40 CFR 60.2635 - What are the operator training and qualification requirements?

Code of Federal Regulations, 2011 CFR

2011-07-01

...) through (xi) of this section. (i) Environmental concerns, including types of emissions. (ii) Basic combustion principles, including products of combustion. (iii) Operation of the specific type of incinerator to be used by the operator, including proper startup, waste charging, and shutdown procedures. (iv...

40 CFR 60.2070 - What are the operator training and qualification requirements?

Code of Federal Regulations, 2011 CFR

2011-07-01

...) Environmental concerns, including types of emissions. (ii) Basic combustion principles, including products of combustion. (iii) Operation of the specific type of incinerator to be used by the operator, including proper startup, waste charging, and shutdown procedures. (iv) Combustion controls and monitoring. (v) Operation...

The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

NASA Technical Reports Server (NTRS)

Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

1985-01-01

Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

NASA Astrophysics Data System (ADS)

Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

1985-08-01

Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

Evidence for an interaction between leptin, T cell costimulatory antigens CD28, CTLA-4 and CD26 (dipeptidyl peptidase IV) in BCG-induced immune responses of leptin- and leptin receptor-deficient mice.

PubMed

Rüter, Jens; Hoffmann, Torsten; Demuth, Hans-Ulrich; Moschansky, Petra; Klapp, Burghard F; Hildebrandt, Martin

2004-06-01

We assessed changes of the enzyme dipeptidyl peptidase IV (DPP IV, CD26) in the context of leptin or leptin receptor deficiency. C57BL/6 mice, Leptin-deficient mice (ob/ob mice, B6.V-Lep) and Leptin-receptor-deficient mice (db/db mice, B6.Cg-m+/+Lepr) were infected with B. Calmette-Guerin (BCG) and sacrificed three days later. DPP IV activity in serum was higher in ob/ob mice and in db/db mice than in wild-type mice. The expression of DPP IV/CD26 on splenocytes was higher in ob/ob mice than in wild-type animals, and lower in db/db mice, and decreased upon stimulation with BCG in ob/ob mice only. Several T cell antigens including CTLA-4 were expressed aberrantly in ob/ob and in db/db mice. Our observations provide evidence for a relationship between DPP IV and leptin.

Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1

PubMed Central

Xiao, Qian; Jiang, Yan; Liu, Qingbo; Yue, Jiao; Liu, Chunying; Zhao, Xiaotong; Qiao, Yuemei; Ji, Hongbin; Chen, Jianfeng; Ge, Gaoxiang

2015-01-01

Type IV collagens (Col IV), components of basement membrane, are essential in the maintenance of tissue integrity and proper function. Alteration of Col IV is related to developmental defects and diseases, including cancer. Col IV α chains form α1α1α2, α3α4α5 and α5α5α6 protomers that further form collagen networks. Despite knowledge on the functions of major Col IV (α1α1α2), little is known whether minor Col IV (α3α4α5 and α5α5α6) plays a role in cancer. It also remains to be elucidated whether major and minor Col IV are functionally redundant. We show that minor Col IV α5 chain is indispensable in cancer development by using α5(IV)-deficient mouse model. Ablation of α5(IV) significantly impeded the development of KrasG12D-driven lung cancer without affecting major Col IV expression. Epithelial α5(IV) supports cancer cell proliferation, while endothelial α5(IV) is essential for efficient tumor angiogenesis. α5(IV), but not α1(IV), ablation impaired expression of non-integrin collagen receptor discoidin domain receptor-1 (DDR1) and downstream ERK activation in lung cancer cells and endothelial cells. Knockdown of DDR1 in lung cancer cells and endothelial cells phenocopied the cells deficient of α5(IV). Constitutively active DDR1 or MEK1 rescued the defects of α5(IV)-ablated cells. Thus, minor Col IV α5(IV) chain supports lung cancer progression via DDR1-mediated cancer cell autonomous and non-autonomous mechanisms. Minor Col IV can not be functionally compensated by abundant major Col IV. PMID:25992553

Matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in paediatric burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors.

PubMed

Weremijewicz, Artur; Matuszczak, Ewa; Sankiewicz, Anna; Tylicka, Marzena; Komarowska, Marta; Tokarzewicz, Anna; Debek, Wojciech; Gorodkiewicz, Ewa; Hermanowicz, Adam

2018-06-01

The purpose of this study was the determination of matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in the blood plasma of burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors. 31 children scalded by hot water who were managed at the Department of Paediatric Surgery between 2014-2015, after primarily presenting with burns in 4-20% TBSA were included into the study (age 9 months up to 14 years, mean age 2,5+1 years). There were 10 girls and 21 boys. Venous blood samples were drawn 2-6h, and 12-16h after the thermal injury, and on the subsequent days 3, 5 and 7. The matrix metalloproteinase-2, collagen type IV and laminin-5 concentrations were assessed using Surface Plasmon Resonance Imaging by the investigators blinded to the other data. The MMP-2, laminin-5 and collagen type IV concentrations in the blood plasma of patients with burns, were highest 12-16h after thermal injury, the difference was statistically significant. The MMP-2, laminin-5 and collagen type IV concentrations measured 3 days, 5 days and 7 days after the thermal injury, slowly decreased over time, and on the 7th day reached the normal range, when compared with the concentration measured in controls. Current work is the first follow-up study regarding MMP-2 in burns. MMP-2, laminin-5 and collagen type IV levels were elevated early after burn injury in the plasma of studied patients, and were highest 12-16h after the injury. MMP-2, laminin-5 and collagen type IV levels were not proportional to the severity of the burn. We believe in the possibility that the gradual decrease of MMP-2, collagen type IV and laminin-5 concentrations could be connected with the process of healing, but to prove it, more investigation is needed in this area. The SPR imaging biosensor is a good diagnostic tool for determination of MMP-2, laminin-5 and collagen type IV in blood plasma of patients with burns. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

Period variations of Algol-type eclipsing binaries AD And, TWCas and IV Cas

NASA Astrophysics Data System (ADS)

Parimucha, Štefan; Gajdoš, Pavol; Kudak, Viktor; Fedurco, Miroslav; Vaňko, Martin

2018-04-01

We present new analyses of variations in O – C diagrams of three Algol-type eclipsing binary stars: AD And, TW Cas and IV Cas. We have used all published minima times (including visual and photographic) as well as newly determined ones from our and SuperWasp observations. We determined orbital parameters of 3rd bodies in the systems with statistically significant errors, using our code based on genetic algorithms and Markov chain Monte Carlo simulations. We confirmed the multiple nature of AD And and the triple-star model of TW Cas, and we proposed a quadruple-star model of IV Cas.

The recent emergence in hospitals of multidrug-resistant community-associated sequence type 1 and spa type t127 methicillin-resistant Staphylococcus aureus investigated by whole-genome sequencing: Implications for screening

PubMed Central

Earls, Megan R.; Kinnevey, Peter M.; Brennan, Gráinne I.; Lazaris, Alexandros; Skally, Mairead; O’Connell, Brian; Humphreys, Hilary; Shore, Anna C.

2017-01-01

Community-associated spa type t127/t922 methicillin-resistant Staphylococcus aureus (MRSA) prevalence increased from 1%-7% in Ireland between 2010–2015. This study tracked the spread of 89 such isolates from June 2013-June 2016. These included 78 healthcare-associated and 11 community associated-MRSA isolates from a prolonged hospital outbreak (H1) (n = 46), 16 other hospitals (n = 28), four other healthcare facilities (n = 4) and community-associated sources (n = 11). Isolates underwent antimicrobial susceptibility testing, DNA microarray profiling and whole-genome sequencing. Minimum spanning trees were generated following core-genome multilocus sequence typing and pairwise single nucleotide variation (SNV) analysis was performed. All isolates were sequence type 1 MRSA staphylococcal cassette chromosome mec type IV (ST1-MRSA-IV) and 76/89 were multidrug-resistant. Fifty isolates, including 40/46 from H1, were high-level mupirocin-resistant, carrying a conjugative 39 kb iles2-encoding plasmid. Two closely related ST1-MRSA-IV strains (I and II) and multiple sporadic strains were identified. Strain I isolates (57/89), including 43/46 H1 and all high-level mupirocin-resistant isolates, exhibited ≤80 SNVs. Two strain I isolates from separate H1 healthcare workers differed from other H1/strain I isolates by 7–47 and 12–53 SNVs, respectively, indicating healthcare worker involvement in this outbreak. Strain II isolates (19/89), including the remaining H1 isolates, exhibited ≤127 SNVs. For each strain, the pairwise SNVs exhibited by healthcare-associated and community-associated isolates indicated recent transmission of ST1-MRSA-IV within and between multiple hospitals, healthcare facilities and communities in Ireland. Given the interchange between healthcare-associated and community-associated isolates in hospitals, the risk factors that inform screening for MRSA require revision. PMID:28399151

Root Canal Anatomy and Morphology of Mandibular First Molars in a Selected Iranian Population: An In Vitro Study

PubMed Central

Mohammadzadeh Akhlaghi, Nahid; Khalilak, Zohreh; Vatanpour, Mehdi; Mohammadi, Saman; Pirmoradi, Sakineh; Fazlyab, Mahta; Safavi, Kamran

2017-01-01

Introduction: The aim of this study was to evaluate root canal anatomy of mandibular first molars (MFM) in a selected Iranian Population using clearing technique. Methods and Materials: A total of 150 extracted MFMs were cleared. The root canal morphology (including the root numbers and root length) and the anatomy of the root canal system (including is the number and type of canals based on Vertucci’s classification, canal curvature according to Schneider's method and the presence of isthmus) was evaluated using the buccolingual and mesiodistal parallel x-rays and stereomicroscope. The data were analyzed using the chi-square test. Results: Two and three roots were present in 96.7% and 33% of the teeth, respectively (P=0.0001). All the teeth (100%) had two canals in the mesial root, while 61.3% of the samples had one distal root canal (P=0.006). The root canal configuration in the mesial canal included type IV (55.3%) and type II (41.3%) (P=0.0001). In doubled-canalled distal roots, 68.8% and 24.3% were type II and type IV, respectively (P=0.0001). Isthmii were observed in 44.6% of mesial and 27.3% of distal roots (P=0.0001). Conclusion: The notable prevalence of type IV configuration in both roots of mandibular first molars, presence of isthmus and root curvature, necessitates the careful negotiation and cleaning of all accessible canal spaces. PMID:28179932

Modulation of substance P signaling by dipeptidyl peptidase-IV enzymatic activity in human glioma cell lines.

PubMed

Busek, P; Stremenová, J; Krepela, E; Sedo, A

2008-01-01

Dipeptidyl peptidase-IV (DPP-IV, CD26) is a serine protease almost ubiquitously expressed on cell surface and present in body fluids. DPP-IV has been suggested to proteolytically modify a number of biologically active peptides including substance P (SP) and the chemokine stromal cell derived factor-1alpha (SDF-1alpha, CXCL12). SP and SDF-1alpha have been implicated in the regulation of multiple biological processes and also induce responses that may be relevant for glioma progression. Both SP and SDF-1alpha are signaling through cell surface receptors and use intracellular calcium as a second messenger. The effect of DPP-IV on intracellular calcium mobilization mediated by SP and SDF-1alpha was monitored in suspension of wild type U373 and DPP-IV transfected U373DPPIV glioma cells using indicator FURA-2. Nanomolar concentrations of SP triggered a transient dose dependent increase in intracellular calcium rendering the cells refractory to repeated stimulation, while SDF-1 had no measurable effect. SP signaling in DPP-IV overexpressing U373DPPIV cells was not substantially different from that in wild type cells. However, preincubation of SP with the DPP-IV overexpressing cells lead to the loss of its signaling potential, which could be prevented with DPP-IV inhibitors. Taken together, DPP-IV may proteolytically inactivate local mediators involved in gliomagenesis.

Malleolar fractures and their ligamentous injury equivalents have similar outcomes in supination-external rotation type IV fractures of the ankle treated by anatomical internal fixation.

PubMed

Berkes, M B; Little, M T M; Lazaro, L E; Sculco, P K; Cymerman, R M; Daigl, M; Helfet, D L; Lorich, D G

2012-11-01

It has previously been suggested that among unstable ankle fractures, the presence of a malleolar fracture is associated with a worse outcome than a corresponding ligamentous injury. However, previous studies have included heterogeneous groups of injury. The purpose of this study was to determine whether any specific pattern of bony and/or ligamentous injury among a series of supination-external rotation type IV (SER IV) ankle fractures treated with anatomical fixation was associated with a worse outcome. We analysed a prospective cohort of 108 SER IV ankle fractures with a follow-up of one year. Pre-operative radiographs and MRIs were undertaken to characterise precisely the pattern of injury. Operative treatment included fixation of all malleolar fractures. Post-operative CT was used to assess reduction. The primary and secondary outcome measures were the Foot and Ankle Outcome Score (FAOS) and the range of movement of the ankle. There were no clinically relevant differences between the four possible SER IV fracture pattern groups with regard to the FAOS or range of movement. In this population of strictly defined SER IV ankle injuries, the presence of a malleolar fracture was not associated with a significantly worse clinical outcome than its ligamentous injury counterpart. Other factors inherent to the injury and treatment may play a more important role in predicting outcome.

[Clinical study on vocal cords spontaneous rehabilitation after CO2 laser surgery].

PubMed

Zhang, Qingxiang; Hu, Huiying; Sun, Guoyan; Yu, Zhenkun

2014-10-01

To study the spontaneous rehabilitation and phonation quality of vocal cords after different types of CO2 laser microsurgery. Surgical procedures based on Remacle system Type I, Type II, Type III, Type IV and Type V a respectively. Three hundred and fifteen cases with hoarseness based on strobe laryngoscopy results were prospectively assigned to different group according to vocal lesions apperence,vocal vibration and imaging of larynx CT/MRI. Each group holded 63 cases. The investigation included the vocal cords morphological features,the patients' subjective feelings and objective results of vocal cords. There are no severe complications for all patients in perioperative period. Vocal scar found in Type I ,1 case; Type II, 9 cases ;Type III, 47 cases; Type IV, 61 cases and Type Va 63 cases respectively after surgery. The difference of Vocal scar formation after surgery between surgical procedures are statistical significance (χ2 = 222.24, P < 0.05). Hoarseness improved after the surgery in 59 cases of Type I , 51 cases of Type II, 43 cases of Type III, 21 cases of Type IV and 17 cases of Type Va. There are statistically significance (χ2 = 89.46, P < 0.05) between different surgical procedures. The parameters of strobe laryngoscope: there are statistical significance on jitter between procedures (F 44.51, P < 0.05), but without difference within Type I and Type II (P > 0.05). This happened in shimmer parameter and the maximum phonation time (MPT) as jitter. There are no statistical significance between Type IV and Type Va on MPT (P > 0.05). Morphological and functional rehabilitation of vocal cord will be affected obviously when the body layer is injured. The depth and range of the CO2 laser microsurgery are the key factors affecting the vocal rehabilitation.

Ehlers-Danlos syndrome type IV

PubMed Central

Germain, Dominique P

2007-01-01

Ehlers-Danlos syndrome type IV, the vascular type of Ehlers-Danlos syndromes (EDS), is an inherited connective tissue disorder defined by characteristic facial features (acrogeria) in most patients, translucent skin with highly visible subcutaneous vessels on the trunk and lower back, easy bruising, and severe arterial, digestive and uterine complications, which are rarely, if at all, observed in the other forms of EDS. The estimated prevalence for all EDS varies between 1/10,000 and 1/25,000, EDS type IV representing approximately 5 to 10% of cases. The vascular complications may affect all anatomical areas, with a tendency toward arteries of large and medium diameter. Dissections of the vertebral arteries and the carotids in their extra- and intra-cranial segments (carotid-cavernous fistulae) are typical. There is a high risk of recurrent colonic perforations. Pregnancy increases the likelihood of a uterine or vascular rupture. EDS type IV is inherited as an autosomal dominant trait that is caused by mutations in the COL3A1 gene coding for type III procollagen. Diagnosis is based on clinical signs, non-invasive imaging, and the identification of a mutation of the COL3A1 gene. In childhood, coagulation disorders and Silverman's syndrome are the main differential diagnoses; in adulthood, the differential diagnosis includes other Ehlers-Danlos syndromes, Marfan syndrome and Loeys-Dietz syndrome. Prenatal diagnosis can be considered in families where the mutation is known. Choriocentesis or amniocentesis, however, may entail risk for the pregnant woman. In the absence of specific treatment for EDS type IV, medical intervention should be focused on symptomatic treatment and prophylactic measures. Arterial, digestive or uterine complications require immediate hospitalisation, observation in an intensive care unit. Invasive imaging techniques are contraindicated. Conservative approach is usually recommended when caring for a vascular complication in a patient suffering from EDS type IV. Surgery may, however, be required urgently to treat potentially fatal complications. PMID:17640391

Computational prediction of secretion systems and secretomes of Brucella: identification of novel type IV effectors and their interaction with the host.

PubMed

Sankarasubramanian, Jagadesan; Vishnu, Udayakumar S; Dinakaran, Vasudevan; Sridhar, Jayavel; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

2016-01-01

Brucella spp. are facultative intracellular pathogens that cause brucellosis in various mammals including humans. Brucella survive inside the host cells by forming vacuoles and subverting host defence systems. This study was aimed to predict the secretion systems and the secretomes of Brucella spp. from 39 complete genome sequences available in the databases. Furthermore, an attempt was made to identify the type IV secretion effectors and their interactions with host proteins. We predicted the secretion systems of Brucella by the KEGG pathway and SecReT4. Brucella secretomes and type IV effectors (T4SEs) were predicted through genome-wide screening using JVirGel and S4TE, respectively. Protein-protein interactions of Brucella T4SEs with their hosts were analyzed by HPIDB 2.0. Genes coding for Sec and Tat pathways of secretion and type I (T1SS), type IV (T4SS) and type V (T5SS) secretion systems were identified and they are conserved in all the species of Brucella. In addition to the well-known VirB operon coding for the type IV secretion system (T4SS), we have identified the presence of additional genes showing homology with T4SS of other organisms. On the whole, 10.26 to 14.94% of total proteomes were found to be either secreted (secretome) or membrane associated (membrane proteome). Approximately, 1.7 to 3.0% of total proteomes were identified as type IV secretion effectors (T4SEs). Prediction of protein-protein interactions showed 29 and 36 host-pathogen specific interactions between Bos taurus (cattle)-B. abortus and Ovis aries (sheep)-B. melitensis, respectively. Functional characterization of the predicted T4SEs and their interactions with their respective hosts may reveal the secrets of host specificity of Brucella.

Mucopolysaccharidosis type IV

MedlinePlus

... include: Abnormal development of bones, including the spine Bell-shaped chest with ribs flared out at the ... may slip and damage the spinal cord, causing paralysis. Surgery to correct such problems should be done ...

Continued expansion of USA300-like methicillin-resistant Staphylococcus aureus (MRSA) among hospitalized patients in the United States.

PubMed

Tickler, Isabella A; Goering, Richard V; Mediavilla, Jose R; Kreiswirth, Barry N; Tenover, Fred C

2017-08-01

We characterized spa types, SCCmec types, and antimicrobial resistance patterns of 516 methicillin-resistant Staphylococcus aureus (MRSA) isolates, collected between 2011 and 2014 from nares and blood cultures of United States patients. Among nares isolates, 45 spa types were observed; 29.9% were t002/SCCmec II and 30.9% were t008/SCCmec IV. Among blood isolates, 40 spa types were identified; 24.4% were t002/SCCmec II and 39.9% were type t008/SCCmec IV. Compared to data from our 2009-2010 survey, the percentage of t008/SCCmec IV isolates from nares increased significantly (20.4%-30.9%; P=0.004) while the percentage from positive blood cultures remained similar (39.2% versus 39.9%; P=0.921). There were also significant changes in the overall antimicrobial resistance patterns observed, including the decrease of the clindamycin, erythromycin, levofloxacin and moxifloxacin multidrug resistance pattern, likely the result of t002/SCCmec II strains being displaced by t008/SCCmec IV strains. Rates of high-level mupirocin resistance did not change significantly from our past study (4.1% compared to 4.7%; P=0.758) but an increase in low-level resistance, particularly among t002/SCCmec II isolates, was observed. Copyright © 2017 Elsevier Inc. All rights reserved.

THE FURTHER SEPARATION OF TYPES AMONG THE PNEUMOCOCCI HITHERTO INCLUDED IN GROUP IV AND THE DEVELOPMENT OF THERAPEUTIC ANTISERA FOR THESE TYPES

PubMed Central

Cooper, Georgia; Rosenstein, Carolyn; Walter, Annabel; Peizer, Lenore

1932-01-01

The unclassified strains known as Group IV have been separated into twenty-nine types which are designated by the Roman numerals IV and XXXII. Only a small percentage of the pneumococcus strains isolated in New York City for this study were left unclassified. The majority of the types gave very slight cross-reactions, the exceptions being Types II and V, III and VIII, VII and XVIII and XV and XXX. In the series of cases studied, Types IV, V, VII and VIII were found more prevalent in the lobar pneumonia of adults and Types V, VI a and XIV in children. The majority of the types were also found in normal individuals and in persons having respiratory infections other than pneumonia. Types VI a and XIX were most prevalent in the limited number of strains studied by us. Fourteen of the types were found in pneumococcus meningitis; Type XVIII was found most often. Antisera suitable for clinical trial have been prepared for fourteen types. From the majority of the horses inoculated for more than a year, antisera having 500 to 1000 units per cc. were obtained. Antisera of lower potency were concentrated and preparations obtained equal to or stronger than high grade unconcentrated serum. Potent bivalent antisera have been prepared for types which were found to give marked cross-agglutination reactions. The results with each type as to prevalence, severity of cases, presence in normal individuals, and in spinal meningitis, potency of antisera produced for therapeutic trial and virulence of strains for mice have been considered under the different type headings. PMID:19870011

Community-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complex 80 Type IV (CC80-MRSA-IV) Isolated from the Middle East: A Heterogeneous Expanding Clonal Lineage

PubMed Central

Harastani, Houda H.; Tokajian, Sima T.

2014-01-01

Background The emergence of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) has caused a change in MRSA epidemiology worldwide. In the Middle East, the persistent spread of CA-MRSA isolates that were associated with multilocus sequence type (MLST) clonal complex 80 and with staphylococcal cassette chromosome mec (SCCmec) type IV (CC80-MRSA-IV), calls for novel approaches for infection control that would limit its spread. Methodology/Principal Findings In this study, the epidemiology of CC80-MRSA-IV was investigated in Jordan and Lebanon retrospectively covering the period from 2000 to 2011. Ninety-four S. aureus isolates, 63 (67%) collected from Lebanon and 31 (33%) collected from Jordan were included in this study. More than half of the isolates (56%) were associated with skin and soft tissue infections (SSTIs), and 73 (78%) were Panton-Valentine Leukocidin (PVL) positive. Majority of the isolates (84%) carried the gene for exofoliative toxin d (etd), 19% had the Toxic Shock Syndrome Toxin-1 gene (tst), and seven isolates from Jordan had a rare combination being positive for both tst and PVL genes. spa typing showed the prevalence of type t044 (85%) and pulsed-field gel electrophoresis (PFGE) recognized 21 different patterns. Antimicrobial susceptibility testing showed the prevalence (36%) of a unique resistant profile, which included resistance to streptomycin, kanamycin, and fusidic acid (SKF profile). Conclusions The genetic diversity among the CC80 isolates observed in this study poses an additional challenge to infection control of CA-MRSA epidemics. CA-MRSA related to ST80 in the Middle East was distinguished in this study from the ones described in other countries. Genetic diversity observed, which may be due to mutations and differences in the antibiotic regimens between countries may have led to the development of heterogeneous strains. Hence, it is difficult to maintain “the European CA-MRSA clone” as a uniform clone and it is better to designate as CC80-MRSA-IV isolates. PMID:25078407

Extension of the classical classification of β-turns

PubMed Central

de Brevern, Alexandre G.

2016-01-01

The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3rd of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years. PMID:27627963

Extension of the classical classification of β-turns.

PubMed

de Brevern, Alexandre G

2016-09-15

The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3(rd) of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years.

AtlA functions as a peptidoglycan lytic transglycosylase in the Neisseria gonorrhoeae type IV secretion system.

PubMed

Kohler, Petra L; Hamilton, Holly L; Cloud-Hansen, Karen; Dillard, Joseph P

2007-08-01

Type IV secretion systems require peptidoglycan lytic transglycosylases for efficient secretion, but the function of these enzymes is not clear. The type IV secretion system gene cluster of Neisseria gonorrhoeae encodes two peptidoglycan transglycosylase homologues. One, LtgX, is similar to peptidoglycan transglycosylases from other type IV secretion systems. The other, AtlA, is similar to endolysins from bacteriophages and is not similar to any described type IV secretion component. We characterized the enzymatic function of AtlA in order to examine its role in the type IV secretion system. Purified AtlA was found to degrade macromolecular peptidoglycan and to produce 1,6-anhydro peptidoglycan monomers, characteristic of lytic transglycosylase activity. We found that AtlA can functionally replace the lambda endolysin to lyse Escherichia coli. In contrast, a sensitive measure of lysis demonstrated that AtlA does not lyse gonococci expressing it or gonococci cocultured with an AtlA-expressing strain. The gonococcal type IV secretion system secretes DNA during growth. A deletion of ltgX or a substitution in the putative active site of AtlA severely decreased DNA secretion. These results indicate that AtlA and LtgX are actively involved in type IV secretion and that AtlA is not involved in lysis of gonococci to release DNA. This is the first demonstration that a type IV secretion peptidoglycanase has lytic transglycosylase activity. These data show that AtlA plays a role in type IV secretion of DNA that requires peptidoglycan breakdown without cell lysis.

The Molecular Epidemiology of the Highly Virulent ST93 Australian Community Staphylococcus aureus Strain

PubMed Central

Coombs, Geoffrey W.; Goering, Richard V.; Chua, Kyra Y. L.; Monecke, Stefan; Howden, Benjamin P.; Stinear, Timothy P.; Ehricht, Ralf; O’Brien, Frances G.; Christiansen, Keryn J.

2012-01-01

In Australia the PVL - positive ST93-IV [2B], colloquially known as “Queensland CA-MRSA” has become the dominant CA-MRSA clone. First described in the early 2000s, ST93-IV [2B] is associated with skin and severe invasive infections including necrotizing pneumonia. A singleton by multilocus sequence typing (MLST) eBURST analysis ST93 is distinct from other S aureus clones. To determine if the increased prevalence of ST93-IV [2B] is due to the widespread transmission of a single strain of ST93-IV [2B] the genetic relatedness of 58 S. aureus ST93 isolated throughout Australia over an extended period were studied in detail using a variety of molecular methods including pulsed-field gel electrophoresis, spa typing, MLST, microarray DNA, SCCmec typing and dru typing. Identification of the phage harbouring the lukS-PV/lukF-PV Panton Valentine leucocidin genes, detection of allelic variations in lukS-PV/lukF-PV, and quantification of LukF-PV expression was also performed. Although ST93-IV [2B] is known to have an apparent enhanced clinical virulence, the isolates harboured few known virulence determinants. All PVL-positive isolates carried the PVL-encoding phage ΦSa2USA and the lukS-PV/lukF-PV genes had the same R variant SNP profile. The isolates produced similar expression levels of LukF-PV. Although multiple rearrangements of the spa sequence have occurred, the core genome in ST93 is very stable. The emergence of ST93-MRSA is due to independent acquisitions of different dru-defined type IV and type V SCCmec elements in several spa-defined ST93-MSSA backgrounds. Rearrangement of the spa sequence in ST93-MRSA has subsequently occurred in some of these strains. Although multiple ST93-MRSA strains were characterised, little genetic diversity was identified for most isolates, with PVL-positive ST93-IVa [2B]-t202-dt10 predominant across Australia. Whether ST93-IVa [2B] t202-dt10 arose from one PVL-positive ST93-MSSA-t202, or by independent acquisitions of SCCmec-IVa [2B]-dt10 into multiple PVL-positive ST93-MSSA-t202 strains is not known. PMID:22900085

Evaluation of a Hyperlinked Consumer Health Dictionary for reading EHR notes.

PubMed

Slaughter, Laura; Oyri, Karl; Fosse, Erik

2011-01-01

In this paper, we report on a pilot study conducted to test the usefulness and understandability of definitions in a Consumer Health Dictionary (IVS-CHD). Our two main goals for this study were to evaluate functionality of the dictionary when embedded in electronic health records (EHR) and determine the methodology for our larger-scale project to iteratively develop the IVS-CHD. The hyperlinked IVS-CHD was made available to thoracic surgery patients reading their own EHR. We asked patients to rate definitions on two 5-level Likert items measuring perceived usefulness and understandability. We also captured the terms that patients wanted defined, but that were not included in the IVS-CHD. Preliminary results indicate the types of problems that must be avoided when creating definitions, for example, that patients prefer detailed explanations that include medical outcomes, and that do not use "unfamiliar" terms they must also look up. We also have gained insight into the types of terms that patients want defined from their EHR notes, especially certain abbreviations. Patients further commented on the experience of reading EHR notes directly from the same system used by healthcare personnel and the help strategy of linking the contents to a hyperlinked dictionary.

Chemical Basis for Qualitative and Quantitative Differences Between ABO Blood Groups and Subgroups: Implications for Organ Transplantation.

PubMed

Jeyakanthan, M; Tao, K; Zou, L; Meloncelli, P J; Lowary, T L; Suzuki, K; Boland, D; Larsen, I; Burch, M; Shaw, N; Beddows, K; Addonizio, L; Zuckerman, W; Afzali, B; Kim, D H; Mengel, M; Shapiro, A M J; West, L J

2015-10-01

Blood group ABH(O) carbohydrate antigens are carried by precursor structures denoted type I-IV chains, creating unique antigen epitopes that may differ in expression between circulating erythrocytes and vascular endothelial cells. Characterization of such differences is invaluable in many clinical settings including transplantation. Monoclonal antibodies were generated and epitope specificities were characterized against chemically synthesized type I-IV ABH and related glycans. Antigen expression was detected on endomyocardial biopsies (n = 50) and spleen (n = 11) by immunohistochemical staining and on erythrocytes by flow cytometry. On vascular endothelial cells of heart and spleen, only type II-based ABH antigens were expressed; type III/IV structures were not detected. Type II-based ABH were expressed on erythrocytes of all blood groups. Group A1 and A2 erythrocytes additionally expressed type III/IV precursors, whereas group B and O erythrocytes did not. Intensity of A/B antigen expression differed among group A1 , A2 , A1 B, A2 B and B erythrocytes. On group A2 erythrocytes, type III H structures were largely un-glycosylated with the terminal "A" sugar α-GalNAc. Together, these studies define qualitative and quantitative differences in ABH antigen expression between erythrocytes and vascular tissues. These expression profiles have important implications that must be considered in clinical settings of ABO-incompatible transplantation when interpreting anti-ABO antibodies measured by hemagglutination assays with reagent erythrocytes. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

[Purging behaviors and nutritional status in anorexia nervosa and bulimia nervosa].

PubMed

Vaz, F J; García-Herráiz, A; López-Vinuesa, B; Monge, M; Fernández-Gil, M A; Guisado, J A

2003-01-01

The aim of the study was to investigate whether the use of purgative methods in patients with eating disorders (anorexia nervosa [AN] and bulimia nervosa [BN]) could be capable of producing changes in the nutritional status of the patients. The group under study was composed of 184 female eating disordered outpatients. One hundred and sixteen patients (63.0%) fulfilled the DSM-IV diagnostic criteria for BN (90 purging type, 26 nonpurging type). Sixty eight patients (37.0%) fulfilled the DSM-IV criteria for the diagnosis of AN (48 restricting type, 20 binging-purging type). The assessment process included anthropometry (body circumferences and skinfold thickness) and body impedance analysis. The two subgroups of AN patients significantly differed from each of the BN subgroups. From a nutritional point of view, some significant differences between the two DSM-IV subtypes of AN existed, but not between the purging type and the nonpurging type of BN. The paper discusses the clinical significance of these findings. An alternative subtypification of AN patients is proposed: 1) restricting type [patients who control their food intake and do not purge]; 2) purging type [patient with true episodes of binging which are followed by purgative behaviors]; and 3) pseudopurging type [patients with subjective binging episodes who use purging methods].

NATIONAL COASTAL CONDITION REPORT IV | Science ...

EPA Pesticide Factsheets

The National Coastal Condition Report IV (NCCR IV) is the fourth in a series of environmental assessments of U.S. coastal waters and the Great Lakes. The report includes assessments of all the nation’s estuaries in the contiguous 48 states and Puerto Rico, south-eastern Alaska, Hawaii, the U.S. Virgin Islands, Guam, and American Samoa. The NCCR IV presents four main types of data: (1) coastal monitoring data, (2) coastal ocean/ offshore monitoring data, (3) offshore fisheries data, and (4) assessment and advisory data (new to NCCR IV). The NCCR IV relies heavily on coastal monitoring data from EPA’s National Coastal Assessment (NCA) to assess coastal condition by evaluating five indicators of condition—water quality, sediment quality, benthic community condition, coastal habitat loss, and fish tissue contaminants. To assess and report on the condition of the nation's coastal resources

Insights into early extracellular matrix evolution: spongin short chain collagen-related proteins are homologous to basement membrane type IV collagens and form a novel family widely distributed in invertebrates.

PubMed

Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves

2006-12-01

Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.

Testing for Drug Hypersensitivity Syndromes

PubMed Central

Rive, Craig M; Bourke, Jack; Phillips, Elizabeth J

2013-01-01

Adverse drug reactions are a common cause of patient morbidity and mortality. Type B drug reactions comprise only 20% of all drug reactions but they tend to be primarily immunologically mediated and less dependent on the drug’s pharmacological action and dose. Common Type B reactions seen in clinical practice are those of the immediate, IgE, Gell-Coombs Type I reactions, and the delayed, T-cell mediated, Type IV reactions. Management of these types of reactions, once they have occurred, requires careful consideration and recognition of the utility of routine diagnostic tests followed by ancillary specialised diagnostic testing. For Type I, IgE mediated reactions this includes prick/intradermal skin testing and oral provocation. For Type IV, T-cell mediated reactions this includes a variety of in vivo (patch testing) and ex vivo tests, many of which are currently mainly used in highly specialised research laboratories. The recent association of many serious delayed (Type IV) hypersensitivity reactions to specific drugs with HLA class I and II alleles has created the opportunity for HLA screening to exclude high risk populations from exposure to the implicated drug and hence prevent clinical reactions. For example, the 100% negative predictive value of HLA-B*5701 for true immunologically mediated abacavir hypersensitivity and the development of feasible, inexpensive DNA-based molecular tests has led to incorporation of HLA-B*5701 screening in routine HIV clinical practice. The mechanism by which drugs specifically interact with HLA has been recently characterised and promises to lead to strategies for pre-clinical screening to inform drug development and design. PMID:23592889

Genetics Home Reference: familial porencephaly

MedlinePlus

... one component of a protein called type IV collagen. Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

A type IV burst associated with a coronal streamer disruption event

NASA Technical Reports Server (NTRS)

Kundu, M. R.

1987-01-01

A type IV burst was observed on February 17, 1985 with the Clark Lake Radio Observatory multifrequency radioheliograph operating in the frequency range 20-125 MHz. This burst was associated with a coronal streamer disruption event. From two-dimensional images produced at 50 MHz, evidence of a type II burst and a slow moving type IV burst are shown. The observations of the moving type IV burst suggests that a plasmoid containing energetic electrons can result from the disruption of a coronal streamer.

Extensive Genetic Diversity Identified among Sporadic Methicillin-Resistant Staphylococcus aureus Isolates Recovered in Irish Hospitals between 2000 and 2012

PubMed Central

Kinnevey, Peter M.; Shore, Anna C.; Brennan, Grainne I.; Sullivan, Derek J.; Ehricht, Ralf; Monecke, Stefan

2014-01-01

Clonal replacement of predominant nosocomial methicillin-resistant Staphylococcus aureus (MRSA) strains has occurred several times in Ireland during the last 4 decades. However, little is known about sporadically occurring MRSA in Irish hospitals or in other countries. Eighty-eight representative pvl-negative sporadic MRSA isolates recovered in Irish hospitals between 2000 and 2012 were investigated. These yielded unusual pulsed-field gel electrophoresis and antibiogram-resistogram typing patterns distinct from those of the predominant nosocomial MRSA clone, ST22-MRSA-IV, during the study period. Isolates were characterized by spa typing and DNA microarray profiling for multilocus sequence type (MLST) clonal complex (CC) and/or sequence type (ST) and SCCmec type assignment, as well as for detection of virulence and antimicrobial resistance genes. Conventional PCR-based SCCmec subtyping was undertaken when necessary. Extensive diversity was detected, including 38 spa types, 13 MLST-CCs (including 18 STs among 62 isolates assigned to STs), and 25 SCCmec types (including 2 possible novel SCCmec elements and 7 possible novel SCCmec subtypes). Fifty-four MLST-spa-SCCmec type combinations were identified. Overall, 68.5% of isolates were assigned to nosocomial lineages, with ST8-t190-MRSA-IID/IIE ± SCCM1 predominating (17.4%), followed by CC779/ST779-t878-MRSA-ψSCCmec-SCC-SCCCRISPR (7.6%) and CC22/ST22-t032-MRSA-IVh (5.4%). Community-associated clones, including CC1-t127/t386/t2279-MRSA-IV, CC59-t216-MRSA-V, CC8-t008-MRSA-IVa, and CC5-t002/t242-MRSA-IV/V, and putative animal-associated clones, including CC130-t12399-MRSA-XI, ST8-t064-MRSA-IVa, ST398-t011-MRSA-IVa, and CC6-t701-MRSA-V, were also identified. In total, 53.3% and 47.8% of isolates harbored genes for resistance to two or more classes of antimicrobial agents and two or more mobile genetic element-encoded virulence-associated factors, respectively. Effective ongoing surveillance of sporadic nosocomial MRSA is warranted for early detection of emerging clones and reservoirs of virulence, resistance, and SCCmec genes. PMID:24395241

[Joint endoprosthesis pathology. Histopathological diagnostics and classification].

PubMed

Krenn, V; Morawietz, L; Jakobs, M; Kienapfel, H; Ascherl, R; Bause, L; Kuhn, H; Matziolis, G; Skutek, M; Gehrke, T

2011-05-01

Prosthesis durability has steadily increased with high 10-year rates of 88-95%. However, four pathogenetic groups of diseases can decrease prosthesis durability: (1) periprosthetic wear particle disease (aseptic loosening) (2) bacterial infection (septic loosening) (3) periprosthetic ossification, and (4) arthrofibrosis. The histopathological "extended consensus classification of periprosthetic membranes" includes four types of membranes, arthrofibrosis, and osseous diseases of endoprosthetics: The four types of neosynovia are: wear particle-induced type (type I), mean prosthesis durability (MPD) in years 12.0; infectious type (type II), MPD 2.5; combined type (type III) MPD 4.2; and indeterminate type (type IV), MPD 5.5. Arthrofibrosis can be determined in three grades: grade 1 needs clinical information to be differentiated from a type IV membrane, and grades 2 & 3 can be diagnosed histopathologically. Periprosthetic ossification, osteopenia-induced fractures, and aseptic osteonecrosis can be histopathologically diagnosed safely with clinical information. The extended consensus classification of periprosthetic membranes may be a diagnostic groundwork for a future national endoprosthesis register.

Genetics Home Reference: multicentric osteolysis, nodulosis, and arthropathy

MedlinePlus

... to cut (cleave) a protein called type IV collagen. Type IV collagen is a major structural component of basement membranes, ... enzyme, preventing the normal cleavage of type IV collagen. It is unclear how a loss of enzyme ...

viking: identification and characterization of a second type IV collagen in Drosophila.

PubMed

Yasothornsrikul, S; Davis, W J; Cramer, G; Kimbrell, D A; Dearolf, C R

1997-10-01

We have taken an enhancer trap approach to identify genes that are expressed in hematopoietic cells and tissues of Drosophila. We conducted a molecular analysis of two P-element insertion strains that have reporter gene expression in embryonic hemocytes, strain 197 and vikingICO. This analysis has determined that viking encodes a collagen type IV gene, alpha2(IV). The viking locus is located adjacent to the previously described DCg1, which encodes collagen alpha1(IV), and in the opposite orientation. The alpha2(IV) and alpha1(IV) collagens are structurally very similar to one another, and to vertebrate type IV collagens. In early development, viking and DCg1 are transcribed in the same tissue-specific pattern, primarily in the hemocytes and fat body cells. Our results suggest that both the alpha1 and alpha2 collagen IV chains may contribute to basement membranes in Drosophila. This work also provides the foundation for a more complete genetic dissection of collagen type IV molecules and their developmental function in Drosophila.

Mapping General Anesthetic Sites in Heteromeric γ-Aminobutyric Acid Type A Receptors Reveals a Potential For Targeting Receptor Subtypes.

PubMed

Forman, Stuart A; Miller, Keith W

2016-11-01

IV general anesthetics, including propofol, etomidate, alphaxalone, and barbiturates, produce important actions by enhancing γ-aminobutyric acid type A (GABAA) receptor activation. In this article, we review scientific studies that have located and mapped IV anesthetic sites using photoaffinity labeling and substituted cysteine modification protection. These anesthetics bind in transmembrane pockets between subunits of typical synaptic GABAA receptors, and drugs that display stereoselectivity also show remarkably selective interactions with distinct interfacial sites. These results suggest strategies for developing new drugs that selectively modulate distinct GABAA receptor subtypes.

Treatment of melasma with low fluence, large spot size, 1064-nm Q-switched neodymium-doped yttrium aluminum garnet (Nd:YAG) laser for the treatment of melasma in Fitzpatrick skin types II-IV.

PubMed

Brown, Alia S; Hussain, Mussarat; Goldberg, David J

2011-12-01

Melasma is a common condition affecting over six million American women. Treatment of dermal or combined melasma is difficult and does not respond well to conventional topical therapies. Various light sources have been used recently in the treatment of melasma including fractionated ablative and non-ablative lasers as well as intense pulse light. We report the use of low fluence, large spot size Q-switched, Nd:Yag laser for the treatment of melasma in skin types II-IV.

Bacterial Translocation Ratchets: Shared Physical Principles with Different Molecular Implementations: How bacterial secretion systems bias Brownian motion for efficient translocation of macromolecules.

PubMed

Hepp, Christof; Maier, Berenike

2017-10-01

Secretion systems enable bacteria to import and secrete large macromolecules including DNA and proteins. While most components of these systems have been identified, the molecular mechanisms of macromolecular transport remain poorly understood. Recent findings suggest that various bacterial secretion systems make use of the translocation ratchet mechanism for transporting polymers across the cell envelope. Translocation ratchets are powered by chemical potential differences generated by concentration gradients of ions or molecules that are specific to the respective secretion systems. Bacteria employ these potential differences for biasing Brownian motion of the macromolecules within the conduits of the secretion systems. Candidates for this mechanism include DNA import by the type II secretion/type IV pilus system, DNA export by the type IV secretion system, and protein export by the type I secretion system. Here, we propose that these three secretion systems employ different molecular implementations of the translocation ratchet mechanism. © 2017 The Authors. BioEssays Published by WILEY Periodicals, Inc.

Expression of heat shock protein 47 is increased in remnant kidney and correlates with disease progression

PubMed Central

SUNAMOTO, MASAAKI; KUZE, KOGO; IEHARA, NORIYUKI; TAKEOKA, HIROYA; NAGATA, KAZUHIRO; KITA, TORU; DOI, TOSHIO

1998-01-01

Glomerulosclerosis is characterized by accumulation of the mesangial extracellular matrix, including type I and IV collagen. The processing for the collagens in the glomeruli may play a critical role for development of glomerulosclerosis. We examined the expression of heat shock protein 47 (HSP47), a collagen-binding molecular chaperone in the progresive glomerulosclerosis model. Subtotally nephrectomized rats, unlike sham-operated rats, developed focal and segmental glomerulosclerosis. Immunological staining demonstrated an increased expression of HSP47 which paralleled the expression of type I and IV collagen in the glomeruli of the nephrectomized rats as the glomerulosclerosis developed. The mRNA levels encoding type I and type IV collagen and HSP47 were increased 3.4 fold, 3.6 fold and 2.8 fold, respectively, at week 7 after nephrectomy. By in situ hybridization, the expression of HSP47 mRNA was determined to be localized to the glomeruli with segmental sclerosis. These results suggest that HSP47 may play a central role in the process of extracellular matrix accumulation during the development of glomerulosclerosis. PMID:9741355

Distribution of type IV collagen in pancreatic adenocarcinoma and chronic pancreatitis.

PubMed Central

Lee, C. S.; Montebello, J.; Georgiou, T.; Rode, J.

1994-01-01

Changes in the basement membrane are present in various neoplastic conditions such as neurofibrosarcoma, cervical carcinoma, colorectal cancers and hepatoblastoma. This study examines the expression of type IV collagen in the basement membrane, using an immunohistochemical method, in the normal pancreas (n = 10), chronic pancreatitis (n = 15) and pancreatic adenocarcinoma (n = 30). The formalin fixed, paraffin embedded tissue was sectioned and pretreated with protease prior to immunostaining for type IV collagen. There was a statistically significant difference in type IV collagen expression between pancreatic carcinoma and chronic pancreatitis (P = 0.0001; chi 2 test with continuity correction). In pancreatic adenocarcinoma, type IV collagen distribution in the basement membrane was discontinuous and irregular or absent around individual or groups of neoplastic cells (n = 30). Most cases of chronic pancreatitis showed continuous pattern of basement membrane type IV collagen around residual ducts (n = 10). In the normal pancreas, only one of the ten cases showed discontinuous basement membrane around pancreatic ducts, while in the rest of the cases, the pattern was continuous. This study suggests that there is abnormal distribution of type IV collagen in the basement membrane in pancreatic carcinoma, which may be related to either abnormal deposition or degradation of the collagen. Immunostaining for type IV collagen may be of some diagnostic use for distinguishing pancreatic adenocarcinoma from problematic cases of chronic pancreatitis. Images Figure 1 Figure 2 Figure 3 PMID:8199008

A novel GBE1 gene variant in a child with glycogen storage disease type IV.

PubMed

Said, Samar M; Murphree, Marine I; Mounajjed, Taofic; El-Youssef, Mounif; Zhang, Lizhi

2016-08-01

Glycogen storage disease type IV is an autosomal recessive disorder of carbohydrates caused by deficiency of amylo-1-4-glycanoglycosyltransferase, which leads to accumulation of amylopectin-like polysaccharides in tissues including liver, heart and neuromuscular system. More than 40 different mutations in the glycogen branching enzyme gene (GBE1) have been described. In this study, we report a 2-year-old boy who presented with developmental delay and muscle weakness. He subsequently was diagnosed with glycogen storage disease type IV based on a liver biopsy histology and electron microscopy. Glycogen branching enzyme activity was in the low range. Genetic analysis demonstrated a novel heterozygous variant (c.760A>G; p.Thr254Ala) in exon 6 of the GBE1 gene, which is believed to be pathogenic. This variant was inherited from the patient's mother who was asymptomatic with normal glycogen branching enzyme activity. Whole-exome sequencing failed to reveal additional variations in the GBE1 gene. Copyright © 2016 Elsevier Inc. All rights reserved.

Exome sequencing establishes a gelsolin mutation as the cause of inherited bulbar-onset neuropathy.

PubMed

Caress, James B; Johnson, Janel O; Abramzon, Yevgeniya A; Hawkins, Gregory A; Gibbs, J Raphael; Sullivan, Elizabeth A; Chahal, Chamanpreet S; Traynor, Bryan J

2017-11-01

Progressive bulbar motor neuropathy is primarily caused by bulbar-onset ALS. Hereditary amyloidosis type IV also presents with a bulbar neuropathy that mimics motor neuron disease. The disease is prevalent in Finland only and is not commonly included in the differential diagnosis of ALS. We studied 18 members of a family in which some had bulbar motor neuropathy, and we performed exome sequencing. Five affected family members were found to have a D187Y substitution in the GSN gene known to cause hereditary amyloidosis type IV. This American family presented with progressive bulbar neuropathy due to a gelsolin mutation not found in Finland. Hereditary amyloidosis type IV presents with bulbar motor neuropathy and not with peripheral neuropathy as occurs with common forms of amyloidosis. This report demonstrates the power of exome sequencing to determine the cause of rare hereditary diseases with incomplete or atypical phenotypes. Muscle Nerve 56: 1001-1005, 2017. © 2016 Wiley Periodicals, Inc.

Genetics Home Reference: hereditary angiopathy with nephropathy, aneurysms, and muscle cramps syndrome

MedlinePlus

... one component of a protein called type IV collagen . Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

PubMed

McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

2014-10-01

The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

PubMed Central

McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

2014-01-01

The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

Percutaneous intraductal radiofrequency ablation in the management of unresectable Bismuth types III and IV hilar cholangiocarcinoma.

PubMed

Wang, Yu; Cui, Wei; Fan, Wenzhe; Zhang, Yingqiang; Yao, Wang; Huang, Kunbo; Li, Jiaping

2016-08-16

To assess the feasibility and safety of percutaneous intraductal radiofrequency ablation (RFA) for unresectable Bismuth types III and IV hilar cholangiocarcinoma. Percutaneous intraductal RFA combined with metal stent placement was successful in all patients without any technical problems; the technical success rate was 100%. Chemotherapy was administered to two patients. After treatment, serum direct bilirubin levels were notably decreased. Six patients died during the follow-up period. Median stent patency from the time of the first RFA and survival from the time of diagnosis were 100 days (95% confidence interval (CI), 85-115 days) and 5.3 months (95% CI, 2.5-8.1 months), respectively. No acute pancreatitis, bile duct bleeding and perforation, bile leakage, or other severe complications occurred. Four cases of procedure-related cholangitis, three cases of postoperative abdominal pain, and five cases of asymptomatic transient increase in serum amylase were observed. One patient who presented with stent blockage 252 days' post-procedure underwent repeat ablation. Between September 2013 and May 2015, nine patients with unresectable Bismuth types III and IV hilar cholangiocarcinoma who were treated with percutaneous intraductal RFA combined with metal stent placement after the percutaneous transhepatic cholangial drainage were included in the retrospective analysis. Procedure-related complications, stent patency, and survival after treatment were investigated. Percutaneous intraductal RFA combined with metal stent placement is a technically safe and feasible therapeutic option for the palliative treatment of unresectable Bismuth types III and IV hilar cholangiocarcinoma. Its long-term efficacy and safety is promising, but needs further study via randomized and prospective trials that include a greater number of patients.

A unifying concept: pancreatic ductal anatomy both predicts and determines the major complications resulting from pancreatitis.

PubMed

Nealon, William H; Bhutani, Manoop; Riall, Taylor S; Raju, Gottumukkala; Ozkan, Orhan; Neilan, Ryan

2009-05-01

Precepts about acute pancreatitis, necrotizing pancreatitis, and pancreatic fluid collections or pseudocyst rarely include the impact of pancreatic ductal injuries on their natural course and outcomes. We previously examined and established a system to categorize ductal changes. We sought a unifying concept that may predict course and direct therapies in these complex patients. We use our system categorizing ductal changes in pseudocyst of the pancreas and severe necrotizing pancreatitis (type I, normal duct; type II, duct stricture; type III, duct occlusion or "disconnected duct"; and type IV, chronic pancreatitis). From 1985 to 2006, a policy was implemented of routine imaging (cross-sectional, endoscopic retrograde cholangiopancreatography, or magnetic resonance cholangiopancreatography). Clinical outcomes were measured. Among 563 patients with pseudocyst, 142 resolved spontaneously (87% of type I, 5% of type II, and no type III, and 3% of type IV). Percutaneous drainage was successful in 83% of type I, 49% of type II, and no type III or type IV. Among 174 patients with severe acute pancreatitis percutaneous drainage was successful in 64% of type I, 38% of type II, and no type III. Operative debridement was required in 39% of type I and 83% and 85% of types II and III, respectively. Persistent fistula after debridement occurred in 27%, 54%, and 85% of types I, II, and III ducts, respectively. Late complications correlated with duct injury. Pancreatic ductal changes predict spontaneous resolution, success of nonoperative measures, and direct therapies in pseudocyst. Ductal changes also predict patients with necrotizing pancreatitis who are most likely to have immediate and delayed complications.

Sunlight exposure and photoprotection behaviour of white Caucasian adolescents in the UK.

PubMed

Gould, M; Farrar, M D; Kift, R; Berry, J L; Mughal, M Z; Bundy, C; Vail, A; Webb, A R; Rhodes, L E

2015-04-01

Sun exposure has positive and negative effects on health, yet little is known about the sun exposure behaviour of UK adolescents, including those more prone or less prone to sunburn. To examine sun exposure behaviour of UK white Caucasian adolescents including time spent outdoors, holiday behaviour, use of sunscreen and clothing, with assessment for differences between sun-reactive skin type groups. White Caucasian adolescents (12-15 years) attending schools in Greater Manchester completed a two-page questionnaire to assess sun exposure and photoprotective behaviour. A total of 133 adolescents (median age 13.4 years; 39% skin type I/II, 61% skin type III/IV) completed the questionnaire. In summer, adolescents spent significantly longer outdoors at weekends (median 4 h/day, range 0.25-10) than on weekdays (2, 0.25-6; P < 0.0001). When at home in the UK during summer, 44% reported never wearing sunscreen compared to just 1% when on a sunny holiday. Sunscreen use was also greater (frequency/coverage) when on a sunny holiday than at home in the UK summer (P < 0.0001). Adolescents of skin types I/II (easy burning) spent significantly less time outdoors than skin types III/IV (easy tanning) on summer weekends (P < 0.001), summer weekdays (P < 0.05) and on a sunny holiday (P = 0.001). Furthermore, skin types I/II reported greater sunscreen use during summer in the UK and on sunny holiday (both P < 0.01), and wore clothing covering a greater skin area on a sunny holiday (P < 0.01) than skin types III/IV. There was no difference in sun exposure behaviour/protection between males and females. The greater sun-protective measures reported by adolescents of sun-reactive skin type group I/II than III/IV suggest those who burn more easily are aware of the greater need to protect their skin. However, use of sunscreen during the UK summer is low and may need more effective promotion in adolescents. © 2014 European Academy of Dermatology and Venereology.

Alport syndrome and Pierson syndrome: Diseases of the glomerular basement membrane.

PubMed

Funk, Steven D; Lin, Meei-Hua; Miner, Jeffrey H

2018-04-16

The glomerular basement membrane (GBM) is an important component of the kidney's glomerular filtration barrier. Like all basement membranes, the GBM contains type IV collagen, laminin, nidogen, and heparan sulfate proteoglycan. It is flanked by the podocytes and glomerular endothelial cells that both synthesize it and adhere to it. Mutations that affect the GBM's collagen α3α4α5(IV) components cause Alport syndrome (kidney disease with variable ear and eye defects) and its variants, including thin basement membrane nephropathy. Mutations in LAMB2 that impact the synthesis or function of laminin α5β2γ1 (LM-521) cause Pierson syndrome (congenital nephrotic syndrome with eye and neurological defects) and its less severe variants, including isolated congenital nephrotic syndrome. The very different types of kidney diseases that result from mutations in collagen IV vs. laminin are likely due to very different pathogenic mechanisms. A better understanding of these mechanisms should lead to targeted therapeutic approaches that can help people with these rare but important diseases. Copyright © 2017 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

Palliative treatment with radiation-emitting metallic stents in unresectable Bismuth type III or IV hilar cholangiocarcinoma.

