to assess functional causality of candidate genes and constructed a genetic network associated with variation in sensitivity to lead exposure, on which we could superimpose human orthologs. We found substantial heritabilities for all three traits and identified candidate genes associated with variation in susceptibility to lead exposure for each phenotype. The genetic architectures that determine variation in sensitivity to lead exposure are highly polygenic. Gene ontology and network analyses showed enrichment of genes associated with early development and function of the nervous system. Drosophila melanogaster presents an advantageous model to study the genetic underpinnings of variation in susceptibility to lead toxicity. Evolutionary conservation of cellular pathways that respond to toxic exposure allows predictions regarding orthologous genes and pathways across phyla. Thus, studies in the D. melanogaster model system can identify candidate susceptibility genes to guide subsequent studies in human populations. Zhou S, Morozova TV, Hussain YN, Luoma SE, McCoy L, Yamamoto A, Mackay TF, Anholt RR. 2016. The genetic basis for variation in sensitivity to lead toxicity in Drosophila melanogaster. Environ Health Perspect 124:1062-1070; http://dx.doi.org/10.1289/ehp.1510513.

Replication of type 2 diabetes candidate genes variations in three geographically unrelated Indian population groups.

PubMed

Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Singh, Yoginder Pal; Kaul, Nabodita; Behura, Anita; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K; Chainy, Gagan B N; Bhanwer, Amarjit S; Sharma, Swarkar; Bamezai, Rameshwar N K

2013-01-01

Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E-04) with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E-08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67-3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D.

Replication of Type 2 Diabetes Candidate Genes Variations in Three Geographically Unrelated Indian Population Groups

PubMed Central

Ali, Shafat; Chopra, Rupali; Manvati, Siddharth; Mahajan, Ankit; Sehajpal, Prabodh; Gupta, Subash; Dhar, Manoj K.; Chainy, Gagan B. N.; Bhanwer, Amarjit S.; Sharma, Swarkar; Bamezai, Rameshwar N. K.

2013-01-01

Type 2 diabetes (T2D) is a syndrome of multiple metabolic disorders and is genetically heterogeneous. India comprises one of the largest global populations with highest number of reported type 2 diabetes cases. However, limited information about T2D associated loci is available for Indian populations. It is, therefore, pertinent to evaluate the previously associated candidates as well as identify novel genetic variations in Indian populations to understand the extent of genetic heterogeneity. We chose to do a cost effective high-throughput mass-array genotyping and studied the candidate gene variations associated with T2D in literature. In this case-control candidate genes association study, 91 SNPs from 55 candidate genes have been analyzed in three geographically independent population groups from India. We report the genetic variants in five candidate genes: TCF7L2, HHEX, ENPP1, IDE and FTO, are significantly associated (after Bonferroni correction, p<5.5E−04) with T2D susceptibility in combined population. Interestingly, SNP rs7903146 of the TCF7L2 gene passed the genome wide significance threshold (combined P value = 2.05E−08) in the studied populations. We also observed the association of rs7903146 with blood glucose (fasting and postprandial) levels, supporting the role of TCF7L2 gene in blood glucose homeostasis. Further, we noted that the moderate risk provided by the independently associated loci in combined population with Odds Ratio (OR)<1.38 increased to OR = 2.44, (95%CI = 1.67–3.59) when the risk providing genotypes of TCF7L2, HHEX, ENPP1 and FTO genes were combined, suggesting the importance of gene-gene interactions evaluation in complex disorders like T2D. PMID:23527042

Regional Anesthesia and Valproate Sodium for the Prevention of Chronic Post-Amputation Pain

DTIC Science & Technology

2013-10-01

revised documents August Non-perishable Supplies ordered & received DUKE IRB approved study via expedited review September Submitted all revisions...2013 February March April May June July August September October HRPO request for revised, addtn’l docs VA approved protocol...A few candidate gene polymorphisms have been linked to pain susceptibility, including catechol-O-methyltranferase ( COMT ). This gene modulates

A polymorphism in a gene encoding Perilipin 4 is associated with height but not with bone measures in individuals from the Framingham Osteoporosis Study

USDA-ARS?s Scientific Manuscript database

There is increasing interest in identifying new pathways and candidate genes that confer susceptibility to osteoporosis. There is evidence that adipogenesis and osteogenesis may be related, including a common bone marrow progenitor cell for both adipocytes and osteoblasts. Perilipin 1 (PLIN1) and Pe...

The database of chromosome imbalance regions and genes resided in lung cancer from Asian and Caucasian identified by array-comparative genomic hybridization

PubMed Central

2012-01-01

Background Cancer-related genes show racial differences. Therefore, identification and characterization of DNA copy number alteration regions in different racial groups helps to dissect the mechanism of tumorigenesis. Methods Array-comparative genomic hybridization (array-CGH) was analyzed for DNA copy number profile in 40 Asian and 20 Caucasian lung cancer patients. Three methods including MetaCore analysis for disease and pathway correlations, concordance analysis between array-CGH database and the expression array database, and literature search for copy number variation genes were performed to select novel lung cancer candidate genes. Four candidate oncogenes were validated for DNA copy number and mRNA and protein expression by quantitative polymerase chain reaction (qPCR), chromogenic in situ hybridization (CISH), reverse transcriptase-qPCR (RT-qPCR), and immunohistochemistry (IHC) in more patients. Results We identified 20 chromosomal imbalance regions harboring 459 genes for Caucasian and 17 regions containing 476 genes for Asian lung cancer patients. Seven common chromosomal imbalance regions harboring 117 genes, included gain on 3p13-14, 6p22.1, 9q21.13, 13q14.1, and 17p13.3; and loss on 3p22.2-22.3 and 13q13.3 were found both in Asian and Caucasian patients. Gene validation for four genes including ARHGAP19 (10q24.1) functioning in Rho activity control, FRAT2 (10q24.1) involved in Wnt signaling, PAFAH1B1 (17p13.3) functioning in motility control, and ZNF322A (6p22.1) involved in MAPK signaling was performed using qPCR and RT-qPCR. Mean gene dosage and mRNA expression level of the four candidate genes in tumor tissues were significantly higher than the corresponding normal tissues (P<0.001~P=0.06). In addition, CISH analysis of patients indicated that copy number amplification indeed occurred for ARHGAP19 and ZNF322A genes in lung cancer patients. IHC analysis of paraffin blocks from Asian Caucasian patients demonstrated that the frequency of PAFAH1B1 protein overexpression was 68% in Asian and 70% in Caucasian. Conclusions Our study provides an invaluable database revealing common and differential imbalance regions at specific chromosomes among Asian and Caucasian lung cancer patients. Four validation methods confirmed our database, which would help in further studies on the mechanism of lung tumorigenesis. PMID:22691236

Genetic basis of interindividual susceptibility to cancer cachexia: selection of potential candidate gene polymorphisms for association studies.

PubMed

Johns, N; Tan, B H; MacMillan, M; Solheim, T S; Ross, J A; Baracos, V E; Damaraju, S; Fearon, K C H

2014-12-01

Cancer cachexia is a complex and multifactorial disease. Evolving definitions highlight the fact that a diverse range of biological processes contribute to cancer cachexia. Part of the variation in who will and who will not develop cancer cachexia may be genetically determined. As new definitions, classifications and biological targets continue to evolve, there is a need for reappraisal of the literature for future candidate association studies. This review summarizes genes identified or implicated as well as putative candidate genes contributing to cachexia, identified through diverse technology platforms and model systems to further guide association studies. A systematic search covering 1986-2012 was performed for potential candidate genes / genetic polymorphisms relating to cancer cachexia. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Pathway analysis software was used to reveal possible network associations between genes. Functionality of SNPs/genes was explored based on published literature, algorithms for detecting putative deleterious SNPs and interrogating the database for expression of quantitative trait loci (eQTLs). A total of 154 genes associated with cancer cachexia were identified and explored for functional polymorphisms. Of these 154 genes, 119 had a combined total of 281 polymorphisms with functional and/or clinical significance in terms of cachexia associated with them. Of these, 80 polymorphisms (in 51 genes) were replicated in more than one study with 24 polymorphisms found to influence two or more hallmarks of cachexia (i.e., inflammation, loss of fat mass and/or lean mass and reduced survival). Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides a contemporary basis to select genes and/or polymorphisms for further association studies in cancer cachexia, and to develop their potential as susceptibility biomarkers of cachexia.

Candidate Gene Identification of Feed Efficiency and Coat Color Traits in a C57BL/6J × Kunming F2 Mice Population Using Genome-Wide Association Study.

PubMed

Miao, Yuanxin; Soudy, Fathia; Xu, Zhong; Liao, Mingxing; Zhao, Shuhong; Li, Xinyun

2017-01-01

Feed efficiency (FE) is a very important trait in livestock industry. Identification of the candidate genes could be of benefit for the improvement of FE trait. Mouse is used as the model for many studies in mammals. In this study, the candidate genes related to FE and coat color were identified using C57BL/6J (C57) × Kunming (KM) F2 mouse population. GWAS results showed that 61 and 2 SNPs were genome-wise suggestive significantly associated with feed conversion ratio (FCR) and feed intake (FI) traits, respectively. Moreover, the Erbin, Msrb2, Ptf1a, and Fgf10 were considered as the candidate genes of FE. The Lpl was considered as the candidate gene of FI. Further, the coat color trait was studied. KM mice are white and C57 ones are black. The GWAS results showed that the most significant SNP was located at chromosome 7, and the closely linked gene was Tyr. Therefore, our study offered useful target genes related to FE in mice; these genes may play similar roles in FE of livestock. Also, we identified the major gene of coat color in mice, which would be useful for better understanding of natural mutation of the coat color in mice.

New mutations in BBS genes in small consanguineous families with Bardet-Biedl syndrome: Detection of candidate regions by homozygosity mapping

PubMed Central

Pereiro, Ines; Piñeiro-Gallego, Teresa; Baiget, Montserrat; Borrego, Salud; Ayuso, Carmen; Searby, Charles; Nishimura, Darryl

2010-01-01

Purpose Bardet-Biedl syndrome (BBS, OMIM 209900) is a rare multi-organ disorder in which BBS patients manifest a variable phenotype that includes retinal dystrophy, polydactyly, mental delay, obesity, and also reproductive tract and renal abnormalities. Mutations in 14 genes (BBS1–BBS14) are found in 70% of the patients, indicating that additional mutations in known and new BBS genes remain to be identified. Therefore, the molecular diagnosis of this complex disorder is a challenging task. Methods In this study we show the use of the genome-wide homozygosity mapping strategy in the mutation detection of nine Caucasian BBS families, eight of them consanguineous and one from the same geographic area with no proven consanguinity. Results We identified the disease-causing mutation in six of the families studied, five of which had novel sequence variants in BBS3, BBS6, and BBS12. This is the first null mutation reported in BBS3. Furthermore, this approach defined homozygous candidate regions that could harbor potential candidate genes for BBS in three of the families. Conclusions These findings further underline the importance of homozygosity mapping as a useful technology for diagnosis in small consanguineous families with a complex disease like BBS. PMID:20142850

Combined meta-genomics analyses unravel candidate genes for the grain dietary fiber content in bread wheat (Triticum aestivum L.).

PubMed

Quraishi, Umar Masood; Murat, Florent; Abrouk, Mickael; Pont, Caroline; Confolent, Carole; Oury, François Xavier; Ward, Jane; Boros, Danuta; Gebruers, Kurt; Delcour, Jan A; Courtin, Christophe M; Bedo, Zoltan; Saulnier, Luc; Guillon, Fabienne; Balzergue, Sandrine; Shewry, Peter R; Feuillet, Catherine; Charmet, Gilles; Salse, Jerome

2011-03-01

Grain dietary fiber content in wheat not only affects its end use and technological properties including milling, baking and animal feed but is also of great importance for health benefits. In this study, integration of association genetics (seven detected loci on chromosomes 1B, 3A, 3D, 5B, 6B, 7A, 7B) and meta-QTL (three consensus QTL on chromosomes 1B, 3D and 6B) analyses allowed the identification of seven chromosomal regions underlying grain dietary fiber content in bread wheat. Based either on a diversity panel or on bi-parental populations, we clearly demonstrate that this trait is mainly driven by a major locus located on chromosome 1B associated with a log of p value >13 and a LOD score >8, respectively. In parallel, we identified 73 genes differentially expressed during the grain development and between genotypes with contrasting grain fiber contents. Integration of quantitative genetics and transcriptomic data allowed us to propose a short list of candidate genes that are conserved in the rice, sorghum and Brachypodium chromosome regions orthologous to the seven wheat grain fiber content QTL and that can be considered as major candidate genes for future improvement of the grain dietary fiber content in bread wheat breeding programs.

Case-control approach application for finding a relationship between candidate genes and clinical mastitis in Holstein dairy cattle.

PubMed

Bagheri, Masoumeh; Moradi-Sharhrbabak, M; Miraie-Ashtiani, R; Safdari-Shahroudi, M; Abdollahi-Arpanahi, R

2016-02-01

Mastitis is a major source of economic loss in dairy herds. The objective of this research was to evaluate the association between genotypes within SLC11A1 and CXCR1 candidate genes and clinical mastitis in Holstein dairy cattle using the selective genotyping method. The data set contained clinical mastitis records of 3,823 Holstein cows from two Holstein dairy herds located in two different regions in Iran. Data included the number of cases of clinical mastitis per lactation. Selective genotyping was based on extreme values for clinical mastitis residuals (CMR) from mixed model analyses. Two extreme groups consisting of 135 cows were formed (as cases and controls), and genotyped for the two candidate genes, namely, SLC11A1 and CXCR1, using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), respectively. Associations between single nucleotide polymorphism (SNP) genotypes with CMR and breeding values for milk and protein yield were carried out by applying logistic regression analyses, i.e. estimating the probability of the heterogeneous genotype in the dependency of values for CMR and breeding values (BVs). The sequencing results revealed a novel mutation in 1139 bp of exon 11 of the SLC11A1 gene and this SNP had a significant association with CMR (P < 0.05). PCR-RFLP analysis leads to three banding patterns for CXCR1c.735C>G and these genotypes had significant relationships with CMR. Overall, the results showed that SLC11A1 and CXCR1 are valuable candidate genes for the improvement of mastitis resistance as well as production traits in dairy cattle populations.

The ecological genomic basis of salinity adaptation in Tunisian Medicago truncatula.

PubMed

Friesen, Maren L; von Wettberg, Eric J B; Badri, Mounawer; Moriuchi, Ken S; Barhoumi, Fathi; Chang, Peter L; Cuellar-Ortiz, Sonia; Cordeiro, Matilde A; Vu, Wendy T; Arraouadi, Soumaya; Djébali, Naceur; Zribi, Kais; Badri, Yazid; Porter, Stephanie S; Aouani, Mohammed Elarbi; Cook, Douglas R; Strauss, Sharon Y; Nuzhdin, Sergey V

2014-12-22

As our world becomes warmer, agriculture is increasingly impacted by rising soil salinity and understanding plant adaptation to salt stress can help enable effective crop breeding. Salt tolerance is a complex plant phenotype and we know little about the pathways utilized by naturally tolerant plants. Legumes are important species in agricultural and natural ecosystems, since they engage in symbiotic nitrogen-fixation, but are especially vulnerable to salinity stress. Our studies of the model legume Medicago truncatula in field and greenhouse settings demonstrate that Tunisian populations are locally adapted to saline soils at the metapopulation level and that saline origin genotypes are less impacted by salt than non-saline origin genotypes; these populations thus likely contain adaptively diverged alleles. Whole genome resequencing of 39 wild accessions reveals ongoing migration and candidate genomic regions that assort non-randomly with soil salinity. Consistent with natural selection acting at these sites, saline alleles are typically rare in the range-wide species' gene pool and are also typically derived relative to the sister species M. littoralis. Candidate regions for adaptation contain genes that regulate physiological acclimation to salt stress, such as abscisic acid and jasmonic acid signaling, including a novel salt-tolerance candidate orthologous to the uncharacterized gene AtCIPK21. Unexpectedly, these regions also contain biotic stress genes and flowering time pathway genes. We show that flowering time is differentiated between saline and non-saline populations and may allow salt stress escape. This work nominates multiple potential pathways of adaptation to naturally stressful environments in a model legume. These candidates point to the importance of both tolerance and avoidance in natural legume populations. We have uncovered several promising targets that could be used to breed for enhanced salt tolerance in crop legumes to enhance food security in an era of increasing soil salinization.

Dissecting Vancomycin-Intermediate Resistance in Staphylococcus aureus Using Genome-Wide Association

PubMed Central

Alam, Md Tauqeer; Petit, Robert A.; Crispell, Emily K.; Thornton, Timothy A.; Conneely, Karen N.; Jiang, Yunxuan; Satola, Sarah W.; Read, Timothy D.

2014-01-01

Vancomycin-intermediate Staphylococcus aureus (VISA) is currently defined as having minimal inhibitory concentration (MIC) of 4–8 µg/ml. VISA evolves through changes in multiple genetic loci with at least 16 candidate genes identified in clinical and in vitro-selected VISA strains. We report a whole-genome comparative analysis of 49 vancomycin-sensitive S. aureus and 26 VISA strains. Resistance to vancomycin was determined by broth microdilution, Etest, and population analysis profile-area under the curve (PAP-AUC). Genome-wide association studies (GWAS) of 55,977 single-nucleotide polymorphisms identified in one or more strains found one highly significant association (P = 8.78E-08) between a nonsynonymous mutation at codon 481 (H481) of the rpoB gene and increased vancomycin MIC. Additionally, we used a database of public S. aureus genome sequences to identify rare mutations in candidate genes associated with VISA. On the basis of these data, we proposed a preliminary model called ECM+RMCG for the VISA phenotype as a benchmark for future efforts. The model predicted VISA based on the presence of a rare mutation in a set of candidate genes (walKR, vraSR, graSR, and agrA) and/or three previously experimentally verified mutations (including the rpoB H481 locus) with an accuracy of 81% and a sensitivity of 73%. Further, the level of resistance measured by both Etest and PAP-AUC regressed positively with the number of mutations present in a strain. This study demonstrated 1) the power of GWAS for identifying common genetic variants associated with antibiotic resistance in bacteria and 2) that rare mutations in candidate gene, identified using large genomic data sets, can also be associated with resistance phenotypes. PMID:24787619

Pharmacological Validation of Candidate Causal Sleep Genes Identified in an N2 Cross

PubMed Central

Brunner, Joseph I.; Gotter, Anthony L.; Millstein, Joshua; Garson, Susan; Binns, Jacquelyn; Fox, Steven V.; Savitz, Alan T.; Yang, He S.; Fitzpatrick, Karrie; Zhou, Lili; Owens, Joseph R.; Webber, Andrea L.; Vitaterna, Martha H.; Kasarskis, Andrew; Uebele, Victor N.; Turek, Fred; Renger, John J.; Winrow, Christopher J.

2013-01-01

Despite the substantial impact of sleep disturbances on human health and the many years of study dedicated to understanding sleep pathologies, the underlying genetic mechanisms that govern sleep and wake largely remain unknown. Recently, we completed large scale genetic and gene expression analyses in a segregating inbred mouse cross and identified candidate causal genes that regulate the mammalian sleep-wake cycle, across multiple traits including total sleep time, amounts of REM, non-REM, sleep bout duration and sleep fragmentation. Here we describe a novel approach toward validating candidate causal genes, while also identifying potential targets for sleep-related indications. Select small molecule antagonists and agonists were used to interrogate candidate causal gene function in rodent sleep polysomnography assays to determine impact on overall sleep architecture and to evaluate alignment with associated sleep-wake traits. Significant effects on sleep architecture were observed in validation studies using compounds targeting the muscarinic acetylcholine receptor M3 subunit (Chrm3)(wake promotion), nicotinic acetylcholine receptor alpha4 subunit (Chrna4)(wake promotion), dopamine receptor D5 subunit (Drd5)(sleep induction), serotonin 1D receptor (Htr1d)(altered REM fragmentation), glucagon-like peptide-1 receptor (Glp1r)(light sleep promotion and reduction of deep sleep), and Calcium channel, voltage-dependent, T type, alpha 1I subunit (Cacna1i)(increased bout duration slow wave sleep). Taken together, these results show the complexity of genetic components that regulate sleep-wake traits and highlight the importance of evaluating this complex behavior at a systems level. Pharmacological validation of genetically identified putative targets provides a rapid alternative to generating knock out or transgenic animal models, and may ultimately lead towards new therapeutic opportunities. PMID:22091728

Behavioral genomics of honeybee foraging and nest defense

NASA Astrophysics Data System (ADS)

Hunt, Greg J.; Amdam, Gro V.; Schlipalius, David; Emore, Christine; Sardesai, Nagesh; Williams, Christie E.; Rueppell, Olav; Guzmán-Novoa, Ernesto; Arechavaleta-Velasco, Miguel; Chandra, Sathees; Fondrk, M. Kim; Beye, Martin; Page, Robert E.

2007-04-01

The honeybee has been the most important insect species for study of social behavior. The recently released draft genomic sequence for the bee will accelerate honeybee behavioral genetics. Although we lack sufficient tools to manipulate this genome easily, quantitative trait loci (QTLs) that influence natural variation in behavior have been identified and tested for their effects on correlated behavioral traits. We review what is known about the genetics and physiology of two behavioral traits in honeybees, foraging specialization (pollen versus nectar), and defensive behavior, and present evidence that map-based cloning of genes is more feasible in the bee than in other metazoans. We also present bioinformatic analyses of candidate genes within QTL confidence intervals (CIs). The high recombination rate of the bee made it possible to narrow the search to regions containing only 17-61 predicted peptides for each QTL, although CIs covered large genetic distances. Knowledge of correlated behavioral traits, comparative bioinformatics, and expression assays facilitated evaluation of candidate genes. An overrepresentation of genes involved in ovarian development and insulin-like signaling components within pollen foraging QTL regions suggests that an ancestral reproductive gene network was co-opted during the evolution of foraging specialization. The major QTL influencing defensive/aggressive behavior contains orthologs of genes involved in central nervous system activity and neurogenesis. Candidates at the other two defensive-behavior QTLs include modulators of sensory signaling ( Am5HT 7 serotonin receptor, AmArr4 arrestin, and GABA-B-R1 receptor). These studies are the first step in linking natural variation in honeybee social behavior to the identification of underlying genes.

Transcriptome Sequencing of Codonopsis pilosula and Identification of Candidate Genes Involved in Polysaccharide Biosynthesis

PubMed Central

Gao, Jian Ping; Wang, Dong; Cao, Ling Ya; Sun, Hai Feng

2015-01-01

Background Codonopsis pilosula (Franch.) Nannf. is one of the most widely used medicinal plants. Although chemical and pharmacological studies have shown that codonopsis polysaccharides (CPPs) are bioactive compounds and that their composition is variable, their biosynthetic pathways remain largely unknown. Next-generation sequencing is an efficient and high-throughput technique that allows the identification of candidate genes involved in secondary metabolism. Principal Findings To identify the components involved in CPP biosynthesis, a transcriptome library, prepared using root and other tissues, was assembled with the help of Illumina sequencing. A total of 9.2 Gb of clean nucleotides was obtained comprising 91,175,044 clean reads, 102,125 contigs, and 45,511 unigenes. After aligning the sequences to the public protein databases, 76.1% of the unigenes were annotated. Among these annotated unigenes, 26,189 were assigned to Gene Ontology categories, 11,415 to Clusters of Orthologous Groups, and 18,848 to Kyoto Encyclopedia of Genes and Genomes pathways. Analysis of abundance of transcripts in the library showed that genes, including those encoding metallothionein, aquaporin, and cysteine protease that are related to stress responses, were in the top list. Among genes involved in the biosynthesis of CPP, those responsible for the synthesis of UDP-L-arabinose and UDP-xylose were highly expressed. Significance To our knowledge, this is the first study to provide a public transcriptome dataset prepared from C. pilosula and an outline of the biosynthetic pathway of polysaccharides in a medicinal plant. Identified candidate genes involved in CPP biosynthesis provide understanding of the biosynthesis and regulation of CPP at the molecular level. PMID:25719364

Isolation and characterization of multiple F-box genes linked to the S9- and S10-RNase in apple (Malus × domestica Borkh.).

PubMed

Okada, Kazuma; Moriya, Shigeki; Haji, Takashi; Abe, Kazuyuki

2013-06-01

Using 11 consensus primer pairs designed from S-linked F-box genes of apple and Japanese pear, 10 new F-box genes (MdFBX21 to 30) were isolated from the apple cultivar 'Spartan' (S(9)S(10)). MdFBX21 to 23 and MdFBX24 to 30 were completely linked to the S(9) -RNase and S(10-)RNase, respectively, and showed pollen-specific expression and S-haplotype-specific polymorphisms. Therefore, these 10 F-box genes are good candidates for the pollen determinant of self-incompatibility in apple. Phylogenetic analysis and comparison of deduced amino acid sequences of MdFBX21 to 30 with those of 25 S-linked F-box genes previously isolated from apple showed that a deduced amino acid identity of greater than 88.0 % can be used as the tentative criterion to classify F-box genes into one type. Using this criterion, 31 of 35 F-box genes of apple were classified into 11 types (SFBB1-11). All types included F-box genes derived from S(3-) and S(9-)haplotypes, and seven types included F-box genes derived from S(3-), S(9-), and S(10-)haplotypes. Moreover, comparison of nucleotide sequences of S-RNases and multiple F-box genes among S(3-), S(9-), and S(10-)haplotypes suggested that F-box genes within each type showed high nucleotide identity regardless of the identity of the S-RNase. The large number of F-box genes as candidates for the pollen determinant and the high degree of conservation within each type are consistent with the collaborative non-self-recognition model reported for Petunia. These findings support that the collaborative non-self-recognition system also exists in apple.

Genetic analysis of dyslexia candidate genes in the European cross-linguistic NeuroDys cohort.

PubMed

Becker, Jessica; Czamara, Darina; Scerri, Tom S; Ramus, Franck; Csépe, Valéria; Talcott, Joel B; Stein, John; Morris, Andrew; Ludwig, Kerstin U; Hoffmann, Per; Honbolygó, Ferenc; Tóth, Dénes; Fauchereau, Fabien; Bogliotti, Caroline; Iannuzzi, Stéphanie; Chaix, Yves; Valdois, Sylviane; Billard, Catherine; George, Florence; Soares-Boucaud, Isabelle; Gérard, Christophe-Loïc; van der Mark, Sanne; Schulz, Enrico; Vaessen, Anniek; Maurer, Urs; Lohvansuu, Kaisa; Lyytinen, Heikki; Zucchelli, Marco; Brandeis, Daniel; Blomert, Leo; Leppänen, Paavo H T; Bruder, Jennifer; Monaco, Anthony P; Müller-Myhsok, Bertram; Kere, Juha; Landerl, Karin; Nöthen, Markus M; Schulte-Körne, Gerd; Paracchini, Silvia; Peyrard-Janvid, Myriam; Schumacher, Johannes

2014-05-01

Dyslexia is one of the most common childhood disorders with a prevalence of around 5-10% in school-age children. Although an important genetic component is known to have a role in the aetiology of dyslexia, we are far from understanding the molecular mechanisms leading to the disorder. Several candidate genes have been implicated in dyslexia, including DYX1C1, DCDC2, KIAA0319, and the MRPL19/C2ORF3 locus, each with reports of both positive and no replications. We generated a European cross-linguistic sample of school-age children - the NeuroDys cohort - that includes more than 900 individuals with dyslexia, sampled with homogenous inclusion criteria across eight European countries, and a comparable number of controls. Here, we describe association analysis of the dyslexia candidate genes/locus in the NeuroDys cohort. We performed both case-control and quantitative association analyses of single markers and haplotypes previously reported to be dyslexia-associated. Although we observed association signals in samples from single countries, we did not find any marker or haplotype that was significantly associated with either case-control status or quantitative measurements of word-reading or spelling in the meta-analysis of all eight countries combined. Like in other neurocognitive disorders, our findings underline the need for larger sample sizes to validate possibly weak genetic effects.

Forkhead-box series expression network is associated with outcome of clear-cell renal cell carcinoma.

PubMed

Jia, Zhongwei; Wan, Fangning; Zhu, Yao; Shi, Guohai; Zhang, Hailiang; Dai, Bo; Ye, Dingwei

2018-06-01

Previous studies have demonstrated that several members of the Forkhead-box (FOX) family of genes are associated with tumor progression and metastasis. The objective of the current study was to screen candidate FOX family genes identified from analysis of molecular networks in clear cell renal cell carcinoma (ccRCC). The expression of FOX family genes as well as FOX family-associated genes was examined, and Kaplan-Meier survival analysis was performed in The Cancer Genome Atlas (TCGA) cohort (n=525). Patient characteristics, including sex, age, tumor diameter, laterality, tumor-node-metastasis, tumor grade, stage, white blood cell count, platelet count, the levels of hemoglobin, overall survival (OS) and disease-free survival (DFS), were collected for univariate and multivariate Cox proportional hazards ratio analyses. A total of seven candidate FOX family genes were selected from the TCGA database subsequent to univariate and multivariate Cox proportional hazards ratio analyses. FOXA1, FOXA2, FOXD1, FOXD4L2, FOXK2 and FOXL1 were associated with poor OS time, while FOXA1, FOXA2, FOXD1 and FOXK2 were associated with poor DFS time (P<0.05). FOXN2 was associated with favorable outcomes for overall and disease-free survival (P<0.05). In the gene cluster network analysis, the expression of FOX family-associated genes, including nuclear receptor coactivator ( NCOA ) 1 , NADH-ubiquinone oxidoreductase flavoprotein 3 ( NDUFV3 ), phosphatidylserine decarboxylase ( PISD ) and pyruvate kinase liver and red blood cell ( PKLR ), were independent prognostic factors for OS in patients with ccRCC. Results of the present study revealed that the expression of FOX family genes, including FOXA1, FOXA2, FOXD1, FOXD4L2, FOXK2 and FOXL1 , and FOX family-associated genes, including NCOA1, NDUFV3, PISD and PKLR , are independent prognostic factors for patients with ccRCC.

Translocation breakpoint at 7q31 associated with tics: further evidence for IMMP2L as a candidate gene for Tourette syndrome

PubMed Central

Patel, Chirag; Cooper-Charles, Lisa; McMullan, Dominic J; Walker, Judith M; Davison, Val; Morton, Jenny

2011-01-01

Gilles de la Tourette syndrome is a complex neuropsychiatric disorder with a strong genetic basis. We identified a male patient with Tourette syndrome-like tics and an apparently balanced de novo translocation [46,XY,t(2;7)(p24.2;q31)]. Further analysis using array comparative genomic hybridisation (CGH) revealed a cryptic deletion at 7q31.1–7q31.2. Breakpoints disrupting this region have been reported in one isolated and one familial case of Tourette syndrome. In our case, IMMP2L, a gene coding for a human homologue of the yeast inner mitochondrial membrane peptidase subunit 2, was disrupted by the breakpoint on 7q31.1, with deletion of exons 1–3 of the gene. The IMMP2L gene has previously been proposed as a candidate gene for Tourette syndrome, and our case provides further evidence of its possible role in the pathogenesis. The deleted region (7q31.1–7q31.2) of 7.2 Mb of genomic DNA also encompasses numerous genes, including FOXP2, associated with verbal dyspraxia, and the CFTR gene. PMID:21386874

Translocation breakpoint at 7q31 associated with tics: further evidence for IMMP2L as a candidate gene for Tourette syndrome.

PubMed

Patel, Chirag; Cooper-Charles, Lisa; McMullan, Dominic J; Walker, Judith M; Davison, Val; Morton, Jenny

2011-06-01

Gilles de la Tourette syndrome is a complex neuropsychiatric disorder with a strong genetic basis. We identified a male patient with Tourette syndrome-like tics and an apparently balanced de novo translocation [46,XY,t(2;7)(p24.2;q31)]. Further analysis using array comparative genomic hybridisation (CGH) revealed a cryptic deletion at 7q31.1-7q31.2. Breakpoints disrupting this region have been reported in one isolated and one familial case of Tourette syndrome. In our case, IMMP2L, a gene coding for a human homologue of the yeast inner mitochondrial membrane peptidase subunit 2, was disrupted by the breakpoint on 7q31.1, with deletion of exons 1-3 of the gene. The IMMP2L gene has previously been proposed as a candidate gene for Tourette syndrome, and our case provides further evidence of its possible role in the pathogenesis. The deleted region (7q31.1-7q31.2) of 7.2 Mb of genomic DNA also encompasses numerous genes, including FOXP2, associated with verbal dyspraxia, and the CFTR gene.

Identification of Cellular Proteins Required for Replication of Human Immunodeficiency Virus Type 1

PubMed Central

Dziuba, Natallia; Ferguson, Monique R.; O'Brien, William A.; Sanchez, Anthony; Prussia, Andrew J.; McDonald, Natalie J.; Friedrich, Brian M.; Li, Guangyu; Shaw, Michael W.; Sheng, Jinsong; Hodge, Thomas W.; Rubin, Donald H.

2012-01-01

Abstract Cellular proteins are essential for human immunodeficiency virus type 1 (HIV-1) replication and may serve as viable new targets for treating infection. Using gene trap insertional mutagenesis, a high-throughput approach based on random inactivation of cellular genes, candidate genes were found that limit virus replication when mutated. Disrupted genes (N=87) conferring resistance to lytic infection with several viruses were queried for an affect on HIV-1 replication by utilizing small interfering RNA (siRNA) screens in TZM-bl cells. Several genes regulating diverse pathways were found to be required for HIV-1 replication, including DHX8, DNAJA1, GTF2E1, GTF2E2, HAP1, KALRN, UBA3, UBE2E3, and VMP1. Candidate genes were independently tested in primary human macrophages, toxicity assays, and/or Tat-dependent β-galactosidase reporter assays. Bioinformatics analyses indicated that several host factors present in this study participate in canonical pathways and functional processes implicated in prior genome-wide studies. However, the genes presented in this study did not share identity with those found previously. Novel antiviral targets identified in this study should open new avenues for mechanistic investigation. PMID:22404213

Identification of cellular proteins required for replication of human immunodeficiency virus type 1.

PubMed

Dziuba, Natallia; Ferguson, Monique R; O'Brien, William A; Sanchez, Anthony; Prussia, Andrew J; McDonald, Natalie J; Friedrich, Brian M; Li, Guangyu; Shaw, Michael W; Sheng, Jinsong; Hodge, Thomas W; Rubin, Donald H; Murray, James L

2012-10-01

Cellular proteins are essential for human immunodeficiency virus type 1 (HIV-1) replication and may serve as viable new targets for treating infection. Using gene trap insertional mutagenesis, a high-throughput approach based on random inactivation of cellular genes, candidate genes were found that limit virus replication when mutated. Disrupted genes (N=87) conferring resistance to lytic infection with several viruses were queried for an affect on HIV-1 replication by utilizing small interfering RNA (siRNA) screens in TZM-bl cells. Several genes regulating diverse pathways were found to be required for HIV-1 replication, including DHX8, DNAJA1, GTF2E1, GTF2E2, HAP1, KALRN, UBA3, UBE2E3, and VMP1. Candidate genes were independently tested in primary human macrophages, toxicity assays, and/or Tat-dependent β-galactosidase reporter assays. Bioinformatics analyses indicated that several host factors present in this study participate in canonical pathways and functional processes implicated in prior genome-wide studies. However, the genes presented in this study did not share identity with those found previously. Novel antiviral targets identified in this study should open new avenues for mechanistic investigation.

Defining the role of the MADS-box gene, Zea agamous like1, in maize domestication

USDA-ARS?s Scientific Manuscript database

Genomic scans for genes that show the signature of past selection have been widely applied to a number of species and have identified a large number of selection candidate genes. In cultivated maize (Zea mays ssp. mays) selection scans have identified several hundred candidate domestication genes...

Deploying QTL-seq for rapid delineation of a potential candidate gene underlying major trait-associated QTL in chickpea

PubMed Central

Das, Shouvik; Upadhyaya, Hari D.; Bajaj, Deepak; Kujur, Alice; Badoni, Saurabh; Laxmi; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. Laxmipathi; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

2015-01-01

A rapid high-resolution genome-wide strategy for molecular mapping of major QTL(s)/gene(s) regulating important agronomic traits is vital for in-depth dissection of complex quantitative traits and genetic enhancement in chickpea. The present study for the first time employed a NGS-based whole-genome QTL-seq strategy to identify one major genomic region harbouring a robust 100-seed weight QTL using an intra-specific 221 chickpea mapping population (desi cv. ICC 7184 × desi cv. ICC 15061). The QTL-seq-derived major SW QTL (CaqSW1.1) was further validated by single-nucleotide polymorphism (SNP) and simple sequence repeat (SSR) marker-based traditional QTL mapping (47.6% R2 at higher LOD >19). This reflects the reliability and efficacy of QTL-seq as a strategy for rapid genome-wide scanning and fine mapping of major trait regulatory QTLs in chickpea. The use of QTL-seq and classical QTL mapping in combination narrowed down the 1.37 Mb (comprising 177 genes) major SW QTL (CaqSW1.1) region into a 35 kb genomic interval on desi chickpea chromosome 1 containing six genes. One coding SNP (G/A)-carrying constitutive photomorphogenic9 (COP9) signalosome complex subunit 8 (CSN8) gene of these exhibited seed-specific expression, including pronounced differential up-/down-regulation in low and high seed weight mapping parents and homozygous individuals during seed development. The coding SNP mined in this potential seed weight-governing candidate CSN8 gene was found to be present exclusively in all cultivated species/genotypes, but not in any wild species/genotypes of primary, secondary and tertiary gene pools. This indicates the effect of strong artificial and/or natural selection pressure on target SW locus during chickpea domestication. The proposed QTL-seq-driven integrated genome-wide strategy has potential to delineate major candidate gene(s) harbouring a robust trait regulatory QTL rapidly with optimal use of resources. This will further assist us to extrapolate the molecular mechanism underlying complex quantitative traits at a genome-wide scale leading to fast-paced marker-assisted genetic improvement in diverse crop plants, including chickpea. PMID:25922536

Genetic and Proteomic Interrogation of Lower Confidence Candidate Genes Reveals Signaling Networks in beta-Catenin-Active Cancers | Office of Cancer Genomics

Cancer.gov

Genome-scale expression studies and comprehensive loss-of-function genetic screens have focused almost exclusively on the highest confidence candidate genes. Here, we describe a strategy for characterizing the lower confidence candidates identified by such approaches.

Meta-analysis of shared genetic architecture across ten pediatric autoimmune diseases

PubMed Central

Li, Yun R; Li, Jin; Zhao, Sihai D; Bradfield, Jonathan P; Mentch, Frank D; Maggadottir, S Melkorka; Hou, Cuiping; Abrams, Debra J; Chang, Diana; Gao, Feng; Guo, Yiran; Wei, Zhi; Connolly, John J; Cardinale, Christopher J; Bakay, Marina; Glessner, Joseph T; Li, Dong; Kao, Charlly; Thomas, Kelly A; Qiu, Haijun; Chiavacci, Rosetta M; Kim, Cecilia E; Wang, Fengxiang; Snyder, James; Richie, Marylyn D; Flatø, Berit; Førre, Øystein; Denson, Lee A; Thompson, Susan D; Becker, Mara L; Guthery, Stephen L; Latiano, Anna; Perez, Elena; Resnick, Elena; Russell, Richard K; Wilson, David C; Silverberg, Mark S; Annese, Vito; Lie, Benedicte A; Punaro, Marilynn; Dubinsky, Marla C; Monos, Dimitri S; Strisciuglio, Caterina; Staiano, Annamaria; Miele, Erasmo; Kugathasan, Subra; Ellis, Justine A; Munro, Jane E; Sullivan, Kathleen E; Wise, Carol A; Chapel, Helen; Cunningham-Rundles, Charlotte; Grant, Struan F A; Orange, Jordan S; Sleiman, Patrick M A; Behrens, Edward M; Griffiths, Anne M; Satsangi, Jack; Finkel, Terri H; Keinan, Alon; Prak, Eline T Luning; Polychronakos, Constantin; Baldassano, Robert N; Li, Hongzhe; Keating, Brendan J; Hakonarson, Hakon

2016-01-01

Genome-wide association studies (GWASs) have identified hundreds of susceptibility genes, including shared associations across clinically distinct autoimmune diseases. We performed an inverse χ2 meta-analysis across ten pediatric-age-of-onset autoimmune diseases (pAIDs) in a case-control study including more than 6,035 cases and 10,718 shared population-based controls. We identified 27 genome-wide significant loci associated with one or more pAIDs, mapping to in silico–replicated autoimmune-associated genes (including IL2RA) and new candidate loci with established immunoregulatory functions such as ADGRL2, TENM3, ANKRD30A, ADCY7 and CD40LG. The pAID-associated single-nucleotide polymorphisms (SNPs) were functionally enriched for deoxyribonuclease (DNase)-hypersensitivity sites, expression quantitative trait loci (eQTLs), microRNA (miRNA)-binding sites and coding variants. We also identified biologically correlated, pAID-associated candidate gene sets on the basis of immune cell expression profiling and found evidence of genetic sharing. Network and protein-interaction analyses demonstrated converging roles for the signaling pathways of type 1, 2 and 17 helper T cells (TH1, TH2 and TH17), JAK-STAT, interferon and interleukin in multiple autoimmune diseases. PMID:26301688

A candidate gene study in low HDL-cholesterol families provides evidence for the involvement of the APOA2 gene and the APOA1C3A4 gene cluster.

PubMed

Lilja, Heidi E; Soro, Aino; Ylitalo, Kati; Nuotio, Ilpo; Viikari, Jorma S A; Salomaa, Veikko; Vartiainen, Erkki; Taskinen, Marja-Riitta; Peltonen, Leena; Pajukanta, Päivi

2002-09-01

In patients with premature coronary heart disease, the most common lipoprotein abnormality is high-density lipoprotein (HDL) deficiency. To assess the genetic background of the low HDL-cholesterol trait, we performed a candidate gene study in 25 families with low HDL, collected from the genetically isolated population of Finland. We studied 21 genes encoding essential proteins involved in the HDL metabolism by genotyping intragenic and flanking markers for these genes. We found suggestive evidence for linkage in two candidate regions: Marker D1S2844, in the apolipoprotein A-II (APOA2) region, yielded a LOD score of 2.14 and marker D11S939 flanking the apolipoprotein A-I/C-III/A-IV gene cluster (APOA1C3A4) produced a LOD score of 1.69. Interestingly, we identified potential shared haplotypes in these two regions in a subset of low HDL families. These families also contributed to the obtained positive LOD scores, whereas the rest of the families produced negative LOD scores. None of the remaining candidate regions provided any evidence for linkage. Since only a limited number of loci were tested in this candidate gene study, these LOD scores suggest significant involvement of the APOA2 gene and the APOA1C3A4 gene cluster, or loci in their immediate vicinity, in the pathogenesis of low HDL.

Combining mouse mammary gland gene expression and comparative mapping for the identification of candidate genes for QTL of milk production traits in cattle

PubMed Central

Ron, Micha; Israeli, Galit; Seroussi, Eyal; Weller, Joel I; Gregg, Jeffrey P; Shani, Moshe; Medrano, Juan F

2007-01-01

Background Many studies have found segregating quantitative trait loci (QTL) for milk production traits in different dairy cattle populations. However, even for relatively large effects with a saturated marker map the confidence interval for QTL location by linkage analysis spans tens of map units, or hundreds of genes. Combining mapping and arraying has been suggested as an approach to identify candidate genes. Thus, gene expression analysis in the mammary gland of genes positioned in the confidence interval of the QTL can bridge the gap between fine mapping and quantitative trait nucleotide (QTN) determination. Results We hybridized Affymetrix microarray (MG-U74v2), containing 12,488 murine probes, with RNA derived from mammary gland of virgin, pregnant, lactating and involuting C57BL/6J mice in a total of nine biological replicates. We combined microarray data from two additional studies that used the same design in mice with a total of 75 biological replicates. The same filtering and normalization was applied to each microarray data using GeneSpring software. Analysis of variance identified 249 differentially expressed probe sets common to the three experiments along the four developmental stages of puberty, pregnancy, lactation and involution. 212 genes were assigned to their bovine map positions through comparative mapping, and thus form a list of candidate genes for previously identified QTLs for milk production traits. A total of 82 of the genes showed mammary gland-specific expression with at least 3-fold expression over the median representing all tissues tested in GeneAtlas. Conclusion This work presents a web tool for candidate genes for QTL (cgQTL) that allows navigation between the map of bovine milk production QTL, potential candidate genes and their level of expression in mammary gland arrays and in GeneAtlas. Three out of four confirmed genes that affect QTL in livestock (ABCG2, DGAT1, GDF8, IGF2) were over expressed in the target organ. Thus, cgQTL can be used to determine priority of candidate genes for QTN analysis based on differential expression in the target organ. PMID:17584498

Digital transcriptome analysis of putative sex-determination genes in papaya (Carica papaya).

PubMed

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Y(h)) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Y(h) chromosome, implying a loss of many genes on the Y(h) chromosome. Nevertheless, candidate Y(h) chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya.

Digital Transcriptome Analysis of Putative Sex-Determination Genes in Papaya (Carica papaya)

PubMed Central

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Yh) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Yh chromosome, implying a loss of many genes on the Yh chromosome. Nevertheless, candidate Yh chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya. PMID:22815863

Pea Marker Database (PMD) - A new online database combining known pea (Pisum sativum L.) gene-based markers.

PubMed

Kulaeva, Olga A; Zhernakov, Aleksandr I; Afonin, Alexey M; Boikov, Sergei S; Sulima, Anton S; Tikhonovich, Igor A; Zhukov, Vladimir A

2017-01-01

Pea (Pisum sativum L.) is the oldest model object of plant genetics and one of the most agriculturally important legumes in the world. Since the pea genome has not been sequenced yet, identification of genes responsible for mutant phenotypes or desirable agricultural traits is usually performed via genetic mapping followed by candidate gene search. Such mapping is best carried out using gene-based molecular markers, as it opens the possibility for exploiting genome synteny between pea and its close relative Medicago truncatula Gaertn., possessing sequenced and annotated genome. In the last 5 years, a large number of pea gene-based molecular markers have been designed and mapped owing to the rapid evolution of "next-generation sequencing" technologies. However, the access to the complete set of markers designed worldwide is limited because the data are not uniformed and therefore hard to use. The Pea Marker Database was designed to combine the information about pea markers in a form of user-friendly and practical online tool. Version 1 (PMD1) comprises information about 2484 genic markers, including their locations in linkage groups, the sequences of corresponding pea transcripts and the names of related genes in M. truncatula. Version 2 (PMD2) is an updated version comprising 15944 pea markers in the same format with several advanced features. To test the performance of the PMD, fine mapping of pea symbiotic genes Sym13 and Sym27 in linkage groups VII and V, respectively, was carried out. The results of mapping allowed us to propose the Sen1 gene (a homologue of SEN1 gene of Lotus japonicus (Regel) K. Larsen) as the best candidate gene for Sym13, and to narrow the list of possible candidate genes for Sym27 to ten, thus proving PMD to be useful for pea gene mapping and cloning. All information contained in PMD1 and PMD2 is available at www.peamarker.arriam.ru.