PubMed

Lu, Jian; Guo, Jin-He; Zhu, Hai-Dong; Zhu, Guang-Yu; Wang, Yong; Zhang, Qi; Chen, Li; Wang, Chao; Pan, Tian-Fan; Teng, Gao-Jun

2017-01-01

The emerging data for stenting in combination with brachytherapy in unresectable hilar cholangiocarcinoma are encouraging. The aim of this study was to evaluate the efficacy and safety of radiation-emitting metallic stents (REMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma. Consecutive patients who underwent percutaneous placement with REMS or uncovered self-expandable metallic stent (SEMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma between September 2011 and April 2016 were identified into this retrospective study. Data on patient demographics and overall survival, functional success, stent patency and complications were collected at the authors' hospital. A total of 59 patients were included: 33 (55.9%) in the REMS group and 26 (44.1%) in the SEMS group. The median overall survival was 338 days in the REMS group and 141 days in the SEMS group (p<0.001). The median stent patency time was 385 days for REMS and 142 days for SEMS (p<0.001). The functional success rate (87.9% vs 84.6%, p=0.722) and incidence of overall complications (27.3% vs 26.9%, p=0.999) did not differ in the two groups. Placement with REMS is safe and effective in palliation for unresectable Bismuth type III or IV hilar cholangiocarcinoma, and seems to prolong survival as well as patency of stent in these patients.

Type IV Ehlers-Danlos Syndrome: A Surgical Emergency? A Case of Massive Retroperitoneal Hemorrhage

PubMed Central

Chun, Stephen G; Pedro, Patrick; Yu, Mihae; Takanishi, Danny M

2011-01-01

Retroperitoneal hemorrhagic bleeding is a known manifestation of Type-IV Ehlers-Danlos Syndrome that is caused by loss-of-function mutations of the pro-alpha-1 chains of type III pro-collagen (COL3A1) resulting in vascular fragility. A number of previous reports describe futile surgical intervention for retroperitoneal bleeding in Type-IV Ehlers-Danlos Syndrome with high post-operative mortality, although the rarity of retroperitoneal bleeding associated with Type-IV Ehlers-Danlos Syndrome precludes an evidence-based approach to clinical management. We report a 23-year-old male with history of Type-IV Ehlers-Danlos Syndrome who presented with severe abdominal pain and tachycardia following an episode of vomiting. Further work-up of his abdominal pain revealed massive retroperitoneal bleeding by CT-scan of the abdomen. Given numerous cases of catastrophic injury caused by surgical intervention in Type-IV Ehlers-Danlos Syndrome, the patient was treated non-operatively, and the patient made a full recovery. This case suggests that even in cases of large retroperitoneal hemorrhages associated with Ehlers-Danlos Syndrome, it may not truly represent a surgical emergency. PMID:21966332

Selective thoracic surgery in the Lenke type 1A: King III and King IV type curves.

PubMed

Parisini, P; Di Silvestre, M; Lolli, F; Bakaloudis, G

2009-06-01

Pedicle screw fixation enables enhanced three-dimensional correction of spinal deformities and effectively shortens the distal fusion level. However, the choice of distal fusion level is still controversial in single thoracic idiopathic scoliosis with the lumbar compensatory curve not crossing the middle line (Lenke type 1 with modifier A or King type III and IV curves).The authors retrospectively analyzed 31 patients treated by segmental pedicular instrumentation alone, affected by a single thoracic adolescent idiopathic scoliosis with a compensatory lumbar curve not crossing the midline (Lenke 1A), with an average age of 16.3 years (range 10-22 years). The patients with regard to the King classification were also assessed. A statistical analysis was performed to determine whether the two groups (King III, King IV) presented differences concerning the level of the stable vertebra (SV), end vertebra (EV), and neutral vertebra (NV) and were also analyzed the results at follow-up regarding the relationships between the SV, EV, and lowest instrumented vertebra (LIV). The statistical analysis showed a significant difference between the two curve types. In the King III type curve the SV, EV, and NV appeared to be more proximal than those of the King IV type curve and the segments between the SV, EV, and NV appeared to be reduced in King III curves compared with King IV curves. At a follow-up of 3.2 years (range 2.2-5) the thoracic curve showed a correction of 58.4% (from 62.3 degrees to 26.6 degrees ) and compensatory lumbar curve an average spontaneous correction of 52.4% (from 38.1 degrees to 18.1 degrees ).The position of the LIV was shorter than the position of the SV in 30 patients (97%) with an average "salvage" of 2.1 (from 1 to 4) distal fusion levels. Four cases (13%), all affected by a King IV type curve, presented at follow-up an unsatisfactory results due to an "adding on" phenomenon. The statistical analysis confirmed that this phenomenon was correlated with The King IV curve (P = 0.043; Chi-square test) and that the only predictive parameter for its onset was the LIV-SV difference (odds ratio = 0.093; with a confidence interval of 0.008-1): every time that in King IV curve type the LIV was three or more levels shorter than the stable vertebra at follow-up the "adding on" phenomenon was present. The authors conclude that Lenke's type 1 with modifier A includes two kinds of curves, King III and King IV and that the Lenke's type 2 curves and King V with the lumbar curve not crossing the middle line have a similar behavior. Therefore, it is of authors' opinion that "the adding on phenomenon" could be prevented by more rigidly defining K. IV versus K. III curves. In Lenke's 1/2 A-K. IV/V type with the rotation of the first vertebra just below the thoracic lower EV in the same direction as the thoracic curve, and when SV and EV show more than two levels of difference, it is necessary to extend the lower fusion down to L2 or L3 (not more than two levels shorter than the SV). Whereas in Lenke's 1/2 A-K. III/V with the rotation of the first proximal vertebra of lumbar curve in the opposite direction to the thoracic apex and when SV and EV show not more than two level gap differences, the position of the lowest instrumented vertebra can be two or three levels shorter than the stable vertebra with satisfactory postoperative spinal balance. Therefore, the stable vertebra and the rotation of lumbar curve are considered to be a reliable guide for selecting the lower level of fusion.

Fosaprepitant-induced phlebitis: a focus on patients receiving doxorubicin/cyclophosphamide therapy.

PubMed

Leal, A D; Kadakia, K C; Looker, S; Hilger, C; Sorgatz, K; Anderson, K; Jacobson, A; Grendahl, D; Seisler, D; Hobday, T; Loprinzi, Charles L

2014-05-01

The purpose of this study was to investigate the incidence of fosaprepitant-associated infusion site adverse events (ISAEs) among a cohort of breast cancer patients receiving doxorubicin/cyclophosphamide (AC) chemotherapy. A retrospective review of electronic medical record (EMR) data was performed for all patients who were initiated on AC from January 2011 to April 2012. Data collected included baseline demographics, antiemetic regimen, documentation of ISAEs, and type of intravenous (IV) access. Descriptive statistics (mean and standard deviation or percentages) were summarized overall, by type of IV access and initial antiemetic given. Among the 148 patients included in this analysis, 98 initially received fosaprepitant and 44 received aprepitant. The incidence of ISAEs associated with fosaprepitant administration was 34.7 % (n=34), while the incidence of aprepitant-associated ISAEs was 2.3 % (n=1). All ISAEs were associated with peripheral IV access. The most commonly reported ISAEs were infusion site pain (n=26), erythema (n=22), swelling (n=12), superficial thrombosis (n=8), infusion site hives (n=5), and phlebitis/thrombophlebitis (n=5). Twenty-six patients experienced more than one type of ISAE. The incidence and severity of ISAEs associated with fosaprepitant administration among a group of patients receiving AC chemotherapy are significant and appreciably higher than what has been previously reported.

Fosaprepitant-induced Phlebitis: A Focus on Patients receiving Doxorubicin/Cyclophosphamide therapy

PubMed Central

Leal, A. D.; Kadakia, K. C.; Looker, S.; Hilger, C.; Sorgatz, K.; Anderson, K.; Jacobson, A.; Grendahl, D.; Seisler, D.; Hobday, T.; Loprinzi, C. L.

2014-01-01

Purpose The purpose of this study was to investigate the incidence of fosaprepitant-associated infusion site adverse events (ISAEs) among a cohort of breast cancer patients receiving doxorubicin/cyclophosphamide (AC) chemotherapy. Methods A retrospective review of electronic medical record (EMR) data was performed for all patients who were initiated on AC from January 2011 to April 2012. Data collected included baseline demographics, antiemetic regimen, documentation of ISAEs and type of intravenous (IV) access. Descriptive statistics (mean and standard deviation or percentages) were summarized overall, by type of IV access and initial antiemetic given. Results Among the 148 patients included in this analysis, 98 initially received fosaprepitant and 44 received aprepitant. The incidence of ISAEs associated with fosaprepitant administration was 34.7% (n=34), while the incidence of aprepitant-associated ISAEs was 2.3% (n=1). All ISAEs were associated with peripheral IV access. The most commonly reported ISAEs were: infusion site pain (n=26), erythema (n=22), swelling (n=12), superficial thrombosis (n=8), infusion site hives (n=5) and phlebitis/thrombophlebitis (n=5). Twenty-six patients experienced more than one type of ISAE. Conclusions The incidence and severity of ISAEs associated with fosaprepitant administration among a group of patients receiving AC chemotherapy is significant and appreciably higher than what has been previously reported. PMID:24402411

Genetics Home Reference: mucopolysaccharidosis type IV

MedlinePlus

... individuals develop various skeletal abnormalities, including short stature, knock knees, and abnormalities of the ribs, chest, spine, ... links) Encyclopedia: Cloudy cornea Encyclopedia: Hypermobile joints Encyclopedia: Knock ... Morquio syndrome Encyclopedia: Mucopolysaccharides Health Topic: ...

A novel arctigenin-containing latex glove prevents latex allergy by inhibiting type I/IV allergic reactions.

PubMed

Wang, Yong-Xin; Xue, Dan-Ting; Liu, Meng; Zhou, Zheng-Min; Shang, Jing

2016-03-01

The present study aimed at developing a natural compound with anti-allergic effect and stability under latex glove manufacturing conditions and investigating whether its anti-allergic effect is maintained after its addition into the latex. The effects of nine natural compounds on growth of the RBL-2H3 cells and mouse primary spleen lymphocytes were determined using MTT assay. The compounds included glycyrrhizin, osthole, tetrandrine, tea polyphenol, catechin, arctigenin, oleanolic acid, baicalin and oxymatrine. An ELISA assay was used for the in vitro anti-type I/IV allergy screening; in this process β-hexosaminidase, histamine, and IL-4 released from RBL-2H3 cell lines and IFN-γ and IL-2 released from mouse primary spleen lymphocytes were taken as screening indices. The physical stability of eight natural compounds and the dissolubility of arctigenin, selected based on the in vitro pharnacodynamaic screening and the stability evaluation, were detected by HPLC. The in vivo pharmacodynamic confirmation of arctigenin and final latex product was evaluated with a passive cutaneous anaphylaxis (PCA) model and an allergen-specific skin response model. Nine natural compounds showed minor growth inhibition on RBL-2H3 cells and mouse primary spleen lymphocytes. Baicalin and arctigenin had the best anti-type I and IV allergic effects among the natural compounds based on the in vitro pharmacodynamic screening. Arctigenin and catechin had the best physical stability under different manufacturing conditions. Arctigenin was the selected for further evaluation and proven to have anti-type I and IV allergic effects in vivo in a dose-dependent manner. The final product of the arctigenin-containing latex glove had anti-type I and IV allergic effects in vivo which were mainly attributed to arctigenin as proved from the dissolubility results. Arctigenin showed anti-type I and IV allergic effects in vitro and in vivo, with a good stability under latex glove manufacturing conditions, and a persistent anti-allergic effect after being added into the latex to prevent latex allergy. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Mutational Analysis of the QRRQ Motif in the Yeast Hig1 Type 2 Protein Rcf1 Reveals a Regulatory Role for the Cytochrome c Oxidase Complex*

PubMed Central

Garlich, Joshua; Strecker, Valentina; Wittig, Ilka; Stuart, Rosemary A.

2017-01-01

The yeast Rcf1 protein is a member of the conserved family of proteins termed the hypoxia-induced gene (domain) 1 (Hig1 or HIGD1) family. Rcf1 interacts with components of the mitochondrial oxidative phosphorylation system, in particular the cytochrome bc1 (complex III)-cytochrome c oxidase (complex IV) supercomplex (termed III-IV) and the ADP/ATP carrier proteins. Rcf1 plays a role in the assembly and modulation of the activity of complex IV; however, the molecular basis for how Rcf1 influences the activity of complex IV is currently unknown. Hig1 type 2 isoforms, which include the Rcf1 protein, are characterized in part by the presence of a conserved motif, (Q/I)X3(R/H)XRX3Q, termed here the QRRQ motif. We show that mutation of conserved residues within the Rcf1 QRRQ motif alters the interactions between Rcf1 and partner proteins and results in the destabilization of complex IV and alteration of its enzymatic properties. Our findings indicate that Rcf1 does not serve as a stoichiometric component, i.e. as a subunit of complex IV, to support its activity. Rather, we propose that Rcf1 serves to dynamically interact with complex IV during its assembly process and, in doing so, regulates a late maturation step of complex IV. We speculate that the Rcf1/Hig1 proteins play a role in the incorporation and/or remodeling of lipids, in particular cardiolipin, into complex IV and. possibly, other mitochondrial proteins such as ADP/ATP carrier proteins. PMID:28167530

Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

PubMed

Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

2018-07-01

Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Differential expression of basement membrane type IV collagen α2 and α6 chains as a prognostic factor in patients with extrahepatic bile duct carcinoma.

PubMed

Hirashima, Kotaro; Iyama, Ken-Ichi; Baba, Yoshifumi; Honda, Yumi; Sado, Yoshikazu; Ninomiya, Yoshifumi; Watanabe, Masayuki; Takamori, Hiroshi; Beppu, Toru; Baba, Hideo

2013-03-01

The destruction of the basement membrane (BM) is the first step in cancer invasion and metastasis. Type IV collagen is a major component of the BM, and is composed of six genetically distinct α(IV) chains; α1(IV) to α6(IV). The loss of α5(IV) and α6(IV) chains from the epithelial BM at the early stage of cancer invasion has been reported in several types of cancers. However, the expression of α5(IV) and α6(IV) chains in extrahepatic bile duct carcinoma (EBDC) remains unclear. We examined the expression of α(IV) chains by immunohistochemistry using 71 resected EBDC specimens. Prognostic significance of α(IV) chains was examined by Cox regression and Kaplan-Meier analyses. In the invasive cancer, the expression of α6(IV) chain in the BM was lost partially or completely preceded by the loss of α2(IV) chain. The loss of α6(IV) chain in the BM of the invasive cancer was related to the tumor classification, TNM stages, and the expression of α2(IV) chain. The patients with α2(IV)-negative and α6(IV)-negative chains had significantly poorer prognosis than those with α2(IV)-positive and α6(IV)-positive/negative chains (P = 0.04). The loss of α2(IV) and α6(IV) chains might be a useful prognostic factor in patients with EBDC. Copyright © 2012 Wiley Periodicals, Inc.

Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

PubMed

Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

2011-10-01

Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

Essential core of the Hawking–Ellis types

NASA Astrophysics Data System (ADS)

Martín-Moruno, Prado; Visser, Matt

2018-06-01

The Hawking–Ellis (Segre–Plebański) classification of possible stress–energy tensors is an essential tool in analyzing the implications of the Einstein field equations in a more-or-less model-independent manner. In the current article the basic idea is to simplify the Hawking–Ellis type I, II, III, and IV classification by isolating the ‘essential core’ of the type II, type III, and type IV stress–energy tensors; this being done by subtracting (special cases of) type I to simplify the (Lorentz invariant) eigenvalue structure as much as possible without disturbing the eigenvector structure. We will denote these ‘simplified cores’ type II0, type III0, and type IV0. These ‘simplified cores’ have very nice and simple algebraic properties. Furthermore, types I and II0 have very simple classical interpretations, while type IV0 is known to arise semi-classically (in renormalized expectation values of standard stress–energy tensors). In contrast type III0 stands out in that it has neither a simple classical interpretation, nor even a simple semi-classical interpretation. We will also consider the robustness of this classification considering the stability of the different Hawking–Ellis types under perturbations. We argue that types II and III are definitively unstable, whereas types I and IV are stable.

Observational properties of decameter type IV bursts

NASA Astrophysics Data System (ADS)

Melnik, Valentin; Brazhenko, Anatoly; Rucker, Helmut; Konovalenko, Alexander; Briand, Carine; Dorovskyy, Vladimir; Zarka, Philippe; Frantzusenko, Anatoly; Panchenko, Michael; Poedts, Stefan; Zaqarashvili, Teimuraz; Shergelashvili, Bidzina

2013-04-01

Oscillations of decameter type IV bursts were registered during observations of solar radio emission by UTR-2, URAN-2 and NDA in 2011-2012. Large majority of these bursts were accompanied by coronal mass ejections (CMEs), which were observed by SOHO and STEREO in the visible light. Only in some cases decameter type IV bursts were not associated with CMEs. The largest periods of oscillations P were some tens of minutes. There were some modes of long periods of oscillations simultaneously. Periods of oscillations in flux and in polarization profiles were close. Detailed properties of oscillations at different frequencies were analyzed on the example of two type IV bursts. One of them was observed on April 7, 2011 when a CME happened. Another one (August 1, 2011) was registered without any CME. The 7 April type IV burst had two periods in the frames 75-85 and 35-85 minutes. Interesting feature of these oscillations is decreasing periods with time. The observed decreasing rates dP/dt equaled 0.03-0.07. Concerning type IV burst observed on August 1, 2011 the period of its oscillations increases from 17 min. at 30 MHz to 44 min. at 10 MHz. Connection of type IV burst oscillations with oscillations of magnetic arches and CMEs at corresponding altitudes are discussed. The work is fulfilled in the frame of FP7 project "SOLSPANET".

Involvement of DPP IV/CD26 in cutaneous wound healing process in mice.

PubMed

Baticic Pucar, Lara; Pernjak Pugel, Ester; Detel, Dijana; Varljen, Jadranka

2017-01-01

Dipeptidyl peptidase IV (DPP IV/CD26) is a widely distributed multifunctional protein that plays a significant role in different physiological as well as pathological processes having a broad spectrum of bioactive substrates and immunomodulative properties. It has potential influence on different processes crucial for wound healing, including cell adhesion, migration, apoptosis, and extracellular matrix degradation. However, despite its known enzymatic and immunomodulative functions, limited data characterize the role of DPP IV/CD26 in cutaneous wound healing mechanisms. The aim of this study was to investigate the process of wound healing in conditions of CD26 deficiency in order to obtain better insights on the role of DPP IV/CD26 in cutaneous regeneration. Experimental wounds were made on the dorsal part of CD26 deficient (CD26 -/- ) and wild-type mice (C57BL/6). The process of cutaneous wound healing was monitored on defined time schedule postwounding by macroscopic, microscopic, and biochemical analyses. Obtained results revealed a better rate of wound closure, revascularization and cell proliferation in CD26 -/- mice, with enhanced local expression of hypoxia-inducible factor 1α and vascular endothelial growth factor. CD26 deficiency induced prompt macrophage recruitment at the site of skin damage but did not influence mobilization of T-cells in comparison with wild-type mice. CD26 -/- mice have significantly higher values of IP-10 in serum and control skins compared with wild-type mice but values in wounds did not differ significantly on days 2, 4, and 7 of wound healing. DPP IV/CD26 activity was found to be decreased 4 days postwounding in serum and 2, 4, and 7 days postwounding in wounds of wild-type animals compared with control skins. These findings contribute to better understanding of wound healing mechanisms and could give a support in finding new therapeutic approaches for wound healing and tissue regeneration. © 2016 by the Wound Healing Society.

Endovascular repair of an iliac artery aneurysm in a patient with Ehlers-Danlos syndrome type IV.

PubMed

Tonnessen, Britt H; Sternbergh, W Charles; Mannava, Krishna; Money, Samuel R

2007-01-01

Ehlers-Danlos type IV (EDS-IV) is an inherited condition most notable for its associated vascular complications. Patients are prone to aneurysm formation, arterial dissection, and spontaneous vessel rupture. Intervention for the vascular pathology of EDS-IV carries high morbidity and mortality. We describe a case of a 57-year-old man with EDS-IV and an expanding iliac aneurysm who underwent successful endovascular repair with a stent-graft. Endovascular aneurysm repair is feasible and should be considered for patients with EDS-IV.

Association of history of allergies and influenza-like infections with laryngeal cancer in a case-control study.

PubMed

Filippidis, Filippos T; Schwartz, Stephen M; Becker, Nikolaus; Dyckhoff, Gerhard; Kirschfink, Michael; Dietz, Andreas; Becher, Heiko; Ramroth, Heribert

2015-08-01

Prior studies suggest that history of allergy and infections early in life might be inversely associated with cancer. We explored the association between allergies, recent influenza infections and laryngeal cancer risk. We used data from a case-control study which included 229 cases of laryngeal cancer and 769 population controls matched for age and sex. History of a physician-diagnosed allergy, influenza-like infections in the past 5 years, smoking, alcohol consumption and occupational exposure to carcinogens were self-reported. Allergies were classified into two groups (Type I and Type IV), according to the underlying immunologic mechanism. Conditional logistic regression models were fitted using laryngeal cancer as the outcome, adjusting for smoking, alcohol consumption and occupational exposure and stratified for age and sex. Having any allergy was not associated significantly with laryngeal cancer. Although Type I and Type IV allergies were non-significantly associated with laryngeal cancer, Type IV allergies showed a strong inverse association after adjusting for smoking and alcohol (OR 0.50, 95 % CI 0.22-1.2). Participants who reported at least one influenza-like infection during the past 5 years were significantly less likely to have laryngeal cancer (OR 0.57, 95 % CI 0.39-0.81). After considering fever (≥38.5 °C) as a criterion for influenza infection, the association between influenza infection and laryngeal cancer was even stronger (OR 0.29, 95 % CI 0.13-0.63). We found no significant association between any allergy and laryngeal cancer, some indication of an inverse association between Type IV allergy and laryngeal cancer, whereas recent influenza infections were inversely associated with laryngeal cancer risk.

Urinary type IV collagen is related to left ventricular diastolic function and brain natriuretic peptide in hypertensive patients with prediabetes.

PubMed

Iida, Masato; Yamamoto, Mitsuru; Ishiguro, Yuko S; Yamazaki, Masatoshi; Ueda, Norihiro; Honjo, Haruo; Kamiya, Kaichirou

2014-01-01

Urinary type IV collagen is an early biomarker of diabetic nephropathy. Concomitant prediabetes (the early stage of diabetes) was associated with left ventricular (LV) diastolic dysfunction and increased brain natriuretic peptide (BNP) in hypertensive patients. We hypothesized that urinary type IV collagen may be related to these cardiac dysfunctions. We studied hypertensive patients with early prediabetes (HbA1c <5.7% and fasting glucose >110, n=18), those with prediabetes (HbA1c 5.7-6.4, n=98), and those with diabetes (HbA1c>6.5 or on diabetes medications, n=92). The participants underwent echocardiography to assess left atrial volume/body surface area (BSA) and the ratio of early mitral flow velocity to mitral annular velocity (E/e'). Left ventricular diastolic dysfunction (LVDD) was defined if patients had E/e'≥15, or E/e'=9-14 accompanied by left atrial volume/BSA≥32ml/mm(2). Urinary samples were collected for type IV collagen and albumin, and blood samples were taken for BNP and HbA1c. Urinary type IV collagen and albumin increased in parallel with the deterioration of glycemic status. In hypertensive patients with prediabetes, subjects with LVDD had higher levels of BNP and urinary type IV collagen than those without LVDD. In contrast, in hypertensive patients with diabetes, subjects with LVDD had higher urinary albumin and BNP than those without LVDD. Urinary type IV collagen correlated positively with BNP in hypertensive patients with prediabetes, whereas it correlated with HbA1c in those with diabetes. In hypertensive patients with prediabetes, urinary type IV collagen was associated with LV diastolic dysfunction and BNP. Copyright © 2014 Elsevier Inc. All rights reserved.

Clinical presentations of Ehlers Danlos syndrome type IV.

PubMed Central

Pope, F M; Narcisi, P; Nicholls, A C; Liberman, M; Oorthuys, J W

1988-01-01

Ehlers Danlos syndrome type IV is an often lethal disease caused by various mutations of type III collagen genes. It presents in infancy and childhood in several ways, and the symptoms and signs include low birth weight, prematurity, congenital dislocation of the hips, easy inappropriate bruising (sometimes suspected as child battering), and a diagnostic facial phenotype. These features predict a lethal adult disease often complicated by fatal arterial rupture in early or middle adult life. Most affected patients can be diagnosed from radiolabelled collagen protein profiles by polyacrylamide gel electrophoresis. Prenatal diagnosis by specific type III collagen restriction fragment length polymorphisms is possible in some families, and will become increasingly important. Prenatal diagnosis and prevention of the disease in selected families is already possible and will be widely available in the future. Images Fig 1 Fig 2 Fig 3 Fig 4 Fig 5 Fig 6 Fig 7 Fig 8 Fig 9 Fig 10 Fig 11 PMID:3178263

A comparative study of percutaneous atherectomy for femoropopliteal arterial occlusive disease.

PubMed

Gu, Yongquan; Malas, Mahmoud B; Qi, Lixing; Guo, Lianrui; Guo, Jianming; Yu, Hengxi; Tong, Zhu; Gao, Xixiang; Zhang, Jian; Wang, Zhonggao

2017-08-01

SilverHawk™ directional atherectomy has been used to treat more than 300 thousand cases of lower extremity atherosclerotic occlusive disease in the world since it was approved by FDA in 2003. This study aimed to analyze the safety and effectiveness of symptomatic femoral popliteal atherosclerotic disease treated by directional atherectomy (DA). Clinical data of all consecutive patients treated with percutaneous atherectomy utilizing the SilverHawk™ plaque excision was retrospectively analyzed. The anatomic criteria of the atherosclerotic lesions were divided into four types: type I stenosis; type II occlusion; type III in-stent restenosis; type IV stent occlusion. There were 160 patients treated during the study period. Intermittent claudication in 75 patients (47%), rest pain in 55 patients (34.5%) and tissue loss in 30 patients (18.5%). The number of patients was 72, 15, 49 and 24 in type I, II, III and IV lesions, respectively. Technical success rate was 98.6%, 93.3%, 97.9% and 91.7% in type I, II, III and IV lesions, respectively. Debris of intimal plaque was captured by protection device in 92 patients (71.3%). The mean follow-up period was 23.5±10.4 months. Restenosis rate of type I to IV lesions was 21%, 36%, 36% and 40% respectively. Restenosis rate in type I lesion was significantly lower than that in type III and IV lesions (P<0.05). Patients with tissue loss responded to revascularization as follow: type I, 11/13 healed or reduced (84.6%), type II, 3/3 patients improved (100%), type III, 5/6 patients improved (83.3%) and type IV 4/4 healed (100%). In type IV group, four patients had in-stent thrombosis found by postoperative Duplex ultrasonography. They all underwent DA after catheter-directed thrombolysis with good angiographic results. Percutaneous DA is safe and effective for both de-novo atherosclerotic and in-stent stenotic or occlusive lesions. Thrombolysis before plaque excision is recommended in case of in-stenting thrombosis.

Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

PubMed Central

Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

2009-01-01

Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

CT-based radiomics signature for differentiating Borrmann type IV gastric cancer from primary gastric lymphoma.

PubMed

Ma, Zelan; Fang, Mengjie; Huang, Yanqi; He, Lan; Chen, Xin; Liang, Cuishan; Huang, Xiaomei; Cheng, Zixuan; Dong, Di; Liang, Changhong; Xie, Jiajun; Tian, Jie; Liu, Zaiyi

2017-06-01

To evaluate the value of CT-based radiomics signature for differentiating Borrmann type IV gastric cancer (GC) from primary gastric lymphoma (PGL). 40 patients with Borrmann type IV GC and 30 patients with PGL were retrospectively recruited. 485 radiomics features were extracted and selected from the portal venous CT images to build a radiomics signature. Subjective CT findings, including gastric wall peristalsis, perigastric fat infiltration, lymphadenopathy below the renal hila and enhancement pattern, were assessed to construct a subjective findings model. The radiomics signature, subjective CT findings, age and gender were integrated into a combined model by multivariate analysis. The diagnostic performance of these three models was assessed with receiver operating characteristics curves (ROC) and were compared using DeLong test. The subjective findings model, the radiomics signature and the combined model showed a diagnostic accuracy of 81.43% (AUC [area under the curve], 0.806; 95% CI [confidence interval]: 0.696-0.917; sensitivity, 63.33%; specificity, 95.00%), 84.29% (AUC, 0.886 [95% CI: 0.809-0.963]; sensitivity, 86.67%; specificity, 82.50%), 87.14% (AUC, 0.903 [95%CI: 0.831-0.975]; sensitivity, 70.00%; specificity, 100%), respectively. There were no significant differences in AUC among these three models (P=0.051-0.422). Radiomics analysis has the potential to accurately differentiate Borrmann type IV GC from PGL. Copyright © 2017 Elsevier B.V. All rights reserved.

Shifts in the Clonal Distribution of Methicillin-Resistant Staphylococcus aureus in Kuwait Hospitals: 1992-2010

PubMed Central

Boswihi, Samar S.; Udo, Edet E.; Al-Sweih, Noura

2016-01-01

Background As the epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) is constantly changing globally, determining the prevailing MRSA clones in a local healthcare facility is important for better management of infections. This study investigated clonal composition and distribution of MRSA isolates in Kuwait’s hospitals using a combination of molecular typing methods. Materials and Methods In total, 400 non-repeat MRSA isolates were obtained between 1992 and 2010 in 13 public hospitals and were characterized using antibiogram, SCCmec typing, spa typing, and multilocus-sequence typing. Clonal assignment and detection of virulence factors and antibiotic resistance genes were performed by DNA microarray. Results The isolates were resistant to kanamycin (74.2%), erythromycin (69.5%), tetracycline (66.7%), gentamicin (61%), ciprofloxacin, (61%), fusidic acid (53.5%), clindamycin (41.5%), high-level mupirocin resistance (5.2%) and carried aphA3, aacA-aphD, ermA, ermC, mupA, tetK, tetM, fusC and far1. Molecular typing revealed 31 different MRSA clones consisting of ST239-MRSA-III (52.2%), ST22-MRSA-IV (9.2%), ST80-MRSA-IV (7.5%), ST5-MRSA-II/IV/V/VI (6.5%), ST30-MRSA-IV (3.5%), ST241-MRSA-III (2.7%), ST6-MRSA-IV (2.2%), ST36-MRSA-II (2%) and ST772-MRSA-V (1.75%). The isolates differed in the carriage of genes for enterotoxins, Panton–Valentine leukocidin (PVL), toxic shock syndrome toxin (tst-1), arginine catabolic mobile element (ACME) and exfoliative toxins. The number of clones increased from one (ST239-III-t037) in 1992 to 30 in 2010 including ST8-IV-t008 [PVL+] [ACME+] (USA300), ST772-V (Bengal Bay clone) and ST2816 identified for the first time in Kuwait. Conclusion The study revealed that the MRSA isolates belonged to diverse clones that changed in numbers and diversity overtime. Although ST239-MRSA-III, a healthcare-associated clone remained the dominant MRSA clone overtime, the newly emerged clones consisted mostly of community-associated. PMID:27631623

Secretion of TcpF by the Vibrio cholerae Toxin-Coregulated Pilus Biogenesis Apparatus Requires an N-Terminal Determinant

PubMed Central

Megli, Christina J.

2013-01-01

Type IV pili are important for microcolony formation, biofilm formation, twitching motility, and attachment. We and others have shown that type IV pili are important for protein secretion across the outer membrane, similar to type II secretion systems. This study explored the relationship between protein secretion and pilus formation in Vibrio cholerae. The toxin-coregulated pilus (TCP), a type IV pilus required for V. cholerae pathogenesis, is necessary for the secretion of the colonization factor TcpF (T. J. Kirn, N. Bose, and R. K. Taylor, Mol. Microbiol. 49:81–92, 2003). This phenomenon is not unique to V. cholerae; secreted virulence factors that are dependent on the presence of components of the type IV pilus biogenesis apparatus for secretion have been reported with Dichelobacter nodosus (R. M. Kennan, O. P. Dhungyel, R. J. Whittington, J. R. Egerton, and J. I. Rood, J. Bacteriol. 183:4451–4458, 2001) and Francisella tularensis (A. J. Hager et al., Mol. Microbiol. 62:227–237, 2006). Using site-directed mutagenesis, we demonstrated that the secretion of TcpF is dependent on the presence of selected amino acid R groups at position five. We were unable to find other secretion determinants, suggesting that Y5 is the major secretion determinant within TcpF. We also report that proteins secreted in a type IV pilus biogenesis apparatus-dependent manner have a YXS motif within the first 15 amino acids following the Sec cleavage site. The YXS motif is not present in proteins secreted by type II secretion systems, indicating that this is unique to type IV pilus-mediated secretion. Moreover, we show that TcpF interacts with the pilin TcpA, suggesting that these proteins are secreted by the type IV pilus biogenesis system. These data provide a starting point for understanding how type IV pili can mediate secretion of virulence factors important for bacterial pathogenesis. PMID:23564177

Chronic administration of DSP-7238, a novel, potent, specific and substrate-selective DPP IV inhibitor, improves glycaemic control and beta-cell damage in diabetic mice.

PubMed

Furuta, Y; Horiguchi, M; Sugaru, E; Ono-Kishino, M; Otani, M; Sakai, M; Masui, Y; Tsuchida, A; Sato, Y; Takubo, K; Hochigai, H; Kimura, H; Nakahira, H; Nakagawa, T; Taiji, M

2010-05-01

The purpose of this study is to assess the in vitro enzyme inhibition profile of DSP-7238, a novel non-cyanopyrrolidine dipeptidyl peptidase (DPP) IV inhibitor and to evaluate the acute and chronic effects of this compound on glucose metabolism in two different mouse models of type 2 diabetes. The in vitro enzyme inhibition profile of DSP-7238 was assessed using plasma and recombinant enzymes including DPP IV, DPP II, DPP8, DPP9 and fibroblast activation protein alpha (FAPalpha) with fluorogenic substrates. The inhibition type was evaluated based on the Lineweaver-Burk plot. Substrate selectivity of DSP-7238 and comparator DPP IV inhibitors (vildagliptin, sitagliptin, saxagliptin and linagliptin) was evaluated by mass spectrometry based on the changes in molecular weight of peptide substrates caused by release of N-terminal dipeptides. In the in vivo experiments, high-fat diet-induced obese (DIO) mice were subjected to oral glucose tolerance test (OGTT) following a single oral administration of DSP-7238. To assess the chronic effects of DSP-7238 on glycaemic control and pancreatic beta-cell damage, DSP-7238 was administered for 11 weeks to mice made diabetic by a combination of high-fat diet (HFD) and a low-dose of streptozotocin (STZ). After the dosing period, HbA1c was measured and pancreatic damage was evaluated by biological and histological analyses. DSP-7238 and sitagliptin both competitively inhibited recombinant human DPP IV (rhDPP IV) with K(i) values of 0.60 and 2.1 nM respectively. Neither vildagliptin nor saxagliptin exhibited competitive inhibition of rhDPP IV. DSP-7238 did not inhibit DPP IV-related enzymes including DPP8, DPP9, DPP II and FAPalpha, whereas vildagliptin and saxagliptin showed inhibition of DPP8 and DPP9. Inhibition of glucagon-like peptide-1 (GLP-1) degradation by DSP-7238 was apparently more potent than its inhibition of chemokine (C-X-C motif) ligand 10 (IP-10) or chemokine (C-X-C motif) ligand 12 (SDF-1alpha) degradation. In contrast, vildagliptin and saxagliptin showed similar degree of inhibition of degradation for all the substrates tested. Compared to treatment with the vehicle, single oral administration of DSP-7238 dose-dependently decreased plasma DPP IV activity and improved glucose tolerance in DIO mice. In addition, DSP-7238 significantly decreased HbA1c and ameliorated pancreatic damage following 11 weeks of chronic treatment in HFD/STZ mice. We have shown in this study that DSP-7238 is a potent DPP IV inhibitor that has high specificity for DPP IV and substrate selectivity against GLP-1. We have also found that chronic treatment with DSP-7238 improves glycaemic control and ameliorates beta-cell damage in a mouse model with impaired insulin sensitivity and secretion. These findings indicate that DSP-7238 may be a new therapeutic agent for the treatment of type 2 diabetes.

Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na +/K+/2Cl- cotransporter and CFTR anion channel

USGS Publications Warehouse

Hiroi, J.; McCormick, S.D.; Ohtani-Kaneko, R.; Kaneko, T.

2005-01-01

Mozambique tilapia Oreochromis mossambicus embryos were transferred from freshwater to seawater and vice versa, and short-term changes in the localization of three major ion transport proteins, Na+/K +-ATPase, Na+/K+/2Cl- cotransporter (NKCC) and cystic fibrosis transmembrane conductance regulator (CFTR) were examined within mitochondrion-rich cells (MRCs) in the embryonic yolk-sac membrane. Triple-color immunofluorescence staining allowed us to classify MRCs into four types: type I, showing only basolateral Na+/K +-ATPase staining; type II, basolateral Na+/K +-ATPase and apical NKCC; type III, basolateral Na+/K +-ATPase and basolateral NKCC; type IV, basolateral Na +/K+-ATPase, basolateral NKCC and apical CFTR. In freshwater, type-I, type-II and type-III cells were observed. Following transfer from freshwater to seawater, type-IV cells appeared at 12 h and showed a remarkable increase in number between 24 h and 48 h, whereas type-III cells disappeared. When transferred from seawater back to freshwater, type-IV cells decreased and disappeared at 48 h, type-III cells increased, and type-II cells, which were not found in seawater, appeared at 12 h and increased in number thereafter. Type-I cells existed consistently irrespective of salinity changes. These results suggest that type I is an immature MRC, type II is a freshwater-type ion absorptive cell, type III is a dormant type-IV cell and/or an ion absorptive cell (with a different mechanism from type II), and type IV is a seawater-type ion secretory cell. The intracellular localization of the three ion transport proteins in type-IV cells is completely consistent with a widely accepted model for ion secretion by MRCs. A new model for ion absorption is proposed based on type-II cells possessing apical NKCC.

Software Development for Automation of Space- and Time- Varying Pressurization on Small Caliber Gun Barrels

DTIC Science & Technology

2007-08-01

PAGE Form Approved OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response, including...PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1 . REPORT DATE (DD-MM-YYYY) August 2007 2. REPORT TYPE Final 3. DATES COVERED (From...Z39.18 iii Contents List of Figures iv List of Tables iv Acknowledgments v 1 . Introduction 1 2. Functional Requirements and Use Cases 2 3

Modulation of type I immediate and type IV delayed immunoreactivity using direct suggestion and guided imagery during hypnosis.

PubMed

Zachariae, R; Bjerring, P; Arendt-Nielsen, L

1989-11-01

Cutaneous reactivity against histamine skin prick test (Type I) and purified tuberculin protein derivative (Mantoux reaction, Type IV) was studied in eight volunteers under hypnosis. Types I and IV immunoreactivity were modulated by direct suggestion (Type I) and guided imagery (Type IV). The volunteers were highly susceptible subjects, selected by means of the Harvard Group Scale of Hypnotic Susceptibility, Form A. When the volunteers underwent hypnotic suggestion to decrease the cutaneous reaction to histamine prick test, a significant (P less than 0.02) reduction of the flare reaction (area of erythema) was observed compared with control histamine skin prick tests. The wheal reaction did not respond to hypnotic suggestion. Neither wheal nor flare reaction could be increased in size by hypnotic suggestion compared with control histamine skin prick tests. A hypnotic suggestion of increasing the Type IV reaction on one arm and decreasing the reaction on the other revealed a significant difference in both erythema size (P less than 0.02) and palpable induration (P less than 0.01). In two cases the reactions were monitored by laser doppler blood flowmetry and skin thickness measurement by ultrasound. The difference between the suggested increased and decreased reaction was 19% for the laser doppler bloodflow (in favor of the augmented side), and 44% for the dermal infiltrate thickness. This study objectively supports the numerous uncontrolled case reports of modulation of immunoreactivity in allergic diseases involving both Type I and Type IV skin reactions following hypnotic suggestions.

Amplified QCM biosensor for type IV collagenase based on collagenase-cleavage of gold nanoparticles functionalized peptide.

PubMed

Dong, Zong-Mu; Jin, Xin; Zhao, Guang-Chao

2018-05-30

The present study develops a rapid, simple and efficient method for the determination of type IV collagenase by using a specific peptide-modified quartz crystal microbalance (QCM). A small peptide (P1), contains a specific sequence (Pro-Gly) and a terminal cysteine, was synthetized and immobilized to the surface of QCM electrode via the reaction between Au and thiol of the cysteine. The peptide bond between proline and glycine can be specific hydrolyzed cleavage by type IV collagenase, which enabled the modified electrode with a high selectivity toward type IV collagenase. The cleaving process caused a frequency change of QCM to give a signal related to the concentration of type IV collagenase. The morphologies of the modified electrodes were characterized by scanning electron microscope (SEM) and the specific hydrolyzed cleavage process was monitored by QCM. When P1 was modified with gold nanoparticles (P1-Au NPs), the signal could be amplified to further enhance the sensitivity of the designed sensor due to the high-mass of the modified Au NPs. Compared the direct unamplified assay, the values obtained for the limit of detection for type IV collagenase was 0.96 ng mL -1 , yielding about 6.5 times of magnitude improvement in sensitivity. This signal enhanced peptide based QCM biosensor for type IV collagenase also showed good selectivity and sensitivity in complex matrix. Copyright © 2018 Elsevier B.V. All rights reserved.

46 CFR 197.340 - Breathing gas supply.

Code of Federal Regulations, 2010 CFR

2010-10-01

...-925a; and (2) Be type 1 (gaseous) grade A or B. (g) Nitrogen used for breathing mixtures must— (1) Meet... per cubic meter of solid and liquid particulates including oil; and (iv) 25 parts per million of...

The variable presentations of glycogen storage disease type IV: a review of clinical, enzymatic and molecular studies.

PubMed

Moses, Shimon W; Parvari, Ruti

2002-03-01

Glycogen storage disease type IV (GSD-IV), also known as Andersen disease or amylopectinosis (MIM 23250), is a rare autosomal recessive disorder caused by a deficiency of glycogen branching enzyme (GBE) leading to the accumulation of amylopectin-like structures in affected tissues. The disease is extremely heterogeneous in terms of tissue involvement, age of onset and clinical manifestations. The human GBE cDNA is approximately 3-kb in length and encodes a 702-amino acid protein. The GBE amino acid sequence shows a high degree of conservation throughout species. The human GBE gene is located on chromosome 3p14 and consists of 16 exons spanning at least 118 kb of chromosomal DNA. Clinically the classic Andersen disease is a rapidly progressive disorder leading to terminal liver failure unless liver transplantation is performed. Several mutations have been reported in the GBE gene in patients with classic phenotype. Mutations in the GBE gene have also been identified in patients with the milder non-progressive hepatic form of the disease. Several other variants of GSD-IV have been reported: a variant with multi-system involvement including skeletal and cardiac muscle, nerve and liver; a juvenile polysaccharidosis with multi-system involvement but normal GBE activity; and the fatal neonatal neuromuscular form associated with a splice site mutation in the GBE gene. Other presentations include cardiomyopathy, arthrogryposis and even hydrops fetalis. Polyglucosan body disease, characterized by widespread upper and lower motor neuron lesions, can present with or without GBE deficiency indicating that different biochemical defects could result in an identical phenotype. It is evident that this disease exists in multiple forms with enzymatic and molecular heterogeneity unparalleled in the other types of glycogen storage diseases.

Uranium(IV) adsorption by natural organic matter in anoxic sediments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bone, Sharon E.; Dynes, James J.; Cliff, John

2017-01-09

Uranium is an important fuel source and a global environmental contaminant. It accumulates in the tetravalent state, U(IV), in anoxic sediments, including ore deposits, marine basins, and contaminated aquifers. However, very little is known about the speciation of U(IV) in low temperature geochemical environments, inhibiting the development of a conceptual model of U behavior. Until recently, U(IV) was assumed to exist predominantly as the sparingly soluble mineral uraninite (UO 2) in anoxic sediments; yet studies now show that UO 2 is not often dominant in these environments. However, a model of U(IV) speciation under environmentally relevant conditions has not yetmore » been developed. Here we show that complexes of U(IV) adsorb on organic carbon and organic carbon-coated clays in an organic-rich natural substrate under field-relevant conditions. Whereas previous research assumed that the U(IV) product depended on the reduction pathway, our results demonstrate that UO 2 formation can be inhibited simply by decreasing the U:solid ratio. Thus, it is the number and type of surface ligands that controls U(IV) speciation subsequent to U(VI) reduction. Projections of U transport and bioavailability, and thus its threat to human and ecosystem health, must consider retention of U(IV) ions within the local sediment environment.« less

Bowel perforation in type IV vascular Ehlers-Danlos syndrome. A systematic review.

PubMed

El Masri, H; Loong, T-H; Meurette, G; Podevin, J; Zinzindohoue, F; Lehur, P-A

2018-05-01

Spontaneous gastrointestinal (GI) perforation is a well-known complication occurring in patients suffering from Type IV vascular Ehlers-Danlos syndrome (EDS IV). The aim of the present study was to review the current literature on spontaneous GI perforation in EDS IV and illustrate the surgical management and outcome when possible. A systematic review of all the published data on EDS IV patients with spontaneous GI perforation between January 2000 and December 2015 was conducted using three major databases PUBMED, EMBASE, and Cochrane Central Register of Controlled Trails. References of the selected articles were screened to avoid missing main articles. Twenty-seven published case reports and four retrospective studies, including 31 and 527 cases, respectively, matched the search criteria. A case from our institution was added. Mean age was 26 years (range 6-64 years). The most frequent site of perforation was the colon, particularly the sigmoid, followed by small bowel, upper rectum, and finally stomach. The majority of cases were initially managed with Hartmann's procedure. In recurrent perforations, total colectomy was performed. The reperforation rate was considerably higher in the "partial colectomy with anastomosis" group than in the Hartmann group. Colonic perforation is the most common spontaneous GI perforation in EDS IV patients. An unexpected fragility of the tissues should raise the possibility of a connective tissue disorder and prompt further investigation with eventual management of these high-risk patients with a multidisciplinary team approach in dedicated centres. In the emergency setting, a Hartmann procedure should be performed.

A retrospective chart review to assess the safety of nonablative fractional laser resurfacing in Fitzpatrick skin types IV to VI.

PubMed

Clark, Charlotte M; Silverberg, Jonathan I; Alexis, Andrew F

2013-04-01

Laser resurfacing in patients with Fitzpatrick skin phototypes (SPT) IV to VI is associated with a higher risk of pigmentary alteration. There is a paucity of studies evaluating optimum treatment parameters for fractional lasers in darkly pigmented skin types. This is a retrospective review of medical records for patients with SPT IV to VI who were treated with a 1,550 nm erbium-doped fractional nonablative laser (Fraxel Re:Store SR 1550; Solta Medical, Hayword, CA). Data were collected from patient charts and the clinic laser logbook from January 2008 to January 2012. The frequency of treatment-associated postinflammatory hyperpigmentation (PIH) and treatment settings used were evaluated. A total of 115 total laser sessions (45 patients) were included in our analysis. Five of the sessions (4%) were accompanied by PIH, 2 of which occurred in a single patient. Only 1 episode of PIH lasted longer than 1 month (2 months). Two of the 5 cases had only transient PIH (≤7 days), one of which was reported by the patient and not clinically evident on examination. The 1,550 nm erbium-doped fractional laser is well tolerated in SPT IV to VI. Fractional laser resurfacing, with the settings used and pretreatment and posttreatment hydroquinone 4% cream, was associated with a low risk of PIH in darker skin types.

Fine typing of methicillin-resistant Staphylococcus aureus isolates using direct repeat unit and staphylococcal interspersed repeat unit typing methods.

PubMed

Ho, Cheng-Mao; Ho, Mao-Wang; Li, Chi-Yuan; Lu, Jang-Jih

2015-08-01

Methicillin-resistant Staphylococcus aureus (MRSA) typing is an important epidemiologic tool for monitoring trends and preventing outbreaks. However, the efficiency of various MRSA typing methods for each SCCmec MRSA isolate is rarely evaluated. A total of 157 MRSA isolates from four different regions in Taiwan were typed with five different molecular methods, including SCCmec typing, multilocus sequence typing (MLST), spa typing, mec-associated direct repeat unit (dru) copy number determination, and staphylococcal interspersed repeat unit (SIRU) profiling. There were four SCCmec types, eight MLST types, 15 spa types, 11 dru types, and 31 SIRU profiles. The most common type determined by each molecular typing method was SCCmec III (115 isolates, 73.2%), ST239 (99 isolates, 63.1%), t037 (107 isolates, 68.2%), 14 dru copies (76 isolates, 48.4%), and SIRU profile 3013722 (102 isolates, 65%), respectively. When using the combination of MLST, spa typing, and dru copy number, ST5-t002-4 (n = 8), ST239-t037-14 (n = 68), ST59-t437-9 (n = 9), and ST59-t437-11 (n = 6) were found to be the most common types of SCCmec types II (n = 9), III (n = 115), IV (n = 21), and VT (n = 11) isolates, respectively. SCCmec type III isolates were further classified into 11 dru types. Of the 21 SCCmec type IV isolates, 14 SIRU profiles were found. Seven SIRU patterns were observed in the 11 SCCmec type VT isolates. Different typing methods showed a similar Hunter-Gaston discrimination index among the 157 MRSA isolates. However, dru and SIRU typing methods had a better discriminatory power for SCCmec type III and SCCmec types IV and VT isolates, respectively, suggesting that dru and SIRU can be used to further type these isolates. Copyright © 2013. Published by Elsevier B.V.

Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

PubMed

Gulubova, M V

1996-07-01

Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

Oxygen microprofile in the prepared sediments and its implication for the sediment oxygen consuming process in a heavily polluted river of China.

PubMed

Wang, Chao; Zhai, Wanying; Shan, Baoqing

2016-05-01

Dissolved oxygen (DO) microprofiles of prepared sediments from 24 sampling sites in the Fuyang River were measured using a gold amalgam microelectrode in this study. The measured microprofiles can be divided into four types. In type I profiles, DO kept constant in the overlying water and decreased smoothly in the pore water; in type II profile, DO showed fluctuation in the pore water; in type III profiles, DO showed peak in the SWI; in type IV profiles, DO decreased obviously in the overlying water. Type I profiles indicated the absence of benthic organisms and thus the degradation of the sediment habitat. Type II and III profiles indicated the activity of benthic animal and epipelic algae, which is common in the healthy aquatic sediment. Type IV profiles indicated that the excessive accumulation of pollutants in the sediment and thus the serious sediment pollution. There are nine sites showing type I profile, three sites showing type II profile, nine sites showing type III profile, and three sites showing type IV profile in the Fuyang River. The dominance of type I and appearance of type IV indicated that sediment oxygen consumption processes in the Fuyang River were strongly influenced by the sediment pollutants release and the vanish of benthic organisms. The pharmacy, metallurgy, and curriery industries may contribute to the sediment deterioration and thus to the occurrence of type I and type IV oxygen profiles in the Fuyang River.

The Preliminary Study on Procurement Biliary Convergence from Donors with Complicated Bile Duct Variant in Emergency Right Lobe Living Donor Liver Transplantation.

PubMed

Ye, Sheng; Dong, Jia-Hong; Duan, Wei-Dong; Ji, Wen-Bing; Liang, Yu-Rong

2017-03-01

The incidence of biliary complications after living donor adult liver transplantation (LDALT) is still high due to the bile duct variation and necessity reconstruction of multiple small bile ducts. The current surgical management of the biliary variants is unsatisfactory. We evaluated the role of a new surgical approach in a complicated hilar bile duct variant (Nakamura type IV and Nakamura type II) under emergent right lobe LDALT for high model for end-stage liver disease score patients. The common hepatic duct (CHD) and the left hepatic duct (LHD) of the donor were transected in a right-graft including short common trunks with right posterior and anterior bile ducts, whereas the LHD of the donor was anastomosed to the CHD and the common trunks of a right-graft bile duct and the recipient CHD was end-to-end anastomosed. Ten of 13 grafts (Nakamura types II, III, and IV) had two or more biliary orifices after right graft lobectomy; seven patients had biliary complications (53.8%). Later, the surgical innovation was carried out in five donors with variant bile duct (four Nakamura type IV and one type II), and, consequently, no biliary or other complications were observed in donors and recipients during 47-53 months of follow-up; significant differences ( P  < 0.05) were found when two stages were compared. Our initial experience suggests that, in the urgent condition of LDALT when an alternative live donor was unavailable, a surgical innovation of cutting part of the CHD trunks including variant right hepatic ducts in a complicated donor bile duct variant may facilitate biliary reconstruction and reduce long-term biliary complications.

Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome

PubMed Central

Kim, Jeong Gyun; Cho, Won-Sang; Kim, Jeong Eun

2014-01-01

Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure. PMID:24653803

Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome.

PubMed

Kim, Jeong Gyun; Cho, Won-Sang; Kang, Hyun-Seung; Kim, Jeong Eun

2014-02-01

Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure.

A new system for cultivation of human keratinocytes on acellular dermal matrix substitute with the use of human fibroblast feeder layer.

PubMed

Xiao, S; Zhu, S; Ma, B; Xia, Z-F; Yang, J; Wang, G

2008-01-01

To improve the proliferative potential of human keratinocytes (HK) cultured on acellular dermal matrix (ADM), HK and mitomycin C-treated human fibroblasts (MMC-HF) were seeded onto ADM to form four types of composite skin: type I, HK were seeded onto the epidermal side of ADM; type II, both HK and MMC-HF were seeded onto the epidermal side; type III, MMC-HF were preseeded onto the dermal side of ADM, and then HK were seeded onto the epidermal side, and type IV, where MMC-HF were preseeded onto both sides, and then HK were seeded onto the epidermal side. Compared with type I and III, the proliferative potential of HK of type II and IV was significantly higher on day 3, 5, 7 and 9 in vitro. In type I and III, HK grew into one layer on day 7-9, while in type II and IV keratinocytes grew into a confluent monolayer by day 4-6. The adherence to ADM of HK in types II and IV was stronger than that in type I and III. The take rate of type II and IV composite skin was also significantly higher. In conclusion, when MMC-HF and HK were cocultured on the epidermal side of ADM, MMC-HF could serve as excellent feeder cells. Copyright 2007 S. Karger AG, Basel.

9 CFR 381.167 - Other poultry dishes and specialty items.

Code of Federal Regulations, 2013 CFR

2013-01-01

..., irrespective of the type of packaging, and the percentages in Table IV shall be calculated on a ready-to-serve...) with rice or similar starches. 3 The 25 percent-standard listed includes poultry meat plus proportions...

9 CFR 381.167 - Other poultry dishes and specialty items.

Code of Federal Regulations, 2014 CFR

2014-01-01

..., irrespective of the type of packaging, and the percentages in Table IV shall be calculated on a ready-to-serve...) with rice or similar starches. 3 The 25 percent-standard listed includes poultry meat plus proportions...

9 CFR 381.167 - Other poultry dishes and specialty items.

Code of Federal Regulations, 2012 CFR

2012-01-01

..., irrespective of the type of packaging, and the percentages in Table IV shall be calculated on a ready-to-serve...) with rice or similar starches. 3 The 25 percent-standard listed includes poultry meat plus proportions...