Mutant prenyltransferase-like mitochondrial protein (PLMP) and mitochondrial abnormalities in kd/kd mice

PubMed Central

Peng, Min; Jarett, Leonard; Meade, Ray; Madaio, Michael P.; Hancock, Wayne W.; George, Alfred L.; Neilson, Eric G.; Gasser, David L.

2008-01-01

Background Mice that are homozygous for the kidney disease (kd) mutation are apparently healthy for the first 8 weeks of life, but spontaneously develop a severe form of interstitial nephritis that progresses to end-stage renal disease (ESRD) by 4 to 8 months of age. By testing for linkage to microsatellite markers, we previously localized the kd gene to a YAC/BAC contig. Methods The sequence of the entire critical region was examined, and candidate genes were identified. These candidate genes were sequenced in both mutant (kd/kd) mice and normal controls. The phenotype was further characterized by immunohistochemistry and electron microscopy. Transgenic mice were constructed that carried the wild-type allele of the prime candidate gene, and this transgene was transferred to a kd/kd background by breeding. Results We have obtained evidence that kd is a mutant allele of a novel gene for a prenyltransferase-like mitochondrial protein (PLMP). This gene is alternatively spliced, with the larger gene product having one domain that resembles transprenyltransferase and another that is similar to geranylgeranyl pyrophosphate synthase. The smaller gene product includes only the first domain. An antiserum to PLMP localizes to mitochondria, and ultrastructural defects are present in the mitochondria of renal tubular epithelial cells, and to a lesser extent, hepatocytes and heart cells from kd/kd mice. In a line of kd/kd mice that carried the wild-type PLMP allele as a transgene, only 1 out of 13 animals expressed the disease by 120 days of age. Conclusion The kd allele codes for a novel protein that localizes to the mitochondria, and the kd/kd mouse has dysmorphic mitochondria in the renal tubular epithelial cells. This mouse is therefore a unique animal model for studying mechanisms that lead to tubulointerstitial nephritis. PMID:15200409

Mapping a candidate gene (MdMYB10) for red flesh and foliage colour in apple

PubMed Central

Chagné, David; Carlisle, Charmaine M; Blond, Céline; Volz, Richard K; Whitworth, Claire J; Oraguzie, Nnadozie C; Crowhurst, Ross N; Allan, Andrew C; Espley, Richard V; Hellens, Roger P; Gardiner, Susan E

2007-01-01

Background Integrating plant genomics and classical breeding is a challenge for both plant breeders and molecular biologists. Marker-assisted selection (MAS) is a tool that can be used to accelerate the development of novel apple varieties such as cultivars that have fruit with anthocyanin through to the core. In addition, determining the inheritance of novel alleles, such as the one responsible for red flesh, adds to our understanding of allelic variation. Our goal was to map candidate anthocyanin biosynthetic and regulatory genes in a population segregating for the red flesh phenotypes. Results We have identified the Rni locus, a major genetic determinant of the red foliage and red colour in the core of apple fruit. In a population segregating for the red flesh and foliage phenotype we have determined the inheritance of the Rni locus and DNA polymorphisms of candidate anthocyanin biosynthetic and regulatory genes. Simple Sequence Repeats (SSRs) and Single Nucleotide Polymorphisms (SNPs) in the candidate genes were also located on an apple genetic map. We have shown that the MdMYB10 gene co-segregates with the Rni locus and is on Linkage Group (LG) 09 of the apple genome. Conclusion We have performed candidate gene mapping in a fruit tree crop and have provided genetic evidence that red colouration in the fruit core as well as red foliage are both controlled by a single locus named Rni. We have shown that the transcription factor MdMYB10 may be the gene underlying Rni as there were no recombinants between the marker for this gene and the red phenotype in a population of 516 individuals. Associating markers derived from candidate genes with a desirable phenotypic trait has demonstrated the application of genomic tools in a breeding programme of a horticultural crop species. PMID:17608951

Elevated transcription factor specificity protein 1 in autistic brains alters the expression of autism candidate genes.

PubMed

Thanseem, Ismail; Anitha, Ayyappan; Nakamura, Kazuhiko; Suda, Shiro; Iwata, Keiko; Matsuzaki, Hideo; Ohtsubo, Masafumi; Ueki, Takatoshi; Katayama, Taiichi; Iwata, Yasuhide; Suzuki, Katsuaki; Minoshima, Shinsei; Mori, Norio

2012-03-01

Profound changes in gene expression can result from abnormalities in the concentrations of sequence-specific transcription factors like specificity protein 1 (Sp1). Specificity protein 1 binding sites have been reported in the promoter regions of several genes implicated in autism. We hypothesize that dysfunction of Sp1 could affect the expression of multiple autism candidate genes, contributing to the heterogeneity of autism. We assessed any alterations in the expression of Sp1 and that of autism candidate genes in the postmortem brain (anterior cingulate gyrus [ACG], motor cortex, and thalamus) of autism patients (n = 8) compared with healthy control subjects (n = 13). Alterations in the expression of candidate genes upon Sp1/DNA binding inhibition with mithramycin and Sp1 silencing by RNAi were studied in SK-N-SH neuronal cells. We observed elevated expression of Sp1 in ACG of autism patients (p = .010). We also observed altered expression of several autism candidate genes. GABRB3, RELN, and HTR2A showed reduced expression, whereas CD38, ITGB3, MAOA, MECP2, OXTR, and PTEN showed elevated expression in autism. In SK-N-SH cells, OXTR, PTEN, and RELN showed reduced expression upon Sp1/DNA binding inhibition and Sp1 silencing. The RNA integrity number was not available for any of the samples. Transcription factor Sp1 is dysfunctional in the ACG of autistic brain. Consequently, the expression of potential autism candidate genes regulated by Sp1, especially OXTR and PTEN, could be affected. The diverse downstream pathways mediated by the Sp1-regulated genes, along with the environmental and intracellular signal-related regulation of Sp1, could explain the complex phenotypes associated with autism.

Genetic variation in RPS6KA1, RPS6KA2, RPS6KB1, RPS6KB2, and PDK1 and risk of colon or rectal cancer

PubMed Central

Slattery, Martha L.; Lundgreen, Abbie; Herrick, Jennifer S.; Wolff, Roger K.

2010-01-01

RPS6KA1, RPS6KA2, RPS6KB1, RPS6KB2, and PDK1 are involved in several pathways central to the carcinogenic process, including regulation of cell growth, insulin, and inflammation. We evaluated genetic variation in their candidate genes to obtain a better understanding of their association with colon and rectal cancer. We used data from two population-based case-control studies of colon (n=1574 cases, 1940 controls) and rectal (n=791 cases, 999 controls) cancer. We observed genetic variation in RPS6KA1, RPS6KA2, and PRS6KB2 were associated with risk of developing colon cancer while only genetic variation in RPS6KA2 was associated with altering risk of rectal cancer. These genes also interacted significantly with other genes operating in similar mechanisms, including Akt1, FRAP1, NFκB1, and PIK3CA. Assessment of tumor markers indicated that these genes and this pathway may importantly contributed to CIMP+ tumors and tumors with KRAS2 mutations. Our findings implicate these candidate genes in the etiology of colon and rectal cancer and provide information on how these genes operate with other genes in the pathway. Our data further suggest that this pathway may lead to CIMP+ and KRAS2-mutated tumors. PMID:21035469

Development of New Candidate Gene and EST-Based Molecular Markers for Gossypium Species

PubMed Central

Buyyarapu, Ramesh; Kantety, Ramesh V.; Yu, John Z.; Saha, Sukumar; Sharma, Govind C.

2011-01-01

New source of molecular markers accelerate the efforts in improving cotton fiber traits and aid in developing high-density integrated genetic maps. We developed new markers based on candidate genes and G. arboreum EST sequences that were used for polymorphism detection followed by genetic and physical mapping. Nineteen gene-based markers were surveyed for polymorphism detection in 26 Gossypium species. Cluster analysis generated a phylogenetic tree with four major sub-clusters for 23 species while three species branched out individually. CAP method enhanced the rate of polymorphism of candidate gene-based markers between G. hirsutum and G. barbadense. Two hundred A-genome based SSR markers were designed after datamining of G. arboreum EST sequences (Mississippi Gossypium arboreum   EST-SSR: MGAES). Over 70% of MGAES markers successfully produced amplicons while 65 of them demonstrated polymorphism between the parents of G. hirsutum and G. barbadense RIL population and formed 14 linkage groups. Chromosomal localization of both candidate gene-based and MGAES markers was assisted by euploid and hypoaneuploid CS-B analysis. Gene-based and MGAES markers were highly informative as they were designed from candidate genes and fiber transcriptome with a potential to be integrated into the existing cotton genetic and physical maps. PMID:22315588

Integrated multi-cohort transcriptional meta-analysis of neurodegenerative diseases.

PubMed

Li, Matthew D; Burns, Terry C; Morgan, Alexander A; Khatri, Purvesh

2014-09-04

Neurodegenerative diseases share common pathologic features including neuroinflammation, mitochondrial dysfunction and protein aggregation, suggesting common underlying mechanisms of neurodegeneration. We undertook a meta-analysis of public gene expression data for neurodegenerative diseases to identify a common transcriptional signature of neurodegeneration. Using 1,270 post-mortem central nervous system tissue samples from 13 patient cohorts covering four neurodegenerative diseases, we identified 243 differentially expressed genes, which were similarly dysregulated in 15 additional patient cohorts of 205 samples including seven neurodegenerative diseases. This gene signature correlated with histologic disease severity. Metallothioneins featured prominently among differentially expressed genes, and functional pathway analysis identified specific convergent themes of dysregulation. MetaCore network analyses revealed various novel candidate hub genes (e.g. STAU2). Genes associated with M1-polarized macrophages and reactive astrocytes were strongly enriched in the meta-analysis data. Evaluation of genes enriched in neurons revealed 70 down-regulated genes, over half not previously associated with neurodegeneration. Comparison with aging brain data (3 patient cohorts, 221 samples) revealed 53 of these to be unique to neurodegenerative disease, many of which are strong candidates to be important in neuropathogenesis (e.g. NDN, NAP1L2). ENCODE ChIP-seq analysis predicted common upstream transcriptional regulators not associated with normal aging (REST, RBBP5, SIN3A, SP2, YY1, ZNF143, IKZF1). Finally, we removed genes common to neurodegeneration from disease-specific gene signatures, revealing uniquely robust immune response and JAK-STAT signaling in amyotrophic lateral sclerosis. Our results implicate pervasive bioenergetic deficits, M1-type microglial activation and gliosis as unifying themes of neurodegeneration, and identify numerous novel genes associated with neurodegenerative processes.

Combined analysis of transcriptome and proteome data as a tool for the identification of candidate biomarkers in renal cell carcinoma

PubMed Central

Seliger, Barbara; Dressler, Sven P.; Wang, Ena; Kellner, Roland; Recktenwald, Christian V.; Lottspeich, Friedrich; Marincola, Francesco M.; Baumgärtner, Maja; Atkins, Derek; Lichtenfels, Rudolf

2012-01-01

Results obtained from expression profilings of renal cell carcinoma using different “ome”-based approaches and comprehensive data analysis demonstrated that proteome-based technologies and cDNA microarray analyses complement each other during the discovery phase for disease-related candidate biomarkers. The integration of the respective data revealed the uniqueness and complementarities of the different technologies. While comparative cDNA microarray analyses though restricted to upregulated targets largely revealed genes involved in controlling gene/protein expression (19%) and signal transduction processes (13%), proteomics/PROTEOMEX-defined candidate biomarkers include enzymes of the cellular metabolism (36%), transport proteins (12%) and cell motility/structural molecules (10%). Candidate biomarkers defined by proteomics and PROTEOMEX are frequently shared, whereas the sharing rate between cDNA microarray and proteome-based profilings is limited. Putative candidate biomarkers provide insights into their cellular (dys)function and their diagnostic/prognostic value but still warrant further validation in larger patient numbers. Based on the fact that merely 3 candidate biomarkers were shared by all applied technologies, namely annexin A4, tubulin alpha-1A chain and ubiquitin carboxyl-terminal hydrolase L1 the analysis at a single hierarchical level of biological regulation seems to provide only limited results thus emphasizing the importance and benefit of performing rather combinatorial screenings which can complement the standard clinical predictors. PMID:19235166

Status of Therapeutic Gene Transfer to Treat Cardiovascular Disease in Dogs and Cats.

PubMed

Sleeper, Meg M

2017-09-01

Gene therapy is a procedure resulting in the transfer of a gene into an individual's cells to treat a disease. One goal of gene transfer is to express a functional gene when the endogenous gene is inactive. However, because heart failure is a complex disease characterized by multiple abnormalities at the cellular level, an alternate gene delivery approach is to alter myocardial protein levels to improve function. This article discusses background information on gene delivery, including packaging, administration, and a brief discussion of some of the candidate transgenes likely to alter the progression of naturally occurring heart disease in dogs and cats. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of 12 new susceptibility loci for different histotypes of epithelial ovarian cancer.

PubMed

Phelan, Catherine M; Kuchenbaecker, Karoline B; Tyrer, Jonathan P; Kar, Siddhartha P; Lawrenson, Kate; Winham, Stacey J; Dennis, Joe; Pirie, Ailith; Riggan, Marjorie J; Chornokur, Ganna; Earp, Madalene A; Lyra, Paulo C; Lee, Janet M; Coetzee, Simon; Beesley, Jonathan; McGuffog, Lesley; Soucy, Penny; Dicks, Ed; Lee, Andrew; Barrowdale, Daniel; Lecarpentier, Julie; Leslie, Goska; Aalfs, Cora M; Aben, Katja K H; Adams, Marcia; Adlard, Julian; Andrulis, Irene L; Anton-Culver, Hoda; Antonenkova, Natalia; Aravantinos, Gerasimos; Arnold, Norbert; Arun, Banu K; Arver, Brita; Azzollini, Jacopo; Balmaña, Judith; Banerjee, Susana N; Barjhoux, Laure; Barkardottir, Rosa B; Bean, Yukie; Beckmann, Matthias W; Beeghly-Fadiel, Alicia; Benitez, Javier; Bermisheva, Marina; Bernardini, Marcus Q; Birrer, Michael J; Bjorge, Line; Black, Amanda; Blankstein, Kenneth; Blok, Marinus J; Bodelon, Clara; Bogdanova, Natalia; Bojesen, Anders; Bonanni, Bernardo; Borg, Åke; Bradbury, Angela R; Brenton, James D; Brewer, Carole; Brinton, Louise; Broberg, Per; Brooks-Wilson, Angela; Bruinsma, Fiona; Brunet, Joan; Buecher, Bruno; Butzow, Ralf; Buys, Saundra S; Caldes, Trinidad; Caligo, Maria A; Campbell, Ian; Cannioto, Rikki; Carney, Michael E; Cescon, Terence; Chan, Salina B; Chang-Claude, Jenny; Chanock, Stephen; Chen, Xiao Qing; Chiew, Yoke-Eng; Chiquette, Jocelyne; Chung, Wendy K; Claes, Kathleen B M; Conner, Thomas; Cook, Linda S; Cook, Jackie; Cramer, Daniel W; Cunningham, Julie M; D'Aloisio, Aimee A; Daly, Mary B; Damiola, Francesca; Damirovna, Sakaeva Dina; Dansonka-Mieszkowska, Agnieszka; Dao, Fanny; Davidson, Rosemarie; DeFazio, Anna; Delnatte, Capucine; Doheny, Kimberly F; Diez, Orland; Ding, Yuan Chun; Doherty, Jennifer Anne; Domchek, Susan M; Dorfling, Cecilia M; Dörk, Thilo; Dossus, Laure; Duran, Mercedes; Dürst, Matthias; Dworniczak, Bernd; Eccles, Diana; Edwards, Todd; Eeles, Ros; Eilber, Ursula; Ejlertsen, Bent; Ekici, Arif B; Ellis, Steve; Elvira, Mingajeva; Eng, Kevin H; Engel, Christoph; Evans, D Gareth; Fasching, Peter A; Ferguson, Sarah; Ferrer, Sandra Fert; Flanagan, James M; Fogarty, Zachary C; Fortner, Renée T; Fostira, Florentia; Foulkes, William D; Fountzilas, George; Fridley, Brooke L; Friebel, Tara M; Friedman, Eitan; Frost, Debra; Ganz, Patricia A; Garber, Judy; García, María J; Garcia-Barberan, Vanesa; Gehrig, Andrea; Gentry-Maharaj, Aleksandra; Gerdes, Anne-Marie; Giles, Graham G; Glasspool, Rosalind; Glendon, Gord; Godwin, Andrew K; Goldgar, David E; Goranova, Teodora; Gore, Martin; Greene, Mark H; Gronwald, Jacek; Gruber, Stephen; Hahnen, Eric; Haiman, Christopher A; Håkansson, Niclas; Hamann, Ute; Hansen, Thomas V O; Harrington, Patricia A; Harris, Holly R; Hauke, Jan; Hein, Alexander; Henderson, Alex; Hildebrandt, Michelle A T; Hillemanns, Peter; Hodgson, Shirley; Høgdall, Claus K; Høgdall, Estrid; Hogervorst, Frans B L; Holland, Helene; Hooning, Maartje J; Hosking, Karen; Huang, Ruea-Yea; Hulick, Peter J; Hung, Jillian; Hunter, David J; Huntsman, David G; Huzarski, Tomasz; Imyanitov, Evgeny N; Isaacs, Claudine; Iversen, Edwin S; Izatt, Louise; Izquierdo, Angel; Jakubowska, Anna; James, Paul; Janavicius, Ramunas; Jernetz, Mats; Jensen, Allan; Jensen, Uffe Birk; John, Esther M; Johnatty, Sharon; Jones, Michael E; Kannisto, Päivi; Karlan, Beth Y; Karnezis, Anthony; Kast, Karin; Kennedy, Catherine J; Khusnutdinova, Elza; Kiemeney, Lambertus A; Kiiski, Johanna I; Kim, Sung-Won; Kjaer, Susanne K; Köbel, Martin; Kopperud, Reidun K; Kruse, Torben A; Kupryjanczyk, Jolanta; Kwong, Ava; Laitman, Yael; Lambrechts, Diether; Larrañaga, Nerea; Larson, Melissa C; Lazaro, Conxi; Le, Nhu D; Le Marchand, Loic; Lee, Jong Won; Lele, Shashikant B; Leminen, Arto; Leroux, Dominique; Lester, Jenny; Lesueur, Fabienne; Levine, Douglas A; Liang, Dong; Liebrich, Clemens; Lilyquist, Jenna; Lipworth, Loren; Lissowska, Jolanta; Lu, Karen H; Lubinński, Jan; Luccarini, Craig; Lundvall, Lene; Mai, Phuong L; Mendoza-Fandiño, Gustavo; Manoukian, Siranoush; Massuger, Leon F A G; May, Taymaa; Mazoyer, Sylvie; McAlpine, Jessica N; McGuire, Valerie; McLaughlin, John R; McNeish, Iain; Meijers-Heijboer, Hanne; Meindl, Alfons; Menon, Usha; Mensenkamp, Arjen R; Merritt, Melissa A; Milne, Roger L; Mitchell, Gillian; Modugno, Francesmary; Moes-Sosnowska, Joanna; Moffitt, Melissa; Montagna, Marco; Moysich, Kirsten B; Mulligan, Anna Marie; Musinsky, Jacob; Nathanson, Katherine L; Nedergaard, Lotte; Ness, Roberta B; Neuhausen, Susan L; Nevanlinna, Heli; Niederacher, Dieter; Nussbaum, Robert L; Odunsi, Kunle; Olah, Edith; Olopade, Olufunmilayo I; Olsson, Håkan; Olswold, Curtis; O'Malley, David M; Ong, Kai-Ren; Onland-Moret, N Charlotte; Orr, Nicholas; Orsulic, Sandra; Osorio, Ana; Palli, Domenico; Papi, Laura; Park-Simon, Tjoung-Won; Paul, James; Pearce, Celeste L; Pedersen, Inge Søkilde; Peeters, Petra H M; Peissel, Bernard; Peixoto, Ana; Pejovic, Tanja; Pelttari, Liisa M; Permuth, Jennifer B; Peterlongo, Paolo; Pezzani, Lidia; Pfeiler, Georg; Phillips, Kelly-Anne; Piedmonte, Marion; Pike, Malcolm C; Piskorz, Anna M; Poblete, Samantha R; Pocza, Timea; Poole, Elizabeth M; Poppe, Bruce; Porteous, Mary E; Prieur, Fabienne; Prokofyeva, Darya; Pugh, Elizabeth; Pujana, Miquel Angel; Pujol, Pascal; Radice, Paolo; Rantala, Johanna; Rappaport-Fuerhauser, Christine; Rennert, Gad; Rhiem, Kerstin; Rice, Patricia; Richardson, Andrea; Robson, Mark; Rodriguez, Gustavo C; Rodríguez-Antona, Cristina; Romm, Jane; Rookus, Matti A; Rossing, Mary Anne; Rothstein, Joseph H; Rudolph, Anja; Runnebaum, Ingo B; Salvesen, Helga B; Sandler, Dale P; Schoemaker, Minouk J; Senter, Leigha; Setiawan, V Wendy; Severi, Gianluca; Sharma, Priyanka; Shelford, Tameka; Siddiqui, Nadeem; Side, Lucy E; Sieh, Weiva; Singer, Christian F; Sobol, Hagay; Song, Honglin; Southey, Melissa C; Spurdle, Amanda B; Stadler, Zsofia; Steinemann, Doris; Stoppa-Lyonnet, Dominique; Sucheston-Campbell, Lara E; Sukiennicki, Grzegorz; Sutphen, Rebecca; Sutter, Christian; Swerdlow, Anthony J; Szabo, Csilla I; Szafron, Lukasz; Tan, Yen Y; Taylor, Jack A; Tea, Muy-Kheng; Teixeira, Manuel R; Teo, Soo-Hwang; Terry, Kathryn L; Thompson, Pamela J; Thomsen, Liv Cecilie Vestrheim; Thull, Darcy L; Tihomirova, Laima; Tinker, Anna V; Tischkowitz, Marc; Tognazzo, Silvia; Toland, Amanda Ewart; Tone, Alicia; Trabert, Britton; Travis, Ruth C; Trichopoulou, Antonia; Tung, Nadine; Tworoger, Shelley S; van Altena, Anne M; Van Den Berg, David; van der Hout, Annemarie H; van der Luijt, Rob B; Van Heetvelde, Mattias; Van Nieuwenhuysen, Els; van Rensburg, Elizabeth J; Vanderstichele, Adriaan; Varon-Mateeva, Raymonda; Vega, Ana; Edwards, Digna Velez; Vergote, Ignace; Vierkant, Robert A; Vijai, Joseph; Vratimos, Athanassios; Walker, Lisa; Walsh, Christine; Wand, Dorothea; Wang-Gohrke, Shan; Wappenschmidt, Barbara; Webb, Penelope M; Weinberg, Clarice R; Weitzel, Jeffrey N; Wentzensen, Nicolas; Whittemore, Alice S; Wijnen, Juul T; Wilkens, Lynne R; Wolk, Alicja; Woo, Michelle; Wu, Xifeng; Wu, Anna H; Yang, Hannah; Yannoukakos, Drakoulis; Ziogas, Argyrios; Zorn, Kristin K; Narod, Steven A; Easton, Douglas F; Amos, Christopher I; Schildkraut, Joellen M; Ramus, Susan J; Ottini, Laura; Goodman, Marc T; Park, Sue K; Kelemen, Linda E; Risch, Harvey A; Thomassen, Mads; Offit, Kenneth; Simard, Jacques; Schmutzler, Rita Katharina; Hazelett, Dennis; Monteiro, Alvaro N; Couch, Fergus J; Berchuck, Andrew; Chenevix-Trench, Georgia; Goode, Ellen L; Sellers, Thomas A; Gayther, Simon A; Antoniou, Antonis C; Pharoah, Paul D P

2017-05-01

To identify common alleles associated with different histotypes of epithelial ovarian cancer (EOC), we pooled data from multiple genome-wide genotyping projects totaling 25,509 EOC cases and 40,941 controls. We identified nine new susceptibility loci for different EOC histotypes: six for serous EOC histotypes (3q28, 4q32.3, 8q21.11, 10q24.33, 18q11.2 and 22q12.1), two for mucinous EOC (3q22.3 and 9q31.1) and one for endometrioid EOC (5q12.3). We then performed meta-analysis on the results for high-grade serous ovarian cancer with the results from analysis of 31,448 BRCA1 and BRCA2 mutation carriers, including 3,887 mutation carriers with EOC. This identified three additional susceptibility loci at 2q13, 8q24.1 and 12q24.31. Integrated analyses of genes and regulatory biofeatures at each locus predicted candidate susceptibility genes, including OBFC1, a new candidate susceptibility gene for low-grade and borderline serous EOC.

Identification of Candidate Genes Responsible for Stem Pith Production Using Expression Analysis in Solid-Stemmed Wheat.

PubMed

Oiestad, A J; Martin, J M; Cook, J; Varella, A C; Giroux, M J

2017-07-01

The wheat stem sawfly (WSS) is an economically important pest of wheat in the Northern Great Plains. The primary means of WSS control is resistance associated with the single quantitative trait locus (QTL) , which controls most stem solidness variation. The goal of this study was to identify stem solidness candidate genes via RNA-seq. This study made use of 28 single nucleotide polymorphism (SNP) makers derived from expressed sequence tags (ESTs) linked to contained within a 5.13 cM region. Allele specific expression of EST markers was examined in stem tissue for solid and hollow-stemmed pairs of two spring wheat near isogenic lines (NILs) differing for the QTL. Of the 28 ESTs, 13 were located within annotated genes and 10 had detectable stem expression. Annotated genes corresponding to four of the ESTs were differentially expressed between solid and hollow-stemmed NILs and represent possible stem solidness gene candidates. Further examination of the 5.13 cM region containing the 28 EST markers identified 260 annotated genes. Twenty of the 260 linked genes were up-regulated in hollow NIL stems, while only seven genes were up-regulated in solid NIL stems. An -methyltransferase within the region of interest was identified as a candidate based on differential expression between solid and hollow-stemmed NILs and putative function. Further study of these candidate genes may lead to the identification of the gene(s) controlling stem solidness and an increased ability to select for wheat stem solidness and manage WSS. Copyright © 2017 Crop Science Society of America.

confFuse: High-Confidence Fusion Gene Detection across Tumor Entities.

PubMed

Huang, Zhiqin; Jones, David T W; Wu, Yonghe; Lichter, Peter; Zapatka, Marc

2017-01-01

Background: Fusion genes play an important role in the tumorigenesis of many cancers. Next-generation sequencing (NGS) technologies have been successfully applied in fusion gene detection for the last several years, and a number of NGS-based tools have been developed for identifying fusion genes during this period. Most fusion gene detection tools based on RNA-seq data report a large number of candidates (mostly false positives), making it hard to prioritize candidates for experimental validation and further analysis. Selection of reliable fusion genes for downstream analysis becomes very important in cancer research. We therefore developed confFuse, a scoring algorithm to reliably select high-confidence fusion genes which are likely to be biologically relevant. Results: confFuse takes multiple parameters into account in order to assign each fusion candidate a confidence score, of which score ≥8 indicates high-confidence fusion gene predictions. These parameters were manually curated based on our experience and on certain structural motifs of fusion genes. Compared with alternative tools, based on 96 published RNA-seq samples from different tumor entities, our method can significantly reduce the number of fusion candidates (301 high-confidence from 8,083 total predicted fusion genes) and keep high detection accuracy (recovery rate 85.7%). Validation of 18 novel, high-confidence fusions detected in three breast tumor samples resulted in a 100% validation rate. Conclusions: confFuse is a novel downstream filtering method that allows selection of highly reliable fusion gene candidates for further downstream analysis and experimental validations. confFuse is available at https://github.com/Zhiqin-HUANG/confFuse.

Molecular cloning and characterization of a cytochrome P450 taxoid 9á-hydroxylase in Ginkgo biloba cells.

PubMed

Zhang, Nan; Han, Zhentai; Sun, Guiling; Hoffman, Angela; Wilson, Iain W; Yang, Yanfang; Gao, Qian; Wu, Jianqiang; Xie, Dan; Dai, Jungui; Qiu, Deyou

2014-01-17

Taxol is a well-known effective anticancer compound. Due to the inability to synthesize sufficient quantities of taxol to satisfy commercial demand, a biotechnological approach for a large-scale cell or cell-free system for its production is highly desirable. Several important genes in taxol biosynthesis are currently still unknown and have been shown to be difficult to isolate directly from Taxus, including the gene encoding taxoid 9α-hydroxylase. Ginkgo biloba suspension cells exhibit taxoid hydroxylation activity and provides an alternate means of identifying genes encoding enzymes with taxoid 9α-hydroxylation activity. Through analysis of high throughput RNA sequencing data from G. biloba, we identified two candidate genes with high similarity to Taxus CYP450s. Using in vitro cell-free protein synthesis assays and LC-MS analysis, we show that one candidate that belongs to the CYP716B, a subfamily whose biochemical functions have not been previously studied, possessed 9α-hydroxylation activity. This work will aid future identification of the taxoid 9α-hydroxylase gene from Taxus sp. Copyright © 2013 Elsevier Inc. All rights reserved.

Comparative analysis of protein interactome networks prioritizes candidate genes with cancer signatures.

PubMed

Li, Yongsheng; Sahni, Nidhi; Yi, Song

2016-11-29

Comprehensive understanding of human cancer mechanisms requires the identification of a thorough list of cancer-associated genes, which could serve as biomarkers for diagnoses and therapies in various types of cancer. Although substantial progress has been made in functional studies to uncover genes involved in cancer, these efforts are often time-consuming and costly. Therefore, it remains challenging to comprehensively identify cancer candidate genes. Network-based methods have accelerated this process through the analysis of complex molecular interactions in the cell. However, the extent to which various interactome networks can contribute to prediction of candidate genes responsible for cancer is still enigmatic. In this study, we evaluated different human protein-protein interactome networks and compared their application to cancer gene prioritization. Our results indicate that network analyses can increase the power to identify novel cancer genes. In particular, such predictive power can be enhanced with the use of unbiased systematic protein interaction maps for cancer gene prioritization. Functional analysis reveals that the top ranked genes from network predictions co-occur often with cancer-related terms in literature, and further, these candidate genes are indeed frequently mutated across cancers. Finally, our study suggests that integrating interactome networks with other omics datasets could provide novel insights into cancer-associated genes and underlying molecular mechanisms.

The role of human and mouse Y chromosome genes in male infertility.

PubMed

Affara, N A; Mitchell, M J

2000-11-01

It was suggested by Ronald Fisher in 1931 that genes involved in benefit to the male (including spermatogenesis genes) would accumulate on the Y chromosome. The analysis of mouse Y chromosome deletions and the discovery of microdeletions of the human Y chromosome associated with diverse defective spermatogenic phenotypes has revealed the presence of intervals containing one or more genes controlling male germ cell differentiation. These intervals have been mapped, cloned and examined in detail for functional genes. This review discusses the genes mapping to critical spermatogenesis intervals and the evidence indicating which are the most likely candidates underlying Y-linked male infertility.

Next generation sequencing identifies abnormal Y chromosome and candidate causal variants in premature ovarian failure patients.

PubMed

Lee, Yujung; Kim, Changshin; Park, YoungJoon; Pyun, Jung-A; Kwack, KyuBum

2016-12-01

Premature ovarian failure (POF) is characterized by heterogeneous genetic causes such as chromosomal abnormalities and variants in causal genes. Recently, development of techniques made next generation sequencing (NGS) possible to detect genome wide variants including chromosomal abnormalities. Among 37 Korean POF patients, XY karyotype with distal part deletions of Y chromosome, Yp11.32-31 and Yp12 end part, was observed in two patients through NGS. Six deleterious variants in POF genes were also detected which might explain the pathogenesis of POF with abnormalities in the sex chromosomes. Additionally, the two POF patients had no mutation in SRY but three non-synonymous variants were detected in genes regarding sex reversal. These findings suggest candidate causes of POF and sex reversal and show the propriety of NGS to approach the heterogeneous pathogenesis of POF. Copyright © 2016 Elsevier Inc. All rights reserved.

Fourteen-Genome Comparison Identifies DNA Markers for Severe-Disease-Associated Strains of Clostridium difficile▿†

PubMed Central

Forgetta, Vincenzo; Oughton, Matthew T.; Marquis, Pascale; Brukner, Ivan; Blanchette, Ruth; Haub, Kevin; Magrini, Vince; Mardis, Elaine R.; Gerding, Dale N.; Loo, Vivian G.; Miller, Mark A.; Mulvey, Michael R.; Rupnik, Maja; Dascal, Andre; Dewar, Ken

2011-01-01

Clostridium difficile is a common cause of infectious diarrhea in hospitalized patients. A severe and increased incidence of C. difficile infection (CDI) is associated predominantly with the NAP1 strain; however, the existence of other severe-disease-associated (SDA) strains and the extensive genetic diversity across C. difficile complicate reliable detection and diagnosis. Comparative genome analysis of 14 sequenced genomes, including those of a subset of NAP1 isolates, allowed the assessment of genetic diversity within and between strain types to identify DNA markers that are associated with severe disease. Comparative genome analysis of 14 isolates, including five publicly available strains, revealed that C. difficile has a core genome of 3.4 Mb, comprising ∼3,000 genes. Analysis of the core genome identified candidate DNA markers that were subsequently evaluated using a multistrain panel of 177 isolates, representing more than 50 pulsovars and 8 toxinotypes. A subset of 117 isolates from the panel had associated patient data that allowed assessment of an association between the DNA markers and severe CDI. We identified 20 candidate DNA markers for species-wide detection and 10,683 single nucleotide polymorphisms (SNPs) associated with the predominant SDA strain (NAP1). A species-wide detection candidate marker, the sspA gene, was found to be the same across 177 sequenced isolates and lacked significant similarity to those of other species. Candidate SNPs in genes CD1269 and CD1265 were found to associate more closely with disease severity than currently used diagnostic markers, as they were also present in the toxin A-negative and B-positive (A-B+) strain types. The genetic markers identified illustrate the potential of comparative genomics for the discovery of diagnostic DNA-based targets that are species specific or associated with multiple SDA strains. PMID:21508155

Genome Wide Methylome Alterations in Lung Cancer.

PubMed

Mullapudi, Nandita; Ye, Bin; Suzuki, Masako; Fazzari, Melissa; Han, Weiguo; Shi, Miao K; Marquardt, Gaby; Lin, Juan; Wang, Tao; Keller, Steven; Zhu, Changcheng; Locker, Joseph D; Spivack, Simon D

2015-01-01

Aberrant cytosine 5-methylation underlies many deregulated elements of cancer. Among paired non-small cell lung cancers (NSCLC), we sought to profile DNA 5-methyl-cytosine features which may underlie genome-wide deregulation. In one of the more dense interrogations of the methylome, we sampled 1.2 million CpG sites from twenty-four NSCLC tumor (T)-non-tumor (NT) pairs using a methylation-sensitive restriction enzyme- based HELP-microarray assay. We found 225,350 differentially methylated (DM) sites in adenocarcinomas versus adjacent non-tumor tissue that vary in frequency across genomic compartment, particularly notable in gene bodies (GB; p<2.2E-16). Further, when DM was coupled to differential transcriptome (DE) in the same samples, 37,056 differential loci in adenocarcinoma emerged. Approximately 90% of the DM-DE relationships were non-canonical; for example, promoter DM associated with DE in the same direction. Of the canonical changes noted, promoter (PR) DM loci with reciprocal changes in expression in adenocarcinomas included HBEGF, AGER, PTPRM, DPT, CST1, MELK; DM GB loci with concordant changes in expression included FOXM1, FERMT1, SLC7A5, and FAP genes. IPA analyses showed adenocarcinoma-specific promoter DMxDE overlay identified familiar lung cancer nodes [tP53, Akt] as well as less familiar nodes [HBEGF, NQO1, GRK5, VWF, HPGD, CDH5, CTNNAL1, PTPN13, DACH1, SMAD6, LAMA3, AR]. The unique findings from this study include the discovery of numerous candidate The unique findings from this study include the discovery of numerous candidate methylation sites in both PR and GB regions not previously identified in NSCLC, and many non-canonical relationships to gene expression. These DNA methylation features could potentially be developed as risk or diagnostic biomarkers, or as candidate targets for newer methylation locus-targeted preventive or therapeutic agents.

Survey of candidate genes for maize resistance to infection by Aspergillus flavus and/or aflatoxin contamination

Treesearch

Leigh Hawkins; Marilyn Warburton; Juliet Tang; John Tomashek; Dafne Alves Oliveira; Oluwaseun Ogunola; J. Smith; W. Williams

2018-01-01

Many projects have identified candidate genes for resistance to aflatoxin accumulation or Aspergillus flavus infection and growth in maize using genetic mapping, genomics, transcriptomics and/or proteomics studies. However, only a small percentage of these candidates have been validated in field conditions, and their relative contribution to...

Molecular Signatures of Chronic Pain Subtypes

DTIC Science & Technology

2013-01-01

on August 4, 2011. Our project coordinator was in touch with Ms. Lesnow on December 21. We were asked to provide a breakdown of costs for the...49]. A few candidate gene polymorphisms have been linked to pain susceptibility, including catechol-O-methyltranferase ( COMT ). This gene modulates...nociceptive and inflammatory pain and has been linked to temporomandibular joint pain syndromes [50]. Even studies of COMT , however, have demonstrated

A comparative analysis of genetic diversity of candidate genes associated with type 2 diabetes in worldwide populations.

PubMed

Gong, Xian; Zhang, Chao; Yiliyasi·Aisa, Yiliyasi·Aisa; Shi, Ying; Yang, Xue-wei; NuersimanguliAosiman, NuersimanguliAosiman; Guan, Ya-qun; Xu, Shu-hua

2016-06-20

Over the last decade, a larger number of type 2 diabetes mellitus (T2DM) susceptible candidate genes have been reported by numerous genome-wide association studies (GWAS). Understanding the genetic diversity of these candidate genes among worldwide populations not only facilitates to elucidating the genetic mechanism of T2DM, but also provides guidance to further studies of pathogenesis of T2DM in any certain population. In this study, we identified 170 genes or genomic regions associated with T2DM by searching the GWAS databases and related literatures. We next analyzed the genetic diversity of these genes (or genomic regions) among present-day human populations by curetting the 1000 Genomes Projects phase1 dataset covering 14 worldwide populations. We further compared the characteristics of T2DM genes in different populations. No significant differences of genetic diversity were observed among the 14 worldwide populations between the T2DM candidate genes and the non-T2DM genes in terms of overall pattern. However, we observed some genes, such as IL20RA, RNMTL1-NXN, NOTCH2, ADRA2A-BTBD7P2, TBC1D4, RBM38-HMGB1P1, UBE2E2, and PPARD, show considerable differentiation between populations. In particular, IL20RA (FST=0.1521) displays the greatest population difference which is mainly contributed by that between Africans and non-Africans. Moreover, we revealed genetic differences between East Asians and Europeans on some candidate genes such as DGKB-AGMO (FST=0.173) and JAZF1 (FST=0.182). Our results indicate that some T2DM susceptible candidate genes harbor highly-differentiated variants between populations. These analyses, despite preliminary, should advance our understanding of the population difference of susceptibility to T2DM and provide insightful reference that future studies can relay on.

Heat shock alters the expression of schizophrenia and autism candidate genes in an induced pluripotent stem cell model of the human telencephalon.

PubMed

Lin, Mingyan; Zhao, Dejian; Hrabovsky, Anastasia; Pedrosa, Erika; Zheng, Deyou; Lachman, Herbert M

2014-01-01

Schizophrenia (SZ) and autism spectrum disorders (ASD) are highly heritable neuropsychiatric disorders, although environmental factors, such as maternal immune activation (MIA), play a role as well. Cytokines mediate the effects of MIA on neurogenesis and behavior in animal models. However, MIA stimulators can also induce a febrile reaction, which could have independent effects on neurogenesis through heat shock (HS)-regulated cellular stress pathways. However, this has not been well-studied. To help understand the role of fever in MIA, we used a recently described model of human brain development in which induced pluripotent stem cells (iPSCs) differentiate into 3-dimensional neuronal aggregates that resemble a first trimester telencephalon. RNA-seq was carried out on aggregates that were heat shocked at 39°C for 24 hours, along with their control partners maintained at 37°C. 186 genes showed significant differences in expression following HS (p<0.05), including known HS-inducible genes, as expected, as well as those coding for NGFR and a number of SZ and ASD candidates, including SMARCA2, DPP10, ARNT2, AHI1 and ZNF804A. The degree to which the expression of these genes decrease or increase during HS is similar to that found in copy loss and copy gain copy number variants (CNVs), although the effects of HS are likely to be transient. The dramatic effect on the expression of some SZ and ASD genes places HS, and perhaps other cellular stressors, into a common conceptual framework with disease-causing genetic variants. The findings also suggest that some candidate genes that are assumed to have a relatively limited impact on SZ and ASD pathogenesis based on a small number of positive genetic findings, such as SMARCA2 and ARNT2, may in fact have a much more substantial role in these disorders - as targets of common environmental stressors.

Characterization of the Gray Whale Eschrichtius robustus Genome and a Genotyping Array Based on Single-Nucleotide Polymorphisms in Candidate Genes.

PubMed

DeWoody, J Andrew; Fernandez, Nadia B; Brüniche-Olsen, Anna; Antonides, Jennifer D; Doyle, Jacqueline M; San Miguel, Phillip; Westerman, Rick; Vertyankin, Vladimir V; Godard-Codding, Céline A J; Bickham, John W

2017-06-01

Genetic and genomic approaches have much to offer in terms of ecology, evolution, and conservation. To better understand the biology of the gray whale Eschrichtius robustus (Lilljeborg, 1861), we sequenced the genome and produced an assembly that contains ∼95% of the genes known to be highly conserved among eukaryotes. From this assembly, we annotated 22,711 genes and identified 2,057,254 single-nucleotide polymorphisms (SNPs). Using this assembly, we generated a curated list of candidate genes potentially subject to strong natural selection, including genes associated with osmoregulation, oxygen binding and delivery, and other aspects of marine life. From these candidate genes, we queried 92 autosomal protein-coding markers with a panel of 96 SNPs that also included 2 sexing and 2 mitochondrial markers. Genotyping error rates, calculated across loci and across 69 intentional replicate samples, were low (0.021%), and observed heterozygosity was 0.33 averaged over all autosomal markers. This level of variability provides substantial discriminatory power across loci (mean probability of identity of 1.6 × 10 -25 and mean probability of exclusion >0.999 with neither parent known), indicating that these markers provide a powerful means to assess parentage and relatedness in gray whales. We found 29 unique multilocus genotypes represented among our 36 biopsies (indicating that we inadvertently sampled 7 whales twice). In total, we compiled an individual data set of 28 western gray whales (WGSs) and 1 presumptive eastern gray whale (EGW). The lone EGW we sampled was no more or less related to the WGWs than expected by chance alone. The gray whale genomes reported here will enable comparative studies of natural selection in cetaceans, and the SNP markers should be highly informative for future studies of gray whale evolution, population structure, demography, and relatedness.

Frequent epigenetic inactivation of chromosome 3p candidate tumor suppressor genes in gallbladder carcinoma.

PubMed

Riquelme, Erick; Tang, Moying; Baez, Sergio; Diaz, Alfonso; Pruyas, Martha; Wistuba, Ignacio I; Corvalan, Alejandro

2007-05-18

Gallbladder carcinoma (GBC) is a highly malignant neoplasm that represents the leading cause of death for cancer in Chilean females. There is limited information about the molecular abnormalities involved in its pathogenesis. We have identified a number of molecular changes in GBC, including frequent allelic losses at chromosome 3p regions. Four distinct 3p sites (3p12, 3p14.2, 3p21.3 and 3p22-24) with frequent and early allelic losses in the sequential pathogenesis of this neoplasm have been detected. We investigated epigenetic and genetic abnormalities in GBC affecting 6 candidate tumor suppressor genes (TSG) located in chromosome 3p, including DUTT1 (3p12), FHIT (3p14.2), BLU, RASSF1A, SEMA3B and hMLH1 (3p21.3). DNA extracted from frozen tissue obtained from 50 surgical resected GBCs was examined for gene promoter methylation using MSP (methylation-specific PCR) technique after bisulfite treatment in all 6 genes. In addition, we performed PCR-based mutation examination using SSCP in FHIT and RASSF1A genes and loss of heterozygosity (LOH) analysis using microdissected tissue in a subset of tumors for the 3p21.3 region with 8 microsatellite markers. A very high frequency of GBC methylation was detected in SEMA3B (46/50, 92%) and FHIT (33/50, 66%), intermediate incidences in BLU (13/50, 26%) and DUTT1 (11/50, 22%) and very low frequencies in RASSF1A (4/50, 8%) and hMLH1 (2/50, 4%). Allelic loss at 3p21.3 was found in nearly half of the GBCs examined. We conclude that epigenetic inactivation by abnormal promoter methylation is a frequent event in chromosome 3p candidate TSGs in GBC pathogenesis, especially affecting genes SEMA3B (3p21.3) and FHIT (3p14.2).

Editor's Highlight: Genetic Targets of Acute Toluene Inhalation in Drosophila melanogaster.

PubMed

Bushnell, Philip J; Ward, William O; Morozova, Tatiana V; Oshiro, Wendy M; Lin, Mimi T; Judson, Richard S; Hester, Susan D; McKee, John M; Higuchi, Mark

2017-03-01

Interpretation and use of data from high-throughput assays for chemical toxicity require links between effects at molecular targets and adverse outcomes in whole animals. The well-characterized genome of Drosophila melanogaster provides a potential model system by which phenotypic responses to chemicals can be mapped to genes associated with those responses, which may in turn suggest adverse outcome pathways associated with those genes. To determine the utility of this approach, we used the Drosophila Genetics Reference Panel (DGRP), a collection of ∼200 homozygous lines of fruit flies whose genomes have been sequenced. We quantified toluene-induced suppression of motor activity in 123 lines of these flies during exposure to toluene, a volatile organic compound known to induce narcosis in mammals via its effects on neuronal ion channels. We then applied genome-wide association analyses on this effect of toluene using the DGRP web portal (http://dgrp2.gnets.ncsu.edu), which identified polymorphisms in candidate genes associated with the variation in response to toluene exposure. We tested ∼2 million variants and found 82 polymorphisms located in or near 66 candidate genes that were associated with phenotypic variation for sensitivity to toluene at P < 5 × 10-5, and human orthologs for 52 of these candidate Drosophila genes. None of these orthologs are known to be involved in canonical pathways for mammalian neuronal ion channels, including GABA, glutamate, dopamine, glycine, serotonin, and voltage sensitive calcium channels. Thus this analysis did not reveal a genetic signature consistent with processes previously shown to be involved in toluene-induced narcosis in mammals. The list of the human orthologs included Gene Ontology terms associated with signaling, nervous system development and embryonic morphogenesis; these orthologs may provide insight into potential new pathways that could mediate the narcotic effects of toluene. Published by Oxford University Press on behalf of the Society of Toxicology 2016. This work is written by US Government employees and is in the public domain in the US.

Changing the Game: Using Integrative Genomics to Probe Virulence Mechanisms of the Stem Rust Pathogen Puccinia graminis f. sp. tritici.

PubMed

Figueroa, Melania; Upadhyaya, Narayana M; Sperschneider, Jana; Park, Robert F; Szabo, Les J; Steffenson, Brian; Ellis, Jeff G; Dodds, Peter N

2016-01-01

The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort toward controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr) genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr) proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Toward this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens, including the related flax rust fungus. Upregulation of gene expression in haustoria and evidence for diversifying selection are two useful parameters to identify candidate Avr genes. Recently, we have also applied machine learning approaches to agnostically predict candidate effectors. Here, we review progress in stem rust pathogenomics and approaches currently underway to identify Avr genes recognized by wheat Sr genes.

Next-generation sequencing for identification of candidate genes for Fusarium wilt and sterility mosaic disease in pigeonpea (Cajanus cajan).

PubMed

Singh, Vikas K; Khan, Aamir W; Saxena, Rachit K; Kumar, Vinay; Kale, Sandip M; Sinha, Pallavi; Chitikineni, Annapurna; Pazhamala, Lekha T; Garg, Vanika; Sharma, Mamta; Sameer Kumar, Chanda Venkata; Parupalli, Swathi; Vechalapu, Suryanarayana; Patil, Suyash; Muniswamy, Sonnappa; Ghanta, Anuradha; Yamini, Kalinati Narasimhan; Dharmaraj, Pallavi Subbanna; Varshney, Rajeev K

2016-05-01

To map resistance genes for Fusarium wilt (FW) and sterility mosaic disease (SMD) in pigeonpea, sequencing-based bulked segregant analysis (Seq-BSA) was used. Resistant (R) and susceptible (S) bulks from the extreme recombinant inbred lines of ICPL 20096 × ICPL 332 were sequenced. Subsequently, SNP index was calculated between R- and S-bulks with the help of draft genome sequence and reference-guided assembly of ICPL 20096 (resistant parent). Seq-BSA has provided seven candidate SNPs for FW and SMD resistance in pigeonpea. In parallel, four additional genotypes were re-sequenced and their combined analysis with R- and S-bulks has provided a total of 8362 nonsynonymous (ns) SNPs. Of 8362 nsSNPs, 60 were found within the 2-Mb flanking regions of seven candidate SNPs identified through Seq-BSA. Haplotype analysis narrowed down to eight nsSNPs in seven genes. These eight nsSNPs were further validated by re-sequencing 11 genotypes that are resistant and susceptible to FW and SMD. This analysis revealed association of four candidate nsSNPs in four genes with FW resistance and four candidate nsSNPs in three genes with SMD resistance. Further, In silico protein analysis and expression profiling identified two most promising candidate genes namely C.cajan_01839 for SMD resistance and C.cajan_03203 for FW resistance. Identified candidate genomic regions/SNPs will be useful for genomics-assisted breeding in pigeonpea. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

A Novel Strategy for Selection and Validation of Reference Genes in Dynamic Multidimensional Experimental Design in Yeast

PubMed Central

Cankorur-Cetinkaya, Ayca; Dereli, Elif; Eraslan, Serpil; Karabekmez, Erkan; Dikicioglu, Duygu; Kirdar, Betul

2012-01-01

Background Understanding the dynamic mechanism behind the transcriptional organization of genes in response to varying environmental conditions requires time-dependent data. The dynamic transcriptional response obtained by real-time RT-qPCR experiments could only be correctly interpreted if suitable reference genes are used in the analysis. The lack of available studies on the identification of candidate reference genes in dynamic gene expression studies necessitates the identification and the verification of a suitable gene set for the analysis of transient gene expression response. Principal Findings In this study, a candidate reference gene set for RT-qPCR analysis of dynamic transcriptional changes in Saccharomyces cerevisiae was determined using 31 different publicly available time series transcriptome datasets. Ten of the twelve candidates (TPI1, FBA1, CCW12, CDC19, ADH1, PGK1, GCN4, PDC1, RPS26A and ARF1) we identified were not previously reported as potential reference genes. Our method also identified the commonly used reference genes ACT1 and TDH3. The most stable reference genes from this pool were determined as TPI1, FBA1, CDC19 and ACT1 in response to a perturbation in the amount of available glucose and as FBA1, TDH3, CCW12 and ACT1 in response to a perturbation in the amount of available ammonium. The use of these newly proposed gene sets outperformed the use of common reference genes in the determination of dynamic transcriptional response of the target genes, HAP4 and MEP2, in response to relaxation from glucose and ammonium limitations, respectively. Conclusions A candidate reference gene set to be used in dynamic real-time RT-qPCR expression profiling in yeast was proposed for the first time in the present study. Suitable pools of stable reference genes to be used under different experimental conditions could be selected from this candidate set in order to successfully determine the expression profiles for the genes of interest. PMID:22675547

Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction

PubMed Central

Barbero, Marina M. D.; Oliveira, Henrique N.; de Camargo, Gregório M. F.; Fernandes Júnior, Gerardo A.; Aspilcueta-Borquis, Rusbel R.; Souza, Fabio R. P.; Boligon, Arione A.; Melo, Thaise P.; Regatieri, Inaê C.; Feitosa, Fabieli L. B.; Fonseca, Larissa F. S.; Magalhães, Ana F. B.; Costa, Raphael B.; Albuquerque, Lucia G.

2018-01-01

Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs. PMID:29293544

Cross-talk of the biotrophic pathogen Claviceps purpurea and its host Secale cereale.

PubMed

Oeser, Birgitt; Kind, Sabine; Schurack, Selma; Schmutzer, Thomas; Tudzynski, Paul; Hinsch, Janine

2017-04-04

The economically important Ergot fungus Claviceps purpurea is an interesting biotrophic model system because of its strict organ specificity (grass ovaries) and the lack of any detectable plant defense reactions. Though several virulence factors were identified, the exact infection mechanisms are unknown, e.g. how the fungus masks its attack and if the host detects the infection at all. We present a first dual transcriptome analysis using an RNA-Seq approach. We studied both, fungal and plant gene expression in young ovaries infected by the wild-type and two virulence-attenuated mutants. We can show that the plant recognizes the fungus, since defense related genes are upregulated, especially several phytohormone genes. We present a survey of in planta expressed fungal genes, among them several confirmed virulence genes. Interestingly, the set of most highly expressed genes includes a high proportion of genes encoding putative effectors, small secreted proteins which might be involved in masking the fungal attack or interfering with host defense reactions. As known from several other phytopathogens, the C. purpurea genome contains more than 400 of such genes, many of them clustered and probably highly redundant. Since the lack of effective defense reactions in spite of recognition of the fungus could very well be achieved by effectors, we started a functional analysis of some of the most highly expressed candidates. However, the redundancy of the system made the identification of a drastic effect of a single gene most unlikely. We can show that at least one candidate accumulates in the plant apoplast. Deletion of some candidates led to a reduced virulence of C. purpurea on rye, indicating a role of the respective proteins during the infection process. We show for the first time that- despite the absence of effective plant defense reactions- the biotrophic pathogen C. purpurea is detected by its host. This points to a role of effectors in modulation of the effective plant response. Indeed, several putative effector genes are among the highest expressed genes in planta.

Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction.

PubMed

Takada, Luciana; Barbero, Marina M D; Oliveira, Henrique N; de Camargo, Gregório M F; Fernandes Júnior, Gerardo A; Aspilcueta-Borquis, Rusbel R; Souza, Fabio R P; Boligon, Arione A; Melo, Thaise P; Regatieri, Inaê C; Feitosa, Fabieli L B; Fonseca, Larissa F S; Magalhães, Ana F B; Costa, Raphael B; Albuquerque, Lucia G

2018-01-01

Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs.

QTLs for Seed Vigor-Related Traits Identified in Maize Seeds Germinated under Artificial Aging Conditions

PubMed Central

Han, Zanping; Ku, Lixia; Zhang, Zhenzhen; Zhang, Jun; Guo, ShuLei; Liu, Haiying; Zhao, Ruifang; Ren, Zhenzhen; Zhang, Liangkun; Su, Huihui; Dong, Lei; Chen, Yanhui

2014-01-01

High seed vigor is important for agricultural production due to the associated potential for increased growth and productivity. However, a better understanding of the underlying molecular mechanisms is required because the genetic basis for seed vigor remains unknown. We used single-nucleotide polymorphism (SNP) markers to map quantitative trait loci (QTLs) for four seed vigor traits in two connected recombinant inbred line (RIL) maize populations under four treatment conditions during seed germination. Sixty-five QTLs distributed between the two populations were identified and a meta-analysis was used to integrate genetic maps. Sixty-one initially identified QTLs were integrated into 18 meta-QTLs (mQTLs). Initial QTLs with contribution to phenotypic variation values of R2>10% were integrated into mQTLs. Twenty-three candidate genes for association with seed vigor traits coincided with 13 mQTLs. The candidate genes had functions in the glycolytic pathway and in protein metabolism. QTLs with major effects (R2>10%) were identified under at least one treatment condition for mQTL2, mQTL3-2, and mQTL3-4. Candidate genes included a calcium-dependent protein kinase gene (302810918) involved in signal transduction that mapped in the mQTL3-2 interval associated with germination energy (GE) and germination percentage (GP), and an hsp20/alpha crystallin family protein gene (At5g51440) that mapped in the mQTL3-4 interval associated with GE and GP. Two initial QTLs with a major effect under at least two treatment conditions were identified for mQTL5-2. A cucumisin-like Ser protease gene (At5g67360) mapped in the mQTL5-2 interval associated with GP. The chromosome regions for mQTL2, mQTL3-2, mQTL3-4, and mQTL5-2 may be hot spots for QTLs related to seed vigor traits. The mQTLs and candidate genes identified in this study provide valuable information for the identification of additional quantitative trait genes. PMID:24651614

QTLs for seed vigor-related traits identified in maize seeds germinated under artificial aging conditions.

PubMed

Han, Zanping; Ku, Lixia; Zhang, Zhenzhen; Zhang, Jun; Guo, Shulei; Liu, Haiying; Zhao, Ruifang; Ren, Zhenzhen; Zhang, Liangkun; Su, Huihui; Dong, Lei; Chen, Yanhui

2014-01-01

High seed vigor is important for agricultural production due to the associated potential for increased growth and productivity. However, a better understanding of the underlying molecular mechanisms is required because the genetic basis for seed vigor remains unknown. We used single-nucleotide polymorphism (SNP) markers to map quantitative trait loci (QTLs) for four seed vigor traits in two connected recombinant inbred line (RIL) maize populations under four treatment conditions during seed germination. Sixty-five QTLs distributed between the two populations were identified and a meta-analysis was used to integrate genetic maps. Sixty-one initially identified QTLs were integrated into 18 meta-QTLs (mQTLs). Initial QTLs with contribution to phenotypic variation values of R(2)>10% were integrated into mQTLs. Twenty-three candidate genes for association with seed vigor traits coincided with 13 mQTLs. The candidate genes had functions in the glycolytic pathway and in protein metabolism. QTLs with major effects (R(2)>10%) were identified under at least one treatment condition for mQTL2, mQTL3-2, and mQTL3-4. Candidate genes included a calcium-dependent protein kinase gene (302810918) involved in signal transduction that mapped in the mQTL3-2 interval associated with germination energy (GE) and germination percentage (GP), and an hsp20/alpha crystallin family protein gene (At5g51440) that mapped in the mQTL3-4 interval associated with GE and GP. Two initial QTLs with a major effect under at least two treatment conditions were identified for mQTL5-2. A cucumisin-like Ser protease gene (At5g67360) mapped in the mQTL5-2 interval associated with GP. The chromosome regions for mQTL2, mQTL3-2, mQTL3-4, and mQTL5-2 may be hot spots for QTLs related to seed vigor traits. The mQTLs and candidate genes identified in this study provide valuable information for the identification of additional quantitative trait genes.

"Contrasting patterns of selection at Pinus pinaster Ait. Drought stress candidate genes as revealed by genetic differentiation analyses".

PubMed

Eveno, Emmanuelle; Collada, Carmen; Guevara, M Angeles; Léger, Valérie; Soto, Alvaro; Díaz, Luis; Léger, Patrick; González-Martínez, Santiago C; Cervera, M Teresa; Plomion, Christophe; Garnier-Géré, Pauline H

2008-02-01

The importance of natural selection for shaping adaptive trait differentiation among natural populations of allogamous tree species has long been recognized. Determining the molecular basis of local adaptation remains largely unresolved, and the respective roles of selection and demography in shaping population structure are actively debated. Using a multilocus scan that aims to detect outliers from simulated neutral expectations, we analyzed patterns of nucleotide diversity and genetic differentiation at 11 polymorphic candidate genes for drought stress tolerance in phenotypically contrasted Pinus pinaster Ait. populations across its geographical range. We compared 3 coalescent-based methods: 2 frequentist-like, including 1 approach specifically developed for biallelic single nucleotide polymorphisms (SNPs) here and 1 Bayesian. Five genes showed outlier patterns that were robust across methods at the haplotype level for 2 of them. Two genes presented higher F(ST) values than expected (PR-AGP4 and erd3), suggesting that they could have been affected by the action of diversifying selection among populations. In contrast, 3 genes presented lower F(ST) values than expected (dhn-1, dhn2, and lp3-1), which could represent signatures of homogenizing selection among populations. A smaller proportion of outliers were detected at the SNP level suggesting the potential functional significance of particular combinations of sites in drought-response candidate genes. The Bayesian method appeared robust to low sample sizes, flexible to assumptions regarding migration rates, and powerful for detecting selection at the haplotype level, but the frequentist-like method adapted to SNPs was more efficient for the identification of outlier SNPs showing low differentiation. Population-specific effects estimated in the Bayesian method also revealed populations with lower immigration rates, which could have led to favorable situations for local adaptation. Outlier patterns are discussed in relation to the different genes' putative involvement in drought tolerance responses, from published results in transcriptomics and association mapping in P. pinaster and other related species. These genes clearly constitute relevant candidates for future association studies in P. pinaster.

Genetic Basis of Variation in Rice Seed Storage Protein (Albumin, Globulin, Prolamin, and Glutelin) Content Revealed by Genome-Wide Association Analysis.

PubMed

Chen, Pingli; Shen, Zhikang; Ming, Luchang; Li, Yibo; Dan, Wenhan; Lou, Guangming; Peng, Bo; Wu, Bian; Li, Yanhua; Zhao, Da; Gao, Guanjun; Zhang, Qinglu; Xiao, Jinghua; Li, Xianghua; Wang, Gongwei; He, Yuqing

2018-01-01

Rice seed storage protein (SSP) is an important source of nutrition and energy. Understanding the genetic basis of SSP content and mining favorable alleles that control it will be helpful for breeding new improved cultivars. An association analysis for SSP content was performed to identify underlying genes using 527 diverse Oryza sativa accessions grown in two environments. We identified more than 107 associations for five different traits, including the contents of albumin (Alb), globulin (Glo), prolamin (Pro), glutelin (Glu), and total SSP (Total). A total of 28 associations were located at previously reported QTLs or intervals. A lead SNP sf0709447538, associated for Glu content in the indica subpopulation in 2015, was further validated in near isogenic lines NIL(Zhenshan97) and NIL(Delong208), and the Glu phenotype had significantly difference between two NILs. The association region could be target for map-based cloning of the candidate genes. There were 13 associations in regions close to grain-quality-related genes; five lead single nucleotide polymorphisms (SNPs) were located less than 20 kb upstream from grain-quality-related genes ( PG5a , Wx , AGPS2a , RP6 , and, RM1 ). Several starch-metabolism-related genes ( AGPS2a , OsACS6 , PUL , GBSSII , and ISA2 ) were also associated with SSP content. We identified favorable alleles of functional candidate genes, such as RP6 , RM1 , Wx , and other four candidate genes by haplotype analysis and expression pattern. Genotypes of RP6 and RM1 with higher Pro were not identified in japonica and exhibited much higher expression levels in indica group. The lead SNP sf0601764762, repeatedly detected for Alb content in 2 years in the whole association population, was located in the Wx locus that controls the synthesis of amylose. And Alb content was significantly and negatively correlated with amylose content and the level of 2.3 kb Wx pre-mRNA examined in this study. The associations or candidate genes identified would provide new insights into the genetic basis of SSP content that will help in developing rice cultivars with improved grain nutritional quality through marker-assisted breeding.

Genome-wide scan for selection signatures in six cattle breeds in South Africa.

PubMed

Makina, Sithembile O; Muchadeyi, Farai C; van Marle-Köster, Este; Taylor, Jerry F; Makgahlela, Mahlako L; Maiwashe, Azwihangwisi

2015-11-26

The detection of selection signatures in breeds of livestock species can contribute to the identification of regions of the genome that are, or have been, functionally important and, as a consequence, have been targeted by selection. This study used two approaches to detect signatures of selection within and between six cattle breeds in South Africa, including Afrikaner (n = 44), Nguni (n = 54), Drakensberger (n = 47), Bonsmara (n = 44), Angus (n = 31) and Holstein (n = 29). The first approach was based on the detection of genomic regions in which haplotypes have been driven towards complete fixation within breeds. The second approach identified regions of the genome that had very different allele frequencies between populations (F ST). Forty-seven candidate genomic regions were identified as harbouring putative signatures of selection using both methods. Twelve of these candidate selected regions were shared among the breeds and ten were validated by previous studies. Thirty-three of these regions were successfully annotated and candidate genes were identified. Among these genes the keratin genes (KRT222, KRT24, KRT25, KRT26, and KRT27) and one heat shock protein gene (HSPB9) on chromosome 19 between 42,896,570 and 42,897,840 bp were detected for the Nguni breed. These genes were previously associated with adaptation to tropical environments in Zebu cattle. In addition, a number of candidate genes associated with the nervous system (WNT5B, FMOD, PRELP, and ATP2B), immune response (CYM, CDC6, and CDK10), production (MTPN, IGFBP4, TGFB1, and AJAP1) and reproductive performance (ADIPOR2, OVOS2, and RBBP8) were also detected as being under selection. The results presented here provide a foundation for detecting mutations that underlie genetic variation of traits that have economic importance for cattle breeds in South Africa.

Combined serial analysis of gene expression and transcription factor binding site prediction identifies novel-candidate-target genes of Nr2e1 in neocortex development.

PubMed

Schmouth, Jean-François; Arenillas, David; Corso-Díaz, Ximena; Xie, Yuan-Yun; Bohacec, Slavita; Banks, Kathleen G; Bonaguro, Russell J; Wong, Siaw H; Jones, Steven J M; Marra, Marco A; Simpson, Elizabeth M; Wasserman, Wyeth W

2015-07-24

Nr2e1 (nuclear receptor subfamily 2, group e, member 1) encodes a transcription factor important in neocortex development. Previous work has shown that nuclear receptors can have hundreds of target genes, and bind more than 300 co-interacting proteins. However, recognition of the critical role of Nr2e1 in neural stem cells and neocortex development is relatively recent, thus the molecular mechanisms involved for this nuclear receptor are only beginning to be understood. Serial analysis of gene expression (SAGE), has given researchers both qualitative and quantitative information pertaining to biological processes. Thus, in this work, six LongSAGE mouse libraries were generated from laser microdissected tissue samples of dorsal VZ/SVZ (ventricular zone and subventricular zone) from the telencephalon of wild-type (Wt) and Nr2e1-null embryos at the critical development ages E13.5, E15.5, and E17.5. We then used a novel approach, implementing multiple computational methods followed by biological validation to further our understanding of Nr2e1 in neocortex development. In this work, we have generated a list of 1279 genes that are differentially expressed in response to altered Nr2e1 expression during in vivo neocortex development. We have refined this list to 64 candidate direct-targets of NR2E1. Our data suggested distinct roles for Nr2e1 during different neocortex developmental stages. Most importantly, our results suggest a possible novel pathway by which Nr2e1 regulates neurogenesis, which includes Lhx2 as one of the candidate direct-target genes, and SOX9 as a co-interactor. In conclusion, we have provided new candidate interacting partners and numerous well-developed testable hypotheses for understanding the pathways by which Nr2e1 functions to regulate neocortex development.

Candidate Gene Associations with Withdrawn Behavior

ERIC Educational Resources Information Center

Rubin, David H.; Althoff, Robert R.; Ehli, Erik A.; Davies, Gareth E.; Rettew, David C.; Crehan, Eileen T.; Walkup, John T.; Hudziak, James J.

2013-01-01

Background: Social withdrawal is a core neuropsychiatric phenomenon in developmental psychopathology. Its presence predicts psychopathology across many domains, including depression, psychosis, autism, anxiety, and suicide. Withdrawn behavior is highly heritable, persistent, and characteristically worsens without intervention. To date, few studies…

Molecular genetics and animal models in autistic disorder.

PubMed

Andres, Christian

2002-01-01

Autistic disorder is a behavioural syndrome beginning before the age of 3 years and lasting over the whole lifetime. It is characterised by impaired communication, impaired social interactions, and repetitive interests and behaviour. The prevalence is about 7/10,000 taking a restrictive definition and more than 1/500 with a broader definition, including all the pervasive developmental disorders. The importance of genetic factors has been highlighted by epidemiological studies showing that autistic disorder is one of the most genetic neuropsychiatric diseases. The relative risk of first relatives is about 100-fold higher than the risk in the normal population and the concordance in monozygotic twin is about 60%. Different strategies have been applied on the track of susceptibility genes. The systematic search of linked loci led to contradictory results, in part due to the heterogeneity of the clinical definitions, to the differences in the DNA markers, and to the different methods of analysis used. An oversimplification of the inferred model is probably also cause of our disappointment. More work is necessary to give a clearer picture. One region emerges more frequently: the long arm of chromosome 7. Several candidate genes have been studied and some gave indications of association: the Reelin gene and the Wnt2 gene. Cytogenetical abnormalities are frequent at 15q11-13, the region of the Angelman and Prader-Willi syndrome. Imprinting plays an important role in this region, no candidate gene has been identified in autism. Biochemical abnormalities have been found in the serotonin system. Association and linkage studies gave no consistent results with some serotonin receptors and in the transporter, although it seems interesting to go further in the biochemical characterisation of the serotonin transporter activity, particularly in platelets, easily accessible. Two monogenic diseases have been associated with autistic disorder: tuberous sclerosis and fragile X. A better knowledge of the pathophysiology of these disorders can help to understand autism. Different other candidate genes have been tested, positive results await replications in other samples. Animal models have been developed, generally by knocking out the different candidate genes. Behaviour studies have mainly focused on anxiety and learning paradigms. Another group of models results from surgical or toxic lesions of candidate regions in the brain, in general during development. The tools to analyse these animals are not yet standardised, and an important effort needs to be undertaken.

High-throughput discovery of mutations in tef semi-dwarfing genes by next-generation sequencing analysis.

PubMed

Zhu, Qihui; Smith, Shavannor M; Ayele, Mulu; Yang, Lixing; Jogi, Ansuya; Chaluvadi, Srinivasa R; Bennetzen, Jeffrey L

2012-11-01

Tef (Eragrostis tef) is a major cereal crop in Ethiopia. Lodging is the primary constraint to increasing productivity in this allotetraploid species, accounting for losses of ∼15-45% in yield each year. As a first step toward identifying semi-dwarf varieties that might have improved lodging resistance, an ∼6× fosmid library was constructed and used to identify both homeologues of the dw3 semi-dwarfing gene of Sorghum bicolor. An EMS mutagenized population, consisting of ∼21,210 tef plants, was planted and leaf materials were collected into 23 superpools. Two dwarfing candidate genes, homeologues of dw3 of sorghum and rht1 of wheat, were sequenced directly from each superpool with 454 technology, and 120 candidate mutations were identified. Out of 10 candidates tested, six independent mutations were validated by Sanger sequencing, including two predicted detrimental mutations in both dw3 homeologues with a potential to improve lodging resistance in tef through further breeding. This study demonstrates that high-throughput sequencing can identify potentially valuable mutations in under-studied plant species like tef and has provided mutant lines that can now be combined and tested in breeding programs for improved lodging resistance.

Vanilloid receptor-related osmotically activated channel (VR-OAC), a candidate vertebrate osmoreceptor

PubMed Central

Liedtke, Wolfgang; Choe, Yong; Martí-Renom, Marc A.; Bell, Andrea M.; Denis, Charlotte S.; Šali, Andrej; Hudspeth, A. J.; Friedman, Jeffrey M.; Heller, Stefan

2008-01-01

SUMMARY The detection of osmotic stimuli is essential for all organisms, yet few osmoreceptive proteins are known, none of them in vertebrates. By employing a candidate-gene approach based on genes encoding members of the TRP superfamily of ion channels, we cloned cDNAs encoding the vanilloid receptor-related osmotically activated channel (VR-OAC) from the rat, mouse, human, and chicken. This novel cation-selective channel is gated by exposure to hypotonicity within the physiological range. In the central nevous system, the channel is expressed neurons of the circumventricular organs, neurosensory cells responsive to systemic osmotic pressure. The channel also occurs in other neurosensory cells, including inner-ear hair cells, sensory neurons, and Merkel cells. PMID:11081638

Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar

PubMed Central

González, Ana M.; Godoy, Luís

2017-01-01

Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F2 populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype. PMID:29168746

Schizophrenia, vitamin D, and brain development.

PubMed

Mackay-Sim, Alan; Féron, François; Eyles, Darryl; Burne, Thomas; McGrath, John

2004-01-01

Schizophrenia research is invigorated at present by the recent discovery of several plausible candidate susceptibility genes identified from genetic linkage and gene expression studies of brains from persons with schizophrenia. It is a current challenge to reconcile this gathering evidence for specific candidate susceptibility genes with the "neurodevelopmental hypothesis," which posits that schizophrenia arises from gene-environment interactions that disrupt brain development. We make the case here that schizophrenia may result not from numerous genes of small effect, but a few genes of transcriptional regulation acting during brain development. In particular we propose that low vitamin D during brain development interacts with susceptibility genes to alter the trajectory of brain development, probably by epigenetic regulation that alters gene expression throughout adult life. Vitamin D is an attractive "environmental" candidate because it appears to explain several key epidemiological features of schizophrenia. Vitamin D is an attractive "genetic" candidate because its nuclear hormone receptor regulates gene expression and nervous system development. The polygenic quality of schizophrenia, with linkage to many genes of small effect, maybe brought together via this "vitamin D hypothesis." We also discuss the possibility of a broader set of environmental and genetic factors interacting via the nuclear hormone receptors to affect the development of the brain leading to schizophrenia.

Multi-Dimensional Prioritization of Dental Caries Candidate Genes and Its Enriched Dense Network Modules

PubMed Central

Wang, Quan; Jia, Peilin; Cuenco, Karen T.; Feingold, Eleanor; Marazita, Mary L.; Wang, Lily; Zhao, Zhongming

2013-01-01

A number of genetic studies have suggested numerous susceptibility genes for dental caries over the past decade with few definite conclusions. The rapid accumulation of relevant information, along with the complex architecture of the disease, provides a challenging but also unique opportunity to review and integrate the heterogeneous data for follow-up validation and exploration. In this study, we collected and curated candidate genes from four major categories: association studies, linkage scans, gene expression analyses, and literature mining. Candidate genes were prioritized according to the magnitude of evidence related to dental caries. We then searched for dense modules enriched with the prioritized candidate genes through their protein-protein interactions (PPIs). We identified 23 modules comprising of 53 genes. Functional analyses of these 53 genes revealed three major clusters: cytokine network relevant genes, matrix metalloproteinases (MMPs) family, and transforming growth factor-beta (TGF-β) family, all of which have been previously implicated to play important roles in tooth development and carious lesions. Through our extensive data collection and an integrative application of gene prioritization and PPI network analyses, we built a dental caries-specific sub-network for the first time. Our study provided insights into the molecular mechanisms underlying dental caries. The framework we proposed in this work can be applied to other complex diseases. PMID:24146904

Integrative Approach to Pain Genetics Identifies Pain Sensitivity Loci across Diseases

PubMed Central

Ruau, David; Dudley, Joel T.; Chen, Rong; Phillips, Nicholas G.; Swan, Gary E.; Lazzeroni, Laura C.; Clark, J. David

2012-01-01

Identifying human genes relevant for the processing of pain requires difficult-to-conduct and expensive large-scale clinical trials. Here, we examine a novel integrative paradigm for data-driven discovery of pain gene candidates, taking advantage of the vast amount of existing disease-related clinical literature and gene expression microarray data stored in large international repositories. First, thousands of diseases were ranked according to a disease-specific pain index (DSPI), derived from Medical Subject Heading (MESH) annotations in MEDLINE. Second, gene expression profiles of 121 of these human diseases were obtained from public sources. Third, genes with expression variation significantly correlated with DSPI across diseases were selected as candidate pain genes. Finally, selected candidate pain genes were genotyped in an independent human cohort and prospectively evaluated for significant association between variants and measures of pain sensitivity. The strongest signal was with rs4512126 (5q32, ABLIM3, P = 1.3×10−10) for the sensitivity to cold pressor pain in males, but not in females. Significant associations were also observed with rs12548828, rs7826700 and rs1075791 on 8q22.2 within NCALD (P = 1.7×10−4, 1.8×10−4, and 2.2×10−4 respectively). Our results demonstrate the utility of a novel paradigm that integrates publicly available disease-specific gene expression data with clinical data curated from MEDLINE to facilitate the discovery of pain-relevant genes. This data-derived list of pain gene candidates enables additional focused and efficient biological studies validating additional candidates. PMID:22685391

Genome-wide association studies and epistasis analyses of candidate genes related to age at menarche and age at natural menopause in a Korean population.

PubMed

Pyun, Jung-A; Kim, Sunshin; Cho, Nam H; Koh, InSong; Lee, Jong-Young; Shin, Chol; Kwack, KyuBum

2014-05-01

The aim of this study was to identify polymorphisms and gene-gene interactions that are significantly associated with age at menarche and age at menopause in a Korean population. A total of 3,452 and 1,827 women participated in studies of age at menarche and age at natural menopause, respectively. Linear regression analyses adjusted for residence area were used to perform genome-wide association studies (GWAS), candidate gene association studies, and interactions between the candidate genes for age at menarche and age at natural menopause. In GWAS, four single nucleotide polymorphisms (SNPs; rs7528241, rs1324329, rs11597068, and rs6495785) were strongly associated with age at natural menopause (lowest P = 9.66 × 10). However, GWAS of age at menarche did not reveal any strong associations. In candidate gene association studies, SNPs with P < 0.01 were selected to test their synergistic interactions. For age at natural menopause, there was a significant interaction between intronic SNPs on ADAM metallopeptidase with thrombospondin type I motif 9 (ADAMTS9) and SMAD family member 3 (SMAD3) genes (P = 9.52 × 10). For age at menarche, there were three significant interactions between three intronic SNPs on follicle-stimulating hormone receptor (FSHR) gene and one SNP located at the 3' flanking region of insulin-like growth factor 2 receptor (IGF2R) gene (lowest P = 1.95 × 10). Novel SNPs and synergistic interactions between candidate genes are significantly associated with age at menarche and age at natural menopause in a Korean population.

Immunogenetic mechanisms leading to thyroid autoimmunity: recent advances in identifying susceptibility genes and regions.

PubMed

Brand, Oliver J; Gough, Stephen C L

2011-12-01

The autoimmune thyroid diseases (AITD) include Graves' disease (GD) and Hashimoto's thyroiditis (HT), which are characterised by a breakdown in immune tolerance to thyroid antigens. Unravelling the genetic architecture of AITD is vital to better understanding of AITD pathogenesis, required to advance therapeutic options in both disease management and prevention. The early whole-genome linkage and candidate gene association studies provided the first evidence that the HLA region and CTLA-4 represented AITD risk loci. Recent improvements in; high throughput genotyping technologies, collection of larger disease cohorts and cataloguing of genome-scale variation have facilitated genome-wide association studies and more thorough screening of candidate gene regions. This has allowed identification of many novel AITD risk genes and more detailed association mapping. The growing number of confirmed AITD susceptibility loci, implicates a number of putative disease mechanisms most of which are tightly linked with aspects of immune system function. The unprecedented advances in genetic study will allow future studies to identify further novel disease risk genes and to identify aetiological variants within specific gene regions, which will undoubtedly lead to a better understanding of AITD patho-physiology.

Immunogenetic Mechanisms Leading to Thyroid Autoimmunity: Recent Advances in Identifying Susceptibility Genes and Regions

PubMed Central

Brand, Oliver J; Gough, Stephen C.L

2011-01-01

The autoimmune thyroid diseases (AITD) include Graves’ disease (GD) and Hashimoto’s thyroiditis (HT), which are characterised by a breakdown in immune tolerance to thyroid antigens. Unravelling the genetic architecture of AITD is vital to better understanding of AITD pathogenesis, required to advance therapeutic options in both disease management and prevention. The early whole-genome linkage and candidate gene association studies provided the first evidence that the HLA region and CTLA-4 represented AITD risk loci. Recent improvements in; high throughput genotyping technologies, collection of larger disease cohorts and cataloguing of genome-scale variation have facilitated genome-wide association studies and more thorough screening of candidate gene regions. This has allowed identification of many novel AITD risk genes and more detailed association mapping. The growing number of confirmed AITD susceptibility loci, implicates a number of putative disease mechanisms most of which are tightly linked with aspects of immune system function. The unprecedented advances in genetic study will allow future studies to identify further novel disease risk genes and to identify aetiological variants within specific gene regions, which will undoubtedly lead to a better understanding of AITD patho-physiology. PMID:22654554

An SNP within the Angiotensin-Converting Enzyme Distinguishes between Sprint and Distance Performing Alaskan Sled Dogs in a Candidate Gene Analysis

PubMed Central

Huson, Heather J.; Byers, Alexandra M.; Runstadler, Jonathan

2011-01-01

The Alaskan sled dog offers a unique mechanism for studying the genetics of elite athletic performance. They are a group of mixed breed dogs, comprised of multiple common breeds, and a unique breed entity seen only as a part of the sled dog mix. Alaskan sled dogs are divided into 2 primary groups as determined by their racing skills. Distance dogs are capable of running over 1000 miles in 10 days, whereas sprint dogs run much shorter distances, approximately 30 miles, but in faster times, that is, 18–25 mph. Finding the genes that distinguish these 2 types of performers is likely to illuminate genetic contributors to human athletic performance. In this study, we tested for association between polymorphisms in 2 candidate genes; angiotensin-converting enzyme (ACE) and myostatin (MSTN) and enhanced speed and endurance performance in 174 Alaskan sled dogs. We observed 81 novel genetic variants within the ACE gene and 4 within the MSTN gene, including a polymorphism within the ACE gene that significantly (P value 2.38 × 10−5) distinguished the sprint versus distance populations. PMID:21846742

Cracking the genomic piggy bank: identifying secrets of the pig genome.

PubMed

Mote, B E; Rothschild, M F

2006-01-01

Though researchers are uncovering valuable information about the pig genome at unprecedented speed, the porcine genome community is barely scratching the surface as to understanding interactions of the biological code. The pig genetic linkage map has nearly 5,000 loci comprised of genes, microsatellites, and amplified fragment length polymorphism markers. Likewise, the physical map is becoming denser with nearly 6,000 markers. The long awaited sequencing efforts are providing multidimensional benefits with sequence available for comparative genomics and identifying single nucleotide polymorphisms for use in linkage and trait association studies. Scientists are using exotic and commercial breeds for quantitative trait loci scans. Additionally, candidate gene studies continue to identify chromosomal regions or genes associated with economically important traits such as growth rate, leanness, feed intake, meat quality, litter size, and disease resistance. The commercial pig industry is actively incorporating these markers in marker-assisted selection along with traditional performance information to improve said traits. Researchers are utilizing novel tools including pig microarrays along with advanced bioinformatics to identify new candidate genes, understand gene function, and piece together gene networks involved in important biological processes. Advances in pig genomics and implications to the pork industry as well as human health are reviewed.

The Effects of Selenium Supplementation on Gene Expression Related to Insulin and Lipid in Infertile Polycystic Ovary Syndrome Women Candidate for In Vitro Fertilization: a Randomized, Double-Blind, Placebo-Controlled Trial.

PubMed

Zadeh Modarres, Shahrzad; Heidar, Zahra; Foroozanfard, Fatemeh; Rahmati, Zahra; Aghadavod, Esmat; Asemi, Zatollah

2018-06-01

This study was conducted to evaluate the effects of selenium supplementation on gene expression related to insulin and lipid in infertile women with polycystic ovary syndrome (PCOS) candidate for in vitro fertilization (IVF). This randomized double-blind, placebo-controlled trial was conducted among 40 infertile women with PCOS candidate for IVF. Subjects were randomly allocated into two groups to intake either 200-μg selenium (n = 20) or placebo (n = 20) per day for 8 weeks. Gene expression levels related to insulin and lipid were quantified in lymphocytes of women with PCOS candidate for IVF with RT-PCR method. Results of RT-PCR demonstrated that after the 8-week intervention, compared with the placebo, selenium supplementation upregulated gene expression of peroxisome proliferator-activated receptor gamma (PPAR-γ) (1.06 ± 0.15-fold increase vs. 0.94 ± 0.18-fold reduction, P = 0.02) and glucose transporter 1 (GLUT-1) (1.07 ± 0.20-fold increase vs. 0.87 ± 0.18-fold reduction, P = 0.003) in lymphocytes of women with PCOS candidate for IVF. In addition, compared with the placebo, selenium supplementation downregulated gene expression of low-density lipoprotein receptor (LDLR) (0.88 ± 0.17-fold reduction vs. 1.05 ± 0.22-fold increase, P = 0.01) in lymphocytes of women with PCOS candidate for IVF. We did not observe any significant effect of selenium supplementation on gene expression levels of lipoprotein(a) [LP(a)] in lymphocytes of women with PCOS candidate for IVF. Overall, selenium supplementation for 8 weeks in lymphocytes of women with infertile PCOS candidate for IVF significantly increased gene expression levels of PPAR-γ and GLUT-1 and significantly decreased gene expression levels of LDLR, but did not affect LP(a). http://www.irct.ir : IRCT201704245623N113.

Human native lipoprotein-induced de novo DNA methylation is associated with repression of inflammatory genes in THP-1 macrophages.

PubMed

Rangel-Salazar, Rubén; Wickström-Lindholm, Marie; Aguilar-Salinas, Carlos A; Alvarado-Caudillo, Yolanda; Døssing, Kristina B V; Esteller, Manel; Labourier, Emmanuel; Lund, Gertrud; Nielsen, Finn C; Rodríguez-Ríos, Dalia; Solís-Martínez, Martha O; Wrobel, Katarzyna; Wrobel, Kazimierz; Zaina, Silvio

2011-11-25

We previously showed that a VLDL- and LDL-rich mix of human native lipoproteins induces a set of repressive epigenetic marks, i.e. de novo DNA methylation, histone 4 hypoacetylation and histone 4 lysine 20 (H4K20) hypermethylation in THP-1 macrophages. Here, we: 1) ask what gene expression changes accompany these epigenetic responses; 2) test the involvement of candidate factors mediating the latter. We exploited genome expression arrays to identify target genes for lipoprotein-induced silencing, in addition to RNAi and expression studies to test the involvement of candidate mediating factors. The study was conducted in human THP-1 macrophages. Native lipoprotein-induced de novo DNA methylation was associated with a general repression of various critical genes for macrophage function, including pro-inflammatory genes. Lipoproteins showed differential effects on epigenetic marks, as de novo DNA methylation was induced by VLDL and to a lesser extent by LDL, but not by HDL, and VLDL induced H4K20 hypermethylation, while HDL caused H4 deacetylation. The analysis of candidate factors mediating VLDL-induced DNA hypermethylation revealed that this response was: 1) surprisingly, mediated exclusively by the canonical maintenance DNA methyltransferase DNMT1, and 2) independent of the Dicer/micro-RNA pathway. Our work provides novel insights into epigenetic gene regulation by native lipoproteins. Furthermore, we provide an example of DNMT1 acting as a de novo DNA methyltransferase independently of canonical de novo enzymes, and show proof of principle that de novo DNA methylation can occur independently of a functional Dicer/micro-RNA pathway in mammals.

Finding gene regulatory network candidates using the gene expression knowledge base.

PubMed

Venkatesan, Aravind; Tripathi, Sushil; Sanz de Galdeano, Alejandro; Blondé, Ward; Lægreid, Astrid; Mironov, Vladimir; Kuiper, Martin

2014-12-10

Network-based approaches for the analysis of large-scale genomics data have become well established. Biological networks provide a knowledge scaffold against which the patterns and dynamics of 'omics' data can be interpreted. The background information required for the construction of such networks is often dispersed across a multitude of knowledge bases in a variety of formats. The seamless integration of this information is one of the main challenges in bioinformatics. The Semantic Web offers powerful technologies for the assembly of integrated knowledge bases that are computationally comprehensible, thereby providing a potentially powerful resource for constructing biological networks and network-based analysis. We have developed the Gene eXpression Knowledge Base (GeXKB), a semantic web technology based resource that contains integrated knowledge about gene expression regulation. To affirm the utility of GeXKB we demonstrate how this resource can be exploited for the identification of candidate regulatory network proteins. We present four use cases that were designed from a biological perspective in order to find candidate members relevant for the gastrin hormone signaling network model. We show how a combination of specific query definitions and additional selection criteria derived from gene expression data and prior knowledge concerning candidate proteins can be used to retrieve a set of proteins that constitute valid candidates for regulatory network extensions. Semantic web technologies provide the means for processing and integrating various heterogeneous information sources. The GeXKB offers biologists such an integrated knowledge resource, allowing them to address complex biological questions pertaining to gene expression. This work illustrates how GeXKB can be used in combination with gene expression results and literature information to identify new potential candidates that may be considered for extending a gene regulatory network.

Rapid identification of candidate genes for resistance to tomato late blight disease using next-generation sequencing technologies

PubMed Central

Arafa, Ramadan A.; Rakha, Mohamed T.; Kamel, Said M.

2017-01-01

Tomato late blight caused by Phytophthora infestans (Mont.) de Bary, also known as the Irish famine pathogen, is one of the most destructive plant diseases. Wild relatives of tomato possess useful resistance genes against this disease, and could therefore be used in breeding to improve cultivated varieties. In the genome of a wild relative of tomato, Solanum habrochaites accession LA1777, we identified a new quantitative trait locus for resistance against blight caused by an aggressive Egyptian isolate of P. infestans. Using double-digest restriction site–associated DNA sequencing (ddRAD-Seq) technology, we determined 6,514 genome-wide SNP genotypes of an F2 population derived from an interspecific cross. Subsequent association analysis of genotypes and phenotypes of the mapping population revealed that a 6.8 Mb genome region on chromosome 6 was a candidate locus for disease resistance. Whole-genome resequencing analysis revealed that 298 genes in this region potentially had functional differences between the parental lines. Among of them, two genes with missense mutations, Solyc06g071810.1 and Solyc06g083640.3, were considered to be potential candidates for disease resistance. SNP and SSR markers linking to this region can be used in marker-assisted selection in future breeding programs for late blight disease, including introgression of new genetic loci from wild species. In addition, the approach developed in this study provides a model for identification of other genes for attractive agronomical traits. PMID:29253902

Comparative Transcriptome Analysis Identifies Putative Genes Involved in the Biosynthesis of Xanthanolides in Xanthium strumarium L.

PubMed

Li, Yuanjun; Gou, Junbo; Chen, Fangfang; Li, Changfu; Zhang, Yansheng

2016-01-01

Xanthium strumarium L. is a traditional Chinese herb belonging to the Asteraceae family. The major bioactive components of this plant are sesquiterpene lactones (STLs), which include the xanthanolides. To date, the biogenesis of xanthanolides, especially their downstream pathway, remains largely unknown. In X. strumarium, xanthanolides primarily accumulate in its glandular trichomes. To identify putative gene candidates involved in the biosynthesis of xanthanolides, three X. strumarium transcriptomes, which were derived from the young leaves of two different cultivars and the purified glandular trichomes from one of the cultivars, were constructed in this study. In total, 157 million clean reads were generated and assembled into 91,861 unigenes, of which 59,858 unigenes were successfully annotated. All the genes coding for known enzymes in the upstream pathway to the biosynthesis of xanthanolides were present in the X. strumarium transcriptomes. From a comparative analysis of the X. strumarium transcriptomes, this study identified a number of gene candidates that are putatively involved in the downstream pathway to the synthesis of xanthanolides, such as four unigenes encoding CYP71 P450s, 50 unigenes for dehydrogenases, and 27 genes for acetyltransferases. The possible functions of these four CYP71 candidates are extensively discussed. In addition, 116 transcription factors that are highly expressed in X. strumarium glandular trichomes were also identified. Their possible regulatory roles in the biosynthesis of STLs are discussed. The global transcriptomic data for X. strumarium should provide a valuable resource for further research into the biosynthesis of xanthanolides.

A data science approach to candidate gene selection of pain regarded as a process of learning and neural plasticity.

PubMed

Ultsch, Alfred; Kringel, Dario; Kalso, Eija; Mogil, Jeffrey S; Lötsch, Jörn

2016-12-01

The increasing availability of "big data" enables novel research approaches to chronic pain while also requiring novel techniques for data mining and knowledge discovery. We used machine learning to combine the knowledge about n = 535 genes identified empirically as relevant to pain with the knowledge about the functions of thousands of genes. Starting from an accepted description of chronic pain as displaying systemic features described by the terms "learning" and "neuronal plasticity," a functional genomics analysis proposed that among the functions of the 535 "pain genes," the biological processes "learning or memory" (P = 8.6 × 10) and "nervous system development" (P = 2.4 × 10) are statistically significantly overrepresented as compared with the annotations to these processes expected by chance. After establishing that the hypothesized biological processes were among important functional genomics features of pain, a subset of n = 34 pain genes were found to be annotated with both Gene Ontology terms. Published empirical evidence supporting their involvement in chronic pain was identified for almost all these genes, including 1 gene identified in March 2016 as being involved in pain. By contrast, such evidence was virtually absent in a randomly selected set of 34 other human genes. Hence, the present computational functional genomics-based method can be used for candidate gene selection, providing an alternative to established methods.

The Genetic Basis for Variation in Sensitivity to Lead Toxicity in Drosophila melanogaster

PubMed Central

Zhou, Shanshan; Morozova, Tatiana V.; Hussain, Yasmeen N.; Luoma, Sarah E.; McCoy, Lenovia; Yamamoto, Akihiko; Mackay, Trudy F.C.; Anholt, Robert R.H.