Ultraviolet properties of IRAS-selected Be stars

NASA Technical Reports Server (NTRS)

Bjorkman, Karen S.; Snow, Theodore P.

1988-01-01

New IUE observations were obtained of 35 Be stars from a list of stars which show excess infrared fluxes in IRAS data. The IRAS-selected Be stars show larger C IV and Si IV equivalent widths than other Be stars. Excess C IV and Si IV absorption seems to be independent of spectral type for IRAS-selected Be stars later than spectral type B4. This is interpreted as evidence for a possible second mechanism acting in conjunction with radiation pressure for producing the winds in Be stars. No clear correlation of IR excess of v sin i with C IV or Si IV equivalent widths is seen, although a threshold for the occurrence of excess C IV and Si IV absorption appears at a v sin i of 150 km/sec.

Genetics Home Reference: congenital insensitivity to pain with anhidrosis

MedlinePlus

... is also known as hereditary sensory and autonomic neuropathy type IV. The signs and symptoms of CIPA ... to pain with anhidrosis hereditary sensory and autonomic neuropathy type IV hereditary sensory and autonomic neuropathy, type ...

Collagen type IV at the fetal-maternal interface.

PubMed

Oefner, C M; Sharkey, A; Gardner, L; Critchley, H; Oyen, M; Moffett, A

2015-01-01

Extracellular matrix proteins play a crucial role in influencing the invasion of trophoblast cells. However the role of collagens and collagen type IV (col-IV) in particular at the implantation site is not clear. Immunohistochemistry was used to determine the distribution of collagen types I, III, IV and VI in endometrium and decidua during the menstrual cycle and the first trimester of pregnancy. Expression of col-IV alpha chains during the reproductive cycle was determined by qPCR and protein localisation by immunohistochemistry. The structure of col-IV in placenta was examined using transmission electron microscopy. Finally, the expression of col-IV alpha chain NC1 domains and collagen receptors was localised by immunohistochemistry. Col-IV alpha chains were selectively up-regulated during the menstrual cycle and decidualisation. Primary extravillous trophoblast cells express collagen receptors and secrete col-IV in vitro and in vivo, resulting in the increased levels found in decidua basalis compared to decidua parietalis. A novel expression pattern of col-IV in the mesenchyme of placental villi, as a three-dimensional network, was found. NC1 domains of col-IV alpha chains are known to regulate tumour cell migration and the selective expression of these domains in decidua basalis compared to decidua parietalis was determined. Col-IV is expressed as novel forms in the placenta. These findings suggest that col-IV not only represents a structural protein providing tissue integrity but also influences the invasive behaviour of trophoblast cells at the implantation site. Copyright © 2014 Elsevier Ltd. All rights reserved.

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2012 CFR

2012-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2013 CFR

2013-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2014 CFR

2014-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

Code of Federal Regulations, 2011 CFR

2011-01-01

...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

On the Directivity of Low-Frequency Type IV Radio Bursts

NASA Technical Reports Server (NTRS)

Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.

2016-01-01

An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.

Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

PubMed

Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

2012-06-01

Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

Clinical outcome in women with HER2-positive de novo or recurring stage IV breast cancer receiving trastuzumab-based therapy.

PubMed

Rossi, Valentina; Nolè, Franco; Redana, Stefania; Adamoli, Laura; Martinello, Rossella; Aurilio, Gaetano; Verri, Elena; Sapino, Anna; Viale, Giuseppe; Aglietta, Massimo; Montemurro, Filippo

2014-02-01

Five to 10% of women with newly diagnosed breast cancer have synchronous metastases (de novo stage IV). A further 20% will develop metastases during follow-up (recurring stage IV). We compared the clinical outcomes of women with HER2-positive metastatic breast cancer (MBC) receiving first-line trastuzumab-based therapy according to type of metastatic presentation. Retrospective analysis of 331 MBC patients receiving first-line trastuzumab-based treatment. Response rates (RR) were compared by the chi-square test. Time-to progression (TTP) and overall survival (OS) curves were compared by the log-rank test. Cox-proportional hazards models were used to study predictors of PFS and OS, including the type of metastatic presentation. Seventy-seven patients (23%) had de novo stage IV disease. Forty-six of these patients underwent surgery of the primary ("de novo/surgery"). Response rates to first-line trastuzumab-based therapy and median progression-free survival did not differ in patients with "recurring", "de novo/surgery" and "de novo" without surgery ("de novo/no surgery) stage IV breast cancer. However, women with "de novo/surgery" stage IV breast cancer had the longest median OS (60 months), and those with "de novo/no surgery" stage IV breast cancer the shortest (26 months). For women with recurring metastatic breast cancer median OS was 40 months (overall log-rank test, p < 0.01). Multivariate analysis confirmed these findings. Our analysis shows that response rates and PFS to first-line trastuzumab-based therapy do not differ significantly between de novo and recurring stage IV, HER2 positive breast cancer. The observed difference in OS favoring women with de novo stage IV disease submitted to surgery of the primary tumor could be the result of a selection bias. Copyright © 2013 Elsevier Ltd. All rights reserved.

Serum Levels of Soluble CD26/Dipeptidyl Peptidase-IV in Type 2 Diabetes Mellitus and Its Association with Metabolic Syndrome and Therapy with Antidiabetic Agents in Malaysian Subjects.

PubMed

Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Muniandy, Sekaran

2015-01-01

A soluble form of CD26/dipeptidyl peptidase-IV (sCD26/DPP-IV) induces DPP-IV enzymatic activity that degrades incretin. We investigated fasting serum levels of sCD26/DPP-IV and active glucagon-like peptide-1 (GLP-1) in Malaysian patients with type 2 diabetes mellitus (T2DM) with and without metabolic syndrome (MetS), as well as the associations between sCD26/DPP-IV levels, MetS, and antidiabetic therapy. We assessed sCD26/DPP-IV levels, active GLP-1 levels, body mass index (BMI), glucose, insulin, A1c, glucose homeostasis indices, and lipid profiles in 549 Malaysian subjects (including 257 T2DM patients with MetS, 57 T2DM patients without MetS, 71 non-diabetics with MetS, and 164 control subjects without diabetes or metabolic syndrome). Fasting serum levels of sCD26/DPP-IV were significantly higher in T2DM patients with and without MetS than in normal subjects. Likewise, sCD26/DPP-IV levels were significantly higher in patients with T2DM and MetS than in non-diabetic patients with MetS. However, active GLP-1 levels were significantly lower in T2DM patients both with and without MetS than in normal subjects. In T2DM subjects, sCD26/DPP-IV levels were associated with significantly higher A1c levels, but were significantly lower in patients using monotherapy with metformin. In addition, no significant differences in sCD26/DPP-IV levels were found between diabetic subjects with and without MetS. Furthermore, sCD26/DPP-IV levels were negatively correlated with active GLP-1 levels in T2DM patients both with and without MetS. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-cholesterol (LDL-c) levels. Serum sCD26/DPP-IV levels increased in T2DM subjects with and without MetS. Active GLP-1 levels decreased in T2DM patients both with and without MetS. In addition, sCD26/DPP-IV levels were associated with Alc levels and negatively correlated with active GLP-1 levels. Moreover, metformin monotherapy was associated with reduced sCD26/DPP-IV levels. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-c.

Management of Mirizzi Syndrome in Emergency.

PubMed

Testini, Mario; Sgaramella, Lucia Ilaria; De Luca, Giuseppe Massimiliano; Pasculli, Alessandro; Gurrado, Angela; Biondi, Antonio; Piccinni, Giuseppe

2017-01-01

Mirizzi syndrome (MS) is a rare complication of cholelithiasis. Despite the success of laparoscopic cholecystectomy as a minimally invasive approach to gallstone disease, MS remains a challenge, also for open and robotic approaches, due to the subverted anatomy of the hepatocystic triangle. Moreover, when emergency surgery is needed, the optimal preoperative diagnostic assessment could not be always achievable. We aim to analyze our experience of MS treated in emergency and to assess the feasibility of a diagnostic and therapeutic decisional algorithm. From March 2006 to February 2016, all patients with a preoperative diagnosis, or an intraoperative evidence of MS, were retrospectively analyzed at our Academic Hospital, including patients operated on in emergency or in deferred urgency. Eighteen patients were included in the study using exclusion criteria and were treated in elective surgery. The patients were distributed according to modified Csendes' classification: type I in 15 cases, type II in 2, type III in 0, type IV in 1, and type V in 0. In the type I group, diagnosis was intraoperatively performed. Laparoscopic approach was performed with cholecystectomy or subtotal cholecystectomy, when the hepatocystic triangle dissection was hazardous. Patients with preoperative diagnosis of acute abdomen and MS type IV were directly managed by open approach. Diagnosis of MS and the therapeutic management of MS are still a challenge, mostly in an emergency setting. Waiting for standardized guidelines, we propose a decisional algorithm in emergency, especially in nonspecialized centeres of hepatobiliary surgery.

Genome-Enabled Studies of Anaerobic, Nitrate-Dependent Iron Oxidation in the Chemolithoautotrophic Bacterium Thiobacillus denitrificans

NASA Astrophysics Data System (ADS)

Beller, H. R.; Zhou, P.; Legler, T. C.; Chakicherla, A.; O'Day, P. A.

2013-12-01

Thiobacillus denitrificans is a chemolithoautotrophic bacterium capable of anaerobic, nitrate-dependent U(IV) and Fe(II) oxidation, both of which can strongly influence the long-term efficacy of in situ reductive immobilization of uranium in contaminated aquifers. We previously identified two c-type cytochromes involved in nitrate-dependent U(IV) oxidation in T. denitrificans and hypothesized that c-type cytochromes would also catalyze Fe(II) oxidation, as they have been found to play this role in anaerobic phototrophic Fe(II)-oxidizing bacteria. Here we report on efforts to identify genes associated with nitrate-dependent Fe(II) oxidation, namely (a) whole-genome transcriptional studies [using FeCO3, Fe2+, and U(IV) oxides as electron donors under denitrifying conditions], (b) Fe(II) oxidation assays performed with knockout mutants targeting primarily highly expressed or upregulated c-type cytochromes, and (c) random transposon-mutagenesis studies with screening for Fe(II) oxidation. Assays of mutants for 26 target genes, most of which were c-type cytochromes, indicated that none of the mutants tested were significantly defective in nitrate-dependent Fe(II) oxidation. The non-defective mutants included the c1-cytochrome subunit of the cytochrome bc1 complex (complex III), which has relevance to a previously proposed role for this complex in nitrate-dependent Fe(II) oxidation and to current concepts of reverse electron transfer. Of the transposon mutants defective in Fe(II) oxidation, one mutant with a disrupted gene associated with NADH:ubiquinone oxidoreductase (complex I) was ~35% defective relative to the wild-type strain; this strain was similarly defective in nitrate reduction with thiosulfate as the electron donor. Overall, our results indicate that nitrate-dependent Fe(II) oxidation in T. denitrificans is not catalyzed by the same c-type cytochromes involved in U(IV) oxidation, nor have other c-type cytochromes yet been implicated in the process.

Genome-enabled studies of anaerobic, nitrate-dependent iron oxidation in the chemolithoautotrophic bacterium Thiobacillus denitrificans

PubMed Central

Beller, Harry R.; Zhou, Peng; Legler, Tina C.; Chakicherla, Anu; Kane, Staci; Letain, Tracy E.; A. O’Day, Peggy

2013-01-01

Thiobacillus denitrificans is a chemolithoautotrophic bacterium capable of anaerobic, nitrate-dependent U(IV) and Fe(II) oxidation, both of which can strongly influence the long-term efficacy of in situ reductive immobilization of uranium in contaminated aquifers. We previously identified two c-type cytochromes involved in nitrate-dependent U(IV) oxidation in T. denitrificans and hypothesized that c-type cytochromes would also catalyze Fe(II) oxidation, as they have been found to play this role in anaerobic phototrophic Fe(II)-oxidizing bacteria. Here we report on efforts to identify genes associated with nitrate-dependent Fe(II) oxidation, namely (a) whole-genome transcriptional studies [using FeCO3, Fe2+, and U(IV) oxides as electron donors under denitrifying conditions], (b) Fe(II) oxidation assays performed with knockout mutants targeting primarily highly expressed or upregulated c-type cytochromes, and (c) random transposon-mutagenesis studies with screening for Fe(II) oxidation. Assays of mutants for 26 target genes, most of which were c-type cytochromes, indicated that none of the mutants tested were significantly defective in nitrate-dependent Fe(II) oxidation. The non-defective mutants included the c1-cytochrome subunit of the cytochrome bc1 complex (complex III), which has relevance to a previously proposed role for this complex in nitrate-dependent Fe(II) oxidation and to current concepts of reverse electron transfer. A transposon mutant with a disrupted gene associated with NADH:ubiquinone oxidoreductase (complex I) was ~35% defective relative to the wild-type strain; this strain was similarly defective in nitrate reduction with thiosulfate as the electron donor. Overall, our results indicate that nitrate-dependent Fe(II) oxidation in T. denitrificans is not catalyzed by the same c-type cytochromes involved in U(IV) oxidation, nor have other c-type cytochromes yet been implicated in the process. PMID:24065960

Methods to Improve Osseointegration of Dental Implants in Low Quality (Type-IV) Bone: An Overview.

PubMed

Alghamdi, Hamdan S

2018-01-13

Nowadays, dental implants have become more common treatment for replacing missing teeth and aim to improve chewing efficiency, physical health, and esthetics. The favorable clinical performance of dental implants has been attributed to their firm osseointegration, as introduced by Brånemark in 1965. Although the survival rate of dental implants over a 10-year observation has been reported to be higher than 90% in totally edentulous jaws, the clinical outcome of implant treatment is challenged in compromised (bone) conditions, as are frequently present in elderly people. The biomechanical characteristics of bone in aged patients do not offer proper stability to implants, being similar to type-IV bone (Lekholm & Zarb classification), in which a decreased clinical fixation of implants has been clearly demonstrated. However, the search for improved osseointegration has continued forward for the new evolution of modern dental implants. This represents a continuum of developments spanning more than 20 years of research on implant related-factors including surgical techniques, implant design, and surface properties. The methods to enhance osseointegration of dental implants in low quality (type-IV) bone are described in a general manner in this review.

Proposal of a novel system for the staging of thymic epithelial tumors.

PubMed

Bedini, Amedeo Vittorio; Andreani, Stefano Michele; Tavecchio, Luca; Fabbri, Alessandra; Giardini, Roberto; Camerini, Tiziana; Bufalino, Rosaria; Morabito, Alberto; Rosai, Juan

2005-12-01

We designed and assessed a new TNM staging system (herein called the INT [Istituto Nazionale Tumori] system) for thymic epithelial tumors in order to overcome the perceived drawbacks of Masaoka's system, which represents the current standard. In all, 123 cases were evaluated. The histologic types according to the World Health Organization (WHO) classification were as follows: subtype A: 5 cases; AB: 40; B1: 16; B2: 29; B3: 16; and C: 17 cases. There were 45 Masaoka's stage I, 33 stage II, 26 stage III, and 19 stage IV cases. A total of 11 INT definitions were grouped into three stages: locally restricted disease (75 cases), which included Masaoka's stage I and selected stage II cases (no pleural invasion); locally advanced disease (37 cases), which included Masaoka's stage III cases plus those staged II owing to pleural invasion and those staged IV owing to intrathoracic nodal or limited pleuropericardial involvement; and systemic disease (11 cases), which included the remaining Masaoka's stage IV cases. Completeness of resection, WHO types, and both staging systems were significant prognostic factors (p < 0.0001) on univariate analysis. The 95-month progression-free survival rates according to Masaoka's system were stage I: 100%; II: 93.6%; III: 46.3%; and IV: 23.2%. The INT system corresponding figures were as follows: locally restricted disease: 98.6%; locally advanced disease: 46.9%; and systemic disease: 11.7%. The INT system was the prognostic factor with the greatest impact (p = 0.0218) on multivariate analysis (Masaoka's system: p = 0.2012; completeness of resection: p = 0.6855; histology: p = 0.9386). The INT system allows finer disease descriptions than Masaoka's system, resulting in a stage grouping with higher prognostic distinctiveness.

Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias).

PubMed

Gilmour, K M; Bayaa, M; Kenney, L; McNeill, B; Perry, S F

2007-01-01

Physiological and biochemical studies have provided indirect evidence for a membrane-associated carbonic anhydrase (CA) isoform, similar to mammalian type IV CA, in the gills of dogfish (Squalus acanthias). This CA isoform is linked to the plasma membrane of gill epithelial cells by a glycosylphosphatidylinositol anchor and oriented toward the plasma, such that it can catalyze the dehydration of plasma HCO(3)(-) ions. The present study directly tested the hypothesis that CA IV is present in dogfish gills in a location amenable to catalyzing plasma HCO(3)(-) dehydration. Homology cloning techniques were used to assemble a 1,127 base pair cDNA that coded for a deduced protein of 306 amino acids. Phylogenetic analysis suggested that this protein was a type IV CA. For purposes of comparison, a second cDNA (1,107 base pairs) was cloned from dogfish blood; it encoded a deduced protein of 260 amino acids that was identified as a cytosolic CA through phylogenetic analysis. Using real-time PCR and in situ hybridization, mRNA expression for the dogfish type IV CA was detected in gill tissue and specifically localized to pillar cells and branchial epithelial cells that flanked the pillar cells. Immunohistochemistry using a polyclonal antibody raised against rainbow trout type IV CA revealed a similar pattern of CA IV immunoreactivity and demonstrated a limited degree of colocalization with Na(+)-K(+)-ATPase immunoreactivity. The presence and localization of a type IV CA isoform in the gills of dogfish is consistent with the hypothesis that branchial membrane-bound CA with an extracellular orientation contributes to CO(2) excretion in dogfish by catalyzing the dehydration of plasma HCO(3)(-) ions.

Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

PubMed

Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

2015-04-02

Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

PubMed

Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

2005-04-01

The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

The Role of Dipeptidyl Peptidase IV in Lung Metastasis of Breast Cancer Cells

DTIC Science & Technology

1999-05-01

Our studies focused on (1) cloning and sequencing of wild-type endothelial DPP IV (wtDPP IV) and preparation of truncated DPP IV ( tDPP IV); (2...that was identical to hepatic DPP IV. Acid extraction of rat lung yielded a tDPP IV, which was an effective inhibitor of breast cancer cell adhesion to

Prevention of Contrast-Induced AKI: A Review of Published Trials and the Design of the Prevention of Serious Adverse Events following Angiography (PRESERVE) Trial

PubMed Central

Gallagher, Martin; Kaufman, James; Cass, Alan; Parikh, Chirag R.; Chertow, Glenn M.; Shunk, Kendrick A.; McCullough, Peter A.; Fine, Michael J.; Mor, Maria K.; Lew, Robert A.; Huang, Grant D.; Conner, Todd A.; Brophy, Mary T.; Lee, Joanne; Soliva, Susan; Palevsky, Paul M.

2013-01-01

Summary Contrast-induced AKI (CI-AKI) is a common condition associated with serious, adverse outcomes. CI-AKI may be preventable because its risk factors are well characterized and the timing of renal insult is commonly known in advance. Intravenous (IV) fluids and N-acetylcysteine (NAC) are two of the most widely studied preventive measures for CI-AKI. Despite a multitude of clinical trials and meta-analyses, the most effective type of IV fluid (sodium bicarbonate versus sodium chloride) and the benefit of NAC remain unclear. Careful review of published trials of these interventions reveals design limitations that contributed to their inconclusive findings. Such design limitations include the enrollment of small numbers of patients, increasing the risk for type I and type II statistical errors; the use of surrogate primary endpoints defined by small increments in serum creatinine, which are associated with, but not necessarily causally related to serious, adverse, patient-centered outcomes; and the inclusion of low-risk patients with intact baseline kidney function, yielding low event rates and reduced generalizability to a higher-risk population. The Prevention of Serious Adverse Events following Angiography (PRESERVE) trial is a randomized, double-blind, multicenter trial that will enroll 8680 high-risk patients undergoing coronary or noncoronary angiography to compare the effectiveness of IV isotonic sodium bicarbonate versus IV isotonic sodium chloride and oral NAC versus oral placebo for the prevention of serious, adverse outcomes associated with CI-AKI. This article discusses key methodological issues of past trials investigating IV fluids and NAC and how they informed the design of the PRESERVE trial. PMID:23660180

Endovascular Treatment of a Carotid Dissecting Pseudoaneurysm in a Patient with Ehlers-Danlos Syndrome Type IV with Fatal Outcome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lim, Siok Ping, E-mail: siokpinglim@yahoo.co.uk; Duddy, Martin J.

2008-01-15

We present a patient with Ehlers-Danlos syndrome type IV (EDS IV) with a carotid dissecting pseudoaneurysm causing severe carotid stenosis. This lesion was treated endovascularly. Unfortunately, the patient died of remote vascular catastrophes (intracranial hemorrhage and abdominal aortic rupture). This unique case illustrates the perils of endovascular treatment of EDS IV patients and the need for preoperative screening for concomitant lesions. It also shows that a dissecting pseudoaneurysm can feasibly be treated with a covered stent and that closure is effective using Angioseal in patients with EDS IV.

In vivo imaging of cortical pathology in multiple sclerosis using ultra-high field MRI

PubMed Central

Mainero, C; Benner, T; Radding, A; van der Kouwe, A; Jensen, R; Rosen, B R.; Kinkel, R P.

2009-01-01

Objective: We used ultra-high field MRI to visualize cortical lesion types described by neuropathology in 16 patients with multiple sclerosis (MS) compared with 8 age-matched controls; to characterize the contrast properties of cortical lesions including T2*, T2, T1, and phase images; and to investigate the relationship between cortical lesion types and clinical data. Methods: We collected, on a 7-T scanner, 2-dimensional fast low-angle shot (FLASH)-T2*-weighted spoiled gradient-echo, T2-weighted turbo spin-echo (TSE) images (0.33 × 033 × 1 mm3), and a 3-dimensional magnetization-prepared rapid gradient echo. Results: Overall, 199 cortical lesions were detected in patients on both FLASH-T2* and T2-TSE scans. Seven-tesla MRI allowed for characterization of cortical plaques into type I (leukocortical), type II (intracortical), and type III/IV (subpial extending partly or completely through the cortical width) lesions as described histopathologically. Types III and IV were the most frequent type of cortical plaques (50.2%), followed by type I (36.2%) and type II (13.6%) lesions. Each lesion type was more frequent in secondary progressive than in relapsing–remitting MS. This difference, however, was significant only for type III/IV lesions. T2*-weighted images showed the highest, while phase images showed the lowest, contrast-to-noise ratio for all cortical lesion types. In patients, the number of type III/IV lesions was associated with greater disability (p < 0.02 by Spearman test) and older age (p < 0.04 by Spearman test). Conclusions: Seven-tesla MRI detected different histologic cortical lesion types in our small multiple sclerosis (MS) sample, suggesting, if validated in a larger population, that it may prove a valuable tool to assess the contribution of cortical MS pathology to clinical disability. GLOSSARY ANOVA = analysis of variance; BN = background noise; CNR = contrast-to-noise ratio; DIR = double-inversion recovery; EDSS = Expanded Disability Status Scale; FLAIR = fluid-attenuated inversion recovery; FLASH = fast low-angle shot; GM = gray matter; MPRAGE = magnetization-prepared rapid gradient echo; MR = magnetic resonance; MS = multiple sclerosis; NACGM = normal-appearing cortical gray matter; RF = radiofrequency; ROI = region of interest; RRMS = relapsing–remitting multiple sclerosis; SNR = signal-to-noise ratio; SPMS = secondary progressive multiple sclerosis; TA = time of acquisition; TE = echo time; TR = repetition time; TSE = turbo spin-echo; WM = white matter. PMID:19641168

Role of 17 beta-estradiol on type IV collagen fibers volumetric density in the basement membrane of bladder wall.

PubMed

de Fraga, Rogerio; Dambros, Miriam; Miyaoka, Ricardo; Riccetto, Cássio Luís Zanettini; Palma, Paulo César Rodrigues

2007-10-01

The authors quantified the type IV collagen fibers volumetric density in the basement membrane of bladder wall of ovariectomized rats with and without estradiol replacement. This study was conducted on 40 Wistar rats (3 months old) randomly divided in 4 groups: group 1, remained intact (control); group 2, submitted to bilateral oophorectomy and daily replacement 4 weeks later of 17 beta-estradiol for 12 weeks; group 3, sham operated and daily replacement 4 weeks later of sesame oil for 12 weeks; and group 4, submitted to bilateral oophorectomy and killed after 12 weeks. It was used in immunohistochemistry evaluation using type IV collagen polyclonal antibody to stain the fibers on paraffin rat bladder sections. The M-42 stereological grid system was used to analyze the fibers. Ovariectomy had an increase effect on the volumetric density of the type IV collagen fibers in the basement membrane of rat bladder wall. Estradiol replacement in castrated animals demonstrated a significative difference in the stereological parameters when compared to the castrated group without hormonal replacement. Surgical castration performed on rats induced an increasing volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall and the estradiol treatment had a significant effect in keeping a low volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall.

Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea.

PubMed

Shin, E; Hong, H; Park, J; Oh, Y; Jung, J; Lee, Y

2016-07-01

To characterize Staphylococcus aureus faecal isolates from people suspected to be infected with food poisoning by using antimicrobial susceptibility testing and molecular techniques. A total of 340 Staph. aureus isolates from 6226 people suspected to be infected with food poisoning were identified and characterized by biochemical methods, antimicrobial susceptibility testing and PCR. Samples were obtained from January 2006 to December 2008 from the National Notifiable Diseases Surveillance System at the Research Institute of Public Health and Environment in Seoul Metropolitan, Korea. All strains carried at least one of the eight staphylococcal enterotoxin (se) genes tested and a total of 27 se profiles were produced; the most frequent se profile was seg-sei and the next was sea. Among the total isolates, 36 methicillin-resistant Staphylococcus aureus (MRSAs) isolates were further analysed by multilocus sequence typing (MLST), Staphylococcal cassette chromosome mec (SCCmec) typing, pulsed-field gel electrophoresis (PFGE) and PCR detection for pvl. ST72-SCCmec type IV was the most predominant clone (27 isolates, 75%) followed by ST1-SCCmec type IV (five isolates, 13·8%), ST20-SCCmec type IV (one isolate, 2·8%), ST493-SCCmec type IV (one isolate, 2·8%), ST903-SCCmec type IV (one isolate, 2·8%) and ST5-SCCmec type II (one isolate, 2·8%). By PFGE typing, MRSAs isolated during the same period were grouped together although they were isolated from different regions. None of MRSAs had PVL gene and nine MRSAs were multidrug resistant. Analysis of MRSAs by MLST, SCCmec typing, PFGE and pvl detection showed that the majority of strain associated with food-borne diseases belonged to a Korean community-acquired (CA) MRSA clone with ST72-SCCmec type IV-PVL negative-SEG/SEI and its variations while one strain was hospital-acquired (HA) MRSA. CA-MRSA clone which possessed ST72-SCCmec type IV-PVL negative-SEG/SEI was spread most commonly among MRSAs that were associated with food-borne diseases. This is the first report of ST903 strain in Korea. © 2016 The Society for Applied Microbiology.

Adenocarcinoma of the lung with scattered consolidation: radiological-pathological correlation and prognosis.

PubMed

Jiang, Binghu; Takashima, Shodayu; Hakucho, Tomoaki; Hodaka, Numasaki; Yasuhiko, Tomita; Masahiko, Higashiyama

2013-10-01

To investigate the clinicopathological features and prognosis in patients with adenocarcinoma of the lung with scattered consolidation (ALSC). Between January 2006 and March 2010, 139 consecutive patients with lung adenocarcinoma of ≤3 cm, who underwent pulmonary resection for lung cancer, were investigated retrospectively. Radiologic classification was based on the findings of thin-section CT such as the presence of consolidation or ground-glass opacity (GGO). Type I (n=15) and Type II (n=14), showed a pure GGO and a mixed GGO with consolidation <50%, respectively. Type IV (n=38) and Type V (n=52) showed a mixed GGO with consolidation ≥50% and a pure consolidation, respectively. Type III (n=20) was the adenocarcinoma of the lung with scattered consolidation (ALSC). The clinicopathological features and prognosis of ALSC was investigated with comparative analysis and survival analysis. Because of the similar recurrence rate for Type I and Type II (P=1.000), Type IV and Type V (P=0.343), we merged Type I and Type II as Type I+II, Type IV and Type V as Type IV+V, respectively. In the 20 (14.4%) patients with ALSC, lymph node metastasis was not observed, and it was rare in lymphatic invasion and vascular invasion. On the basis of IASLC/ATS/ERS 2011 classification, 80% of the ALSC were preinvasive lesions. In Noguchi classification, there was no significant difference between Type I+II and ALSC (P=0.260). The prognosis of ALSC was similar to Type I+II (P=0.408), but better than Type IV+V (P=0.040). Adenocarcinoma of the lung with scattered consolidation (ALSC) on thin-section CT was a relatively favorable prognostic factor. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Impact of Marital Status on Tumor Stage at Diagnosis and on Survival in Male Breast Cancer.

PubMed

Adekolujo, Orimisan Samuel; Tadisina, Shourya; Koduru, Ujwala; Gernand, Jill; Smith, Susan Jane; Kakarala, Radhika Ramani

2017-07-01

The effect of marital status (MS) on survival varies according to cancer type and gender. There has been no report on the impact of MS on survival in male breast cancer (MBC). This study aims to determine the influence of MS on tumor stage at diagnosis and survival in MBC. Men with MBC ≥18 years of age in the SEER database from 1990 to 2011 were included in the study. MS was classified as married and unmarried (including single, divorced, separated, widowed). Kaplan-Meier method was used to estimate the 5-year cancer-specific survival. Multivariate regression analyses were done to determine the effect of MS on presence of Stage IV disease at diagnosis and on cancer-specific mortality. The study included 3,761 men; 2,647 (70.4%) were married. Unmarried men were more often diagnosed with Stage IV MBC compared with married (10.7% vs. 5.5%, p < .001). Unmarried men (compared with married) were significantly less likely to undergo surgery (92.4% vs. 96.7%, p < .001). Overall unmarried males with Stages II, III, and IV MBC have significantly worse 5-year cancer-specific survival compared with married. On multivariate analysis, being unmarried was associated with increased hazard of death (HR = 1.43, p < .001) and increased likelihood of Stage IV disease at diagnosis ( OR = 1.96, p < .001). Unmarried males with breast cancer are at greater risk for Stage IV disease at diagnosis and poorer outcomes compared with married males.

46 CFR 164.019-3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Guard-approved PFDs. Commandant means the Chief of the Lifesaving and Fire Safety Division, Office of... code PFD type acceptable for use 1 I, II, and III. 2 II and III. 3 III. 4B IV (all Ring Buoys). 4BC IV (Buoyant Cushions). 4RB IV (Recreational Ring Buoys only). 5 Wearable Type V (intended use must be...

Metachronous Bilateral Posterior Tibial Artery Aneurysms in Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hagspiel, Klaus D., E-mail: kdh2n@virginia.edu; Bonatti, Hugo; Sabri, Saher

2011-04-15

Ehlers-Danlos syndrome type IV is a life-threatening genetic connective tissue disorder. We report a 24-year-old woman with EDS-IV who presented with metachronous bilateral aneurysms/pseudoaneurysms of the posterior tibial arteries 15 months apart. Both were treated successfully with transarterial coil embolization from a distal posterior tibial approach.

Laser and Light Treatments for Hair Reduction in Fitzpatrick Skin Types IV-VI: A Comprehensive Review of the Literature.

PubMed

Fayne, Rachel A; Perper, Marina; Eber, Ariel E; Aldahan, Adam S; Nouri, Keyvan

2018-04-01

Unwanted facial and body hair presents as a common finding in many patients, such as females with hirsutism. With advances in laser and light technology, a clinically significant reduction in hair can be achieved in patients with light skin. However, in patients with darker skin, Fitzpatrick skin types (FST) IV-VI, the higher melanin content of the skin interferes with the proposed mechanism of laser-induced selective photothermolysis, which is to target the melanin in the hair follicle to cause permanent destruction of hair bulge stem cells. Many prospective and retrospective studies have been conducted with laser and light hair-removal devices, but most exclude patients with darkly pigmented skin, considering them a high-risk group for unwanted side effects, including pigmentation changes, blisters, and crust formation. We reviewed the published literature to obtain studies that focused on hair reduction for darker skin types. The existing literature for this patient population identifies longer wavelengths as a key element of the treatment protocol and indicates neodymium-doped yttrium aluminum garnet (Nd:YAG), diode, alexandrite, and ruby lasers as well as certain intense pulsed light sources for safe hair reduction with minimal side effects in patients with FST IV-VI, so long as energy settings and wavelengths are appropriate. Based on the findings in this review, safe and effective hair reduction for patients with FST IV-VI is achievable under proper treatment protocols and energy settings.

Interstellar C IV and Si IV column densities toward early-type stars

NASA Technical Reports Server (NTRS)

Bruhweiler, F. C.; Kondo, Y.; Mccluskey, G. E.

1980-01-01

Equivalent widths and deduced column densities of Si IV and C IV are examined for 18 early-type close binaries, and physical processes responsible for the origin of these ions in the interstellar medium are investigated. The available C IV/Si IV column density ratios typically lie within a narrow range from 0.8 to 4.5, and there is evidence that the column density of C IV is higher than that of N V along most lines of sight, suggesting that C IV is not formed in the same hot region as O VI. In addition, the existence of regions with a narrowly defined new temperature range around 50,000 deg K is indicated. The detection of the semitorrid gas of Bruhweiler, Kondo, and McCluskey (1978, 1979) is substantiated, and the relation of this gas to the observations of coronal gas in the galactic halo is discussed.

Prospective Computed Tomographic Analysis of Osteochondral Lesions of the Ankle Joint Associated With Ankle Fractures.

PubMed

Nosewicz, Tomasz L; Beerekamp, M Suzan H; De Muinck Keizer, Robert-Jan O; Schepers, Tim; Maas, Mario; Niek van Dijk, C; Goslings, J Carel

2016-08-01

Osteochondral lesions (OCLs) associated with ankle fracture correlate with unfavorable outcome. The goals of this study were to detect OCLs following ankle fracture, to associate fracture type to OCLs and to investigate whether OCLs affect clinical outcome. 100 ankle fractures requiring operative treatment were prospectively included (46 men, 54 women; mean age 44 ± 14 years, range 20-77). All ankle fractures (conventional radiography; 71 Weber B, 22 Weber C, 1 Weber A, 4 isolated medial malleolus and 2 isolated posterior malleolus fractures) were treated by open reduction and internal fixation. Multidetector computed tomography (CT) was performed postoperatively. For each OCL, the location, size, and Loomer OCL classification (CT modified Berndt and Harty classification) were determined. The subjective Foot and Ankle Outcome Scoring (FAOS) was used for clinical outcome at 1 year. OCLs were found in 10/100 ankle fractures (10.0%). All OCLs were solitary talar lesions. Four OCLs were located posteromedial, 4 posterolateral, 1 anterolateral, and 1 anteromedial. There were 2 type I OCLs (subchondral compression), 6 type II OCLs (partial, nondisplaced fracture) and 2 type IV OCLs (displaced fracture). Mean OCL size (largest diameter) was 4.4 ± 1.7 mm (range, 1.7 mm to 6.2 mm). Chi-square analysis showed no significant association between ankle fracture type and occurrence of OCLs. OCLs did occur only in Lauge-Hansen stage III/IV ankle fractures. There were no significant differences in FAOS outcome between patients with or without OCLs. Ten percent of investigated ankle fractures had associated OCLs on CT. Although no significant association between fracture type and OCL was found, OCLs only occurred in Lauge-Hansen stage III/IV ankle fractures. With the numbers available, OCLs did not significantly affect clinical outcome at 1 year according to FAOS. Level IV, observational study. © The Author(s) 2016.

The effects of wearing Passenger Protective Breathing Equipment on evacuation times through type III and type IV emergency aircraft exits in clear air and smoke.

DOT National Transportation Integrated Search

1989-11-01

The effects of Passenger Protective Breathing Equipment (PPBE) on the time required for simulated emergency evacuations through Type III and Type IV overwing aircraft exits were studied in two quasi-independent experiments, one in clear air and anoth...

Diversity of methicillin-resistant Staphylococcus aureus CC22-MRSA-IV from Saudi Arabia and the Gulf region.

PubMed

Senok, Abiola; Somily, Ali; Raji, Adeola; Gawlik, Darius; Al-Shahrani, Fatimah; Baqi, Shehla; Boswihi, Samar; Skakni, Leila; Udo, Edet E; Weber, Stefan; Ehricht, Ralf; Monecke, Stefan

2016-10-01

CC22-MRSA-IV, UK-EMRSA-15/Barnim EMRSA, is a common and pandemic strain of methicillin-resistant Staphylococcus aureus (MRSA) that has been found mainly in Western Europe, but also in other parts of the world including some Gulf countries. One suspected case of an infection with this strain in a patient who was admitted to the surgical unit in Riyadh, Kingdom of Saudi Arabia (KSA) was investigated in order to check whether this strain has reached KSA. Besides the index isolate, 46 additional isolates of CC22-MRSA-IV from patients from KSA, Abu Dhabi, Kuwait, and Germany (patients with a history of travel in the Middle East), were characterized by microarray hybridization. The study revealed a regional presence of as many as six distinct 'strains' of CC22-MRSA-IV that could be distinguished based on carriage of SCCmec IV subtypes and virulence factors. No true UK-EMRSA-15/Barnim EMRSA was identified in Riyadh; all suspected isolates from Riyadh were assigned to other, albeit related strains. However, this strain was identified in Abu Dhabi and Kuwait. CC22-MRSA-IV from KSA could be linked to other epidemic strains from the Middle East and possibly India, rather than to the Western European UK-EMRSA-15/Barnim EMRSA. High-resolution typing methods, including SCCmec subtyping, might help to differentiate related epidemic strains and to monitor routes of transmission. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Expression of the rat CD26 antigen (dipeptidyl peptidase IV) on subpopulations of rat lymphocytes.

PubMed

Gorrell, M D; Wickson, J; McCaughan, G W

1991-04-15

The T cell activation antigen CD26 has been recently identified as the cell surface ectopeptidase dipeptidyl peptidase IV (DPP-IV). DPP-IV is found on many cell types, including lymphocytes, epithelial cells, and certain endothelial cells. The MRC OX61 monoclonal antibody (MAb) which specifically recognises rat DPP-IV was used to examine the expression of CD26/DPP-IV on rat lymphocytes. The molecular nature of the antigen was examined by immunoprecipitation from thymocytes, splenocytes, and hepatocytes. Analysis by one- and two-dimensional gel electrophoresis indicated that the native form of CD26 includes a 220-kDa homodimer. On tissue sections MRC OX61 MAb stained nearly all thymocytes and in the spleen and lymph nodes predominantly stained the T cell areas. However, in immunofluorescence experiments OX61 stained 80 to 87% of lymph node cells and 78 to 85% of spleen cells. Furthermore, two-colour immunofluorescence analysis of the CD4+, CD8+, and Ig+ lymphocyte subsets indicated that only 2 to 5% of each of these subsets lacked OX61 staining. Spleen cells and thymocytes of both CD4+ and CD8+ subsets stained much more intensely with OX61 after these cells were stimulated with phytohemagglutinin. These findings indicate that rat CD26 antigen expression is not confined to the T cell population as has been suggested, but also occurs on B cells, and is increased on T cells following their activation.

An Analysis of Type IV Precision Measurement Equipment Laboratory Logistical Support Relative to the Implementation of F-15/F-16 Two-Level Maintenance

DTIC Science & Technology

1994-09-01

wife, Margie, for her patience and understanding. Graduate school definitely affects the family . Margie allowed me to use many valuable family hours...Consolidations and reorganizations, in which the face of logistics is changing day -by- day , are taking place throughout the Department of Defense. Two...will focus on Type IV F-15 and Type IV F-16 PMELs. Imporane of Research The two-level maintenance concept significantly alters the structure of

Glomerular basement membrane injuries in IgA nephropathy evaluated by double immunostaining for α5(IV) and α2(IV) chains of type IV collagen and low-vacuum scanning electron microscopy.

PubMed

Masuda, Yukinari; Yamanaka, Nobuaki; Ishikawa, Arimi; Kataoka, Mitue; Arai, Takashi; Wakamatsu, Kyoko; Kuwahara, Naomi; Nagahama, Kiyotaka; Ichikawa, Kaori; Shimizu, Akira

2015-06-01

The glomerulus contains well-developed capillaries, which are at risk of injury due to high hydrostatic pressure, hyperfiltration, hypertension and inflammation. However, the pathological alterations of the injured glomerular basement membrane (GBM), the main component of the glomerular filtration barrier, are still uncertain in cases of glomerulonephritis. We examined the alterations of the GBM in 50 renal biopsy cases with IgA nephropathy (31.8 ± 17.6 years old) using double immunostaining for the α2(IV) and α5(IV) chains of type IV collagen, and examining the ultrastructural alterations by transmission electron microscopy (TEM) and low-vacuum scanning electron microscopy (LV-SEM). The GBM of IgA nephropathy cases showed various morphological and qualitative alterations. In the TEM findings, thinning, gaps, rupture, thickening with a lamellar and reticular structure and double contours were detected in the GBM. Double immunostaining for α5(IV) and α2(IV) showed thickening of the GBM with reduced α5(IV) and increased α2(IV), or mosaic images of α5(IV) and α2(IV), and holes, fractures, spiny projections and rupture of α5(IV) in the GBM. In addition, LV-SEM showed an etched image and multiple holes in a widening and wavy GBM. These findings might be associated with the development of a brittle GBM in IgA nephropathy. Glomerular basement membrane alterations were frequently noted in IgA nephropathy, and were easily evaluated by double immunostaining for α2(IV) and α5(IV) of type IV collagen and LV-SEM. The application of these analyses to human renal biopsy specimens may enhance our understanding of the alterations of the GBM that occur in human glomerular diseases.

Genetics Home Reference: glycogen storage disease type IV

MedlinePlus

... 000 to 800,000 individuals worldwide. Type IV accounts for roughly 3 percent of all cases of glycogen storage disease. Related Information What information about a genetic condition can statistics ...

Staging of intestinal- and diffuse-type gastric cancers with the OLGA and OLGIM staging systems.

PubMed

Cho, S-J; Choi, I J; Kook, M-C; Nam, B-H; Kim, C G; Lee, J Y; Ryu, K W; Kim, Y-W

2013-11-01

Operative link on gastritis assessment (OLGA) and Operative link on gastric intestinal metaplasia assessment (OLGIM) staging systems have been proposed for gastric cancer (GC) risk estimation. To validate the OLGA and OLGIM staging systems in a region with high risk of GC. This retrospective study included 474 GC patients and age- and sex-matched health screening control persons in a cancer centre hospital. We classified gastritis patterns according to the OLGA and OLGIM systems using the histological database that a pathologist prospectively evaluated using the updated Sydney system. GC risk according to the OLGA and OLGIM stages was evaluated using logistic regression analysis. More GC patients had OLGA stages III-IV (46.2%) than controls (26.6%, P < 0.001), particularly among patients with intestinal-type GCs (62.2%) compared with diffuse-type GCs (30.9%). OLGA stages III and IV were significantly associated with increased risk of GC [odds ratios (ORs), 2.09; P = 0.008 and 2.04; P = 0.014 respectively] in multivariate analysis. The association was more significant for intestinal-type (ORs, 4.76; P = 0.001 and 4.19; P = 0.002 respectively), but not diffuse-type GC. OLGIM stages from I to IV were significantly associated with increased risk of both intestinal-type (ORs, 3.64, 5.15, 7.89 and 13.20 respectively) and diffuse-type GC (ORs, 1.84, 2.59, 5.08 and 6.32 respectively) with a significantly increasing trend. As high OLGA and OLGIM stages are independent risk factors for gastric cancer, the staging systems may be useful for risk assessment in high-risk regions, especially for intestinal-type gastric cancer. © 2013 John Wiley & Sons Ltd.

Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus.

PubMed

Nagar, Elad; Zilberman, Shaul; Sendersky, Eleonora; Simkovsky, Ryan; Shimoni, Eyal; Gershtein, Diana; Herzberg, Moshe; Golden, Susan S; Schwarz, Rakefet

2017-07-01

The hair-like cell appendages denoted as type IV pili are crucial for biofilm formation in diverse eubacteria. The protein complex responsible for type IV pilus assembly is homologous with the type II protein secretion complex. In the cyanobacterium Synechococcus elongatus PCC 7942, the gene Synpcc7942_2071 encodes an ATPase homologue of type II/type IV systems. Here, we report that inactivation of Synpcc7942_2071 strongly affected the suite of proteins present in the extracellular milieu (exo-proteome) and eliminated pili observable by electron microscopy. These results support a role for this gene product in protein secretion as well as in pili formation. As we previously reported, inactivation of Synpcc7942_2071 enables biofilm formation and suppresses the planktonic growth of S. elongatus. Thus, pili are dispensable for biofilm development in this cyanobacterium, in contrast to their biofilm-promoting function in type IV pili-producing heterotrophic bacteria. Nevertheless, pili removal is not required for biofilm formation as evident by a piliated mutant of S. elongatus that develops biofilms. We show that adhesion and timing of biofilm development differ between the piliated and non-piliated strains. The study demonstrates key differences in the process of biofilm formation between cyanobacteria and well-studied type IV pili-producing heterotrophic bacteria. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Drosophila type IV collagen mutation associates with immune system activation and intestinal dysfunction.

PubMed

Kiss, Márton; Kiss, András A; Radics, Monika; Popovics, Nikoletta; Hermesz, Edit; Csiszár, Katalin; Mink, Mátyás

2016-01-01

The basal lamina (BM) contains numerous components with a predominance of type IV collagens. Clinical manifestations associated with mutations of the human COL4A1 gene include perinatal cerebral hemorrhage and porencephaly, hereditary angiopathy, nephropathy, aneurysms and muscle cramps (HANAC), ocular dysgenesis, myopathy, Walker–Warburg syndrome and systemic tissue degeneration. In Drosophila, the phenotype associated with dominant temperature sensitive mutations of col4a1 include severe myopathy resulting from massive degradation of striated muscle fibers, and in the gut, degeneration of circular visceral muscle cells and epithelial cells following detachment from the BM. In order to determine the consequences of altered BMfunctions due to aberrant COL4A1 protein, we have carried out a series of tests using Drosophila DTS-L3 mutants from our allelic series of col4a1 mutations with confirmed degeneration of various cell types and lowest survival rate among the col4a1 mutant lines at restrictive temperature. Results demonstrated epithelial cell degeneration in the gut, shortened gut, enlarged midgut with multiple diverticulae, intestinal dysfunction and shortened life span. Midgut immunohistochemistry analyses confirmed altered expression and distribution of BM components integrin PSI and PSII alpha subunits, laminin gamma 1, and COL4A1 both in larvae and adults. Global gene expression analysis revealed activation of the effector AMP genes of the primary innate immune system including Metchnikowin, Diptericin, Diptericin B, and edin that preceded morphological changes. Attacin::GFP midgut expression pattern further supported these changes. An increase in ROS production and changes in gut bacterial flora were also noted and may have further enhanced an immune response. The phenotypic features of Drosophila col4a1 mutants confirmed an essential role for type IV collagen in maintaining epithelial integrity, gut morphology and intestinal function and suggest that aberrant structure and function of the COL4A1 protein may also be a significant factor in modulating immunity.

10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

Effects of enzyme replacement therapy for cardiac-type Fabry patients with a Chinese hotspot late-onset Fabry mutation (IVS4+919G>A)

PubMed Central

Lin, Hsiang-Yu; Liu, Hao-Chuan; Huang, Yu-Hsiu; Liao, Hsuan-Chieh; Hsu, Ting-Rong; Shen, Chia-I; Li, Shao-Tzu; Li, Cheng-Fang; Lee, Li-Hong; Lee, Pi-Chang; Huang, Chun-Kai; Chiang, Chuan-Chi; Lin, Ching-Yuang; Lin, Shuan-Pei; Niu, Dau-Ming

2013-01-01

Objective Current studies of newborn screening for Fabry disease in Taiwan have revealed a remarkably high prevalence of cardiac-type Fabry disease with a Chinese hotspot late-onset Fabry mutation (IVS4+919G>A). Design Retrospective cohort study. Setting Tertiary medical centre. Participants 21 patients with cardiac-type Fabry disease (15 men and 6 women) as well as 15 patients with classic Fabry disease (4 men and 11 women) treated with biweekly intravenous infusions of agalsidase β (1 mg/kg) or agalsidase α (0.2 mg/kg) for at least 6 months. Outcome measures These data were collected at the time before enzyme replacement therapy (ERT) began and followed up after ERT for at least 6 months, including patient demographics, medical history, parameter changes of cardiac status and renal functions, plasma globotriaosylsphingosine (lyso-Gb3) and Mainz Severity Score Index. Results After 6–39 months of ERT, plasma lyso-Gb3 was found to be reduced in 89% (17/19) and 93% (14/15) of patients with cardiac-type and classic Fabry disease, respectively, which indicated an improvement of disease severity. For patients with cardiac-type Fabry disease, echocardiography revealed the reduction or stabilisation of left ventricular mass index (LVMI), the thicknesses of intraventricular septum (IVS) and left posterior wall (LPW) in 83% (15/18), 83% (15/18) and 67% (12/18) of patients, respectively, as well as 77% (10/13), 73% (11/15) and 60% (9/15) for those with classic type. Most patients showed stable renal function after ERT. There were statistically significant improvements (p<0.05) between the data at baseline and those after ERT for values of plasma lyso-Gb3, LVMI, IVS, LPW and Mainz Severity Score Index. No severe clinical events were reported during the treatment. Conclusions ERT is beneficial and appears to be safe for Taiwanese patients with cardiac-type Fabry disease, as well as for those with the classic type. PMID:23864212

A survey of the intravenous sedation status in one provincial dental clinic center for the disabled in Korea

PubMed Central

Seok, Ujeong; Ji, Sangeun; Yoo, Seunghoon; Kim, Jongsoo; Kim, Seungoh

2016-01-01

Background The objective of the present study was to examine the status of patients who had received dental treatment under intravenous (IV) sedation at Chungnam Dental Clinic for the Disabled in Korea from its inception to the present time, and to review the analysis results. Methods Retrospective analysis was performed on 305 cases of patients who had received dental treatments under IV sedation between January 2011 and May 2016. The analysis examined the patient's sex, age, primary reason for IV sedation, duration of anesthesia and dental treatment, type of dental treatment performed, number of clinical departments involved in the dental treatment and level of multidisciplinary cooperation, and annual trends. Results Most dental treatments using intravenous sedation were performed on medically disabled patients or dentally disabled patients with an extreme gag reflex or dental phobia. The mean duration of IV sedation was 72.5 min, while the mean duration of treatment was 58.0 min. The types of dental treatments included surgical treatment (n = 209), periodontal treatment (n = 28), prosthodontic treatment (n = 28), restorative treatment (n = 23), implant surgery (n = 22), endodontic treatment (n = 9), reduction of temporomandibular joint dislocation (n = 1), and treatment of traumatic injuries (n = 1), with treatments mostly performed on adult patients. Conclusions With increasing demand for minimally painful treatment, cases using IV sedation are on an upward trend and are expected to continue to increase. PMID:28879305

Preparation of graphene oxide-manganese dioxide for highly efficient adsorption and separation of Th(IV)/U(VI).

PubMed

Pan, Ning; Li, Long; Ding, Jie; Li, Shengke; Wang, Ruibing; Jin, Yongdong; Wang, Xiangke; Xia, Chuanqin

2016-05-15

Manganese dioxide decorated graphene oxide (GOM) was prepared via fixation of crystallographic MnO2 (α, γ) on the surface of graphene oxide (GO) and was explored as an adsorbent material for simultaneous removal of thorium/uranium ions from aqueous solutions. In single component systems (Th(IV) or U(VI)), the α-GOM2 (the weight ratio of GO/α-MnO2 of 2) exhibited higher maximum adsorption capacities toward both Th(IV) (497.5mg/g) and U(VI) (185.2 mg/g) than those of GO. In the binary component system (Th(IV)/U(VI)), the saturated adsorption capacity of Th(IV) (408.8 mg/g)/U(VI) (66.8 mg/g) on α-GOM2 was also higher than those on GO. Based on the analysis of various data, it was proposed that the adsorption process may involve four types of molecular interactions including coordination, electrostatic interaction, cation-pi interaction, and Lewis acid-base interaction between Th(IV)/U(VI) and α-GOM2. Finally, the Th(IV)/U(VI) ions on α-GOM2 can be separated by a two-stage desorption process with Na2CO3/EDTA. Those results displayed that the α-GOM2 may be utilized as an potential adsorbent for removing and separating Th(IV)/U(VI) ions from aqueous solutions. Copyright © 2016 Elsevier B.V. All rights reserved.

Using computer-aided drug design and medicinal chemistry strategies in the fight against diabetes.

PubMed

Semighini, Evandro P; Resende, Jonathan A; de Andrade, Peterson; Morais, Pedro A B; Carvalho, Ivone; Taft, Carlton A; Silva, Carlos H T P

2011-04-01

The aim of this work is to present a simple, practical and efficient protocol for drug design, in particular Diabetes, which includes selection of the illness, good choice of a target as well as a bioactive ligand and then usage of various computer aided drug design and medicinal chemistry tools to design novel potential drug candidates in different diseases. We have selected the validated target dipeptidyl peptidase IV (DPP-IV), whose inhibition contributes to reduce glucose levels in type 2 diabetes patients. The most active inhibitor with complex X-ray structure reported was initially extracted from the BindingDB database. By using molecular modification strategies widely used in medicinal chemistry, besides current state-of-the-art tools in drug design (including flexible docking, virtual screening, molecular interaction fields, molecular dynamics, ADME and toxicity predictions), we have proposed 4 novel potential DPP-IV inhibitors with drug properties for Diabetes control, which have been supported and validated by all the computational tools used herewith.

Very low density lipoprotein triglyceride transport in type IV hyperlipoproteinemia and the effects of carbohydrate-rich diets.

PubMed

Quarfordt, S H; Frank, A; Shames, D M; Berman, M; Steinberg, D

1970-12-01

Transport of plasma-free fatty acids (FFA) and of fatty acids in triglycerides of plasma very low density lipoproteins (VLDL-TGFA) was studied in two normal subjects, five patients with type IV hyperlipoproteinemia, and two patients with type I hyperlipoproteinemia. After intravenous pulse-labeling with albumin-bound 1-palmitate-(14)C, specific radioactivity of plasma FFA and VLDL-TGFA were determined at intervals up to 24 hr. The results were analyzed using several different multicompartmental models each compatible with the experimental data. Fractional transport of VLDL-TGFA was distinctly lower (no overlap) in the type IV patients than in the control subjects, both on a usual balanced diet (40% of calories from carbohydrate) and on a high-carbohydrate diet (80% of calories). However, net or total transport of VLDL-TGFA in the type IV patients was not clearly distinguishable from that in the control subjects, there being considerable overlap on either diet. The results suggest that in this group of type IV patients the underlying defect leading to the increased pool size of VLDL-TGFA is not overproduction but a relative defect in mechanisms for removal of VLDL-TGFA. Since some of these type IV patients had only a moderate degree of hypertriglyceridemia at the time they were studied, and since it is not established that patients with the type IV phenotype constitute a biochemically homogeneous population, the present results should not be generalized. Four studies were done (in two control subjects and two type IV patients) in which the kinetic parameters in the same individual were determined on the balanced diet and on the high-carbohydrate diet. All subjects showed an increase in VLDL-TGFA pool size. Using two of the models for analysis, all showed an increase in net transport of VLDL-TGFA; using the third model, three of the four studies showed an increase in VLDL-TGFA transport. The results are compatible with the interpretation that the carbohydrate-induced increase in VLDL-TGFA, both in controls and type IV patients, is at least in part due to an increased rate of production of VLDL-TGFA. The magnitude of the increase was approximately the same in controls and patients. Thus, metabolic adjustment to a high-carbohydrate regimen in these type IV patients may not be basically different from that in normal controls; the higher levels of VLDL-TGFA reached may simply be another reflection of a defective removal mechanism. An alternative interpretation, compatible with the data, would involve both a carbohydrate-induced increase in fractional rate of release of VLDL-TGFA from liver to plasma and a decrease in fractional removal of VLDL-TGFA from plasma without increase in net production rate. The simpler hypothesis of a single primary effect on net VLDL-TGFA production from FFA seems more likely.