2016-01-01

Background: Lead toxicity presents a worldwide health problem, especially due to its adverse effects on cognitive development in children. However, identifying genes that give rise to individual variation in susceptibility to lead toxicity is challenging in human populations. Objectives: Our goal was to use Drosophila melanogaster to identify evolutionarily conserved candidate genes associated with individual variation in susceptibility to lead exposure. Methods: To identify candidate genes associated with variation in susceptibility to lead toxicity, we measured effects of lead exposure on development time, viability and adult activity in the Drosophila melanogaster Genetic Reference Panel (DGRP) and performed genome-wide association analyses to identify candidate genes. We used mutants to assess functional causality of candidate genes and constructed a genetic network associated with variation in sensitivity to lead exposure, on which we could superimpose human orthologs. Results: We found substantial heritabilities for all three traits and identified candidate genes associated with variation in susceptibility to lead exposure for each phenotype. The genetic architectures that determine variation in sensitivity to lead exposure are highly polygenic. Gene ontology and network analyses showed enrichment of genes associated with early development and function of the nervous system. Conclusions: Drosophila melanogaster presents an advantageous model to study the genetic underpinnings of variation in susceptibility to lead toxicity. Evolutionary conservation of cellular pathways that respond to toxic exposure allows predictions regarding orthologous genes and pathways across phyla. Thus, studies in the D. melanogaster model system can identify candidate susceptibility genes to guide subsequent studies in human populations. Citation: Zhou S, Morozova TV, Hussain YN, Luoma SE, McCoy L, Yamamoto A, Mackay TF, Anholt RR. 2016. The genetic basis for variation in sensitivity to lead toxicity in Drosophila melanogaster. Environ Health Perspect 124:1062–1070; http://dx.doi.org/10.1289/ehp.1510513 PMID:26859824

Array-based comparative genomic hybridization-guided identification of reference genes for normalization of real-time quantitative polymerase chain reaction assay data for lymphomas, histiocytic sarcomas, and osteosarcomas of dogs.

PubMed

Tsai, Pei-Chien; Breen, Matthew

2012-09-01

To identify suitable reference genes for normalization of real-time quantitative PCR (RT-qPCR) assay data for common tumors of dogs. Malignant lymph node (n = 8), appendicular osteosarcoma (9), and histiocytic sarcoma (12) samples and control samples of various nonneoplastic canine tissues. Array-based comparative genomic hybridization (aCGH) data were used to guide selection of 9 candidate reference genes. Expression stability of candidate reference genes and 4 commonly used reference genes was determined for tumor samples with RT-qPCR assays and 3 software programs. LOC611555 was the candidate reference gene with the highest expression stability among the 3 tumor types. Of the commonly used reference genes, expression stability of HPRT was high in histiocytic sarcoma samples, and expression stability of Ubi and RPL32 was high in osteosarcoma samples. Some of the candidate reference genes had higher expression stability than did the commonly used reference genes. Data for constitutively expressed genes with high expression stability are required for normalization of RT-qPCR assay results. Without such data, accurate quantification of gene expression in tumor tissue samples is difficult. Results of the present study indicated LOC611555 may be a useful RT-qPCR assay reference gene for multiple tissue types. Some commonly used reference genes may be suitable for normalization of gene expression data for tumors of dogs, such as lymphomas, osteosarcomas, or histiocytic sarcomas.

Zinc-dependent global transcriptional control, transcriptional deregulation, and higher gene copy number for genes in metal homeostasis of the hyperaccumulator Arabidopsis halleri.

PubMed

Talke, Ina N; Hanikenne, Marc; Krämer, Ute

2006-09-01

The metal hyperaccumulator Arabidopsis halleri exhibits naturally selected zinc (Zn) and cadmium (Cd) hypertolerance and accumulates extraordinarily high Zn concentrations in its leaves. With these extreme physiological traits, A. halleri phylogenetically belongs to the sister clade of Arabidopsis thaliana. Using a combination of genome-wide cross species microarray analysis and real-time reverse transcription-PCR, a set of candidate genes is identified for Zn hyperaccumulation, Zn and Cd hypertolerance, and the adjustment of micronutrient homeostasis in A. halleri. Eighteen putative metal homeostasis genes are newly identified to be more highly expressed in A. halleri than in A. thaliana, and 11 previously identified candidate genes are confirmed. The encoded proteins include HMA4, known to contribute to root-shoot transport of Zn in A. thaliana. Expression of either AtHMA4 or AhHMA4 confers cellular Zn and Cd tolerance to yeast (Saccharomyces cerevisiae). Among further newly implicated proteins are IRT3 and ZIP10, which have been proposed to contribute to cytoplasmic Zn influx, and FRD3 required for iron partitioning in A. thaliana. In A. halleri, the presence of more than a single genomic copy is a hallmark of several highly expressed candidate genes with possible roles in metal hyperaccumulation and metal hypertolerance. Both A. halleri and A. thaliana exert tight regulatory control over Zn homeostasis at the transcript level. Zn hyperaccumulation in A. halleri involves enhanced partitioning of Zn from roots into shoots. The transcriptional regulation of marker genes suggests that in the steady state, A. halleri roots, but not the shoots, act as physiologically Zn deficient under conditions of moderate Zn supply.

The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color.

PubMed

Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N

2013-06-03

Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.

Bisphenol A-Associated Alterations in the Expression and Epigenetic Regulation of Genes Encoding Xenobiotic Metabolizing Enzymes in Human Fetal Liver

PubMed Central

Nahar, Muna S.; Kim, Jung H.; Sartor, Maureen A.; Dolinoy, Dana C.

2014-01-01

Alterations in xenobiotic metabolizing enzyme (XME) expression across the life course, along with genetic, nutritional, and environmental regulation, can influence how organisms respond to toxic insults. In this study, we investigated the hypothesis that in utero exposure to the endocrine active compound, bisphenol A (BPA), influences expression and epigenetic regulation of phase I and II XME genes during development. Using healthy 1st to 2nd trimester human fetal liver specimens quantified for internal BPA levels, we examined XME gene expression using PCR Array (n =8) and RNA-sequencing (n =12) platforms. Of the greater than 160 XME genes assayed, 2 phase I and 12 phase II genes exhibited significantly reduced expression with higher BPA levels, including isoforms from the carboxylesterase, catechol O-methyltransferase, glutathione S-transferase, sulfotransferase, and UDP-glucuronosyltransferase families. When the promoters of these candidate genes were evaluated in silico, putative binding sites for the E-twenty-six (ETS) and activator protein1 (AP1) related transcription factor families were identified and unique to 97% of all candidate transcripts. Interestingly, many ETS binding sites contain cytosine-guanine dinucleotides (CpGs) within their consensus sequences. Thus, quantitative analysis of CpG methylation of three candidate genes was conducted across n =50 samples. Higher BPA levels were associated with increased site-specific methylation at COMT (P <0.005) and increased average methylation at SULT2A1 (P <0.020) promoters. While toxicological studies have traditionally focused on high-dose effects and hormonal receptor mediated regulation, our findings suggest the importance of low-dose effects and nonclassical mechanisms of endocrine disruption during development. PMID:24214726

Adaptations to Climate in Candidate Genes for Common Metabolic Disorders

PubMed Central

Hancock, Angela M; Witonsky, David B; Gordon, Adam S; Eshel, Gidon; Pritchard, Jonathan K; Coop, Graham; Di Rienzo, Anna

2008-01-01

Evolutionary pressures due to variation in climate play an important role in shaping phenotypic variation among and within species and have been shown to influence variation in phenotypes such as body shape and size among humans. Genes involved in energy metabolism are likely to be central to heat and cold tolerance. To test the hypothesis that climate shaped variation in metabolism genes in humans, we used a bioinformatics approach based on network theory to select 82 candidate genes for common metabolic disorders. We genotyped 873 tag SNPs in these genes in 54 worldwide populations (including the 52 in the Human Genome Diversity Project panel) and found correlations with climate variables using rank correlation analysis and a newly developed method termed Bayesian geographic analysis. In addition, we genotyped 210 carefully matched control SNPs to provide an empirical null distribution for spatial patterns of allele frequency due to population history alone. For nearly all climate variables, we found an excess of genic SNPs in the tail of the distributions of the test statistics compared to the control SNPs, implying that metabolic genes as a group show signals of spatially varying selection. Among our strongest signals were several SNPs (e.g., LEPR R109K, FABP2 A54T) that had previously been associated with phenotypes directly related to cold tolerance. Since variation in climate may be correlated with other aspects of environmental variation, it is possible that some of the signals that we detected reflect selective pressures other than climate. Nevertheless, our results are consistent with the idea that climate has been an important selective pressure acting on candidate genes for common metabolic disorders. PMID:18282109

The candidate tumor suppressor gene, RASSF1A, from human chromosome 3p21.3 is involved in kidney tumorigenesis

PubMed Central

Dreijerink, Koen; Braga, Eleonora; Kuzmin, Igor; Geil, Laura; Duh, Fuh-Mei; Angeloni, Debora; Zbar, Berton; Lerman, Michael I.; Stanbridge, Eric J.; Minna, John D.; Protopopov, Alexei; Li, Jingfeng; Kashuba, Vladimir; Klein, George; Zabarovsky, Eugene R.

2001-01-01

Clear cell-type renal cell carcinomas (clear RCC) are characterized almost universally by loss of heterozygosity on chromosome 3p, which usually involves any combination of three regions: 3p25-p26 (harboring the VHL gene), 3p12-p14.2 (containing the FHIT gene), and 3p21-p22, implying inactivation of the resident tumor-suppressor genes (TSGs). For the 3p21-p22 region, the affected TSGs remain, at present, unknown. Recently, the RAS association family 1 gene (isoform RASSF1A), located at 3p21.3, has been identified as a candidate lung and breast TSG. In this report, we demonstrate aberrant silencing by hypermethylation of RASSF1A in both VHL-caused clear RCC tumors and clear RCC without VHL inactivation. We found hypermethylation of RASSF1A's GC-rich putative promoter region in most of analyzed samples, including 39 of 43 primary tumors (91%). The promoter was methylated partially or completely in all 18 RCC cell lines analyzed. Methylation of the GC-rich putative RASSF1A promoter region and loss of transcription of the corresponding mRNA were related causally. RASSF1A expression was reactivated after treatment with 5-aza-2′-deoxycytidine. Forced expression of RASSF1A transcripts in KRC/Y, a renal carcinoma cell line containing a normal and expressed VHL gene, suppressed growth on plastic dishes and anchorage-independent colony formation in soft agar. Mutant RASSF1A had reduced growth suppression activity significantly. These data suggest that RASSF1A is the candidate renal TSG gene for the 3p21.3 region. PMID:11390984

Genetic Predictors of Susceptibility to Cutaneous Fungal Infections: a pilot Genome Wide Association Study to Refine a Candidate Gene Search

PubMed Central

Abdel-Rahman, Susan M.; Preuett, Barry L.

2012-01-01

Background Trichophyton tonsurans is the foremost fungal pathogen of minority children in the U.S. Despite overwhelming infection rates, it does not appear that this fungus infects children in a non-specific manner. Objective This study was designed to identify genes that may predispose or protect a child from T. tonsurans infection. Methods Children participating in an earlier longitudinal study wherein infection rates could be reliably determined were eligible for inclusion. DNA from a subset (n=40) of these children at the population extremes underwent whole genome genotyping (WGG). Allele frequencies between cases and controls were examined and significant SNPs were used to develop a candidate gene list for which the remainder of the cohort (n=115) were genotyped. Cumulative infection rate was examined by genotype and the ability of selected genotypes to predict the likelihood of infection explored by multivariable analysis. Results 23 genes with a putative mechanistic role in cutaneous infection were selected for evaluation. Of these, 21 demonstrated significant differences in infection rate between genotypes. A risk index assigned to genotypes in the 21 genes accounted for over 60% of the variability observed in infection rate (adjusted r2=0.665, p<0.001). Among these, 8 appeared to account for the majority of variability that was observed (r2=0.603, p<0.001). These included genes involved in: leukocyte activation and migration, extracellular matrix integrity and remodeling, epidermal maintenance and wound repair, and cutaneous permeability. Conclusions Applying WGG to individuals at the extremes of phenotype can help to guide the selection of candidate genes in populations of small cohorts where disease etiology is likely polygenic in nature. PMID:22704677

The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color

PubMed Central

2013-01-01

Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509

Association of lung function genes with chronic obstructive pulmonary disease.

PubMed

Kim, Woo Jin; Lim, Myoung Nam; Hong, Yoonki; Silverman, Edwin K; Lee, Ji-Hyun; Jung, Bock Hyun; Ra, Seung Won; Choi, Hye Sook; Jung, Young Ju; Park, Yong Bum; Park, Myung Jae; Lee, Sei Won; Lee, Jae Seung; Oh, Yeon-Mok; Lee, Sang Do

2014-08-01

Spirometric measurements of pulmonary function are important in diagnosing and determining the severity of chronic obstructive pulmonary disease (COPD). We performed this study to determine whether candidate genes identified in genome-wide association studies of spirometric measurements were associated with COPD and if they interacted with smoking intensity. The current analysis included 1,000 COPD subjects and 1,000 controls recruited from 24 hospital-based pulmonary clinics. Thirteen SNPs, chosen based on genome-wide association studies of spirometric measurements in the Korean population cohorts, were genotyped. Genetic association tests were performed, adjusting for age, sex, and smoking intensity, using models including a SNP-by-smoking interaction term. PID1 and FAM13A were significantly associated with COPD susceptibility. There were also significant interactions between SNPs in ACN9 and FAM13A and smoking pack-years, and an association of ACN9 with COPD in the lowest smoking tertile. The risk allele of FAM13A was associated with increased expression of FAM13A in the lung. We have validated associations of FAM13A and PID1 with COPD. ACN9 showed significant interaction with smoking and is a potential candidate gene for COPD. Significant associations of genetic variants of FAM13A with gene expression levels suggest that the associated loci may act as genetic regulatory elements for FAM13A gene expression.

Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis.

PubMed

dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

2015-01-01

Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis.

Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis

PubMed Central

dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

2015-01-01

Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928

Candidate genes that have facilitated freshwater adaptation by palaemonid prawns in the genus Macrobrachium: identification and expression validation in a model species (M. koombooloomba).

PubMed

Rahi, Md Lifat; Amin, Shorash; Mather, Peter B; Hurwood, David A

2017-01-01

The endemic Australian freshwater prawn, Macrobrachium koombooloomba , provides a model for exploring genes involved with freshwater adaptation because it is one of the relatively few Macrobrachium species that can complete its entire life cycle in freshwater. The present study was conducted to identify potential candidate genes that are likely to contribute to effective freshwater adaptation by M. koombooloomba using a transcriptomics approach. De novo assembly of 75 bp paired end 227,564,643 high quality Illumina raw reads from 6 different cDNA libraries revealed 125,917 contigs of variable lengths (200-18,050 bp) with an N50 value of 1597. In total, 31,272 (24.83%) of the assembled contigs received significant blast hits, of which 27,686 and 22,560 contigs were mapped and functionally annotated, respectively. CEGMA (Core Eukaryotic Genes Mapping Approach) based transcriptome quality assessment revealed 96.37% completeness. We identified 43 different potential genes that are likely to be involved with freshwater adaptation in M. koombooloomba . Identified candidate genes included: 25 genes for osmoregulation, five for cell volume regulation, seven for stress tolerance, three for body fluid (haemolymph) maintenance, eight for epithelial permeability and water channel regulation, nine for egg size control and three for larval development. RSEM (RNA-Seq Expectation Maximization) based abundance estimation revealed that 6,253, 5,753 and 3,795 transcripts were expressed (at TPM value ≥10) in post larvae, juveniles and adults, respectively. Differential gene expression (DGE) analysis showed that 15 genes were expressed differentially in different individuals but these genes apparently were not involved with freshwater adaptation but rather were involved in growth, development and reproductive maturation. The genomic resources developed here will be useful for better understanding the molecular basis of freshwater adaptation in Macrobrachium prawns and other crustaceans more broadly.

Candidate genes that have facilitated freshwater adaptation by palaemonid prawns in the genus Macrobrachium: identification and expression validation in a model species (M. koombooloomba)

PubMed Central

Amin, Shorash; Mather, Peter B.; Hurwood, David A.

2017-01-01

Background The endemic Australian freshwater prawn, Macrobrachium koombooloomba, provides a model for exploring genes involved with freshwater adaptation because it is one of the relatively few Macrobrachium species that can complete its entire life cycle in freshwater. Methods The present study was conducted to identify potential candidate genes that are likely to contribute to effective freshwater adaptation by M. koombooloomba using a transcriptomics approach. De novo assembly of 75 bp paired end 227,564,643 high quality Illumina raw reads from 6 different cDNA libraries revealed 125,917 contigs of variable lengths (200–18,050 bp) with an N50 value of 1597. Results In total, 31,272 (24.83%) of the assembled contigs received significant blast hits, of which 27,686 and 22,560 contigs were mapped and functionally annotated, respectively. CEGMA (Core Eukaryotic Genes Mapping Approach) based transcriptome quality assessment revealed 96.37% completeness. We identified 43 different potential genes that are likely to be involved with freshwater adaptation in M. koombooloomba. Identified candidate genes included: 25 genes for osmoregulation, five for cell volume regulation, seven for stress tolerance, three for body fluid (haemolymph) maintenance, eight for epithelial permeability and water channel regulation, nine for egg size control and three for larval development. RSEM (RNA-Seq Expectation Maximization) based abundance estimation revealed that 6,253, 5,753 and 3,795 transcripts were expressed (at TPM value ≥10) in post larvae, juveniles and adults, respectively. Differential gene expression (DGE) analysis showed that 15 genes were expressed differentially in different individuals but these genes apparently were not involved with freshwater adaptation but rather were involved in growth, development and reproductive maturation. Discussion The genomic resources developed here will be useful for better understanding the molecular basis of freshwater adaptation in Macrobrachium prawns and other crustaceans more broadly. PMID:28194319

Time-course microarray analysis for identifying candidate genes involved in obesity-associated pathological changes in the mouse colon.

PubMed

Bae, Yun Jung; Kim, Sung-Eun; Hong, Seong Yeon; Park, Taesun; Lee, Sang Gyu; Choi, Myung-Sook; Sung, Mi-Kyung

2016-01-01

Obesity is known to increase the risk of colorectal cancer. However, mechanisms underlying the pathogenesis of obesity-induced colorectal cancer are not completely understood. The purposes of this study were to identify differentially expressed genes in the colon of mice with diet-induced obesity and to select candidate genes as early markers of obesity-associated abnormal cell growth in the colon. C57BL/6N mice were fed normal diet (11% fat energy) or high-fat diet (40% fat energy) and were euthanized at different time points. Genome-wide expression profiles of the colon were determined at 2, 4, 8, and 12 weeks. Cluster analysis was performed using expression data of genes showing log 2 fold change of ≥1 or ≤-1 (twofold change), based on time-dependent expression patterns, followed by virtual network analysis. High-fat diet-fed mice showed significant increase in body weight and total visceral fat weight over 12 weeks. Time-course microarray analysis showed that 50, 47, 36, and 411 genes were differentially expressed at 2, 4, 8, and 12 weeks, respectively. Ten cluster profiles representing distinguishable patterns of genes differentially expressed over time were determined. Cluster 4, which consisted of genes showing the most significant alterations in expression in response to high-fat diet over 12 weeks, included Apoa4 (apolipoprotein A-IV), Ppap2b (phosphatidic acid phosphatase type 2B), Cel (carboxyl ester lipase), and Clps (colipase, pancreatic), which interacted strongly with surrounding genes associated with colorectal cancer or obesity. Our data indicate that Apoa4 , Ppap2b , Cel , and Clps are candidate early marker genes associated with obesity-related pathological changes in the colon. Genome-wide analyses performed in the present study provide new insights on selecting novel genes that may be associated with the development of diseases of the colon.

Comparison of Expression Profiles in Ovarian Epithelium In Vivo and Ovarian Cancer Identifies Novel Candidate Genes Involved in Disease Pathogenesis

PubMed Central

Emmanuel, Catherine; Gava, Natalie; Kennedy, Catherine; Balleine, Rosemary L.; Sharma, Raghwa; Wain, Gerard; Brand, Alison; Hogg, Russell; Etemadmoghadam, Dariush; George, Joshy; Birrer, Michael J.; Clarke, Christine L.; Chenevix-Trench, Georgia; Bowtell, David D. L.; Harnett, Paul R.; deFazio, Anna

2011-01-01

Molecular events leading to epithelial ovarian cancer are poorly understood but ovulatory hormones and a high number of life-time ovulations with concomitant proliferation, apoptosis, and inflammation, increases risk. We identified genes that are regulated during the estrous cycle in murine ovarian surface epithelium and analysed these profiles to identify genes dysregulated in human ovarian cancer, using publically available datasets. We identified 338 genes that are regulated in murine ovarian surface epithelium during the estrous cycle and dysregulated in ovarian cancer. Six of seven candidates selected for immunohistochemical validation were expressed in serous ovarian cancer, inclusion cysts, ovarian surface epithelium and in fallopian tube epithelium. Most were overexpressed in ovarian cancer compared with ovarian surface epithelium and/or inclusion cysts (EpCAM, EZH2, BIRC5) although BIRC5 and EZH2 were expressed as highly in fallopian tube epithelium as in ovarian cancer. We prioritised the 338 genes for those likely to be important for ovarian cancer development by in silico analyses of copy number aberration and mutation using publically available datasets and identified genes with established roles in ovarian cancer as well as novel genes for which we have evidence for involvement in ovarian cancer. Chromosome segregation emerged as an important process in which genes from our list of 338 were over-represented including two (BUB1, NCAPD2) for which there is evidence of amplification and mutation. NUAK2, upregulated in ovarian surface epithelium in proestrus and predicted to have a driver mutation in ovarian cancer, was examined in a larger cohort of serous ovarian cancer where patients with lower NUAK2 expression had shorter overall survival. In conclusion, defining genes that are activated in normal epithelium in the course of ovulation that are also dysregulated in cancer has identified a number of pathways and novel candidate genes that may contribute to the development of ovarian cancer. PMID:21423607

Genome-wide association links candidate genes to resistance to Plum Pox Virus in apricot (Prunus armeniaca).

PubMed

Mariette, Stéphanie; Wong Jun Tai, Fabienne; Roch, Guillaume; Barre, Aurélien; Chague, Aurélie; Decroocq, Stéphane; Groppi, Alexis; Laizet, Yec'han; Lambert, Patrick; Tricon, David; Nikolski, Macha; Audergon, Jean-Marc; Abbott, Albert G; Decroocq, Véronique

2016-01-01

In fruit tree species, many important traits have been characterized genetically by using single-family descent mapping in progenies segregating for the traits. However, most mapped loci have not been sufficiently resolved to the individual genes due to insufficient progeny sizes for high resolution mapping and the previous lack of whole-genome sequence resources of the study species. To address this problem for Plum Pox Virus (PPV) candidate resistance gene identification in Prunus species, we implemented a genome-wide association (GWA) approach in apricot. This study exploited the broad genetic diversity of the apricot (Prunus armeniaca) germplasm containing resistance to PPV, next-generation sequence-based genotyping, and the high-quality peach (Prunus persica) genome reference sequence for single nucleotide polymorphism (SNP) identification. The results of this GWA study validated previously reported PPV resistance quantitative trait loci (QTL) intervals, highlighted other potential resistance loci, and resolved each to a limited set of candidate genes for further study. This work substantiates the association genetics approach for resolution of QTL to candidate genes in apricot and suggests that this approach could simplify identification of other candidate genes for other marked trait intervals in this germplasm. © 2015 INRA, UMR 1332 BFP New Phytologist © 2015 New Phytologist Trust.

Genetics of primary ovarian insufficiency: new developments and opportunities

PubMed Central

Qin, Yingying; Jiao, Xue; Simpson, Joe Leigh; Chen, Zi-Jiang

2015-01-01

BACKGROUND Primary ovarian insufficiency (POI) is characterized by marked heterogeneity, but with a significant genetic contribution. Identifying exact causative genes has been challenging, with many discoveries not replicated. It is timely to take stock of the field, outlining the progress made, framing the controversies and anticipating future directions in elucidating the genetics of POI. METHODS A search for original articles published up to May 2015 was performed using PubMed and Google Scholar, identifying studies on the genetic etiology of POI. Studies were included if chromosomal analysis, candidate gene screening and a genome-wide study were conducted. Articles identified were restricted to English language full-text papers. RESULTS Chromosomal abnormalities have long been recognized as a frequent cause of POI, with a currently estimated prevalence of 10–13%. Using the traditional karyotype methodology, monosomy X, mosaicism, X chromosome deletions and rearrangements, X-autosome translocations, and isochromosomes have been detected. Based on candidate gene studies, single gene perturbations unequivocally having a deleterious effect in at least one population include Bone morphogenetic protein 15 (BMP15), Progesterone receptor membrane component 1 (PGRMC1), and Fragile X mental retardation 1 (FMR1) premutation on the X chromosome; Growth differentiation factor 9 (GDF9), Folliculogenesis specific bHLH transcription factor (FIGLA), Newborn ovary homeobox gene (NOBOX), Nuclear receptor subfamily 5, group A, member 1 (NR5A1) and Nanos homolog 3 (NANOS3) seem likely as well, but mostly being found in no more than 1–2% of a single population studied. Whole genome approaches have utilized genome-wide association studies (GWAS) to reveal loci not predicted on the basis of a candidate gene, but it remains difficult to locate causative genes and susceptible loci were not always replicated. Cytogenomic methods (array CGH) have identified other regions of interest but studies have not shown consistent results, the resolution of arrays has varied and replication is uncommon. Whole-exome sequencing in non-syndromic POI kindreds has only recently begun, revealing mutations in the Stromal antigen 3 (STAG3), Synaptonemal complex central element 1 (SYCE1), minichromosome maintenance complex component 8 and 9 (MCM8, MCM9) and ATP-dependent DNA helicase homolog (HFM1) genes. Given the slow progress in candidate-gene analysis and relatively small sample sizes available for GWAS, family-based whole exome and whole genome sequencing appear to be the most promising approaches for detecting potential genes responsible for POI. CONCLUSION Taken together, the cytogenetic, cytogenomic (array CGH) and exome sequencing approaches have revealed a genetic causation in ∼20–25% of POI cases. Uncovering the remainder of the causative genes will be facilitated not only by whole genome approaches involving larger cohorts in multiple populations but also incorporating environmental exposures and exploring signaling pathways in intragenic and intergenic regions that point to perturbations in regulatory genes and networks. PMID:26243799

Genetics of primary ovarian insufficiency: new developments and opportunities.

PubMed

Qin, Yingying; Jiao, Xue; Simpson, Joe Leigh; Chen, Zi-Jiang

2015-01-01

Primary ovarian insufficiency (POI) is characterized by marked heterogeneity, but with a significant genetic contribution. Identifying exact causative genes has been challenging, with many discoveries not replicated. It is timely to take stock of the field, outlining the progress made, framing the controversies and anticipating future directions in elucidating the genetics of POI. A search for original articles published up to May 2015 was performed using PubMed and Google Scholar, identifying studies on the genetic etiology of POI. Studies were included if chromosomal analysis, candidate gene screening and a genome-wide study were conducted. Articles identified were restricted to English language full-text papers. Chromosomal abnormalities have long been recognized as a frequent cause of POI, with a currently estimated prevalence of 10-13%. Using the traditional karyotype methodology, monosomy X, mosaicism, X chromosome deletions and rearrangements, X-autosome translocations, and isochromosomes have been detected. Based on candidate gene studies, single gene perturbations unequivocally having a deleterious effect in at least one population include Bone morphogenetic protein 15 (BMP15), Progesterone receptor membrane component 1 (PGRMC1), and Fragile X mental retardation 1 (FMR1) premutation on the X chromosome; Growth differentiation factor 9 (GDF9), Folliculogenesis specific bHLH transcription factor (FIGLA), Newborn ovary homeobox gene (NOBOX), Nuclear receptor subfamily 5, group A, member 1 (NR5A1) and Nanos homolog 3 (NANOS3) seem likely as well, but mostly being found in no more than 1-2% of a single population studied. Whole genome approaches have utilized genome-wide association studies (GWAS) to reveal loci not predicted on the basis of a candidate gene, but it remains difficult to locate causative genes and susceptible loci were not always replicated. Cytogenomic methods (array CGH) have identified other regions of interest but studies have not shown consistent results, the resolution of arrays has varied and replication is uncommon. Whole-exome sequencing in non-syndromic POI kindreds has only recently begun, revealing mutations in the Stromal antigen 3 (STAG3), Synaptonemal complex central element 1 (SYCE1), minichromosome maintenance complex component 8 and 9 (MCM8, MCM9) and ATP-dependent DNA helicase homolog (HFM1) genes. Given the slow progress in candidate-gene analysis and relatively small sample sizes available for GWAS, family-based whole exome and whole genome sequencing appear to be the most promising approaches for detecting potential genes responsible for POI. Taken together, the cytogenetic, cytogenomic (array CGH) and exome sequencing approaches have revealed a genetic causation in ∼20-25% of POI cases. Uncovering the remainder of the causative genes will be facilitated not only by whole genome approaches involving larger cohorts in multiple populations but also incorporating environmental exposures and exploring signaling pathways in intragenic and intergenic regions that point to perturbations in regulatory genes and networks. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology.

Adaptation to climate through flowering phenology: a case study in Medicago truncatula.

PubMed

Burgarella, Concetta; Chantret, Nathalie; Gay, Laurène; Prosperi, Jean-Marie; Bonhomme, Maxime; Tiffin, Peter; Young, Nevin D; Ronfort, Joelle

2016-07-01

Local climatic conditions likely constitute an important selective pressure on genes underlying important fitness-related traits such as flowering time, and in many species, flowering phenology and climatic gradients strongly covary. To test whether climate shapes the genetic variation on flowering time genes and to identify candidate flowering genes involved in the adaptation to environmental heterogeneity, we used a large Medicago truncatula core collection to examine the association between nucleotide polymorphisms at 224 candidate genes and both climate variables and flowering phenotypes. Unlike genome-wide studies, candidate gene approaches are expected to enrich for the number of meaningful trait associations because they specifically target genes that are known to affect the trait of interest. We found that flowering time mediates adaptation to climatic conditions mainly by variation at genes located upstream in the flowering pathways, close to the environmental stimuli. Variables related to the annual precipitation regime reflected selective constraints on flowering time genes better than the other variables tested (temperature, altitude, latitude or longitude). By comparing phenotype and climate associations, we identified 12 flowering genes as the most promising candidates responsible for phenological adaptation to climate. Four of these genes were located in the known flowering time QTL region on chromosome 7. However, climate and flowering associations also highlighted largely distinct gene sets, suggesting different genetic architectures for adaptation to climate and flowering onset. © 2016 John Wiley & Sons Ltd.

Gene expression analysis of a Helicobacter pylori-infected and high-salt diet-treated mouse gastric tumor model: identification of CD177 as a novel prognostic factor in patients with gastric cancer

PubMed Central

2013-01-01

Background Helicobacter pylori (H. pylori) infection and excessive salt intake are known as important risk factors for stomach cancer in humans. However, interactions of these two factors with gene expression profiles during gastric carcinogenesis remain unclear. In the present study, we investigated the global gene expression associated with stomach carcinogenesis and prognosis of human gastric cancer using a mouse model. Methods To find candidate genes involved in stomach carcinogenesis, we firstly constructed a carcinogen-induced mouse gastric tumor model combined with H. pylori infection and high-salt diet. C57BL/6J mice were given N-methyl-N-nitrosourea in their drinking water and sacrificed after 40 weeks. Animals of a combination group were inoculated with H. pylori and fed a high-salt diet. Gene expression profiles in glandular stomach of the mice were investigated by oligonucleotide microarray. Second, we examined an availability of the candidate gene as prognostic factor for human patients. Immunohistochemical analysis of CD177, one of the up-regulated genes, was performed in human advanced gastric cancer specimens to evaluate the association with prognosis. Results The multiplicity of gastric tumor in carcinogen-treated mice was significantly increased by combination of H. pylori infection and high-salt diet. In the microarray analysis, 35 and 31 more than two-fold up-regulated and down-regulated genes, respectively, were detected in the H. pylori-infection and high-salt diet combined group compared with the other groups. Quantitative RT-PCR confirmed significant over-expression of two candidate genes including Cd177 and Reg3g. On immunohistochemical analysis of CD177 in human advanced gastric cancer specimens, over-expression was evident in 33 (60.0%) of 55 cases, significantly correlating with a favorable prognosis (P = 0.0294). Multivariate analysis including clinicopathological factors as covariates revealed high expression of CD177 to be an independent prognostic factor for overall survival. Conclusions These results suggest that our mouse model combined with H. pylori infection and high-salt diet is useful for gene expression profiling in gastric carcinogenesis, providing evidence that CD177 is a novel prognostic factor for stomach cancer. This is the first report showing a prognostic correlation between CD177 expression and solid tumor behavior. PMID:23899160

Genetic risk prediction and neurobiological understanding of alcoholism.

PubMed

Levey, D F; Le-Niculescu, H; Frank, J; Ayalew, M; Jain, N; Kirlin, B; Learman, R; Winiger, E; Rodd, Z; Shekhar, A; Schork, N; Kiefer, F; Kiefe, F; Wodarz, N; Müller-Myhsok, B; Dahmen, N; Nöthen, M; Sherva, R; Farrer, L; Smith, A H; Kranzler, H R; Rietschel, M; Gelernter, J; Niculescu, A B

2014-05-20

We have used a translational Convergent Functional Genomics (CFG) approach to discover genes involved in alcoholism, by gene-level integration of genome-wide association study (GWAS) data from a German alcohol dependence cohort with other genetic and gene expression data, from human and animal model studies, similar to our previous work in bipolar disorder and schizophrenia. A panel of all the nominally significant P-value SNPs in the top candidate genes discovered by CFG  (n=135 genes, 713 SNPs) was used to generate a genetic  risk prediction score (GRPS), which showed a trend towards significance (P=0.053) in separating  alcohol dependent individuals from controls in an independent German test cohort. We then validated and prioritized our top findings from this discovery work, and subsequently tested them in three independent cohorts, from two continents. A panel of all the nominally significant P-value single-nucleotide length polymorphisms (SNPs) in the top candidate genes discovered by CFG (n=135 genes, 713 SNPs) were used to generate a Genetic Risk Prediction Score (GRPS), which showed a trend towards significance (P=0.053) in separating alcohol-dependent individuals from controls in an independent German test cohort. In order to validate and prioritize the key genes that drive behavior without some of the pleiotropic environmental confounds present in humans, we used a stress-reactive animal model of alcoholism developed by our group, the D-box binding protein (DBP) knockout mouse, consistent with the surfeit of stress theory of addiction proposed by Koob and colleagues. A much smaller panel (n=11 genes, 66 SNPs) of the top CFG-discovered genes for alcoholism, cross-validated and prioritized by this stress-reactive animal model showed better predictive ability in the independent German test cohort (P=0.041). The top CFG scoring gene for alcoholism from the initial discovery step, synuclein alpha (SNCA) remained the top gene after the stress-reactive animal model cross-validation. We also tested this small panel of genes in two other independent test cohorts from the United States, one with alcohol dependence (P=0.00012) and one with alcohol abuse (a less severe form of alcoholism; P=0.0094). SNCA by itself was able to separate alcoholics from controls in the alcohol-dependent cohort (P=0.000013) and the alcohol abuse cohort (P=0.023). So did eight other genes from the panel of 11 genes taken individually, albeit to a lesser extent and/or less broadly across cohorts. SNCA, GRM3 and MBP survived strict Bonferroni correction for multiple comparisons. Taken together, these results suggest that our stress-reactive DBP animal model helped to validate and prioritize from the CFG-discovered genes some of the key behaviorally relevant genes for alcoholism. These genes fall into a series of biological pathways involved in signal transduction, transmission of nerve impulse (including myelination) and cocaine addiction. Overall, our work provides leads towards a better understanding of illness, diagnostics and therapeutics, including treatment with omega-3 fatty acids. We also examined the overlap between the top candidate genes for alcoholism from this work and the top candidate genes for bipolar disorder, schizophrenia, anxiety from previous CFG analyses conducted by us, as well as cross-tested genetic risk predictions. This revealed the significant genetic overlap with other major psychiatric disorder domains, providing a basis for comorbidity and dual diagnosis, and placing alcohol use in the broader context of modulating the mental landscape.

A Strategy to Validate the Role of Callose-mediated Plasmodesmal Gating in the Tropic Response.

PubMed

Kumar, Ritesh; Wu, Shu Wei; Iswanto, Arya Bagus Boedi; Kumar, Dhinesh; Han, Xiao; Kim, Jae-Yean

2016-04-17

The plant hormone auxin plays an important role in many growth and developmental processes, including tropic responses to light and gravity. The establishment of an auxin gradient is a key event leading to phototropism and gravitropism. Previously, polar auxin transport (PAT) was shown to establish an auxin gradient in different cellular domains of plants. However, Han et al. recently demonstrated that for proper auxin gradient formation, plasmodesmal callose-mediated symplasmic connectivity between the adjacent cells is also a critical factor. In this manuscript, the strategy to elucidate the role of particular genes, which can affect phototropism and gravitropism by altering the symplasmic connectivity through modulating plasmodesmal callose synthesis, is discussed. The first step is to screen aberrant tropic responses from 3-day-old etiolated seedlings of mutants or over-expression lines of a gene along with the wild type. This preliminary screening can lead to the identification of a range of genes functioning in PAT or controlling symplasmic connectivity. The second screening involves the sorting of candidates that show altered tropic responses by affecting symplasmic connectivity. To address such candidates, the movement of a symplasmic tracer and the deposition of plasmodesmal callose were examined. This strategy would be useful to explore new candidate genes that can regulate symplasmic connectivity directly or indirectly during tropic responses and other developmental processes.

Loci and candidate genes conferring resistance to soybean cyst nematode HG type 2.5.7.

PubMed

Zhao, Xue; Teng, Weili; Li, Yinghui; Liu, Dongyuan; Cao, Guanglu; Li, Dongmei; Qiu, Lijuan; Zheng, Hongkun; Han, Yingpeng; Li, Wenbin

2017-06-14

Soybean (Glycine max L. Merr.) cyst nematode (SCN, Heterodera glycines I,) is a major pest of soybean worldwide. The most effective strategy to control this pest involves the use of resistant cultivars. The aim of the present study was to investigate the genome-wide genetic architecture of resistance to SCN HG Type 2.5.7 (race 1) in landrace and elite cultivated soybeans. A total of 200 diverse soybean accessions were screened for resistance to SCN HG Type 2.5.7 and genotyped through sequencing using the Specific Locus Amplified Fragment Sequencing (SLAF-seq) approach with a 6.14-fold average sequencing depth. A total of 33,194 SNPs were identified with minor allele frequencies (MAF) over 4%, covering 97% of all the genotypes. Genome-wide association mapping (GWAS) revealed thirteen SNPs associated with resistance to SCN HG Type 2.5.7. These SNPs were distributed on five chromosomes (Chr), including Chr7, 8, 14, 15 and 18. Four SNPs were novel resistance loci and nine SNPs were located near known QTL. A total of 30 genes were identified as candidate genes underlying SCN resistance. A total of sixteen novel soybean accessions were identified with significant resistance to HG Type 2.5.7. The beneficial alleles and candidate genes identified by GWAS might be valuable for improving marker-assisted breeding efficiency and exploring the molecular mechanisms underlying SCN resistance.

Genetic Variants Identified from Epilepsy of Unknown Etiology in Chinese Children by Targeted Exome Sequencing

PubMed Central

Wang, Yimin; Du, Xiaonan; Bin, Rao; Yu, Shanshan; Xia, Zhezhi; Zheng, Guo; Zhong, Jianmin; Zhang, Yunjian; Jiang, Yong-hui; Wang, Yi

2017-01-01

Genetic factors play a major role in the etiology of epilepsy disorders. Recent genomics studies using next generation sequencing (NGS) technique have identified a large number of genetic variants including copy number (CNV) and single nucleotide variant (SNV) in a small set of genes from individuals with epilepsy. These discoveries have contributed significantly to evaluate the etiology of epilepsy in clinic and lay the foundation to develop molecular specific treatment. However, the molecular basis for a majority of epilepsy patients remains elusive, and furthermore, most of these studies have been conducted in Caucasian children. Here we conducted a targeted exome-sequencing of 63 trios of Chinese epilepsy families using a custom-designed NGS panel that covers 412 known and candidate genes for epilepsy. We identified pathogenic and likely pathogenic variants in 15 of 63 (23.8%) families in known epilepsy genes including SCN1A, CDKL5, STXBP1, CHD2, SCN3A, SCN9A, TSC2, MBD5, POLG and EFHC1. More importantly, we identified likely pathologic variants in several novel candidate genes such as GABRE, MYH1, and CLCN6. Our results provide the evidence supporting the application of custom-designed NGS panel in clinic and indicate a conserved genetic susceptibility for epilepsy between Chinese and Caucasian children. PMID:28074849

Utilizing the Dog Genome in the Search for Novel Candidate Genes Involved in Glioma Development—Genome Wide Association Mapping followed by Targeted Massive Parallel Sequencing Identifies a Strongly Associated Locus

PubMed Central

Dickinson, Peter; Xiong, Anqi; York, Daniel; Jayashankar, Kartika; Pielberg, Gerli; Koltookian, Michele; Murén, Eva; Fuxelius, Hans-Henrik; Weishaupt, Holger; Andersson, Göran; Hedhammar, Åke; Bongcam-Rudloff, Erik; Forsberg-Nilsson, Karin

2016-01-01

Gliomas are the most common form of malignant primary brain tumors in humans and second most common in dogs, occurring with similar frequencies in both species. Dogs are valuable spontaneous models of human complex diseases including cancers and may provide insight into disease susceptibility and oncogenesis. Several brachycephalic breeds such as Boxer, Bulldog and Boston Terrier have an elevated risk of developing glioma, but others, including Pug and Pekingese, are not at higher risk. To identify glioma-associated genetic susceptibility factors, an across-breed genome-wide association study (GWAS) was performed on 39 dog glioma cases and 141 controls from 25 dog breeds, identifying a genome-wide significant locus on canine chromosome (CFA) 26 (p = 2.8 x 10−8). Targeted re-sequencing of the 3.4 Mb candidate region was performed, followed by genotyping of the 56 SNVs that best fit the association pattern between the re-sequenced cases and controls. We identified three candidate genes that were highly associated with glioma susceptibility: CAMKK2, P2RX7 and DENR. CAMKK2 showed reduced expression in both canine and human brain tumors, and a non-synonymous variant in P2RX7, previously demonstrated to have a 50% decrease in receptor function, was also associated with disease. Thus, one or more of these genes appear to affect glioma susceptibility. PMID:27171399

Transcriptome profiling of two maize inbreds with distinct responses to Gibberella ear rot disease to identify candidate resistance genes.

PubMed

Kebede, Aida Z; Johnston, Anne; Schneiderman, Danielle; Bosnich, Whynn; Harris, Linda J

2018-02-09

Gibberella ear rot (GER) is one of the most economically important fungal diseases of maize in the temperate zone due to moldy grain contaminated with health threatening mycotoxins. To develop resistant genotypes and control the disease, understanding the host-pathogen interaction is essential. RNA-Seq-derived transcriptome profiles of fungal- and mock-inoculated developing kernel tissues of two maize inbred lines were used to identify differentially expressed transcripts and propose candidate genes mapping within GER resistance quantitative trait loci (QTL). A total of 1255 transcripts were significantly (P ≤ 0.05) up regulated due to fungal infection in both susceptible and resistant inbreds. A greater number of transcripts were up regulated in the former (1174) than the latter (497) and increased as the infection progressed from 1 to 2 days after inoculation. Focusing on differentially expressed genes located within QTL regions for GER resistance, we identified 81 genes involved in membrane transport, hormone regulation, cell wall modification, cell detoxification, and biosynthesis of pathogenesis related proteins and phytoalexins as candidate genes contributing to resistance. Applying droplet digital PCR, we validated the expression profiles of a subset of these candidate genes from QTL regions contributed by the resistant inbred on chromosomes 1, 2 and 9. By screening global gene expression profiles for differentially expressed genes mapping within resistance QTL regions, we have identified candidate genes for gibberella ear rot resistance on several maize chromosomes which could potentially lead to a better understanding of Fusarium resistance mechanisms.

An Integrative Genetics Approach to Identify Candidate Genes Regulating BMD: Combining Linkage, Gene Expression, and Association

PubMed Central

Farber, Charles R; van Nas, Atila; Ghazalpour, Anatole; Aten, Jason E; Doss, Sudheer; Sos, Brandon; Schadt, Eric E; Ingram-Drake, Leslie; Davis, Richard C; Horvath, Steve; Smith, Desmond J; Drake, Thomas A; Lusis, Aldons J

2009-01-01

Numerous quantitative trait loci (QTLs) affecting bone traits have been identified in the mouse; however, few of the underlying genes have been discovered. To improve the process of transitioning from QTL to gene, we describe an integrative genetics approach, which combines linkage analysis, expression QTL (eQTL) mapping, causality modeling, and genetic association in outbred mice. In C57BL/6J × C3H/HeJ (BXH) F2 mice, nine QTLs regulating femoral BMD were identified. To select candidate genes from within each QTL region, microarray gene expression profiles from individual F2 mice were used to identify 148 genes whose expression was correlated with BMD and regulated by local eQTLs. Many of the genes that were the most highly correlated with BMD have been previously shown to modulate bone mass or skeletal development. Candidates were further prioritized by determining whether their expression was predicted to underlie variation in BMD. Using network edge orienting (NEO), a causality modeling algorithm, 18 of the 148 candidates were predicted to be causally related to differences in BMD. To fine-map QTLs, markers in outbred MF1 mice were tested for association with BMD. Three chromosome 11 SNPs were identified that were associated with BMD within the Bmd11 QTL. Finally, our approach provides strong support for Wnt9a, Rasd1, or both underlying Bmd11. Integration of multiple genetic and genomic data sets can substantially improve the efficiency of QTL fine-mapping and candidate gene identification. PMID:18767929

A Stratified Transcriptomics Analysis of Polygenic Fat and Lean Mouse Adipose Tissues Identifies Novel Candidate Obesity Genes

PubMed Central

Morton, Nicholas M.; Nelson, Yvonne B.; Michailidou, Zoi; Di Rollo, Emma M.; Ramage, Lynne; Hadoke, Patrick W. F.; Seckl, Jonathan R.; Bunger, Lutz; Horvat, Simon; Kenyon, Christopher J.; Dunbar, Donald R.

2011-01-01

Background Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F) mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L) strain. Results To enrich for adipose tissue obesity genes a ‘snap-shot’ pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney) was performed. Known obesity quantitative trait loci (QTL) information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r) as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr) that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity. Conclusions A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity. PMID:21915269

A stratified transcriptomics analysis of polygenic fat and lean mouse adipose tissues identifies novel candidate obesity genes.