Alport Syndrome Diagnosis

MedlinePlus

... the presence or absence of the type IV collagen alpha-3, alpha-4 and alpha-5 chains ( ... linked Alport syndrome) is suspected. The type IV collagen alpha-5 chain (COL4A5) is normally present in ...

Super-Radiant Free Electron Laser Measurement and Detection

DTIC Science & Technology

2013-09-01

collection of information is estimated to average 1 hour per response, including the time for reviewing instruction, searching existing data sources... relativistic electron bunches and a periodic magnetic field to generate coherent radiation. These types of lasers are of interest to the Navy because...Physics iv THIS PAGE INTENTIONALLY LEFT BLANK v ABSTRACT A free electron laser (FEL) is a type of laser that use relativistic electron bunches

Urinary type IV collagen excretion predicts subsequent declining renal function in type 2 diabetic patients with proteinuria.

PubMed

Katavetin, Pisut; Katavetin, Paravee; Susantitaphong, Paweena; Townamchai, Natavudh; Tiranathanagul, Khajohn; Tungsanga, Kriang; Eiam-Ong, Somchai

2010-08-01

Baseline urinary type IV collagen excretion was negatively correlated with the subsequent GFR change (r(s)=-0.39, p=0.04) in our cohort of 30 type 2 diabetic patients with proteinuria. Therefore, it could be used to predict subsequent declining renal function in type 2 diabetic patients with proteinuria. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

25 CFR 700.815 - Issuance of permits.

Code of Federal Regulations, 2011 CFR

2011-04-01

... activity of the type and scope proposed; (iii) The demonstrated ability to carry research to completion, as evidenced by timely completion of theses, research reports, or similar documents; (iv) Completion of at..., laboratory, or library research, administration, or management, including at least 4 months experience and/or...

25 CFR 700.815 - Issuance of permits.

Code of Federal Regulations, 2010 CFR

2010-04-01

... activity of the type and scope proposed; (iii) The demonstrated ability to carry research to completion, as evidenced by timely completion of theses, research reports, or similar documents; (iv) Completion of at..., laboratory, or library research, administration, or management, including at least 4 months experience and/or...

25 CFR 700.815 - Issuance of permits.

Code of Federal Regulations, 2012 CFR

2012-04-01

... activity of the type and scope proposed; (iii) The demonstrated ability to carry research to completion, as evidenced by timely completion of theses, research reports, or similar documents; (iv) Completion of at..., laboratory, or library research, administration, or management, including at least 4 months experience and/or...

29 CFR 1910.1051 - 1,3-Butadiene.

Code of Federal Regulations, 2013 CFR

2013-07-01

... samples taken; (E) Type of protective devices worn, if any; and (F) Name, social security number and... include at least the following information: (A) The name and social security number of the employee; (B... before the need arises. IV. Respirators and Protective Clothing A. Respirators: Good industrial hygiene...

29 CFR 1910.1051 - 1,3-Butadiene. =

Code of Federal Regulations, 2012 CFR

2012-07-01

... samples taken; (E) Type of protective devices worn, if any; and (F) Name, social security number and... include at least the following information: (A) The name and social security number of the employee; (B... before the need arises. IV. Respirators and Protective Clothing A. Respirators: Good industrial hygiene...

29 CFR 1910.1051 - 1,3-Butadiene.

Code of Federal Regulations, 2014 CFR

2014-07-01

... samples taken; (E) Type of protective devices worn, if any; and (F) Name, social security number and... include at least the following information: (A) The name and social security number of the employee; (B... before the need arises. IV. Respirators and Protective Clothing A. Respirators: Good industrial hygiene...

Two type IV pili of Vibrio parahaemolyticus play different roles in biofilm formation.

PubMed

Shime-Hattori, Akiko; Iida, Tetsuya; Arita, Michiko; Park, Kwon-Sam; Kodama, Toshio; Honda, Takeshi

2006-11-01

Vibrio parahaemolyticus RIMD2210633 has two sets of type IV-A pilus genes. One set is similar to that found in other Gram-negative bacteria, such as Pseudomonas aeruginosa, Vibrio cholerae (chitin-regulated pilus; ChiRP), and Vibrio vulnificus. The other is homologous to the genes for the mannose-sensitive hemagglutinin (MSHA) pilus. In this study, we analyzed the effects of the deletions in the pilin genes for each type IV pilus (the ChiRP and the MSHA pilus) on biofilm formation. Although the MSHA pilin mutant formed aggregates, the number of bacteria that attached directly to the coverslip was reduced, suggesting that this pilus contributes to the bacterial attachment to the surface of the coverslip. In contrast, the ChiRP mutant attached to the surface of the coverslip, but did not form aggregates, suggesting that ChiRP plays a role in bacterial agglutination during biofilm formation. These results suggest that the two type IV pili of V. parahaemolyticus contribute to biofilm formation in different ways. Both mutants showed a lower fitness for adsorption onto chitin particles than that of the wild type. Collectively, these data suggest that the use of two type IV pili is a refined strategy of V. parahaemolyticus for survival in natural environments.

A Split-Luciferase-Based Trimer Formation Assay as a High-throughput Screening Platform for Therapeutics in Alport Syndrome.

PubMed

Omachi, Kohei; Kamura, Misato; Teramoto, Keisuke; Kojima, Haruka; Yokota, Tsubasa; Kaseda, Shota; Kuwazuru, Jun; Fukuda, Ryosuke; Koyama, Kosuke; Matsuyama, Shingo; Motomura, Keishi; Shuto, Tsuyoshi; Suico, Mary Ann; Kai, Hirofumi

2018-05-17

Alport syndrome is a hereditary glomerular disease caused by mutation in type IV collagen α3-α5 chains (α3-α5(IV)), which disrupts trimerization, leading to glomerular basement membrane degeneration. Correcting the trimerization of α3/α4/α5 chain is a feasible therapeutic approach, but is hindered by lack of information on the regulation of intracellular α(IV) chain and the absence of high-throughput screening (HTS) platforms to assess α345(IV) trimer formation. Here, we developed sets of split NanoLuc-fusion α345(IV) proteins to monitor α345(IV) trimerization of wild-type and clinically associated mutant α5(IV). The α345(IV) trimer assay, which satisfied the acceptance criteria for HTS, enabled the characterization of intracellular- and secretion-dependent defects of mutant α5(IV). Small interfering RNA-based and chemical screening targeting the ER identified several chemical chaperones that have potential to promote α345(IV) trimer formation. This split luciferase-based trimer formation assay is a functional HTS platform that realizes the feasibility of targeting α345(IV) trimers to treat Alport syndrome. Copyright © 2018 Elsevier Ltd. All rights reserved.

Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.

PubMed

Lassak, Kerstin; Ghosh, Abhrajyoti; Albers, Sonja-Verena

2012-01-01

Archaea have evolved fascinating surface structures allowing rapid adaptation to changing environments. The archaeal surface appendages display such diverse biological roles as motility, adhesion, biofilm formation, exchange of genetic material and species-specific interactions and, in turn, increase fitness of the cells. Intriguingly, despite sharing the same functions with their bacterial counterparts, the assembly mechanism of many archaeal surface structures is rather related to assembly of bacterial type IV pili. This review summarizes our state-of-the-art knowledge about unique structural and biochemical properties of archaeal surface appendages with a particular focus on archaeal type IV pili-like structures. The latter comprise not only widely distributed archaella (formerly known as archaeal flagella), but also different highly specialized archaeal pili, which are often restricted to certain species. Recent findings regarding assembly mechanisms, structural aspects and physiological roles of these type IV pili-like structures will be discussed in detail. Recently, first regulatory proteins involved in transition from both planktonic to sessile lifestyle and in assembly of archaella were identified. To conclude, we provide novel insights into regulatory mechanisms underlying the assembly of archaeal surface structures. Copyright © 2012. Published by Elsevier Masson SAS.

Sorption of Ferrioxime B to Synthetic and Biogenic layer type Mn Oxides

NASA Astrophysics Data System (ADS)

Duckworth, O. W.; Bargar, J. R.; Sposito, G.

2005-12-01

Siderophores are biogenic chelating agents produced in terrestrial and marine environments to increase the bioavailablity of ferric iron. Recent work has suggested that both aqueous and solid-phase Mn(III) may affect siderophore-mediated iron transport, but no information appears to be available about the effect of solid-phase Mn(IV). To probe the effect of solid-phase Mn(IV), we studied the sorption reaction of ferrioxamine B [principally the species, Fe(III)HDFOB+, an Fe(III) chelate of the trihydroxamate siderophore, desferrioxamine B (DFOB)] with two synthetic birnessites [layer type Mn(IV) oxides] and a biogenic birnessite produced by Pseudomonas putida MnB1. We found that all of these predominantly Mn(IV) oxides greatly reduced the aqueous concentration of Fe(III)HDFOB+ over the pH range between 5 and 9. After 72 h equilibration time at pH 8, the sorption behavior for the synthetic birnessites could be accurately described by a Langmuir isotherm; for the biogenic oxide, a Freundlich isotherm was best utilized to model the sorption data. To study the molecular nature of the interaction between the Fe(III)HDFOB+ complex and the oxide surface, Fe K-edge extended X-Ray absorption fine structure (EXAFS) spectroscopy was employed. Analysis of the X-ray absorption spectra indicated that Fe(III) associated with the Mn(IV) oxides is not complexed with DFOB, but instead is incorporated into the mineral structure, thus implying that the Mn(IV) oxides displaced Fe(III) from the siderophore complex. These results indicate that manganese oxides, including biominerals, may strongly sequester iron from soluble ferric complexes and thus may play a significant role in the biogeochemical cycling of iron.

Sorption of Ferric Iron from Ferrioxamine B to Synthetic and Biogenic Layer Type Manganese Oxides

NASA Astrophysics Data System (ADS)

Duckworth, O.; John, B.; Sposito, G.

2006-12-01

Siderophores are biogenic chelating agents produced in terrestrial and marine environments to increase the bioavailablity of ferric iron. Recent work has suggested that both aqueous and solid-phase Mn(III) may affect siderophore-mediated iron transport, but no information appears to be available about the effect of solid-phase Mn(IV). To probe the effects of predominantly Mn(IV) oxides, we studied the sorption reaction of ferrioxamine B [Fe(III)HDFOB+, an Fe(III) chelate of the trihydroxamate siderophore desferrioxamine B (DFOB)] with two synthetic birnessites [layer type Mn(III, IV) oxides] and a biogenic birnessite produced by Pseudomonas putida MnB1. We found that all of these predominantly Mn(IV) oxides greatly reduced the aqueous concentration of Fe(III)HDFOB+ over at pH 8. After 72 hours equilibration time, the sorption behavior for the synthetic birnessites could be accurately described by a Langmuir isotherm; for the biogenic oxide, a Freundlich isotherm was best utilized to model the sorption data. To study the molecular nature of the interaction between the Fe(III)HDFOB+ complex and the oxide surface, Fe K-edge extended X-ray absorption fine structure (EXAFS) spectroscopy was employed. Analysis of the EXAFS spectra indicated that Fe(III) associated with the Mn(IV) oxides is not complexed by DFOB as in solution, but instead Fe(III) is specifically adsorbed to into the mineral structure at multiple sites with no evidence of DFOB complexation, thus indicating that the Mn(IV) oxides displaced Fe(III) from the siderophore complex. These results indicate that manganese oxides, including biominerals, may strongly sequester iron from soluble ferric complexes and thus may play a significant role in the biogeochemical cycling of iron in marine and terrestrial environments.

Root canal morphology of South Asian Indian maxillary molar teeth

PubMed Central

Singh, Shishir; Pawar, Mansing

2015-01-01

Objective: The objective was to study the root canal morphology of South Asian Indian Maxillary molars using a tooth clearing technique. Materials and Methods: Hundred teeth each comprising of first, second, and third molars collected from different dental schools and clinics in India were subjected to standard dye penetration, decalcification and clearing procedure before being studied. Results: The first molar mesiobuccal roots exhibited 69% Type I, 24% Type II, 4% Type IV, 2% Type V, and 1% exhibited a Vertuccis Type VIII canal anatomy. In the group with three separate roots the second molar mesiobuccal roots in exhibited 80.6% Type I, 15.3% Type II, 2.7% Type IV, and 1.4% Type V canal anatomy while the third molars mesiobuccal roots exhibited 57.4% Type I, 32% Type II, 2.1% Type III, 8.5% Type IV, 1% had a Type V canal anatomy in the similar group. Conclusion: A varied root canal anatomy was seen in the mesiobuccal root canal of the maxillary molars. PMID:25713497

Evaluation of magnifying colonoscopy in the diagnosis of serrated polyps.

PubMed

Ishigooka, Shinya; Nomoto, Masahito; Obinata, Nobuyuki; Oishi, Yoshichika; Sato, Yoshinori; Nakatsu, Satoko; Suzuki, Midori; Ikeda, Yoshiko; Maehata, Tadateru; Kimura, Tomoaki; Watanabe, Yoshiyuki; Nakajima, Takashi; Yamano, Hiro-o; Yasuda, Hiroshi; Itoh, Fumio

2012-08-28

To elucidate the colonoscopic features of serrated lesions of the colorectum using magnifying colonoscopy. Broad division of serrated lesions of the colorectum into hyperplastic polyps (HPs), traditional serrated adenomas (TSAs), and sessile serrated adenomas/polyps (SSA/Ps) has been proposed on the basis of recent molecular biological studies. However, few reports have examined the colonoscopic features of these divisions, including magnified colonoscopic findings. This study examined 118 lesions excised in our hospital as suspected serrated lesions after magnified observation between January 2008 and September 2011. Patient characteristics (sex, age), conventional colonoscopic findings (location, size, morphology, color, mucin) and magnified colonoscopic findings (pit pattern diagnosis) were interpreted by five colonoscopists with experience in over 1000 colonoscopies, and were compared with histopathological diagnoses. The pit patterns were categorized according to Kudo's classification, but a more detailed investigation was also performed using the subclassification [type II-Open (type II-O), type II-Long (type II-L), or type IV-Serrated (type IV-S)] proposed by Kimura T and Yamano H. Lesions comprised 23 HPs (23/118: 19.5%), 39 TSAs (39/118: 33.1%: with cancer in one case), 50 SSA/Ps (50/118: 42.4%: complicated with cancer in three cases), and six others (6/118: 5.1%). We excluded six others, including three regular adenomas, one hamartoma, one inflammatory polyp, and one juvenile polyp for further analysis. Conventional colonoscopy showed that SSA/Ps were characterized as larger in diameter than TSAs and HPs (SSA/P vs HP, 13.62 ± 8.62 mm vs 7.74 ± 3.24 mm, P < 0.001; SSA/Ps vs TSA, 13.62 ± 8.62 mm vs 9.89 ± 5.73 mm, P < 0.01); common in the right side of the colon [HPs, 30.4% (7/23): TSAs, 20.5% (8/39): SSA/P, 84.0% (42/50), P < 0.001]; flat-elevated lesion [HPs, 30.4% (7/23): TSAs, 5.1% (2/39): SSA/Ps, 90.0% (45/50), P < 0.001]; normal-colored or pale imucosa [HPs, 34.8% (8/23): TSAs, 10.3% (4/39): SSA/Ps, 80% (40/50), P < 0.001]; and with large amounts of mucin [HPs, 21.7% (5/23): TSAs, 17.9% (7/39): SSA/Ps, 72.0% (36/50), P < 0.001]. In magnified colonoscopic findings, 17 lesions showed either type II pit pattern alone or partial type II pit pattern as the basic architecture, with 14 HPs (14/17, 70.0%) and 3 SSA/Ps. Magnified colonoscopy showed the type II-O pit pattern as characteristic of SSA/Ps [sensitivity 83.7% (41/49), specificity 85.7% (54/63)]. Cancer was also present in three lesions, in all of which a type VI pit pattern was also present within the same lesion. There were four HPs and four TSAs each. The type IV-S pit pattern was characteristic of TSAs [sensitivity 96.7% (30/31), specificity 89.9% (72/81)]. Cancer was present in one lesion, in which a type VI pit pattern was also present within the same lesion. In our study, serrated lesions of the colorectum also possessed the features described in previous reports of conventional colonoscopic findings. The pit pattern diagnosis using magnifying colonoscopy, particularly magnified colonoscopic findings using subclassifications of surface architecture, reflected the pathological characteristics of SSA/Ps and TSAs, and will be useful for colonoscopic diagnosis. We suggest that this system could be a good diagnostic tool for SSA/Ps using magnifying colonoscopy.

A CFD modeling study of the impacts of NO x and VOC emissions on reactive pollutant dispersion in and above a street canyon

NASA Astrophysics Data System (ADS)

Kwak, Kyung-Hwan; Baik, Jong-Jin

2012-01-01

A computational fluid dynamics (CFD) model that includes the carbon bond mechanism IV (CBM-IV) is developed and used to investigate reactive pollutant dispersion in and above a street canyon with an aspect ratio of 1. Fourteen emission scenarios of NO x and volatile organic compounds (VOCs) are considered. Dispersion types are classified into NO-type, NO 2-type, and O 3-type dispersion that exhibit concentration maxima at the street bottom, near the center of the street canyon, and above the street canyon, respectively. For the base emission scenario, the number of reactive species is 9 in the NO-type dispersion, 10 in the NO 2-type dispersion, and 15 in the O 3-type dispersion. As the NO x emission level decreases or the VOC emission level increases, some species in the O 3-type dispersion are shifted to the NO 2-type dispersion. The VOC-to-NO x emission ratio is found to be an important factor in determining the transition of dispersion type. In this transition process, OH plays a key role through a radical chain including HO 2, RO, and RO 2. Because of their high OH reactivities, XYL (xylene) and OLE (olefin carbon bond) among VOCs are largely responsible for the transition of dispersion type. The O 3 sensitivity is examined by reducing NO x or VOC emission level by a half. Because the NO titration of O 3 is more pronounced than the NO 2 photolysis and the radical chain process in the street canyon, the O 3 concentration therein is negatively correlated with the NO x emission level and weakly correlated with the VOC emission level. As a result, the street canyon is a negatively NO x-sensitive regime.

Visualisation of Rouviere's Sulcus during Laparoscopic Cholecystectomy.

PubMed

Thapa, P B; Maharjan, D K; Tamang, T Y; Shrestha, S K

2015-01-01

Safe dissection of Calot's Triangle is important during the performance of laparascopic cholucystectomy. The purpose of the study is to determine the frequency of demonstrable Rouviere's sulcus in patients with symptomatic gall stones and its role in safe dissection in Calot's triangle. This is a prospective descriptive study design done in Department of surgery, Kathmandu Medical College Teaching Hospital from Jan 2013 to Jan 2015. Patients who were posted for laparoscopic cholecystectomy were included. During laparoscopy, Rouviere's sulcus was noted in the operative note and classified according to following: Type I: Open type was defined as a cleft in which the right hepatic pedicle was visualized and the sulcus was opened throughout its length. Type II: if the sulcus was open only at its lateral end. Type III If the sulcus was open only at its medial end. Type IV: Fused type was defined as one in which the pedicle was not visualized.  A total of 200 patients underwent laparoscopic cholecystectomy during period of 2 years. Out of which Rouviere's sulcus was visualized in 150 patients (75 %).Type I (open type) was commoner in 54%, type II in 12%, Type III in 9% and type IV (fused type) in 25%. Rouviere's Sulcus is an important extra biliary land mark for safe dissection of Calot's triangle during laparoscopic cholecystectomy.  Rouviere's Sulcus, Laparoscopic cholecystectomy, Bile duct injury.

[Patients' perspective and economic variables as objectives in clinical trials: added value to clinical parameters].

PubMed

Bovaira-García, M J; Soler-Company, E

2012-01-01

Patient-reported outcome (PRO) measures complement traditional biomedical outcome measures. The purpose of this study was to evaluate the use of PRO measures including health-related quality of life (HRQoL) questionnaires as a measurement of efficacy and the frequency of inclusion of economic variables related to direct and indirect costs in the design of clinical trials and phase IV observational studies. Moreover, for the trials quality score were measured, and if there were any relationship between the quality study design score and the PRO inclusion. Retrospective observational study of the clinical trials and phase IV observational studies approved by a Clinical Research Ethics Committee (2008-2010). We gathered data concerning general aspects including medical specialty, pathology, methodological quality based on Jadad scale (0-5), inclusion of PRO and economic variables. For clinical trials including HRQoL measurements, we analysed the type of questionnaire in use. Where there were no HRQoL measurements, we analysed if their inclusion would have been proper or not. A total of 70 protocols (59 CTs and 11 phase IV observational studies) were analysed; 37 (52.8%) included PRO measures, and 3 protocols (4.3%) used them as a primary endpoint. Data analysis by therapeutic area showed that PRO measures were most commonly studied in the fields of endocrinology, neurology, digestive diseases, and cardiology. The average quality score for the trials was 2.8. The trials with more PRO inclusion in their end points had a significantly higher quality score. Only 13 (22%) clinical trials and 2 (18.2%) phase IV observational studies included economic variables. The emergence of economic variables in clinical trials and phase IV observational studies evaluated was low, however, more than half of the revised protocols have included PRO measures, reflecting the importance of these parameters in the assessment of the effectiveness of drug treatments, although its use is still not systematic. Copyright © 2011 SECA. Published by Elsevier Espana. All rights reserved.

Oral cryotherapy reduces mucositis and opioid use after myeloablative therapy--a randomized controlled trial.

PubMed

Svanberg, Anncarin; Birgegård, Gunnar; Ohrn, Kerstin

2007-10-01

Mucositis is a major complication in myeloablative therapy, which often necessitates advanced pharmacological pain treatment, including i.v. opioids. Attempts to prevent oral mucositis have included oral cryotherapy, which has been shown to reduce mucositis, but there is a lack of knowledge concerning the effect of oral cryotherapy on opioid use by reducing the mucositis for patients treated with myeloablative therapy before bone marrow transplantation (BMT). The aim of the present study was to evaluate if oral cryotherapy could delay or alleviate the development of mucositis and thereby reduce the number of days with i.v. opioids among patients who receive myeloablative therapy before BMT. Eighty patients 18 years and older, scheduled for BMT, were included consecutively and randomised to oral cryotherapy or standard oral care. A stratified randomisation was used with regard to type of transplantation. Intensity of pain, severity of mucositis and use of opioids were recorded using pain visual analogue scale (VAS) scores, mucositis index scores and medical and nursing charts. This study showed that patients receiving oral cryotherapy had less pronounced mucositis and significantly fewer days with i.v. opioids than the control group. In the autologous setting, cryotherapy patients also needed significantly lower total dose of opioids. Oral cryotherapy is an effective and well-tolerated therapy to alleviate mucositis and consequently reduce the number of days with i.v. opioids among patients treated with myeloablative therapy before BMT.

Efficacy of Guanfacine Extended Release in the Treatment of Combined and Inattentive Only Subtypes of Attention-Deficit/Hyperactivity Disorder

PubMed Central

Kollins, Scott H.; Wigal, Timothy L.

2012-01-01

Abstract Background Extended-release guanfacine (GXR) is approved for the treatment of attention-deficit/hyperactivity disorder (ADHD) in children and adolescents aged 6–17 years. This post-hoc analysis further examines the effects of GXR on hyperactivity-impulsivity and inattentiveness. Method Data from two large double-blind placebo-controlled pivotal trials of GXR in the treatment of ADHD were analyzed. Using the pooled population to provide sufficient sample size and associated statistical power, the impact of GXR treatment on core ADHD symptoms was examined by comparing ADHD Rating Scale IV (ADHD-RS-IV) total scores in the overall GXR and placebo groups in subjects with each of the three ADHD subtypes. ADHD-RS-IV Hyperactivity-Impulsivity and Inattentiveness subscale scores in the overall study population by randomized dose group (vs. placebo) were also examined. Results The full analysis set included 631 subjects aged 6–17 years (GXR: n=490; placebo: n=141). Among subjects with the predominantly inattentive subtype of ADHD, differences in least squares (LS) mean reductions from baseline in ADHD-RS-IV total scores were significantly greater in GXR-treated subjects (n=127) than in placebo-treated subjects (n=38) at treatment weeks 3 through 5 and end point (p≤0.020). Among subjects with combined type ADHD, differences in LS mean ADHD-RS-IV total score reductions from baseline were significantly greater in the GXR group (n=354) than in the placebo group (n=100) at treatment weeks 1 through 5 and end point (p≤0.011). The dearth of predominantly hyperactive-impulsive type subjects (n=12) precluded analysis of this subgroup. Each randomized GXR dose group in each trial demonstrated significantly greater reductions from baseline in ADHD-RS-IV Hyperactivity-Impulsivity and Inattentiveness subscale scores than did the respective placebo group at end point (p≤0.05 for all). Conclusions The results support the use of GXR in the treatment of core ADHD symptoms as defined in the American Psychiatric Association Diagnostic and Statistical Manual of Mental Disorders, 4th ed., Text Revision, including hyperactivity, impulsivity, and inattention. PMID:22612526

Native structure of a type IV secretion system core complex essential for Legionella pathogenesis.

PubMed

Kubori, Tomoko; Koike, Masafumi; Bui, Xuan Thanh; Higaki, Saori; Aizawa, Shin-Ichi; Nagai, Hiroki

2014-08-12

Bacterial type IV secretion systems are evolutionarily related to conjugation systems and play a pivotal role in infection by delivering numerous virulence factors into host cells. Using transmission electron microscopy, we report the native molecular structure of the core complex of the Dot/Icm type IV secretion system encoded by Legionella pneumophila, an intracellular human pathogen. The biochemically isolated core complex, composed of at least five proteins--DotC, DotD, DotF, DotG, and DotH--has a ring-shaped structure. Intriguingly, morphologically distinct premature complexes are formed in the absence of DotG or DotF. Our data suggest that DotG forms a central channel spanning inner and outer membranes. DotF, a component dispensable for type IV secretion, plays a role in efficient embedment of DotG into the functional core complex. These results highlight a common scheme for the biogenesis of transport machinery.

Polyvalent type IV sensitizations to multiple fragrances and a skin protection cream in a metal worker.

PubMed

Tanko, Zita; Shab, Arna; Diepgen, Thomas Ludwig; Weisshaar, Elke

2009-06-01

Fragrances are very common in everyday products. A metalworker with chronic hand eczema and previously diagnosed type IV sensitizations to epoxy resin, balsam of Peru, fragrance mix and fragrance mix II was diagnosed with additional type IV sensitizations to geraniol, hydroxycitronellal, lilial, tree moss, oak moss absolute, citral, citronellol, farnesol, Lyral, fragrance mix II and fragrance mix (with sorbitan sesquioleate). In addition, a type IV sensitization to the skin protection cream containing geraniol and citronellol used at the workplace was detected, and deemed occupationally relevant in this case. The patient could have had contact to fragrances through private use of cosmetics and detergents. On the other hand, the fragrance-containing skin protection cream supports occupational exposure. This case report demonstrates that fragrance contact allergy has to be searched for and clarified individually, which requires a thorough history and a detailed analysis of the work place.

Solid-phase extraction of iridium from soil and water samples by using activated carbon cloth prior to its spectrophotometric determination.

PubMed

Ozkantar, Nebiye; Yilmaz, Erkan; Soylak, Mustafa; Tuzen, Mustafa

2015-08-01

A solid-phase extraction method for separation and preconcentration of Ir(IV) ion by using activated carbon cloth (ACC) has been presented. Ir(IV) as their 1-(2-pyridylazo) 2-naphtol (PAN) chelate was adsorbed on ACC at pH 2.0 and was eluted from ACC with acidic dimethylformamide (DMF). The Ir(IV) concentration was determined at 536 nm as Ir(IV)-PAN complex by using UV-vis spectrophotometer. The analytical parameters including pH, sample and eluent flow rates, amount of PAN, eluent type, concentration, and sample volume were optimized. The effects of foreign ions on the recoveries of iridium were also investigated. The preconcentration factor was calculated as 60. The limit of detection (LOD) and the limit of quantification (LOQ) of the method were found as 0.039 and 0.129 μg L(-1), respectively. The method was applied to soil and water samples for iridium determination.

7 CFR 1945.21 - Reporting and coordination requirements.

Code of Federal Regulations, 2011 CFR

2011-01-01

.../notification; (iii) Disaster number; (iv) Type of disaster; (v) Incidence period; and (vi) Termination date for... victims; (4) Make appropriate public announcements, including notices in Indian Tribal Council(s) news media. However, if the declaration was by the President, under § 1945.20(a) of this subpart, news...

7 CFR 766.108 - Reamortization.

Code of Federal Regulations, 2011 CFR

2011-01-01

... at the time of reamortization. (2) The Agency adds protective advances for the payment of real estate... eligible for reamortization. The Agency may reamortize loans made for real estate purposes, including FO... (iv), or the useful life of the security, whichever is less. (i) FO, SW, RL, EE real estate-type, and...

40 CFR 63.1590 - What reports must I submit?

Code of Federal Regulations, 2013 CFR

2013-07-01

... will be used for determining continuing compliance; (iv) The type and quantity of HAP emitted by your... this part, including a notification of performance tests; a performance test report; a startup... must also submit a startup, shutdown, and malfunction report. [64 FR 57579, Oct. 26, 1999, as amended...

40 CFR 63.1590 - What reports must I submit?

Code of Federal Regulations, 2014 CFR

2014-07-01

... will be used for determining continuing compliance; (iv) The type and quantity of HAP emitted by your... this part, including a notification of performance tests; a performance test report; a startup... must also submit a startup, shutdown, and malfunction report. [64 FR 57579, Oct. 26, 1999, as amended...

40 CFR 63.1590 - What reports must I submit?

Code of Federal Regulations, 2012 CFR

2012-07-01

... will be used for determining continuing compliance; (iv) The type and quantity of HAP emitted by your... this part, including a notification of performance tests; a performance test report; a startup... must also submit a startup, shutdown, and malfunction report. [64 FR 57579, Oct. 26, 1999, as amended...

20 CFR 645.235 - What types of activities are subject to the administrative cost limit on Welfare-to-Work grants?

Code of Federal Regulations, 2010 CFR

2010-04-01

... WtW including: (i) Accounting, budgeting, financial and cash management functions; (ii) Procurement and purchasing functions; (iii) Property management functions; (iv) Personnel management functions; (v... administrative functions (for example, personnel, procurement, purchasing, property management, accounting and...

Opioid use in knee arthroplasty after receiving intravenous acetaminophen.

PubMed

Kelly, Jennifer S; Opsha, Yekaterina; Costello, Jennifer; Schiller, Daryl; Hola, Eric T

2014-12-01

Intravenous (IV) acetaminophen may be an effective component of multimodal postoperative pain management. The primary objective of this study was to evaluate the impact of IV acetaminophen on total opioid use in postoperative patients. The secondary objective was to evaluate the effect of IV acetaminophen on hospital length of stay. This retrospective, case-control study evaluated the impact of IV acetaminophen on total opioid use in surgical patients. Patients were included if they received at least one perioperative dose of IV acetaminophen and underwent a surgical knee procedure. Controls were matched and randomly selected based on procedure type, age, and severity of illness. Postoperative opioids were converted into oral morphine equivalents, and overall use was compared between groups. One hundred patients were enrolled, with 25 patients receiving IV acetaminophen and 75 matched controls. A total of 135 mg versus 112.5 mg oral morphine equivalents were used in the IV acetaminophen group and control group, respectively (p=0.987). There were 45 mg/day oral morphine equivalents used in the IV acetaminophen group versus 37.5 mg in the control group (p=0.845). The median hospital length of stay in both groups was 3 days (p=0.799). IV acetaminophen did not significantly decrease postoperative opioid use in patients who underwent surgical knee procedures. In addition, there was a nonsignificant trend toward increased opioid use in the IV acetaminophen group. There was no significant difference in hospital length of stay between the IV acetaminophen group and the control group. These findings require further study in larger patient populations and in other orthopedic procedures that typically require longer hospital stays. © 2014 Pharmacotherapy Publications, Inc.

Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli*

PubMed Central

Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

2015-01-01

Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. PMID:26324721

Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli.

PubMed

Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

2015-10-23

Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

[Analysis of the parental origin of MECP2 mutations in patients with Rett syndrome].

PubMed

Zhang, Jing-jing; Bao, Xin-hua; Cao, Guang-na; Jiang, Sheng-ling; Zhu, Xing-wang; Lu, Hong-mei; Jia, Li-fang; Pan, Hong; Wu, Xi-ru

2010-04-01

To identify the parental origin of methyl-CpG-binding protein 2 (MECP2) gene mutations in Chinese patients with Rett syndrome. Single nucleotide polymorphisms (SNPs) in intron 3 of the MECP2 gene were analyzed by PCR and sequencing in 115 patients with Rett syndrome. Then sequencing of the SNP region was performed for the fathers of the patients who had at least one SNP, to determine which allele was from the father. Then allele-specific PCR was performed and the products were sequenced to see whether the allele from father or mother harbored the mutation. Seventy-six of the 115 patients had at least one SNP. Three hot SNPs were found in these patients. They were: IVS3+22C >G, IVS3+266C >T and IVS3+683C>T. Among the 76 cases, 73 had a paternal origin of MECP2 mutations, and the other 3 had a maternal origin. There were multiple types of MECP2 mutation of the paternal origin, including 4 frame shift, 2 deletion and 67 point (56C >T, 6C >G, 2A >G, 2G >T and 1A >T) mutations. The mutation types of the 3 patients with maternal origin included 2 frame shift and 1 point (C >T) mutation. In Chinese RTT patients, the MECP2 mutations are mostly of paternal origin.

Fractures and mortality in relation to different osteoporosis treatments.

PubMed

Yun, Huifeng; Delzell, Elizabeth; Saag, Kenneth G; Kilgore, Meredith L; Morrisey, Michael A; Muntner, Paul; Matthews, Robert; Guo, Lingli; Wright, Nicole; Smith, Wilson; Colón-Emeric, Cathleen; O'Connor, Christopher M; Lyles, Kenneth W; Curtis, Jeffrey R

2015-01-01

Few studies have assessed the effectiveness of different drugs for osteoporosis (OP). We aimed to determine if fracture and mortality rates vary among patients initiating different OP medications. We used the Medicare 5% sample to identify new users of intravenous (IV) zoledronic acid (n=1.674), oral bisphosphonates (n=32.626), IV ibandronate (n=492), calcitonin (n=2.606), raloxifene (n=1.950), or parathyroid hormone (n=549). We included beneficiaries who were ≥65 years of age, were continuously enrolled in fee-for-service Medicare and initiated therapy during 2007-2009. Outcomes were hip fracture, clinical vertebral fracture, and all-cause mortality, identified using inpatient and physician diagnosis codes for fracture, procedure codes for fracture repair, and vital status information. Cox regression models compared users of each medication to users of IV zoledronic acid, adjusting for multiple confounders. During follow-up (median, 0.8-1.5 years depending on the drug), 787 subjects had hip fractures, 986 had clinical vertebral fractures, and 2.999 died. Positive associations included IV ibandronate with hip fracture (adjusted hazard ratio (HR), 2.37; 95% confidence interval (CI) 1.25-4.51), calcitonin with vertebral fracture (HR=1.59, 95%CI 1.04-2.43), and calcitonin with mortality (HR=1.31; 95%CI 1.02-1.68). Adjusted HRs for other drug-outcome comparisons were not statistically significant. IV ibandronate and calcitonin were associated with higher rates of some types of fracture when compared to IV zolendronic acid. The relatively high mortality associated with use of calcitonin may reflect the poorer health of users of this agent.

Environmentally Benign Aircraft Anti-icing and Deicing Fluids Based on Cost Effective, Bio-based Ingredients

DTIC Science & Technology

2012-09-01

xanthan gum, welan gum, or carraggenan gum.(13) Examples of particulate thickeners include lightly cross-linked polyacrylic acid. Both types of ...based formulation.(14) The currently used Type IV AAFs are believed to primarily use polyacrylic acid (PAA) polymer, stabilized by potassium ...Prescribed by ANSI-Std Z39-18 REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public reporting burden for this collection of information

On the type Ia supernovae 2007on and 2011iv: evidence for Chandrasekhar-mass explosions at the faint end of the luminosity-width relationship

NASA Astrophysics Data System (ADS)

Ashall, C.; Mazzali, P. A.; Stritzinger, M. D.; Hoeflich, P.; Burns, C. R.; Gall, C.; Hsiao, E. Y.; Phillips, M. M.; Morrell, N.; Foley, Ryan J.

2018-06-01

Radiative transfer models of two transitional type Ia supernovae (SNe Ia) have been produced using the abundance stratification technique. These two objects - designated SN 2007on and SN 2011iv - both exploded in the same galaxy, NGC 1404, which allows for a direct comparison. SN 2007on synthesized 0.25 M_{⊙} of 56Ni and was less luminous than SN 2011iv, which produced 0.31 M_{⊙} of 56Ni. SN 2007on had a lower central density (ρc) and higher explosion energy (Ekin ˜1.3 ± 0.3 × 1051erg) than SN 2011iv, and it produced less nuclear statistical equilibrium (NSE) elements (0.06 M_{⊙}). Whereas, SN 2011iv had a larger ρc, which increased the electron capture rate in the lowest velocity regions, and produced 0.35 M_{⊙} of stable NSE elements. SN 2011iv had an explosion energy of ˜Ekin ˜0.9 ± 0.2 × 1051erg. Both objects had an ejecta mass consistent with the Chandrasekhar mass (Ch-mass), and their observational properties are well described by predictions from delayed-detonation explosion models. Within this framework, comparison to the sub-luminous SN 1986G indicates SN 2011iv and SN 1986G have different transition densities (ρtr) but similar ρc. Whereas SN 1986G and SN 2007on had a similar ρtr but different ρc. Finally, we examine the colour-stretch parameter sBV versus Lmax relation and determine that the bulk of SNe Ia (including the sub-luminous ones) are consistent with Ch-mass delayed-detonation explosions, where the main parameter driving the diversity is ρtr. We also find ρc to be driving the second-order scatter observed at the faint end of the luminosity-width relationship.

Spatial and Functional Relationships Among Pol V-Associated loci, Pol IV-Dependent siRNAs, and Cytosine Methylation in the Arabidopsis Epigenome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop

2012-08-15

Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less

Contribution of type IV pili to the virulence of Aeromonas salmonicida subsp. salmonicida in Atlantic salmon (Salmo salar L.).

PubMed

Boyd, Jessica M; Dacanay, Andrew; Knickle, Leah C; Touhami, Ahmed; Brown, Laura L; Jericho, Manfred H; Johnson, Stewart C; Reith, Michael

2008-04-01

Aeromonas salmonicida subsp. salmonicida, a bacterial pathogen of Atlantic salmon, has no visible pili, yet its genome contains genes for three type IV pilus systems. One system, Tap, is similar to the Pseudomonas aeruginosa Pil system, and a second, Flp, resembles the Actinobacillus actinomycetemcomitans Flp pilus, while the third has homology to the mannose-sensitive hemagglutinin pilus of Vibrio cholerae. The latter system is likely nonfunctional since eight genes, including the gene encoding the main pilin subunit, are deleted compared with the orthologous V. cholerae locus. The first two systems were characterized to investigate their expression and role in pathogenesis. The pili of A. salmonicida subsp. salmonicida were imaged using atomic force microscopy and Tap- and Flp-overexpressing strains. The Tap pili appeared to be polar, while the Flp pili appeared to be peritrichous. Strains deficient in tap and/or flp were used in live bacterial challenges of Atlantic salmon, which showed that the Tap pilus made a moderate contribution to virulence, while the Flp pilus made little or no contribution. Delivery of the tap mutant by immersion resulted in reduced cumulative morbidity compared with the cumulative morbidity observed with the wild-type strain; however, delivery by intraperitoneal injection resulted in cumulative morbidity similar to that of the wild type. Unlike the pili of other piliated bacterial pathogens, A. salmonicida subsp. salmonicida type IV pili are not absolutely required for virulence in Atlantic salmon. Significant differences in the behavior of the two mutant strains indicated that the two pilus systems are not redundant.

Neurons of human nucleus accumbens.

PubMed

Sazdanović, Maja; Sazdanović, Predrag; Zivanović-Macuzić, Ivana; Jakovljević, Vladimir; Jeremić, Dejan; Peljto, Amir; Tosevski, Jovo

2011-08-01

Nucleus accumbens is a part of the ventral striatum also known as a drug active brain region, especially related with drug addiction. The aim of the study was to investigate the Golgi morphology of the nucleus accumbens neurons. The study was performed on the frontal and sagittal sections of 15 human brains by the Golgi Kopsch method. We classified neurons in the human nucleus accumbens according to their morphology and size into four types: type I--fusiform neurons; type II--fusiform neurons with lateral dendrite, arising from a part of the cell body; type III--pyramidal-like neuron; type IV--multipolar neuron. The medium spiny neurons, which are mostly noted regarding to the drug addictive conditions of the brain, correspond to the type IV--multipolar neurons. Two regions of human nucleus accumbens could be clearly recognized on Nissl and Golgi preparations each containing different predominant neuronal types. Central part of nucleus accumbens, core region, has a low density of impregnated neurons with predominant type III, pyramidal-like neurons, with spines on secondary branches and rare type IV, multipolar neurons. Contrary to the core, peripheral region, shell of nucleus, has a high density of impregnated neurons predominantly contained of type I and type IV--multipolar neurons, which all are rich in spines on secondary and tertiary dendritic branches. Our results indicate great morphological variability of human nucleus accumbens neurons. This requires further investigations and clarifying clinical significance of this important brain region.

[Surgical management, prognostic factors, and outcome in hepatic trauma].

PubMed

Ott, R; Schön, M R; Seidel, S; Schuster, E; Josten, C; Hauss, J

2005-02-01

Hepatic trauma is a rare surgical emergency with significant morbidity and mortality. Extensive experience in liver surgery is a prerequisite for the management of these injuries. The medical records of 68 consecutive patients with hepatic trauma were retrospectively reviewed for the severity of liver injury, management, morbidity, mortality, and risk factors. Of the patients, 14 were treated conservatively and 52 surgically (24 suture/fibrin glue, 16 perihepatic packing, 11 resections, 1 liver transplantation). Two patients died just before emergency surgery could be performed. Overall mortality was 21% (14/68), and 13, 14, 6, 27, and 50% for types I, II, III, IV, and V injuries, respectively. Only nine deaths (all type IV and V) were liver related, while four were caused by extrahepatic injuries and one by concomitant liver cirrhosis. With respect to treatment, conservative management, suture, and resection had a low mortality of 0, 4, and 9%, respectively. In contrast, mortality was 47% in patients in whom only packing was performed (in severe injuries). Stepwise multivariate regression analysis proved prothrombin values <40%, ISS scores >30, and transfusion requirements of more than 10 red packed cells to be significant risk factors for post-traumatic death. Type I-III hepatic injuries can safely be treated by conservative or simple surgical means. However, complex hepatic injuries (types IV and V) carry a significant mortality and may require hepatic surgery, including liver resection or even transplantation. Therefore, patients with severe hepatic injuries should be treated in a specialized institution.

Heterogeneity in Positive Predictive Value of RAS Mutations in Cytologically Indeterminate Thyroid Nodules.

PubMed

Nabhan, Fadi; Porter, Kyle; Lupo, Mark A; Randolph, Gregory W; Patel, Kepal N; Kloos, Richard T

2018-06-01

RAS mutations are common in the available mutational analysis of cytologically indeterminate (Cyto-I) thyroid nodules. However, their reported positive predictive value (PPV) for cancer is widely variable. The reason for this variability is unknown, and it causes clinical management uncertainty. A systematic review was performed, evaluating the PPV for cancer in RAS mutation positive Cyto-I nodules, and variables that might affect residual heterogeneity across the different studies were considered. PubMed was searched through February 22, 2017, including studies that evaluated at least one type of RAS mutation in Cyto-I nodules, including any (or all) of the Bethesda III/IV/V categories or their equivalents and where the histological diagnosis was available. The PPV residual heterogeneity was investigated after accounting for Bethesda classification, blindedness of the histopathologist to the RAS mutational status, Bethesda category-specific cancer prevalence for each study, and which RAS genes and codons were tested. This was studied using five meta-regression models fit to different sets of Bethesda classification categories: Bethesda III, IV, or V (III/IV/V); Bethesda III or IV (III/IV); Bethesda III only; Bethesda IV only; and Bethesda V only. Of 1831 studies, 23 were eligible for data inclusion. Wide ranges of PPV were found at 0-100%, 28-100%, and 0-100% in Bethesda III, IV, and V, respectively. Residual heterogeneity remained moderately high for PPV after accounting for the above moderators for Bethesda III/IV/V (21 studies; I 2  = 59.5%) and Bethesda III/IV (19 studies; I 2  = 66.0%), with significant Cochran's Q-test for residual heterogeneity (p < 0.001). Among individual Bethesda categories, residual heterogeneity was: Bethesda III (eight studies; I 2  = 89.0%), IV (12 studies; I 2  = 53.5%), and V (10 studies; I 2  = 34.4%), with significant Cochran's Q-test for Bethesda III (p < 0.001) and IV (p = 0.04). The PPV of RAS mutations in Bethesda III and IV categories is quite heterogeneous across different studies, creating low confidence in the accuracy of a single estimate of PPV. Clinicians must appreciate this wide variability when managing a RAS-mutated Cyto-I nodule. Future studies should seek to resolve this unexplained variability.

MORPHOLOGICAL PATTERN AND FREQUENCY OF CENTRAL NERVOUS SYSTEM TUMOURS IN CHILDREN.

PubMed

Bilqees, Fatima; Samina, Khaleeq; Mohammad, Tahir; Khaleeq-uz-Zamaan

2016-01-01

Recent studies, including a comprehensive study by National Cancer Institute, have shown that a significant increase in the incidence of childhood brain tumours makes them the most common paediatric tumour. The objectives of this study were to determine the frequency of central nervous system tumours in paediatric age group (0-12 years), and to segregate various morphologic types according to WHO classification. The study included consecutive cases of central nervous system tumours diagnosed in children in the histopathology department at Federal Government Polyclinic, PGMI, Islamabad, during a period of 4.8 years (Jan 2009-Aug 2013). The initial histopathological evaluation of these lesions was performed on H&E stained sections of paraffin embedded tissues. Special stains and immunohistochemistry were performed whenever indicated. Out of 75 cases, 34 (45.3%) were astrocytic tumours, including 16 (47.1%) Pilocytic astrocytomas (WHO Grade-I), 1 (2.9%) diffuse fibrillary astrocytoma (WHO Grade-II), 1 (2.9%) anaplastic astrocytoma (WHO Grade-III) and 16(47.1%) glioblastoma multiforme (WHO Grade-IV); 18 (24%) were embryonal tumours including 17 (94.4%) medulloblastoma (WHO Grade-IV) and 1 (5.6%) neuroblastoma (WHO Grade IV); 10 (13.3%) were craniopharyngiomas (WHO Grade-I) and 5 (6.7%) were ependymal tumours including 1 (20%) myxopapillary ependymoma (WHO Grade-I) and 4 (80%) ependymomas (WHO Grade-II). Miscellaneous entities included 3 (4%) choroid plexus tumours; 1 (2%) anaplastic oligodendroglioma (WHO Grade-III); 1 (2%) atypical meningioma (WHO Grade-II); 1 (2%) schwannoma (WHO Grade-I); 1 (2%) neurofibroma (WHO Grade-I) and 1 (2%) lipoma (WHO Grade-I). Astrocytic tumours are the most common central nervous system tumours in paediatric age group and high grade lesions (WHO Grade-IV) constitute the largest category (45.3%).

Liver fibrosis score predicts mortality in heart failure patients with preserved ejection fraction.

PubMed

Yoshihisa, Akiomi; Sato, Yu; Yokokawa, Tetsuro; Sato, Takamasa; Suzuki, Satoshi; Oikawa, Masayoshi; Kobayashi, Atsushi; Yamaki, Takayoshi; Kunii, Hiroyuki; Nakazato, Kazuhiko; Saitoh, Shu-Ichi; Takeishi, Yasuchika

2018-04-01

Heart failure with preserved ejection fraction (HFpEF) has several pathophysiological aspects, including stiffness and/or congestion of multiple organs. Poor prognosis is expected in heart failure patients with liver stiffness, which has recently been assessed by non-alcoholic fatty liver disease fibrosis score (NFS; based on aspartate aminotransferase to alanine aminotransferase ratio, platelet counts, and albumin). We aimed to investigate the impact of NFS on prognosis of HFpEF patients, with consideration for the peripheral collagen markers such as procollagen type III peptide (PIIIP), type IV collagen 7S, and hyaluronic acid. We performed a prospective observational study. Consecutive 492 hospitalized HFpEF patients were divided into four groups based on their NFS: first-fourth quartiles (n = 123). The fourth quartile group had the highest levels of PIIIP, type IV collagen 7S, hyaluronic acid, and B-type natriuretic peptide (P<0.001 each). In addition, there were significant positive correlations between PIIIP, type IV collagen 7S, hyaluronic acid, B-type natriuretic peptide, and NFS (P < 0.001 each). In the follow-up period (mean 1107 days), 93 deaths occurred. All-cause mortality increased in all four quartiles (8.1%, 12.2%, 23.6%, and 31.7%, P < 0.001). In the multivariable Cox proportional hazard analysis, NFS was an independent predictor of all-cause mortality in the HFpEF patients. NFS, a novel indicator of liver fibrosis, correlates with circulating systemic markers of fibrosis and congestion and is associated with higher all-cause mortality in HFpEF patients. NFS can be calculated simply and may be a useful tool to assess liver stiffness and prognosis in HFpEF patients. © 2017 The Authors. ESC Heart Failure published by John Wiley & Sons Ltd on behalf of the European Society of Cardiology.

Structural characterization of CFA/III and Longus type IVb pili from enterotoxigenic Escherichia coli.

PubMed

Kolappan, Subramaniapillai; Roos, Justin; Yuen, Alex S W; Pierce, Owen M; Craig, Lisa

2012-05-01

The type IV pili are helical filaments found on many Gram-negative pathogenic bacteria, with multiple diverse roles in pathogenesis, including microcolony formation, adhesion, and twitching motility. Many pathogenic enterotoxigenic Escherichia coli (ETEC) isolates express one of two type IV pili belonging to the type IVb subclass: CFA/III or Longus. Here we show a direct correlation between CFA/III expression and ETEC aggregation, suggesting that these pili, like the Vibrio cholerae toxin-coregulated pili (TCP), mediate microcolony formation. We report a 1.26-Å resolution crystal structure of CofA, the major pilin subunit from CFA/III. CofA is very similar in structure to V. cholerae TcpA but possesses a 10-amino-acid insertion that replaces part of the α2-helix with an irregular loop containing a 3(10)-helix. Homology modeling suggests a very similar structure for the Longus LngA pilin. A model for the CFA/III pilus filament was generated using the TCP electron microscopy reconstruction as a template. The unique 3(10)-helix insert fits perfectly within the gap between CofA globular domains. This insert, together with differences in surface-exposed residues, produces a filament that is smoother and more negatively charged than TCP. To explore the specificity of the type IV pilus assembly apparatus, CofA was expressed heterologously in V. cholerae by replacing the tcpA gene with that of cofA within the tcp operon. Although CofA was synthesized and processed by V. cholerae, no CFA/III filaments were detected, suggesting that the components of the type IVb pilus assembly system are highly specific to their pilin substrates.

Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

PubMed

Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

2006-08-01

The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

[Gene mutation analysis of X-linked hypophosphatemic rickets].

PubMed

Song, Ying; Ma, Hong-Wei; Li, Fang; Hu, Man; Ren, Shuang; Yu, Ya-Fen; Zhao, Gui-Jie

2013-11-01

To investigate the frequency and type of PHEX gene mutations in children with X-linked hypophosphatemic rickets (XLH), the possible presence of mutational hot spots, and the relationship between genotype and clinical phenotype. Clinical data of 10 children with XLH was retrospectively reviewed. The relationship between gene mutation type and severity of XLH was evaluated. PHEX gene mutations were detected in all 10 children with XLH, including 6 cases of missense mutation, 2 cases of splice site mutation, 1 case of frameshift mutation, and 1 case of nonsense mutation. Two new mutations, c.2048T>C and IVS14+1delAG, were found. The type of PHEX gene mutation was not associated with the degree of short stature and leg deformity (P=0.571 and 0.467), and the mutation site was also not associated with the degree of short stature and leg deformity (P=0.400 and 1.000). Missense mutation is the most common type of PHEX gene mutation in children with XLH, and c.2048T>C and IVS14+1delAG are two new PHEX gene mutations. The type and site of PHEX gene mutation are not associated with the severity of XLH.

Proposal for a histopathological consensus classification of the periprosthetic interface membrane

PubMed Central

Morawietz, L; Classen, R‐A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer‐Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

2006-01-01

Aims The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Methods Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Results Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter‐observer reproducibility sufficient (85%). Conclusion The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non‐infectious, non‐particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients. PMID:16731601

Proposal for a histopathological consensus classification of the periprosthetic interface membrane.

PubMed

Morawietz, L; Classen, R-A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer-Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

2006-06-01

The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter-observer reproducibility sufficient (85%). The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non-infectious, non-particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients.

Environmentally Safe and Effective Processes for Paint Removal

DTIC Science & Technology

1995-04-01

Urea Formaldehyde 3.5 1.5 Type III Melamine Formaldehyde 4.0 1.5 Type IV Phenol Formaldehyde 3.5 1.5...Polyester 3.0 34 - 42 1.04 - 1.46 Type II Urea Formaldehyde 3.5 54 - 62 1.47- 1.54 Type III Melamine Formaldehyde 4.0 64- 72 1.47- 1.52 Type IV Phenol... Melamine Formaldehyde electronics industry and to remove coatings from fibreglass and composite materials. Melamine formaldehyde resin is produced

Study of the relationship between mononuclear inflammatory infiltrate and Ki-67 and basement membrane and extracellular matrix protein expression in radicular cysts.

PubMed

Mourão, R V C; Júnior, E C Pinheiro; Barros Silva, P G; Turatti, E; Mota, M R L; Alves, A P N N

2016-05-01

To evaluate the relationship between mononuclear inflammatory infiltrate and the expression of a proliferative immunomarker (Ki-67) as well as to evaluate basement membrane and extracellular matrix proteins (laminin and collagen type IV) in radicular cysts and dentigerous cysts (DC). Immunohistochemical analyses were performed in heavily inflamed radicular cysts (HIRC), slightly inflamed radicular cysts (SIRC) and DC (n = 20) using Ki-67 (Dako(®) , 1 : 50), anticollagen type IV (DBS(®) , 1 : 40) and antilaminin (DBS(®) , 1 : 20). The data were analysed using anova/Tukey's test (Ki-67) and Kruskal-Wallis/Dunn's test (collagen type IV and laminin) (P < 0.05). The immunoexpression of Ki-67 was significantly greater in the SIRC group compared with the HIRC and DC (P = 0.0040). Likewise, the immunoexpression of collagen type IV in the basement membrane of the SIRC group was significantly more continuous (P = 0.0475) than in the HIRC group. DC had significantly less collagen type IV in extracellular matrix immunoexpression than HIRC and SIRC (P = 0.0246). Laminin was absent in the basement membrane in the SIRC and DC groups, and the extracellular matrix of the HIRC was weak and punctate. The presence of inflammatory factors in the radicular cyst wall modified the expression of proliferation factors in the epithelial lining and the expression of collagen type IV and laminin in the basement membrane, but did not modify extracellular matrix behaviour in radicular cysts. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

PubMed Central

Miyakawa, T; Kojima, M; Ui, M

1998-01-01

Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation. PMID:9405282

Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

PubMed

Miyakawa, T; Kojima, M; Ui, M

1998-01-01

Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation.

The Pseudomonas aeruginosa Pathogenicity Island PAPI-1 is transferred via a novel Type IV pilus

USDA-ARS?s Scientific Manuscript database

Pseudomonas aeruginosa is a major cause of nosocomial infections, particularly in immunocompromised patients or in individuals with cystic fibrosis. The notable ability of P. aeruginosa to inhabit a broad range of environments including humans is in part due to its large and diverse genomic repertoi...

40 CFR 60.103a - Design, equipment, work practice or operational standards.

Code of Federal Regulations, 2014 CFR

2014-07-01

...) Description and simple process flow diagram showing the interconnection of the following components of the... rate. (iv) Description and simple process flow diagram showing all gas lines (including flare, purge... which lines are monitored and identify on the process flow diagram the location and type of each monitor...

40 CFR 60.103a - Design, equipment, work practice or operational standards.

Code of Federal Regulations, 2013 CFR

2013-07-01

...) Description and simple process flow diagram showing the interconnection of the following components of the... rate. (iv) Description and simple process flow diagram showing all gas lines (including flare, purge... which lines are monitored and identify on the process flow diagram the location and type of each monitor...

25 CFR 542.11 - What are the minimum internal control standards for pari-mutuel wagering?

Code of Federal Regulations, 2011 CFR

2011-04-01

...; (ii) Gaming operation name (or identification number) and station number; (iii) Race track, race number, horse identification or event identification, as applicable; (iv) Type of bet(s), each bet amount... wagering on race events while on duty, including during break periods. (g) Computer reports standards. (1...

Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

PubMed

Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

2007-01-01

Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

Mechanisms of chiral discrimination by topoisomerase IV

PubMed Central

Neuman, K. C.; Charvin, G.; Bensimon, D.; Croquette, V.

2009-01-01

Topoisomerase IV (Topo IV), an essential ATP-dependent bacterial type II topoisomerase, transports one segment of DNA through a transient double-strand break in a second segment of DNA. In vivo, Topo IV unlinks catenated chromosomes before cell division and relaxes positive supercoils generated during DNA replication. In vitro, Topo IV relaxes positive supercoils at least 20-fold faster than negative supercoils. The mechanisms underlying this chiral discrimination by Topo IV and other type II topoisomerases remain speculative. We used magnetic tweezers to measure the relaxation rates of single and multiple DNA crossings by Topo IV. These measurements allowed us to determine unambiguously the relative importance of DNA crossing geometry and enzymatic processivity in chiral discrimination by Topo IV. Our results indicate that Topo IV binds and passes DNA strands juxtaposed in a nearly perpendicular orientation and that relaxation of negative supercoiled DNA is perfectly distributive. Together, these results suggest that chiral discrimination arises primarily from dramatic differences in the processivity of relaxing positive and negative supercoiled DNA: Topo IV is highly processive on positively supercoiled DNA, whereas it is perfectly distributive on negatively supercoiled DNA. These results provide fresh insight into topoisomerase mechanisms and lead to a model that reconciles contradictory aspects of previous findings while providing a framework to interpret future results. PMID:19359479

Interaction of Type IV Toxin/Antitoxin Systems in Cryptic Prophages of Escherichia coli K-12.

PubMed

Wen, Zhongling; Wang, Pengxia; Sun, Chenglong; Guo, Yunxue; Wang, Xiaoxue

2017-03-01

Toxin/antitoxin (TA) systems are widespread in prokaryotic chromosomes and in mobile genetic elements including plasmids and prophages. The first characterized Type IV TA system CbtA/CbeA was found in cryptic prophage CP4-44 in Escherichia coli K-12. Two homologous TA loci of CbtA/CbeA also reside in cryptic prophages of E. coli K-12, YkfI/YafW in CP4-6 and YpjF/YfjZ in CP4-57. In this study, we demonstrated that YkfI and YpjF inhibited cell growth and led to the formation of "lemon-shaped" cells. Prolonged overproduction of YkfI led to the formation of "gourd-shaped" cells and immediate cell lysis. YafW and YfjZ can neutralize the toxicity of YkfI or YpjF. Furthermore, we found that YkfI and YpjF interacted with cell division protein FtsZ in E. coli , but ectopic expression in Pseudomonas and Shewanella did not cause the formation of "lemon-shaped" cells. Moreover, deletion of all of the three toxin genes together decreased resistance to oxidative stress and deletion of the antitoxin genes increased early biofilm formation. Collectively, these results demonstrated that the homologous Type IV TA systems in E. coli may target cell division protein FtsZ in E. coli and may have different physiological functions in E. coli .

Interaction of Type IV Toxin/Antitoxin Systems in Cryptic Prophages of Escherichia coli K-12

PubMed Central

Wen, Zhongling; Wang, Pengxia; Sun, Chenglong; Guo, Yunxue; Wang, Xiaoxue

2017-01-01

Toxin/antitoxin (TA) systems are widespread in prokaryotic chromosomes and in mobile genetic elements including plasmids and prophages. The first characterized Type IV TA system CbtA/CbeA was found in cryptic prophage CP4-44 in Escherichia coli K-12. Two homologous TA loci of CbtA/CbeA also reside in cryptic prophages of E. coli K-12, YkfI/YafW in CP4-6 and YpjF/YfjZ in CP4-57. In this study, we demonstrated that YkfI and YpjF inhibited cell growth and led to the formation of “lemon-shaped” cells. Prolonged overproduction of YkfI led to the formation of “gourd-shaped” cells and immediate cell lysis. YafW and YfjZ can neutralize the toxicity of YkfI or YpjF. Furthermore, we found that YkfI and YpjF interacted with cell division protein FtsZ in E. coli, but ectopic expression in Pseudomonas and Shewanella did not cause the formation of “lemon-shaped” cells. Moreover, deletion of all of the three toxin genes together decreased resistance to oxidative stress and deletion of the antitoxin genes increased early biofilm formation. Collectively, these results demonstrated that the homologous Type IV TA systems in E. coli may target cell division protein FtsZ in E. coli and may have different physiological functions in E. coli. PMID:28257056

Stress failure of pulmonary capillaries: role in lung and heart disease

NASA Technical Reports Server (NTRS)

West, J. B.; Mathieu-Costello, O.

1992-01-01

Pulmonary capillaries have extremely thin walls to allow rapid exchange of respiratory gases across them. Recently it has been shown that the wall stresses become very large when the capillary pressure is raised, and in anaesthetised rabbits, ultrastructural damage to the walls is seen at pressures of 40 mm Hg and above. The changes include breaks in the capillary endothelial layer, alveolar epithelial layer, and sometimes all layers of the wall. The strength of the thin part of the capillary wall can be attributed to the type IV collagen in the extracellular matrix. Stress failure of pulmonary capillaries results in a high-permeability form of oedema, or even frank haemorrhage, and is apparently the mechanism of neurogenic pulmonary oedema and high-altitude pulmonary oedema. It also explains the exercise-induced pulmonary haemorrhage that occurs in all racehorses. Several features of mitral stenosis are consistent with stress failure. Overinflation of the lung also leads to stress failure, a common cause of increased capillary permeability in the intensive care environment. Stress failure also occurs if the type IV collagen of the capillary wall is weakened by autoantibodies as in Goodpasture's syndrome. Neutrophil elastase degrades type IV collagen and this may be the starting point of the breakdown of alveolar walls that is characteristic of emphysema. Stress failure of pulmonary capillaries is a hitherto overlooked and potentially important factor in lung and heart disease.

DSMC Simulation and Experimental Validation of Shock Interaction in Hypersonic Low Density Flow

PubMed Central

2014-01-01

Direct simulation Monte Carlo (DSMC) of shock interaction in hypersonic low density flow is developed. Three collision molecular models, including hard sphere (HS), variable hard sphere (VHS), and variable soft sphere (VSS), are employed in the DSMC study. The simulations of double-cone and Edney's type IV hypersonic shock interactions in low density flow are performed. Comparisons between DSMC and experimental data are conducted. Investigation of the double-cone hypersonic flow shows that three collision molecular models can predict the trend of pressure coefficient and the Stanton number. HS model shows the best agreement between DSMC simulation and experiment among three collision molecular models. Also, it shows that the agreement between DSMC and experiment is generally good for HS and VHS models in Edney's type IV shock interaction. However, it fails in the VSS model. Both double-cone and Edney's type IV shock interaction simulations show that the DSMC errors depend on the Knudsen number and the models employed for intermolecular interaction. With the increase in the Knudsen number, the DSMC error is decreased. The error is the smallest in HS compared with those in the VHS and VSS models. When the Knudsen number is in the level of 10−4, the DSMC errors, for pressure coefficient, the Stanton number, and the scale of interaction region, are controlled within 10%. PMID:24672360

The effect of a class IV hurricane on emergency department operations.

PubMed

Sheppa, C M; Stevens, J; Philbrick, J T; Canada, M

1993-09-01

The objective of this study was to determine the impact on emergency department (ED) operations of Hurricane Hugo, a class IV hurricane that struck Charleston, South Carolina, on September 21, 1989. The study design was a retrospective record-based descriptive study and mail survey of the ED of a 300-bed regional medical center directly in the path of the storm. During the 3 weeks after the storm, ED patient volume increased 19% over that of the 3 weeks before the storm. Increased visit volumes were evident for at least 3 months. Compared with a similar period of the previous year, there was an increase in the proportion of patients seen for lacerations of all types, puncture wounds, stings, and falls. Sixty-two percent of physician offices were still closed 7 days after the storm. The direct effects of a class IV hurricane on ED operations included major alterations in the volume and types of patient visits. Because of the evacuation of approximately 40% of the coastal population and storm damage hindering travel, the increase in visit volume was less in magnitude but of longer duration has been reported in class III hurricanes.

Serotype IV Sequence Type 468 Group B Streptococcus Neonatal Invasive Disease, Minnesota, USA.

PubMed

Teatero, Sarah; Ferrieri, Patricia; Fittipaldi, Nahuel

2016-11-01

To further understand the emergence of serotype IV group B Streptococcus (GBS) invasive disease, we used whole-genome sequencing to characterize 3 sequence type 468 strains isolated from neonates in Minnesota, USA. We found that strains of tetracycline-resistant sequence type 468 GBS have acquired virulence genes from a putative clonal complex 17 GBS donor by recombination.

Diagnostic Accuracy of History and Physical Examination of Superior Labrum Anterior-Posterior Lesions

PubMed Central

Michener, Lori A.; Doukas, William C.; Murphy, Kevin P.; Walsworth, Matthew K.

2011-01-01

Context: Type I superior labrum anterior-posterior (SLAP) lesions involve degenerative fraying and probably are not the cause of shoulder pain. Type II to IV SLAP lesions are tears of the labrum. Objective: To determine the diagnostic accuracy of patient history and the active compression, anterior slide, and crank tests for type I and type II to IV SLAP lesions. Design: Cohort study. Setting: Clinic. Patients or Other Participants: Fifty-five patients (47 men, 8 women; age = 40.6 ± 15.1 years) presenting with shoulder pain. Intervention(s): For each patient, an orthopaedic surgeon conducted a clinical examination of history of trauma; sudden onset of symptoms; history of popping, clicking, or catching; age; and active compression, crank, and anterior slide tests. The reference standard was the intraoperative diagnosis. The operating surgeon was blinded to the results of the clinical examination. Main Outcome Measure(s): Diagnostic utility was calculated using the receiver operating characteristic curve and area under the curve (AUC), sensitivity, specificity, positive likelihood ratio (+LR), and negative likelihood ratio (−LR). Forward stepwise binary regression was used to determine a combination of tests for diagnosis. Results: No history item or physical examination test had diagnostic accuracy for type I SLAP lesions (n = 13). The anterior slide test had utility (AUC = 0.70, +LR = 2.25, −LR = 0.44) to confirm and exclude type II to IV SLAP lesions (n = 10). The combination of a history of popping, clicking, or catching and the anterior slide test demonstrated diagnostic utility for confirming type II to IV SLAP lesions (+LR = 6.00). Conclusions: The anterior slide test had limited diagnostic utility for confirming and excluding type II to IV SLAP lesions; diagnostic values indicated only small shifts in probability. However, the combination of the anterior slide test with a history of popping, clicking, or catching had moderate diagnostic utility for confirming type II to IV SLAP lesions. No single item or combination of history items and physical examination tests had diagnostic utility for type I SLAP lesions. PMID:21944065

Terminal ileum gangrene secondary to a type IV paraesophageal hernia.

PubMed

Hsu, Ching Tsai; Hsiao, Po Jen; Chiu, Chih Chien; Chan, Jenq Shyong; Lin, Yee Fung; Lo, Yuan Hung; Hsiao, Chia Jen

2016-02-28

Type IV paraesophageal hernia (PEH) is very rare, and is characterized by the intrathoracic herniation of the abdominal viscera other than the stomach into the chest. We describe a 78-year-old woman who presented at our emergency department because of epigastric pain that she had experienced over the past 24 h. On the day after admission, her pain became severe and was accompanied by right chest pain and dyspnea. Chest radiography revealed an intrathoracic intestinal gas bubble occupying the right lower lung field. Emergency explorative laparotomy identified a type IV PEH with herniation of only the terminal ileum through a hiatal defect into the right thoracic cavity. In this report, we also present a review of similar cases in the literature published between 1980 and 2015 in PubMed. There were four published cases of small bowel herniation into the thoracic cavity during this period. Our patient represents a rare case of an individual diagnosed with type IV PEH with incarceration of only the terminal ileum.

Type IV Hypersensitivity to Gold Weight Upper-Eyelid Implant: Case Report and Review of the Literature.

PubMed

Kilduff, Caroline L S; Casswell, Edward J; Imonikhe, Richard; Marjanovic, Branka

2017-05-04

Complications associated with gold-weight insertion for lagophthalmos are uncommon, recent reports have provided evidence to suggest that type IV hypersensitivity to gold can cause a persistent inflammatory reaction. We present a case of a 46-year-old man who experienced persistent post-operative inflammation, and summarize previously documented cases. This patient underwent uncomplicated insertion of an upper eyelid gold weight for right-sided facial nerve palsy. He had no allergies or implanted metalwork. Post-operatively erythema was noted at seven-weeks and did not resolve. The weight was removed after six-months. The histopathological findings were in keeping with type IV hypersensitivity and similar to previous cases. Although infrequent, this complication has poor outcomes. The definitive management is removal of the weight. Information regarding implanted gold, and previous reactions should be elicited pre-operatively. Type IV hypersensitivity should be considered in patients with persistent inflammation that do not respond to antibiotic or steroid therapy.

Spectral, thermal, XRD and SEM studies of charge-transfer complexation of hexamethylenediamine and three types of acceptors: π-, σ- and vacant orbital acceptors that include quinol, picric acid, bromine, iodine, SnCl4 and ZnCl2 acceptors

NASA Astrophysics Data System (ADS)

Adam, Abdel Majid A.; Refat, Moamen S.; Saad, Hosam A.

2013-11-01

In this work, structural, thermal, morphological and pharmacological characterization was performed on the interactions between a hexamethylenediamine (HMDA) donor and three types of acceptors to understand the complexation behavior of diamines. The three types of acceptors include π-acceptors (i.e., quinol (QL) and picric acid (PA)), σ-acceptors (i.e., bromine and iodine) and vacant orbital acceptors (i.e., tin(IV) tetrachloride (SnCl4) and zinc chloride (ZnCl2)). The characterization of the obtained CT complexes was performed using elemental analysis, infrared (IR), Raman, 1H NMR and electronic absorption spectroscopy, powder X-ray diffraction (XRD) and thermogravimetric (TG) analysis. Their morphologies were studied using scanning electron microscopy with energy-dispersive X-ray analysis (SEM-EDX). The biological activities of the obtained CT complexes were tested for their antibacterial activities. The complex containing the QL acceptor exhibited a remarkable electronic spectrum with a strong, broad absorption band, which had an observed λmax that was at a much longer wavelength than those of the free reactants. In addition, this complex exhibited strong antimicrobial activities against various bacterial and fungal strains compared to standard drugs. The complexes containing the PA, iodine, Sn(IV) and Zn(II) acceptors exhibited good thermal stability up to 240, 330, 275 and 295 °C, respectively. The complexes containing bromine, Sn(IV) and Zn(II) acceptors exhibited good crystallinity. In addition to its good crystallinity properties, the complex containing the bromine acceptor exhibits a remarkable morphology feature.

Diabetes and cardiovascular disease: the potential benefit of incretin-based therapies.

PubMed

Addison, Daniel; Aguilar, David

2011-04-01

The health burden of type 2 diabetes mellitus continues to increase worldwide. A substantial portion of this burden is due to the development of cardiovascular disease in patients with diabetes. Recent failures of clinical trials of intensive glucose control to reduce macrovascular events, coupled with reports of potential harm of certain diabetic therapy, have led to increased scrutiny as new diabetic therapies are developed. Incretin peptides are a group of gastrointestinal proteins that regulate glucose metabolism through multiple mechanisms, and incretin-based therapies have been developed to treat type 2 diabetes. These agents include glucagon-like peptide-1 (GLP-1) and dipeptidyl peptidase-IV (DPP-IV) inhibitors. In addition to effects on glucose homeostasis, growing evidence suggest that these peptides may also affect the cardiovascular system. In this review, we discuss recent findings concerning the potential, yet untested, benefits of incretin-based pharmacotherapy in the treatment of cardiovascular disease.

Use of an autologous liver round ligament flap zeros postoperative bile leak after curative resection of hilar cholangiocarcinoma.

PubMed

Sun, Da-Xin; Tan, Xiao-Dong; Gao, Feng; Xu, Jin; Cui, Dong-Xu; Dai, Xian-Wei

2015-01-01

Postoperative bile leak is a major surgical morbidity after curative resection with hepaticojejunostomy for hilar cholangiocarcinoma, especially in Bismuth-Corlette types III and IV. This retrospective study assessed the effectiveness and safety of an autologous hepatic round ligament flap (AHRLF) for reducing bile leak after hilar hepaticojejunostomy. Nine type III and IV hilar cholangiocarcinoma patients were consecutively hospitalized for elective perihilar partial hepatectomy with hilar hepaticojejunostomy using an AHRLF between October 2009 and September 2013. The AHRLF was harvested to reinforce the perihilar hepaticojejunostomy. Main outcome measures included operative time, blood loss, postoperative recovery times, morbidity, bile leak, R0 resection rate, and overall survival. All patients underwent uneventful R0 resection with hilar hepaticojejunostomy. No patient experienced postoperative bile leak. The AHRLF was associated with lack of bile leak after curative perihilar hepatectomy with hepaticojejunostomy for hilar cholangiocarcinoma, without compromising oncologic safety, and is recommended in selected patients.

Novel use of non-ablative fractional photothermolysis for café-au-lait macules in darker skin types.

PubMed

Balaraman, Brundha; Ravanfar-Jordan, Parisa; Friedman, Paul M

2017-01-01

The removal of café-au-lait macules (CALMs) in patients with darker skin phototypes poses a significant challenge due to limited available therapeutic options and increased risk of adverse effects, including permanent scarring and further dyspigmentation. Herein, we demonstrate the novel use of non-ablative fractional photothermolysis for the safe removal of CALMs in individuals with Fitzpatrick skin type (FST) IV-V. Retrospective analysis of four patients (FST IV-V) with CALMs revealed that three of these patients had greater than 50% clearance after multiple treatment sessions with the non-ablative fractional 1,550-nm erbium-doped fiber laser. This report demonstrates the utility and safety of non-ablative fractional resurfacing in the treatment of CALMs in darker skin phototypes. Lasers Surg. Med. 49:84-87, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Correlation Between the Integrity of the Circle of Willis and the Severity of Initial Noncardiac Cerebral Infarction and Clinical Prognosis

PubMed Central

Zhou, Houshi; Sun, Jian; Ji, Xiaotan; Lin, Jing; Tang, Shujin; Zeng, Jinsheng; Fan, Yu-hua

2016-01-01

Abstract The quality of collateral circulation affects the severity and prognosis of stroke patients. The effect of the circle of Willis, which is the primary collateral circulation, on ischemic stroke has attracted significant attention. This study was designed to investigate the effect of different circles of Willis types on stroke severity and prognosis in patients with noncardiac stroke. A total of 376 patients with noncardiac ischemic stroke, who were treated by the specialty team of cerebrovascular diseases at the First Affiliated Hospital of Sun Yat-sen Hospital, were successively enrolled in this study. The detailed clinical characteristics of the patients were recorded upon admission, including risk factors of vascular disease and National Institutes of Health Stroke Scale (NIHSS) scores. The patients were divided into groups of different circles of Willis types based on magnetic resonance angiography (MRA) that was performed within 3 days of admission—type I: complete circle of Willis; type II: complete anterior half of the circle of Willis and incomplete posterior half of the circle of Willis; type III: incomplete anterior half of the circle of Willis and complete posterior half of the circle of Willis; and type IV: incomplete anterior and posterior halves of the circle of Willis. Patients were re-evaluated for NIHSS scores at discharge and after discharge. The modified Rankin score (mRS) was recorded for 90 days, and stroke recurrence and death after 90 days were also recorded until the end of the study. The 376 patients were divided into 4 groups based on the MRA—type I group: 92 patients (24.5%); type II group: 215 patients (57.2%); type III group: 12 patients (3.2%), and type IV group: 57 patients (15.2%). NIHSS scores at admission and discharge were significantly lower for the type I group compared with those for the type II and type IV groups (P < 0.05). NIHSS scores were higher in the groups with an incomplete circle of Willis compared with the group with a complete circle of Willis. A poor recovery rate was highest for the type IV group, whereas a good recovery rate was highest for the type I group. The logistic regression analysis showed that a complete circle of Willis was one of the predictors of suitable recovery (odds ratio [OR] = 0.708, 95% confidence interval [CI]: 0.554–0.906). Circle of Willis type was associated with stroke severity and patient prognosis, whereas an incomplete circle of Willis was associated with more severe conditions and a higher 90-day poor diagnosis rate. A complete circle of Willis was an independent predictor of good prognosis. PMID:26962785

Accentuated hyperparathyroidism in type II Bartter syndrome.

PubMed

Landau, Daniel; Gurevich, Evgenia; Sinai-Treiman, Levana; Shalev, Hannah

2016-07-01

Bartter syndrome (BS) may be associated with different degrees of hypercalciuria, but marked parathyroid hormone (PTH) abnormalities have not been described. We compared clinical and laboratory data of patients with either ROMK-deficient type II BS (n = 14) or Barttin-deficient type IV BS (n = 20). Only BS-IV patients remained mildly hypokalemic in spite of a higher need for potassium supplementation. Estimated glomerular filtration rate (eGFR) was mildly decreased in only four BS-IV patients. Average PTH values were significantly higher in BS-II (160.6 ± 85.8 vs. 92.5 ± 48 pg/ml in BS-IV, p = 0.006). In both groups, there was a positive correlation between age and log(PTH). Levels of 25(OH) vitamin D were not different. Total serum calcium was lower (within normal limits) and age-related serum phosphate (Pi)-SDS was increased in BS-II (1.19 ± 0.71 vs. 0.01 ± 1.04 in BS-IV, p < 0.001). The GFR threshold for Pi reabsorption was higher in BS-II (5.63 ± 1.25 vs. 4.36 ± 0.98, p = 0.002). Spot urine calcium/creatinine ratio and nephrocalcinosis rate (100 vs. 16 %) were higher in the BS-II group. PTH, serum Pi levels, and urinary threshold for Pi reabsorption are significantly elevated in type II vs. type IV BS, suggesting a PTH resistance state. This may be a response to more severe long-standing hypercalciuria, leading to a higher rate of nephrocalcinosis in BS-II.

Morphological patterns of lip prints in Mangaloreans based on Suzuki and Tsuchihashi classification

PubMed Central

Jeergal, Prabhakar A; Pandit, Siddharth; Desai, Dinkar; Surekha, R; Jeergal, Vasanti A

2016-01-01

Introduction: Cheiloscopy is the study of the furrows or grooves present on the red part or vermilion border of the human lips. The present study aims to classify the characteristics of lip prints and to know the most common morphological pattern specific to Mangalorean people of Southern India. For the first time, this study also assesses the association between gender and different lip segments within a population. Materials and Methods: A total of 200 residents of Mangalore (100 males and 100 females) were included of age ranging from 18 years to 60 years. Materials used to take the impression of lips included red lipstick, A4 size white bond paper and cellophane tape. The prints obtained were scanned using a Canon Image Scanner and stored in a folder on a personal computer. The images were cropped and inverted in gray scale using Adobe Photoshop software. Each lip print was divided into eight segments and was examined. Suzuki and Tsuchihashi's classification (1970) was used to classify the types of grooves, and the results were statistically analyzed. Six types of grooves were recorded in the Mangalorean's lips. Statistical Analysis: Association between gender and different lip segments was tested using Chi-square analysis in the given population. Results: In males, the groove Type I' was the highest recorded followed by Type III, Type II, Type I, Type IV and Type V in descending order. In females, Type I' was the highest recorded followed by Type II, Type III, Type IV, Type I and Type V in descending order. Conclusion: Males and females displayed statistically significant differences in lip print patterns for different lip sites: lower medial lip, as well as upper and lower lateral segments. Only the upper medial lip segment displayed no statistically significant difference in lip print pattern between males and females. This shows that the distribution of lip prints is generally dissimilar for males and females, with varying predominance according to lip segment. PMID:27601831

Properties of the highly ionized disk and halo gas toward two distant high-latitude stars

NASA Technical Reports Server (NTRS)

Savage, Blair D.; Sembach, K. R.

1994-01-01

Goddard High Resolution Spectrograph (GHRS) intermediate -resolution observations of S III, Si III, Al III, Si IV, C IV, and N V absorption along the sight lines to HD 18100 (l = 217.9 deg, b = -62.7, d = 3.1 kpc, z = -2.8 kpc) and HD 100340 (l = 258.9 deg, b = +61.2 deg, d = 5.3 kpc, z = 4.6 kpc) are presented. These small science aperture spectra have resolutions ranging from 11 to 20 km/s full width at half maximum (FWHM) and S/N from 30 to 65 per diode substep. Strong absorption by moderately and highly ionized gas is seen in each direction. The absorption in the direction of the south Galactic polar region (HD 18100) is kinematically simple, while the absorption in the direction of north Galactic polar region (HD 100304) is kinematically complex. In each case the absorption by the highly ionized gas lies within the velocity range of absorption by neutral and weakly ionized gas. Along each sight line, the velocity dispersion determined from the unsaturated absorption lines increases with the energy required to create each ion. The logarithmic column densities for Al III, Si IV, C IV, and N V are log N(atoms/sq cm = 12.71, 13.10, 13.58, and 12.75 toward HD 18100 and log N = 12.88, 13.31, 13.83, and 13.04 toward HD 100340. Average ionic ratios among these species are very similar along the two sight lines. Differences in profile shape between the absorption for AL II, Si IV, C IV, and N V provide additional support for the claim of Savage, Sembach, & Cardelli (1994) that there exists two types of highly ionized gas in the interstellar medium. One type of highly ionized gas is responsible for the structured Si IV absorption and part of the C IV absorption. In this gas N(C IV)/N(Si IV) approximately 3.0 and N(C IV)/N(N V) greater than 6. The absorption by this gas seems to be associated with some type of self-regulating interface or mixing layer between the warm and hot interstellar medium. The other type of highly ionized gas is responsible for most of the N V absorption, part of the C IV absorption, and has very little associated Si IV absorption. In this gas N(C IV)/N(N V) is approximately 1 to 3. This gas is hot (T greater than 2 x 10(exp 5) K) and may be tracing the cooling gas of supernova (SN) bubbles or a Galactic fountain. The relative mixture of these two types of highly ionized gas varies from one sight line to the next. The two sight lines in this study sample halo gas in the solar neighborhood and have a smaller percentage of the more highly ionized gas than inner Galaxy sight lines.

Local therapy to distant metastatic sites in stage IV rhabdomyosarcoma.

PubMed

Mohan, Arvind C; Venkatramani, Rajkumar; Okcu, M Fatih; Nuchtern, Jed G; Vasudevan, Sanjeev A; Mahajan, Anita; Rainusso, Nino C; Allen-Rhoades, Wendy; Chintagumpala, Murali; Paulino, Arnold C

2018-02-01

To determine the impact of surgery and/or radiation therapy on distant metastatic sites (DMS) in children with stage IV rhabdomyosarcoma (RMS). A retrospective chart review was conducted on all patients with stage IV RMS at Texas Children's Hospital from 1992 to 2012. Data analyzed included age, gender, primary site, histologic subtype, number and sites of metastases, treatment including local therapy to DMS, and Oberlin score. The 5-year progression-free survival (PFS) and overall survival (OS) rates were 20% and 25%. The 5-year PFS in patients receiving local therapy to all DMS (n = 16) and to less than all DMS (n = 19) was 31.3% versus 0% (P = 0.002), whereas the 5-year OS was 37.3% versus 0% (P < 0.001), respectively. The 5-year PFS in patients with isolated lung metastasis versus other types of metastasis was 29% versus 7% (P = n.s.), whereas the 5-year OS was 43% versus 10% (P = 0.01). The 5-year pulmonary local control was improved by the use of whole lung irradiation (WLI; 56% vs. 10%, P = 0.03). Local treatment to all metastatic sites was associated with improved PFS and OS at 5 years. The use of WLI improved pulmonary control in patients with lung metastasis. We recommend an aggressive approach including local therapy to DMS in children with stage IV RMS. © 2017 Wiley Periodicals, Inc.

Phylogenetic analysis of dengue virus types 1 and 3 isolated in Jakarta, Indonesia in 1988.

PubMed

Sjatha, Fithriyah; Takizawa, Yamato; Yamanaka, Atsushi; Konishi, Eiji

2012-12-01

Dengue viruses are mosquito-borne viruses that cause dengue fever and dengue hemorrhagic fever, both of which are globally important diseases. These viruses have evolved in a transmission cycle between human hosts and mosquito vectors in various tropical and subtropical environments. We previously isolated three strains of dengue type 1 virus (DENV1) and 14 strains of dengue type 3 virus (DENV3) during an outbreak of dengue fever and dengue hemorrhagic fever in Jakarta, Indonesia in 1988. Here, we compared the nucleotide sequences of the entire envelope protein-coding region among these strains. The isolates were 97.6-100% identical for DENV1 and 98.8-100% identical for DENV3. All DENV1 isolates were included in two different clades of genotype IV and all DENV3 isolates were included in a single clade of genotype I. For DENV1, three Yap Island strains isolated in 2004 were the only strains closely related to the present isolates; the recently circulated Indonesian strains were in different clades. Molecular clock analyses estimated that ancestors of the genotype IV strains of DENV1 have been indigenous in Indonesia since 1948. We predict that they diverged frequently around 1967 and that their offspring distributed to Southeast Asia, the Western Pacific, and Africa. For DENV3, the clade containing all the present isolates also contained strains isolated from other Indonesian regions and other countries including Malaysia, Singapore, China, and East Timor from 1985-2010. Molecular clock analyses estimated that the common ancestor of the genotype I strains of DENV3 emerged in Indonesia around 1967 and diverged frequently until 1980, and that their offspring distributed mainly in Southeast Asia. The first dengue outbreak in 1968 and subsequent outbreaks in Indonesia might have influenced the divergence and distribution of the DENV1 genotype IV strains and the DENV3 genotype I strains in many countries. Copyright © 2012 Elsevier B.V. All rights reserved.

Specific Accumulation of Tumor-Derived Adhesion Factor in Tumor Blood Vessels and in Capillary Tube-Like Structures of Cultured Vascular Endothelial Cells

NASA Astrophysics Data System (ADS)

Akaogi, Kotaro; Okabe, Yukie; Sato, Junji; Nagashima, Yoji; Yasumitsu, Hidetaro; Sugahara, Kazuyuki; Miyazaki, Kaoru

1996-08-01

Tumor-derived adhesion factor (TAF) was previously identified as a cell adhesion molecule secreted by human bladder carcinoma cell line EJ-1. To elucidate the physiological function of TAF, we examined its distribution in human normal and tumor tissues. Immunochemical staining with an anti-TAF monoclonal antibody showed that TAF was specifically accumulated in small blood vessels and capillaries within and adjacent to tumor nests, but not in those in normal tissues. Tumor blood vessel-specific staining of TAF was observed in various human cancers, such as esophagus, brain, lung, and stomach cancers. Double immunofluorescent staining showed apparent colocalization of TAF and type IV collagen in the vascular basement membrane. In vitro experiments demonstrated that TAF preferentially bound to type IV collagen among various extracellular matrix components tested. In cell culture experiments, TAF promoted adhesion of human umbilical vein endothelial cells to type IV collagen substrate and induced their morphological change. Furthermore, when the endothelial cells were induced to form capillary tube-like structures by type I collagen, TAF and type IV collagen were exclusively detected on the tubular structures. The capillary tube formation in vitro was prevented by heparin, which inhibited the binding of TAF to the endothelial cells. These results strongly suggest that TAF contributes to the organization of new capillary vessels in tumor tissues by modulating the interaction of endothelial cells with type IV collagen.

Target Selection for the SDSS-IV APOGEE-2 Survey

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zasowski, G.; Cohen, R. E.; Carlberg, J. K.

APOGEE-2 is a high-resolution, near-infrared spectroscopic survey observing ∼3 × 10{sup 5} stars across the entire sky. It is the successor to APOGEE and is part of the Sloan Digital Sky Survey IV (SDSS-IV). APOGEE-2 is expanding on APOGEE’s goals of addressing critical questions of stellar astrophysics, stellar populations, and Galactic chemodynamical evolution using (1) an enhanced set of target types and (2) a second spectrograph at Las Campanas Observatory in Chile. APOGEE-2 is targeting red giant branch and red clump stars, RR Lyrae, low-mass dwarf stars, young stellar objects, and numerous other Milky Way and Local Group sources across the entiremore » sky from both hemispheres. In this paper, we describe the APOGEE-2 observational design, target selection catalogs and algorithms, and the targeting-related documentation included in the SDSS data releases.« less

Structure of a quinolone-stabilized cleavage complex of topoisomerase IV from Klebsiella pneumoniae and comparison with a related Streptococcus pneumoniae complex

PubMed Central

Veselkov, Dennis A.; Laponogov, Ivan; Pan, Xiao-Su; Selvarajah, Jogitha; Skamrova, Galyna B.; Branstrom, Arthur; Narasimhan, Jana; Prasad, Josyula V. N. Vara; Fisher, L. Mark; Sanderson, Mark R.

2016-01-01

Klebsiella pneumoniae is a Gram-negative bacterium that is responsible for a range of common infections, including pulmonary pneumonia, bloodstream infections and meningitis. Certain strains of Klebsiella have become highly resistant to antibiotics. Despite the vast amount of research carried out on this class of bacteria, the molecular structure of its topoisomerase IV, a type II topoisomerase essential for catalysing chromosomal segregation, had remained unknown. In this paper, the structure of its DNA-cleavage complex is reported at 3.35 Å resolution. The complex is comprised of ParC breakage-reunion and ParE TOPRIM domains of K. pneumoniae topoisomerase IV with DNA stabilized by levofloxacin, a broad-spectrum fluoroquinolone antimicrobial agent. This complex is compared with a similar complex from Streptococcus pneumoniae, which has recently been solved. PMID:27050128

Successful Multiresistant Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from Taipei, Taiwan, That Carries Either the Novel Staphylococcal Chromosome Cassette mec (SCCmec) Type VT or SCCmec Type IV

PubMed Central

Boyle-Vavra, Susan; Ereshefsky, Ben; Wang, Chih-Chien; Daum, Robert S.

2005-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) isolates carry the methicillin resistance gene (mecA) on a horizontally transferred genetic element called the staphylococcal chromosome cassette mec (SCCmec). Community-acquired MRSA (CAMRSA) isolates usually carry SCCmec type IV. We previously reported that 76% of 17 CAMRSA isolates (multilocus sequence type 59) obtained from pediatric patients with skin and soft tissue infections (SSTI) from Taipei did not carry SCCmec types I to IV. We used DNA sequence analysis to determine that the element harbored by these nontypeable isolates is a novel subtype of SCCmec V called SCCmec VT. It contains a ccrC recombinase gene variant (ccrC2) and mec complex C2. One SSTI isolate contained molecular features of SCCmec IV but also contained ccrC2 (a feature of SCCmec VT), suggesting that it may harbor a composite SCCmec element. The genes lukS-PV and lukF-PV encoding the Panton-Valentine leukocidin (PVL) were present in all CAMRSA SSTI isolates whether they contained SCCmec type IV or VT. SCCmec VT was also present in 5 of 34 (14.7%) CAMRSA colonization isolates collected from healthy children from Taipei who lacked MRSA risk factors. Four (80%) of the these isolates contained lukS-PV and lukF-PV, as did 1 of 27 (3.7%) SCCmec IV-containing colonization isolates. A total of 63% (10 of 16) of the SSTI isolates and 61.7% (21 of 34) of the colonization isolates tested were resistant to at least four classes of non-β-lactam antimicrobials. SCCmec VT is a novel SCCmec variant that is found in multiply resistant CAMRSA strains with sequence type 59 in Taipei in association with the PVL leukotoxin genes. PMID:16145133

(2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, D.; Wang, L.; Beconi, M.

2010-11-10

A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

Genetics Home Reference: mucolipidosis type IV

MedlinePlus

... PubMed Vergarajauregui S, Puertollano R. Mucolipidosis type IV: the importance of functional lysosomes for efficient autophagy. Autophagy. 2008 ... Reviewed : August 2013 Published : June 26, 2018 The resources on this site should not be used as a substitute ... Department of Health & Human Services National Institutes of Health National Library of ...

Mass loss in the interacting semi-detached binary delta librae

NASA Technical Reports Server (NTRS)

Mccluskey, George E., Jr.; Mccluskey, Carolina P. S.; Kondo, Yoji

1995-01-01

The interacting Algol-type binary Delta Librae (AOV + G: V) has been observed with the International Ultraviolet Explorer (IUE) satellite. More than fifty high resolution spectra in the far-ultraviolet and mid-ultraviolet spectrum have been analyzed in order to model the mass flow in the Delta Librae system. The resonance lines of Si IV and C IV are present in absorption and vary in strength both secularly and with phase. The radial velocities of the Si IV and C IV absorption lines generally follow the orbital motion of the primary star but deviate by typically a few tens of kilometers per second in the direction of the observer. The presence of Si IV and C IV features indicates the existence of a region considerably hotter than the normal AOV photosphere and, since these lines are present at all phases, this region must be fairly extensive. These results are interpreted in terms of a 'pseudo-photosphere' around the equatorial region of the AOV star, created by matter being accreted from the G-type companion. The widths of the Si IV and C IV absorption features imply that some of the matter lost by the G-star leaves the system entirely.

WOLF; automatic typing program

USGS Publications Warehouse

Evenden, G.I.

1982-01-01

A FORTRAN IV program for the Hewlett-Packard 1000 series computer provides for automatic typing operations and can, when employed with manufacturer's text editor, provide a system to greatly facilitate preparation of reports, letters and other text. The input text and imbedded control data can perform nearly all of the functions of a typist. A few of the features available are centering, titles, footnotes, indentation, page numbering (including Roman numerals), automatic paragraphing, and two forms of tab operations. This documentation contains both user and technical description of the program.

Morphologic classification of the right auricule on 256-slice computed tomography.

PubMed

Li, Cai-Ying; Gao, Bu-Lang; Pan, Tong; Xiang, Cheng; Liu, Xiao-Wei; Yang, Hai-Qing; Yi, Lan-Ying; Liao, Qi-Bin

2017-06-01

To investigate the shape of right auricule on 256-slice computed tomography (CT). Five hundred people (250 men, age range 16-84 years) who had cardiac multidetector CT angiography were recruited in this study. All patients had normal sinus rhythm with normal blood pressure (<140/90 mmHg for systolic/diastolic pressure). The morphology of the right auricule was studied and compared after reconstruction of the raw images. All patients successfully had cardiac CT angiography (100%), and the right auricule morphology was divided into five types and nine subtypes, including Type I of triangular shape (Ia and Ib), Type II of M shape (IIa and IIb), Type III of L shape (IIIa and IIIb), Type IV of reverse L shape (IVa and IVb), and Type V of balanced shape. The most common type of right auricule is Type IV (28.4%) followed by Type II (24.0%), whereas the least common is Type V (11.0%). Type Ia was present significantly (P < 0.0001) more frequently in females than in males, whereas Type IIa significantly (P = 0.042) more frequently in males than females. No other significant (P > 0.05) sex difference existed in the constitution ratio of the types. The normal angle was greater in Type Ib than in Ia. The greater the normal angle in Type I, the greater the deviation of the right auricule tip towards the left. A good understanding of the right auricule anatomical morphology can better guide atrial pacing, radiofrequency ablation and other surgical procedures while preventing possible intra-procedural complications.

Basement Membrane Type IV Collagen and Laminin: An Overview of Their Biology and Value as Fibrosis Biomarkers of Liver Disease.

PubMed

Mak, Ki M; Mei, Rena

2017-08-01

Basement membranes provide structural support to epithelium, endothelium, muscles, fat cells, Schwann cells, and axons. Basement membranes are multifunctional: they modulate cellular behavior, regulate organogenesis, promote tissue repair, form a barrier to filtration and tumor metastasis, bind growth factors, and mediate angiogenesis. All basement membranes contain type IV collagen (Col IV), laminin, nidogen, and perlecan. Col IV and laminin self-assemble into two independent supramolecular networks that are linked to nidogen and perlecan to form a morphological discernable basement membrane/basal lamina. The triple helical region, 7S domain and NCI domain of Col IV, laminin and laminin fragment P1 have been evaluated as noninvasive fibrosis biomarkers of alcoholic liver disease, viral hepatitis, and nonalcoholic fatty liver disease. Elevated serum Col IV and laminin are related to degrees of fibrosis and severity of hepatitis, and may reflect hepatic basement membrane metabolism. But the serum assays have not been linked to disclosing the anatomical sites and lobular distribution of perisinusoidal basement membrane formation in the liver. Hepatic sinusoids normally lack a basement membrane, although Col IV is a normal matrix component of the space of Disse. In liver disease, laminin deposits in the space of Disse and codistributes with Col IV, forming a perisinusoidal basement membrane. Concomitantly, the sinusoidal endothelium loses its fenestrae and is transformed into vascular type endothelium. These changes lead to capillarization of hepatic sinusoids, a significant pathology that impairs hepatic function. Accordingly, codistribution of Col IV and laminin serves as histochemical marker of perisinusoidal basement membrane formation in liver disease. Anat Rec, 300:1371-1390, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Odorant transfer characteristics of white bread during baking.

PubMed

Onishi, Masanobu; Inoue, Michiko; Araki, Tetsuya; Iwabuchi, Hisakatsu; Sagara, Yasuyuki

2011-01-01

The potent odorants in the crust and crumb of white bread were identified and quantified by gas chromatography-mass spectrometry and gas chromatography/olfactometry. The weight loss ratio of the samples baked at 220 °C was controlled in the range of 0-28%. The odorants were classified into 5 types by the transfer characteristics: i) All amounts of odorant transferred from the crust to external space (type-I). ii) All transferred from the crust to the crumb and external space (type-II). iii) Certain amount remaining in the crust and the rest transferred to the crumb and external space (type-III). iv) All transferred from the crumb to external space (type-IV). v) Certain amount remaining in the crumb and the rest transferred to the crust and external space (type-V). The odorants of type-IV were not apparent after the crust had formed. The results indicate that the crust could be a barrier to prevent the odorants from being transferred to external space.

Immunotherapy using regulatory T cells in cancer suggests more flavors of hypersensitivity type IV.

PubMed

Pakravan, Nafiseh; Hassan, Zuhair Mohammad

2018-03-01

Regulatory T cells (Tregs) profoundly affect tumor microenvironment and exert dominant suppression over antitumor immunity in response to self-antigen expressed by tumor. Immunotherapy targeting Tregs lead to a significant improvement in antitumor immunity. Intradermal injection of tumor antigen results in negative delayed-type hypersensitivity (DTH) type IV. However, anti-Tregs treatment/use of adjuvant along with tumor antigens turns DTH to positive. Considering Tregs as the earliest tumor sensor/responders, tumor can be regarded as Treg-mediated type IV hypersensitivity and negative DTH to tumor antigen is due to anti-inflammatory action of Tregs to tumor antigens at the injection site. Such a view would help us in basic and clinical situations to testify a candidate vaccine via dermal administration and evaluation of Treg proportion at injection site.

[Treatment of Schatzker IV tibial plateau fractures with arthroscopy combined with MIPPO technique].

PubMed

Li, Jian-Wen; Ye, Feng; Bi, Da-Wei; Zheng, Xiao-Dong; Chen, Jian-Liang

2018-02-25

To discusses the clinical effects of arthroscopy combined with minimally invasive percutaneous plate osteosynthesis(MIPPO) technology in treating Schatzker IV tibial plateau fractures. From January 2012 to January 2016, 19 patients with Schatzker type IV tibial plateau fractures were treated with arthroscopy combined with minimally invasive technique including 12 males and 7 females with an average age of 46.5 years old ranging from 19 to 78 years old. Patients were suffering knee pain, swelling, flexion and extension limited, and other symptoms preoperative. Patients were followed up and assessed by Rasmussen knee function score. No infection, traumatic arthritis, and knee joint valgus occurred after operation. Nineteen cases were followed up for 12 to 24 months with an average of 18.6 months. Fracture healing time was 3 to 5 months with an average of 3.8 months. The knee pain and limited mobility improved significantly. The range of autonomic movement of joints was from 90 to 136 degrees. According to Rasmussen functional score criteria, the total score was 27.00±2.49, the result was excellent in 16 cases, good in 2 cases, fair in 1 case. Arthroscopic treatment for Schatzker type IV tibial plateau fractures combined with MIPPO can simultaneously treat internal structural injuries such as meniscus and other knee joints, with less trauma, fewer complications, and faster joint function recovery, but we must strictly grasp surgical indications and avoid expanding injuries. Copyright© 2018 by the China Journal of Orthopaedics and Traumatology Press.

[Clinical analysis of LPFP, PFNA and BPH in treating femoral intertrochanteric fractures in elderly patients].

PubMed

Zhu, Li-Jun; Li, Xiao-Fei; Liu, Chao; Lyu, Cheng-Yu

2017-07-25

To evaluate the clinical results of locking proximal femur plate(LPFP), proximal femoral nail antirotation(PFNA) and bipolar hemiarthroplasty(BPH) in the treatment of femoral intertrochanteric fractures in elderly patients. Retrospective analysis of the 86 elderly patients with femoral intertrochanteric fractures during June 2011 and August 2016 were enrolled in this study. The patients were divided into 3 groups: 26 cases in LPFP group included 10 males and 16 females with an average age of (72.54±4.78) years old, 5 cases of type II of Evans, 12 cases of type III and 9 cases of type IV; 39 cases in PFNA group included 17 males and 22 females with an average age of 74.41±5.65, 11 cases of type II, 18 cases of type III and 10 cases of type IV; 21 cases in BPH group included 9 males and 12 females with an average age of 76.23±6.97, 1 case of type II, 10 cases of type III and 10 cases of type IV. The data of three groups were collected for statistical analysis on the following aspects: operation time, intraoperative blood loss, the length of hospital stay, postoperative complications and Harris score of the hip joint function. The wound healed well and no complication occurred. Eighty-four cases were follow-up, while 2 cases were lost, the follow-up rate was 97.6%. The patients were followed up for 22 to 41 months with an average of 26.3 months. For comparison of operation time and time of the hospital stay, BPH group was shorter than the LPFP and PFNA group( F =19.782, 21.981, P <0.05). For comparison of the intraoperative blood loss, the BPH group was less blood loss than the LPFP and PFNA group( F =12.976, P <0.05), while there was no significant means between the LPFP and PFNA group( t =10.879, P >0.05). For comparison of the postoperative complications, LPFP group was higher than BHP and PFNA group( F =30.976, P <0.05), while there was no significant means between LPFP and PFNA group( t =9.902, P >0.05). For comparison of the Harris score of the hip joint at 1 year after operation, BPH and PFNA group were both higher than LPFP group( F =19.692, P <0.05), while there was no significant means between BPH and PFNA group ( t =4.971, P >0.05). For elder patient with femoral intertrochanteric fracture, BPH could be the best optional for the shorter operation time and less complications. And the PFNA also could be optional choice for the patients while the LPFP was forbidden for the elder patients.

Cardiac arrest after anesthetic management in a patient with hereditary sensory autonomic neuropathy type IV.

PubMed

Ergül, Yakup; Ekici, Bariş; Keskin, Sabiha

2011-01-01

Hereditary sensory autonomic neuropathy type IV is a rare disorder with an autosomal recessive transmission and characterized by self-mutilation due to a lack in pain and heat sensation. Recurrent hyperpyrexia and anhydrosis are seen in patients as a result of a lack of sweat gland innervation. Self-mutilation and insensitivity to pain result in orthopedic complications and patients undergone recurrent surgical interventions with anesthesia. However, these patients are prone to perioperative complications such as hyperthermia, hypothermia, and cardiac complications like bradycardia and hypotension. We report a 5-year-old boy with hereditary sensory autonomic neuropathy type IV, developing hyperpyrexia and cardiac arrest after anesthesia.

Delusional versus nondelusional body dysmorphic disorder: recommendations for DSM-5

PubMed Central

Phillips, Katharine A.; Hart, Ashley S.; Simpson, Helen Blair; Stein, Dan J.

2016-01-01

The core feature of body dysmorphic disorder (BDD) is distressing or impairing preoccupation with nonexistent or slight defects in one’s physical appearance. BDD beliefs are characterized by varying degrees of insight, ranging from good (ie, recognition that one’s BDD beliefs are not true) through “absent insight/delusional” beliefs (ie, complete conviction that one’s BDD beliefs are true). The Diagnostic and Statistical Manual of Mental Disorders, 3rd ed., rev. (DSM-III-R) and The Diagnostic and Statistical Manual of Mental Disorders, 4th ed. (DSM-IV) classified BDD’s nondelusional form in the somatoform section of the manual and its delusional form in the psychosis section, as a type of delusional disorder, somatic type (although DSM-IV allowed double-coding of delusional BDD as both a psychotic disorder and BDD). However, little or no evidence on this issue was available when these editions were published. In this article, we review the classification of BDD’s delusional and nondelusional variants in earlier editions of DSM and the limitations of their approaches. We then review empirical evidence on this topic, which has become available since DSM-IV was developed. Available evidence indicates that across a range of validators, BDD’s delusional and nondelusional variants have many more similarities than differences, including response to pharmacotherapy. Based on these data, we propose that BDD’s delusional and nondelusional forms be classified as the same disorder and that BDD’s diagnostic criteria include an insight specifier that spans a range of insight, including absent insight/delusional BDD beliefs. We hope that this recommendation will improve care for patients with this common and often-severe disorder. This increased understanding of BDD may also have implications for other disorders that have an “absent insight/delusional” form. PMID:23659348

Decameter Type IV Burst Associated with a Behind-the-limb CME Observed on 7 November 2013

NASA Astrophysics Data System (ADS)

Melnik, V. N.; Brazhenko, A. I.; Konovalenko, A. A.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.; Frantsuzenko, A. V.; Shevchuk, M. V.

2018-03-01

We report on the results of observations of a type IV burst made by the Ukrainian Radio interferometer of the Academy of Sciences (URAN-2) in the frequency range 22 - 33 MHz. The burst is associated with a coronal mass ejection (CME) initiated by a behind-the-limb active region (N05E151) and was also observed by the Nançay Decameter Array (NDA) radio telescope in the frequency band 30 - 60 MHz. The purpose of the article is the determination of the source of this type IV burst. After analysis of the observational data obtained with the URAN-2, the NDA, the Solar-Terrestrial Relations Observatory (STEREO) A and B spacecraft, and the Solar and Heliospheric Observatory (SOHO) spacecraft, we come to the conclusion that the source of the burst is the core of a behind-the-limb CME. We conclude that the radio emission can escape the center of the CME core at a frequency of 60 MHz and originates from the periphery of the core at a frequency of 30 MHz that is due to occultation by the solar corona at the corresponding frequencies. We find plasma densities in these regions assuming the plasma mechanism of radio emission. We show that the frequency drift of the start of the type IV burst is governed by an expansion of the CME core. The type III bursts that were observed against this type IV burst are shown to be generated by fast electrons propagating through the CME core plasma. A type II burst was registered at frequencies of 44 - 64 MHz and 3 - 16 MHz and was radiated by a shock with velocities of about 1000 km s^{-1} and 800 km s^{-1}, respectively.

Transport Modeling for Metallic Electrode: Semiconducting Nanotube Systems

NASA Technical Reports Server (NTRS)

Yamada, Toshishige; Biegel, Bryan (Technical Monitor)

2001-01-01

Recently, current-voltage (I-V) characteristics have been reported by Collins et al. for a system with a scanning tunneling microscope (STM) tip and a carbon nanotube. The STM tip was driven forward into a film of many entangled nanotubes on a substrate, and then was retracted, so that one of nanotubes bridged the STM and the film. I-V characteristics had two different patterns for different heights. One showed large dI/ dV with V greater than 0, small dI/dV with V less than 0, and I = 0 near V = 0 (type-I), while the other showed rectification, i.e., I does not equal 0 only with V less than 0 (type-II), with the tip grounded. We propose a physical mechanism to explain the observed I-V patterns. We consider that the observed characteristics strongly reflected the nature of the tip (metal) - nanotube (semiconductor) contact. The other end of the nanotube was entangled well in the film, and simply provided a good Ohmic contact. We will argue that there are two different contact modes: vacuum gap and touching modes, depending on the presence or absence of a tiny vacuum gap d approx. 0.1 - 0.2 nm at the junction. These modes may be related to physisorption and chemisorption, respectively. Once admitting their existence, it is naturally shown that I-V characteristics are type-I in the vacuum gap mode, and type-II in the touching mode. We argue that the nanotube had to be an n-type semiconductor judging from the I-V characteristics, contrary to often observed p-type in the transistor applications, where p-type is probably due to the oxidation in air or the trapped charges in the silicon dioxide. Additional information is contained in the original extended abstract.

Organic metamorphism in the California petroleum basins; Chapter A, Rock-Eval and vitrinite reflectance

USGS Publications Warehouse

Price, Leigh C.; Pawlewicz, Mark J.; Daws, Ted A.