PubMed

Morton, Nicholas M; Nelson, Yvonne B; Michailidou, Zoi; Di Rollo, Emma M; Ramage, Lynne; Hadoke, Patrick W F; Seckl, Jonathan R; Bunger, Lutz; Horvat, Simon; Kenyon, Christopher J; Dunbar, Donald R

2011-01-01

Obesity and metabolic syndrome results from a complex interaction between genetic and environmental factors. In addition to brain-regulated processes, recent genome wide association studies have indicated that genes highly expressed in adipose tissue affect the distribution and function of fat and thus contribute to obesity. Using a stratified transcriptome gene enrichment approach we attempted to identify adipose tissue-specific obesity genes in the unique polygenic Fat (F) mouse strain generated by selective breeding over 60 generations for divergent adiposity from a comparator Lean (L) strain. To enrich for adipose tissue obesity genes a 'snap-shot' pooled-sample transcriptome comparison of key fat depots and non adipose tissues (muscle, liver, kidney) was performed. Known obesity quantitative trait loci (QTL) information for the model allowed us to further filter genes for increased likelihood of being causal or secondary for obesity. This successfully identified several genes previously linked to obesity (C1qr1, and Np3r) as positional QTL candidate genes elevated specifically in F line adipose tissue. A number of novel obesity candidate genes were also identified (Thbs1, Ppp1r3d, Tmepai, Trp53inp2, Ttc7b, Tuba1a, Fgf13, Fmr) that have inferred roles in fat cell function. Quantitative microarray analysis was then applied to the most phenotypically divergent adipose depot after exaggerating F and L strain differences with chronic high fat feeding which revealed a distinct gene expression profile of line, fat depot and diet-responsive inflammatory, angiogenic and metabolic pathways. Selected candidate genes Npr3 and Thbs1, as well as Gys2, a non-QTL gene that otherwise passed our enrichment criteria were characterised, revealing novel functional effects consistent with a contribution to obesity. A focussed candidate gene enrichment strategy in the unique F and L model has identified novel adipose tissue-enriched genes contributing to obesity.

The WRKY Transcription Factor Family in Citrus: Valuable and Useful Candidate Genes for Citrus Breeding.

PubMed

Ayadi, M; Hanana, M; Kharrat, N; Merchaoui, H; Marzoug, R Ben; Lauvergeat, V; Rebaï, A; Mzid, R

2016-10-01

WRKY transcription factors belong to a large family of plant transcriptional regulators whose members have been reported to be involved in a wide range of biological roles including plant development, adaptation to environmental constraints and response to several diseases. However, little or poor information is available about WRKY's in Citrus. The recent release of completely assembled genomes sequences of Citrus sinensis and Citrus clementina and the availability of ESTs sequences from other citrus species allowed us to perform a genome survey for Citrus WRKY proteins. In the present study, we identified 100 WRKY members from C. sinensis (51), C. clementina (48) and Citrus unshiu (1), and analyzed their chromosomal distribution, gene structure, gene duplication, syntenic relation and phylogenetic analysis. A phylogenetic tree of 100 Citrus WRKY sequences with their orthologs from Arabidopsis has distinguished seven groups. The CsWRKY genes were distributed across all ten sweet orange chromosomes. A comprehensive approach and an integrative analysis of Citrus WRKY gene expression revealed variable profiles of expression within tissues and stress conditions indicating functional diversification. Thus, candidate Citrus WRKY genes have been proposed as potentially involved in fruit acidification, essential oil biosynthesis and abiotic/biotic stress tolerance. Our results provided essential prerequisites for further WRKY genes cloning and functional analysis with an aim of citrus crop improvement.

Teaching bioinformatics and neuroinformatics by using free web-based tools.

PubMed

Grisham, William; Schottler, Natalie A; Valli-Marill, Joanne; Beck, Lisa; Beatty, Jackson

2010-01-01

This completely computer-based module's purpose is to introduce students to bioinformatics resources. We present an easy-to-adopt module that weaves together several important bioinformatic tools so students can grasp how these tools are used in answering research questions. Students integrate information gathered from websites dealing with anatomy (Mouse Brain Library), quantitative trait locus analysis (WebQTL from GeneNetwork), bioinformatics and gene expression analyses (University of California, Santa Cruz Genome Browser, National Center for Biotechnology Information's Entrez Gene, and the Allen Brain Atlas), and information resources (PubMed). Instructors can use these various websites in concert to teach genetics from the phenotypic level to the molecular level, aspects of neuroanatomy and histology, statistics, quantitative trait locus analysis, and molecular biology (including in situ hybridization and microarray analysis), and to introduce bioinformatic resources. Students use these resources to discover 1) the region(s) of chromosome(s) influencing the phenotypic trait, 2) a list of candidate genes-narrowed by expression data, 3) the in situ pattern of a given gene in the region of interest, 4) the nucleotide sequence of the candidate gene, and 5) articles describing the gene. Teaching materials such as a detailed student/instructor's manual, PowerPoints, sample exams, and links to free Web resources can be found at http://mdcune.psych.ucla.edu/modules/bioinformatics.

Selection of reference genes for RT-qPCR analysis in a predatory biological control agent, Coleomegilla maculata (Coleoptera: Coccinellidae).

PubMed

Yang, Chunxiao; Pan, Huipeng; Noland, Jeffrey Edward; Zhang, Deyong; Zhang, Zhanhong; Liu, Yong; Zhou, Xuguo

2015-12-10

Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) is a reliable technique for quantifying gene expression across various biological processes, of which requires a set of suited reference genes to normalize the expression data. Coleomegilla maculata (Coleoptera: Coccinellidae), is one of the most extensively used biological control agents in the field to manage arthropod pest species. In this study, expression profiles of 16 housekeeping genes selected from C. maculata were cloned and investigated. The performance of these candidates as endogenous controls under specific experimental conditions was evaluated by dedicated algorithms, including geNorm, Normfinder, BestKeeper, and ΔCt method. In addition, RefFinder, a comprehensive platform integrating all the above-mentioned algorithms, ranked the overall stability of these candidate genes. As a result, various sets of suitable reference genes were recommended specifically for experiments involving different tissues, developmental stages, sex, and C. maculate larvae treated with dietary double stranded RNA. This study represents the critical first step to establish a standardized RT-qPCR protocol for the functional genomics research in a ladybeetle C. maculate. Furthermore, it lays the foundation for conducting ecological risk assessment of RNAi-based gene silencing biotechnologies on non-target organisms; in this case, a key predatory biological control agent.

Identification of evolutionarily conserved DNA damage response genes that alter sensitivity to cisplatin

PubMed Central

Gaponova, Anna V.; Deneka, Alexander Y.; Beck, Tim N.; Liu, Hanqing; Andrianov, Gregory; Nikonova, Anna S.; Nicolas, Emmanuelle; Einarson, Margret B.; Golemis, Erica A.; Serebriiskii, Ilya G.

2017-01-01

Ovarian, head and neck, and other cancers are commonly treated with cisplatin and other DNA damaging cytotoxic agents. Altered DNA damage response (DDR) contributes to resistance of these tumors to chemotherapies, some targeted therapies, and radiation. DDR involves multiple protein complexes and signaling pathways, some of which are evolutionarily ancient and involve protein orthologs conserved from yeast to humans. To identify new regulators of cisplatin-resistance in human tumors, we integrated high throughput and curated datasets describing yeast genes that regulate sensitivity to cisplatin and/or ionizing radiation. Next, we clustered highly validated genes based on chemogenomic profiling, and then mapped orthologs of these genes in expanded genomic networks for multiple metazoans, including humans. This approach identified an enriched candidate set of genes involved in the regulation of resistance to radiation and/or cisplatin in humans. Direct functional assessment of selected candidate genes using RNA interference confirmed their activity in influencing cisplatin resistance, degree of γH2AX focus formation and ATR phosphorylation, in ovarian and head and neck cancer cell lines, suggesting impaired DDR signaling as the driving mechanism. This work enlarges the set of genes that may contribute to chemotherapy resistance and provides a new contextual resource for interpreting next generation sequencing (NGS) genomic profiling of tumors. PMID:27863405

A high-resolution genetic, physical, and comparative gene map of the doublefoot (Dbf) region of mouse chromosome 1 and the region of conserved synteny on human chromosome 2q35.

PubMed

Hayes, C; Rump, A; Cadman, M R; Harrison, M; Evans, E P; Lyon, M F; Morriss-Kay, G M; Rosenthal, A; Brown, S D

2001-12-01

The mouse doublefoot (Dbf) mutant exhibits preaxial polydactyly in association with craniofacial defects. This mutation has previously been mapped to mouse chromosome 1. We have used a positional cloning strategy, coupled with a comparative sequencing approach using available human draft sequence, to identify putative candidates for the Dbf gene in the mouse and in homologous human region. We have constructed a high-resolution genetic map of the region, localizing the mutation to a 0.4-cM (+/-0.0061) interval on mouse chromosome 1. Furthermore, we have constructed contiguous BAC/PAC clone maps across the mouse and human Dbf region. Using existing markers and additional sequence tagged sites, which we have generated, we have anchored the physical map to the genetic map. Through the comparative sequencing of these clones we have identified 35 genes within this interval, indicating that the region is gene-rich. From this we have identified several genes that are known to be differentially expressed in the developing mid-gestation mouse embryo, some in the developing embryonic limb buds. These genes include those encoding known developmental signaling molecules such as WNT proteins and IHH, and we provide evidence that these genes are candidates for the Dbf mutation.

Direct and long-term detection of gene doping in conventional blood samples.

PubMed

Beiter, T; Zimmermann, M; Fragasso, A; Hudemann, J; Niess, A M; Bitzer, M; Lauer, U M; Simon, P

2011-03-01

The misuse of somatic gene therapy for the purpose of enhancing athletic performance is perceived as a coming threat to the world of sports and categorized as 'gene doping'. This article describes a direct detection approach for gene doping that gives a clear yes-or-no answer based on the presence or absence of transgenic DNA in peripheral blood samples. By exploiting a priming strategy to specifically amplify intronless DNA sequences, we developed PCR protocols allowing the detection of very small amounts of transgenic DNA in genomic DNA samples to screen for six prime candidate genes. Our detection strategy was verified in a mouse model, giving positive signals from minute amounts (20 μl) of blood samples for up to 56 days following intramuscular adeno-associated virus-mediated gene transfer, one of the most likely candidate vector systems to be misused for gene doping. To make our detection strategy amenable for routine testing, we implemented a robust sample preparation and processing protocol that allows cost-efficient analysis of small human blood volumes (200 μl) with high specificity and reproducibility. The practicability and reliability of our detection strategy was validated by a screening approach including 327 blood samples taken from professional and recreational athletes under field conditions.

Tumour gene expression predicts response to cetuximab in patients with KRAS wild-type metastatic colorectal cancer.

PubMed

Baker, J B; Dutta, D; Watson, D; Maddala, T; Munneke, B M; Shak, S; Rowinsky, E K; Xu, L-A; Harbison, C T; Clark, E A; Mauro, D J; Khambata-Ford, S

2011-02-01

Although it is accepted that metastatic colorectal cancers (mCRCs) that carry activating mutations in KRAS are unresponsive to anti-epidermal growth factor receptor (EGFR) monoclonal antibodies, a significant fraction of KRAS wild-type (wt) mCRCs are also unresponsive to anti-EGFR therapy. Genes encoding EGFR ligands amphiregulin (AREG) and epiregulin (EREG) are promising gene expression-based markers but have not been incorporated into a test to dichotomise KRAS wt mCRC patients with respect to sensitivity to anti-EGFR treatment. We used RT-PCR to test 110 candidate gene expression markers in primary tumours from 144 KRAS wt mCRC patients who received monotherapy with the anti-EGFR antibody cetuximab. Results were correlated with multiple clinical endpoints: disease control, objective response, and progression-free survival (PFS). Expression of many of the tested candidate genes, including EREG and AREG, strongly associate with all clinical endpoints. Using multivariate analysis with two-layer five-fold cross-validation, we constructed a four-gene predictive classifier. Strikingly, patients below the classifier cutpoint had PFS and disease control rates similar to those of patients with KRAS mutant mCRC. Gene expression appears to identify KRAS wt mCRC patients who receive little benefit from cetuximab. It will be important to test this model in an independent validation study.

Kinase domain-targeted isolation of defense-related receptor-like kinases (RLK/Pelle) in Platanus×acerifolia: phylogenetic and structural analysis.

PubMed

Pilotti, Massimo; Brunetti, Angela; Uva, Paolo; Lumia, Valentina; Tizzani, Lorenza; Gervasi, Fabio; Iacono, Michele; Pindo, Massimo

2014-12-08

Plant receptor-like kinase (RLK/Pelle) family regulates growth and developmental processes and interaction with pathogens and symbionts.Platanaceae is one of the earliest branches of Eudicots temporally located before the split which gave rise to Rosids and Asterids. Thus investigations into the RLK family in Platanus can provide information on the evolution of this gene family in the land plants.Moreover RLKs are good candidates for finding genes that are able to confer resistance to Platanus pathogens. Degenerate oligonucleotide primers targeting the kinase domain of stress-related RLKs were used to isolate for the first time 111 RLK gene fragments in Platanus×acerifolia. Sequences were classified as candidates of the following subfamilies: CrRLK1L, LRR XII, WAK-like, and LRR X-BRI1 group. All the structural features typical of the RLK kinase domain were identified, including the non-RD motif which marks potential pathogen recognition receptors (PRRs). The LRR XII candidates, whose counterpart in Arabidopsis and rice comprises non-RD PRRs, were mostly non-RD kinases, suggesting a group of PRRs. Region-specific signatures of a relaxed purifying selection in the LRR XII candidates were also found, which is novel for plant RLK kinase domain and further supports the role of LRR XII candidates as PRRs. As we obtained CrRLK1L candidates using primers designed on Pto of tomato, we analysed the phylogenetic relationship between CrRLK1L and Pto-like of plant species. We thus classified all non-solanaceous Pto-like genes as CrRLK1L and highlighted for the first time the close phylogenetic vicinity between CrRLK1L and Pto group. The origins of Pto from CrRLK1L is proposed as an evolutionary mechanism. The signatures of relaxed purifying selection highlight that a group of RLKs might have been involved in the expression of phenotypic plasticity and is thus a good candidate for investigations into pathogen resistance.Search of Pto-like genes in Platanus highlighted the close relationship between CrRLK1L and Pto group. It will be exciting to verify if sensu strictu Pto are present in taxonomic groups other than Solanaceae, in order to further clarify the evolutionary link with CrRLK1L.We obtained a first valuable resource useful for an in-depth study on stress perception systems.

A microarray analysis of potential genes underlying the neurosensitivity of mice to propofol.

PubMed

Lowes, Damon A; Galley, Helen F; Lowe, Peter R; Rikke, Brad A; Johnson, Thomas E; Webster, Nigel R

2005-09-01

Establishing the mechanism of action of general anesthetics at the molecular level is difficult because of the multiple targets with which these drugs are associated. Inbred short sleep (ISS) and long sleep (ILS) mice are differentially sensitive in response to ethanol and other sedative hypnotics and contain a single quantitative trait locus (Lorp1) that accounts for the genetic variance of loss-of-righting reflex in response to propofol (LORP). In this study, we used high-density oligonucleotide microarrays to identify global gene expression and candidate genes differentially expressed within the Lorp1 region that may give insight into the molecular mechanism underlying LORP. Microarray analysis was performed using Affymetrix MG-U74Av2 Genechips and a selection of differentially expressed genes was confirmed by semiquantitative reverse transcription-polymerase chain reaction. Global expression in the brains of ILS and ISS mice revealed 3423 genes that were significantly expressed, of which 139 (4%) were differentially expressed. Analysis of genes located within the Lorp1 region showed that 26 genes were significantly expressed and that just 2 genes (7%) were differentially expressed. These genes encoded for the proteins AWP1 (associated with protein kinase 1) and "BTB (POZ) domain containing 1," whose functions are largely uncharacterized. Genes differentially expressed outside Lorp1 included seven genes with previously characterized neuronal functions and thus stand out as additional candidate genes that may be involved in mediating the neurosensitivity differences between ISS and ILS.

ICan: an integrated co-alteration network to identify ovarian cancer-related genes.

PubMed

Zhou, Yuanshuai; Liu, Yongjing; Li, Kening; Zhang, Rui; Qiu, Fujun; Zhao, Ning; Xu, Yan

2015-01-01

Over the last decade, an increasing number of integrative studies on cancer-related genes have been published. Integrative analyses aim to overcome the limitation of a single data type, and provide a more complete view of carcinogenesis. The vast majority of these studies used sample-matched data of gene expression and copy number to investigate the impact of copy number alteration on gene expression, and to predict and prioritize candidate oncogenes and tumor suppressor genes. However, correlations between genes were neglected in these studies. Our work aimed to evaluate the co-alteration of copy number, methylation and expression, allowing us to identify cancer-related genes and essential functional modules in cancer. We built the Integrated Co-alteration network (ICan) based on multi-omics data, and analyzed the network to uncover cancer-related genes. After comparison with random networks, we identified 155 ovarian cancer-related genes, including well-known (TP53, BRCA1, RB1 and PTEN) and also novel cancer-related genes, such as PDPN and EphA2. We compared the results with a conventional method: CNAmet, and obtained a significantly better area under the curve value (ICan: 0.8179, CNAmet: 0.5183). In this paper, we describe a framework to find cancer-related genes based on an Integrated Co-alteration network. Our results proved that ICan could precisely identify candidate cancer genes and provide increased mechanistic understanding of carcinogenesis. This work suggested a new research direction for biological network analyses involving multi-omics data.

ICan: An Integrated Co-Alteration Network to Identify Ovarian Cancer-Related Genes

PubMed Central

Zhou, Yuanshuai; Liu, Yongjing; Li, Kening; Zhang, Rui; Qiu, Fujun; Zhao, Ning; Xu, Yan

2015-01-01

Background Over the last decade, an increasing number of integrative studies on cancer-related genes have been published. Integrative analyses aim to overcome the limitation of a single data type, and provide a more complete view of carcinogenesis. The vast majority of these studies used sample-matched data of gene expression and copy number to investigate the impact of copy number alteration on gene expression, and to predict and prioritize candidate oncogenes and tumor suppressor genes. However, correlations between genes were neglected in these studies. Our work aimed to evaluate the co-alteration of copy number, methylation and expression, allowing us to identify cancer-related genes and essential functional modules in cancer. Results We built the Integrated Co-alteration network (ICan) based on multi-omics data, and analyzed the network to uncover cancer-related genes. After comparison with random networks, we identified 155 ovarian cancer-related genes, including well-known (TP53, BRCA1, RB1 and PTEN) and also novel cancer-related genes, such as PDPN and EphA2. We compared the results with a conventional method: CNAmet, and obtained a significantly better area under the curve value (ICan: 0.8179, CNAmet: 0.5183). Conclusion In this paper, we describe a framework to find cancer-related genes based on an Integrated Co-alteration network. Our results proved that ICan could precisely identify candidate cancer genes and provide increased mechanistic understanding of carcinogenesis. This work suggested a new research direction for biological network analyses involving multi-omics data. PMID:25803614

Modulation of phytochrome signaling networks for improved biomass accumulation using a bioenergy crop model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mockler, Todd C.

Plant growth and development, including stem elongation, flowering time, and shade-avoidance habits, are affected by wavelength composition (i.e., light quality) of the light environment. the molecular mechanisms underlying light perception and signaling pathways in plants have been best characterized in Arabidopsis thaliana where dozens of genes have been implicated in converging, complementary, and antagonistic pathways communicating light quality cues perceived by the phytochrome (red/far-red) cryptochrome (blue) and phototropin (blue) photorecptors. Light perception and signaling have been studied in grasses, including rice and sorghum but in much less detail than in Arabidopsis. During the course of the Mocker lab's DOE-funded wrokmore » generating a gene expression atlas in Brachypodium distachyon we observed that Brachypodium plants grown in continuous monochromatic red light or continuous white light enriched in far-red light accumulated significantly more biomass and exhibited significantly greater seed yield than plants grown in monochromatic blue light or white light. This phenomenon was also observed in two other grasses, switchgrass and rice. We will systematically manipulate the expression of genes predicted to function in Brachypodium phytochrome signaling and assess the phenotypic consequences in transgenic Brachypodium plants in terms of morphology, stature, biomass accumulation, and cell wall composition. We will also interrogate direct interactions between candidate phytochrome signaling transcription factors and target promoters using a high-throughput yeast one-hybrid system. Brachypodium distachyon has emerged as a model grass species and is closely related to candidate feedstock crops for bioethanol production. Identification of genes capable of modifying growth characteristics of Brachypodium, when misexpressed, in particular increasing biomass accumulation, by modulating photoreceptor signaling will provide valuable candidates for manipulation in biomass and biofuel feedstock grass crops through targeted breeding or engineering efforts.« less

Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis

PubMed Central

Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

2013-01-01

AIM: To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. METHODS: A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. RESULTS: There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. CONCLUSION: In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis. PMID:24409064

Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis.

PubMed

Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

2013-12-28

To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis.

Genome-Wide Prediction of the Polymorphic Ser Gene Family in Tetrahymena thermophila Based on Motif Analysis

PubMed Central

Ponsuwanna, Patrath; Kümpornsin, Krittikorn; Chookajorn, Thanat

2014-01-01

Even though antigenic variation is employed among parasitic protozoa for host immune evasion, Tetrahymena thermophila, a free-living ciliate, can also change its surface protein antigens. These cysteine-rich glycosylphosphatidylinositol (GPI)-linked surface proteins are encoded by a family of polymorphic Ser genes. Despite the availability of T. thermophila genome, a comprehensive analysis of the Ser family is limited by its high degree of polymorphism. In order to overcome this problem, a new approach was adopted by searching for Ser candidates with common motif sequences, namely length-specific repetitive cysteine pattern and GPI anchor site. The candidate genes were phylogenetically compared with the previously identified Ser genes and classified into subtypes. Ser candidates were often found to be located as tandem arrays of the same subtypes on several chromosomal scaffolds. Certain Ser candidates located in the same chromosomal arrays were transcriptionally expressed at specific T. thermophila developmental stages. These Ser candidates selected by the motif analysis approach can form the foundation for a systematic identification of the entire Ser gene family, which will contribute to the understanding of their function and the basis of T. thermophila antigenic variation. PMID:25133747

Analysis of Craniocardiac Malformations in Xenopus using Optical Coherence Tomography

PubMed Central

Deniz, Engin; Jonas, Stephan; Hooper, Michael; N. Griffin, John; Choma, Michael A.; Khokha, Mustafa K.

2017-01-01

Birth defects affect 3% of children in the United States. Among the birth defects, congenital heart disease and craniofacial malformations are major causes of mortality and morbidity. Unfortunately, the genetic mechanisms underlying craniocardiac malformations remain largely uncharacterized. To address this, human genomic studies are identifying sequence variations in patients, resulting in numerous candidate genes. However, the molecular mechanisms of pathogenesis for most candidate genes are unknown. Therefore, there is a need for functional analyses in rapid and efficient animal models of human disease. Here, we coupled the frog Xenopus tropicalis with Optical Coherence Tomography (OCT) to create a fast and efficient system for testing craniocardiac candidate genes. OCT can image cross-sections of microscopic structures in vivo at resolutions approaching histology. Here, we identify optimal OCT imaging planes to visualize and quantitate Xenopus heart and facial structures establishing normative data. Next we evaluate known human congenital heart diseases: cardiomyopathy and heterotaxy. Finally, we examine craniofacial defects by a known human teratogen, cyclopamine. We recapitulate human phenotypes readily and quantify the functional and structural defects. Using this approach, we can quickly test human craniocardiac candidate genes for phenocopy as a critical first step towards understanding disease mechanisms of the candidate genes. PMID:28195132

Evaluation of reference genes for reverse transcription quantitative real-time PCR (RT-qPCR) studies in Silene vulgaris considering the method of cDNA preparation

PubMed Central

Koloušková, Pavla; Stone, James D.

2017-01-01

Accurate gene expression measurements are essential in studies of both crop and wild plants. Reverse transcription quantitative real-time PCR (RT-qPCR) has become a preferred tool for gene expression estimation. A selection of suitable reference genes for the normalization of transcript levels is an essential prerequisite of accurate RT-qPCR results. We evaluated the expression stability of eight candidate reference genes across roots, leaves, flower buds and pollen of Silene vulgaris (bladder campion), a model plant for the study of gynodioecy. As random priming of cDNA is recommended for the study of organellar transcripts and poly(A) selection is indicated for nuclear transcripts, we estimated gene expression with both random-primed and oligo(dT)-primed cDNA. Accordingly, we determined reference genes that perform well with oligo(dT)- and random-primed cDNA, making it possible to estimate levels of nucleus-derived transcripts in the same cDNA samples as used for organellar transcripts, a key benefit in studies of cyto-nuclear interactions. Gene expression variance was estimated by RefFinder, which integrates four different analytical tools. The SvACT and SvGAPDH genes were the most stable candidates across various organs of S. vulgaris, regardless of whether pollen was included or not. PMID:28817728

Discovering genetic variants in Crohn's disease by exploring genomic regions enriched of weak association signals.

PubMed

D'Addabbo, Annarita; Palmieri, Orazio; Maglietta, Rosalia; Latiano, Anna; Mukherjee, Sayan; Annese, Vito; Ancona, Nicola

2011-08-01

A meta-analysis has re-analysed previous genome-wide association scanning definitively confirming eleven genes and further identifying 21 new loci. However, the identified genes/loci still explain only the minority of genetic predisposition of Crohn's disease. To identify genes weakly involved in disease predisposition by analysing chromosomal regions enriched of single nucleotide polymorphisms with modest statistical association. We utilized the WTCCC data set evaluating 1748 CD and 2938 controls. The identification of candidate genes/loci was performed by a two-step procedure: first of all chromosomal regions enriched of weak association signals were localized; subsequently, weak signals clustered in gene regions were identified. The statistical significance was assessed by non parametric permutation tests. The cytoband enrichment analysis highlighted 44 regions (P≤0.05) enriched with single nucleotide polymorphisms significantly associated with the trait including 23 out of 31 previously confirmed and replicated genes. Importantly, we highlight further 20 novel chromosomal regions carrying approximately one hundred genes/loci with modest association. Amongst these we find compelling functional candidate genes such as MAPT, GRB2 and CREM, LCT, and IL12RB2. Our study suggests a different statistical perspective to discover genes weakly associated with a given trait, although further confirmatory functional studies are needed. Copyright © 2011 Editrice Gastroenterologica Italiana S.r.l. All rights reserved.

A novel gammaretroviral shuttle vector insertional mutagenesis screen identifies SHARPIN as a breast cancer metastasis gene and prognostic biomarker.

PubMed

Bii, Victor M; Rae, Dustin T; Trobridge, Grant D

2015-11-24

Breast cancer (BC) is the second leading cause of malignancy among U.S. women. Metastasis results in a poor prognosis and increased mortality, but the molecular mechanisms by which metastatic tumors occur are not well understood. Identifying the genes that drive the metastatic process could provide targets for improved therapy and biomarkers to improve BC patient outcomes. Using a forward mutagenesis screen, BC cells mutagenized with a replication-incompetent gammaretroviral vector (γRV) were xenotransplanted into the mammary fat pad of immunodeficient mice. In this approach the vector provirus dysregulates nearby genes, providing a selective advantage to transduced cells to form metastases. Metastatic tumors were analyzed for proviral integration sites to identify nearby candidate metastasis genes. The γRV has a transgene cassette that allows for rescue in bacteria and rapid identification of vector integration sites. Using this approach, we identified the previously described metastasis gene WWTR1 (TAZ), and three other novel candidate metastasis genes including SHARPIN. SHARPIN was independently validated in vivo as a BC metastasis gene. Analysis of patient data showed that SHARPIN expression predicts metastasis-free survival after adjuvant therapy. Our approach has broad potential to identify genes involved in oncogenic processes for BC and other cancers. We show here it can identify both known (WWTR1) and novel (SHARPIN) BC metastasis genes.

Identification of genes related to proliferative diabetic retinopathy through RWR algorithm based on protein-protein interaction network.

PubMed

Zhang, Jian; Suo, Yan; Liu, Min; Xu, Xun

2018-06-01

Proliferative diabetic retinopathy (PDR) is one of the most common complications of diabetes and can lead to blindness. Proteomic studies have provided insight into the pathogenesis of PDR and a series of PDR-related genes has been identified but are far from fully characterized because the experimental methods are expensive and time consuming. In our previous study, we successfully identified 35 candidate PDR-related genes through the shortest-path algorithm. In the current study, we developed a computational method using the random walk with restart (RWR) algorithm and the protein-protein interaction (PPI) network to identify potential PDR-related genes. After some possible genes were obtained by the RWR algorithm, a three-stage filtration strategy, which includes the permutation test, interaction test and enrichment test, was applied to exclude potential false positives caused by the structure of PPI network, the poor interaction strength, and the limited similarity on gene ontology (GO) terms and biological pathways. As a result, 36 candidate genes were discovered by the method which was different from the 35 genes reported in our previous study. A literature review showed that 21 of these 36 genes are supported by previous experiments. These findings suggest the robustness and complementary effects of both our efforts using different computational methods, thus providing an alternative method to study PDR pathogenesis. Copyright © 2017 Elsevier B.V. All rights reserved.

Using Association Mapping in Teosinte (Zea Mays ssp Parviglumis) to Investigate the Function of Selection-Candidate Genes

USDA-ARS?s Scientific Manuscript database

Large-scale screens of the maize genome identified 48 genes that show the putative signature of artificial selection during maize domestication or improvement. These selection-candidate genes may act as quantitative trait loci (QTL) that control the phenotypic differences between maize and its proge...

Knowledge Discovery in Biological Databases for Revealing Candidate Genes Linked to Complex Phenotypes.

PubMed

Hassani-Pak, Keywan; Rawlings, Christopher

2017-06-13

Genetics and "omics" studies designed to uncover genotype to phenotype relationships often identify large numbers of potential candidate genes, among which the causal genes are hidden. Scientists generally lack the time and technical expertise to review all relevant information available from the literature, from key model species and from a potentially wide range of related biological databases in a variety of data formats with variable quality and coverage. Computational tools are needed for the integration and evaluation of heterogeneous information in order to prioritise candidate genes and components of interaction networks that, if perturbed through potential interventions, have a positive impact on the biological outcome in the whole organism without producing negative side effects. Here we review several bioinformatics tools and databases that play an important role in biological knowledge discovery and candidate gene prioritization. We conclude with several key challenges that need to be addressed in order to facilitate biological knowledge discovery in the future.

Identification and association analysis of several hundred single nucleotide polymorphisms within candidate genes for back fat thickness in Italian Large White pigs using a selective genotyping approach.

PubMed

Fontanesi, L; Galimberti, G; Calò, D G; Fronza, R; Martelli, P L; Scotti, E; Colombo, M; Schiavo, G; Casadio, R; Buttazzoni, L; Russo, V

2012-08-01

Combining different approaches (resequencing of portions of 54 obesity candidate genes, literature mining for pig markers associated with fat deposition or related traits in 77 genes, and in silico mining of porcine expressed sequence tags and other sequences available in databases), we identified and analyzed 736 SNP within candidate genes to identify markers associated with back fat thickness (BFT) in Italian Large White sows. Animals were chosen using a selective genotyping approach according to their EBV for BFT (276 with most negative and 279 with most positive EBV) within a population of ≈ 12,000 pigs. Association analysis between the SNP and BFT has been carried out using the MAX test proposed for case-control studies. The designed assays were successful for 656 SNP: 370 were excluded (low call rate or minor allele frequency <5%), whereas the remaining 286 in 212 genes were taken for subsequent analyses, among which 64 showed a P(nominal) value <0.1. To deal with the multiple testing problem in a candidate gene approach, we applied the proportion of false positives (PFP) method. Thirty-eight SNP were significant (P(PFP) < 0.20). The most significant SNP was the IGF2 intron3-g.3072G>A polymorphism (P(nominal) < 1.0E-50). The second most significant SNP was the MC4R c.1426A>G polymorphism (P(nominal) = 8.0E-05). The third top SNP (P(nominal) = 6.2E-04) was the intronic TBC1D1 g.219G>A polymorphic site, in agreement with our previous results obtained in an independent study. The list of significant markers also included SNP in additional genes (ABHD16A, ABHD5, ACP2, ALMS1, APOA2, ATP1A2, CALR, COL14A1, CTSF, DARS, DECR1, ENPP1, ESR1, GH1, GHRL, GNMT, IKBKB, JAK3, MTTP, NFKBIA, NT5E, PLAT, PPARG, PPP2R5D, PRLR, RRAGD, RFC2, SDHD, SERPINF1, UBE2H, VCAM1, and WAT). Functional relationships between genes were obtained using the Ingenuity Pathway Analysis (IPA) Knowledge Base. The top scoring pathway included 19 genes with a P(nominal) < 0.1, 2 of which (IKBKB and NFKBIA) are involved in the hypothalamic IKKβ/NFκB program that could represent a key axis to affect fat deposition traits in pigs. These results represent a starting point to plan marker-assisted selection in Italian Large White nuclei for BFT. Because of similarities between humans and pigs, this study might also provide useful clues to investigate genetic factors affecting human obesity.

PINTA: a web server for network-based gene prioritization from expression data

PubMed Central

Nitsch, Daniela; Tranchevent, Léon-Charles; Gonçalves, Joana P.; Vogt, Josef Korbinian; Madeira, Sara C.; Moreau, Yves

2011-01-01

PINTA (available at http://www.esat.kuleuven.be/pinta/; this web site is free and open to all users and there is no login requirement) is a web resource for the prioritization of candidate genes based on the differential expression of their neighborhood in a genome-wide protein–protein interaction network. Our strategy is meant for biological and medical researchers aiming at identifying novel disease genes using disease specific expression data. PINTA supports both candidate gene prioritization (starting from a user defined set of candidate genes) as well as genome-wide gene prioritization and is available for five species (human, mouse, rat, worm and yeast). As input data, PINTA only requires disease specific expression data, whereas various platforms (e.g. Affymetrix) are supported. As a result, PINTA computes a gene ranking and presents the results as a table that can easily be browsed and downloaded by the user. PMID:21602267

Unsupervised, statistically-based systems biology approach for unraveling the genetics of complex traits: A demonstration with ethanol metabolism.

PubMed

Lusk, Ryan; Saba, Laura M; Vanderlinden, Lauren A; Zidek, Vaclav; Silhavy, Jan; Pravenec, Michal; Hoffman, Paula L; Tabakoff, Boris

2018-04-24

A statistical pipeline was developed and used for determining candidate genes and candidate gene co-expression networks involved in two alcohol (i.e., ethanol) metabolism phenotypes, namely alcohol clearance and acetate area under the curve (AUC) in a recombinant inbred (HXB/BXH) rat panel. The approach was also used to provide an indication of how ethanol metabolism can impact the normal function of the identified networks. RNA was extracted from alcohol-naïve liver tissue of 30 strains of HXB/BXH recombinant inbred rats. The reconstructed transcripts were quantitated and data was used to construct gene co-expression modules and networks. A separate group of rats, comprising the same 30 strains, were injected with ethanol (2 gm/kg) for measurement of blood ethanol and acetate levels. These data were used for QTL analysis of the rate of ethanol disappearance and circulating acetate levels. The analysis pipeline required calculation of the module eigengene values, the correction of these values with ethanol metabolism rates and acetate levels across the rat strains and the determination of the eigengene QTLs. For a module to be considered a candidate for determining phenotype, the module eigengene values had to have significant correlation with the strain phenotypic values and the module eigengene QTLs had to overlap the phenotypic QTLs. Of the 658 transcript co-expression modules generated from liver RNA sequencing data, a single module satisfied all criteria for being a candidate for determining the alcohol clearance trait. This module contained two alcohol dehydrogenase genes, including the gene whose product was previously shown to be responsible for the majority of alcohol elimination in the rat. This module was also the only module identified as a candidate for influencing circulating acetate levels. This module was also linked to the process of generation and utilization of retinoic acid as related to the autonomous immune response. We propose that our analytical pipeline can successfully identify genetic regions and transcripts which predispose a particular phenotype and our analysis provides functional context for co-expression module components. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Analysis of 60 reported glioma risk SNPs replicates published GWAS findings but fails to replicate associations from published candidate-gene studies.

PubMed

Walsh, Kyle M; Anderson, Erik; Hansen, Helen M; Decker, Paul A; Kosel, Matt L; Kollmeyer, Thomas; Rice, Terri; Zheng, Shichun; Xiao, Yuanyuan; Chang, Jeffrey S; McCoy, Lucie S; Bracci, Paige M; Wiemels, Joe L; Pico, Alexander R; Smirnov, Ivan; Lachance, Daniel H; Sicotte, Hugues; Eckel-Passow, Jeanette E; Wiencke, John K; Jenkins, Robert B; Wrensch, Margaret R

2013-02-01

Genomewide association studies (GWAS) and candidate-gene studies have implicated single-nucleotide polymorphisms (SNPs) in at least 45 different genes as putative glioma risk factors. Attempts to validate these associations have yielded variable results and few genetic risk factors have been consistently replicated. We conducted a case-control study of Caucasian glioma cases and controls from the University of California San Francisco (810 cases, 512 controls) and the Mayo Clinic (852 cases, 789 controls) in an attempt to replicate previously reported genetic risk factors for glioma. Sixty SNPs selected from the literature (eight from GWAS and 52 from candidate-gene studies) were successfully genotyped on an Illumina custom genotyping panel. Eight SNPs in/near seven different genes (TERT, EGFR, CCDC26, CDKN2A, PHLDB1, RTEL1, TP53) were significantly associated with glioma risk in the combined dataset (P < 0.05), with all associations in the same direction as in previous reports. Several SNP associations showed considerable differences across histologic subtype. All eight successfully replicated associations were first identified by GWAS, although none of the putative risk SNPs from candidate-gene studies was associated in the full case-control sample (all P values > 0.05). Although several confirmed associations are located near genes long known to be involved in gliomagenesis (e.g., EGFR, CDKN2A, TP53), these associations were first discovered by the GWAS approach and are in noncoding regions. These results highlight that the deficiencies of the candidate-gene approach lay in selecting both appropriate genes and relevant SNPs within these genes. © 2012 WILEY PERIODICALS, INC.

Harnessing apomictic reproduction in grasses: what we have learned from Paspalum

PubMed Central

Ortiz, Juan Pablo A.; Quarin, Camilo L.; Pessino, Silvina C.; Acuña, Carlos; Martínez, Eric J.; Espinoza, Francisco; Hojsgaard, Diego H.; Sartor, Maria E.; Cáceres, Maria E.; Pupilli, Fulvio

2013-01-01

Background Apomixis is an alternative route of plant reproduction that produces individuals genetically identical to the mother plant through seeds. Apomixis is desirable in agriculture, because it guarantees the perpetuation of superior genotypes (i.e. heterotic hybrid seeds) by self-seeding without loss of hybrid vigour. The Paspalum genus, an archetypal model system for mining apomixis gene(s), is composed of about 370 species that have extremely diverse reproductive systems, including self-incompatibility, self-fertility, full sexual reproduction, and facultative or obligate apomixis. Barriers to interspecific hybridization are relaxed in this genus, allowing the production of new hybrids from many different parental combinations. Paspalum is also tolerant to various parental genome contributions to the endosperm, allowing analyses of how sexually reproducing crop species might escape from dosage effects in the endosperm. Scope In this article, the available literature characterizing apomixis in Paspalum spp. and its use in breeding is critically reviewed. In particular, a comparison is made across species of the structure and function of the genomic region controlling apomixis in order to identify a common core region shared by all apomictic Paspalum species and where apomixis genes are likely to be localized. Candidate genes are discussed, either as possible genetic determinants (including homologs to signal transduction and RNA methylation genes) or as downstream factors (such as cell-to-cell signalling and auxin response genes) depending, respectively, on their co-segregation with apomixis or less. Strategies to validate the role of candidate genes in apomictic process are also discussed, with special emphasis on plant transformation in natural apomictic species. PMID:23864004

Microarray analysis identifies candidate genes for key roles in coral development

PubMed Central

Grasso, Lauretta C; Maindonald, John; Rudd, Stephen; Hayward, David C; Saint, Robert; Miller, David J; Ball, Eldon E

2008-01-01

Background Anthozoan cnidarians are amongst the simplest animals at the tissue level of organization, but are surprisingly complex and vertebrate-like in terms of gene repertoire. As major components of tropical reef ecosystems, the stony corals are anthozoans of particular ecological significance. To better understand the molecular bases of both cnidarian development in general and coral-specific processes such as skeletogenesis and symbiont acquisition, microarray analysis was carried out through the period of early development – when skeletogenesis is initiated, and symbionts are first acquired. Results Of 5081 unique peptide coding genes, 1084 were differentially expressed (P ≤ 0.05) in comparisons between four different stages of coral development, spanning key developmental transitions. Genes of likely relevance to the processes of settlement, metamorphosis, calcification and interaction with symbionts were characterised further and their spatial expression patterns investigated using whole-mount in situ hybridization. Conclusion This study is the first large-scale investigation of developmental gene expression for any cnidarian, and has provided candidate genes for key roles in many aspects of coral biology, including calcification, metamorphosis and symbiont uptake. One surprising finding is that some of these genes have clear counterparts in higher animals but are not present in the closely-related sea anemone Nematostella. Secondly, coral-specific processes (i.e. traits which distinguish corals from their close relatives) may be analogous to similar processes in distantly related organisms. This first large-scale application of microarray analysis demonstrates the potential of this approach for investigating many aspects of coral biology, including the effects of stress and disease. PMID:19014561

Analysis of copy number variation in Alzheimer's disease in a cohort of clinically characterized and neuropathologically verified individuals.

PubMed

Swaminathan, Shanker; Huentelman, Matthew J; Corneveaux, Jason J; Myers, Amanda J; Faber, Kelley M; Foroud, Tatiana; Mayeux, Richard; Shen, Li; Kim, Sungeun; Turk, Mari; Hardy, John; Reiman, Eric M; Saykin, Andrew J

2012-01-01

Copy number variations (CNVs) are genomic regions that have added (duplications) or deleted (deletions) genetic material. They may overlap genes affecting their function and have been shown to be associated with disease. We previously investigated the role of CNVs in late-onset Alzheimer's disease (AD) and mild cognitive impairment using Alzheimer's Disease Neuroimaging Initiative (ADNI) and National Institute of Aging-Late Onset AD/National Cell Repository for AD (NIA-LOAD/NCRAD) Family Study participants, and identified a number of genes overlapped by CNV calls. To confirm the findings and identify other potential candidate regions, we analyzed array data from a unique cohort of 1617 Caucasian participants (1022 AD cases and 595 controls) who were clinically characterized and whose diagnosis was neuropathologically verified. All DNA samples were extracted from brain tissue. CNV calls were generated and subjected to quality control (QC). 728 cases and 438 controls who passed all QC measures were included in case/control association analyses including candidate gene and genome-wide approaches. Rates of deletions and duplications did not significantly differ between cases and controls. Case-control association identified a number of previously reported regions (CHRFAM7A, RELN and DOPEY2) as well as a new gene (HLA-DRA). Meta-analysis of CHRFAM7A indicated a significant association of the gene with AD and/or MCI risk (P = 0.006, odds ratio = 3.986 (95% confidence interval 1.490-10.667)). A novel APP gene duplication was observed in one case sample. Further investigation of the identified genes in independent and larger samples is warranted.

Indel-seq: a fast-forward genetics approach for identification of trait-associated putative candidate genomic regions and its application in pigeonpea (Cajanus cajan).

PubMed

Singh, Vikas K; Khan, Aamir W; Saxena, Rachit K; Sinha, Pallavi; Kale, Sandip M; Parupalli, Swathi; Kumar, Vinay; Chitikineni, Annapurna; Vechalapu, Suryanarayana; Sameer Kumar, Chanda Venkata; Sharma, Mamta; Ghanta, Anuradha; Yamini, Kalinati Narasimhan; Muniswamy, Sonnappa; Varshney, Rajeev K

2017-07-01

Identification of candidate genomic regions associated with target traits using conventional mapping methods is challenging and time-consuming. In recent years, a number of single nucleotide polymorphism (SNP)-based mapping approaches have been developed and used for identification of candidate/putative genomic regions. However, in the majority of these studies, insertion-deletion (Indel) were largely ignored. For efficient use of Indels in mapping target traits, we propose Indel-seq approach, which is a combination of whole-genome resequencing (WGRS) and bulked segregant analysis (BSA) and relies on the Indel frequencies in extreme bulks. Deployment of Indel-seq approach for identification of candidate genomic regions associated with fusarium wilt (FW) and sterility mosaic disease (SMD) resistance in pigeonpea has identified 16 Indels affecting 26 putative candidate genes. Of these 26 affected putative candidate genes, 24 genes showed effect in the upstream/downstream of the genic region and two genes showed effect in the genes. Validation of these 16 candidate Indels in other FW- and SMD-resistant and FW- and SMD-susceptible genotypes revealed a significant association of five Indels (three for FW and two for SMD resistance). Comparative analysis of Indel-seq with other genetic mapping approaches highlighted the importance of the approach in identification of significant genomic regions associated with target traits. Therefore, the Indel-seq approach can be used for quick and precise identification of candidate genomic regions for any target traits in any crop species. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Candidate EDA targets revealed by expression profiling of primary keratinocytes from Tabby mutant mice

PubMed Central

Esibizione, Diana; Cui, Chang-Yi; Schlessinger, David

2009-01-01

EDA, the gene mutated in anhidrotic ectodermal dysplasia, encodes ectodysplasin, a TNF superfamily member that activates NF-kB mediated transcription. To identify EDA target genes, we have earlier used expression profiling to infer genes differentially expressed at various developmental time points in Tabby (Eda-deficient) compared to wild-type mouse skin. To increase the resolution to find genes whose expression may be restricted to epidermal cells, we have now extended studies to primary keratinocyte cultures established from E19 wild-type and Tabby skin. Using microarrays bearing 44,000 gene probes, we found 385 preliminary candidate genes whose expression was significantly affected by Eda loss. By comparing expression profiles to those from Eda-A1 transgenic skin, we restricted the list to 38 “candidate EDA targets”, 14 of which were already known to be expressed in hair follicles or epidermis. We confirmed expression changes for 3 selected genes, Tbx1, Bmp7, and Jag1, both in keratinocytes and in whole skin, by Q-PCR and Western blotting analyses. Thus, by the analysis of keratinocytes, novel candidate pathways downstream of EDA were detected. PMID:18848976

Systematic review and meta-analysis of genetic association studies in idiopathic recurrent spontaneous abortion.