1999-01-01

The results of ROCK-EVAL and vitrinite reflectance analyses of a large sample base from more than 70 wells located in three oil-rich California petroleum basins are reported. The cores from these wells have a wide range of present-day burial temperatures (40 ? to 220 ? C). The rocks in these basins were deposited under highly variable conditions, sometimes resulting in substantially different organic matter (OM) types in rocks tens of meters vertically apart from each other in one well. The kinetic response of these different OM types to equivalent wellknown burial histories is a pivotal point of this study. In the Los Angeles and Ventura Basins, rock organic-richness significantly increased with depth, as did kerogen hydrogen content, and the percentage of fine-grained versus coarsegrained rocks. The shales in these basins are perceived as containing primarily hydrogen-rich amorphous OM. In actuality, the shallowest 2,000 to 3,000 m of rocks in the basins, and at least the upper 6,000 m of rocks in parts of the Los Angeles Basin central syncline, are dominated by type III/IV OM. In the Los Angeles Basin, mainstage hydrocarbon (HC) generation commences in the type III/IV OM at present-day burial temperatures of 85 ? to 110 ? C, most likely around 100 ? C, and is largely complete by 220 ? C. In the Southern San Joaquin Valley Basin, mainstage HC generation commences in type III/IV OM at 150 ? C and is also largely complete by 220 ? C. In the Ventura Basin, mainstage HC generation commences above 140 ? C in type III/IV OM. The apparent lower temperatures for commencement of HC generation in the Los Angeles Basin are attributed to the fact that parts of the basin were cooled from maximal burial temperatures by increased meteoric water flows during the last glaciations. All aspects of organic metamorphism, including mainstage HC generation, are strongly suppressed in rocks with hydrogenrich OM in these basins. For example, ROCK-EVAL data suggest that mainstage HC generation has not commenced in rocks with hydrogen-rich OM at present-day temperatures of 198?C. This observation is attributed to much stronger bonds in hydrogen- rich OM compared to types III and IV OM and, therefore, significantly higher burial temperatures are required to break these bonds. This difference in OM kinetics has profound ramifications for petroleum-geochemical exploration models. Organic-matter characteristics inherited from original depositional conditions were overlaid on, and at times confused interpretation of, characteristics from organic metamorphism in all study areas. In all the basins examined in this study, immature fine-grained rocks occasionally had high to very high carbon-normalized concentrations of pre-generation indigenous bitumen. This unusual characteristic may be due to unique depositional conditions in these basins.

Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors.

PubMed

Richter, Lubna V; Franks, Ashley E; Weis, Robert M; Sandler, Steven J

2017-04-15

Geobacter sulfurreducens , an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c -type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. Copyright © 2017 American Society for Microbiology.

Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors

PubMed Central

Franks, Ashley E.; Weis, Robert M.; Sandler, Steven J.

2017-01-01

ABSTRACT Geobacter sulfurreducens, an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c-type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. PMID:28138101

Hereditary sensory and autonomic neuropathy type IV and orthopaedic complications.

PubMed

Kim, W; Guinot, A; Marleix, S; Chapuis, M; Fraisse, B; Violas, P

2013-11-01

Hereditary sensory and autonomic neuropathy type IV (HSAN-IV) is a very rare autosomal recessive disorder characterized by recurrent episodes of unexplained fever, extensive anhidrosis, total insensitivity to pain, hypotonia, and mental retardation. The most frequent complications of this disease are corneal scarring, multiple fractures, joint deformities, osteomyelitis, and disabling self-mutilations. We reported the case of a 12-year-old boy. The goal was to discuss our decision-making and compare this case with cases described in the literature. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Campylobacter fetus subspecies contain conserved type IV secretion systems on multiple genomic islands and plasmids

USDA-ARS?s Scientific Manuscript database

The features contributing to the differences in pathogenicity of the C. fetus subspecies are unknown. Putative factors involved in pathogenesis are located in genomic islands that encode type IV secretion system (T4SS) and fic-domain (filamentation induced by cyclic AMP) proteins. In the genomes of ...

A unique evolution of the kidney phenotype in a patient with autosomal recessive Alport syndrome.

PubMed

Vischini, Gisella; Kapp, Meghan E; Wheeler, Ferrin C; Hopp, Laszlo; Fogo, Agnes B

2018-03-09

Alport syndrome is due to mutations in one of the genes encoding (α3,4,5) type IV collagen resulting in defective type IV collagen, a key component of the glomerular basement membrane (GBM). The GBM is initially thin, and with ongoing remodeling, develops a thickened basket-woven appearance. We report a unique case of a 9-year-old boy who was biopsied for hematuria and proteinuria, diagnosed as IgA nephropathy, with normal GBM appearance and thickness. Due to a family history of hematuria and chronic kidney disease, he subsequently underwent genetic evaluation and a mutation of α3 type IV collagen (COL4A3) was detected. Additional studies of the initial biopsy demonstrated abnormal type IV collagen immunostaining. A repeat biopsy 4years later showed characteristic glomerular basement membrane morphology of Alport syndrome, and scarring consistent with sequelae of IgA nephropathy. This is the first description of this unusual transition from an initial normal appearance of the glomerular basement membrane to the classic Alport phenotype. Copyright © 2018. Published by Elsevier Inc.

Exploring new classification criteria for the earliest type stars: the 3400 Aregion

NASA Astrophysics Data System (ADS)

Morrell, Nidia I.; Walborn, Nolan R.; Arias, Julia I.

2002-02-01

We propose spectroscopic observations of a sample of standard O2-O4 stars in the wavelength region containing the N IV 3479-83-85 Aand O IV 3381-85-3412 Alines, in order to analyze the behavior of these spectral features as a function of the spectral type. We aim to define new classification criteria for the hottest stars, evaluating these N IV and O IV lines near 3400 Aas possible temperature and luminosity discriminators. The former spectral class O3 has just been split into three different classes: O2, O3 and O3.5 (Walborn et al. 2001). The paucity of classification criteria at these types in the traditional wavelength domain (4000 - 4700 Å), makes clear the need to explore other spectral ranges in order to define additional constraints on the determination of spectral types and luminosity classes. The wavelength range around 3400 Ahas been observed in many faint, crowded early O-type stars by HST/FOS, the corresponding data being available from the HST archive. This enhances our interest in observing this spectral range in the classification standards for the early O-type stars in order to make these existing HST observations even more useful, allowing the determination of accurate spectral types for unknown objects from them, once the behavior of the new criteria in the standards has been charted.

Nascent Transcription Affected by RNA Polymerase IV in Zea mays

PubMed Central

Erhard, Karl F.; Talbot, Joy-El R. B.; Deans, Natalie C.; McClish, Allison E.; Hollick, Jay B.

2015-01-01

All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3ʹ-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance. PMID:25653306

Classification of small molecule protein kinase inhibitors based upon the structures of their drug-enzyme complexes.

PubMed

Roskoski, Robert

2016-01-01

Because dysregulation and mutations of protein kinases play causal roles in human disease, this family of enzymes has become one of the most important drug targets over the past two decades. The X-ray crystal structures of 21 of the 27 FDA-approved small molecule inhibitors bound to their target protein kinases are depicted in this paper. The structure of the enzyme-bound antagonist complex is used in the classification of these inhibitors. Type I inhibitors bind to the active protein kinase conformation (DFG-Asp in, αC-helix in). Type I½ inhibitors bind to a DFG-Asp in inactive conformation while Type II inhibitors bind to a DFG-Asp out inactive conformation. Type I, I½, and type II inhibitors occupy part of the adenine binding pocket and form hydrogen bonds with the hinge region connecting the small and large lobes of the enzyme. Type III inhibitors bind next to the ATP-binding pocket and type IV inhibitors do not bind to the ATP or peptide substrate binding sites. Type III and IV inhibitors are allosteric in nature. Type V inhibitors bind to two different regions of the protein kinase domain and are therefore bivalent inhibitors. The type I-V inhibitors are reversible. In contrast, type VI inhibitors bind covalently to their target enzyme. Type I, I½, and II inhibitors are divided into A and B subtypes. The type A inhibitors bind in the front cleft, the back cleft, and near the gatekeeper residue, all of which occur within the region separating the small and large lobes of the protein kinase. The type B inhibitors bind in the front cleft and gate area but do not extend into the back cleft. An analysis of the limited available data indicates that type A inhibitors have a long residence time (minutes to hours) while the type B inhibitors have a short residence time (seconds to minutes). The catalytic spine includes residues from the small and large lobes and interacts with the adenine ring of ATP. Nearly all of the approved protein kinase inhibitors occupy the adenine-binding pocket; thus it is not surprising that these inhibitors interact with nearby catalytic spine (CS) residues. Moreover, a significant number of approved drugs also interact with regulatory spine (RS) residues. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identification of airway mucosal type 2 inflammation by using clinical biomarkers in asthmatic patients.

PubMed

Silkoff, Philip E; Laviolette, Michel; Singh, Dave; FitzGerald, J Mark; Kelsen, Steven; Backer, Vibeke; Porsbjerg, Celeste M; Girodet, Pierre-Olivier; Berger, Patrick; Kline, Joel N; Chupp, Geoffrey; Susulic, Vedrana S; Barnathan, Elliot S; Baribaud, Frédéric; Loza, Matthew J

2017-09-01

The Airways Disease Endotyping for Personalized Therapeutics (ADEPT) study profiled patients with mild, moderate, and severe asthma and nonatopic healthy control subjects. We explored this data set to define type 2 inflammation based on airway mucosal IL-13-driven gene expression and how this related to clinically accessible biomarkers. IL-13-driven gene expression was evaluated in several human cell lines. We then defined type 2 status in 25 healthy subjects, 28 patients with mild asthma, 29 patients with moderate asthma, and 26 patients with severe asthma based on airway mucosal expression of (1) CCL26 (the most differentially expressed gene), (2) periostin, or (3) a multigene IL-13 in vitro signature (IVS). Clinically accessible biomarkers included fraction of exhaled nitric oxide (Feno) values, blood eosinophil (bEOS) counts, serum CCL26 expression, and serum CCL17 expression. Expression of airway mucosal CCL26, periostin, and IL-13-IVS all facilitated segregation of subjects into type 2-high and type 2-low asthmatic groups, but in the ADEPT study population CCL26 expression was optimal. All subjects with high airway mucosal CCL26 expression and moderate-to-severe asthma had Feno values (≥35 ppb) and/or high bEOS counts (≥300 cells/mm 3 ) compared with a minority (36%) of subjects with low airway mucosal CCL26 expression. A combination of Feno values, bEOS counts, and serum CCL17 and CCL26 expression had 100% positive predictive value and 87% negative predictive value for airway mucosal CCL26-high status. Clinical variables did not differ between subjects with type 2-high and type 2-low status. Eosinophilic inflammation was associated with but not limited to airway mucosal type 2 gene expression. A panel of clinical biomarkers accurately classified type 2 status based on airway mucosal CCL26, periostin, or IL-13-IVS gene expression. Use of Feno values, bEOS counts, and serum marker levels (eg, CCL26 and CCL17) in combination might allow patient selection for novel type 2 therapeutics. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. All rights reserved.

A Solar Stationary Type IV Radio Burst and Its Radiation Mechanism

NASA Astrophysics Data System (ADS)

Liu, Hongyu; Chen, Yao; Cho, Kyungsuk; Feng, Shiwei; Vasanth, Veluchamy; Koval, Artem; Du, Guohui; Wu, Zhao; Li, Chuanyang

2018-04-01

A stationary Type IV (IVs) radio burst was observed on September 24, 2011. Observations from the Nançay RadioHeliograph (NRH) show that the brightness temperature (TB) of this burst is extremely high, over 10^{11} K at 150 MHz and over 108 K in general. The degree of circular polarization (q) is between -60% ˜ -100%, which means that it is highly left-handed circularly polarized. The flux-frequency spectrum follows a power-law distribution, and the spectral index is considered to be roughly -3 ˜ -4 throughout the IVs. Radio sources of this event are located in the wake of the coronal mass ejection and are spatially dispersed. They line up to present a formation in which lower-frequency sources are higher. Based on these observations, it is suggested that the IVs was generated through electron cyclotron maser emission.

C IV λ1549 as an Eigenvector 1 Parameter for Active Galactic Nuclei

NASA Astrophysics Data System (ADS)

Sulentic, Jack W.; Bachev, Rumen; Marziani, Paola; Negrete, C. Alenka; Dultzin, Deborah

2007-09-01

We are exploring a spectroscopic unification for all types of broad-line emitting AGNs. The four-dimensional Eigenvector 1 (4DE1) parameter space organizes quasar diversity in a sequence primarily governed by Eddington ratio. This paper considers the role of C IV λ1549 measures as 4DE1 diagnostics. We use HST archival spectra for 130 sources with S/N high enough to permit reliable C IV λ1549 broad-component measures. We find a C IV λ1549BC profile blueshift that is strongly concentrated among (largely radio-quiet [RQ]) sources with FWHM(HβBC)<~4000 km s-1 (which we call Population A). Narrow-line Seyfert 1 (NLSy1; with FWHM Hβ<=2000 km s-1) sources belong to this population but do not emerge as a distinct class. The systematic blueshift, widely interpreted as arising in a disk wind/outflow, is not observed in broader line AGNs (including most radio-loud [RL] sources), which we call Population B. We find new correlations involving FWHM(C IV λ1549BC), C IV λ1549 line shift, and equivalent width only among Population A sources. Sulentic et al. suggested C IV λ1549 measures enhance an apparent dichotomy between sources with FWHM(HβBC) less and greater than 4000 km s-1, suggesting that it has more significance in the context of broad-line region structure than the more commonly discussed RL versus RQ dichotomy. Black hole masses computed from FWHM C IV λ1549BC for about 80 AGNs indicate that the C IV λ1549 width is a poor virial estimator. Comparison of mass estimates derived from HβBC and C IV λ1549 reveals that the latter show different and nonlinear offsets for Population A and B sources. A significant number of sources also show narrow-line C IV λ1549 emission that must be removed before C IV λ1549BC measures can be made and interpreted effectively. We present a recipe for C IV λ1549 narrow-component extraction.

Practice patterns for the use of iodinated i.v. contrast media for pediatric CT studies: a survey of the Society for Pediatric Radiology.

PubMed

Callahan, Michael J; Servaes, Sabah; Lee, Edward Y; Towbin, Alexander J; Westra, Sjirk J; Frush, Donald P

2014-04-01

There are limited data available on the use of i.v. contrast media for CT studies in the pediatric population. The purpose of this study is to determine the practice patterns of i.v. contrast media usage for pediatric CT by members of the Society for Pediatric Radiology (SPR). SPR members were surveyed regarding the use of i.v. contrast media for pediatric CT studies. Questions pertained to information required before administering i.v. contrast media, types of central catheters for injecting i.v. contrast media, injection rates based on angiocatheter size and study type, and management of i.v. contrast media extravasation. The response rate of 6% (88/1545) represented practice patterns of 26% (401/1545) of the SPR membership. Most respondents thought the following clinical information was mandatory before i.v. contrast media administration: allergy to i.v. contrast media (97%), renal insufficiency (97%), current metformin use (72%), significant allergies (61%), diabetes (54%), and asthma (52%). Most administered i.v. contrast media through nonimplanted central venous catheters (78%), implanted venous ports (78%), and peripherally inserted central catheters (72%). The most common maximum i.v. contrast media injection rates were 5.0 mL/s or greater for a 16-gauge angiocatheter, 4.0 mL/s for an 18-gauge angiocatheter, 3.0 mL/s for a 20-gauge angiocatheter, and 2.0 mL/s for a 22-gauge angiocatheter. For soft-tissue extravasation of i.v. contrast media, 95% elevate the affected extremity, 76% use ice, and 45% use heat. The results of this survey illustrate the collective opinion of a subset of SPR members relating to the use of i.v. contrast media in pediatric CT, providing guidelines for clinical histories needed before i.v. contrast media, maximum i.v. contrast injection rates for standard angiocatheters, contrast media injection rates for specific CT studies, and management of i.v. contrast media soft-tissue extravasation.

A study of lip print pattern in Goan dental students - A digital approach.

PubMed

Prabhu, Rachana V; Dinkar, Ajit; Prabhu, Vishnudas

2012-10-01

To find the incidence of different types of lip patterns, the dominant pattern, quadrant wise, amongst the Goan population. To assess, the quadrant wise differences in lip patterns among males and females and to report new lip print pattern in Goan population. Lip prints of 100 students studying in Goa Dental College & Hospital were taken using 14 mm wide and 50 mm long Scotch tape without any distortion. These prints were then scanned (256 gray shades at a resolution of 300 dpi.) for the digital analysis. Using various applications of Adobe Photoshop 7 software an attempt was made to trace each and every line. K. Suzuki and Y. Tsuchihashi's classification was followed to define the patterns of the grooves. The current study has found the most predominant pattern in Quadrant I to be Type V (580 lines; 52.39%) followed in order by Type I' (196 lines; 17.70%), Type I (166 lines; 14.99%), Type II (166 lines; 10.47%), Type IV (40 lines; 3.61%), Type III (9 lines; 0.81%). In Quadrant II of this study the most predominant pattern recorded was Type V (589 lines; 50.47%) followed in order by Type I' (209 lines; 17.90%), Type I (204 lines; 17.48%), Type II (130 lines; 11.13%), Type IV (34 lines; 2.91%), Type III (1 line; 0.08%). In Quadrant III of this study the most predominant pattern recorded was again Type V (484 lines; 52.09%) followed in order by Type I' (174 lines; 18.72%), Type I (155 lines; 16.68%), Type II (102 lines; 10.97%), Type IV (9 lines; 0.96%), Type III (5 lines; 0.53%). In Quadrant IV of this study the most predominant pattern recorded was Type V (543 lines; 58.19%) followed in order by Type I (151 lines; 16.18%), Type I' (138 lines; 14.79%), Type II (85 lines; 9.11%), Type III (9 lines; 0.96%), Type IV (7 line; 0.75%). In all four Quadrants the most predominant pattern found in males and females was Type V. The present study recorded the following types of type V patterns for the first time; Trifurcations, Bridge or 'H' pattern, Horizontal Lines, Cartwheel, Pineapple Skin and Multiple Branching Appearance. The digital method of analyzing the Lip Print images using Adobe Photoshop 7 software serves as a convenient method that provides better visualization and ease in identification and recording of the Lip Print pattern. Predominant pattern in all four quadrants was Type V followed by the linear pattern i.e. Type I' in quadrants I, II, and III and Type I in quadrant IV in the studied population. Distribution of pattern is not affected by the sex. Although type V is the most predominant pattern found in Goan population, the sub-classification of this type defines the more defined term and aids in accuracy of the classification. Copyright © 2012. Published by Elsevier Ltd.

Anomalous ionization seen in the spectra of B supergiants

NASA Technical Reports Server (NTRS)

Cassinelli, J. P.; Abbott, D. C.

1981-01-01

An IUE survey of B supergiants has been conducted to study the persistence with spectral type of the ultraviolet resonance lines of N V, C IV and Si IV. N V is seen as late as B2.5Ia, C IV until B6Ia and Si IV throughout the range from B1.5 to B9. This is in fairly good agreement with the Auger ionization model of Cassinelli and Olson (1979). The terminal velocities are derived for the 20 stars in the sample and it is found that the ratio v(T)/v(esc) decreases monotonically with spectral type from the value of 3.0 that it has in the O spectral range to the value 1.0 at B9Ia.

Safety of a picosecond laser with diffractive lens array (DLA) in the treatment of Fitzpatrick skin types IV to VI: A retrospective review.

PubMed

Haimovic, Adele; Brauer, Jeremy A; Cindy Bae, Yoon-Soo; Geronemus, Roy G

2016-05-01

Laser therapy in patients with skin of color is associated with an increased rate of complications. The 755-nm picosecond laser with the diffractive lens array (DLA) has been used for the treatment of scars, striae, and rejuvenation. By delivering high energy to focused areas, the DLA minimizes complications. This study explores the adverse events associated with treatment with the 755-nm picosecond laser with DLA in individuals with Fitzpatrick skin type IV to VI. A retrospective chart review of patients treated with the 755-nm picosecond laser with DLA with a standardized spot size of 6 mm, fluence of 0.71 J/cm(2), and pulse width of 750 to 850 picoseconds was performed. Standard clinical photographs were obtained before treatment and at follow-up. Treatment sites were assessed for dyspigmentation, erythema, edema, and herpetic lesions. A total of 56 patients with Fitzpatrick skin type IV to VI, atrophic and hypertrophic scars, and pigmented lesions or striae were included. Ten patients (17.9%) were lost to follow-up. Transient adverse events, most commonly erythema and hyperpigmentation, were reported after therapy; these resolved in all cases. Retrospective design is a limitation. The 755-nm picosecond laser with the DLA device may be a safe therapeutic alternative for unwanted scars, pigmented lesions, and striae in patients with skin of color. Copyright © 2015 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

Interleukin-34 as a fibroblast-derived marker of liver fibrosis in patients with non-alcoholic fatty liver disease

PubMed Central

Shoji, Hirotaka; Yoshio, Sachiyo; Mano, Yohei; Kumagai, Erina; Sugiyama, Masaya; Korenaga, Masaaki; Arai, Taeang; Itokawa, Norio; Atsukawa, Masanori; Aikata, Hiroshi; Hyogo, Hideyuki; Chayama, Kazuaki; Ohashi, Tomohiko; Ito, Kiyoaki; Yoneda, Masashi; Nozaki, Yuichi; Kawaguchi, Takumi; Torimura, Takuji; Abe, Masanori; Hiasa, Yoichi; Fukai, Moto; Kamiyama, Toshiya; Taketomi, Akinobu; Mizokami, Masashi; Kanto, Tatsuya

2016-01-01

Non-alcoholic fatty liver disease (NAFLD) is a common cause of chronic non-viral liver disease. Activation of macrophages and hepatic stellate cells is a critical step that promotes liver fibrosis. We aimed to explore the feasibility of interleukin-34 (IL-34), a key regulator of macrophages, as a fibrosis marker in patients with NAFLD. We enrolled 197 liver biopsy-proven NAFLD patients. We evaluated the serum levels of IL-34, macrophage-colony stimulating factor (M-CSF), soluble CD163 (sCD163), 40 cytokines/chemokines, hyaluronic acid, type IV collagen 7s, and clinically-approved fibrosis scores. IL-34 increased with the progression of fibrosis and was an independent marker for liver fibrosis. Immunostaining experiments, using resected liver specimens from NAFLD patients, revealed that IL-34 was mainly expressed on liver fibroblasts. IL-34 based fibrosis score (0.0387*IL-34 (pg/ml) + 0.3623*type IV collagen 7s (ng/ml) + 0.0184*age (year)–1.1850) was a practical predictive model of liver fibrosis. Using receiver-operating characteristic analyses, the area under the curve, sensitivity, and specificity of IL-34 based fibrosis score were superior or comparable to the other fibrosis biomarkers and scores. In conclusion, the IL-34 based fibrosis score, including serum IL-34, type IV collagen 7s and age, is a feasible diagnostic marker of liver fibrosis in NAFLD patients. PMID:27363523

Molecular epidemiology of community-onset methicillin-resistant Staphylococcus aureus infections in Israel.

PubMed

Biber, A; Parizade, M; Taran, D; Jaber, H; Berla, E; Rubin, C; Rahav, G; Glikman, D; Regev-Yochay, G

2015-08-01

Data on community-associated (CA) methicillin-resistant Staphylococcus aureus (MRSA) in Israel are scarce. The objective of this study was to characterize the major CA-MRSA clones in Israel. All clinical MRSA isolates detected in the community during a period of 2.5 years (2011-2013) from individuals insured by a major health maintenance organization in Israel were collected, with additional data from medical records. Antibiotic susceptibility patterns and staphylococcal chromosomal cassette mec (SCCmec) typing were determined. SCCmec IV and V isolates were further typed by pulsed-field gel electrophoresis (PFGE), spa typing, and detection of a panel of toxin genes. MRSA were detected in 280 patients, mostly from skin infections. Patients with SCCmec IV (n = 120, 43 %) were younger (p < 0.0001) and reported less contact with healthcare facilities. Almost all isolates were trimethoprim-sulfamethoxazole susceptible (98 %). spa-CC032, a typical nosocomial MRSA clone, accounted for 28 % of SCCmec IV. The two major CA-MRSA clones were t008 USA300 (13 %) and t991 (10 %); t991 was isolated mainly from children (75 %), was Panton-Valentine leukocidin (PVL) negative but eta-positive, and was typically susceptible to most antibiotic groups. PVL-positive strains (n = 31) included mainly USA300 (52 %) and t019 (13 %). While multiple genetic lineages were evident among community-onset MRSA in Israel, approximately 20 % are typical CA-MRSA clones, mainly USA300 and a local clone, t991.

SOME COMMENTS ON TYPE IV BURSTS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, H.; Kakinuma, T.

1962-01-01

It has become clear that a large continuum burst is composed of 4 distinctive types, CM/sub 1/, CM/sub 2/, DM, and IV, which originate from different altitudes over the photosphere. The observational characters of each type are given. CM/sub 1/ is the main phase of a centimeter-wave burst originating from about 0.02-0.05 R/sub S/ in height. DM burst is polarized in the ordinary sense, which is the cause of reversal of polarization with frequency. Its center frequency lies between about 1000 and 200 Mc/s, and is often misunderstood as the original Type IV burst. The movement of magnetic field duringmore » a burst is suggested. CM/sub 2/ may be considered as an enhancement of the upper part of the source of S-component caused by this movement of the field. (auth)« less

Singular cosmological evolution using canonical and ghost scalar fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nojiri, Shin'ichi; Odintsov, S.D.; Oikonomou, V.K.

2015-09-01

We demonstrate that finite time singularities of Type IV can be consistently incorporated in the Universe's cosmological evolution, either appearing in the inflationary era, or in the late-time regime. While using only one scalar field instabilities can in principle occur at the time of the phantom-divide crossing, when two fields are involved we are able to avoid such instabilities. Additionally, the two-field scalar-tensor theories prove to be able to offer a plethora of possible viable cosmological scenarios, at which various types of cosmological singularities can be realized. Amongst others, it is possible to describe inflation with the appearance of amore » Type IV singularity, and phantom late-time acceleration which ends in a Big Rip. Finally, for completeness, we also present the Type IV realization in the context of suitably reconstructed F(R) gravity.« less

A non-LTE study of silicon line formation in early-type main-sequence atmospheres.

NASA Technical Reports Server (NTRS)

Kamp, L. W.

1973-01-01

We have computed populations of 16 levels of Si III-V and radiation fields in all connecting transitions; in particular the first six Si III triplet levels, including the 4553 line, and the first six Si IV levels including 4089. The computations were done for four non-LTE H-He model atmospheres, provided by Auer and Mihalas. Estimates of corresponding MK types are B1.5 V, B0.5 V, O9 V, and O6. Solutions were obtained by iterating the linearized equations of radiative transfer and statistical equilibrium, except that for less important lines an approximate equivalent two-level atom treatment was used. Continuous opacities of C, N, O, and Ne were included. All abundances were solar values.

Effects of Mineral Compositions on Matrix Diffusion and Sorption of 75Se(IV) in Granite.

PubMed

Yang, Xiaoyu; Ge, Xiangkun; He, Jiangang; Wang, Chunli; Qi, Liye; Wang, Xiangyun; Liu, Chunli

2018-02-06

Exploring the migration behaviors of selenium in granite is critical for the safe disposal of radioactive waste. The matrix diffusion and sorption of 75 Se(IV) (analogue for 79 Se) in granite were systematically studied to set reliable parameters in this work. Through-diffusion and batch sorption experiments were conduct with four types of Beishan granite. The magnitudes of the obtained apparent diffusion coefficient (D a ) values are of the following order: monzogranite > granodiorite-2 > granodiorite-1, which is opposite to the sequence of the K d values obtained from both the diffusion model and batch sorption experiments. The EPMA results of the granitic flakes showed that there was no obvious enrichment of Se(IV) on quartz, microcline and albite. Only biotite showed a weak affinity for Se(IV). Macroscopic sorption behaviors of Se(IV) on the four types of granite were identical with the sequence of the granitic biotite contents. Quantitative fitting results were also provided. XPS and XANES spectroscopy data revealed that bidentate inner-sphere complexes were formed between Se(IV) and Fe(III). Our results indicate that biotite can be representative of the Se(IV) sorption in complex mineral assemblages such as granite, and the biotite contents are critically important to evaluate Se(IV) transport in granite.

Comparison of currents predicted by NASCAP/LEO model simulations with elementary Langmuir-type bare probe models for an insulated cable containing a single pinhole

NASA Technical Reports Server (NTRS)

Galofaro, Joel T.

1990-01-01

The behavior of a defect in the insulation of a short biased section of cable in a Low Earth Orbit (LEO) space environment was examined. Such studies are of the utmost importance for large space power systems where great quantities of cabling will be deployed. An insulated probe containing a pinhole was placed into a hypothetical high speed LEO plasma. The NASA Charging Analyzer Program (NASCAP/LEO) was used to explore sheath growth about the probe as a function of applied voltage and to predict I-V behavior. A set of independent current calculations using Langmuir's formulations for concentric spheres and coaxial cylinders were also performed. The case of concentric spheres was here extended to include the case of concentric hemispheres. Several simple Langmuir-type models were then constructed to bracket the current collected by the cable. The space-charge sheath radius and impact parameters were used to determine the proper current regime. I-V curves were plotted for the models and comparisons were made with NASCAP/LEO results. Finally, NASCAP/LEO potential contours and surface cell potential plots were examined to explain interesting features in the NASCAP/LEO I-V curve.

Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

PubMed

Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

2002-09-01

With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

The role of the PHP domain associated with DNA polymerase X from Thermus thermophilus HB8 in base excision repair.

PubMed

Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

2012-11-01

Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.

45 CFR 2522.110 - What types of programs are eligible to compete for AmeriCorps grants?

Code of Federal Regulations, 2011 CFR

2011-10-01

... preprofessional training program in which students enrolled in an institution of higher education— (i) Receive... of higher education, including students participating in a work-study program assisted under part C of title IV of the Higher Education Act of 1965 (42 U.S.C. 2751 et seq.); (2) Teams composed of such...

Glycated Apolipoprotein A-IV Induces Atherogenesis in Patients With CAD in Type 2 Diabetes.

PubMed

Dai, Yang; Shen, Ying; Li, Qing Run; Ding, Feng Hua; Wang, Xiao Qun; Liu, Hong Juan; Yan, Xiao Xiang; Wang, Ling Jie; Yang, Ke; Wang, Hai Bo; Chen, Qiu Jing; Shen, Wei Feng; Zhang, Rui Yan; Lu, Lin

2017-10-17

Nonenzymatic glycation of apolipoproteins plays a role in the pathogenesis of the vascular complications of diabetes. This study investigated whether apolipoprotein (apo) A-IV was glycated in patients with type 2 diabetes mellitus (T2DM) and whether apoA-IV glycation was related to coronary artery disease (CAD). The study also determined the biological effects of glycated apoA-IV. The authors consecutively enrolled 204 patients with T2DM without CAD (Group I), 515 patients with T2DM with CAD (Group II), and 176 healthy subjects (control group) in this study. ApoA-IV was precipitated from ultracentrifugally isolated high-density lipoprotein, and its glycation level was determined based on Western blotting densitometry (relative intensity of apoA-IV glycation). ApoA-IV NƐ-(carboxylmethyl) lysine (CML) modification sites were identified by mass spectrometry in 37 control subjects, 63 patients in Group I, and 138 patients in Group II. Saline or glycated apoA-IV (g-apoA-IV) generated by glyoxal culture was injected into apoE -/- mice to evaluate atherogenesis, and was also used for the cell experiments. The relative intensity and the abundance of apoA-IV glycation were associated with the presence and severity of CAD in patients with T2DM (all p < 0.05). The experiments showed that g-apoA-IV induced proinflammatory reactions in vitro and promoted atherogenesis in apoE -/- mice through the nuclear receptor NR4A3. G-apoA-IV with mutations (K-A) at high-frequency glycation sites exhibited more weakened proinflammatory and atherogenic effects than did g-apoA-IV both in vitro and in vivo. ApoA-IV glycation is associated with CAD severity in patients with T2DM, and g-apoA-IV induces atherogenesis through NR4A3 in apoE -/- mice. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

In vitro characterization of the antibacterial spectrum of novel bacterial type II topoisomerase inhibitors of the aminobenzimidazole class.

PubMed

Mani, Nagraj; Gross, Christian H; Parsons, Jonathan D; Hanzelka, Brian; Müh, Ute; Mullin, Steve; Liao, Yusheng; Grillot, Anne-Laure; Stamos, Dean; Charifson, Paul S; Grossman, Trudy H

2006-04-01

Antibiotics with novel mechanisms of action are becoming increasingly important in the battle against bacterial resistance to all currently used classes of antibiotics. Bacterial DNA gyrase and topoisomerase IV (topoIV) are the familiar targets of fluoroquinolone and coumarin antibiotics. Here we present the characterization of two members of a new class of synthetic bacterial topoII ATPase inhibitors: VRT-125853 and VRT-752586. These aminobenzimidazole compounds were potent inhibitors of both DNA gyrase and topoIV and had excellent antibacterial activities against a wide spectrum of problematic pathogens responsible for both nosocomial and community-acquired infections, including staphylococci, streptococci, enterococci, and mycobacteria. Consistent with the novelty of their structures and mechanisms of action, antibacterial potency was unaffected by commonly encountered resistance phenotypes, including fluoroquinolone resistance. In time-kill assays, VRT-125853 and VRT-752586 were bactericidal against Staphylococcus aureus, Streptococcus pneumoniae, Enterococcus faecalis, and Haemophilus influenzae, causing 3-log reductions in viable cells within 24 h. Finally, similar to the fluoroquinolones, relatively low frequencies of spontaneous resistance to VRT-125853 and VRT-752586 were found, a property consistent with their in vitro dual-targeting activities.

In Vitro Characterization of the Antibacterial Spectrum of Novel Bacterial Type II Topoisomerase Inhibitors of the Aminobenzimidazole Class

PubMed Central

Mani, Nagraj; Gross, Christian H.; Parsons, Jonathan D.; Hanzelka, Brian; Müh, Ute; Mullin, Steve; Liao, Yusheng; Grillot, Anne-Laure; Stamos, Dean; Charifson, Paul S.; Grossman, Trudy H.

2006-01-01

Antibiotics with novel mechanisms of action are becoming increasingly important in the battle against bacterial resistance to all currently used classes of antibiotics. Bacterial DNA gyrase and topoisomerase IV (topoIV) are the familiar targets of fluoroquinolone and coumarin antibiotics. Here we present the characterization of two members of a new class of synthetic bacterial topoII ATPase inhibitors: VRT-125853 and VRT-752586. These aminobenzimidazole compounds were potent inhibitors of both DNA gyrase and topoIV and had excellent antibacterial activities against a wide spectrum of problematic pathogens responsible for both nosocomial and community-acquired infections, including staphylococci, streptococci, enterococci, and mycobacteria. Consistent with the novelty of their structures and mechanisms of action, antibacterial potency was unaffected by commonly encountered resistance phenotypes, including fluoroquinolone resistance. In time-kill assays, VRT-125853 and VRT-752586 were bactericidal against Staphylococcus aureus, Streptococcus pneumoniae, Enterococcus faecalis, and Haemophilus influenzae, causing 3-log reductions in viable cells within 24 h. Finally, similar to the fluoroquinolones, relatively low frequencies of spontaneous resistance to VRT-125853 and VRT-752586 were found, a property consistent with their in vitro dual-targeting activities. PMID:16569833

Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

PubMed

Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

2008-05-01

Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

Upregulated Expression of Integrin α1 in Mesangial Cells and Integrin α3 and Vimentin in Podocytes of Col4a3-Null (Alport) Mice

PubMed Central

Steenhard, Brooke M.; Vanacore, Roberto; Friedman, David; Zelenchuk, Adrian; Stroganova, Larysa; Isom, Kathryn; St. John, Patricia L.; Hudson, Billy G.; Abrahamson, Dale R.

2012-01-01

Alport disease in humans, which usually results in proteinuria and kidney failure, is caused by mutations to the COL4A3, COL4A4, or COL4A5 genes, and absence of collagen α3α4α5(IV) networks found in mature kidney glomerular basement membrane (GBM). The Alport mouse harbors a deletion of the Col4a3 gene, which also results in the lack of GBM collagen α3α4α5(IV). This animal model shares many features with human Alport patients, including the retention of collagen α1α2α1(IV) in GBMs, effacement of podocyte foot processes, gradual loss of glomerular barrier properties, and progression to renal failure. To learn more about the pathogenesis of Alport disease, we undertook a discovery proteomics approach to identify proteins that were differentially expressed in glomeruli purified from Alport and wild-type mouse kidneys. Pairs of cy3- and cy5-labeled extracts from 5-week old Alport and wild-type glomeruli, respectively, underwent 2-dimensional difference gel electrophoresis. Differentially expressed proteins were digested with trypsin and prepared for mass spectrometry, peptide ion mapping/fingerprinting, and protein identification through database searching. The intermediate filament protein, vimentin, was upregulated ∼2.5 fold in Alport glomeruli compared to wild-type. Upregulation was confirmed by quantitative real time RT-PCR of isolated Alport glomeruli (5.4 fold over wild-type), and quantitative confocal immunofluorescence microscopy localized over-expressed vimentin specifically to Alport podocytes. We next hypothesized that increases in vimentin abundance might affect the basement membrane protein receptors, integrins, and screened Alport and wild-type glomeruli for expression of integrins likely to be the main receptors for GBM type IV collagen and laminin. Quantitative immunofluorescence showed an increase in integrin α1 expression in Alport mesangial cells and an increase in integrin α3 in Alport podocytes. We conclude that overexpression of mesangial integrin α1 and podocyte vimentin and integrin α3 may be important features of glomerular Alport disease, possibly affecting cell-signaling, cell shape and cellular adhesion to the GBM. PMID:23236390

Immunohistochemical diagnosis of Alport's syndrome in paraffin-embedded renal sections: antigen retrieval with autoclave heating.

PubMed

Naito, Ichiro; Ninomiya, Yoshifumi; Nomura, Shinsuke

2003-03-01

Alport's syndrome (AS) is a hereditary renal disease caused by mutations in the genes encoding collagen type IV. Immunohistochemical analysis of the alpha chains of collagen type IV has been found to be useful for the diagnosis of this disease. The monoclonal antibodies (mAbs) generated by us recognize alpha 1(IV) through alpha 6(IV) chains of collagen type IV on fresh-frozen sections but not on paraffin-embedded sections. Antigen retrieval by autoclave heating has been found to restore the epitopes recognized by the mAbs; however the heating conditions had not been well established. In this study, the heating conditions were carefully examined using renal sections obtained from AS and non-AS patients. The heating was performed in an autoclave, at 105 degrees -127 degrees C for 6-8 min. During the heating, the sections were immersed in 0.2 N HCl solution (pH 0.9). Then, the mAbs were applied for 30 min, and the bound mAbs were detected using the LSAB kit. The optimal temperature for the antigen retrieval varied among specimens, and was dependent on the type of basement membrane examined. Thus, it was considered that heating at two or three different temperatures could be helpful for the precise diagnosis of AS. Adopting the antigen retrieval method could extend the possibility of immunohistochemical diagnosis of AS to cases without using fresh-frozen sections.

T1-weighted dynamic contrast-enhanced brain magnetic resonance imaging: A preliminary study with low infusion rate in pediatric patients.

PubMed

Rochetams, Bruno-Bernard; Marechal, Bénédicte; Cottier, Jean-Philippe; Gaillot, Kathleen; Sembely-Taveau, Catherine; Sirinelli, Dominique; Morel, Baptiste

2017-10-01

Background The aim of this preliminary study is to evaluate the results of T1-weighted dynamic contrast-enhanced (DCE) magnetic resonance imaging (MRI) in pediatric patients at 1.5T, with a low peripheral intravenous gadoteric acid injection rate of 1 ml/s. Materials and methods Children with neurological symptoms were examined prospectively with conventional MRI and T1-weighted DCE MRI. An magnetic resonance perfusion analysis method was used to obtain time-concentration curves (persistent pattern, type-I; plateau pattern, type-II; washout pattern, type-III) and to calculate pharmacokinetic parameters. A total of two radiologists manually defined regions of interest (ROIs) in the part of the lesion exhibiting the greatest contrast enhancement and in the surrounding normal or contralateral tissue. Lesion/surrounding tissue or contralateral tissue pharmacokinetic parameter ratios were calculated. Tumors were categorized by grade (I-IV) using the World Health Organization (WHO) Grade. Mann-Whitney testing and receiver-operating characteristic (ROC) curves were performed. Results A total of nine boys and nine girls (mean age 10.5 years) were included. Lesions consisted of 10 brain tumors, 3 inflammatory lesions, 3 arteriovenous malformations and 2 strokes. We obtained analyzable concentration-time curves for all patients (6 type-I, 9 type-II, 3 type-III). K trans between tumor tissue and surrounding or contralateral tissue was significantly different ( p = 0.034). K trans ratios were significantly different between grade I tumors and grade IV tumors ( p = 0.027) and a K trans ratio value superior to 0.63 appeared to be discriminant to determine a grade IV of malignancy. Conclusions Our results confirm the feasibility of pediatric T1-weighted DCE MRI at 1.5T with a low injection rate, which could be of great value in differentiating brain tumor grades.

Variation in arterial supply to the floor of the mouth and assessment of relative hemorrhage risk in implant surgery.

PubMed

Katsumi, Yuji; Tanaka, Ray; Hayashi, Takafumi; Koga, Taketo; Takagi, Ritsuo; Ohshima, Hayato

2013-04-01

Bleeding in the floor of the mouth during implant surgery is attributed to arterial injuries in the sublingual space: clinicians may injure the submental and sublingual arteries, which originate from the facial and lingual arteries, respectively. This study aimed to clarify the three-dimensional courses of submental and sublingual arteries and their topographic relation to the mandible. During the gross anatomy course at the Faculty of Dentistry and Graduate School, Niigata University (2009-2011), we investigated the relationship between the courses of submental and sublingual arteries and their dividing patterns of the mylohyoid muscle, sublingual gland, and mandible using 27 human cadavers. The courses of submental and sublingual arteries were divided into four patterns: (1) the sublingual space was supplied by the sublingual artery (type I: 63%), (2) it was supplied by both the sublingual and submental arteries (type II: 5.6%), (3) it was supplied by the submental artery without the sublingual artery (type III: 29.6%), and (4) type III without the deep lingual artery originated from the lingual artery (type IV: 1.8%). In type II, III, and IV, the submental artery perforates the mylohyoid muscle or takes a roundabout route to travel near the surface of the mandible. The percentage occurrence of arteries traveling between the sublingual gland and mandible in type II, III, and IV (55%) is higher than that in type I (8.8%). Susceptibility of the submental artery in type II, III, and IV to injury during implant surgery is suggested. © 2011 John Wiley & Sons A/S.

Improved multi-level capability in Si3N4-based resistive switching memory using continuous gradual reset switching

NASA Astrophysics Data System (ADS)

Kim, Sungjun; Park, Byung-Gook

2017-01-01

In this letter, we compare three different types of reset switching behavior in a bipolar resistive random-access memory (RRAM) system that is housed in a Ni/Si3N4/Si structure. The abrupt, step-like gradual and continuous gradual reset transitions are largely determined by the low-resistance state (LRS). For abrupt reset switching, the large conducting path shows ohmic behavior or has a weak nonlinear current-voltage (I-V) characteristics in the LRS. For gradual switching, including both the step-like and continuous reset types, trap-assisted direct tunneling is dominant in the low-voltage regime, while trap-assisted Fowler-Nordheim tunneling is dominant in the high-voltage regime, thus causing nonlinear I-V characteristics. More importantly, we evaluate the multi-level capabilities of the two different gradual switching types, including both step-like and continuous reset behavior, using identical and incremental voltage conditions. Finer control of the conductance level with good uniformity is achieved in continuous gradual reset switching when compared to that in step-like gradual reset switching. For continuous reset switching, a single conducting path, which initially has a tunneling gap, gradually responds to pulses with even and identical amplitudes, while for step-like reset switching, the multiple conducting paths only respond to incremental pulses to obtain effective multi-level states.

A systematic review of the management and outcome of ERCP related duodenal perforations using a standardized classification system.

PubMed

Cirocchi, Roberto; Kelly, Michael Denis; Griffiths, Ewen A; Tabola, Renata; Sartelli, Massimo; Carlini, Luigi; Ghersi, Stefania; Di Saverio, Salomone

2017-12-01

The incidence of duodenal perforation after ERCP ranges from 0.09% to 1.67% and mortality up to 8%. This systematic review was registered in Prospective Register of Systematic Reviews, PROSPERO. Stapfer classification of ERCP-related duodenal perforations was used. The systematic search yielded 259 articles. Most frequent post-ERCP perforation was Stapfer type II (58.4%), type I second most frequent perforation (17.8%) followed by Stapfer type III in 13.2% and type IV in 10.6%. Rate of NOM was lowest in Stapfer type I perforations (13%), moderate in type III lesions (58.1%) and high in other types of perforations (84.2% in type II and 84.6% in IV). In patients underwent early surgical treatment (<24 h from ERCP) the most frequent operation was simple duodenal suture with or without omentopexy (93.7%). In patients undergoing late surgical treatment (>24 h from ERCP) interventions performed were more complex. In type I lesions post-operative mortality rate was higher in patients underwent late operation (>24 h). In type I lesions, failure of NOM occurred in 42.8% of patients. In type II failure of NOM occurred in 28.9% of patients and in type III there was failure of NOM in only 11.1%, none in type IV. Postoperative mortality after NOM failure was 75% in type I, 22.5% in type II and none died after surgical treatment for failure of NOM in type III perforations. This systematic review showed that in patients with Stapfer type I lesions, early surgical treatment gives better results, however the opposite seems true in Stapfer III and IV lesions. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

Effects of carbonate species on the kinetics of dechlorination of 1,1,1-trichloroethane by zero-valent iron.

PubMed

Agrawal, Abinash; Ferguson, William J; Gardner, Bruce O; Christ, John A; Bandstra, Joel Z; Tratnyek, Paul G

2002-10-15

The effect of precipitates on the reactivity of iron metal (Fe0) with 1,1,1-trichloroethane (TCA) was studied in batch systems designed to model groundwaters that contain dissolved carbonate species (i.e., C(IV)). At representative concentrations for high-C(IV) groundwaters (approximately 10(-2) M), the pH in batch reactors containing Fe0 was effectively buffered until most of the aqueous C(IV) precipitated. The precipitate was mainly FeCO3 (siderite) but may also have included some carbonate green rust. Exposure of the Fe0 to dissolved C(IV) accelerated reduction of TCA, and the products formed under these conditions consisted mainly of ethane and ethene, with minor amounts of several butenes. The kinetics of TCA reduction were first-order when C(IV)-enhanced corrosion predominated but showed mixed-order kinetics (zero- and first-order) in experiments performed with passivated Fe0 (i.e., before the onset of pitting corrosion and after repassivation by precipitation of FeCO3). All these data were described by fitting a Michaelis-Menten-type kinetic model and approximating the first-order rate constant as the ratio of the maximum reaction rate (Vm) and the concentration of TCA at half of the maximum rate (K(1/2)). The decrease in Vm/K(1/2) with increasing C(IV) exposure time was fit to a heuristic model assuming proportionality between changes in TCA reduction rate and changes in surface coverage with FeCO3.

Classifying Non-Small Cell Lung Cancer by Status of Programmed Cell Death Ligand 1 and Tumor-Infiltrating Lymphocytes on Tumor Cells.

PubMed

Cui, Shaohua; Dong, Lili; Qian, Jialin; Ye, Lin; Jiang, Liyan

2018-01-01

Purpose: To explore the possible correlation between programmed death ligand 1 (PD-L1)/tumor-infiltrating lymphocytes (TIL) status and clinical factors in non-small cell lung (NSCLC). Materials and Methods: A total of 126 surgical NSCLC samples with stage I to IIIA were retrospectively collected and analyzed. Immunohistochemistry (IHC) assays were used to detect PD-L1 protein expression. PD-L1 positivity on tumor cells was defined by positive tumor cell (TC) percentage using 5% cutoff value. Results: Thirty-seven patients (29.4%), thirty patients (23.8%), six patients (4.8%) and fifty-three patients (42%) were classified as type I (PD-L1+, TIL+), type II (PD-L1-, TIL-), type III (PD-L1+, TIL-) and type IV (PD-L1-, TIL+) tumor environments according to PD-L1/TIL status, respectively. Statistical differences could be observed in factors including gender ( P <0.001), smoking status ( P <0.001), age ( P =0.002), histological types ( P <0.001), EGFR mutation ( P =0.008) and KRAS mutation ( P =0.003) across the four type tumors. Type I tumors were associated with ever smoking, non-adenocarcinoma histological types and KRAS mutation. Type II tumors were associated with female gender, never-smoking, adenocarcinoma histological types and EGFR mutation. Type III tumors were associated with ever smoking and type IV tumors were associated with female gender and EGFR mutation. Conclusion: Clinical factors associated with NSCLC microenvironment types based on PD-L1/TIL differed a lot across different types. The findings of this study may help to facilitate the understanding of the relationship between tumor microenvironment and clinical factors, and also the selecting of patients for combination immunotherapies.

Treatment of Medial Malleolus or Pure Deltoid Ligament Injury in Patients with Supination-External Rotation Type IV Ankle Fractures.

PubMed

Wang, Xu; Zhang, Chao; Yin, Jian-Wen; Wang, Chen; Huang, Jia-Zhang; Ma, Xin; Wang, Cheng-Wei; Wang, Xue

2017-02-01

To investigate the effect of internal fixation on postoperative ankle function in patients with supination-external rotation type IV ankle fractures, including medial malleolus fractures and deltoid ligament injury. Between January 2012 and June 2014, patients with medial structure injuries were enrolled in this study and assigned to the medial malleolus fracture group or the deltoid ligament group. The surgical procedures for the two groups were documented. The follow-up endpoint was the time point when the steel plate or screw was removed from the lateral ankle. The Olerud-Molander ankle scoring system was used to assess ankle function. A total of 84 patients with supination-external rotation type IV ankle fractures had complete medical records and were included in this study. The average age of the patients was 44.16 years (range, 15-75). The patient sample included 39 males and 45 females. Overall, 49 patients (19 males and 30 females) suffered a medial malleolus fracture. The average age of these patients was 40.20 years (range, 15-75). Patients with a posterior malleolar fracture fragment >25% of the articular surface accounted for 81.6% (40 patients) of these patients. Overall, 35 patients (20 males and 15 females) experienced a deltoid ligament injury. The average age of these patients was 44.21 years (range, 17-73). Patients with a posterior malleolar fracture fragment >25% of the articular surface accounted for 11.5% (four patients) of these patients. Open reduction was performed in patients with medial malleolus fractures, and two 4.0-mm cannulated screws were used to fixate the posterior malleolus and the medial malleolus. The suture-anchor technique was used to repair the ligaments in patients with deltoid ligament injuries. The follow-up endpoint was the time point when the steel plate and screws were removed from the lateral ankle in patients. The average follow-up period was 13.4 months (range, 11-17). The Olerud-Molander ankle scoring system was used to assess postoperative ankle function. The average score for the patients in the medial malleolus fracture group was 90.3 points (range, 85-95). The average score for the patients in the deltoid ligament injury group was 87.7 points (range, 80-95). No significant differences were found in the scores between the two groups. Medial malleolus fracture and deltoid ligament injury are two different presentations of supination-external rotation type IV ankle fractures. Anatomic reduction of the articular surface concurrent with restoration of ankle stability can achieve favorable results for these two injuries. © 2017 Chinese Orthopaedic Association and John Wiley & Sons Australia, Ltd.

Tissue-engineered cartilaginous constructs for the treatment of caprine cartilage defects, including distribution of laminin and type IV collagen.

PubMed

Jeng, Lily; Hsu, Hu-Ping; Spector, Myron

2013-10-01

The purpose of this study was the immunohistochemical evaluation of (1) cartilage tissue-engineered constructs; and (2) the tissue filling cartilage defects in a goat model into which the constructs were implanted, particularly for the presence of the basement membrane molecules, laminin and type IV collagen. Basement membrane molecules are localized to the pericellular matrix in normal adult articular cartilage, but have not been examined in tissue-engineered constructs cultured in vitro or in tissue filling cartilage defects into which the constructs were implanted. Cartilaginous constructs were engineered in vitro using caprine chondrocyte-seeded type II collagen scaffolds. Autologous constructs were implanted into 4-mm-diameter defects created to the tidemark in the trochlear groove in the knee joints of skeletally mature goats. Eight weeks after implantation, the animals were sacrificed. Constructs underwent immunohistochemical and histomorphometric evaluation. Widespread staining for the two basement membrane molecules was observed throughout the extracellular matrix of in vitro and in vivo samples in a distribution unlike that previously reported for cartilage. At sacrifice, 70% of the defect site was filled with reparative tissue, which consisted largely of fibrous tissue and some fibrocartilage, with over 70% of the reparative tissue bonded to the adjacent host tissue. A novel finding of this study was the observation of laminin and type IV collagen in in vitro engineered cartilaginous constructs and in vivo cartilage repair samples from defects into which the constructs were implanted, as well as in normal caprine articular cartilage. Future work is needed to elucidate the role of basement membrane molecules during cartilage repair and regeneration.

Tissue-Engineered Cartilaginous Constructs for the Treatment of Caprine Cartilage Defects, Including Distribution of Laminin and Type IV Collagen

PubMed Central

Jeng, Lily; Hsu, Hu-Ping

2013-01-01

The purpose of this study was the immunohistochemical evaluation of (1) cartilage tissue-engineered constructs; and (2) the tissue filling cartilage defects in a goat model into which the constructs were implanted, particularly for the presence of the basement membrane molecules, laminin and type IV collagen. Basement membrane molecules are localized to the pericellular matrix in normal adult articular cartilage, but have not been examined in tissue-engineered constructs cultured in vitro or in tissue filling cartilage defects into which the constructs were implanted. Cartilaginous constructs were engineered in vitro using caprine chondrocyte-seeded type II collagen scaffolds. Autologous constructs were implanted into 4-mm-diameter defects created to the tidemark in the trochlear groove in the knee joints of skeletally mature goats. Eight weeks after implantation, the animals were sacrificed. Constructs underwent immunohistochemical and histomorphometric evaluation. Widespread staining for the two basement membrane molecules was observed throughout the extracellular matrix of in vitro and in vivo samples in a distribution unlike that previously reported for cartilage. At sacrifice, 70% of the defect site was filled with reparative tissue, which consisted largely of fibrous tissue and some fibrocartilage, with over 70% of the reparative tissue bonded to the adjacent host tissue. A novel finding of this study was the observation of laminin and type IV collagen in in vitro engineered cartilaginous constructs and in vivo cartilage repair samples from defects into which the constructs were implanted, as well as in normal caprine articular cartilage. Future work is needed to elucidate the role of basement membrane molecules during cartilage repair and regeneration. PMID:23672504

Clues to evolution of the SERA multigene family in 18 Plasmodium species.

PubMed

Arisue, Nobuko; Kawai, Satoru; Hirai, Makoto; Palacpac, Nirianne M Q; Jia, Mozhi; Kaneko, Akira; Tanabe, Kazuyuki; Horii, Toshihiro

2011-03-15

SERA gene sequences were newly determined from 11 primate Plasmodium species including two human parasites, P. ovale and P. malariae, and the evolutionary history of SERA genes was analyzed together with 7 known species. All have one each of Group I to III cysteine-type SERA genes and varying number of Group IV serine-type SERA genes in tandem cluster. Notably, Group IV SERA genes were ascertained in all mammalian parasite lineages; and in two primate parasite lineages gene events such as duplication, truncation, fragmentation and gene loss occurred at high frequency in a manner that mimics the birth-and-death evolution model. Transcription profile of individual SERA genes varied greatly among rodent and monkey parasites. Results support the lineage-specific evolution of the Plasmodium SERA gene family. These findings provide further impetus for studies that could clarify/provide proof-of-concept that duplications of SERA genes were associated with the parasites' expansion of host range and the evolutionary conundrums of multigene families in Plasmodium.

Novel degenerative and developmental defects in a zebrafish model of mucolipidosis type IV

PubMed Central

Li, Huiqing; Pei, Wuhong; Vergarajauregui, Sivia; Zerfas, Patricia M.; Raben, Nina; Burgess, Shawn M.; Puertollano, Rosa

2017-01-01

Abstract Mucolipidosis type IV (MLIV) is a lysosomal storage disease characterized by neurologic and ophthalmologic abnormalities. There is currently no effective treatment. MLIV is caused by mutations in MCOLN1, a lysosomal cation channel from the transient receptor potential (TRP) family. In this study, we used genome editing to knockout the two mcoln1 genes present in Danio rerio (zebrafish). Our model successfully reproduced the retinal and neuromuscular defects observed in MLIV patients, indicating that this model is suitable for studying the disease pathogenesis. Importantly, our model revealed novel insights into the origins and progression of the MLIV pathology, including the contribution of autophagosome accumulation to muscle dystrophy and the role of mcoln1 in embryonic development, hair cell viability and cellular maintenance. The generation of a MLIV model in zebrafish is particularly relevant given the suitability of this organism for large-scale in vivo drug screening, thus providing unprecedented opportunities for therapeutic discovery. PMID:28449103

Use of an Autologous Liver Round Ligament Flap Zeros Postoperative Bile Leak after Curative Resection of Hilar Cholangiocarcinoma

PubMed Central

Sun, Da-Xin; Tan, Xiao-Dong; Gao, Feng; Xu, Jin; Cui, Dong-Xu; Dai, Xian-Wei

2015-01-01

Background Postoperative bile leak is a major surgical morbidity after curative resection with hepaticojejunostomy for hilar cholangiocarcinoma, especially in Bismuth-Corlette types III and IV. This retrospective study assessed the effectiveness and safety of an autologous hepatic round ligament flap (AHRLF) for reducing bile leak after hilar hepaticojejunostomy. Methods Nine type III and IV hilar cholangiocarcinoma patients were consecutively hospitalized for elective perihilar partial hepatectomy with hilar hepaticojejunostomy using an AHRLF between October 2009 and September 2013. The AHRLF was harvested to reinforce the perihilar hepaticojejunostomy. Main outcome measures included operative time, blood loss, postoperative recovery times, morbidity, bile leak, R0 resection rate, and overall survival. Results All patients underwent uneventful R0 resection with hilar hepaticojejunostomy. No patient experienced postoperative bile leak. Conclusions The AHRLF was associated with lack of bile leak after curative perihilar hepatectomy with hepaticojejunostomy for hilar cholangiocarcinoma, without compromising oncologic safety, and is recommended in selected patients. PMID:25938440

Severe manifestation of Bartter syndrome Type IV caused by a novel insertion mutation in the BSND gene.

PubMed

de Pablos, Augusto Luque; García-Nieto, Victor; López-Menchero, Jesús C; Ramos-Trujillo, Elena; González-Acosta, Hilaria; Claverie-Martín, Félix

2014-05-01

Bartter syndrome Type IV is a rare subtype of the Bartter syndromes that leads to both severe renal salt wasting and sensorineural deafness. This autosomal recessive disease is caused by mutations in the gene encoding barttin, BSND, an essential subunit of the ClC-K chloride channels expressed in renal and inner ear epithelia. Patients differ in the severity of renal symptoms, which appears to depend on the modification of channel function by the mutant barttin. To date, only a few BSND mutations have been reported, most of which are missense or nonsense mutations. In this study, we report the identification of the first insertion mutation, p.W102Vfs*7, in the BSND gene of a newborn girl with acute clinical symptoms including early-onset chronic renal failure. The results support previous data indicating that mutations that are predicted to abolish barttin expression are associated with a severe phenotype and early onset renal failure.

Novel mutations in the SOX10 gene in the first two Chinese cases of type IV Waardenburg syndrome.

PubMed

Jiang, Lu; Chen, Hongsheng; Jiang, Wen; Hu, Zhengmao; Mei, Lingyun; Xue, Jingjie; He, Chufeng; Liu, Yalan; Xia, Kun; Feng, Yong

2011-05-20

We analyzed the clinical features and family-related gene mutations for the first two Chinese cases of type IV Waardenburg syndrome (WS4). Two families were analyzed in this study. The analysis included a medical history, clinical analysis, a hearing test and a physical examination. In addition, the EDNRB, EDN3 and SOX10 genes were sequenced in order to identify the pathogenic mutation responsible for the WS4 observed in these patients. The two WS4 cases presented with high phenotypic variability. Two novel heterozygous mutations (c.254G>A and c.698-2A>T) in the SOX10 gene were detected. The mutations identified in the patients were not found in unaffected family members or in 200 unrelated control subjects. This is the first report of WS4 in Chinese patients. In addition, two novel mutations in SOX10 gene have been identified. Crown Copyright © 2011. Published by Elsevier Inc. All rights reserved.

Detection and modeling of leakage current in AlGaN-based deep ultraviolet light-emitting diodes

DOE PAGES

Moseley, Michael William; Allerman, Andrew A.; Crawford, Mary H.; ...

2015-03-01

Current-voltage (IV) characteristics of two AlGaN-based deep ultraviolet (DUV) light-emitting diodes (LEDs) with differing densities of open-core threading dislocations (nanopipes) are analyzed. A three-diode circuit is simulated to emulate the IV characteristics of the DUV-LEDs, but is only able to accurately model the lower leakage current, lower nanopipe density DUV-LED. It was found that current leakage through the nanopipes in these structures is rectifying, despite nanopipes being previously established as inherently n-type. Using defect-sensitive etching, the nanopipes are revealed to terminate within the p-type GaN capping layer of the DUV-LEDs. The circuit model is modified to account for another p-nmore » junction between the n-type nanopipes and the p-type GaN, and an excellent fit to the IV characteristics of the leaky DUV-LED is achieved.« less

Bevacizumab and Cediranib Maleate in Treating Patients With Metastatic or Unresectable Solid Tumor, Lymphoma, Intracranial Glioblastoma, Gliosarcoma or Anaplastic Astrocytoma

ClinicalTrials.gov

2014-02-14

Adult Grade III Lymphomatoid Granulomatosis; Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Childhood Burkitt Lymphoma; Childhood Diffuse Large Cell Lymphoma; Childhood Grade III Lymphomatoid Granulomatosis; Childhood Immunoblastic Large Cell Lymphoma; Childhood Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Noncutaneous Extranodal Lymphoma; Peripheral T-cell Lymphoma; Progressive Hairy Cell Leukemia, Initial Treatment; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Childhood Anaplastic Large Cell Lymphoma; Recurrent Childhood Large Cell Lymphoma; Recurrent Childhood Lymphoblastic Lymphoma; Recurrent Childhood Small Noncleaved Cell Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent/Refractory Childhood Hodgkin Lymphoma; Refractory Hairy Cell Leukemia; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Childhood Anaplastic Large Cell Lymphoma; Stage IV Childhood Hodgkin Lymphoma; Stage IV Childhood Large Cell Lymphoma; Stage IV Childhood Lymphoblastic Lymphoma; Stage IV Childhood Small Noncleaved Cell Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IVA Mycosis Fungoides/Sezary Syndrome; Stage IVB Mycosis Fungoides/Sezary Syndrome; T-cell Large Granular Lymphocyte Leukemia; Testicular Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

Solar radio observations in support of Skylab A

NASA Technical Reports Server (NTRS)

Gotwols, B. L.

1974-01-01

The solar radio spectra were recorded in real time, both on film and magnetic tape, during the period from November 1972 to February 1974. A catalogue of the observations is given for the frequency range 565-1000 MHz and includes descriptions of the bursts, intensity scales, and pertinent remarks. Some theoretical considerations resulting from the research are given. Equipment modified for the experiment is described and the text of the final report which summarizes the research on type IV solar radio bursts is included.

High Efficiency, Room Temperature Mid-Infrared Semiconductor Laser Development for IR Countermeasures

DTIC Science & Technology

2009-05-01

voltage (I-V) characteristics of several infrared LEDs, including a type-II W-well laser grown by Molecular Beam Epitaxy at Naval Research Laboratory...Injection Cavity (OPIC) lasers includes >4 um emission from a broadband laser and the measurement of spatial and temporal beam profiles. From August 2006...argon) at 15 mTorr, 400W ICP, and 70W RIE power, with an etch rate of 300 nm/min. Epitaxial ZnO layers were plasma etched using BCl3/SF0gas mixtures

Specific Phobia among U.S. Adolescents: Phenomenology and Typology

PubMed Central

Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

2014-01-01

Background Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. Methods The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13–18 years in the continental United States. Results Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Conclusions Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. PMID:23108894

Protease nexin 1 is a potent urinary plasminogen activator inhibitor in the presence of collagen type IV.

PubMed

Crisp, Robert J; Knauer, Mary F; Knauer, Daniel J

2002-12-06

Protease nexin 1 (PN1) in solution forms inhibitory complexes with thrombin or urokinase, which have opposing effects on the blood coagulation cascade. An initial report provided data supporting the idea that PN1 target protease specificity is under the influence of collagen type IV (1). Although collagen type IV demonstrated no effect on the association rate between PN1 and thrombin, the study reported that the association rate between PN1 and urokinase was allosterically reduced 10-fold. This has led to the generally accepted idea that the primary role of PN1 in the brain is to act as a rapid thrombin inhibition and clearance mechanism during trauma and loss of vascular integrity. In studies to identify the structural determinants of PN1 that mediate the allosteric interaction with collagen type IV, we found that protease specificity was only affected after transient exposure of PN1 to acidic conditions that mimic the elution protocol from a monoclonal antibody column. Because PN1 used in previous studies was purified over a monoclonal antibody column, we propose that the allosteric regulation of PN1 target protease specificity by collagen type IV is a result of the purification protocol. We provide both biochemical and kinetic data to support this conclusion. This finding is significant because it implies that PN1 may play a much larger role in the modeling and remodeling of brain tissues during development and is not simply an extravasated thrombin clearance mechanism as previously suggested.

Highly ionized gas absorption in the disk and halo toward HD 167756 at 3.5 kilometers per second resolution

NASA Technical Reports Server (NTRS)

Savage, Blair D.; Sembach, Kenneth R.; Cardelli, Jason A.

1994-01-01

High-resolution spectra of interstellar Si IV, C IV, and N V absorption lines along the 4 kpc path to the inner Galaxy star HD 167756 at z = -0.85 kpc are presented. The spectra were obtained with the echelle mode of Goddard High Resolution Spectrograph (GHRS) aboard the Hubble Space Telescope (HST) and have signal-to-noise ratios ranging from 23 to 38. The high resolution of the measurements full width at half maximum (FWHM = 3.5 km/s) results in fully resolved line profiles for the highly ionized gas absorption. The measurements provide information on the column density per unit velocity, N(v), as a function of velocity for Si IV, C IV, and N V. The C IV and N V profiles extend from -70 to +70 km/s, while the Si IV profiles extend from -40 to +70 km/s. The integrated logarithmic column densities are long N(Si IV) = 13.09 +/- 0.02, log N(C IV) = 13.83 +/- 0.02, and log N(N V) = 13.56 +/- 0.03. The N V profile is broad, asymmetric, and featureless, while the Si IV profile contains narrow absorption components near V(sub LSR) = -19, 0, +20, and +52 km/s with Doppler spread parameters, b about = 10-12 km/s. The C IV profile contains both broad and narrow structure. The high ion feature near +52 km/s is also detected in the low-ionization lines of Ca II, O I, Si II, and Fe II. The other narrow Si IV and C IV components occur within several km/s of components seen in low-ionization species. The sight line contains at least two types of highly ionized gas. One type gives rise to a broad N V profile, and the other results in the more structured Si IV profile. The C IV profile contains contributions from both types of highly ionized gas. The broad but asymmetric N V profile is well represented by a large Galactic scale height gas which is participating in Galactic rotation and has a combination of thermal and turbulent broadening with b(sub tot) about = 42 km/s. The C IV to N V abundance ratio of 1.0 +/- 0.3 for the gas implies T about 1.6 x 10(exp 5) K or about 8 x 10(exp 5) K if the gas is in collisional ionization equilibrium and has a solar carbon to nitrogen abundance ratio. This absorption may be associated with cooling hot gas situated in Galactic shells and supershells along the sight line. The gas producing the narrow Si IV and C IV absorption components has line widths that are compatible with origins in conductive interfaces between the warm and hot interstellar medium. Kinematic flows associated with the photoionized edges of clouds might also produce Si IV and C IV lines with Doppler spread parameters similar to those observed, but the C IV to Si IV ratio in this gas is 3.5, which leads us to favor the conductive interface interpretation.

Community-associated methicillin-resistant Staphylococcus aureus causing chronic pneumonia.

PubMed

Enayet, Iram; Nazeri, Ali; Johnson, Leonard B; Riederer, Kathleen; Pawlak, Joan; Saravolatz, Louis D

2006-04-01

A young woman presented with pneumonia of a 3-month duration with predominantly nodular pulmonary infiltrates. Methicillin-resistant Staphylococcus aureus was identified in multiple cultures of sputum specimens. According to findings of pulsed-field gel electrophoresis, the isolate was identical to USA 300 and carried a type IV Staphylococcus cassette chromosome mec type IV gene and the genes for Panton-Valentine leukocidin.

Treatment with 17-allylamino-17-demethoxygeldanamycin ameliorated symptoms of Bartter syndrome type IV caused by mutated Bsnd in mice.

PubMed

Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich

2013-11-22

Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.

The Effect of Basis Selection on Thermal-Acoustic Random Response Prediction Using Nonlinear Modal Simulation

NASA Technical Reports Server (NTRS)

Rizzi, Stephen A.; Przekop, Adam

2004-01-01

The goal of this investigation is to further develop nonlinear modal numerical simulation methods for prediction of geometrically nonlinear response due to combined thermal-acoustic loadings. As with any such method, the accuracy of the solution is dictated by the selection of the modal basis, through which the nonlinear modal stiffness is determined. In this study, a suite of available bases are considered including (i) bending modes only; (ii) coupled bending and companion modes; (iii) uncoupled bending and companion modes; and (iv) bending and membrane modes. Comparison of these solutions with numerical simulation in physical degrees-of-freedom indicates that inclusion of any membrane mode variants (ii - iv) in the basis affects the bending displacement and stress response predictions. The most significant effect is on the membrane displacement, where it is shown that only the type (iv) basis accurately predicts its behavior. Results are presented for beam and plate structures in the thermally pre-buckled regime.

Balanced complex chromosome rearrangements: reproductive aspects. A review.

PubMed

Madan, Kamlesh

2012-04-01

This review examines the reproductive consequences for carriers of a balanced complex chromosome rearrangement (CCR). It is based on an analysis of CCRs in 103 adults referred for reproductive problems, including male infertility. The main focus is on reproductive risks based on data from 84 CCRs. Carriers of balanced CCRs have a high risk of an abortion and/or a chromosomally unbalanced child. I have identified roughly four different types of CCRs (I-IV); most (44%) belong to Type I with a simple 3-way or 4-way exchange of segments and risk factors similar to those for reciprocal translocations. There were only three CCRs (4%) of type II, which involve an inversion. Type III CCRs (21%) involve one or more insertions with ∼35% risk of a child with a duplication or a deletion of the inserted segment. Type IV CCRs (31%) involve a "middle segment" in a derivative chromosome with segments from at least three chromosomes. In ∼35% of these CCRs, recombination occurs in this segment, which can produce imbalance but in many cases it changes a CCR into a simpler balanced rearrangement in the next generation. Balanced CCRs, which have been often considered together in one group, can now be split into four types, each with a risk of a different type of imbalance. This analysis provides a better understanding of the reproductive consequences for carriers of balanced CCRs and should be useful in prenatal diagnosis and genetic counseling. Copyright © 2012 Wiley Periodicals, Inc.

RNA polymerase V-dependent small RNAs in Arabidopsis originate from small, intergenic loci including most SINE repeats.

PubMed

Lee, Tzuu-fen; Gurazada, Sai Guna Ranjan; Zhai, Jixian; Li, Shengben; Simon, Stacey A; Matzke, Marjori A; Chen, Xuemei; Meyers, Blake C

2012-07-01

In plants, heterochromatin is maintained by a small RNA-based gene silencing mechanism known as RNA-directed DNA methylation (RdDM). RdDM requires the non-redundant functions of two plant-specific DNA-dependent RNA polymerases (RNAP), RNAP IV and RNAP V. RNAP IV plays a major role in siRNA biogenesis, while RNAP V may recruit DNA methylation machinery to target endogenous loci for silencing. Although small RNA-generating regions that are dependent on both RNAP IV and RNAP V have been identified previously, the genomic loci targeted by RNAP V for siRNA accumulation and silencing have not been described extensively. To characterize the RNAP V-dependent, heterochromatic siRNA-generating regions in the Arabidopsis genome, we deeply sequenced the small RNA populations of wild-type and RNAP V null mutant (nrpe1) plants. Our results showed that RNAP V-dependent siRNA-generating loci are associated predominately with short repetitive sequences in intergenic regions. Suppression of small RNA production from short repetitive sequences was also prominent in RdDM mutants including dms4, drd1, dms3 and rdm1, reflecting the known association of these RdDM effectors with RNAP V. The genomic regions targeted by RNAP V were small, with an estimated average length of 238 bp. Our results suggest that RNAP V affects siRNA production from genomic loci with features dissimilar to known RNAP IV-dependent loci. RNAP V, along with RNAP IV and DRM1/2, may target and silence a set of small, intergenic transposable elements located in dispersed genomic regions for silencing. Silencing at these loci may be actively reinforced by RdDM.

Comorbid Anxiety and Depression and Their Impact on Cardiovascular Disease in Type 2 Diabetes: The Fremantle Diabetes Study Phase II.

PubMed

Bruce, David G; Davis, Wendy A; Dragovic, Milan; Davis, Timothy M E; Starkstein, Sergio E

2016-10-01

The aims were to determine whether anxious depression, defined by latent class analysis (LCA), predicts cardiovascular outcomes in type 2 diabetes and to compare the predictive power of anxious depression with Diagnostic & Statistical Manual Versions IV and 5 (DSM-IV/5) categories of depression and generalized anxiety disorder (GAD). Prospective observational study of 1,337 type 2 participants. Baseline assessment with the 9-item Patient Health Questionnaire and the GAD Scale; LCA-defined groups with minor or major anxious depression based on anxiety and depression symptoms. Cox modeling used to compare the independent impact of: (1) LCA anxious depression, (2) DSM-IV/5 depression, (3) GAD on incident cardiovascular events and deaths after 4 years. LCA minor and major anxious depression was present in 21.9 and 7.8% of participants, respectively, DSM-IV/5 minor and major depression in 6.2 and 6.1%, respectively, and GAD in 4.8%. There were 110 deaths, 31 cardiovascular deaths, and 199 participants had incident cardiovascular events. In adjusted models, minor anxious depression (Hazard ratio (95% confidence intervals): 1.70 (1.15-2.50)) and major anxious depression (1.90 (1.11-3.25)) predicted incident cardiovascular events and major anxious depression also predicted cardiovascular mortality (4.32 (1.35-13.86)). By comparison, incident cardiovascular events were predicted by DSM-IV/5 major depression (2.10 (1.22-3.62)) only and cardiovascular mortality was predicted by both DSM-IV/5 major depression (3.56 (1.03-12.35)) and GAD (5.92 (1.84-19.08)). LCA-defined anxious depression is more common than DSM-IV/5 categories and is a strong predictor of cardiovascular outcomes in type 2 diabetes. These data suggest that this diagnostic scheme has predictive validity and clinical relevance. © 2016 Wiley Periodicals, Inc.

The willingness of patients to pay for intravenous patient-controlled analgesia in Korea.

PubMed

Lim, Hyungsun; Lee, Duck-Hyoung; Lee, Jeongwoo; Han, Young Jin; Choe, Huhn; Son, Ji-Seon

2012-06-01

The use of intravenous patient-controlled analgesia (IV-PCA) has been increasing because it has advantages such as improved pain relief, greater patient satisfaction, and fewer postoperative complications. However, current research has not considered the patients' thoughts about IV-PCA's cost-effectiveness. The purpose of this study was to investigate the willingness to pay (WTP) for IV-PCA and the relationship between patients' characteristics and WTP in Korea. We enrolled 400 adult patients who were scheduled for elective surgery. The patient was requested to indicate a series of predefined amounts of money (Korean won; 30,000/50,000/100,000/150,000/200,000/300,000/500,000). We also recorded patient characteristics, such as age, sex, type of surgery, IV-PCA history, education level, the person responsible for medical expenses, type of insurance, net annual income, and residential area. Three days after surgery, we asked about the degree of satisfaction and the WTP for IV-PCA. For IV-PCA, the median WTP was 100,000 won (25-75%; 50,000-200,000 won: US$1 = W1078.04; July 19, 2011) before surgery. All patients' characteristics were not related to preoperative WTP for IV-PCA, whereas the increase in WTP after surgery showed a tendency correlated to higher IV-PCA satisfaction. The median WTP was 100,000 won. The satisfaction of IV-PCA increased patients' WTP after surgery, but the WTP may be independent of patient characteristics in Korea.

Bond Strength of Gold Alloys Laser Welded to Cobalt-Chromium Alloy

PubMed Central

Watanabe, Ikuya; Wallace, Cameron

2008-01-01

The objective of this study was to investigate the joint properties between cast gold alloys and Co-Cr alloy laser-welded by Nd:YAG laser. Cast plates were fabricated from three types of gold alloys (Type IV, Type II and low-gold) and a Co-Cr alloy. Each gold alloy was laser-welded to Co-Cr using a dental laser-welding machine. Homogeneously-welded and non-welded control specimens were also prepared. Tensile testing was conducted and data were statistically analyzed using ANOVA. The homogeneously-welded groups showed inferior fracture load compared to corresponding control groups, except for Co-Cr. In the specimens welded heterogeneously to Co-Cr, Type IV was the greatest, followed by low-gold and Type II. There was no statistical difference (P<0.05) in fracture load between Type II control and that welded to Co-Cr. Higher elongations were obtained for Type II in all conditions, whereas the lowest elongation occurred for low-gold welded to Co-Cr. This study indicated that, of the three gold alloys tested, the Type IV gold alloy was the most suitable alloy for laser-welding to Co-Cr. PMID:19088892

Setup for irradiation and characterization of materials and Si particle detectors at cryogenic temperatures

NASA Astrophysics Data System (ADS)

Väyrynen, S.; Pusa, P.; Sane, P.; Tikkanen, P.; Räisänen, J.; Kuitunen, K.; Tuomisto, F.; Härkönen, J.; Kassamakov, I.; Tuominen, E.; Tuovinen, E.

2007-03-01

A novel facility for proton irradiation with sample cryocooling has been developed at the Accelerator Laboratory of Helsinki University (equipped with a 5 MV tandem accelerator). The setup enables unique experiments to be carried out within the temperature range of 10-300 K. The setup has been constructed for "on-line" studies of vacancies with positron annihilation spectroscopy (PAS) including the option for optical ionization of the vacancies, and for current-voltage ( IV) measurements of irradiated silicon particle detectors. The setup is described in detail and typical performance characteristics are provided. The facility functionality was tested by performing PAS experiments with high-resistivity silicon and by IV measurements for two types of irradiated silicon particle detectors.

Regulation of COX-2–mediated signaling by α3 type IV noncollagenous domain in tumor angiogenesis

PubMed Central

Boosani, Chandra Shekhar; Mannam, Arjuna P.; Cosgrove, Dominic; Silva, Rita; Hodivala-Dilke, Kairbaan M.; Keshamouni, Venkateshwar G.

2007-01-01

Human α3 chain, a noncollagenous domain of type IV collagen [α3(IV)NC1], inhibits angiogenesis and tumor growth. These biologic functions are partly attributed to the binding of α3(IV)NC1 to αVβ3 and α3β1 integrins. α3(IV)NC1 binds αVβ3 integrin, leading to translation inhibition by inhibiting focal adhesion kinase/phosphatidylinositol 3-kinase/Akt/mTOR/4E-BP1 pathways. In the present study, we evaluated the role of α3β1 and αVβ3 integrins in tube formation and regulation of cyclooxygenase-2 (COX-2) on α3(IV)NC1 stimulation. We found that although both integrins were required for the inhibition of tube formation by α3(IV)NC1 in endothelial cells, only α3β1 integrin was sufficient to regulate COX-2 in hypoxic endothelial cells. We show that binding of α3(IV)NC1 to α3β1 integrin leads to inhibition of COX-2–mediated pro-angiogenic factors, vascular endothelial growth factor, and basic fibroblast growth factor by regulating IκBα/NFκB axis, and is independent of αVβ3 integrin. Furthermore, β3 integrin–null endothelial cells, when treated with α3(IV)NC1, inhibited hypoxia-mediated COX-2 expression, whereas COX-2 inhibition was not observed in α3 integrin–null endothelial cells, indicating that regulation of COX-2 by α3(IV)NC1 is mediated by integrin α3β1. Our in vitro and in vivo findings demonstrate that α3β1 integrin is critical for α3(IV)NC1-mediated inhibition of COX-2–dependent angiogenic signaling and inhibition of tumor progression. PMID:17426256

Loss of Intralipid®- but Not Sevoflurane-Mediated Cardioprotection in Early Type-2 Diabetic Hearts of Fructose-Fed Rats: Importance of ROS Signaling

PubMed Central

Zhang, Liyan; Affolter, Andreas; Gandhi, Manoj; Hersberger, Martin; Warren, Blair E.; Lemieux, Hélène; Sobhi, Hany F.; Clanachan, Alexander S.; Zaugg, Michael

2014-01-01

Background Insulin resistance and early type-2 diabetes are highly prevalent. However, it is unknown whether Intralipid® and sevoflurane protect the early diabetic heart against ischemia-reperfusion injury. Methods Early type-2 diabetic hearts from Sprague-Dawley rats fed for 6 weeks with fructose were exposed to 15 min of ischemia and 30 min of reperfusion. Intralipid® (1%) was administered at the onset of reperfusion. Peri-ischemic sevoflurane (2 vol.-%) served as alternative protection strategy. Recovery of left ventricular function was recorded and the activation of Akt and ERK 1/2 was monitored. Mitochondrial function was assessed by high-resolution respirometry and mitochondrial ROS production was measured by Amplex Red and aconitase activity assays. Acylcarnitine tissue content was measured and concentration-response curves of complex IV inhibition by palmitoylcarnitine were obtained. Results Intralipid® did not exert protection in early diabetic hearts, while sevoflurane improved functional recovery. Sevoflurane protection was abolished by concomitant administration of the ROS scavenger N-2-mercaptopropionyl glycine. Sevoflurane, but not Intralipid® produced protective ROS during reperfusion, which activated Akt. Intralipid® failed to inhibit respiratory complex IV, while sevoflurane inhibited complex I. Early diabetic hearts exhibited reduced carnitine-palmitoyl-transferase-1 activity, but palmitoylcarnitine could not rescue protection and enhance postischemic functional recovery. Cardiac mitochondria from early diabetic rats exhibited an increased content of subunit IV-2 of respiratory complex IV and of uncoupling protein-3. Conclusions Early type-2 diabetic hearts lose complex IV-mediated protection by Intralipid® potentially due to a switch in complex IV subunit expression and increased mitochondrial uncoupling, but are amenable to complex I-mediated sevoflurane protection. PMID:25127027

Comparison of adverse events of laser and light-assisted hair removal systems in skin types IV-VI.

PubMed

Breadon, Jonith Y; Barnes, Chad A

2007-01-01

Photoepilation, utilizing lasers and noncoherent light sources, is designed to irradiate as much of the follicular unit as possible, with melanin as the target chromophore. Wavelength absorption should generate energy sufficient to heat and destroy the hair follicle, while preserving the surrounding tissue. When performing photoepilation on African-American skin (Fitzpatrick skin types IV-VI) a greater risk of potential epidermal adverse events, such as dyspigmentation, blistering, crusting, edema, and subsequent scarring, is possible. To reduce epidermal melanin absorption of energy longer wavelengths are considered safer for use on Fitzpatrick skin types IV to VI. This article reviews and compares the reported incidences of adverse events in African-American skin, utilizing lasers and noncoherent light sources for assisted hair removal.

Identification of dipeptidyl peptidase-IV inhibitory peptides from mare whey protein hydrolysates.

PubMed

Song, J J; Wang, Q; Du, M; Ji, X M; Mao, X Y

2017-09-01

Inhibition of dipeptidyl peptidase-IV (DPP-IV) activity is a promising strategy for treatment of type 2 diabetes. In the current study, DPP-IV inhibitory peptides were identified from mare whey protein hydrolysates obtained by papain. The results showed that all the mare whey protein hydrolysates obtained at various hydrolysis durations possessed more potent DPP-IV inhibitory activity compared with intact whey protein. The 4-h hydrolysates showed the greatest DPP-IV inhibitory activity with half-maximal inhibitory concentration of 0.18 mg/mL. The 2 novel peptides from 4-h hydrolysate fractions separated by successive chromatographic steps were characterized by liquid chromatography-electrospray ionization tandem mass spectrometry. The novel peptides Asn-Leu-Glu-Ile-Ile-Leu-Arg and Thr-Gln-Met-Val-Asp-Glu-Glu-Ile-Met-Glu-Lys-Phe-Arg, which corresponded to β-lactoglobulin 1 f(71-77) and β-lactoglobulin 1 f(143-155), demonstrated DPP-IV inhibitory activity with half-maximal inhibitory concentrations of 86.34 and 69.84 μM, respectively. The DPP-IV inhibitory activity of the 2 peptides was retained or even improved after simulated gastrointestinal digestion in vitro. Our findings indicate that mare whey protein-derived peptides may possess potential as functional food ingredients in the management of type 2 diabetes. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Equilibrium between Different Coordination Geometries in Oxidovanadium(IV) Complexes

ERIC Educational Resources Information Center

Ugone, Valeria; Garribba, Eugenio; Micera, Giovanni; Sanna, Daniele

2015-01-01

In this laboratory activity, the equilibrium between square pyramidal and octahedral V(IV)O[superscript 2+] complexes is described. We propose a set of experiments to synthesize and characterize two types of V(IV)O[superscript 2+] complexes. The experiment allows great flexibility and may be effectively used at a variety of levels and the activity…

[Hiatal hernias: why and how should they be surgically treated].

PubMed

Braghetto, Italo; Csendes, Attila; Korn, Owen; Musleh, Maher; Lanzarini, Enrique; Saure, Alex; Hananias, Baydir; Valladares, Héctor

2013-01-01

There is controversy in the literature about the choice of expectant medical treatment versus surgical treatment of hiatal hernias, depending on the presence or absence of symptoms. This study presents the results obtained by our group, considering disease duration and postoperative results. A total of 121 patients were included and divided by age, disease duration, type of hiatal hernia and postoperative outcome. In 32% of the patients younger than 70 years, symptom duration was longer than 11 years and 68% of those aged more than 71 years had long-term symptoms (p<.05). Type iv hernias (complex) and those with diameters measuring more than 16 cm were observed in the group with longer symptom duration. Complications were more frequent in the older age group, in those with longer symptom duration and in those with type iv complex hernias. There was no postoperative mortality and only one patient (0.8%) with a type iii hernia and severe oesophagitis required reoperation. We recommend that patients with hiatal hernia undergo surgery at diagnosis to avoid complications and risks. Older patients should not be excluded from surgical indication but should undergo a complete multidisciplinary evaluation to avoid complications and postoperative mortality. Copyright © 2012 AEC. Published by Elsevier Espana. All rights reserved.

Genetic analysis of a Chinese family with members affected with Usher syndrome type II and Waardenburg syndrome type IV.

PubMed

Wang, Xueling; Lin, Xiao-Jiang; Tang, Xiangrong; Chai, Yong-Chuan; Yu, De-Hong; Chen, Dong-Ye; Wu, Hao

2017-11-01

The purpose of this study was to identify the genetic causes of a family presenting with multiple symptoms overlapping Usher syndrome type II (USH2) and Waardenburg syndrome type IV (WS4). Targeted next-generation sequencing including the exon and flanking intron sequences of 79 deafness genes was performed on the proband. Co-segregation of the disease phenotype and the detected variants were confirmed in all family members by PCR amplification and Sanger sequencing. The affected members of this family had two different recessive disorders, USH2 and WS4. By targeted next-generation sequencing, we identified that USH2 was caused by a novel missense mutation, p.V4907D in GPR98; whereas WS4 due to p.V185M in EDNRB. This is the first report of homozygous p.V185M mutation in EDNRB in patient with WS4. This study reported a Chinese family with multiple independent and overlapping phenotypes. In condition, molecular level analysis was efficient to identify the causative variant p.V4907D in GPR98 and p.V185M in EDNRB, also was helpful to confirm the clinical diagnosis of USH2 and WS4. Copyright © 2017 Elsevier B.V. All rights reserved.

Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

PubMed

Lees, George E

2013-01-01

To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

Chronic constipation recognized as a sign of a SOX10 mutation in a patient with Waardenburg syndrome.

PubMed

Arimoto, Yukiko; Namba, Kazunori; Nakano, Atsuko; Matsunaga, Tatsuo

2014-05-01

Waardenburg syndrome is characterized by hearing loss, pigmentation abnormalities, dysmorphologic features, and neurological phenotypes. Waardenburg syndrome consists of four distinct subtypes, and SOX10 mutations have been identified in type II and type IV. Type IV differs from type II owing to the presence of Hirschsprung disease. We identified a de novo nonsense mutation in SOX10 (p.G39X) in a female pediatric patient with Waardenburg syndrome with heterochromia iridis, profound bilateral sensorineural hearing loss, inner ear malformations, and overall hypopigmentation of the hair without dystopia canthorum. This patient has experienced chronic constipation since she was a neonate, but anorectal manometry showed a normal anorectal reflex. Chronic constipation in this patient was likely to be a consequence of a mild intestinal disorder owing to the SOX10 mutation, and this patient was considered to have a clinical phenotype intermediate between type II and type IV of the syndrome. Chronic constipation may be recognized as indicative of a SOX10 mutation in patients with Waardenburg syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

New patterns of methicillin-resistant Staphylococcus aureus (MRSA) clones, community-associated MRSA genotypes behave like healthcare-associated MRSA genotypes within hospitals, Argentina.

PubMed

Egea, Ana L; Gagetti, Paula; Lamberghini, Ricardo; Faccone, Diego; Lucero, Celeste; Vindel, Ana; Tosoroni, Dario; Garnero, Analía; Saka, Hector A; Galas, Marcelo; Bocco, José L; Corso, Alejandra; Sola, Claudia

2014-11-01

Methicillin-resistant Staphylococcus aureus (MRSA) burden is increasing worldwide in hospitals [healthcare-associated (HA)-MRSA] and in communities [community-associated (CA)-MRSA]. However, the impact of CA-MRSA within hospitals remains limited, particularly in Latin America. A countrywide representative survey of S. aureus infections was performed in Argentina by analyzing 591 clinical isolates from 66 hospitals in a prospective cross-sectional, multicenter study (Nov-2009). This work involved healthcare-onset infections-(HAHO, >48 hospitalization hours) and community-onset (CO) infections [including both, infections (HACO) in patients with healthcare-associated risk-factors (HRFs) and infections (CACO) in those without HRFs]. MRSA strains were genetically typed as CA-MRSA and HA-MRSA genotypes (CA-MRSAG and HA-MRSAG) by SCCmec- and spa-typing, PFGE, MLST and virulence genes profile by PCR. Considering all isolates, 63% were from CO-infections and 55% were MRSA [39% CA-MRSAG and 16% HA-MRSAG]. A significantly higher MRSA proportion among CO- than HAHO-S. aureus infections was detected (58% vs 49%); mainly in children (62% vs 43%). The CA-MRSAG/HA-MRSAG have accounted for 16%/33% of HAHO-, 39%/13% of HACO- and 60.5%/0% of CACO-infections. Regarding the epidemiological associations identified in multivariate models for patients with healthcare-onset CA-MRSAG infections, CA-MRSAG behave like HA-MRSAG within hospitals but children were the highest risk group for healthcare-onset CA-MRSAG infections. Most CA-MRSAG belonged to two major clones: PFGE-type N-ST30-SCCmecIVc-t019-PVL(+) and PFGE-type I-ST5-IV-SCCmecIVa-t311-PVL(+) (45% each). The ST5-IV-PVL(+)/ST30-IV-PVL(+) clones have caused 31%/33% of all infections, 20%/4% of HAHO-, 43%/23% of HACO- and 35%/60% of CACO- infections, with significant differences by age groups (children/adults) and geographical regions. Importantly, an isolate belonging to USA300-0114-(ST8-SCCmecIVa-spat008-PVL(+)-ACME(+)) was detected for the first time in Argentina. Most of HA-MRSAG (66%) were related to the Cordobes/Chilean clone-(PFGE-type A-ST5-SCCmecI-t149) causing 18% of all infections (47% of HAHO- and 13% of HACO-infections). Results strongly suggest that the CA-MRSA clone ST5-IV-PVL(+) has begun to spread within hospitals, replacing the traditional Cordobes/Chilean-HA-MRSA clone ST5-I-PVL(-), mainly in children. Importantly, a growing MRSA reservoir in the community was associated with spreading of two CA-MRSA clones: ST5-IV-PVL(+), mainly in children with HRFs, and ST30-IV-PVL(+) in adults without HRFs. This is the first nationwide study in Argentina providing information about the molecular and clinical epidemiology of CA-MRSA, particularly within hospitals, which is essential for designing effective control measures in this country and worldwide. Copyright © 2014 Elsevier GmbH. All rights reserved.

Classification of corkscrew collaterals in thromboangiitis obliterans (Buerger's disease): relationship between corkscrew type and prevalence of ischemic ulcers.

PubMed

Fujii, Yuichi; Soga, Junko; Nakamura, Shuji; Hidaka, Takayuki; Hata, Takaki; Idei, Naomi; Fujimura, Noritaka; Nishioka, Kenji; Chayama, Kazuaki; Kihara, Yasuki; Higashi, Yukihito

2010-08-01

A corkscrew collateral appearance on angiography is one of the diagnostic criteria for Buerger's disease. The purpose of the present study was to classify the angiographic findings of corkscrew collaterals and to evaluate the relationship between corkscrew collateral type and the severity of Buerger's disease. Corkscrew collaterals were assessed on digital subtraction angiography in lower extremities of 28 patients with Buerger's disease (55 limbs). The corkscrew sign was classified into 4 types by size and pattern as follows: type I, artery diameter >2 mm, large helical sign; type II, diameter >1.5 mm and or=1 mm and

Level III and IV Ecoregions by State

EPA Pesticide Factsheets

Information and links to downloadable maps and datasets for Level III and IV ecoregions, listed by state. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

Level III and IV Ecoregions by EPA Region

EPA Pesticide Factsheets

Information and downloadable maps and datasets for Level III and IV ecoregions, listed by EPA region. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

Distribution of Porphyromonas gingivalis fimA genotypes in chronic apical periodontitis associated with symptoms.

PubMed

Wang, Qian; Zhou, Xue-dong; Zheng, Qing-hua; Wang, Yao; Tang, Lu; Huang, Ding-ming

2010-11-01

Porphyromonas gingivalis (P. gingivalis) is an anaerobic bacterium involved in root canal infections whose fimbriae are classified into six genotypes (types I-V and Ib) based on nucleotide sequence. Accumulated evidence suggests there is significant association between P. gingivalis and some clinical symptoms of periodontal diseases. The present study aims to determine the prevalence of P. gingivalis fimA genotypes in apical periodontitis and to investigate the correlation between P. gingivalis fimA genotypes and clinical symptoms. Samples were obtained from 158 infected root canals with apical periodontitis. DNA was extracted and analyzed with a polymerase chain reaction-based identification assay. Odds ratios, 95% confidence intervals, and contingency coefficient were calculated for associating the fimA-specific genes with clinical symptoms. P. gingivalis was detected in 39.9% of the inflected root canal samples and was found in 44.5% of P. gingivalis-positive specimens with symptoms. Types II (69.4%) were the most frequent in the symptomatic cases followed by type IV (32.7%). The occurrence of type I (64.3%) was significantly higher than any other genotypes in the asymptomatic apical periodontitis, whereas type II and type Ib were not identified. Statistical analysis revealed that the occurrences of types II, IV, and Ib fimA were associated with greater risk of clinical signs (swelling, sinus tract, or intracanal exudates) than type I. Results from this study reinforce the association between P. gingivalis-specific fimA genotypic clones and apical periodontitis, indicating that fimA genotypes (types II, IV, and Ib) were related to the etiology of symptomatic periradicular diseases. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

c-Type Cytochrome-Dependent Formation of U(IV) Nanoparticles by Shewanella oneidensis

PubMed Central

Marshall, Matthew J; Dohnalkova, Alice C; Kennedy, David W; Shi, Liang; Wang, Zheming; Boyanov, Maxim I; Lai, Barry; Kemner, Kenneth M; McLean, Jeffrey S; Reed, Samantha B; Culley, David E; Bailey, Vanessa L; Simonson, Cody J; Saffarini, Daad A; Romine, Margaret F; Zachara, John M

2006-01-01

Modern approaches for bioremediation of radionuclide contaminated environments are based on the ability of microorganisms to effectively catalyze changes in the oxidation states of metals that in turn influence their solubility. Although microbial metal reduction has been identified as an effective means for immobilizing highly-soluble uranium(VI) complexes in situ, the biomolecular mechanisms of U(VI) reduction are not well understood. Here, we show that c-type cytochromes of a dissimilatory metal-reducing bacterium, Shewanella oneidensis MR-1, are essential for the reduction of U(VI) and formation of extracelluar UO 2 nanoparticles. In particular, the outer membrane (OM) decaheme cytochrome MtrC (metal reduction), previously implicated in Mn(IV) and Fe(III) reduction, directly transferred electrons to U(VI). Additionally, deletions of mtrC and/or omcA significantly affected the in vivo U(VI) reduction rate relative to wild-type MR-1. Similar to the wild-type, the mutants accumulated UO 2 nanoparticles extracellularly to high densities in association with an extracellular polymeric substance (EPS). In wild-type cells, this UO 2-EPS matrix exhibited glycocalyx-like properties and contained multiple elements of the OM, polysaccharide, and heme-containing proteins. Using a novel combination of methods including synchrotron-based X-ray fluorescence microscopy and high-resolution immune-electron microscopy, we demonstrate a close association of the extracellular UO 2 nanoparticles with MtrC and OmcA (outer membrane cytochrome). This is the first study to our knowledge to directly localize the OM-associated cytochromes with EPS, which contains biogenic UO 2 nanoparticles. In the environment, such association of UO 2 nanoparticles with biopolymers may exert a strong influence on subsequent behavior including susceptibility to oxidation by O 2 or transport in soils and sediments. PMID:16875436

Comparison of DNA decatenation by Escherichia coli topoisomerase IV and topoisomerase III: implications for non-equilibrium topology simplification

PubMed Central

Seol, Yeonee; Hardin, Ashley H.; Strub, Marie-Paule; Charvin, Gilles; Neuman, Keir C.

2013-01-01

Type II topoisomerases are essential enzymes that regulate DNA topology through a strand-passage mechanism. Some type II topoisomerases relax supercoils, unknot and decatenate DNA to below thermodynamic equilibrium. Several models of this non-equilibrium topology simplification phenomenon have been proposed. The kinetic proofreading (KPR) model postulates that strand passage requires a DNA-bound topoisomerase to collide twice in rapid succession with a second DNA segment, implying a quadratic relationship between DNA collision frequency and relaxation rate. To test this model, we used a single-molecule assay to measure the unlinking rate as a function of DNA collision frequency for Escherichia coli topoisomerase IV (topo IV) that displays efficient non-equilibrium topology simplification activity, and for E. coli topoisomerase III (topo III), a type IA topoisomerase that unlinks and unknots DNA to equilibrium levels. Contrary to the predictions of the KPR model, topo IV and topo III unlinking rates were linearly related to the DNA collision frequency. Furthermore, topo III exhibited decatenation activity comparable with that of topo IV, supporting proposed roles for topo III in DNA segregation. This study enables us to rule out the KPR model for non-equilibrium topology simplification. More generally, we establish an experimental approach to systematically control DNA collision frequency. PMID:23460205

Reliability of Use, Abuse, and Dependence of Four Types of Inhalants in Adolescents and Young Adults

PubMed Central

Ridenour, Ty A.; Bray, Bethany C.; Cottler, Linda B.

2007-01-01

Inhalants, as a class of drugs, consists of heterogeneous substances that include some of the most dangerous drugs on a per use basis. Research on inhalant abuse has lagged behind other drugs partly because of the need for a diagnostic instrument of different types of inhalants. This study was conducted to obtain reliability estimates for the new Substance Abuse Module DSM-IV inhalants diagnoses for four types of inhalants: aerosols, gases, nitrites, and solvents as well as different diagnostic configurations of inhalant use. Participants were 162 community sample adolescents or young adults (mean age = 20.3 years, SD = 2.4). Two-thirds of the sample was male and 83.3% was Caucasian. Kappas and intraclass correlation coefficients were computed to estimate test-retest reliabilities. Results suggested (a) abuse was more common than dependence (34.6% vs. 12.3%), (b) reliabilities of abuse criteria and diagnosis were good to excellent across subtypes, and (c) reliabilities of dependence criteria and diagnoses were poor to good across subtypes. Alternative configurations of DSM-IV criteria that were consistent with previous research on adolescents provided excellent reliabilities across subtypes of inhalants. Moreover, 11.1% of participants experienced inhalants withdrawal. PMID:17576041

Type IV Pili in Gram-Positive Bacteria

PubMed Central

Craig, Lisa

2013-01-01

SUMMARY Type IV pili (T4P) are surface-exposed fibers that mediate many functions in bacteria, including locomotion, adherence to host cells, DNA uptake (competence), and protein secretion and that can act as nanowires carrying electric current. T4P are composed of a polymerized protein, pilin, and their assembly apparatuses share protein homologs with type II secretion systems in eubacteria and the flagella of archaea. T4P are found throughout Gram-negative bacterial families and have been studied most extensively in certain model Gram-negative species. Recently, it was discovered that T4P systems are also widespread among Gram-positive species, in particular the clostridia. Since Gram-positive and Gram-negative bacteria have many differences in cell wall architecture and other features, it is remarkable how similar the T4P core proteins are between these organisms, yet there are many key and interesting differences to be found as well. In this review, we compare the two T4P systems and identify and discuss the features they have in common and where they differ to provide a very broad-based view of T4P systems across all eubacterial species. PMID:24006467

A clinicopathological study of the expression of extracellular matrix components in urothelial carcinoma.

PubMed

Ioachim, Elli; Michael, Michalis; Stavropoulos, Nicolaos E; Kitsiou, Evangelia; Salmas, Marios; Malamou-Mitsi, Vasiliki

2005-03-01

To measure the immunohistochemical expression of the extracellular matrix (ECM) components tenascin, fibronectin, collagen type IV and laminin in urothelial carcinomas, and to correlate their expression with clinicopathological features to clarify the prognostic value of these molecules and their role in tumour progression. Tumour specimens obtained during transurethral resection of bladder tumour (TURBT) from 103 patients (82 men and 2 1 women, mean age 66.7 years, range 27-89) were studied retrospectively. The expression of tenascin, fibronectin, collagen type IV and laminin was correlated with clinicopathological features (tumour grade and stage, multiplicity, simultaneous in situ component, the proliferative activity as estimated by the two proliferation associated indices, Ki-67 and proliferating cell nuclear antigen, the recurrence rate, and the progression of invading tumour). Specimens investigated for tenascin expression from patients with superficial bladder cancers were categorized into 28 treated by TURBT only and 53 who had TURBT followed by intravesical instillations of interferon. Cytoplasmic tenascin expression was detected in tumour cells in 20% of specimens. Tenascin was expressed in the tumour stroma in 76% of specimens, and was positively correlated with tumour grade and stage. Stromal tenascin expression was positively correlated with proliferative activity, and with the expression of fibronectin and collagen type IV. Fibronectin was expressed in the tumour stroma in 89% of specimens and was positively correlated with tumour stage, proliferative activity, and expression of collagen type IV and laminin. Collagen type IV was expressed in 93% of specimens, and was positively correlated with tumour grade and stage. Laminin was expressed in 78% of specimens and had no significant correlation with the clinicopathological features. Patients treated with TURBT alone and who had low levels of tenascin had a longer tumour-free interval than those with high levels of tenascin. Levels of tenascin might be valuable for predicting the risk of early recurrence. The expression of tenascin, fibronectin and collagen type IV seems to be correlated with more aggressive tumour behaviour. Furthermore, their interrelationships could indicate that they are involved in the remodelling of bladder cancer tissue, probably influencing tumour progression.

DPP IV inhibitor treatment attenuates bone loss and improves mechanical bone strength in male diabetic rats.

PubMed

Glorie, Lorenzo; Behets, Geert J; Baerts, Lesley; De Meester, Ingrid; D'Haese, Patrick C; Verhulst, Anja

2014-09-01

Dipeptidyl peptidase IV (DPP IV) modulates protein activity by removing dipeptides. DPP IV inhibitors are currently used to improve glucose tolerance in type 2 diabetes patients. DPP IV substrates not only increase insulin secretion but also affect bone metabolism. In this study, the effect of DPP IV inhibitor sitagliptin on bone was evaluated in normal and streptozotocin-induced diabetic rats. This study included 64 male Wistar rats divided into four groups (n = 16): two diabetic and two control groups. One diabetic and one control group received sitagliptin through drinking water. Tibiae were scanned every 3 wk using an in vivo μCT scanner. After 6 and 12 wk, rats were euthanized for histomorphometric analysis of bone parameters. The mechanical resistance of femora to fracture was assessed using a three-point bending test, and serum levels of bone metabolic markers were measured. Efficient DPP IV inhibition was achieved in sitagliptin-treated groups. Trabecular bone loss, the decrease in trabecular number, and the increase in trabecular spacing was attenuated through sitagliptin treatment in diabetic rats, as shown by in vivo μCT. Bone histomorphometry was in line with these results. μCT analysis furthermore showed that sitagliptin prevented cortical bone growth stagnation in diabetic rats, resulting in stronger femora during three-point bending. Finally, the serum levels of the resorption marker CTX-I were significantly lower in sitagliptin-treated diabetic animals compared with untreated diabetic animals. In conclusion, sitagliptin treatment attenuates bone loss and increases bone strength in diabetic rats probably through the reduction of bone resorption and independent of glycemic management. Copyright © 2014 the American Physiological Society.

The association between Staphylococcus aureus nasal colonization and symptomatic infection in children in Korea where ST72 is the major genotype: A prospective observational study.

PubMed

Kang, Sunghan; Lee, Jina; Kim, Mina

2017-08-01

This study was performed to investigate the concordance in terms of molecular characteristics and antimicrobial susceptibility between colonizing and clinical Staphylococcus aureus isolates obtained from children in Korea, where ST72 is the major genotype.This was a prospective observational descriptive study of culture-confirmed S aureus infections obtained from children ≤18 years old admitted to Asan Medical Center Children's Hospital in Seoul, Korea, from March 2014 to April 2015. Molecular studies including multilocus sequence typing (MLST), SCCmec typing, polymerase chain reaction amplification of the Panton-Valentine leukocidin (PVL) genes, and antibiotic susceptibility tests were performed on S aureus isolates obtained from nares and clinical specimens.During the study period, 126 clinically significant S aureus infections were identified. Nasal swab cultures were made from 113 of the 126 children, and 46.0% (52/113) showed S aureus colonization. The overall concordance between colonizing and clinical isolates by methicillin susceptibility was 94.2% (49/52); all 3 discordant cases were HA-MSSA cases with nasal MRSA. Among the 37 pairs of colonizing and clinical S aureus isolates included in the genotyping analysis, ST72-SCCmec type IV was the most prevalent clone and the PVL genes were positive in 2 patients. Among the 31 pairs of healthcare-associated cases, concordance rates by methicillin susceptibility and sequence type (ST) were 90.3% (28/31) and 84% (26/31), respectively. For the 6 pairs of community-associated (CA) S aureus including 3 CA-MRSA cases, 100% concordance was observed by methicillin susceptibility and ST.The concordance between isolates obtained from children who required medical services was relatively high in Korean children where ST72-SCCmec type IV is the predominant clone as the colonizer and the pathogen. It is suggested that decolonization and continuous care to prevent transmission could be effective in managing and preventing both HA- and CA-SA infections in our setting.

Root anatomy and canal configuration of the permanent mandibular first molar: a systematic review.

PubMed

de Pablo, Oliver Valencia; Estevez, Roberto; Péix Sánchez, Manuel; Heilborn, Carlos; Cohenca, Nestor

2010-12-01

The main goal of endodontic therapy is to prevent or heal apical periodontitis. However, root canal anatomy might present a clinical challenge directly related to the treatment outcome. The purpose of this study was to review published literature related to root anatomy and root canal configuration of the permanent mandibular first molar. An exhaustive search was undertaken to identify published literature related to the root anatomy and root canal morphology of the permanent mandibular first molar by using key words. The search of the MEDLINE database included all publications from 1966-May 2010. Selected articles were then obtained and reviewed. Data evaluated and summarized in the data sheet included methodology, population, number of teeth per study (power), number of root canals, type of root canal configuration, and identification of number of apical foramina. Forty-one studies were identified including a total of 18,781 teeth. The incidence of a third root was 13% and was strongly correlated with the ethnicity of the studied population. Three canals were present in 61.3%, 4 canals in 35.7%, and 5 canals in approximately 1%. Root canal configuration of the mesial root revealed 2 canals in 94.4% and 3 canals in 2.3%. The most common canal system configuration was Vertucci type IV (52.3%), followed by type II (35%). Root canal configuration of the distal root revealed type I configuration in 62.7%, followed by types II (14.5%) and IV (12.4%). The presence of isthmus communications averaged 54.8% on the mesial and 20.2% on the distal root. The number of roots on the mandibular first molar is directly related to ethnicity. Root canal morphology and configuration might present the clinician with a complex anatomy requiring more diagnostic approaches, access modifications, and clinical skills to successfully localize, negotiate, disinfect, and seal the root canal system. Crown Copyright © 2010. Published by Elsevier Inc. All rights reserved.

Neuropathologic Characterization of Pontocerebellar Hypoplasia Type 6 Associated With Cardiomyopathy and Hydrops Fetalis and Severe Multisystem Respiratory Chain Deficiency due to Novel RARS2 Mutations.