PubMed

Pereza, Nina; Ostojić, Saša; Kapović, Miljenko; Peterlin, Borut

2017-01-01

1) To perform the first comprehensive systematic review of genetic association studies (GASs) in idiopathic recurrent spontaneous abortion (IRSA); 2) to analyze studies according to recurrent spontaneous abortion (RSA) definition and selection criteria for patients and control subjects; and 3) to perform meta-analyses for the association of candidate genes with IRSA. Systematic review and meta-analysis. Not applicable. Couples with IRSA and their spontaneously aborted embryos. Summary odds ratios (ORs) were calculated by means of fixed- or random-effects models. Association of genetic variants with IRSA. The systematic review included 428 case-control studies (1990-2015), which differed substantially regarding RSA definition, clinical evaluation of patients, and selection of control subjects. In women, 472 variants in 187 genes were investigated. Meta-analyses were performed for 36 variants in 16 genes. Association with IRSA defined as three or more spontaneous abortions (SAs) was detected for 21 variants in genes involved in immune response (IFNG, IL10, KIR2DS2, KIR2DS3, KIR2DS4, MBL, TNF), coagulation (F2, F5, PAI-1, PROZ), metabolism (GSTT1, MTHFR), and angiogenesis (NOS3, VEGFA). However, ORs were modest (0.51-2.37), with moderate or weak epidemiologic credibility. Minor differences in summary ORs were detected between IRSA defined as two or more and as three or more SAs. Male partners were included in 12.1% of studies, and one study included spontaneously aborted embryos. Candidate gene studies show moderate associations with IRSA. Owing to large differences in RSA definition and selection criteria for participants, consensus is needed. Future GASs should include both partners and spontaneously aborted embryos. Genome-wide association studies and large-scale replications of identified associations are recommended. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

A comprehensive study of the genomic differentiation between temperate Dent and Flint maize.

PubMed

Unterseer, Sandra; Pophaly, Saurabh D; Peis, Regina; Westermeier, Peter; Mayer, Manfred; Seidel, Michael A; Haberer, Georg; Mayer, Klaus F X; Ordas, Bernardo; Pausch, Hubert; Tellier, Aurélien; Bauer, Eva; Schön, Chris-Carolin

2016-07-08

Dent and Flint represent two major germplasm pools exploited in maize breeding. Several traits differentiate the two pools, like cold tolerance, early vigor, and flowering time. A comparative investigation of their genomic architecture relevant for quantitative trait expression has not been reported so far. Understanding the genomic differences between germplasm pools may contribute to a better understanding of the complementarity in heterotic patterns exploited in hybrid breeding and of mechanisms involved in adaptation to different environments. We perform whole-genome screens for signatures of selection specific to temperate Dent and Flint maize by comparing high-density genotyping data of 70 American and European Dent and 66 European Flint inbred lines. We find 2.2 % and 1.4 % of the genes are under selective pressure, respectively, and identify candidate genes associated with agronomic traits known to differ between the two pools. Taking flowering time as an example for the differentiation between Dent and Flint, we investigate candidate genes involved in the flowering network by phenotypic analyses in a Dent-Flint introgression library and find that the Flint haplotypes of the candidates promote earlier flowering. Within the flowering network, the majority of Flint candidates are associated with endogenous pathways in contrast to Dent candidate genes, which are mainly involved in response to environmental factors like light and photoperiod. The diversity patterns of the candidates in a unique panel of more than 900 individuals from 38 European landraces indicate a major contribution of landraces from France, Germany, and Spain to the candidate gene diversity of the Flint elite lines. In this study, we report the investigation of pool-specific differences between temperate Dent and Flint on a genome-wide scale. The identified candidate genes represent a promising source for the functional investigation of pool-specific haplotypes in different genetic backgrounds and for the evaluation of their potential for future crop improvement like the adaptation to specific environments.

Case-Control Study of Candidate Gene Methylation and Adenomatous Polyp Formation

PubMed Central

M, Alexander; JB, Burch; SE, Steck; C-F, Chen; TG, Hurley; P, Cavicchia; N, Shivappa; J, Guess; H, Zhang; SD, Youngstedt; KE, Creek; S, Lloyd; K, Jones; JR, Hébert

2016-01-01

Purpose Colorectal cancer (CRC) is one of the most common and preventable forms of cancer, but remains the second leading cause of cancer-related death. Colorectal adenomas are precursor lesions that develop in 70–90% of CRC cases. Identification of peripheral biomarkers for adenomas would help to enhance screening efforts. This exploratory study examined the methylation status of 20 candidate markers in peripheral blood leukocytes and their association with adenoma formation. Methods Patients recruited from a local endoscopy clinic provided informed consent, and completed an interview to ascertain demographic, lifestyle, and adenoma risk factors. Cases were individuals with a histopathologically confirmed adenoma, and controls included patients with a normal colonoscopy, or those with histopathological findings not requiring heightened surveillance (normal biopsy, hyperplastic polyp). Methylation-specific polymerase chain reaction was used to characterize candidate gene promoter methylation. Odds ratios and 95% confidence intervals (OR, 95% CI) were calculated using unconditional multivariable logistic regression to test the hypothesis that candidate gene methylation differed between cases and controls, after adjustment for confounders. Results Complete data were available for 107 participants; 36% had adenomas (men: 40%, women: 31%). Hypomethylation of the MINT1 locus (OR: 5.3, 95% CI: 1.0–28.2), and the PER1 (OR: 2.9, 95% CI: 1.1–7.7) and PER3 (OR: 11.6, 95% CI: 1.6–78.5) clock gene promoters was more common among adenoma cases. While specificity was moderate to high for the three markers (71–97%), sensitivity was relatively low (18–45%). Conclusion Follow-up of these epigenetic markers is suggested to further evaluate their utility for adenoma screening or surveillance. PMID:27771773

Genome-wide association study reveals a QTL and strong candidate genes for umbilical hernia in pigs on SSC14.

PubMed

Grindflek, Eli; Hansen, Marianne H S; Lien, Sigbjørn; van Son, Maren

2018-05-29

Umbilical hernia is one of the most prevalent congenital defect in pigs, causing economic losses and substantial animal welfare problems. Identification and implementation of genomic regions controlling umbilical hernia in breeding is of great interest to reduce incidences of hernia in commercial pig production. The aim of this study was to identify such regions and possibly identify causative variation affecting umbilical hernia in pigs. A case/control material consisting of 739 Norwegian Landrace pigs was collected and applied in a GWAS study with a genome-wide distributed panel of 60 K SNPs. Additionally candidate genes were sequenced to detect additional polymorphisms that were used for single SNP and haplotype association analyses in 453 of the pigs. The GWAS in this report detected a highly significant region affecting umbilical hernia around 50 Mb on SSC14 (P < 0.0001) explaining up to 8.6% of the phenotypic variance of the trait. The region is rather broad and includes 62 significant SNPs in high linkage disequilibrium with each other. Targeted sequencing of candidate genes within the region revealed polymorphisms within the Leukemia inhibitory factor (LIF) and Oncostatin M (OSM) that were significantly associated with umbilical hernia (P < 0.001). A highly significant QTL for umbilical hernia in Norwegian Landrace pigs was detected around 50 Mb on SSC14. Resequencing of candidate genes within the region revealed SNPs within LIF and OSM highly associated with the trait. However, because of extended LD within the region, studies in other populations and functional studies are needed to determine whether these variants are causal or not. Still without this knowledge, SNPs within the region can be used as genetic markers to reduce incidences of umbilical hernia in Norwegian Landrace pigs.

Genome Wide Screening of Candidate Genes for Improving Piglet Birth Weight Using High and Low Estimated Breeding Value Populations

PubMed Central

Zhang, Lifan; Zhou, Xiang; Michal, Jennifer J.; Ding, Bo; Li, Rui; Jiang, Zhihua

2014-01-01

Birth weight is an economically important trait in pig production because it directly impacts piglet growth and survival rate. In the present study, we performed a genome wide survey of candidate genes and pathways associated with individual birth weight (IBW) using the Illumina PorcineSNP60 BeadChip on 24 high (HEBV) and 24 low estimated breeding value (LEBV) animals. These animals were selected from a reference population of 522 individuals produced by three sires and six dam lines, which were crossbreds with multiple breeds. After quality-control, 43,257 SNPs (single nucleotide polymorphisms), including 42,243 autosomal SNPs and 1,014 SNPs on chromosome X, were used in the data analysis. A total of 27 differentially selected regions (DSRs), including 1 on Sus scrofa chromosome 1 (SSC1), 1 on SSC4, 2 on SSC5, 4 on SSC6, 2 on SSC7, 5 on SSC8, 3 on SSC9, 1 on SSC14, 3 on SSC18, and 5 on SSCX, were identified to show the genome wide separations between the HEBV and LEBV groups for IBW in piglets. A DSR with the most number of significant SNPs (including 7 top 0.1% and 31 top 5% SNPs) was located on SSC6, while another DSR with the largest genetic differences in FST was found on SSC18. These regions harbor known functionally important genes involved in growth and development, such as TNFRSF9 (tumor necrosis factor receptor superfamily member 9), CA6 (carbonic anhydrase VI) and MDFIC (MyoD family inhibitor domain containing). A DSR rich in imprinting genes appeared on SSC9, which included PEG10 (paternally expressed 10), SGCE (sarcoglycan, epsilon), PPP1R9A (protein phosphatase 1, regulatory subunit 9A) and ASB4 (ankyrin repeat and SOCS box containing 4). More importantly, our present study provided evidence to support six quantitative trait loci (QTL) regions for pig birth weight, six QTL regions for average birth weight (ABW) and three QTL regions for litter birth weight (LBW) reported previously by other groups. Furthermore, gene ontology analysis with 183 genes harbored in these 27 DSRs suggested that protein, metal, ion and ATP binding, viral process and innate immune response present important pathways for deciphering their roles in fetal growth or development. Overall, our study provides useful information on candidate genes and pathways for regulating birth weight in piglets, thus improving our understanding of the genetic mechanisms involved in porcine embryonic or fetal development. PMID:24644423

Identification of an miRNA candidate reflects the possible significance of transcribed microsatellites in the hairpin precursors of black pepper.

PubMed

Joy, Nisha; Soniya, Eppurathu Vasudevan

2012-06-01

Plant miRNAs (18-24nt) are generated by the RNase III-type Dicer endonuclease from the endogenous hairpin precursors ('pre-miRNAs') with significant regulatory functions. The transcribed regions display a higher frequency of microsatellites, when compared to other regions of the genomic DNA. Simple sequence repeats (SSRs) resulting from replication slippage occurring in transcripts affect the expression of genes. The available experimental evidence for the incidence of SSRs in the miRNA precursors is limited. Considering the potential significance of SSRs in the miRNA genes, we carried out a preliminary analysis to verify the presence of SSRs in the pri-miRNAs of black pepper (Piper nigrum L.). We isolated a (CT) dinucleotide SSR bearing transcript using SMART strategy. The transcript was predicted to be a 'pri-miRNA candidate' with Dicer sites based on miRNA prediction tools and MFOLD structural predictions. The presence of this 'miRNA candidate' was confirmed by real-time TaqMan assays. The upstream sequence of the 'miRNA candidate' by genome walking when subjected to PlantCARE showed the presence of certain promoter elements, and the deduced amino acid showed significant similarity with NAP1 gene, which affects the transcription of many genes. Moreover the hairpin-like precursor overlapped the neighbouring NAP1 gene. In silico analysis revealed distinct putative functions for the 'miRNA candidate', of which majority were related to growth. Hence, we assume that this 'miRNA candidate' may get activated during transcription of NAP gene, thereby regulating the expression of many genes involved in developmental processes.

Novel candidate genes may be possible predisposing factors revealed by whole exome sequencing in familial esophageal squamous cell carcinoma.

PubMed

Forouzanfar, Narjes; Baranova, Ancha; Milanizadeh, Saman; Heravi-Moussavi, Alireza; Jebelli, Amir; Abbaszadegan, Mohammad Reza

2017-05-01

Esophageal squamous cell carcinoma is one of the deadliest of all the cancers. Its metastatic properties portend poor prognosis and high rate of recurrence. A more advanced method to identify new molecular biomarkers predicting disease prognosis can be whole exome sequencing. Here, we report the most effective genetic variants of the Notch signaling pathway in esophageal squamous cell carcinoma susceptibility by whole exome sequencing. We analyzed nine probands in unrelated familial esophageal squamous cell carcinoma pedigrees to identify candidate genes. Genomic DNA was extracted and whole exome sequencing performed to generate information about genetic variants in the coding regions. Bioinformatics software applications were utilized to exploit statistical algorithms to demonstrate protein structure and variants conservation. Polymorphic regions were excluded by false-positive investigations. Gene-gene interactions were analyzed for Notch signaling pathway candidates. We identified novel and damaging variants of the Notch signaling pathway through extensive pathway-oriented filtering and functional predictions, which led to the study of 27 candidate novel mutations in all nine patients. Detection of the trinucleotide repeat containing 6B gene mutation (a slice site alteration) in five of the nine probands, but not in any of the healthy samples, suggested that it may be a susceptibility factor for familial esophageal squamous cell carcinoma. Noticeably, 8 of 27 novel candidate gene mutations (e.g. epidermal growth factor, signal transducer and activator of transcription 3, MET) act in a cascade leading to cell survival and proliferation. Our results suggest that the trinucleotide repeat containing 6B mutation may be a candidate predisposing gene in esophageal squamous cell carcinoma. In addition, some of the Notch signaling pathway genetic mutations may act as key contributors to esophageal squamous cell carcinoma.

Characterizations of 9p21 candidate genes in familial melanoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walker, G.J.; Flores, J.F.; Glendening, J.M.

We have previously collected and characterized 16 melanoma families for the inheritance of a familial melanoma predisposition gene on 9p21. Clear evidence for genetic linkage has been detected in 8 of these families with the 9p21 markers D9S126 and 1FNA, while linkage of the remaining families to this region is less certain. A candidate for the 9p21 familial melanoma gene, the cyclin kinase inhibitor gene p16 (also known as the multiple tumor suppressor 1 (MTS1) gene), has been recently indentified. Notably, a nonsense mutation within the p16 gene has been detected in the lymphoblastoid cell line DNA from a dysplasticmore » nevus syndrome (DNS), or familial melanoma, patient. The p16 gene is also known to be frequently deleted or mutated in a variety of tumor cell lines (including melanoma) and resides within a region that has been defined as harboring the 9p21 melanoma predisposition locus. This region is delineated on the distal side by the marker D9S736 (which resides just distal to the p16 gene) and extends in a proximal direction to the marker D9S171. Overall, the entire distance between these two loci is estimated at 3-5Mb. Preliminary analysis of our two largest 9p21-linked melanoma kindreds (by direct sequencing of PCR products) has not yet revealed mutations within the coding region of the p16 gene. Others have reported that 8/11 unrelated 9p21-linked melanoma families do not appear to carry p16 mutations; thus the possibility exists that p16 is not a melanoma susceptibility gene per se, although it appears to play some role in melanoma tumor progression. Our melanoma kindred DNAs are currently being analyzed by SSCP using primers that amplify exons of other candidate genes from the 9p21 region implicated in familial melanoma. These novel genes reside within a distinct critical region of homozygous loss in melanoma which is located >2 Mb from the p16 gene on 9p21.« less

Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley.

PubMed

Cai, Jing; Li, Pengfei; Luo, Xiao; Chang, Tianliang; Li, Jiaxing; Zhao, Yuwei; Xu, Yao

2018-01-01

Hulless barley (Hordeum vulgare L. var. nudum. hook. f.) has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin), E2 (Ubiquitin conjugating enzyme 2), TUBα (Alpha-tubulin), TUBβ6 (Beta-tubulin 6), GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), EF-1α (Elongation factor 1-alpha), SAMDC (S-adenosylmethionine decarboxylase), PKABA1 (Gene for protein kinase HvPKABA1), PGK (Phosphoglycerate kinase), and HSP90 (Heat shock protein 90)-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression analysis under tested stress conditions by the qRT-PCR method.

Composite selection signals can localize the trait specific genomic regions in multi-breed populations of cattle and sheep

PubMed Central

2014-01-01

Background Discerning the traits evolving under neutral conditions from those traits evolving rapidly because of various selection pressures is a great challenge. We propose a new method, composite selection signals (CSS), which unifies the multiple pieces of selection evidence from the rank distribution of its diverse constituent tests. The extreme CSS scores capture highly differentiated loci and underlying common variants hauling excess haplotype homozygosity in the samples of a target population. Results The data on high-density genotypes were analyzed for evidence of an association with either polledness or double muscling in various cohorts of cattle and sheep. In cattle, extreme CSS scores were found in the candidate regions on autosome BTA-1 and BTA-2, flanking the POLL locus and MSTN gene, for polledness and double muscling, respectively. In sheep, the regions with extreme scores were localized on autosome OAR-2 harbouring the MSTN gene for double muscling and on OAR-10 harbouring the RXFP2 gene for polledness. In comparison to the constituent tests, there was a partial agreement between the signals at the four candidate loci; however, they consistently identified additional genomic regions harbouring no known genes. Persuasively, our list of all the additional significant CSS regions contains genes that have been successfully implicated to secondary phenotypic diversity among several subpopulations in our data. For example, the method identified a strong selection signature for stature in cattle capturing selective sweeps harbouring UQCC-GDF5 and PLAG1-CHCHD7 gene regions on BTA-13 and BTA-14, respectively. Both gene pairs have been previously associated with height in humans, while PLAG1-CHCHD7 has also been reported for stature in cattle. In the additional analysis, CSS identified significant regions harbouring multiple genes for various traits under selection in European cattle including polledness, adaptation, metabolism, growth rate, stature, immunity, reproduction traits and some other candidate genes for dairy and beef production. Conclusions CSS successfully localized the candidate regions in validation datasets as well as identified previously known and novel regions for various traits experiencing selection pressure. Together, the results demonstrate the utility of CSS by its improved power, reduced false positives and high-resolution of selection signals as compared to individual constituent tests. PMID:24636660

DNA sequence polymorphisms in a panel of eight candidate bovine imprinted genes and their association with performance traits in Irish Holstein-Friesian cattle.

PubMed

Magee, David A; Sikora, Klaudia M; Berkowicz, Erik W; Berry, Donagh P; Howard, Dawn J; Mullen, Michael P; Evans, Ross D; Spillane, Charles; MacHugh, David E

2010-10-13

Studies in mice and humans have shown that imprinted genes, whereby expression from one of the two parentally inherited alleles is attenuated or completely silenced, have a major effect on mammalian growth, metabolism and physiology. More recently, investigations in livestock species indicate that genes subject to this type of epigenetic regulation contribute to, or are associated with, several performance traits, most notably muscle mass and fat deposition. In the present study, a candidate gene approach was adopted to assess 17 validated single nucleotide polymorphisms (SNPs) and their association with a range of performance traits in 848 progeny-tested Irish Holstein-Friesian artificial insemination sires. These SNPs are located proximal to, or within, the bovine orthologs of eight genes (CALCR, GRB10, PEG3, PHLDA2, RASGRF1, TSPAN32, ZIM2 and ZNF215) that have been shown to be imprinted in cattle or in at least one other mammalian species (i.e. human/mouse/pig/sheep). Heterozygosities for all SNPs analysed ranged from 0.09 to 0.46 and significant deviations from Hardy-Weinberg proportions (P ≤ 0.01) were observed at four loci. Phenotypic associations (P ≤ 0.05) were observed between nine SNPs proximal to, or within, six of the eight analysed genes and a number of performance traits evaluated, including milk protein percentage, somatic cell count, culled cow and progeny carcass weight, angularity, body conditioning score, progeny carcass conformation, body depth, rump angle, rump width, animal stature, calving difficulty, gestation length and calf perinatal mortality. Notably, SNPs within the imprinted paternally expressed gene 3 (PEG3) gene cluster were associated (P ≤ 0.05) with calving, calf performance and fertility traits, while a single SNP in the zinc finger protein 215 gene (ZNF215) was associated with milk protein percentage (P ≤ 0.05), progeny carcass weight (P ≤ 0.05), culled cow carcass weight (P ≤ 0.01), angularity (P ≤ 0.01), body depth (P ≤ 0.01), rump width (P ≤ 0.01) and animal stature (P ≤ 0.01). Of the eight candidate bovine imprinted genes assessed, DNA sequence polymorphisms in six of these genes (CALCR, GRB10, PEG3, RASGRF1, ZIM2 and ZNF215) displayed associations with several of the phenotypes included for analyses. The genotype-phenotype associations detected here are further supported by the biological function of these six genes, each of which plays important roles in mammalian growth, development and physiology. The associations between SNPs within the imprinted PEG3 gene cluster and traits related to calving, calf performance and gestation length suggest that this domain on chromosome 18 may play a role regulating pre-natal growth and development and fertility. SNPs within the bovine ZNF215 gene were associated with bovine growth and body conformation traits and studies in humans have revealed that the human ZNF215 ortholog belongs to the imprinted gene cluster associated with Beckwith-Wiedemann syndrome--a genetic disorder characterised by growth abnormalities. Similarly, the data presented here suggest that the ZNF215 gene may have an important role in regulating bovine growth. Collectively, our results support previous work showing that (candidate) imprinted genes/loci contribute to heritable variation in bovine performance traits and suggest that DNA sequence polymorphisms within these genes/loci represents an important reservoir of genomic markers for future genetic improvement of dairy and beef cattle populations.

DNA sequence polymorphisms in a panel of eight candidate bovine imprinted genes and their association with performance traits in Irish Holstein-Friesian cattle

PubMed Central

2010-01-01

Background Studies in mice and humans have shown that imprinted genes, whereby expression from one of the two parentally inherited alleles is attenuated or completely silenced, have a major effect on mammalian growth, metabolism and physiology. More recently, investigations in livestock species indicate that genes subject to this type of epigenetic regulation contribute to, or are associated with, several performance traits, most notably muscle mass and fat deposition. In the present study, a candidate gene approach was adopted to assess 17 validated single nucleotide polymorphisms (SNPs) and their association with a range of performance traits in 848 progeny-tested Irish Holstein-Friesian artificial insemination sires. These SNPs are located proximal to, or within, the bovine orthologs of eight genes (CALCR, GRB10, PEG3, PHLDA2, RASGRF1, TSPAN32, ZIM2 and ZNF215) that have been shown to be imprinted in cattle or in at least one other mammalian species (i.e. human/mouse/pig/sheep). Results Heterozygosities for all SNPs analysed ranged from 0.09 to 0.46 and significant deviations from Hardy-Weinberg proportions (P ≤ 0.01) were observed at four loci. Phenotypic associations (P ≤ 0.05) were observed between nine SNPs proximal to, or within, six of the eight analysed genes and a number of performance traits evaluated, including milk protein percentage, somatic cell count, culled cow and progeny carcass weight, angularity, body conditioning score, progeny carcass conformation, body depth, rump angle, rump width, animal stature, calving difficulty, gestation length and calf perinatal mortality. Notably, SNPs within the imprinted paternally expressed gene 3 (PEG3) gene cluster were associated (P ≤ 0.05) with calving, calf performance and fertility traits, while a single SNP in the zinc finger protein 215 gene (ZNF215) was associated with milk protein percentage (P ≤ 0.05), progeny carcass weight (P ≤ 0.05), culled cow carcass weight (P ≤ 0.01), angularity (P ≤ 0.01), body depth (P ≤ 0.01), rump width (P ≤ 0.01) and animal stature (P ≤ 0.01). Conclusions Of the eight candidate bovine imprinted genes assessed, DNA sequence polymorphisms in six of these genes (CALCR, GRB10, PEG3, RASGRF1, ZIM2 and ZNF215) displayed associations with several of the phenotypes included for analyses. The genotype-phenotype associations detected here are further supported by the biological function of these six genes, each of which plays important roles in mammalian growth, development and physiology. The associations between SNPs within the imprinted PEG3 gene cluster and traits related to calving, calf performance and gestation length suggest that this domain on chromosome 18 may play a role regulating pre-natal growth and development and fertility. SNPs within the bovine ZNF215 gene were associated with bovine growth and body conformation traits and studies in humans have revealed that the human ZNF215 ortholog belongs to the imprinted gene cluster associated with Beckwith-Wiedemann syndrome--a genetic disorder characterised by growth abnormalities. Similarly, the data presented here suggest that the ZNF215 gene may have an important role in regulating bovine growth. Collectively, our results support previous work showing that (candidate) imprinted genes/loci contribute to heritable variation in bovine performance traits and suggest that DNA sequence polymorphisms within these genes/loci represents an important reservoir of genomic markers for future genetic improvement of dairy and beef cattle populations. PMID:20942903

Transcriptional Profiling and Identification of Heat-Responsive Genes in Perennial Ryegrass by RNA-Sequencing

PubMed Central

Wang, Kehua; Liu, Yanrong; Tian, Jinli; Huang, Kunyong; Shi, Tianran; Dai, Xiaoxia; Zhang, Wanjun

2017-01-01

Perennial ryegrass (Lolium perenne) is one of the most widely used forage and turf grasses in the world due to its desirable agronomic qualities. However, as a cool-season perennial grass species, high temperature is a major factor limiting its performance in warmer and transition regions. In this study, a de novo transcriptome was generated using a cDNA library constructed from perennial ryegrass leaves subjected to short-term heat stress treatment. Then the expression profiling and identification of perennial ryegrass heat response genes by digital gene expression analyses was performed. The goal of this work was to produce expression profiles of high temperature stress responsive genes in perennial ryegrass leaves and further identify the potentially important candidate genes with altered levels of transcript, such as those genes involved in transcriptional regulation, antioxidant responses, plant hormones and signal transduction, and cellular metabolism. The de novo assembly of perennial ryegrass transcriptome in this study obtained more total and annotated unigenes compared to previously published ones. Many DEGs identified were genes that are known to respond to heat stress in plants, including HSFs, HSPs, and antioxidant related genes. In the meanwhile, we also identified four gene candidates mainly involved in C4 carbon fixation, and one TOR gene. Their exact roles in plant heat stress response need to dissect further. This study would be important by providing the gene resources for improving heat stress tolerance in both perennial ryegrass and other cool-season perennial grass plants. PMID:28680431

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

PubMed

Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

2018-02-12

Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

Bioinformatics-Based Identification of Candidate Genes from QTLs Associated with Cell Wall Traits in Populus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ranjan, Priya; Yin, Tongming; Zhang, Xinye

2009-11-01

Quantitative trait locus (QTL) studies are an integral part of plant research and are used to characterize the genetic basis of phenotypic variation observed in structured populations and inform marker-assisted breeding efforts. These QTL intervals can span large physical regions on a chromosome comprising hundreds of genes, thereby hampering candidate gene identification. Genome history, evolution, and expression evidence can be used to narrow the genes in the interval to a smaller list that is manageable for detailed downstream functional genomics characterization. Our primary motivation for the present study was to address the need for a research methodology that identifies candidatemore » genes within a broad QTL interval. Here we present a bioinformatics-based approach for subdividing candidate genes within QTL intervals into alternate groups of high probability candidates. Application of this approach in the context of studying cell wall traits, specifically lignin content and S/G ratios of stem and root in Populus plants, resulted in manageable sets of genes of both known and putative cell wall biosynthetic function. These results provide a roadmap for future experimental work leading to identification of new genes controlling cell wall recalcitrance and, ultimately, in the utility of plant biomass as an energy feedstock.« less

A data-mining approach to rank candidate protein-binding partners-The case of biogenesis of lysosome-related organelles complex-1 (BLOC-1).

PubMed

Rodriguez-Fernandez, I A; Dell'Angelica, E C

2009-04-01

The study of protein-protein interactions is a powerful approach to uncovering the molecular function of gene products associated with human disease. Protein-protein interaction data are accumulating at an unprecedented pace owing to interactomics projects, although it has been recognized that a significant fraction of these data likely represents false positives. During our studies of biogenesis of lysosome-related organelles complex-1 (BLOC-1), a protein complex involved in protein trafficking and containing the products of genes mutated in Hermansky-Pudlak syndrome, we faced the problem of having too many candidate binding partners to pursue experimentally. In this work, we have explored ways of efficiently gathering high-quality information about candidate binding partners and presenting the information in a visually friendly manner. We applied the approach to rank 70 candidate binding partners of human BLOC-1 and 102 candidates of its counterpart from Drosophila melanogaster. The top candidate for human BLOC-1 was the small GTPase encoded by the RAB11A gene, which is a paralogue of the Rab38 and Rab32 proteins in mammals and the lightoid gene product in flies. Interestingly, genetic analyses in D. melanogaster uncovered a synthetic sick/lethal interaction between Rab11 and lightoid. The data-mining approach described herein can be customized to study candidate binding partners for other proteins or possibly candidates derived from other types of 'omics' data.

Sleeping Beauty mutagenesis reveals cooperating mutations and pathways in pancreatic adenocarcinoma

PubMed Central

Mann, Karen M.; Ward, Jerrold M.; Yew, Christopher Chin Kuan; Kovochich, Anne; Dawson, David W.; Black, Michael A.; Brett, Benjamin T.; Sheetz, Todd E.; Dupuy, Adam J.; Chang, David K.; Biankin, Andrew V.; Waddell, Nicola; Kassahn, Karin S.; Grimmond, Sean M.; Rust, Alistair G.; Adams, David J.; Jenkins, Nancy A.; Copeland, Neal G.

2012-01-01

Pancreatic cancer is one of the most deadly cancers affecting the Western world. Because the disease is highly metastatic and difficult to diagnosis until late stages, the 5-y survival rate is around 5%. The identification of molecular cancer drivers is critical for furthering our understanding of the disease and development of improved diagnostic tools and therapeutics. We have conducted a mutagenic screen using Sleeping Beauty (SB) in mice to identify new candidate cancer genes in pancreatic cancer. By combining SB with an oncogenic Kras allele, we observed highly metastatic pancreatic adenocarcinomas. Using two independent statistical methods to identify loci commonly mutated by SB in these tumors, we identified 681 loci that comprise 543 candidate cancer genes (CCGs); 75 of these CCGs, including Mll3 and Ptk2, have known mutations in human pancreatic cancer. We identified point mutations in human pancreatic patient samples for another 11 CCGs, including Acvr2a and Map2k4. Importantly, 10% of the CCGs are involved in chromatin remodeling, including Arid4b, Kdm6a, and Nsd3, and all SB tumors have at least one mutated gene involved in this process; 20 CCGs, including Ctnnd1, Fbxo11, and Vgll4, are also significantly associated with poor patient survival. SB mutagenesis provides a rich resource of mutations in potential cancer drivers for cross-comparative analyses with ongoing sequencing efforts in human pancreatic adenocarcinoma. PMID:22421440

A Family-Based Association Analysis and Meta-Analysis of the Reading Disabilities Candidate Gene DYX1C1

PubMed Central

Tran, C.; Gagnon, F.; Wigg, K.G.; Feng, Y.; Gomez, L.; Cate-Carter, T.D.; Kerr, E.N.; Field, L.L.; Kaplan, B.J.; Lovett, M.W.; Barr, C.L.

2017-01-01

Reading disabilities (RD) have a significant genetic basis and have shown linkage to multiple regions including chromosome 15q. Dyslexia susceptibility 1 candidate gene 1 (DYX1C1) on chromosome 15q21 was originally proposed as a candidate gene with two potentially functional polymorphisms at the −3G/A and 1249G/T positions showing association with RD. However, subsequent studies have yielded mixed results. We performed a literature review and meta-analysis of the −3G/A and 1249G/T polymorphisms, including new unpublished data from two family-based samples. Ten markers in DYX1C1 were genotyped in the two independently ascertained samples. Single marker and −3G/A:1249G/T haplotype analyses were performed for RD in both samples, and quantitative trait analyses using standardized reading-related measures was performed in one of the samples. For the meta-analysis, we used a random-effects model to summarize studies that tested for association between −3G/A or 1249G/T and RD. No significant association was found between the DYX1C1 SNPs and RD or any of the reading-related measures tested after correction for the number of tests performed. The previously reported risk haplotype (−3A:1249T) was not biased in transmission. A total of 9 and 10 study samples were included in the meta-analysis of the −3G/A and 1249G/T polymorphisms, respectively. Neither polymorphism reached statistical significance, but the heterogeneity for the 1249G/T polymorphism was high. The results of this study do not provide evidence for association between the putatively functional SNPs −3G/A and 1249G/T and RD. PMID:23341075

Targeted sequencing identifies 91 neurodevelopmental disorder risk genes with autism and developmental disability biases

PubMed Central

Stessman, Holly A. F.; Xiong, Bo; Coe, Bradley P.; Wang, Tianyun; Hoekzema, Kendra; Fenckova, Michaela; Kvarnung, Malin; Gerdts, Jennifer; Trinh, Sandy; Cosemans, Nele; Vives, Laura; Lin, Janice; Turner, Tychele N.; Santen, Gijs; Ruivenkamp, Claudia; Kriek, Marjolein; van Haeringen, Arie; Aten, Emmelien; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Haan, Eric; Shaw, Marie; Gecz, Jozef; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Schwartz, Charles; Kooy, R. Frank; Vandeweyer, Geert; Helsmoortel, Celine; Romano, Corrado; Alberti, Antonino; Vinci, Mirella; Avola, Emanuela; Giusto, Stefania; Courchesne, Eric; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Amaral, David; Scheffer, Ingrid E.; Delatycki, Martin B.; Lockhart, Paul J.; Hormozdiari, Fereydoun; Harich, Benjamin; Castells-Nobau, Anna; Xia, Kun; Peeters, Hilde; Nordenskjöld, Magnus; Schenck, Annette; Bernier, Raphael A.; Eichler, Evan E.

2017-01-01

Gene-disruptive mutations contribute to the biology of neurodevelopmental disorders (NDDs), but most pathogenic genes are not known. We sequenced 208 candidate genes from >11,730 patients and >2,867 controls. We report 91 genes with an excess of de novo mutations or private disruptive mutations in 5.7% of patients, including 38 novel NDD genes. Drosophila functional assays of a subset bolster their involvement in NDDs. We identify 25 genes that show a bias for autism versus intellectual disability and highlight a network associated with high-functioning autism (FSIQ>100). Clinical follow-up for NAA15, KMT5B, and ASH1L reveals novel syndromic and non-syndromic forms of disease. PMID:28191889

Identification of genomic aberrations in hemangioblastoma by droplet digital PCR and SNP microarray highlights novel candidate genes and pathways for pathogenesis.

PubMed

Mehrian-Shai, Ruty; Yalon, Michal; Moshe, Itai; Barshack, Iris; Nass, Dvorah; Jacob, Jasmine; Dor, Chen; Reichardt, Juergen K V; Constantini, Shlomi; Toren, Amos

2016-01-14

The genetic mechanisms underlying hemangioblastoma development are still largely unknown. We used high-resolution single nucleotide polymorphism microarrays and droplet digital PCR analysis to detect copy number variations (CNVs) in total of 45 hemangioblastoma tumors. We identified 94 CNVs with a median of 18 CNVs per sample. The most frequently gained regions were on chromosomes 1 (p36.32) and 7 (p11.2). These regions contain the EGFR and PRDM16 genes. Recurrent losses were located at chromosome 12 (q24.13), which includes the gene PTPN11. Our findings provide the first high-resolution genome-wide view of chromosomal changes in hemangioblastoma and identify 23 candidate genes: EGFR, PRDM16, PTPN11, HOXD11, HOXD13, FLT3, PTCH, FGFR1, FOXP1, GPC3, HOXC13, HOXC11, MKL1, CHEK2, IRF4, GPHN, IKZF1, RB1, HOXA9, and micro RNA, such as hsa-mir-196a-2 for hemangioblastoma pathogenesis. Furthermore, our data implicate that cell proliferation and angiogenesis promoting pathways may be involved in the molecular pathogenesis of hemangioblastoma.

Detection of genomic signatures of recent selection in commercial broiler chickens.

PubMed

Fu, Weixuan; Lee, William R; Abasht, Behnam

2016-08-26

Identification of the genomic signatures of recent selection may help uncover causal polymorphisms controlling traits relevant to recent decades of selective breeding in livestock. In this study, we aimed at detecting signatures of recent selection in commercial broiler chickens using genotype information from single nucleotide polymorphisms (SNPs). A total of 565 chickens from five commercial purebred lines, including three broiler sire (male) lines and two broiler dam (female) lines, were genotyped using the 60K SNP Illumina iSelect chicken array. To detect genomic signatures of recent selection, we applied two methods based on population comparison, cross-population extended haplotype homozygosity (XP-EHH) and cross-population composite likelihood ratio (XP-CLR), and further analyzed the results to find genomic regions under recent selection in multiple purebred lines. A total of 321 candidate selection regions spanning approximately 1.45 % of the chicken genome in each line were detected by consensus of results of both XP-EHH and XP-CLR methods. To minimize false discovery due to genetic drift, only 42 of the candidate selection regions that were shared by 2 or more purebred lines were considered as high-confidence selection regions in the study. Of these 42 regions, 20 were 50 kb or less while 4 regions were larger than 0.5 Mb. In total, 91 genes could be found in the 42 regions, among which 19 regions contained only 1 or 2 genes, and 9 regions were located at gene deserts. Our results provide a genome-wide scan of recent selection signatures in five purebred lines of commercial broiler chickens. We found several candidate genes for recent selection in multiple lines, such as SOX6 (Sex Determining Region Y-Box 6) and cTR (Thyroid hormone receptor beta). These genes may have been under recent selection due to their essential roles in growth, development and reproduction in chickens. Furthermore, our results suggest that in some candidate regions, the same or opposite alleles have been under recent selection in multiple lines. Most of the candidate genes in the selection regions are novel, and as such they should be of great interest for future research into the genetic architecture of traits relevant to modern broiler breeding.

A public platform for the verification of the phenotypic effect of candidate genes for resistance to aflatoxin accumulation and Aspergillus flavus infection in maize

USDA-ARS?s Scientific Manuscript database

A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of any maize gene sequence with resistance under field conditions. Reso...

SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate

Treesearch

Gretchen H. Roffler; Stephen J. Amish; Seth Smith; Ted Cosart; Marty Kardos; Michael K. Schwartz; Gordon Luikart

2016-01-01

Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding...

Association Studies of 22 Candidate SNPs with Late-Onset Alzheimer's Disease

PubMed Central

Figgins, Jessica A.; Minster, Ryan L.; Demirci, F. Yesim; DeKosky, Steven T.; Kamboh, M. Ilyas

2009-01-01

Alzheimer's disease (AD) is a complex and multifactorial disease with the possible involvement of several genes. With the exception of the APOE gene as a susceptibility marker, no other genes have been shown consistently to be associated with late-onset AD (LOAD). A recent genome-wide association study of 17,343 gene-based putative functional single nucleotide polymorphisms (SNPs) found 19 significant variants, including 3 linked to APOE, showing association with LOAD (Hum Mol Genet 2007; 16:865–873). We have set out to replicate the 16 new significant associations in a large case-control cohort of American Whites. Additionally, we examined six variants present in positional and/or biological candidate genes for AD. We genotyped the 22 SNPs in up to 1,009 Caucasian Americans with LOAD and up to 1,010 age-matched healthy Caucasian Americans, using 5′ nuclease assays. We did not observe a statistically significant association between the SNPs and the risk of AD, either individually or stratified by APOE. Our data suggest that the association of the studied variants with LOAD risk, if it exists, is not statistically significant in our sample. PMID:18780302

Copy number variants analysis in a cohort of isolated and syndromic developmental delay/intellectual disability reveals novel genomic disorders, position effects and candidate disease genes.

PubMed

Di Gregorio, E; Riberi, E; Belligni, E F; Biamino, E; Spielmann, M; Ala, U; Calcia, A; Bagnasco, I; Carli, D; Gai, G; Giordano, M; Guala, A; Keller, R; Mandrile, G; Arduino, C; Maffè, A; Naretto, V G; Sirchia, F; Sorasio, L; Ungari, S; Zonta, A; Zacchetti, G; Talarico, F; Pappi, P; Cavalieri, S; Giorgio, E; Mancini, C; Ferrero, M; Brussino, A; Savin, E; Gandione, M; Pelle, A; Giachino, D F; De Marchi, M; Restagno, G; Provero, P; Cirillo Silengo, M; Grosso, E; Buxbaum, J D; Pasini, B; De Rubeis, S; Brusco, A; Ferrero, G B

2017-10-01

Array-comparative genomic hybridization (array-CGH) is a widely used technique to detect copy number variants (CNVs) associated with developmental delay/intellectual disability (DD/ID). Identification of genomic disorders in DD/ID. We performed a comprehensive array-CGH investigation of 1,015 consecutive cases with DD/ID and combined literature mining, genetic evidence, evolutionary constraint scores, and functional information in order to assess the pathogenicity of the CNVs. We identified non-benign CNVs in 29% of patients. Amongst the pathogenic variants (11%), detected with a yield consistent with the literature, we found rare genomic disorders and CNVs spanning known disease genes. We further identified and discussed 51 cases with likely pathogenic CNVs spanning novel candidate genes, including genes encoding synaptic components and/or proteins involved in corticogenesis. Additionally, we identified two deletions spanning potential Topological Associated Domain (TAD) boundaries probably affecting the regulatory landscape. We show how phenotypic and genetic analyses of array-CGH data allow unraveling complex cases, identifying rare disease genes, and revealing unexpected position effects. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Scanning of selection signature provides a glimpse into important economic traits in goats (Capra hircus).

PubMed

Guan, Dailu; Luo, Nanjian; Tan, Xiaoshan; Zhao, Zhongquan; Huang, Yongfu; Na, Risu; Zhang, Jiahua; Zhao, Yongju

2016-10-31

Goats (Capra hircus) are one of the oldest livestock domesticated species, and have been used for their milk, meat, hair and skins over much of the world. Detection of selection footprints in genomic regions can provide potential insights for understanding the genetic mechanism of specific phenotypic traits and better guide in animal breeding. The study presented here has generated 192.747G raw data and identified more than 5.03 million single-nucleotide polymorphisms (SNPs) and 334,151 Indels (insertions and deletions). In addition, we identified 155 and 294 candidate regions harboring 86 and 97 genes based on allele frequency differences in Dazu black goats (DBG) and Inner Mongolia cashmere goats (IMCG), respectively. Populations differentiation reflected by Fst values detected 368 putative selective sweep regions including 164 genes. The top 1% regions of both low heterozygosity and high genetic differentiation contained 239 (135 genes) and 176 (106 genes) candidate regions in DBG and IMCG, respectively. These genes were related to reproductive and productive traits, such as "neurohypophyseal hormone activity" and "adipocytokine signaling pathway". These findings may be conducive to molecular breeding and the long-term preservation of the valuable genetic resources for this species.

High-density genetic map using whole-genome resequencing for fine mapping and candidate gene discovery for disease resistance in peanut.

PubMed

Agarwal, Gaurav; Clevenger, Josh; Pandey, Manish K; Wang, Hui; Shasidhar, Yaduru; Chu, Ye; Fountain, Jake C; Choudhary, Divya; Culbreath, Albert K; Liu, Xin; Huang, Guodong; Wang, Xingjun; Deshmukh, Rupesh; Holbrook, C Corley; Bertioli, David J; Ozias-Akins, Peggy; Jackson, Scott A; Varshney, Rajeev K; Guo, Baozhu

2018-04-10

Whole-genome resequencing (WGRS) of mapping populations has facilitated development of high-density genetic maps essential for fine mapping and candidate gene discovery for traits of interest in crop species. Leaf spots, including early leaf spot (ELS) and late leaf spot (LLS), and Tomato spotted wilt virus (TSWV) are devastating diseases in peanut causing significant yield loss. We generated WGRS data on a recombinant inbred line population, developed a SNP-based high-density genetic map, and conducted fine mapping, candidate gene discovery and marker validation for ELS, LLS and TSWV. The first sequence-based high-density map was constructed with 8869 SNPs assigned to 20 linkage groups, representing 20 chromosomes, for the 'T' population (Tifrunner × GT-C20) with a map length of 3120 cM and an average distance of 1.45 cM. The quantitative trait locus (QTL) analysis using high-density genetic map and multiple season phenotyping data identified 35 main-effect QTLs with phenotypic variation explained (PVE) from 6.32% to 47.63%. Among major-effect QTLs mapped, there were two QTLs for ELS on B05 with 47.42% PVE and B03 with 47.38% PVE, two QTLs for LLS on A05 with 47.63% and B03 with 34.03% PVE and one QTL for TSWV on B09 with 40.71% PVE. The epistasis and environment interaction analyses identified significant environmental effects on these traits. The identified QTL regions had disease resistance genes including R-genes and transcription factors. KASP markers were developed for major QTLs and validated in the population and are ready for further deployment in genomics-assisted breeding in peanut. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

A genomic scan for selection reveals candidates for genes involved in the evolution of cultivated sunflower (Helianthus annuus).

PubMed

Chapman, Mark A; Pashley, Catherine H; Wenzler, Jessica; Hvala, John; Tang, Shunxue; Knapp, Steven J; Burke, John M

2008-11-01

Genomic scans for selection are a useful tool for identifying genes underlying phenotypic transitions. In this article, we describe the results of a genome scan designed to identify candidates for genes targeted by selection during the evolution of cultivated sunflower. This work involved screening 492 loci derived from ESTs on a large panel of wild, primitive (i.e., landrace), and improved sunflower (Helianthus annuus) lines. This sampling strategy allowed us to identify candidates for selectively important genes and investigate the likely timing of selection. Thirty-six genes showed evidence of selection during either domestication or improvement based on multiple criteria, and a sequence-based test of selection on a subset of these loci confirmed this result. In view of what is known about the structure of linkage disequilibrium across the sunflower genome, these genes are themselves likely to have been targeted by selection, rather than being merely linked to the actual targets. While the selection candidates showed a broad range of putative functions, they were enriched for genes involved in amino acid synthesis and protein catabolism. Given that a similar pattern has been detected in maize (Zea mays), this finding suggests that selection on amino acid composition may be a general feature of the evolution of crop plants. In terms of genomic locations, the selection candidates were significantly clustered near quantitative trait loci (QTL) that contribute to phenotypic differences between wild and cultivated sunflower, and specific instances of QTL colocalization provide some clues as to the roles that these genes may have played during sunflower evolution.

A priori and a posteriori approaches for finding genes of evolutionary interest in non-model species: osmoregulatory genes in the kidney transcriptome of the desert rodent Dipodomys spectabilis (banner-tailed kangaroo rat).

PubMed

Marra, Nicholas J; Eo, Soo Hyung; Hale, Matthew C; Waser, Peter M; DeWoody, J Andrew

2012-12-01

One common goal in evolutionary biology is the identification of genes underlying adaptive traits of evolutionary interest. Recently next-generation sequencing techniques have greatly facilitated such evolutionary studies in species otherwise depauperate of genomic resources. Kangaroo rats (Dipodomys sp.) serve as exemplars of adaptation in that they inhabit extremely arid environments, yet require no drinking water because of ultra-efficient kidney function and osmoregulation. As a basis for identifying water conservation genes in kangaroo rats, we conducted a priori bioinformatics searches in model rodents (Mus musculus and Rattus norvegicus) to identify candidate genes with known or suspected osmoregulatory function. We then obtained 446,758 reads via 454 pyrosequencing to characterize genes expressed in the kidney of banner-tailed kangaroo rats (Dipodomys spectabilis). We also determined candidates a posteriori by identifying genes that were overexpressed in the kidney. The kangaroo rat sequences revealed nine different a priori candidate genes predicted from our Mus and Rattus searches, as well as 32 a posteriori candidate genes that were overexpressed in kidney. Mutations in two of these genes, Slc12a1 and Slc12a3, cause human renal diseases that result in the inability to concentrate urine. These genes are likely key determinants of physiological water conservation in desert rodents. Copyright © 2012 Elsevier Inc. All rights reserved.

Transcriptomic analysis links gene expression to unilateral pollen-pistil reproductive barriers.

PubMed

Broz, Amanda K; Guerrero, Rafael F; Randle, April M; Baek, You Soon; Hahn, Matthew W; Bedinger, Patricia A

2017-04-24

Unilateral incompatibility (UI) is an asymmetric reproductive barrier that unidirectionally prevents gene flow between species and/or populations. UI is characterized by a compatible interaction between partners in one direction, but in the reciprocal cross fertilization fails, generally due to pollen tube rejection by the pistil. Although UI has long been observed in crosses between different species, the underlying molecular mechanisms are only beginning to be characterized. The wild tomato relative Solanum habrochaites provides a unique study system to investigate the molecular basis of this reproductive barrier, as populations within the species exhibit both interspecific and interpopulation UI. Here we utilized a transcriptomic approach to identify genes in both pollen and pistil tissues that may be key players in UI. We confirmed UI at the pollen-pistil level between a self-incompatible population and a self-compatible population of S. habrochaites. A comparison of gene expression between pollinated styles exhibiting the incompatibility response and unpollinated controls revealed only a small number of differentially expressed transcripts. Many more differences in transcript profiles were identified between UI-competent versus UI-compromised reproductive tissues. A number of intriguing candidate genes were highly differentially expressed, including a putative pollen arabinogalactan protein, a stylar Kunitz family protease inhibitor, and a stylar peptide hormone Rapid ALkalinization Factor. Our data also provide transcriptomic evidence that fundamental processes including reactive oxygen species (ROS) signaling are likely key in UI pollen-pistil interactions between both populations and species. Gene expression analysis of reproductive tissues allowed us to better understand the molecular basis of interpopulation incompatibility at the level of pollen-pistil interactions. Our transcriptomic analysis highlighted specific genes, including those in ROS signaling pathways that warrant further study in investigations of UI. To our knowledge, this is the first report to identify candidate genes involved in unilateral barriers between populations within a species.

Cross-Species Transcriptome Profiling Identifies New Alveolar Epithelial Type I Cell–Specific Genes

PubMed Central

Sunohara, Mitsuhiro; Pouldar, Tiffany M.; Wang, Hongjun; Liu, Yixin; Rieger, Megan E.; Tran, Evelyn; Flodby, Per; Siegmund, Kimberly D.; Crandall, Edward D.; Laird-Offringa, Ite A.

2017-01-01

Diseases involving the distal lung alveolar epithelium include chronic obstructive pulmonary disease, idiopathic pulmonary fibrosis, and lung adenocarcinoma. Accurate labeling of specific cell types is critical for determining the contribution of each to the pathogenesis of these diseases. The distal lung alveolar epithelium is composed of two cell types, alveolar epithelial type 1 (AT1) and type 2 (AT2) cells. Although cell type–specific markers, most prominently surfactant protein C, have allowed detailed lineage tracing studies of AT2 cell differentiation and the cells’ roles in disease, studies of AT1 cells have been hampered by a lack of genes with expression unique to AT1 cells. In this study, we performed genome-wide expression profiling of multiple rat organs together with purified rat AT2, AT1, and in vitro differentiated AT1-like cells, resulting in the identification of 54 candidate AT1 cell markers. Cross-referencing with genes up-regulated in human in vitro differentiated AT1-like cells narrowed the potential list to 18 candidate genes. Testing the top four candidate genes at RNA and protein levels revealed GRAM domain 2 (GRAMD2), a protein of unknown function, as highly specific to AT1 cells. RNA sequencing (RNAseq) confirmed that GRAMD2 is transcriptionally silent in human AT2 cells. Immunofluorescence verified that GRAMD2 expression is restricted to the plasma membrane of AT1 cells and is not expressed in bronchial epithelial cells, whereas reverse transcription–polymerase chain reaction confirmed that it is not expressed in endothelial cells. Using GRAMD2 as a new AT1 cell–specific gene will enhance AT1 cell isolation, the investigation of alveolar epithelial cell differentiation potential, and the contribution of AT1 cells to distal lung diseases. PMID:27749084

Genomic signatures of fine-scale local selection in Atlantic salmon suggest involvement of sexual maturation, energy homeostasis and immune defence-related genes.

PubMed

Pritchard, Victoria L; Mäkinen, Hannu; Vähä, Juha-Pekka; Erkinaro, Jaakko; Orell, Panu; Primmer, Craig R

2018-06-01

Elucidating the genetic basis of adaptation to the local environment can improve our understanding of how the diversity of life has evolved. In this study, we used a dense SNP array to identify candidate loci potentially underlying fine-scale local adaptation within a large Atlantic salmon (Salmo salar) population. By combining outlier, gene-environment association and haplotype homozygosity analyses, we identified multiple regions of the genome with strong evidence for diversifying selection. Several of these candidate regions had previously been identified in other studies, demonstrating that the same loci could be adaptively important in Atlantic salmon at subdrainage, regional and continental scales. Notably, we identified signals consistent with local selection around genes associated with variation in sexual maturation, energy homeostasis and immune defence. These included the large-effect age-at-maturity gene vgll3, the known obesity gene mc4r, and major histocompatibility complex II. Most strikingly, we confirmed a genomic region on Ssa09 that was extremely differentiated among subpopulations and that is also a candidate for local selection over the global range of Atlantic salmon. This region colocalized with a haplotype strongly associated with spawning ecotype in sockeye salmon (Oncorhynchus nerka), with circumstantial evidence that the same gene (six6) may be the selective target in both cases. The phenotypic effect of this region in Atlantic salmon remains cryptic, although allelic variation is related to upstream catchment area and covaries with timing of the return spawning migration. Our results further inform management of Atlantic salmon and open multiple avenues for future research. © 2018 John Wiley & Sons Ltd.

Whole-genome sequence analyses of Western Central African Pygmy hunter-gatherers reveal a complex demographic history and identify candidate genes under positive natural selection

PubMed Central

Hsieh, PingHsun; Veeramah, Krishna R.; Lachance, Joseph; Tishkoff, Sarah A.; Wall, Jeffrey D.; Hammer, Michael F.; Gutenkunst, Ryan N.

2016-01-01

African Pygmies practicing a mobile hunter-gatherer lifestyle are phenotypically and genetically diverged from other anatomically modern humans, and they likely experienced strong selective pressures due to their unique lifestyle in the Central African rainforest. To identify genomic targets of adaptation, we sequenced the genomes of four Biaka Pygmies from the Central African Republic and jointly analyzed these data with the genome sequences of three Baka Pygmies from Cameroon and nine Yoruba famers. To account for the complex demographic history of these populations that includes both isolation and gene flow, we fit models using the joint allele frequency spectrum and validated them using independent approaches. Our two best-fit models both suggest ancient divergence between the ancestors of the farmers and Pygmies, 90,000 or 150,000 yr ago. We also find that bidirectional asymmetric gene flow is statistically better supported than a single pulse of unidirectional gene flow from farmers to Pygmies, as previously suggested. We then applied complementary statistics to scan the genome for evidence of selective sweeps and polygenic selection. We found that conventional statistical outlier approaches were biased toward identifying candidates in regions of high mutation or low recombination rate. To avoid this bias, we assigned P-values for candidates using whole-genome simulations incorporating demography and variation in both recombination and mutation rates. We found that genes and gene sets involved in muscle development, bone synthesis, immunity, reproduction, cell signaling and development, and energy metabolism are likely to be targets of positive natural selection in Western African Pygmies or their recent ancestors. PMID:26888263

Association of genetic variation with systolic and diastolic blood pressure among African Americans: the Candidate Gene Association Resource study

PubMed Central

Fox, Ervin R.; Young, J. Hunter; Li, Yali; Dreisbach, Albert W.; Keating, Brendan J.; Musani, Solomon K.; Liu, Kiang; Morrison, Alanna C.; Ganesh, Santhi; Kutlar, Abdullah; Ramachandran, Vasan S.; Polak, Josef F.; Fabsitz, Richard R.; Dries, Daniel L.; Farlow, Deborah N.; Redline, Susan; Adeyemo, Adebowale; Hirschorn, Joel N.; Sun, Yan V.; Wyatt, Sharon B.; Penman, Alan D.; Palmas, Walter; Rotter, Jerome I.; Townsend, Raymond R.; Doumatey, Ayo P.; Tayo, Bamidele O.; Mosley, Thomas H.; Lyon, Helen N.; Kang, Sun J.; Rotimi, Charles N.; Cooper, Richard S.; Franceschini, Nora; Curb, J. David; Martin, Lisa W.; Eaton, Charles B.; Kardia, Sharon L.R.; Taylor, Herman A.; Caulfield, Mark J.; Ehret, Georg B.; Johnson, Toby; Chakravarti, Aravinda; Zhu, Xiaofeng; Levy, Daniel; Munroe, Patricia B.; Rice, Kenneth M.; Bochud, Murielle; Johnson, Andrew D.; Chasman, Daniel I.; Smith, Albert V.; Tobin, Martin D.; Verwoert, Germaine C.; Hwang, Shih-Jen; Pihur, Vasyl; Vollenweider, Peter; O'Reilly, Paul F.; Amin, Najaf; Bragg-Gresham, Jennifer L.; Teumer, Alexander; Glazer, Nicole L.; Launer, Lenore; Zhao, Jing Hua; Aulchenko, Yurii; Heath, Simon; Sõber, Siim; Parsa, Afshin; Luan, Jian'an; Arora, Pankaj; Dehghan, Abbas; Zhang, Feng; Lucas, Gavin; Hicks, Andrew A.; Jackson, Anne U.; Peden, John F.; Tanaka, Toshiko; Wild, Sarah H.; Rudan, Igor; Igl, Wilmar; Milaneschi, Yuri; Parker, Alex N.; Fava, Cristiano; Chambers, John C.; Kumari, Meena; JinGo, Min; van der Harst, Pim; Kao, Wen Hong Linda; Sjögren, Marketa; Vinay, D.G.; Alexander, Myriam; Tabara, Yasuharu; Shaw-Hawkins, Sue; Whincup, Peter H.; Liu, Yongmei; Shi, Gang; Kuusisto, Johanna; Seielstad, Mark; Sim, Xueling; Nguyen, Khanh-Dung Hoang; Lehtimäki, Terho; Matullo, Giuseppe; Wu, Ying; Gaunt, Tom R.; Charlotte Onland-Moret, N.; Cooper, Matthew N.; Platou, Carl G.P.; Org, Elin; Hardy, Rebecca; Dahgam, Santosh; Palmen, Jutta; Vitart, Veronique; Braund, Peter S.; Kuznetsova, Tatiana; Uiterwaal, Cuno S.P.M.; Campbell, Harry; Ludwig, Barbara; Tomaszewski, Maciej; Tzoulaki, Ioanna; Palmer, Nicholette D.; Aspelund, Thor; Garcia, Melissa; Chang, Yen-Pei C.; O'Connell, Jeffrey R.; Steinle, Nanette I.; Grobbee, Diederick E.; Arking, Dan E.; Hernandez, Dena; Najjar, Samer; McArdle, Wendy L.; Hadley, David; Brown, Morris J.; Connell, John M.; Hingorani, Aroon D.; Day, Ian N.M.; Lawlor, Debbie A.; Beilby, John P.; Lawrence, Robert W.; Clarke, Robert; Collins, Rory; Hopewell, Jemma C.; Ongen, Halit; Bis, Joshua C.; Kähönen, Mika; Viikari, Jorma; Adair, Linda S.; Lee, Nanette R.; Chen, Ming-Huei; Olden, Matthias; Pattaro, Cristian; Hoffman Bolton, Judith A.; Köttgen, Anna; Bergmann, Sven; Mooser, Vincent; Chaturvedi, Nish; Frayling, Timothy M.; Islam, Muhammad; Jafar, Tazeen H.; Erdmann, Jeanette; Kulkarni, Smita R.; Bornstein, Stefan R.; Grässler, Jürgen; Groop, Leif; Voight, Benjamin F.; Kettunen, Johannes; Howard, Philip; Taylor, Andrew; Guarrera, Simonetta; Ricceri, Fulvio; Emilsson, Valur; Plump, Andrew; Barroso, Inês; Khaw, Kay-Tee; Weder, Alan B.; Hunt, Steven C.; Bergman, Richard N.; Collins, Francis S.; Bonnycastle, Lori L.; Scott, Laura J.; Stringham, Heather M.; Peltonen, Leena; Perola, Markus; Vartiainen, Erkki; Brand, Stefan-Martin; Staessen, Jan A.; Wang, Thomas J.; Burton, Paul R.; SolerArtigas, Maria; Dong, Yanbin; Snieder, Harold; Wang, Xiaoling; Zhu, Haidong; Lohman, Kurt K.; Rudock, Megan E.; Heckbert, Susan R.; Smith, Nicholas L.; Wiggins, Kerri L.; Shriner, Daniel; Veldre, Gudrun; Viigimaa, Margus; Kinra, Sanjay; Prabhakaran, Dorairajan; Tripathy, Vikal; Langefeld, Carl D.; Rosengren, Annika; Thelle, Dag S.; MariaCorsi, Anna; Singleton, Andrew; Forrester, Terrence; Hilton, Gina; McKenzie, Colin A.; Salako, Tunde; Iwai, Naoharu; Kita, Yoshikuni; Ogihara, Toshio; Ohkubo, Takayoshi; Okamura, Tomonori; Ueshima, Hirotsugu; Umemura, Satoshi; Eyheramendy, Susana; Meitinger, Thomas; Wichmann, H.-Erich; Cho, Yoon Shin; Kim, Hyung-Lae; Lee, Jong-Young; Scott, James; Sehmi, Joban S.; Zhang, Weihua; Hedblad, Bo; Nilsson, Peter; Smith, George Davey; Wong, Andrew; Narisu, Narisu; Stančáková, Alena; Raffel, Leslie J.; Yao, Jie; Kathiresan, Sekar; O'Donnell, Chris; Schwartz, Steven M.; Arfan Ikram, M.; Longstreth, Will T.; Seshadri, Sudha; Shrine, Nick R.G.; Wain, Louise V.; Morken, Mario A.; Swift, Amy J.; Laitinen, Jaana; Prokopenko, Inga; Zitting, Paavo; Cooper, Jackie A.; Humphries, Steve E.; Danesh, John; Rasheed, Asif; Goel, Anuj; Hamsten, Anders; Watkins, Hugh; Bakker, Stephan J.L.; van Gilst, Wiek H.; Janipalli, Charles S.; Radha Mani, K.; Yajnik, Chittaranjan S.; Hofman, Albert; Mattace-Raso, Francesco U.S.; Oostra, Ben A.; Demirkan, Ayse; Isaacs, Aaron; Rivadeneira, Fernando; Lakatta, Edward G.; Orru, Marco; Scuteri, Angelo; Ala-Korpela, Mika; Kangas, Antti J.; Lyytikäinen, Leo-Pekka; Soininen, Pasi; Tukiainen, Taru; Würz, Peter; Twee-Hee Ong, Rick; Dörr, Marcus; Kroemer, Heyo K.; Völker, Uwe; Völzke, Henry; Galan, Pilar; Hercberg, Serge; Lathrop, Mark; Zelenika, Diana; Deloukas, Panos; Mangino, Massimo; Spector, Tim D.; Zhai, Guangju; Meschia, James F.; Nalls, Michael A.; Sharma, Pankaj; Terzic, Janos; Kranthi Kumar, M.J.; Denniff, Matthew; Zukowska-Szczechowska, Ewa; Wagenknecht, Lynne E.; Fowkes, Gerald R.; Charchar, Fadi J.; Schwarz, Peter E.H.; Hayward, Caroline; Guo, Xiuqing; Bots, Michiel L.; Brand, Eva; Samani, Nilesh J.; Polasek, Ozren; Talmud, Philippa J.; Nyberg, Fredrik; Kuh, Diana; Laan, Maris; Hveem, Kristian; Palmer, Lyle J.; van der Schouw, Yvonne T.; Casas, Juan P.; Mohlke, Karen L.; Vineis, Paolo; Raitakari, Olli; Wong, Tien Y.; Shyong Tai, E.; Laakso, Markku; Rao, Dabeeru C.; Harris, Tamara B.; Morris, Richard W.; Dominiczak, Anna F.; Kivimaki, Mika; Marmot, Michael G.; Miki, Tetsuro; Saleheen, Danish; Chandak, Giriraj R.; Coresh, Josef; Navis, Gerjan; Salomaa, Veikko; Han, Bok-Ghee; Kooner, Jaspal S.; Melander, Olle; Ridker, Paul M.; Bandinelli, Stefania; Gyllensten, Ulf B.; Wright, Alan F.; Wilson, James F.; Ferrucci, Luigi; Farrall, Martin; Tuomilehto, Jaakko; Pramstaller, Peter P.; Elosua, Roberto; Soranzo, Nicole; Sijbrands, Eric J.G.; Altshuler, David; Loos, Ruth J.F.; Shuldiner, Alan R.; Gieger, Christian; Meneton, Pierre; Uitterlinden, Andre G.; Wareham, Nicholas J.; Gudnason, Vilmundur; Rettig, Rainer; Uda, Manuela; Strachan, David P.; Witteman, Jacqueline C.M.; Hartikainen, Anna-Liisa; Beckmann, Jacques S.; Boerwinkle, Eric; Boehnke, Michael; Larson, Martin G.; Järvelin, Marjo-Riitta; Psaty, Bruce M.; Abecasis, Gonçalo R.; Elliott, Paul; van Duijn , Cornelia M.; Newton-Cheh, Christopher

2011-01-01

The prevalence of hypertension in African Americans (AAs) is higher than in other US groups; yet, few have performed genome-wide association studies (GWASs) in AA. Among people of European descent, GWASs have identified genetic variants at 13 loci that are associated with blood pressure. It is unknown if these variants confer susceptibility in people of African ancestry. Here, we examined genome-wide and candidate gene associations with systolic blood pressure (SBP) and diastolic blood pressure (DBP) using the Candidate Gene Association Resource (CARe) consortium consisting of 8591 AAs. Genotypes included genome-wide single-nucleotide polymorphism (SNP) data utilizing the Affymetrix 6.0 array with imputation to 2.5 million HapMap SNPs and candidate gene SNP data utilizing a 50K cardiovascular gene-centric array (ITMAT-Broad-CARe [IBC] array). For Affymetrix data, the strongest signal for DBP was rs10474346 (P= 3.6 × 10−8) located near GPR98 and ARRDC3. For SBP, the strongest signal was rs2258119 in C21orf91 (P= 4.7 × 10−8). The top IBC association for SBP was rs2012318 (P= 6.4 × 10−6) near SLC25A42 and for DBP was rs2523586 (P= 1.3 × 10−6) near HLA-B. None of the top variants replicated in additional AA (n = 11 882) or European-American (n = 69 899) cohorts. We replicated previously reported European-American blood pressure SNPs in our AA samples (SH2B3, P= 0.009; TBX3-TBX5, P= 0.03; and CSK-ULK3, P= 0.0004). These genetic loci represent the best evidence of genetic influences on SBP and DBP in AAs to date. More broadly, this work supports that notion that blood pressure among AAs is a trait with genetic underpinnings but also with significant complexity. PMID:21378095

Association of genetic variation with systolic and diastolic blood pressure among African Americans: the Candidate Gene Association Resource study.

PubMed

Fox, Ervin R; Young, J Hunter; Li, Yali; Dreisbach, Albert W; Keating, Brendan J; Musani, Solomon K; Liu, Kiang; Morrison, Alanna C; Ganesh, Santhi; Kutlar, Abdullah; Ramachandran, Vasan S; Polak, Josef F; Fabsitz, Richard R; Dries, Daniel L; Farlow, Deborah N; Redline, Susan; Adeyemo, Adebowale; Hirschorn, Joel N; Sun, Yan V; Wyatt, Sharon B; Penman, Alan D; Palmas, Walter; Rotter, Jerome I; Townsend, Raymond R; Doumatey, Ayo P; Tayo, Bamidele O; Mosley, Thomas H; Lyon, Helen N; Kang, Sun J; Rotimi, Charles N; Cooper, Richard S; Franceschini, Nora; Curb, J David; Martin, Lisa W; Eaton, Charles B; Kardia, Sharon L R; Taylor, Herman A; Caulfield, Mark J; Ehret, Georg B; Johnson, Toby; Chakravarti, Aravinda; Zhu, Xiaofeng; Levy, Daniel

2011-06-01

The prevalence of hypertension in African Americans (AAs) is higher than in other US groups; yet, few have performed genome-wide association studies (GWASs) in AA. Among people of European descent, GWASs have identified genetic variants at 13 loci that are associated with blood pressure. It is unknown if these variants confer susceptibility in people of African ancestry. Here, we examined genome-wide and candidate gene associations with systolic blood pressure (SBP) and diastolic blood pressure (DBP) using the Candidate Gene Association Resource (CARe) consortium consisting of 8591 AAs. Genotypes included genome-wide single-nucleotide polymorphism (SNP) data utilizing the Affymetrix 6.0 array with imputation to 2.5 million HapMap SNPs and candidate gene SNP data utilizing a 50K cardiovascular gene-centric array (ITMAT-Broad-CARe [IBC] array). For Affymetrix data, the strongest signal for DBP was rs10474346 (P= 3.6 × 10(-8)) located near GPR98 and ARRDC3. For SBP, the strongest signal was rs2258119 in C21orf91 (P= 4.7 × 10(-8)). The top IBC association for SBP was rs2012318 (P= 6.4 × 10(-6)) near SLC25A42 and for DBP was rs2523586 (P= 1.3 × 10(-6)) near HLA-B. None of the top variants replicated in additional AA (n = 11 882) or European-American (n = 69 899) cohorts. We replicated previously reported European-American blood pressure SNPs in our AA samples (SH2B3, P= 0.009; TBX3-TBX5, P= 0.03; and CSK-ULK3, P= 0.0004). These genetic loci represent the best evidence of genetic influences on SBP and DBP in AAs to date. More broadly, this work supports that notion that blood pressure among AAs is a trait with genetic underpinnings but also with significant complexity.

Integrative analysis of gene expression and DNA methylation using unsupervised feature extraction for detecting candidate cancer biomarkers.

PubMed

Moon, Myungjin; Nakai, Kenta

2018-04-01

Currently, cancer biomarker discovery is one of the important research topics worldwide. In particular, detecting significant genes related to cancer is an important task for early diagnosis and treatment of cancer. Conventional studies mostly focus on genes that are differentially expressed in different states of cancer; however, noise in gene expression datasets and insufficient information in limited datasets impede precise analysis of novel candidate biomarkers. In this study, we propose an integrative analysis of gene expression and DNA methylation using normalization and unsupervised feature extractions to identify candidate biomarkers of cancer using renal cell carcinoma RNA-seq datasets. Gene expression and DNA methylation datasets are normalized by Box-Cox transformation and integrated into a one-dimensional dataset that retains the major characteristics of the original datasets by unsupervised feature extraction methods, and differentially expressed genes are selected from the integrated dataset. Use of the integrated dataset demonstrated improved performance as compared with conventional approaches that utilize gene expression or DNA methylation datasets alone. Validation based on the literature showed that a considerable number of top-ranked genes from the integrated dataset have known relationships with cancer, implying that novel candidate biomarkers can also be acquired from the proposed analysis method. Furthermore, we expect that the proposed method can be expanded for applications involving various types of multi-omics datasets.

Association analysis of single nucleotide polymorphisms in candidate genes with root traits in maize (Zea mays L.) seedlings.

PubMed

Kumar, Bharath; Abdel-Ghani, Adel H; Pace, Jordon; Reyes-Matamoros, Jenaro; Hochholdinger, Frank; Lübberstedt, Thomas

2014-07-01

Several genes involved in maize root development have been isolated. Identification of SNPs associated with root traits would enable the selection of maize lines with better root architecture that might help to improve N uptake, and consequently plant growth particularly under N deficient conditions. In the present study, an association study (AS) panel consisting of 74 maize inbred lines was screened for seedling root traits in 6, 10, and 14-day-old seedlings. Allele re-sequencing of candidate root genes Rtcl, Rth3, Rum1, and Rul1 was also carried out in the same AS panel lines. All four candidate genes displayed different levels of nucleotide diversity, haplotype diversity and linkage disequilibrium. Gene based association analyses were carried out between individual polymorphisms in candidate genes, and root traits measured in 6, 10, and 14-day-old maize seedlings. Association analyses revealed several polymorphisms within the Rtcl, Rth3, Rum1, and Rul1 genes associated with seedling root traits. Several nucleotide polymorphisms in Rtcl, Rth3, Rum1, and Rul1 were significantly (P<0.05) associated with seedling root traits in maize suggesting that all four tested genes are involved in the maize root development. Thus considerable allelic variation present in these root genes can be exploited for improving maize root characteristics. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Rapid Communication: MiR-92a as a housekeeping gene for analysis of bovine mastitis-related microRNA in milk.

PubMed

Lai, Y C; Fujikawa, T; Ando, T; Kitahara, G; Koiwa, M; Kubota, C; Miura, N

2017-06-01

Our aim was to identify a suitable microRNA housekeeping gene for real-time PCR analysis of bovine mastitis-related microRNA in milk. We identified , , and as housekeeping gene candidates on the basis of previous Solexa sequencing results. Threshold cycle (CT) values for , , and did not differ between milk from control cows and milk from mastitis-affected cows. NormFinder software identified as the most stable single housekeeping gene. We evaluated the suitability of the housekeeping gene candidates by using them to assess expression levels of the inflammation-related gene . Regardless of the housekeeping gene candidates used for normalization, relative expression levels of were significantly higher in mastitis-affected samples than in control samples. However, of all the housekeeping genes and gene combinations investigated, normalization with alone generated the difference in relative expression between mastitis-affected and control samples with the highest significance. These results suggest that is suitable for use as a housekeeping gene for analysis of bovine mastitis-related microRNA in milk.

Revealing Alzheimer's disease genes spectrum in the whole-genome by machine learning.

PubMed

Huang, Xiaoyan; Liu, Hankui; Li, Xinming; Guan, Liping; Li, Jiankang; Tellier, Laurent Christian Asker M; Yang, Huanming; Wang, Jian; Zhang, Jianguo

2018-01-10

Alzheimer's disease (AD) is an important, progressive neurodegenerative disease, with a complex genetic architecture. A key goal of biomedical research is to seek out disease risk genes, and to elucidate the function of these risk genes in the development of disease. For this purpose, expanding the AD-associated gene set is necessary. In past research, the prediction methods for AD related genes has been limited in their exploration of the target genome regions. We here present a genome-wide method for AD candidate genes predictions. We present a machine learning approach (SVM), based upon integrating gene expression data with human brain-specific gene network data, to discover the full spectrum of AD genes across the whole genome. We classified AD candidate genes with an accuracy and the area under the receiver operating characteristic (ROC) curve of 84.56% and 94%. Our approach provides a supplement for the spectrum of AD-associated genes extracted from more than 20,000 genes in a genome wide scale. In this study, we have elucidated the whole-genome spectrum of AD, using a machine learning approach. Through this method, we expect for the candidate gene catalogue to provide a more comprehensive annotation of AD for researchers.

Transcriptional dynamics of a conserved gene expression network associated with craniofacial divergence in Arctic charr.

PubMed

Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut

2014-01-01

Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional targets and upstream regulators showed differential expression between the contrasting morphotypes. Interestingly, although selected network genes showed overlapping expression patterns in situ and no morph differences, Timp2 expression patterns differed between morphs. Our comparative study of transcriptional dynamics in divergent craniofacial morphologies of Arctic charr revealed a conserved network of coexpressed genes sharing functional roles in structural morphogenesis. We also implicate transcriptional regulators of the network as targets for future functional studies.

A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

PubMed Central

Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

2015-01-01

Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the genes that contribute to cellulose content in cereal culms and to a greater understanding of the interactions between them. PMID:26154104

Immune Profiles to Predict Response to Desensitization Therapy in Highly HLA-Sensitized Kidney Transplant Candidates

PubMed Central

Yabu, Julie M.; Siebert, Janet C.; Maecker, Holden T.

2016-01-01

Background Kidney transplantation is the most effective treatment for end-stage kidney disease. Sensitization, the formation of human leukocyte antigen (HLA) antibodies, remains a major barrier to successful kidney transplantation. Despite the implementation of desensitization strategies, many candidates fail to respond. Current progress is hindered by the lack of biomarkers to predict response and to guide therapy. Our objective was to determine whether differences in immune and gene profiles may help identify which candidates will respond to desensitization therapy. Methods and Findings Single-cell mass cytometry by time-of-flight (CyTOF) phenotyping, gene arrays, and phosphoepitope flow cytometry were performed in a study of 20 highly sensitized kidney transplant candidates undergoing desensitization therapy. Responders to desensitization therapy were defined as 5% or greater decrease in cumulative calculated panel reactive antibody (cPRA) levels, and non-responders had 0% decrease in cPRA. Using a decision tree analysis, we found that a combination of transitional B cell and regulatory T cell (Treg) frequencies at baseline before initiation of desensitization therapy could distinguish responders from non-responders. Using a support vector machine (SVM) and longitudinal data, TRAF3IP3 transcripts and HLA-DR-CD38+CD4+ T cells could also distinguish responders from non-responders. Combining all assays in a multivariate analysis and elastic net regression model with 72 analytes, we identified seven that were highly interrelated and eleven that predicted response to desensitization therapy. Conclusions Measuring baseline and longitudinal immune and gene profiles could provide a useful strategy to distinguish responders from non-responders to desensitization therapy. This study presents the integration of novel translational studies including CyTOF immunophenotyping in a multivariate analysis model that has potential applications to predict response to desensitization, select candidates, and personalize medicine to ultimately improve overall outcomes in highly sensitized kidney transplant candidates. PMID:27078882

Immune Profiles to Predict Response to Desensitization Therapy in Highly HLA-Sensitized Kidney Transplant Candidates.

PubMed

Yabu, Julie M; Siebert, Janet C; Maecker, Holden T

2016-01-01

Kidney transplantation is the most effective treatment for end-stage kidney disease. Sensitization, the formation of human leukocyte antigen (HLA) antibodies, remains a major barrier to successful kidney transplantation. Despite the implementation of desensitization strategies, many candidates fail to respond. Current progress is hindered by the lack of biomarkers to predict response and to guide therapy. Our objective was to determine whether differences in immune and gene profiles may help identify which candidates will respond to desensitization therapy. Single-cell mass cytometry by time-of-flight (CyTOF) phenotyping, gene arrays, and phosphoepitope flow cytometry were performed in a study of 20 highly sensitized kidney transplant candidates undergoing desensitization therapy. Responders to desensitization therapy were defined as 5% or greater decrease in cumulative calculated panel reactive antibody (cPRA) levels, and non-responders had 0% decrease in cPRA. Using a decision tree analysis, we found that a combination of transitional B cell and regulatory T cell (Treg) frequencies at baseline before initiation of desensitization therapy could distinguish responders from non-responders. Using a support vector machine (SVM) and longitudinal data, TRAF3IP3 transcripts and HLA-DR-CD38+CD4+ T cells could also distinguish responders from non-responders. Combining all assays in a multivariate analysis and elastic net regression model with 72 analytes, we identified seven that were highly interrelated and eleven that predicted response to desensitization therapy. Measuring baseline and longitudinal immune and gene profiles could provide a useful strategy to distinguish responders from non-responders to desensitization therapy. This study presents the integration of novel translational studies including CyTOF immunophenotyping in a multivariate analysis model that has potential applications to predict response to desensitization, select candidates, and personalize medicine to ultimately improve overall outcomes in highly sensitized kidney transplant candidates.

HOST GENE CELL RESEARCH FOR DETERMINING VIRULENCE OF AEROMONAS SPP. COLLECTED FROM ENVIRONMENTAL SAMPLES

EPA Science Inventory

The United States Environmental Protection Agency (USEPA) is interested in assessing health risks associated with emerging or potential waterborne pathogens. To this end, the Agency has established a Candidate Contaminant List (CCL) that includes Aeromonas hydrophila an...

Mutation profiling of 19 candidate genes in acute myeloid leukemia suggests significance of DNMT3A mutations.

PubMed

Shin, Sang-Yong; Lee, Seung-Tae; Kim, Hee-Jin; Cho, Eun Hae; Kim, Jong-Won; Park, Silvia; Jung, Chul Won; Kim, Sun-Hee

2016-08-23

We selected 19 significantly-mutated genes in AMLs, including FLT3, DNMT3A, NPM1, TET2, RUNX1, CEBPA, WT1, IDH1, IDH2, NRAS, ASXL1, SETD2, PTPN11, TP53, KIT, JAK2, KRAS, BRAF and CBL, and performed massively parallel sequencing for 114 patients with acute myeloid leukemias, mainly including those with normal karyotypes (CN-AML). More than 80% of patients had at least one mutation in the genes tested. DNMT3A mutation was significantly associated with adverse outcome in addition to conventional risk stratification such as the European LeukemiaNet (ELN) classification. We observed clinical usefulness of mutation testing on multiple target genes and the association with disease subgroups, clinical features and prognosis in AMLs.

Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47.

PubMed

Anderson, Carl A; Boucher, Gabrielle; Lees, Charlie W; Franke, Andre; D'Amato, Mauro; Taylor, Kent D; Lee, James C; Goyette, Philippe; Imielinski, Marcin; Latiano, Anna; Lagacé, Caroline; Scott, Regan; Amininejad, Leila; Bumpstead, Suzannah; Baidoo, Leonard; Baldassano, Robert N; Barclay, Murray; Bayless, Theodore M; Brand, Stephan; Büning, Carsten; Colombel, Jean-Frédéric; Denson, Lee A; De Vos, Martine; Dubinsky, Marla; Edwards, Cathryn; Ellinghaus, David; Fehrmann, Rudolf S N; Floyd, James A B; Florin, Timothy; Franchimont, Denis; Franke, Lude; Georges, Michel; Glas, Jürgen; Glazer, Nicole L; Guthery, Stephen L; Haritunians, Talin; Hayward, Nicholas K; Hugot, Jean-Pierre; Jobin, Gilles; Laukens, Debby; Lawrance, Ian; Lémann, Marc; Levine, Arie; Libioulle, Cecile; Louis, Edouard; McGovern, Dermot P; Milla, Monica; Montgomery, Grant W; Morley, Katherine I; Mowat, Craig; Ng, Aylwin; Newman, William; Ophoff, Roel A; Papi, Laura; Palmieri, Orazio; Peyrin-Biroulet, Laurent; Panés, Julián; Phillips, Anne; Prescott, Natalie J; Proctor, Deborah D; Roberts, Rebecca; Russell, Richard; Rutgeerts, Paul; Sanderson, Jeremy; Sans, Miquel; Schumm, Philip; Seibold, Frank; Sharma, Yashoda; Simms, Lisa A; Seielstad, Mark; Steinhart, A Hillary; Targan, Stephan R; van den Berg, Leonard H; Vatn, Morten; Verspaget, Hein; Walters, Thomas; Wijmenga, Cisca; Wilson, David C; Westra, Harm-Jan; Xavier, Ramnik J; Zhao, Zhen Z; Ponsioen, Cyriel Y; Andersen, Vibeke; Torkvist, Leif; Gazouli, Maria; Anagnou, Nicholas P; Karlsen, Tom H; Kupcinskas, Limas; Sventoraityte, Jurgita; Mansfield, John C; Kugathasan, Subra; Silverberg, Mark S; Halfvarson, Jonas; Rotter, Jerome I; Mathew, Christopher G; Griffiths, Anne M; Gearry, Richard; Ahmad, Tariq; Brant, Steven R; Chamaillard, Mathias; Satsangi, Jack; Cho, Judy H; Schreiber, Stefan; Daly, Mark J; Barrett, Jeffrey C; Parkes, Miles; Annese, Vito; Hakonarson, Hakon; Radford-Smith, Graham; Duerr, Richard H; Vermeire, Séverine; Weersma, Rinse K; Rioux, John D

2011-03-01

Genome-wide association studies and candidate gene studies in ulcerative colitis have identified 18 susceptibility loci. We conducted a meta-analysis of six ulcerative colitis genome-wide association study datasets, comprising 6,687 cases and 19,718 controls, and followed up the top association signals in 9,628 cases and 12,917 controls. We identified 29 additional risk loci (P < 5 × 10(-8)), increasing the number of ulcerative colitis-associated loci to 47. After annotating associated regions using GRAIL, expression quantitative trait loci data and correlations with non-synonymous SNPs, we identified many candidate genes that provide potentially important insights into disease pathogenesis, including IL1R2, IL8RA-IL8RB, IL7R, IL12B, DAP, PRDM1, JAK2, IRF5, GNA12 and LSP1. The total number of confirmed inflammatory bowel disease risk loci is now 99, including a minimum of 28 shared association signals between Crohn's disease and ulcerative colitis.

Alkane hydroxylase genes in psychrophile genomes and the potential for cold active catalysis.

PubMed

Bowman, Jeff S; Deming, Jody W

2014-12-16

Psychrophiles are presumed to play a large role in the catabolism of alkanes and other components of crude oil in natural low temperature environments. In this study we analyzed the functional diversity of genes for alkane hydroxylases, the enzymes responsible for converting alkanes to more labile alcohols, as found in the genomes of nineteen psychrophiles for which alkane degradation has not been reported. To identify possible mechanisms of low temperature optimization we compared putative alkane hydroxylases from these psychrophiles with homologues from nineteen taxonomically related mesophilic strains. Seven of the analyzed psychrophile genomes contained a total of 27 candidate alkane hydroxylase genes, only two of which are currently annotated as alkane hydroxylase. These candidates were mostly related to the AlkB and cytochrome p450 alkane hydroxylases, but several homologues of the LadA and AlmA enzymes, significant for their ability to degrade long-chain alkanes, were also detected. These putative alkane hydroxylases showed significant differences in primary structure from their mesophile homologues, with preferences for specific amino acids and increased flexibility on loops, bends, and α-helices. A focused analysis on psychrophile genomes led to discovery of numerous candidate alkane hydroxylase genes not currently annotated as alkane hydroxylase. Gene products show signs of optimization to low temperature, including regions of increased flexibility and amino acid preferences typical of psychrophilic proteins. These findings are consistent with observations of microbial degradation of crude oil in cold environments and identify proteins that can be targeted in rate studies and in the design of molecular tools for low temperature bioremediation.

Association mapping of starch chain length distribution and amylose content in pea (Pisum sativum L.) using carbohydrate metabolism candidate genes.

PubMed

Carpenter, Margaret A; Shaw, Martin; Cooper, Rebecca D; Frew, Tonya J; Butler, Ruth C; Murray, Sarah R; Moya, Leire; Coyne, Clarice J; Timmerman-Vaughan, Gail M

2017-08-01

Although starch consists of large macromolecules composed of glucose units linked by α-1,4-glycosidic linkages with α-1,6-glycosidic branchpoints, variation in starch structural and functional properties is found both within and between species. Interest in starch genetics is based on the importance of starch in food and industrial processes, with the potential of genetics to provide novel starches. The starch metabolic pathway is complex but has been characterized in diverse plant species, including pea. To understand how allelic variation in the pea starch metabolic pathway affects starch structure and percent amylose, partial sequences of 25 candidate genes were characterized for polymorphisms using a panel of 92 diverse pea lines. Variation in the percent amylose composition of extracted seed starch and (amylopectin) chain length distribution, one measure of starch structure, were characterized for these lines. Association mapping was undertaken to identify polymorphisms associated with the variation in starch chain length distribution and percent amylose, using a mixed linear model that incorporated population structure and kinship. Associations were found for polymorphisms in seven candidate genes plus Mendel's r locus (which conditions the round versus wrinkled seed phenotype). The genes with associated polymorphisms are involved in the substrate supply, chain elongation and branching stages of the pea carbohydrate and starch metabolic pathways. The association of polymorphisms in carbohydrate and starch metabolic genes with variation in amylopectin chain length distribution and percent amylose may help to guide manipulation of pea seed starch structural and functional properties through plant breeding.

Comparative Transcriptome Analysis Identifies Putative Genes Involved in the Biosynthesis of Xanthanolides in Xanthium strumarium L.

PubMed Central

Li, Yuanjun; Gou, Junbo; Chen, Fangfang; Li, Changfu; Zhang, Yansheng

2016-01-01

Xanthium strumarium L. is a traditional Chinese herb belonging to the Asteraceae family. The major bioactive components of this plant are sesquiterpene lactones (STLs), which include the xanthanolides. To date, the biogenesis of xanthanolides, especially their downstream pathway, remains largely unknown. In X. strumarium, xanthanolides primarily accumulate in its glandular trichomes. To identify putative gene candidates involved in the biosynthesis of xanthanolides, three X. strumarium transcriptomes, which were derived from the young leaves of two different cultivars and the purified glandular trichomes from one of the cultivars, were constructed in this study. In total, 157 million clean reads were generated and assembled into 91,861 unigenes, of which 59,858 unigenes were successfully annotated. All the genes coding for known enzymes in the upstream pathway to the biosynthesis of xanthanolides were present in the X. strumarium transcriptomes. From a comparative analysis of the X. strumarium transcriptomes, this study identified a number of gene candidates that are putatively involved in the downstream pathway to the synthesis of xanthanolides, such as four unigenes encoding CYP71 P450s, 50 unigenes for dehydrogenases, and 27 genes for acetyltransferases. The possible functions of these four CYP71 candidates are extensively discussed. In addition, 116 transcription factors that are highly expressed in X. strumarium glandular trichomes were also identified. Their possible regulatory roles in the biosynthesis of STLs are discussed. The global transcriptomic data for X. strumarium should provide a valuable resource for further research into the biosynthesis of xanthanolides. PMID:27625674

TBR1 is the candidate gene for intellectual disability in patients with a 2q24.2 interstitial deletion.

PubMed

Palumbo, Orazio; Fichera, Marco; Palumbo, Pietro; Rizzo, Renata; Mazzolla, Elisabetta; Cocuzza, Donatella Maria; Carella, Massimo; Mattina, Teresa

2014-03-01

Interstitial deletion of 2q24.2 is a rarely described cytogenetic aberration in patients with intellectual disability (ID). Previously reported genotype-phenotype correlation identified a minimum deleted region of 2.65 Mb including 15 genes. Recently, a patient with a de novo 2q24.2 microdeletion of 0.4 Mb encompassing only three genes was described. However, the precise relationship between most deleted genes and the clinical features remains unclear. Here we describe a 12-year-old male patient diagnosed with growth retardation and ID. He also showed microcephaly, right palpebral ptosis, scapular winging, and pectus excavatum. Single nucleotide polymorphisms (SNP) array analysis showed a de novo interstitial deletion of 0.122 Mb at 2q24.2 region harboring only TBR1 (T-box, brain, 1; OMIM: 604616), which encodes a T-box family transcription factor expressed in post-mitotic projection neurons and functionally significant in embryologic corticogenesis. This is the first case of a deletion at 2q24.2 involving only TBR1. This finding narrows the smallest region of overlap (SRO) for deletions in this region and strengthens the previously suggested hypothesis that this gene is a strong candidate for the ID phenotype. The identification of TBR1 as candidate for ID encourages further molecular studies to identify novel mutations to understand the pathogenic effects of its haploinsufficiency. Finally, this report provides a review on 10 2q24.2 microdeletion patients. © 2014 Wiley Periodicals, Inc.

Co-expression analysis identifies CRC and AP1 the regulator of Arabidopsis fatty acid biosynthesis.

PubMed

Han, Xinxin; Yin, Linlin; Xue, Hongwei

2012-07-01

Fatty acids (FAs) play crucial rules in signal transduction and plant development, however, the regulation of FA metabolism is still poorly understood. To study the relevant regulatory network, fifty-eight FA biosynthesis genes including de novo synthases, desaturases and elongases were selected as "guide genes" to construct the co-expression network. Calculation of the correlation between all Arabidopsis thaliana (L.) genes with each guide gene by Arabidopsis co-expression dating mining tools (ACT) identifies 797 candidate FA-correlated genes. Gene ontology (GO) analysis of these co-expressed genes showed they are tightly correlated to photosynthesis and carbohydrate metabolism, and function in many processes. Interestingly, 63 transcription factors (TFs) were identified as candidate FA biosynthesis regulators and 8 TF families are enriched. Two TF genes, CRC and AP1, both correlating with 8 FA guide genes, were further characterized. Analyses of the ap1 and crc mutant showed the altered total FA composition of mature seeds. The contents of palmitoleic acid, stearic acid, arachidic acid and eicosadienoic acid are decreased, whereas that of oleic acid is increased in ap1 and crc seeds, which is consistent with the qRT-PCR analysis revealing the suppressed expression of the corresponding guide genes. In addition, yeast one-hybrid analysis and electrophoretic mobility shift assay (EMSA) revealed that CRC can bind to the promoter regions of KCS7 and KCS15, indicating that CRC may directly regulate FA biosynthesis. © 2012 Institute of Botany, Chinese Academy of Sciences.

Jonquetella anthropi gen. nov., sp. nov., the first member of the candidate phylum 'Synergistetes' isolated from man.

PubMed

Jumas-Bilak, Estelle; Carlier, Jean-Philippe; Jean-Pierre, Hélène; Citron, Diane; Bernard, Kathryn; Damay, Audrey; Gay, Bernard; Teyssier, Corinne; Campos, Josiane; Marchandin, Hélène

2007-12-01

Six clinical isolates of a hitherto unknown, strictly anaerobic, Gram-negative rod showing fastidious growth were subjected to a polyphasic taxonomic study, including phenotypic, genomic and phylogenetic feature analyses. 16S rRNA gene sequenced-based phylogeny revealed that the novel strains represent a homogeneous group distant from any recognized species in the candidate phylum 'Synergistetes'. The novel isolates were most closely related to species of the genus Dethiosulfovibrio, with 88.2-88.7 % 16S rRNA gene sequence similarity. Large-scale chromosome structure and DNA G+C content also differentiated the novel strains from members of the genus Dethiosulfovibrio. The novel strains were asaccharolytic. Major metabolic end products in trypticase/glucose/yeast extract broth were acetic, lactic, succinic and isovaleric acids and the major cellular fatty acids iso-C(15 : 0) and C(16 : 0). Based on the data presented here, a new genus, Jonquetella gen. nov., is proposed with one novel species, Jonquetella anthropi sp. nov. J. anthropi is the first characterized species of the candidate phylum 'Synergistetes' that includes human isolates. The G+C content of the DNA of the type strain of J. anthropi ADV 126(T) (=AIP 136.05(T)=CIP 109408(T)=CCUG 53819(T)) is 59.4 mol%.

Transcriptome analysis of the fungal pathogen Fusarium oxysporum f. sp. medicaginis during colonisation of resistant and susceptible Medicago truncatula hosts identifies differential pathogenicity profiles and novel candidate effectors.

PubMed

Thatcher, Louise F; Williams, Angela H; Garg, Gagan; Buck, Sally-Anne G; Singh, Karam B

2016-11-03

Pathogenic members of the Fusarium oxysporum species complex are responsible for vascular wilt disease on many important crops including legumes, where they can be one of the most destructive disease causing necrotrophic fungi. We previously developed a model legume-infecting pathosystem based on the reference legume Medicago truncatula and a pathogenic F. oxysporum forma specialis (f. sp.) medicaginis (Fom). To dissect the molecular pathogenicity arsenal used by this root-infecting pathogen, we sequenced its transcriptome during infection of a susceptible and resistant host accession. High coverage RNA-Seq of Fom infected root samples harvested from susceptible (DZA315) or resistant (A17) M. truncatula seedlings at early or later stages of infection (2 or 7 days post infection (dpi)) and from vegetative (in vitro) samples facilitated the identification of unique and overlapping sets of in planta differentially expressed genes. This included enrichment, particularly in DZA315 in planta up-regulated datasets, for proteins associated with sugar, protein and plant cell wall metabolism, membrane transport, nutrient uptake and oxidative processes. Genes encoding effector-like proteins were identified, including homologues of the F. oxysporum f. sp. lycopersici Secreted In Xylem (SIX) proteins, and several novel candidate effectors based on predicted secretion, small protein size and high in-planta induced expression. The majority of the effector candidates contain no known protein domains but do share high similarity to predicted proteins predominantly from other F. oxysporum ff. spp. as well as other Fusaria (F. solani, F. fujikori, F. verticilloides, F. graminearum and F. pseudograminearum), and from another wilt pathogen of the same class, a Verticillium species. Overall, this suggests these novel effector candidates may play important roles in Fusaria and wilt pathogen virulence. Combining high coverage in planta RNA-Seq with knowledge of fungal pathogenicity protein features facilitated the identification of differentially expressed pathogenicity associated genes and novel effector candidates expressed during infection of a resistant or susceptible M. truncatula host. The knowledge from this first in depth in planta transcriptome sequencing of any F. oxysporum ff. spp. pathogenic on legumes will facilitate the dissection of Fusarium wilt pathogenicity mechanisms on many important legume crops.

Inferring Gene Regulatory Networks by Singular Value Decomposition and Gravitation Field Algorithm

PubMed Central

Zheng, Ming; Wu, Jia-nan; Huang, Yan-xin; Liu, Gui-xia; Zhou, You; Zhou, Chun-guang

2012-01-01

Reconstruction of gene regulatory networks (GRNs) is of utmost interest and has become a challenge computational problem in system biology. However, every existing inference algorithm from gene expression profiles has its own advantages and disadvantages. In particular, the effectiveness and efficiency of every previous algorithm is not high enough. In this work, we proposed a novel inference algorithm from gene expression data based on differential equation model. In this algorithm, two methods were included for inferring GRNs. Before reconstructing GRNs, singular value decomposition method was used to decompose gene expression data, determine the algorithm solution space, and get all candidate solutions of GRNs. In these generated family of candidate solutions, gravitation field algorithm was modified to infer GRNs, used to optimize the criteria of differential equation model, and search the best network structure result. The proposed algorithm is validated on both the simulated scale-free network and real benchmark gene regulatory network in networks database. Both the Bayesian method and the traditional differential equation model were also used to infer GRNs, and the results were used to compare with the proposed algorithm in our work. And genetic algorithm and simulated annealing were also used to evaluate gravitation field algorithm. The cross-validation results confirmed the effectiveness of our algorithm, which outperforms significantly other previous algorithms. PMID:23226565

Allelic association of sequence variants in the herpes virus entry mediator-B gene (PVRL2) with the severity of multiple sclerosis.

PubMed

Schmidt, S; Pericak-Vance, M A; Sawcer, S; Barcellos, L F; Hart, J; Sims, J; Prokop, A M; van der Walt, J; DeLoa, C; Lincoln, R R; Oksenberg, J R; Compston, A; Hauser, S L; Haines, J L; Gregory, S G

2006-07-01

Discrepant findings have been reported regarding an association of the apolipoprotein E (APOE) gene with the clinical course of multiple sclerosis (MS). To resolve these discrepancies, we examined common sequence variation in six candidate genes residing in a 380-kb genomic region surrounding and including the APOE locus for an association with MS severity. We genotyped at least three polymorphisms in each of six candidate genes in 1,540 Caucasian MS families (729 single-case and multiple-case families from the United States, 811 single-case families from the UK). By applying the quantitative transmission/disequilibrium test to a recently proposed MS severity score, the only statistically significant (P=0.003) association with MS severity was found for an intronic variant in the Herpes Virus Entry Mediator-B Gene PVRL2. Additional genotyping extended the association to a 16.6 kb block spanning intron 1 to intron 2 of the gene. Sequencing of PVRL2 failed to identify variants with an obvious functional role. In conclusion, the analysis of a very large data set suggests that genetic polymorphisms in PVRL2 may influence MS severity and supports the possibility that viral factors may contribute to the clinical course of MS, consistent with previous reports.

Genomewide DNA methylation analysis in combat veterans reveals a novel locus for PTSD.

PubMed

Mehta, D; Bruenig, D; Carrillo-Roa, T; Lawford, B; Harvey, W; Morris, C P; Smith, A K; Binder, E B; Young, R McD; Voisey, J

2017-11-01

Epigenetic modifications such as DNA methylation may play a key role in the aetiology and serve as biomarkers for post-traumatic stress disorder (PTSD). We performed a genomewide analysis to identify genes whose DNA methylation levels are associated with PTSD. A total of 211 individuals comprising Australian male Vietnam War veterans (n = 96) and males from a general population belonging to the Grady Trauma Project (n = 115) were included. Genomewide DNA methylation was performed from peripheral blood using the Illumina arrays. Data analysis was performed using generalized linear regression models. Differential DNA methylation of 17 previously reported PTSD candidate genes was associated with PTSD symptom severity. Genomewide analyses revealed CpG sites spanning BRSK1, LCN8, NFG and DOCK2 genes were associated with PTSD symptom severity. We replicated the findings of DOCK2 in an independent cohort. Pathway analysis revealed that among the associated genes, genes within actin cytoskeleton and focal adhesion molecular pathways were enriched. These data highlight the role of DNA methylation as biomarkers of PTSD. The results support the role of previous candidates and uncover novel genes associated with PTSD, such as DOCK2. This study contributes to our understanding of the biological underpinnings of PTSD. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Deletions of 9p and the quest for a conserved mechanism of sex determination.

PubMed

Ottolenghi, C; McElreavey, K

2000-01-01

Distal chromosome 9p contains a locus that, when deleted, is a cause of 46,XY gonadal dysgenesis in the absence of extragenital anomalies. This locus might account for the frequently observed cases of 46,XY pure gonadal dysgenesis who do not harbor mutations in SRY, the sex master regulator gene found in mammalian species. The genomic organization of 9p positional candidate genes is currently being studied and mutational screens are ongoing. Among other positional candidates, including two additional doublesex-related genes, the evidence to support a role for the gene DMRT1 in vertebrate male sexual development is accumulating. Although formal proof of the requirement of DMRT1 in gonadal sex fate choice has not been obtained so far, the particular interest in this gene and perhaps other doublesex-related genes identified in vertebrates lies in that they may provide an entry point to a conserved mechanism of sex determination across animal phyla. We discuss recent results and emerging views on the genetics of sex determination, while stressing that the majority of cases of 46,XY gonadal dysgenesis remain unexplained. The latter is likely to be efficiently addressed by positional cloning efforts, particularly by considering the wealth of sequence data provided by the Human Genome Project. Copyright 2000 Academic Press.

Genetics, gene expression and bioinformatics of the pituitary gland.

PubMed

Davis, Shannon W; Potok, Mary Anne; Brinkmeier, Michelle L; Carninci, Piero; Lyons, Robert H; MacDonald, James W; Fleming, Michelle T; Mortensen, Amanda H; Egashira, Noboru; Ghosh, Debashis; Steel, Karen P; Osamura, Robert Y; Hayashizaki, Yoshihide; Camper, Sally A

2009-04-01

Genetic cases of congenital pituitary hormone deficiency are common and many are caused by transcription factor defects. Mouse models with orthologous mutations are invaluable for uncovering the molecular mechanisms that lead to problems in organ development and typical patient characteristics. We are using mutant mice defective in the transcription factors PROP1 and POU1F1 for gene expression profiling to identify target genes for these critical transcription factors and candidates for cases of pituitary hormone deficiency of unknown aetiology. These studies reveal critical roles for Wnt signalling pathways, including the TCF/LEF transcription factors and interacting proteins of the groucho family, bone morphogenetic protein antagonists and targets of notch signalling. Current studies are investigating the roles of novel homeobox genes and pathways that regulate the transition from proliferation to differentiation, cell adhesion and cell migration. Pituitary adenomas are a common human health problem, yet most cases are sporadic, necessitating alternative approaches to traditional Mendelian genetic studies. Mouse models of adenoma formation offer the opportunity for gene expression profiling during progressive stages of hyperplasia, adenoma and tumorigenesis. This approach holds promise for the identification of relevant pathways and candidate genes as risk factors for adenoma formation, understanding mechanisms of progression, and identifying drug targets and clinically relevant biomarkers. Copyright 2009 S. Karger AG, Basel.

Genetics, Gene Expression and Bioinformatics of the Pituitary Gland

PubMed Central

Davis, Shannon W; Potok, Mary Anne; Brinkmeier, Michelle L; Carninci, Piero; Lyons, Robert H; MacDonald, James W.; Fleming, Michelle T; Mortensen, Amanda H; Egashira, Noboru; Ghosh, Debashis; Steel, Karen P.; Osamura, Robert Y; Hayashizaki, Yoshihide; Camper, Sally A

2011-01-01

Genetic cases of congenital pituitary hormone deficiency are common and many are caused by transcription factor defects. Mouse models with orthologous mutations are invaluable for uncovering the molecular mechanisms that lead to problems in organ development and typical patient characteristics. We are using mutant mice defective in the transcription factors PROP1 and POU1F1 for gene expression profiling to identify target genes for these critical transcription factors and candidates for cases of pituitary hormone deficiency of unknown etiology. These studies reveal critical roles for Wnt signalling pathways including the TCF/LEF transcription factors and interacting proteins of the groucho family, bone morphogenetic proteins antagonists, and targets of notch signalling. Current studies are investigating roles of novel homeobox genes and pathways that regulate the transition from proliferation to differentiation, cell adhesion and cell migration. Pituitary adenomas are a common human health problem, yet most cases are sporadic, necessitating alternative approaches to traditional Mendelian genetic studies. Mouse models of adenoma formation offer the opportunity for gene expression profiling during progressive stages of hyperplasia, adenoma and tumorigenesis. This approach holds promise for identification of relevant pathways and candidate genes as risk factors for adenoma formation, understanding mechanisms of progression, and identifying drug targets and clinically relevant biomarkers. PMID:19407506

Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

PubMed Central

Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M.

2015-01-01

Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression profile of the target candidate genes. PMID:25793735

Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

PubMed

Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M

2015-01-01

Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression profile of the target candidate genes.

Associations between serotonin-related gene polymorphisms and panic disorder.

PubMed

Maron, Eduard; Lang, Aavo; Tasa, Gunnar; Liivlaid, Liivi; Tõru, Innar; Must, Anne; Vasar, Veiko; Shlik, Jakov

2005-06-01

Studies suggest that vulnerability to panic attacks and panic disorder (PD) may be related to a deficient serotonin (5-HT) neurotransmission. In the present case-control study we investigated possible associations between PD phenotype and five candidate polymorphisms including 5-HT transporter (5-HTTLPR and VNTR), monoamine oxidase A (MAOA promoter region), tryptophan hydroxylase 1 (TPH1 218A/C) and 5-HT1B receptor (5-HT1BR 861G/C) genes. The study sample consisted of 158 patients with PD and 215 healthy control subjects. The analysis showed higher frequencies of LL genotype (p = 0.016) and L allele variant (p = 0.007) of 5-HTTLPR in the patients. No significant associations were observed between PD and other candidate gene polymorphisms. However, a higher frequency of longer allele genotypes of the MAOA promoter region was observed in female PD patients with agoraphobia than in female controls (p = 0.016). These findings indicate that genetic variants conceivably related to lower 5-HT neurotransmission may be involved in the development of PD.

Genomic and Coexpression Analyses Predict Multiple Genes Involved in Triterpene Saponin Biosynthesis in Medicago truncatula[C][W

PubMed Central

Naoumkina, Marina A.; Modolo, Luzia V.; Huhman, David V.; Urbanczyk-Wochniak, Ewa; Tang, Yuhong; Sumner, Lloyd W.; Dixon, Richard A.

2010-01-01

Saponins, an important group of bioactive plant natural products, are glycosides of triterpenoid or steroidal aglycones (sapogenins). Saponins possess many biological activities, including conferring potential health benefits for humans. However, most of the steps specific for the biosynthesis of triterpene saponins remain uncharacterized at the molecular level. Here, we use comprehensive gene expression clustering analysis to identify candidate genes involved in the elaboration, hydroxylation, and glycosylation of the triterpene skeleton in the model legume Medicago truncatula. Four candidate uridine diphosphate glycosyltransferases were expressed in Escherichia coli, one of which (UGT73F3) showed specificity for multiple sapogenins and was confirmed to glucosylate hederagenin at the C28 position. Genetic loss-of-function studies in M. truncatula confirmed the in vivo function of UGT73F3 in saponin biosynthesis. This report provides a basis for future studies to define genetically the roles of multiple cytochromes P450 and glycosyltransferases in triterpene saponin biosynthesis in Medicago. PMID:20348429

Further evidence of the limited role of candidate genes in relation to infant-mother attachment outcomes.

PubMed

Leerkes, Esther M; Gedaly, Lindsey R; Zhou, Nan; Calkins, Susan; Henrich, Vincent C; Smolen, Andrew

2017-02-01

In this paper, we examine the associations between specific candidate genes (DRD2, DRD4, COMT, biallelic and tri-allelic 5HTTLPR, and OXTR) and infant attachment outcomes as main effects and in conjunction with maternal sensitivity. The sample included 200 infants (97 European American, 94 African-American, and 9 biracial) and their mothers. Maternal sensitivity and overtly negative maternal behavior were observed when infants were 6 months and 1 year old in distress-eliciting contexts, attachment was assessed via the Strange Situation at age 1, and DNA samples were collected when children were 2 years old. Consistent with recent research in large samples, there was little evidence that these genes are associated with attachment security, disorganization, or distress as main effects (in additive, dominant, and homozygous models) or in conjunction with maternal sensitivity or overtly negative behavior (primarily dominance models). Furthermore, there was little evidence that associations vary as a function of race.

Genetics of generalized anxiety disorder and related traits.

PubMed

Gottschalk, Michael G; Domschke, Katharina

2017-06-01

This review serves as a systematic guide to the genetics of generalized anxiety disorder (GAD) and further focuses on anxiety-relevant endophenotypes, such as pathological worry fear of uncertainty, and neuroticism. We inspect clinical genetic evidence for the familialityl heritability of GAD and cross-disorder phenotypes based on family and twin studies. Recent advances of linkage studies, genome-wide association studies, and candidate gene studies (eg, 5-HTT, 5-HT1A, MAOA, BDNF ) are outlined. Functional and structural neuroimaging and neurophysiological readouts relating to peripheral stress markers and psychophysiology are further integrated, building a multilevel disease framework. We explore etiologic factors in gene-environment interaction approaches investigating childhood trauma, environmental adversity, and stressful life events in relation to selected candidate genes ( 5-HTT, NPSR1, COMT, MAOA, CRHR1, RGS2 ), Additionally, the pharmacogenetics of selective serotonin reuptake inhibitor/serotonin-norepinephrine reuptake inhibitor treatment are summarized ( 5-HTT, 5-HT2A, COMT, CRHR1 ). Finally, GAD and trait anxiety research challenges and perspectives in the field of genetics, including epigenetics, are discussed.

Human genetic factors in tuberculosis: an update.

PubMed

van Tong, Hoang; Velavan, Thirumalaisamy P; Thye, Thorsten; Meyer, Christian G

2017-09-01

Tuberculosis (TB) is a major threat to human health, especially in many developing countries. Human genetic variability has been recognised to be of great relevance in host responses to Mycobacterium tuberculosis infection and in regulating both the establishment and the progression of the disease. An increasing number of candidate gene and genome-wide association studies (GWAS) have focused on human genetic factors contributing to susceptibility or resistance to TB. To update previous reviews on human genetic factors in TB we searched the MEDLINE database and PubMed for articles from 1 January 2014 through 31 March 2017 and reviewed the role of human genetic variability in TB. Search terms applied in various combinations were 'tuberculosis', 'human genetics', 'candidate gene studies', 'genome-wide association studies' and 'Mycobacterium tuberculosis'. Articles in English retrieved and relevant references cited in these articles were reviewed. Abstracts and reports from meetings were also included. This review provides a recent summary of associations of polymorphisms of human genes with susceptibility/resistance to TB. © 2017 John Wiley & Sons Ltd.

Further Evidence of the Limited Role of Candidate Genes in Relation to Infant-Mother Attachment Outcomes

PubMed Central

Leerkes, Esther M.; Gedaly, Lindsey R.; Zhou, Nan; Calkins, Susan; Henrich, Vincent C.; Smolen, Andrew

2017-01-01

In this paper, we examine the associations between specific candidate genes (DRD2, DRD4, COMT, biallelic and tri-allelic 5HTTLPR, and OXTR) and infant attachment outcomes as main effects and in conjunction with maternal sensitivity. The sample included 200 infants (97 European American, 94 African American, and 9 bi-racial) and their mothers. Maternal sensitivity and overtly negative maternal behavior were observed when infants were 6 months and 1 year old in distress-eliciting contexts, attachment was assessed via the Strange Situation at age 1, and DNA samples were collected when children were 2 years old. Consistent with recent research in large samples (Luijk et al., 2011; Roisman et al., 2013), there was little evidence that these genes are associated with attachment security, disorganization, or distress as main effects (in additive, dominant, and homozygous models) or in conjunction with maternal sensitivity or overtly negative behavior (primarily dominance models). Furthermore, there was little evidence that associations vary as a function of race. PMID:27852134

Identification of Spen as a Crucial Factor for Xist Function through Forward Genetic Screening in Haploid Embryonic Stem Cells

PubMed Central

Monfort, Asun; Di Minin, Giulio; Postlmayr, Andreas; Freimann, Remo; Arieti, Fabiana; Thore, Stéphane; Wutz, Anton

2015-01-01

Summary In mammals, the noncoding Xist RNA triggers transcriptional silencing of one of the two X chromosomes in female cells. Here, we report a genetic screen for silencing factors in X chromosome inactivation using haploid mouse embryonic stem cells (ESCs) that carry an engineered selectable reporter system. This system was able to identify several candidate factors that are genetically required for chromosomal repression by Xist. Among the list of candidates, we identify the RNA-binding protein Spen, the homolog of split ends. Independent validation through gene deletion in ESCs confirms that Spen is required for gene repression by Xist. However, Spen is not required for Xist RNA localization and the recruitment of chromatin modifications, including Polycomb protein Ezh2. The identification of Spen opens avenues for further investigation into the gene-silencing pathway of Xist and shows the usefulness of haploid ESCs for genetic screening of epigenetic pathways. PMID:26190100

Children’s Hospital of Pittsburgh and Diabetes Institute of the Walter Reed Health Care System Genetic Screening in Diabetes: Candidate Gene Analysis for Diabetic Retinopathy

DTIC Science & Technology

2010-05-01

Screening in Diabetes : Candidate Gene Analysis for Diabetic Retinopathy PRINCIPAL INVESTIGATOR: Robert A. Vigersky, COL MC CONTRACTING ORGANIZATION... Diabetes Institute of the Walter Reed Health Care System Genetic Screening in Diabetes : Candidate Gene Analysis for Diabetic Retinopathy 5c. PROGRAM... diabetic  neuropathy, and  diabetic   retinopathy .  This was an observational study in which the investigators obtained DNA samples from the blood of

ProDiGe: Prioritization Of Disease Genes with multitask machine learning from positive and unlabeled examples

PubMed Central

2011-01-01

Background Elucidating the genetic basis of human diseases is a central goal of genetics and molecular biology. While traditional linkage analysis and modern high-throughput techniques often provide long lists of tens or hundreds of disease gene candidates, the identification of disease genes among the candidates remains time-consuming and expensive. Efficient computational methods are therefore needed to prioritize genes within the list of candidates, by exploiting the wealth of information available about the genes in various databases. Results We propose ProDiGe, a novel algorithm for Prioritization of Disease Genes. ProDiGe implements a novel machine learning strategy based on learning from positive and unlabeled examples, which allows to integrate various sources of information about the genes, to share information about known disease genes across diseases, and to perform genome-wide searches for new disease genes. Experiments on real data show that ProDiGe outperforms state-of-the-art methods for the prioritization of genes in human diseases. Conclusions ProDiGe implements a new machine learning paradigm for gene prioritization, which could help the identification of new disease genes. It is freely available at http://cbio.ensmp.fr/prodige. PMID:21977986

Gene Expression Profiling of Gastric Cancer

PubMed Central

Marimuthu, Arivusudar; Jacob, Harrys K.C.; Jakharia, Aniruddha; Subbannayya, Yashwanth; Keerthikumar, Shivakumar; Kashyap, Manoj Kumar; Goel, Renu; Balakrishnan, Lavanya; Dwivedi, Sutopa; Pathare, Swapnali; Dikshit, Jyoti Bajpai; Maharudraiah, Jagadeesha; Singh, Sujay; Sameer Kumar, Ghantasala S; Vijayakumar, M.; Veerendra Kumar, Kariyanakatte Veeraiah; Premalatha, Chennagiri Shrinivasamurthy; Tata, Pramila; Hariharan, Ramesh; Roa, Juan Carlos; Prasad, T.S.K; Chaerkady, Raghothama; Kumar, Rekha Vijay; Pandey, Akhilesh

2015-01-01

Gastric cancer is the second leading cause of cancer death worldwide, both in men and women. A genomewide gene expression analysis was carried out to identify differentially expressed genes in gastric adenocarcinoma tissues as compared to adjacent normal tissues. We used Agilent’s whole human genome oligonucleotide microarray platform representing ~41,000 genes to carry out gene expression analysis. Two-color microarray analysis was employed to directly compare the expression of genes between tumor and normal tissues. Through this approach, we identified several previously known candidate genes along with a number of novel candidate genes in gastric cancer. Testican-1 (SPOCK1) was one of the novel molecules that was 10-fold upregulated in tumors. Using tissue microarrays, we validated the expression of testican-1 by immunohistochemical staining. It was overexpressed in 56% (160/282) of the cases tested. Pathway analysis led to the identification of several networks in which SPOCK1 was among the topmost networks of interacting genes. By gene enrichment analysis, we identified several genes involved in cell adhesion and cell proliferation to be significantly upregulated while those corresponding to metabolic pathways were significantly downregulated. The differentially expressed genes identified in this study are candidate biomarkers for gastric adenoacarcinoma. PMID:27030788

Identification of possible genetic polymorphisms involved in cancer cachexia: a systematic review.

PubMed

Tan, Benjamin H L; Ross, James A; Kaasa, Stein; Skorpen, Frank; Fearon, Kenneth C H

2011-04-01

Cancer cachexia is a polygenic and complex syndrome. Genetic variations in regulation of the inflammatory response, muscle and fat metabolic pathways, and pathways in appetite regulation are likely to contribute to the susceptibility or resistance to developing cancer cachexia. A systematic search of Medline and EmBase databases, covering 1986-2008 was performed for potential candidate genes/genetic polymorphisms relating to cancer cachexia. Related genes were then identified using pathway functional analysis software. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Genes with variants which had functional or clinical associations with cachexia and replicated in at least one study were entered into pathway analysis software to reveal possible network associations between genes. A total of 184 polymorphisms with functional or clinical relevance to cancer cachexia were identified in 92 candidate genes. Of these, 42 polymorphisms (in 33 genes) were replicated in more than one study with 13 polymorphisms found to influence two or more hallmarks of cachexia (i.e. inflammation, loss of fat mass and/or lean mass and reduced survival). Thirty-three genes were found to be significantly interconnected in two major networks with four genes (ADIPOQ, IL6, NFKB1 and TLR4) interlinking both networks. Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides an initial framework to select genes/polymorphisms for further study in cancer cachexia, and to develop their potential as susceptibility biomarkers of developing cachexia.

Identification of an expressed gene in Dipylidium caninum.

PubMed

Miranda, Rodrigo R C; Costa-Júnior, Livio M; Campos, Artur K; Santos, Hudson A; Rabelo, Elida M L

2004-10-01

Recombinant DNA studies have been focused on developing vaccines to different cestodes. But few studies involving Dipylidium caninum molecular biology and genes have been done. Only partial sequences of mitochondrial DNA and ribosomal RNA gene are available in databases. Any molecular work with this parasite, including epidemiology, study of drug-resistant strains, and vaccine development, is hampered by the lack of knowledge of its genome. Thus, the knowledge of specific genes of different developmental stages of D. caninum is crucial to locate potential targets to be used as candidates to develop a vaccine and/or new drugs against this parasite. Here we report, for the first time, the sequencing of a fragment of a D. caninum expressed gene.

Transcriptional regulation of NAD metabolism in bacteria: genomic reconstruction of NiaR (YrxA) regulon

PubMed Central

Rodionov, Dmitry A.; Li, Xiaoqing; Rodionova, Irina A.; Yang, Chen; Sorci, Leonardo; Dervyn, Etienne; Martynowski, Dariusz; Zhang, Hong; Gelfand, Mikhail S.; Osterman, Andrei L.

2008-01-01

A comparative genomic approach was used to reconstruct transcriptional regulation of NAD biosynthesis in bacteria containing orthologs of Bacillus subtilis gene yrxA, a previously identified niacin-responsive repressor of NAD de novo synthesis. Members of YrxA family (re-named here NiaR) are broadly conserved in the Bacillus/Clostridium group and in the deeply branching Fusobacteria and Thermotogales lineages. We analyzed upstream regions of genes associated with NAD biosynthesis to identify candidate NiaR-binding DNA motifs and assess the NiaR regulon content in these species. Representatives of the two distinct types of candidate NiaR-binding sites, characteristic of the Firmicutes and Thermotogales, were verified by an electrophoretic mobility shift assay. In addition to transcriptional control of the nadABC genes, the NiaR regulon in some species extends to niacin salvage (the pncAB genes) and includes uncharacterized membrane proteins possibly involved in niacin transport. The involvement in niacin uptake proposed for one of these proteins (re-named NiaP), encoded by the B. subtilis gene yceI, was experimentally verified. In addition to bacteria, members of the NiaP family are conserved in multicellular eukaryotes, including human, pointing to possible NaiP involvement in niacin utilization in these organisms. Overall, the analysis of the NiaR and NrtR regulons (described in the accompanying paper) revealed mechanisms of transcriptional regulation of NAD metabolism in nearly a hundred diverse bacteria. PMID:18276644

Genetic Dissection of Learning and Memory in Mice

PubMed Central

Mineur, Yann S.; Crusio, Wim E.; Sluyter, Frans

2004-01-01

In this minireview, we discuss different strategies to dissect genetically the keystones of learning and memory. First, we broadly sketch the neurogenetic analysis of complex traits in mice. We then discuss two general strategies to find genes affecting learning and memory: candidate gene studies and whole genome searches. Next, we briefly review more recently developed techniques, such as microarrays and RNA interference. In addition, we focus on gene-environment interactions and endophenotypes. All sections are illustrated with examples from the learning and memory field, including a table summarizing the latest information about genes that have been shown to have effects on learning and memory. PMID:15656270

Extensive transcriptional response associated with seasonal plasticity of butterfly wing patterns.

PubMed

Daniels, Emily V; Murad, Rabi; Mortazavi, Ali; Reed, Robert D

2014-12-01

In the eastern United States, the buckeye butterfly, Junonia coenia, shows seasonal wing colour plasticity where adults emerging in the spring are tan, while those emerging in the autumn are dark red. This variation can be artificially induced in laboratory colonies, thus making J. coenia a useful model system to examine the mechanistic basis of plasticity. To better understand the developmental basis of seasonal plasticity, we used RNA-seq to quantify transcription profiles associated with development of alternative seasonal wing morphs. Depending on the developmental stage, between 547 and 1420 transfrags were significantly differentially expressed between morphs. These extensive differences in gene expression stand in contrast to the much smaller numbers of differentially expressed transcripts identified in previous studies of genetic wing pattern variation in other species and suggest that environmentally induced phenotypic shifts arise from very broad systemic processes. Analyses of candidate endocrine and pigmentation transcripts revealed notable genes upregulated in the red morph, including several ecdysone-associated genes, and cinnabar, an ommochrome pigmentation gene implicated in colour pattern variation in other butterflies. We also found multiple melanin-related transcripts strongly upregulated in the red morph, including tan and yellow-family genes, leading us to speculate that dark red pigmentation in autumn J. coenia may involve nonommochrome pigments. While we identified several endocrine and pigmentation genes as obvious candidates for seasonal colour morph differentiation, we speculate that the majority of observed expression differences were due to thermal stress response. The buckeye transcriptome provides a basis for further developmental studies of phenotypic plasticity. © 2014 John Wiley & Sons Ltd.

Mammalian X homolog acts as sex chromosome in lacertid lizards

PubMed Central

Rovatsos, M; Vukić, J; Kratochvíl, L

2016-01-01

Among amniotes, squamate reptiles are especially variable in their mechanisms of sex determination; however, based largely on cytogenetic data, some lineages possess highly evolutionary stable sex chromosomes. The still very limited knowledge of the genetic content of squamate sex chromosomes precludes a reliable reconstruction of the evolutionary history of sex determination in this group and consequently in all amniotes. Female heterogamety with a degenerated W chromosome typifies the lizards of the family Lacertidae, the widely distributed Old World clade including several hundreds of species. From the liver transcriptome of the lacertid Takydromus sexlineatus female, we selected candidates for Z-specific genes as the loci lacking single-nucleotide polymorphisms. We validated the candidate genes through the comparison of the copy numbers in the female and male genomes of T. sexlineatus and another lacertid species, Lacerta agilis, by quantitative PCR that also proved to be a reliable technique for the molecular sexing of the studied species. We suggest that this novel approach is effective for the detection of Z-specific and X-specific genes in lineages with degenerated W, respectively Y chromosomes. The analyzed gene content of the Z chromosome revealed that lacertid sex chromosomes are not homologous with those of other reptiles including birds, but instead the genes have orthologs in the X-conserved region shared by viviparous mammals. It is possible that this part of the vertebrate genome was independently co-opted for the function of sex chromosomes in viviparous mammals and lacertids because of its content of genes involved in gonad differentiation. PMID:26980341

Genetic variation in the prostaglandin E2 pathway is associated with primary graft dysfunction.

PubMed

Diamond, Joshua M; Akimova, Tatiana; Kazi, Altaf; Shah, Rupal J; Cantu, Edward; Feng, Rui; Levine, Matthew H; Kawut, Steven M; Meyer, Nuala J; Lee, James C; Hancock, Wayne W; Aplenc, Richard; Ware, Lorraine B; Palmer, Scott M; Bhorade, Sangeeta; Lama, Vibha N; Weinacker, Ann; Orens, Jonathan; Wille, Keith; Crespo, Maria; Lederer, David J; Arcasoy, Selim; Demissie, Ejigayehu; Christie, Jason D

2014-03-01

Biologic pathways with significant genetic conservation across human populations have been implicated in the pathogenesis of primary graft dysfunction (PGD). The evaluation of the role of recipient genetic variation in PGD has thus far been limited to single, candidate gene analyses. We sought to identify genetic variants in lung transplant recipients that are responsible for increased risk of PGD using a two-phase large-scale genotyping approach. Phase 1 was a large-scale candidate gene association study of the multicenter, prospective Lung Transplant Outcomes Group cohort. Phase 2 included functional evaluation of selected variants and a bioinformatics screening of variants identified in phase 1. After genetic data quality control, 680 lung transplant recipients were included in the analysis. In phase 1, a total of 17 variants were significantly associated with PGD, four of which were in the prostaglandin E2 family of genes. Among these were a coding variant in the gene encoding prostaglandin E2 synthase (PTGES2; P = 9.3 × 10(-5)) resulting in an arginine to histidine substitution at amino acid position 298, and three variants in a block containing the 5' promoter and first intron of the PTGER4 gene (encoding prostaglandin E2 receptor subtype 4; all P < 5 × 10(-5)). Functional evaluation in regulatory T cells identified that rs4434423A in the PTGER4 gene was associated with differential suppressive function of regulatory T cells. Further research aimed at replication and additional functional insight into the role played by genetic variation in prostaglandin E2 synthetic and signaling pathways in PGD is warranted.

Identification of candidate genes in Populus cell wall biosynthesis using text-mining, co-expression network and comparative genomics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xiaohan; Ye, Chuyu; Bisaria, Anjali

2011-01-01

Populus is an important bioenergy crop for bioethanol production. A greater understanding of cell wall biosynthesis processes is critical in reducing biomass recalcitrance, a major hindrance in efficient generation of ethanol from lignocellulosic biomass. Here, we report the identification of candidate cell wall biosynthesis genes through the development and application of a novel bioinformatics pipeline. As a first step, via text-mining of PubMed publications, we obtained 121 Arabidopsis genes that had the experimental evidences supporting their involvement in cell wall biosynthesis or remodeling. The 121 genes were then used as bait genes to query an Arabidopsis co-expression database and additionalmore » genes were identified as neighbors of the bait genes in the network, increasing the number of genes to 548. The 548 Arabidopsis genes were then used to re-query the Arabidopsis co-expression database and re-construct a network that captured additional network neighbors, expanding to a total of 694 genes. The 694 Arabidopsis genes were computationally divided into 22 clusters. Queries of the Populus genome using the Arabidopsis genes revealed 817 Populus orthologs. Functional analysis of gene ontology and tissue-specific gene expression indicated that these Arabidopsis and Populus genes are high likelihood candidates for functional genomics in relation to cell wall biosynthesis.« less

Clinically relevant known and candidate genes for obesity and their overlap with human infertility and reproduction.

PubMed

Butler, Merlin G; McGuire, Austen; Manzardo, Ann M

2015-04-01

Obesity is a growing public health concern now reaching epidemic status worldwide for children and adults due to multiple problems impacting on energy intake and expenditure with influences on human reproduction and infertility. A positive family history and genetic factors are known to play a role in obesity by influencing eating behavior, weight and level of physical activity and also contributing to human reproduction and infertility. Recent advances in genetic technology have led to discoveries of new susceptibility genes for obesity and causation of infertility. The goal of our study was to provide an update of clinically relevant candidate and known genes for obesity and infertility using high resolution chromosome ideograms with gene symbols and tabular form. We used computer-based internet websites including PubMed to search for combinations of key words such as obesity, body mass index, infertility, reproduction, azoospermia, endometriosis, diminished ovarian reserve, estrogen along with genetics, gene mutations or variants to identify evidence for development of a master list of recognized obesity genes in humans and those involved with infertility and reproduction. Gene symbols for known and candidate genes for obesity were plotted on high resolution chromosome ideograms at the 850 band level. Both infertility and obesity genes were listed separately in alphabetical order in tabular form and those highlighted when involved with both conditions. By searching the medical literature and computer generated websites for key words, we found documented evidence for 370 genes playing a role in obesity and 153 genes for human reproduction or infertility. The obesity genes primarily affected common pathways in lipid metabolism, deposition or transport, eating behavior and food selection, physical activity or energy expenditure. Twenty-one of the obesity genes were also associated with human infertility and reproduction. Gene symbols were plotted on high resolution ideograms and their name, precise chromosome band location and description were summarized in tabular form. Meaningful correlations in the obesity phenotype and associated human infertility and reproduction are represented with the location of genes on chromosome ideograms along with description of the gene and position in tabular form. These high resolution chromosome ideograms and tables will be useful in genetic awareness and counseling, diagnosis and treatment to improve clinical outcomes.

The Influence of Genetics on Cystic Fibrosis Phenotypes

PubMed Central

Knowles, Michael R.; Drumm, Mitchell

2012-01-01

Technological advances in genetics have made feasible and affordable large studies to identify genetic variants that cause or modify a trait. Genetic studies have been carried out to assess variants in candidate genes, as well as polymorphisms throughout the genome, for their associations with heritable clinical outcomes of cystic fibrosis (CF), such as lung disease, meconium ileus, and CF-related diabetes. The candidate gene approach has identified some predicted relationships, while genome-wide surveys have identified several genes that would not have been obvious disease-modifying candidates, such as a methionine sulfoxide transferase gene that influences intestinal obstruction, or a region on chromosome 11 proximate to genes encoding a transcription factor and an apoptosis controller that associates with lung function. These unforeseen associations thus provide novel insight into disease pathophysiology, as well as suggesting new therapeutic strategies for CF. PMID:23209180

Genetic Factors of Autoimmune Thyroid Diseases in Japanese

PubMed Central

Ban, Yoshiyuki

2012-01-01

Autoimmune thyroid diseases (AITDs), including Graves' disease (GD) and Hashimoto's thyroiditis (HT), are caused by immune response to self-thyroid antigens and affect approximately 2–5% of the general population. Genetic susceptibility in combination with external factors, such as smoking, viral/bacterial infection, and chemicals, is believed to initiate the autoimmune response against thyroid antigens. Abundant epidemiological data, including family and twin studies, point to a strong genetic influence on the development of AITDs. Various techniques have been employed to identify genes contributing to the etiology of AITDs, including candidate gene analysis and whole genome screening. These studies have enabled the identification of several loci (genetic regions) that are linked to AITDs, and, in some of these loci, putative AITD susceptibility genes have been identified. Some of these genes/loci are unique to GD and HT and some are common to both diseases, indicating that there is a shared genetic susceptibility to GD and HT. Known AITD-susceptibility genes are classified into three groups: HLA genes, non-HLA immune-regulatory genes (e.g., CTLA-4, PTPN22, and CD40), and thyroid-specific genes (e.g., TSHR and Tg). In this paper, we will summarize the latest findings on AITD susceptibility genes in Japanese. PMID:22242199

Microarray-assisted fine-mapping of quantitative trait loci for cold tolerance in rice.

PubMed

Liu, Fengxia; Xu, Wenying; Song, Qian; Tan, Lubin; Liu, Jiayong; Zhu, Zuofeng; Fu, Yongcai; Su, Zhen; Sun, Chuanqing

2013-05-01

Many important agronomic traits, including cold stress resistance, are complex and controlled by quantitative trait loci (QTLs). Isolation of these QTLs will greatly benefit the agricultural industry but it is a challenging task. This study explored an integrated strategy by combining microarray with QTL-mapping in order to identify cold-tolerant QTLs from a cold-tolerant variety IL112 at early-seedling stage. All the early seedlings of IL112 survived normally for 9 d at 4-5°C, while Guichao2 (GC2), an indica cultivar, died after 4 d under the same conditions. Using the F2:3 population derived from the progeny of GC2 and IL112, we identified seven QTLs for cold tolerance. Furthermore, we performed Affymetrix rice whole-genome array hybridization and obtained the expression profiles of IL112 and GC2 under both low-temperature and normal conditions. Four genes were selected as cold QTL-related candidates, based on microarray data mining and QTL-mapping. One candidate gene, LOC_Os07g22494, was shown to be highly associated with cold tolerance in a number of rice varieties and in the F2:3 population, and its overexpression transgenic rice plants displayed strong tolerance to low temperature at early-seedling stage. The results indicated that overexpression of this gene (LOC_Os07g22494) could increase cold tolerance in rice seedlings. Therefore, this study provides a promising strategy for identifying candidate genes in defined QTL regions.

The Candidate Cancer Gene Database: a database of cancer driver genes from forward genetic screens in mice.

PubMed

Abbott, Kenneth L; Nyre, Erik T; Abrahante, Juan; Ho, Yen-Yi; Isaksson Vogel, Rachel; Starr, Timothy K

2015-01-01

Identification of cancer driver gene mutations is crucial for advancing cancer therapeutics. Due to the overwhelming number of passenger mutations in the human tumor genome, it is difficult to pinpoint causative driver genes. Using transposon mutagenesis in mice many laboratories have conducted forward genetic screens and identified thousands of candidate driver genes that are highly relevant to human cancer. Unfortunately, this information is difficult to access and utilize because it is scattered across multiple publications using different mouse genome builds and strength metrics. To improve access to these findings and facilitate meta-analyses, we developed the Candidate Cancer Gene Database (CCGD, http://ccgd-starrlab.oit.umn.edu/). The CCGD is a manually curated database containing a unified description of all identified candidate driver genes and the genomic location of transposon common insertion sites (CISs) from all currently published transposon-based screens. To demonstrate relevance to human cancer, we performed a modified gene set enrichment analysis using KEGG pathways and show that human cancer pathways are highly enriched in the database. We also used hierarchical clustering to identify pathways enriched in blood cancers compared to solid cancers. The CCGD is a novel resource available to scientists interested in the identification of genetic drivers of cancer. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Integrated Systems Biology Analysis of Transcriptomes Reveals Candidate Genes for Acidity Control in Developing Fruits of Sweet Orange (Citrus sinensis L. Osbeck).

PubMed

Huang, Dingquan; Zhao, Yihong; Cao, Minghao; Qiao, Liang; Zheng, Zhi-Liang

2016-01-01

Organic acids, such as citrate and malate, are important contributors for the sensory traits of fleshy fruits. Although their biosynthesis has been illustrated, regulatory mechanisms of acid accumulation remain to be dissected. To provide transcriptional architecture and identify candidate genes for citrate accumulation in fruits, we have selected for transcriptome analysis four varieties of sweet orange (Citrus sinensis L. Osbeck) with varying fruit acidity, Succari (acidless), Bingtang (low acid), and Newhall and Xinhui (normal acid). Fruits of these varieties at 45 days post anthesis (DPA), which corresponds to Stage I (cell division), had similar acidity, but they displayed differential acid accumulation at 142 DPA (Stage II, cell expansion). Transcriptomes of fruits at 45 and 142 DPA were profiled using RNA sequencing and analyzed with three different algorithms (Pearson correlation, gene coexpression network and surrogate variable analysis). Our network analysis shows that the acid-correlated genes belong to three distinct network modules. Several of these candidate fruit acidity genes encode regulatory proteins involved in transport (such as AHA10), degradation (such as APD2) and transcription (such as AIL6) and act as hubs in the citrate accumulation gene networks. Taken together, our integrated systems biology analysis has provided new insights into the fruit citrate accumulation gene network and led to the identification of candidate genes likely associated with the fruit acidity control.

Integrated Systems Biology Analysis of Transcriptomes Reveals Candidate Genes for Acidity Control in Developing Fruits of Sweet Orange (Citrus sinensis L. Osbeck)

PubMed Central

Huang, Dingquan; Zhao, Yihong; Cao, Minghao; Qiao, Liang; Zheng, Zhi-Liang

2016-01-01

Organic acids, such as citrate and malate, are important contributors for the sensory traits of fleshy fruits. Although their biosynthesis has been illustrated, regulatory mechanisms of acid accumulation remain to be dissected. To provide transcriptional architecture and identify candidate genes for citrate accumulation in fruits, we have selected for transcriptome analysis four varieties of sweet orange (Citrus sinensis L. Osbeck) with varying fruit acidity, Succari (acidless), Bingtang (low acid), and Newhall and Xinhui (normal acid). Fruits of these varieties at 45 days post anthesis (DPA), which corresponds to Stage I (cell division), had similar acidity, but they displayed differential acid accumulation at 142 DPA (Stage II, cell expansion). Transcriptomes of fruits at 45 and 142 DPA were profiled using RNA sequencing and analyzed with three different algorithms (Pearson correlation, gene coexpression network and surrogate variable analysis). Our network analysis shows that the acid-correlated genes belong to three distinct network modules. Several of these candidate fruit acidity genes encode regulatory proteins involved in transport (such as AHA10), degradation (such as APD2) and transcription (such as AIL6) and act as hubs in the citrate accumulation gene networks. Taken together, our integrated systems biology analysis has provided new insights into the fruit citrate accumulation gene network and led to the identification of candidate genes likely associated with the fruit acidity control. PMID:27092171

Effector-mediated discovery of a novel resistance gene against Bremia lactucae in a nonhost lettuce species.

PubMed

Giesbers, Anne K J; Pelgrom, Alexandra J E; Visser, Richard G F; Niks, Rients E; Van den Ackerveken, Guido; Jeuken, Marieke J W

2017-11-01

Candidate effectors from lettuce downy mildew (Bremia lactucae) enable high-throughput germplasm screening for the presence of resistance (R) genes. The nonhost species Lactuca saligna comprises a source of B. lactucae R genes that has hardly been exploited in lettuce breeding. Its cross-compatibility with the host species L. sativa enables the study of inheritance of nonhost resistance (NHR). We performed transient expression of candidate RXLR effector genes from B. lactucae in a diverse Lactuca germplasm set. Responses to two candidate effectors (BLR31 and BLN08) were genetically mapped and tested for co-segregation with disease resistance. BLN08 induced a hypersensitive response (HR) in 55% of the L. saligna accessions, but responsiveness did not co-segregate with resistance to Bl:24. BLR31 triggered an HR in 5% of the L. saligna accessions, and revealed a novel R gene providing complete B. lactucae race Bl:24 resistance. Resistant hybrid plants that were BLR31 nonresponsive indicated other unlinked R genes and/or nonhost QTLs. We have identified a candidate avirulence effector of B. lactucae (BLR31) and its cognate R gene in L. saligna. Concurrently, our results suggest that R genes are not required for NHR of L. saligna. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Whole-Exome Sequencing Study of Thyrotropin-Secreting Pituitary Adenomas.

PubMed

Sapkota, Santosh; Horiguchi, Kazuhiko; Tosaka, Masahiko; Yamada, Syozo; Yamada, Masanobu

2017-02-01

Thyrotropin (TSH)-secreting pituitary adenomas (TSHomas) are a rare cause of hyperthyroidism, and the genetic aberrations responsible remain unknown. To identify somatic genetic abnormalities in TSHomas. A single-nucleotide polymorphism (SNP) array analysis was performed on 8 TSHomas. Four tumors with no allelic losses or limited loss of heterozygosity were selected, and whole-exome sequencing was performed, including their corresponding blood samples. Somatic variants were confirmed by Sanger sequencing. A set of 8 tumors was also assessed to validate candidate genes. Twelve patients with sporadic TSHomas were examined. The overall performance of whole-exome sequencing was good, with an average coverage of each base in the targeted region of 97.6%. Six DNA variants were confirmed as candidate driver mutations, with an average of 1.5 somatic mutations per tumor. No mutations were recurrent. Two of these mutations were found in genes with an established role in malignant tumorigenesis (SMOX and SYTL3), and 4 had unknown roles (ZSCAN23, ASTN2, R3HDM2, and CWH43). Similarly, an SNP array analysis revealed frequent chromosomal regions of copy number gains, including recurrent gains at loci harboring 4 of these 6 genes. Several candidate somatic mutations and changes in copy numbers for TSHomas were identified. The results showed no recurrence of mutations in the tumors studied but a low number of mutations, thereby highlighting their benign nature. Further studies on a larger cohort of TSHomas, along with the use of epigenetic and transcriptomic approaches, may reveal the underlying genetic lesions. Copyright © 2017 by the Endocrine Society

Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.

PubMed

Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H

2009-05-01

Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.