PubMed

Lax, Nichola Z; Alston, Charlotte L; Schon, Katherine; Park, Soo-Mi; Krishnakumar, Deepa; He, Langping; Falkous, Gavin; Ogilvy-Stuart, Amanda; Lees, Christoph; King, Rosalind H; Hargreaves, Iain P; Brown, Garry K; McFarland, Robert; Dean, Andrew F; Taylor, Robert W

2015-07-01

Autosomal recessive mutations in the RARS2 gene encoding the mitochondrial arginyl-transfer RNA synthetase cause infantile-onset myoencephalopathy pontocerebellar hypoplasia type 6 (PCH6). We describe 2 sisters with novel compound heterozygous RARS2 mutations who presented perinatally with neurologic features typical of PCH6 but with additional features including cardiomyopathy, hydrops, and pulmonary hypoplasia and who died at 1 day and 14 days of age. Magnetic resonance imaging findings included marked cerebellar hypoplasia, gyral immaturity, punctate lesions in cerebral white matter, and unfused deep cerebral grey matter. Enzyme histochemistry of postmortem tissues revealed a near-global cytochrome c oxidase-deficiency; assessment of respiratory chain enzyme activities confirmed severe deficiencies involving complexes I, III, and IV. Molecular genetic studies revealed 2 RARS2 gene mutations: a c.1A>G, p.? variant predicted to abolish the initiator methionine, and a deep intronic c.613-3927C>T variant causing skipping of exons 6-8 in the mature RARS2 transcript. Neuropathologic investigation included low brain weights, small brainstem and cerebellum, deep cerebral white matter pathology, pontine nucleus neuron loss (in 1 sibling), and peripheral nerve pathology. Mitochondrial respiratory chain immunohistochemistry in brain tissues confirmed an absence of complexes I and IV immunoreactivity with sparing of mitochondrial numbers. These cases expand the clinical spectrum of RARS2 mutations, including antenatal features and widespread mitochondrial respiratory chain deficiencies in postmortem brain tissues.

Neuropathologic Characterization of Pontocerebellar Hypoplasia Type 6 Associated With Cardiomyopathy and Hydrops Fetalis and Severe Multisystem Respiratory Chain Deficiency due to Novel RARS2 Mutations

PubMed Central

Lax, Nichola Z.; Alston, Charlotte L.; Schon, Katherine; Park, Soo-Mi; Krishnakumar, Deepa; He, Langping; Falkous, Gavin; Ogilvy-Stuart, Amanda; Lees, Christoph; King, Rosalind H.; Hargreaves, Iain P.; Brown, Garry K.; McFarland, Robert; Dean, Andrew F.; Taylor, Robert W.

2015-01-01

Abstract Autosomal recessive mutations in the RARS2 gene encoding the mitochondrial arginyl-transfer RNA synthetase cause infantile-onset myoencephalopathy pontocerebellar hypoplasia type 6 (PCH6). We describe 2 sisters with novel compound heterozygous RARS2 mutations who presented perinatally with neurologic features typical of PCH6 but with additional features including cardiomyopathy, hydrops, and pulmonary hypoplasia and who died at 1 day and 14 days of age. Magnetic resonance imaging findings included marked cerebellar hypoplasia, gyral immaturity, punctate lesions in cerebral white matter, and unfused deep cerebral grey matter. Enzyme histochemistry of postmortem tissues revealed a near-global cytochrome c oxidase-deficiency; assessment of respiratory chain enzyme activities confirmed severe deficiencies involving complexes I, III, and IV. Molecular genetic studies revealed 2 RARS2 gene mutations: a c.1A>G, p.? variant predicted to abolish the initiator methionine, and a deep intronic c.613-3927C>T variant causing skipping of exons 6–8 in the mature RARS2 transcript. Neuropathologic investigation included low brain weights, small brainstem and cerebellum, deep cerebral white matter pathology, pontine nucleus neuron loss (in 1 sibling), and peripheral nerve pathology. Mitochondrial respiratory chain immunohistochemistry in brain tissues confirmed an absence of complexes I and IV immunoreactivity with sparing of mitochondrial numbers. These cases expand the clinical spectrum of RARS2 mutations, including antenatal features and widespread mitochondrial respiratory chain deficiencies in postmortem brain tissues. PMID:26083569

Acute pancreatitis complicating choledochal cysts in children.

PubMed

Muthucumaru, Mathievathaniy; Ljuhar, Damir; Panabokke, Gayathri; Paul, Eldho; Nataraja, Ramesh; Ferguson, Peter; Dagia, Charuta; Clarnette, Tom; King, Sebastian

2017-03-01

To analyse the characteristics of patients with choledochal cysts presenting with acute pancreatitis. Multicenter retrospective review of all paediatric patients (<18 years) with choledochal cysts managed over a 14-year period (2001-2014) at two tertiary paediatric surgical centres. Patient data were analysed for demographics, presentation, radiological classification of cyst type (Todani), operative interventions, complications and long-term follow-up. A total of 49 patients with choledochal cysts were identified with 15 (31%) being Type I fusiform, 18 (37%) Type I cystic and 16 (32%) Type IV-A. Seventeen (35%) patients presented with acute pancreatitis, one having had an ante-natally diagnosed choledochal cyst. Patients presenting with pancreatitis were older when compared to the non-pancreatitis group (5.1 vs. 1.2 years, P = 0.005). Nine out of 16 (53%) patients with Type IV-A cysts presented with pancreatitis compared to five (33%) of Type I fusiform and three (17%) of Type I cystic. There was however no statistically significant association between Todani types and the development of pancreatitis (Type I fusiform, P = 1.0; Type I cystic, P = 0.063; Type IV-A, P = 0.053). The rate of complications was similar in both groups. Pancreatitis was a common presentation in children with a choledochal cyst, however, there was no clear statistically significant association with Todani types and pancreatitis. © 2016 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

Proteolysis breaks tolerance toward intact α345(IV) collagen, eliciting novel anti-GBM autoantibodies specific for α345NC1 hexamers

PubMed Central

Olaru, Florina; Wang, Xu-Ping; Luo, Wentian; Ge, Linna; Miner, Jeffrey H; Kleinau, Sandra; Geiger, Xochiquetzal J.; Wasiluk, Andrew; Heidet, Laurence; Kitching, A. Richard; Borza, Dorin-Bogdan

2012-01-01

Goodpasture disease is an autoimmune kidney disease mediated by autoAbs against NC1 monomers of α3(IV) collagen that bind to the glomerular basement membrane (GBM), usually causing rapidly progressive glomerulonephritis. We identified a novel type of human IgG4-restricted anti-GBM autoAbs associated with mild non-progressive glomerulonephritis, which specifically targeted α345NC1 hexamers but not α3NC1 monomers. The mechanisms eliciting these anti-GBM autoAbs were investigated in mouse models recapitulating this phenotype. Wild type and FcγRIIB−/− mice immunized with autologous murine GBM NC1 hexamers produced mouse IgG1-restricted autoAbs specific for α345NC1 hexamers, which bound to the GBM in vivo but did not cause glomerulonephritis. In these mice, intact collagen IV from murine GBM was not immunogenic. However, in Col4a3−/− Alport mice, both intact collagen IV and NC1 hexamers from murine GBM elicited IgG antibodies specific for α3α4α5NC1 hexamers, which were not subclass restricted. As heterologous antigen in COL4A3-humanized mice, murine GBM NC1 hexamers elicited mouse IgG1, IgG2a and IgG2b autoAbs specific for α345NC1 hexamers and induced anti-GBM Ab glomerulonephritis. These findings indicate that tolerance toward autologous intact α3α4α5(IV) collagen is established in hosts expressing this antigen, even though autoreactive B cells specific for α345NC1 hexamers are not purged from their repertoire. Proteolysis selectively breaches this tolerance by generating autoimmunogenic α3α4α5NC1 hexamers. This provides a mechanism eliciting autoAbs specific for α345NC1 hexamers, which are restricted to non-inflammatory IgG subclasses and non-nephritogenic. In Alport syndrome, lack of tolerance toward α3α4α5(IV) collagen promotes production of alloantibodies to α345NC1 hexamers, including pro-inflammatory IgG subclasses which mediate post-transplant anti-GBM nephritis. PMID:23303673

Identification of the DotL coupling protein subcomplex of the Legionella Dot/Icm type IV secretion system.

PubMed

Vincent, Carr D; Friedman, Jonathan R; Jeong, Kwang Cheol; Sutherland, Molly C; Vogel, Joseph P

2012-07-01

Legionella pneumophila, the causative agent of Legionnaires' disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella type IV secretion system substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. © 2012 Blackwell Publishing Ltd.

The diagnostic accuracy of multiparametric MRI to determine pediatric brain tumor grades and types.

PubMed

Koob, Mériam; Girard, Nadine; Ghattas, Badih; Fellah, Slim; Confort-Gouny, Sylviane; Figarella-Branger, Dominique; Scavarda, Didier

2016-04-01

Childhood brain tumors show great histological variability. The goal of this retrospective study was to assess the diagnostic accuracy of multimodal MR imaging (diffusion, perfusion, MR spectroscopy) in the distinction of pediatric brain tumor grades and types. Seventy-six patients (range 1 month to 18 years) with brain tumors underwent multimodal MR imaging. Tumors were categorized by grade (I-IV) and by histological type (A-H). Multivariate statistical analysis was performed to evaluate the diagnostic accuracy of single and combined MR modalities, and of single imaging parameters to distinguish the different groups. The highest diagnostic accuracy for tumor grading was obtained with diffusion-perfusion (73.24%) and for tumor typing with diffusion-perfusion-MR spectroscopy (55.76%). The best diagnostic accuracy was obtained for tumor grading in I and IV and for tumor typing in embryonal tumor and pilocytic astrocytoma. Poor accuracy was seen in other grades and types. ADC and rADC were the best parameters for tumor grading and typing followed by choline level with an intermediate echo time, CBV for grading and Tmax for typing. Multiparametric MR imaging can be accurate in determining tumor grades (primarily grades I and IV) and types (mainly pilocytic astrocytomas and embryonal tumors) in children.

A retrospective comparative study of arthroscopic fixation in acute Rockwood type IV acromioclavicular joint dislocation: single versus double paired Endobutton technique.

PubMed

Xu, Jian; Liu, Haifeng; Lu, Wei; Li, Dingfu; Zhu, Weimin; Ouyang, Kan; Wu, Bing; Peng, Liangquan; Wang, Daping

2018-05-24

Rockwood type IV acromioclavicular joint (ACJ) dislocation is a trauma usually needs surgical treatment. Paired EndoButton technique (PET) is used in treating such condition. However, the effect of using different types of PET (single versus double PET) for fixation remains controversial. This study aims to evaluate and compare the efficacy of single and double PET and to provide a suitable option for the surgeons. We retrospectively reviewed the charts of patients with acute Rockwood type IV ACJ dislocation who had undergone arthroscopic fixation using single or double PET fixation between March 2009 and March 2015. Seventy-eight consecutive patients identified from chart review were picked and were divided into the single and double PET group with 39 cases in each group. The indexes of visual analog scale score (VAS) for pain, the radiographs of the affected shoulder at different time points of the follow-up, the time of return to activities and sports, the constant functional score, and the Karlsson acromioclavicular joint (ACJ) score, were assessed in a minimum of 2 years postoperation. The average coracoclavicular (CC) and acromioclavicular (AC) distances of the affected joints in the double PET group were significantly smaller than those of the single PET group 2 years postoperation (P < 0.05). The average AC and CC distances in the healthy shoulder joints were significantly smaller than those of the affected joints in the single PET group (P < 0.05); however, these values were not significantly different from those of the affected joints in the double PET group (P > 0.05). The mean VAS pain score was not significantly different, while significant difference was found for the number and times of cases return to activities and sports, constant functional score, and Karlsson ACJ score (P < 0.05) between the two groups. Therefore, the double PET group has better outcome than the single PET group. Complications including redislocation, button slippage, erosion, or AC joint instability occurred in the single PET group, while the complication in the double PET group was rare. Compared with the single PET, the double PET group achieved better outcome with less complications in arthroscopically treating acute Rockwood type IV ACJ dislocation.

Type V Collagen is Persistently Altered after Inguinal Hernia Repair.

PubMed

Lorentzen, L; Henriksen, N A; Juhl, P; Mortensen, J H; Ågren, M S; Karsdal, M A; Jorgensen, L N

2018-04-01

Hernia formation is associated with alterations of collagen metabolism. Collagen synthesis and degradation cause a systemic release of products, which are measurable in serum. Recently, we reported changes in type V and IV collagen metabolisms in patients with inguinal and incisional hernia. The aim of this study was to determine if the altered collagen metabolism was persistent after hernia repair. Patients who had undergone repairs for inguinal hernia (n = 11) or for incisional hernia (n = 17) were included in this study. Patients who had undergone elective cholecystectomy served as controls (n = 10). Whole venous blood was collected 35-55 months after operation. Biomarkers for type V collagen synthesis (Pro-C5) and degradation (C5M) and those for type IV collagen synthesis (P4NP) and degradation (C4M2) were measured by a solid-phase competitive assay. The turnover of type V collagen (Pro-C5/C5M) was slightly higher postoperatively when compared to preoperatively in the inguinal hernia group (P = 0.034). In addition, the results revealed a postoperatively lower type V collagen turnover level in the inguinal hernia group compared to controls (P = 0.012). In the incisional hernia group, the type V collagen turnover was higher after hernia repair (P = 0.004) and the postoperative turnover level was not different from the control group (P = 0.973). Patients with an inguinal hernia demonstrated a systemic and persistent type V collagen turnover alteration. This imbalance of the collagen metabolism may be involved in the development of inguinal hernias.

Free testosterone concentration is inversely associated with markers of liver fibrosis in men with type 2 diabetes mellitus.

PubMed

Miyauchi, Shozo; Miyake, Teruki; Miyazaki, Masumi; Eguchi, Toru; Niiya, Tetsuji; Yamamoto, Shin; Senba, Hidenori; Furukawa, Shinya; Matsuura, Bunzo; Hiasa, Yoichi

2017-12-28

The association between serum testosterone level and liver fibrosis in patients with non-alcoholic fatty liver disease is unclear. To clarify this association, we investigated the relationship between serum free testosterone concentration and markers of liver fibrosis in men with type 2 diabetes mellitus but no obvious features of alcohol consumption. This retrospective observational cross-sectional study enrolled 248 men with type 2 diabetes mellitus. The FIB-4 index was measured as a marker of liver fibrosis, and multiple linear regression analysis was performed to examine its association with serum free testosterone concentration. In addition, the 7S domain of type IV collagen (IV-7S) was examined in 140 of the 248 patients. The mean free testosterone concentration was 10.6 ± 6.8 pg/mL and the means of the FIB-4 index and IV-7S were 1.64 ± 1.19 and 4.02 ± 1.11 ng/mL, respectively. After adjusting for all relevant variables, serum free testosterone concentrations were inversely associated with both the FIB-4 index and IV-7S (β; -0.28, P < 0.0001, and β; -0.28, P = 0.002, respectively). Measuring serum free testosterone concentrations in men with type 2 diabetes mellitus may help to predict progression to advanced liver disease. Identifying patients at risk may help to prevent the development of cirrhosis and hepatocellular carcinoma.

Specific phobia among U.S. adolescents: phenomenology and typology.

PubMed

Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

2012-12-01

Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13-18 years in the continental United States. Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Won Hee; Warrington, Junie P.; Sonntag, William E.

Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy {gamma}-rays or a fractionated dose of 40 Gy {gamma}-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR).more » The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.« less

Multiparametric in situ mRNA hybridization analysis to predict disease recurrence in patients with colon carcinoma.

PubMed Central

Kitadai, Y.; Ellis, L. M.; Tucker, S. L.; Greene, G. F.; Bucana, C. D.; Cleary, K. R.; Takahashi, Y.; Tahara, E.; Fidler, I. J.

1996-01-01

We examined the expression level of several genes that regulate different steps of metastasis in formalin-fixed, paraffin-embedded archival specimens of primary human colon carcinomas from patients with at least 5 years of follow-up. The expression of epidermal growth factor receptor, basic fibroblast growth factor, type IV collagenase, E-cadherin, and multidrug resistance (mdr-1) was examined by a colorimetric in situ mRNA hybridization technique concentrating on reactivity at the periphery of the neoplasms. The in situ hybridization technique revealed inter- and intratumor heterogeneity for expression of the metastasis-related genes. The expression of basic fibroblast growth factor, collagenase type IV, epidermal growth factor receptor, and mdr-1 mRNA was higher in Dukes's stage D than in Dukes' stage B tumors. Among the 22 Dukes' stage B neoplasms, 5 specimens exhibited a high expression level of epidermal growth factor receptor, basic fibroblast growth factor, and collagenase type IV. Clinical outcome data (5-year follow-up) revealed that all 5 patients with Dukes' stage B tumors developed distant metastasis (recurrent disease), whereas the other 17 patients with Dukes' stage B tumors expressing low levels of the metastasis-related genes were disease-free. Multivariate analysis identified high levels of expression of collagenase type IV and low levels of expression of E-cadherin as independent factors significantly associated with metastasis or recurrent disease. More specifically, metastatic or recurrent disease was associated with a high ratio (> 1.35) of expression of collagenase type IV to E-cadherin (specificity of 95%). Collectively, the data show that multiparametric in situ hybridization analysis for several metastasis-related genes may predict the metastatic potential, and hence the clinical outcome, of individual lymph-node-negative human colon cancers. Images Figure 1 Figure 2 PMID:8909244

Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

PubMed

Hidaka, Yoshie; Suzuki, Masakazu

2004-06-01

Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

Cutaneous tolerability to tretinoin shows little variation with Fitzpatrick skin type.

PubMed

Webster, Guy F

2014-06-01

Determinants of skin irritability are poorly understood. This study aims to assess differences in cutaneous safety/irritation based on Fitzpatrick skin type among patients with acne treated with tretinoin gel microsphere (TGM). This was a phase 4, 12-week, prospective, nonrandomized, open-label, multicenter study. Approximately 500 patients with mild to moderate acne were treated with TGM 0.04% or 0.1% and assessed for cutaneous irritation at baseline and weeks 3, 6, and 12. In this post hoc analysis of patients with Fitzpatrick skin type I-III vs Fitzpatrick skin type IV-VI, there was a general trend toward initial worsening of cutaneous adverse events (AEs) by week 3 across all variables and groups. This was followed by a trend toward improvement and resolution of skin-related AEs from week 3 to week 12 regardless of Fitzpatrick skin type, with a few exceptions. Erythema was the only cutaneous AE that consistently decreased among patients with darker skin. Results from a subsequent 3-group analysis (Fitzpatrick I-II vs Fitzpatrick III-IV vs Fitzpatrick V-VI) generally mirrored those from the 2-group study. Study limitations include patient nonadherence, lack of a placebo arm, and lack of data regarding the impact of concurrent medications on outcomes. There was no correlation between irritation and Fitzpatrick skin type. ABBREVIATIONS USED: adverse event (AE), analysis of variance (ANOVA), benzoyl peroxide (BP), case report form (CRF), modified Global Acne Grading Score (mGAGS), tretinoin gel microsphere (TGM).

[Use of theories and models on papers of a Latin-American journal in public health, 2000 to 2004].

PubMed

Cabrera Arana, Gustavo Alonso

2007-12-01

To characterize frequency and type of use of theories or models on papers of a Latin-American journal in public health between 2000 and 2004. The Revista de Saúde Pública was chosen because of its history of periodic publication without interruption and current impact on the scientific communication of the area. A standard procedure was applied for reading and classifying articles in an arbitrary typology of four levels, according to the depth of the use of models or theoretical references to describe problems or issues, to formulate methods and to discuss results. Of 482 articles included, 421 (87%) were research studies, 42 (9%) reviews or special contributions and 19 (4%) opinion texts or assays . Of 421 research studies, 286 (68%) had a quantitative focus, 110 (26%) qualitative and 25 (6%) mixed. Reference to theories or models is uncommon, only 90 (19%) articles mentioned a theory or model. According to the depth of the use, 29 (6%) were classified as type I, 9 (2%) as type II, 6 (1.3%) were type III and the 46 remaining texts (9.5%) were type IV. Reference to models was nine-fold more frequent than the use of theoretical references. The ideal use, type IV, occurred in one of every ten articles studied. It is of relevance to show theoretical and models frames used when approaching topics, formulating hypothesis, designing methods and discussing findings in papers.

Level III and IV Ecoregions of the Continental United States

EPA Pesticide Factsheets

Information and downloadable maps and datasets for Level III and IV ecoregions of the continental United States. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

Enteral Contrast in the Computed Tomography Diagnosis of Appendicitis

PubMed Central

Drake, Frederick Thurston; Alfonso, Rafael; Bhargava, Puneet; Cuevas, Carlos; Dighe, Manjiri K.; Florence, Michael G.; Johnson, Morris G.; Jurkovich, Gregory J.; Steele, Scott R.; Symons, Rebecca Gaston; Thirlby, Richard C.; Flum, David R.

2014-01-01

Objective Our goal was to perform a comparative effectiveness study of intravenous (IV)-only versus IV + enteral contrast in computed tomographic (CT) scans performed for patients undergoing appendectomy across a diverse group of hospitals. Background Small randomized trials from tertiary centers suggest that enteral contrast does not improve diagnostic performance of CT for suspected appendicitis, but generalizability has not been demonstrated. Eliminating enteral contrast may improve efficiency, patient comfort, and safety. Methods We analyzed data for adult patients who underwent nonelective appendectomy at 56 hospitals over a 2-year period. Data were obtained directly from patient charts by trained abstractors. Multivariate logistic regression was utilized to adjust for potential confounding. The main outcome measure was concordance between final radiology interpretation and final pathology report. Results A total of 9047 adults underwent appendectomy and 8089 (89.4%) underwent CT, 54.1% of these with IV contrast only and 28.5% with IV + enteral contrast. Pathology findings correlated with radiographic findings in 90.0% of patients who received IV + enteral contrast and 90.4% of patients scanned with IV contrast alone. Hospitals were categorized as rural or urban and by their teaching status. Regardless of hospital type, there was no difference in concordance between IV-only and IV + enteral contrast. After adjusting for age, sex, comorbid conditions, weight, hospital type, and perforation, odds ratio of concordance for IV + enteral contrast versus IV contrast alone was 0.95 (95% CI: 0.72–1.25). Conclusions Enteral contrast does not improve CT evaluation of appendicitis in patients undergoing appendectomy. These broadly generalizable results from a diverse group of hospitals suggest that enteral contrast can be eliminated in CT scans for suspected appendicitis. PMID:24598250

The type IV pilin of Burkholderia mallei is highly immunogenic but fails to protect against lethal aerosol challenge in a murine model.

PubMed

Fernandes, Paula J; Guo, Qin; Waag, David M; Donnenberg, Michael S

2007-06-01

Burkholderia mallei is the cause of glanders and a proven biological weapon. We identified and purified the type IV pilin protein of this organism to study its potential as a subunit vaccine. We found that purified pilin was highly immunogenic. Furthermore, mice infected via sublethal aerosol challenge developed significant increases in titers of antibody against the pilin, suggesting that it is expressed in vivo. Nevertheless, we found no evidence that high-titer antipilin antisera provided passive protection against a sublethal or lethal aerosol challenge and no evidence of protection afforded by active immunization with purified pilin. These results contrast with the utility of type IV pilin subunit vaccines against other infectious diseases and highlight the need for further efforts to identify protective responses against this pathogen.

Resolution of Large Azygos Vein Aneurysm Following Stent-Graft Shunt Placement in a Patient with Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Souza, Estelle S.; Williams, David M.; Deeb, G.M.

2006-10-15

Ehlers-Danlos syndrome (EDS) type IV is a rare connective tissue disorder associated with thin-walled, friable arteries and veins predisposing patients to aneurysm formation, dissection, fistula formation, and vessel rupture. Azygos vein aneurysm is an extremely rare condition which has not been reported in association with EDS in the literature. We present a patient with EDS type IV and interrupted inferior vena cava (IVC) with azygos continuation who developed an azygos vein aneurysm. In order to decrease flow through the azygos vein and reduce the risk of aneurysm rupture, a stent-graft shunt was created from the right hepatic vein to themore » azygos vein via a transhepatic, retroperitoneal route. At 6 month follow-up the shunt was open and the azygos vein aneurysm had resolved.« less

Differential recognition of geometric isomers by the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae): Evidence for only three essential components in aggregation pheromone.

PubMed

Dickens, J C; Prestwich, G D

1989-02-01

For two decades, the aggregation pheromone of the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae), was thought to consist of four compounds: I [(+)-(Z)-2-isopropenyl-1-methylcyclobutane ethanol]; II [(Z)-3,3-dimethyl-Δ(I,β)-cyclohexane ethanol]; III [(Z)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde); and IV [(E)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde). Evidence is presented from behavioral and electrophysiological studies to show that only three of these components, I, II, and IV, are essential for attraction. Competitive field tests, in which each possible three-component blend was tested against the four-component mixture, demonstrated that omission of I, II. or IV resulted in decreased trap captures (P < 0.01). Trap captures by these blends lacking I, II, or IV resembled those by the hexane solvent alone in a similar experiment. However, omission of III did not significantly alter field attractiveness of the blend. Dosage-response curves constructed from electroantennogram responses of both males and females to serial dilutions of III, IV, and a 50∶50 mixture of the geometric isomers III and IV showed both sexes to be 10- to 100-fold more sensitive to IV than III. Data from the electrophysiological studies were consistent with a single acceptor type for the (E)-cyclohexylidene aldehyde, IV, for males, and possibly one or two acceptor types for III and IV for females. Possible roles for the (Z)-cyclohexylidene aldehyde, III, and implications for the pheromonal attractant currently used in boll weevil eradication/suppression programs are discussed.

Predominance of Three Closely Related Methicillin-Resistant Staphylococcus aureus Clones Carrying a Unique ccrC-Positive SCCmec type III and the Emergence of spa t304 and t690 SCCmec type IV pvl+ MRSA Isolates in Kinta Valley, Malaysia.

PubMed

Ho, Wai-Yew; Choo, Quok-Cheong; Chew, Choy-Hoong

2017-03-01

We investigated the epidemiology and clonality of 175 nonrepetitive methicillin-resistant Staphylococcus aureus (MRSA) isolates from clinical specimens collected between 2011 and 2012 in Kinta Valley in Malaysia. Molecular tools such as polymerase chain reaction, pulsed-field gel electrophoresis, and staphylococcal protein A (spa) typing were used. Our study revealed the predominance of three closely related ermA + SCCmec type III pulsotypes belonging to spa type t037 (Brazilian-Hungarian clone), which were deficient in the locus F, but positive for the ccrC gene in majority (65.7%) of the MRSA infections in this region. The first evidence of SCCmec type II MRSA in the country, belonging to spa type t2460, was also noted. Although the carriage of pvl gene was uncommon (8.6%) and mostly confined to either SCCmec type IV or SCCmec type V isolates, most of these isolates belonged to spa types t345 or t657, which are associated with the Bengal-Bay CA-MRSA clone. Interestingly, spa t304 and t690 SCCmec type IV pvl + were also detected among the MRSA isolates. Data from this study show the rise of uncommon clones among MRSA isolates in Malaysia.

Pentastatin-1, a collagen IV derived 20-mer peptide, suppresses tumor growth in a small cell lung cancer xenograft model.

PubMed

Koskimaki, Jacob E; Karagiannis, Emmanouil D; Tang, Benjamin C; Hammers, Hans; Watkins, D Neil; Pili, Roberto; Popel, Aleksander S

2010-02-01

Angiogenesis is the formation of neovasculature from a pre-existing vascular network. Progression of solid tumors including lung cancer is angiogenesis-dependent. We previously introduced a bioinformatics-based methodology to identify endogenous anti-angiogenic peptide sequences, and validated these predictions in vitro in human umbilical vein endothelial cell (HUVEC) proliferation and migration assays. One family of peptides with high activity is derived from the alpha-fibrils of type IV collagen. Based on the results from the in vitro screening, we have evaluated the ability of a 20 amino acid peptide derived from the alpha5 fibril of type IV collagen, pentastatin-1, to suppress vessel growth in an angioreactor-based directed in vivo angiogenesis assay (DIVAA). In addition, pentastatin-1 suppressed tumor growth with intraperitoneal peptide administration in a small cell lung cancer (SCLC) xenograft model in nude mice using the NCI-H82 human cancer cell line. Pentastatin-1 decreased the invasion of vessels into angioreactors in vivo in a dose dependent manner. The peptide also decreased the rate of tumor growth and microvascular density in vivo in a small cell lung cancer xenograft model. The peptide treatment significantly decreased the invasion of microvessels in angioreactors and the rate of tumor growth in the xenograft model, indicating potential treatment for angiogenesis-dependent disease, and for translational development as a therapeutic agent for lung cancer.

[Addiction in DSM V and ICD-11 state of the art].

PubMed

Lesch, O-M

2009-09-01

Diagnoses are made for identifying rather homogeneous groups of patients being thereby relevant for research and for therapy. Therefore diagnostic manuals, like the DSM-IV and the ICD-10 are subjected to changing knowledge derived from research on one hand and to changes of clinical necessities. The diagnosis of substance related disorders, published for DSM-IV in 1994 and for the ICD-10 in 1992, has proven of value for epidemiological research and economic validation. In spite of these advantages the concept has prove to be too broad and rather unspecific for research, specific therapeutic strategies and for defining an illness course. During the last 20 years research has yielded many criteria of interest, which never entered DSM IV or ICD-10, remaining therefore on the level of single items, which are nowadays additionally assigned to all patients (like e. g. early versus late onset) or on the level of typologies (like e. g. Lesch's typology) demanding different treatments. To give an example: acamprosate has lasting relapse preventing effects in Lesch types I and II, while naltrexone is effective in types III and IV. For rendering an expertise in Germany, the referring literature recommends to utilize Lesch's typology additionally to the ICD-10 diagnosis, especially when prognosis or therapeutic strategies are demanded. Since 1999 different expert groups strive for including new criteria into DSM IV and ICD-10. The revised manuals should include easily assignable items for severity of different arrays (time illness onset, co-morbidity, withdrawal symptoms, bridge symptoms and neurological sequela). Different therapy stages (e. g. withdrawal or relapse prevention) need a different weighting of individual symptoms (e. g. degree of intoxication, severity of withdrawal is needed for acute treatment, while an assignment of co-morbidity and personality factors is necessary for relapse prevention). This quantifier is rendered by Lesch's typology, which is available in the form of a computer programme, based on a decision tree (see also www.ausam.at - Typology according to Lesch). Non substance related disorders should enter other diagnostic categories, like e. g. impulse control disorders. A revised diagnostic classification suggests presently offered therapeutic strategies to follow up with necessary modifications. A tailor made therapy according to subgroups can result in better long term performance of therapies offered to persons suffering form substance related disorders. (c) Georg Thieme Verlag KG Stuttgart-New York.

Multidisciplinary Treatment of Severe Osteogenesis Imperfecta: Functional Outcomes at Skeletal Maturity.

PubMed

Montpetit, Kathleen; Palomo, Telma; Glorieux, Francis H; Fassier, François; Rauch, Frank

2015-10-01

To determine the functional outcomes associated with long-term multidisciplinary treatment, intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation in children with severe osteogenesis imperfecta (OI) (diagnosed clinically as OI types III or IV). Retrospective study where outcomes were measured prospectively. Pediatric orthopedic hospital. Adolescents (N=41; age range, 15-21y) with severe OI (OI type III: n=17; OI type IV: n=24) who had started therapy before the age of 6 years, had received treatment for at least 10 years, and had achieved final height. Intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation. Pediatric Evaluation of Disability Inventory. At the time of the last available follow-up examination, none of the individuals diagnosed with OI type III (most severely affected group) was able to ambulate without ambulation aids, whereas 20 (83%) patients with OI type IV were able to ambulate without ambulation aids. Regarding self-care, we specifically assessed 8 skills that we deemed essential for living independently (grooming; dressing; toileting; bed, chair, toilet, tub, and car transfers). Only 6 (35%) of the youths with OI type III were able to complete all 8 items, whereas 23 (96%) individuals with OI type IV managed to perform all tasks. Teens with OI type III often needed assistance for the transfer to toilet, tub, and car and for personal hygiene and clothing management associated with toileting, usually because of limitations in upper-extremity function. These observations suggest that further improvements in the functional status of the most severely affected children with OI are contingent on advances in the clinical management of upper-extremity issues. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Distribution of Collagen I, III, and IV and Laminin in the Human Liver during Prenatal Development.

PubMed

Jović, Marko; Nikolić, Ivan; Todorović, Vera; Petrović, Aleksandar; Petrović, Vladimir; Mojsilović, Marijola; Denčić, Tijana

2018-06-27

In the absence of systematized data on the extracellular matrix components during prenatal liver development, the present study aimed to investigate the time of appearance and distribution of collagen types I, III, and IV and laminin. The study material included embryonic and fetal livers, aged 7-37 weeks, categorized into 3 trimesters. The material was stained using hematoxylin-eosin and immunohistochemistry methods for the identification of collagen I, III, and IV and laminin. Collagen I was detected near the end of the first trimester in the capsules and walls of interlobular veins. As the liver matures, collagen I is increasingly abundant in the capsules, portal area connective tissues, arterial walls, interlobular veins, sinusoids, and central veins. Collagen III and collagen IV appear in the middle of the first trimester in the capsules, portal areas, and walls of central veins, as well as the sinusoids particularly. In trimesters 2 and 3, these collagens are increasingly present in all the structures, but collagen IV is also present in nerve fibers. Laminin is sporadically present adjacent to the sinusoids in trimester 1, while in trimesters 2 and 3 this protein commonly appears in the walls of arteries and interlobular veins, in the basal membrane of bile ducts, and in nerve fibers. The contents of collagen I, III, and IV increase during prenatal development in the liver capsule, arterial and vein walls, sinusoids, and portal area. Laminin expression is consistent with that of the collagens with the exception that, within lobules, laminin disappears with liver maturation. © 2018 S. Karger AG, Basel.

Preoperative physical examination and imaging of femoroacetabular impingement prior to hip arthroscopy-a systematic review.

PubMed

Haldane, Chloe E; Ekhtiari, Seper; de Sa, Darren; Simunovic, Nicole; Ayeni, Olufemi R

2017-08-01

The purpose of this systematic review is to report current preoperative assessment for femoroacetabular impingement (FAI) including physical examination and imaging modalities prior to hip arthroscopy, and report current imaging measures used in the diagnosis of FAI. The electronic databases MEDLINE, EMBASE and PubMed were searched and screened in duplicate for relevant studies. Data regarding patient demographics, non-operative treatment, preoperative assessment including physical examination and imaging prior to hip arthroscopy were abstracted. Study quality was assessed in duplicate using the Methodological Index for Non-Randomized Studies criteria. Sixty-eight studies of fair quality evidence that involved a total of 5125 patients (5400 hips) were included. In total, 56% of all patients were male and mean age was 36 years (SD ± 10.0). Within physical examination, FADIR impingement testing was reported in 57% of patients. All included studies reported plain radiographic imaging as a component of preoperative assessment with anterior-posterior pelvis view being the most commonly reported view, followed by the cross-table lateral and Dunn views. Magnetic resonance imaging was obtained for 52% of included patients and computed tomography for 26% of patients. The most commonly reported measure within imaging for the diagnosis of cam type impingement was alpha angle (66%), whereas for pincer type impingement, the cross-over sign (48%) was most reported. Preoperative assessment is underreported in the FAI literature. Improved reporting is warranted to develop a more consistent and validated diagnostic algorithm for FAI to enhance patient selection. Level of evidence : Level IV, Systematic Review of Level I-IV Studies.

Preoperative physical examination and imaging of femoroacetabular impingement prior to hip arthroscopy—a systematic review

PubMed Central

Haldane, Chloe E.; Ekhtiari, Seper; de SA, Darren; Simunovic, Nicole

2017-01-01

Abstract The purpose of this systematic review is to report current preoperative assessment for femoroacetabular impingement (FAI) including physical examination and imaging modalities prior to hip arthroscopy, and report current imaging measures used in the diagnosis of FAI. The electronic databases MEDLINE, EMBASE and PubMed were searched and screened in duplicate for relevant studies. Data regarding patient demographics, non-operative treatment, preoperative assessment including physical examination and imaging prior to hip arthroscopy were abstracted. Study quality was assessed in duplicate using the Methodological Index for Non-Randomized Studies criteria. Sixty-eight studies of fair quality evidence that involved a total of 5125 patients (5400 hips) were included. In total, 56% of all patients were male and mean age was 36 years (SD ± 10.0). Within physical examination, FADIR impingement testing was reported in 57% of patients. All included studies reported plain radiographic imaging as a component of preoperative assessment with anterior–posterior pelvis view being the most commonly reported view, followed by the cross-table lateral and Dunn views. Magnetic resonance imaging was obtained for 52% of included patients and computed tomography for 26% of patients. The most commonly reported measure within imaging for the diagnosis of cam type impingement was alpha angle (66%), whereas for pincer type impingement, the cross-over sign (48%) was most reported. Preoperative assessment is underreported in the FAI literature. Improved reporting is warranted to develop a more consistent and validated diagnostic algorithm for FAI to enhance patient selection. Level of evidence: Level IV, Systematic Review of Level I–IV Studies. PMID:28948032

Fatal Peritoneal Bleeding Following Embolization of a Carotid-Cavernous Fistula in Ehlers-Danlos Syndrome Type IV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Usinskiene, Jurgita; Mazighi, Mikael; Bisdorff, Annouk

2006-12-15

We report the case of a 25-year-old woman treated for a spontaneous carotid-cavernous fistula in a context of Ehlers-Danlos syndrome type IV. Embolization with a transvenous approach was achieved without complications; however, the patient died 72 hr later of massive intraperitoneal bleeding. At autopsy, no lesion of the digestive arteries was identified. Possible causes of this bleeding are discussed.

Structure and function of the adhesive type IV pilus of Sulfolobus acidocaldarius

PubMed Central

Henche, Anna-Lena; Ghosh, Abhrajyoti; Yu, Xiong; Jeske, Torsten; Egelman, Edward; Albers, Sonja-Verena

2014-01-01

Archaea display a variety of type IV pili on their surface and employ them in different physiological functions. In the crenarchaeon Sulfolobus acidocaldarius the most abundant surface structure is the aap pilus (archaeal adhesive pilus). The construction of in frame deletions of the aap genes revealed that all the five genes (aapA, aapX, aapE, aapF, aapB) are indispensible for assembly of the pilus and an impact on surface motility and biofilm formation was observed. Our analyses revealed that there exists a regulatory cross-talk between the expression of aap genes and archaella (formerly archaeal flagella) genes during different growth phases. The structure of the aap pilus is entirely different from the known bacterial type IV pili as well as other archaeal type IV pili. An aap pilus displayed 3 stranded helices where there is a rotation per subunit of ~ 138° and a rise per subunit of ~ 5.7 Å. The filaments have a diameter of ~ 110 Å and the resolution was judged to be ~ 9 Å. We concluded that small changes in sequence might be amplified by large changes in higher-order packing. Our finding of an extraordinary stability of aap-pili possibly represents an adaptation to harsh environments that S. acidocaldarius encounters. PMID:23078543

β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study.

PubMed

Kurtoğlu, Ayşegül; Karakuş, Volkan; Erkal, Özgür; Kurtoğlu, Erdal

2016-11-01

β-Thalassemia (β-thal) is a common autosomal recessive disorder resulting from over 300 different mutations of the β-globin genes. Our aim was to create a mutation map of β-thal in the province of Antalya, Turkey. In this study, mutation analysis of a total 146 of β-thal patients followed at the Thalassemia Center of the Antalya Education and Research Hospital, Antalya, Turkey, were included. Direct DNA sequence analysis was performed for mutation scanning of the β-globin gene. One hundred and forty-six patients with β-thal including all types were analyzed, and 14 different β-thal mutations were detected. The most frequently seen mutation was HBB: c.93 - 21G > A [IVS-I-110 (G > A)] (52.7%), followed by HBB: .c.92 + 6T > C [IVS-I-6 (T > C)] (14.4%), HBB: c.-80T > A [-30 (T > A)] (8.2%), HBB: c.315 + 1G > A [IVS-II-1 (G > A)] (8.2%), which made up 83.1% of the observed mutations. Our results indicate the importance of micromapping and epidemiology studies of thalassemia, which will assist in establishing the national prevention and control program in Turkey.

Regulation of Glucose Homeostasis by GLP-1

PubMed Central

Nadkarni, Prashant; Chepurny, Oleg G.; Holz, George G.

2014-01-01

Glucagon-like peptide-1(7–36)amide (GLP-1) is a secreted peptide that acts as a key determinant of blood glucose homeostasis by virtue of its abilities to slow gastric emptying, to enhance pancreatic insulin secretion, and to suppress pancreatic glucagon secretion. GLP-1 is secreted from L cells of the gastrointestinal mucosa in response to a meal, and the blood glucose-lowering action of GLP-1 is terminated due to its enzymatic degradation by dipeptidyl-peptidase-IV (DPP-IV). Released GLP-1 activates enteric and autonomic reflexes while also circulating as an incretin hormone to control endocrine pancreas function. The GLP-1 receptor (GLP-1R) is a G protein-coupled receptor that is activated directly or indirectly by blood glucose-lowering agents currently in use for the treatment of type 2 diabetes mellitus (T2DM). These therapeutic agents include GLP-1R agonists (exenatide, liraglutide, lixisenatide, albiglutide, dulaglutide, and langlenatide) and DPP-IV inhibitors (sitagliptin, vildagliptin, saxagliptin, linagliptin, and alogliptin). Investigational agents for use in the treatment of T2DM include GPR119 and GPR40 receptor agonists that stimulate the release of GLP-1 from L cells. Summarized here is the role of GLP-1 to control blood glucose homeo-stasis, with special emphasis on the advantages and limitations of GLP-1-based therapeutics. PMID:24373234

Alteration of Escherichia coli topoisomerase IV to novobiocin resistance.

PubMed

Hardy, Christine D; Cozzarelli, Nicholas R

2003-03-01

DNA gyrase and topoisomerase IV (topo IV) are the two essential type II topoisomerases of Escherichia coli. Gyrase is responsible for maintaining negative supercoiling of the bacterial chromosome, whereas topo IV's primary role is in disentangling daughter chromosomes following DNA replication. Coumarins, such as novobiocin, are wide-spectrum antimicrobial agents that primarily interfere with DNA gyrase. In this work we designed an alteration in the ParE subunit of topo IV at a site homologous to that which confers coumarin resistance in gyrase. This parE mutation renders the encoded topo IV approximately 40-fold resistant to inhibition by novobiocin in vitro and imparts a similar resistance to inhibition of topo IV-mediated relaxation of supercoiled DNA in vivo. We conclude that topo IV is a secondary target of novobiocin and that it is very likely to be inhibited by the same mechanism as DNA gyrase.

First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

PubMed Central

Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

2016-01-01

Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

Lesch typology and temperament in opioid dependence: a cross-sectional study.

PubMed

Salem, B A; Vyssoki, B; Lesch, O M; Erfurth, A

2014-08-01

The first aim of this study is to investigate the impact of different temperaments in opiate dependency patients. The second aim of this study is to define therapy relevant subgroups in opiate addiction for further basic clinical research and therapy. In the time period from September to November 2010, 101 patients (72 males and 29 females) which fulfilled the diagnosis of opiate dependency according to DSM-IV-TR were recruited consecutively. All patients were in treatment at the Oum El Nour rehabilitation center/Lebanon (Inpatient and Outpatient groups). Lesch Alcoholism Typology modified for assessment of opiate addicts, and the briefTEMPS-M, Arabic version were used. The organic Type IV group was the most prevalent (48.5%) among the sample followed by the Affective Type III group (41.6%) and the minority represented the two other types (I & II). The organic Type IV group represented the major type in the cyclothymic and anxious temperament. In the contrary the other two groups (I & II) were the minority among the cyclothymics. Copyright © 2014 Elsevier B.V. All rights reserved.

Spectral types for objects in the Kiso survey. IV - Data for 81 stars

NASA Technical Reports Server (NTRS)

Wegner, Gary; Mcmahan, Robert K.

1988-01-01

Spectroscopy and spectral types for 81 ultraviolet-excess objects found in the Kiso Schmidt-camera survey are reported. The data were secured with the McGraw-Hill 1.3 m telescope at 8-A resolution covering the wavelength interval 4000 -7200 A using the Mark II spectrograph. Descriptions of the spectra of some of the more peculiar objects found in this sample are given and include 14 sub-dwarfs, 23 definite DA white dwarfs, including a magnetic one, and one DQ whie dwarf, eight quasars and emission-line objects, and a new composite DA + dM system. More spectroscopy of the new cataclysmic variable KUV 01584-0939 and a possibly related object is also described.

Pseudomonas aeruginosa Pore-Forming Exolysin and Type IV Pili Cooperate To Induce Host Cell Lysis

PubMed Central

Basso, Pauline; Ragno, Michel; Elsen, Sylvie; Reboud, Emeline; Golovkine, Guillaume; Bouillot, Stephanie; Huber, Philippe; Lory, Stephen; Faudry, Eric

2017-01-01

ABSTRACT   Clinical strains of Pseudomonas aeruginosa lacking the type III secretion system genes employ a toxin, exolysin (ExlA), for host cell membrane disruption. Here, we demonstrated that ExlA export requires a predicted outer membrane protein, ExlB, showing that ExlA and ExlB define a new active two-partner secretion (TPS) system of P. aeruginosa. In addition to the TPS signals, ExlA harbors several distinct domains, which include one hemagglutinin domain, five arginine-glycine-aspartic acid (RGD) motifs, and a C-terminal region lacking any identifiable sequence motifs. However, this C-terminal region is important for the toxic activity, since its deletion abolishes host cell lysis. Using lipid vesicles and eukaryotic cells, including red blood cells, we demonstrated that ExlA has a pore-forming activity which precedes cell membrane disruption of nucleated cells. Finally, we developed a high-throughput cell-based live-dead assay and used it to screen a transposon mutant library of an ExlA-producing P. aeruginosa clinical strain for bacterial factors required for ExlA-mediated toxicity. The screen resulted in the identification of proteins involved in the formation of type IV pili as being required for ExlA to exert its cytotoxic activity by promoting close contact between bacteria and the host cell. These findings represent the first example of cooperation between a pore-forming toxin of the TPS family and surface appendages in host cell intoxication. PMID:28119472

Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis.

PubMed

Luvan, M; Kanthan, S R; Roshan, G; Saw, A

2015-11-01

Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy.

The cross-cultural validity of posttraumatic stress disorder: implications for DSM-5.

PubMed

Hinton, Devon E; Lewis-Fernández, Roberto

2011-09-01

There is considerable debate about the cross-cultural applicability of the posttraumatic stress disorder (PTSD) category as currently specified. Concerns include the possible status of PTSD as a Western culture-bound disorder and the validity of individual items and criteria thresholds. This review examines various types of cross-cultural validity of the PTSD criteria as defined in DSM-IV-TR, and presents options and preliminary recommendations to be considered for DSM-5. Searches were conducted of the mental health literature, particularly since 1994, regarding cultural-, race-, or ethnicity-related factors that might limit the universal applicability of the diagnostic criteria of PTSD in DSM-IV-TR and the possible criteria for DSM-5. Substantial evidence of the cross-cultural validity of PTSD was found. However, evidence of cross-cultural variability in certain areas suggests the need for further research: the relative salience of avoidance/numbing symptoms, the role of the interpretation of trauma-caused symptoms in shaping symptomatology, and the prevalence of somatic symptoms. This review also indicates the need to modify certain criteria, such as the items on distressing dreams and on foreshortened future, to increase their cross-cultural applicability. Text additions are suggested to increase the applicability of the manual across cultural contexts: specifying that cultural syndromes-such as those indicated in the DSM-IV-TR Glossary-may be a prominent part of the trauma response in certain cultures, and that those syndromes may influence PTSD symptom salience and comorbidity. The DSM-IV-TR PTSD category demonstrates various types of validity. Criteria modification and textual clarifications are suggested to further improve its cross-cultural applicability. © 2010 Wiley-Liss, Inc.

Handbook of Ballistic and Engineering Data for Ammunition. Volume 2. 76-1-42 to 105-1-314 Included

DTIC Science & Technology

1950-07-01

PLaragraphs I General ------------------------------ 1 ITT Description ------------------------- 2- 4 Hm Interior balli3tic data --------------- 6 - 6 IV...Shot T33 be classified as limited standard; by item 30181 , it was made limited procurement type. a. Form factor (Proj Type 7). i, = 0.97. b. Ballistic...01 .90 7- 7 %PU .65 -4- 4w .80 go, PAN.,. II.W CNA PIS 4 ELEVATION MILS t I i f 1 1 1 1 1 1 ; i t 0 200 400 600 Goo 1000 1200 KOO 12 FOR SHELL. HM

Pili of Mycobacterium tuberculosis: current knowledge and future prospects.

PubMed

Ramsugit, Saiyur; Pillay, Manormoney

2015-08-01

Many pathogenic bacteria express filamentous appendages, termed pili, on their surface. These organelles function in several important bacterial processes, including mediating bacterial interaction with, and colonization of the host, signalling events, locomotion, DNA uptake, electric conductance, and biofilm formation. In the last decade, it has been established that the tuberculosis-causing bacterium, Mycobacterium tuberculosis, produces two pili types: curli and type IV pili. In this paper, we review studies on M. tuberculosis pili, highlighting their structure and biological significance to M. tuberculosis pathogenesis, and discuss their potential as targets for therapeutic intervention and diagnostic test development.

[Study of dynamic contrast-enhanced characteristics of stage-I endometrial carcinomas versus polyps with 3.0 T MRI].

PubMed

Wang, Xue; Lu, Yi; Zhang, Xiaoxia; Ji, Taotao; Liu, Kun; Ye, Xinjian; Bai, Guanghui; Yan, Zhihan

2015-01-20

To comparatively analyze the dynamic contrast-enhanced (DCE) characteristics and its clinical value between stage-I endometrial carcinomas versus polyps with 3.0T magnetic resonance imaging (MRI). A retrospective analysis was performed for DCE-MRI manifestation in 27 patients with histopathologically proved endometrial masses. There were stage-I endometrial carcinomas (n = 14) and polyps (n = 13). The signal intensity of solid component was measured and time-intensity curves (TIC) was obtained. TIC of lesions were divided into 4 subtypes. The time-to-peak (TTP) and signal intensity (SI) were determined from TICs. The arterial phase relative signal increase ratio (ARSIR), maximal relative signal increase ratio (MRSIR), signal enhancement ratio (SER) and signal intensity difference values (D) of each phase were calculated based on TIC curves respectively. The TIC of 14 stage-I endometrial carcinomas included type I (n = 4), type II (n = 6) and type IV (n = 4). The TIC of 13 polyps included type III (n = 3) and type IV (n = 10). The D values in each phase of 14 stage-I endometrial carcinomas were lower than normal muscle layers. There were statistic differences (P < 0.05) of each phase including 32, 48, 64, 109, 154, 199 s. For stage-I endometrial carcinomas, MRSIR and TTP were lower (P < 0.01) than normal muscle layers while SER was higher (P < 0.01) than normal muscle layers . The each phase of D of stage-I endometrial carcinomas were lower than polyps, and there were statistic differences (P < 0.05) of each phase including 32, 48, 64, 109, 154, 199 s. The MRSIR and TTP of stage-I endometrial carcinomas were lower (P < 0.01) than those of polyps while SER was higher (P < 0.01) than polyps. DCE-MRI can reflect enhanced features of stage-I endometrial carcinomas and polyps during different phases quantitatively. Parameters of DCE-MR and TIC are helpful in the diagnosis and differential diagnosis of stage-I endometrial carcinomas versus polyps.

[Outcome of operative treatment for supination-external rotation Lauge-Hansen stage IV ankle fractures].

PubMed

Kołodziej, Łukasz; Boczar, Tomasz; Bohatyrewicz, Andrzej; Zietek, Paweł

2010-01-01

Ankle fractures are among the most common musculoskeletal injures. These fractures occur with an overall age- and sex-adjusted incidence rate around 180 per 100 000 person-years. The most frequent mechanism is considered to be supination-external rotation (60 to 80% of all ankle fractures) consisting of pathologic external rotation of the foot initially placed in some degree of supination. According to Lauge-Hansen classification, ankle joint structures are damaged in a sequence where the final, stage IV injuries, represents transverse fracture of the medial malleolus or its equivalent-rupture of the deltoid ligament. The aim of this study is to compare the results of two subtypes of supination-external rotation stage IV fractures. 43 patients treated surgically in 2006 to 2007 at Authors institution because of stage IV supination-external rotation ankle fracture were submitted to retrospective analysis. There were 25 patients with bimalleolar fracture (type 1) and in 18 patients with lateral malleolar fracture with accompanying rupture of the deltoid ligament (type 2). The mean age was 46 years (from 20 to 82 years). Average follow up period was 37 months (from 24 to 46 months). For the evaluation of treatment AOFAS hind-foot score (American Orthopedic Foot and Ankle Society) was used. The mean AOFAS score scale for Type 1 fractures was 85 points and for type 2 was significantly higher and amounted to 91 points (p < 0.05). Supination-external rotation stage IV ankle fractures with medial malleolar fracture, requires the implementation of additional diagnostic and therapeutic strategies and procedures in order to improve the outcome of results.

Adult presentation of Bartter syndrome type IV with erythrocytosis.

PubMed

Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

2015-01-01

Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis.

Audiological findings in children with mucopolysaccharidoses type i-iv.

PubMed

Vargas-Gamarra, María F; de Paula-Vernetta, Carlos; Vitoria Miñana, Isidro; Ibañez-Alcañiz, Isabel; Cavallé-Garrido, Laura; Alamar-Velazquez, Agustín

The aim of our study is to reflect hearing impairment of 23children diagnosed with mucopolysaccharidosis (MPS) typeI, II, III and IV. Retrospective study of the clinical, audiological and treatment (medical vs surgical) findings of 23children diagnosed with MPS typeI, II, III or IV followed at a Tertiary Referral Hospital between 1997 and 2015. Six cases of MPSI, 8 of MPSII, 4 of MPSIII and 5 of MPSIV were reviewed. 71.2% of patients had secretory otitis media (SOM) and 54% of patients had some type of hearing loss (HL). The behaviour of hearing loss was variable in each of the subgroups of MPS, finding greater involvement and variability in typesI and II. Children with MPS have a high risk of hearing loss. A significant percentage of transmissive HL progressing to mixed or sensorineural HL was observed. This was more common in typesI and II. Periodic follow up of these patients is mandatory because of hearing impairment and consequences for their development and quality of life. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.

Short and long-term effects of continuous versus intermittent loop diuretics treatment in acute heart failure with renal dysfunction.

PubMed

Palazzuoli, Alberto; Pellegrini, Marco; Franci, Beatrice; Beltrami, Matteo; Ruocco, Gaetano; Gonnelli, Stefano; Angelini, Gianni D; Nuti, Ranuccio

2015-02-01

Intravenous loop diuretics are still the cornerstone of therapy in acute decompensated heart failure, however, the optimal dosage and administration strategies remain poorly defined particularly in patients with an associated renal dysfunction. This is a single-center, pilot, randomized trial involving patients with acute HF and renal dysfunction. Patients were assigned to receive continuous furosemide infusion (cIV) or bolus injections of furosemide (iIV). Primary end points were the evaluation of urine output volumes, renal function, and b-type natriuretic peptide (BNP) levels during treatment time. Secondary end point included: weight loss, length of hospitalization, differences in plasma electrolytes, need for additional treatment, and evaluation of cardiac events during follow-up period. 57 patients were included in the study. The cIV group showed an increase in urine output (2,505 ± 796 vs 2140 ± 468 ml/day, p < 0.04) and a more significant decrease of BNP levels in respect to the iIV group (679.6 ± 397 vs 949 ± 548 pg/ml, p < 0.04). We observed a significant increase in creatinine levels (1.78 ± 0.5 vs 1.41 ± 0.3 mg/dl, p < 0.01), and a reduction of the estimated glomerular filtration rate in cIV (44.8 ± 6.1 vs 46.7 ± 6.1 ml/min, p < 0.05). We observed a significant difference in eGFR (p = 0.01), creatinine (p = 0.02) and BNP levels (p = 0.03) from baseline to the end of treatment in both groups. A significant increase of in-hospital additional treatment as well as length of hospitalization was observed in cIV. Finally, cIV revealed a higher rate of adverse events during the follow-up period (p < 0.03). cIV appears to provide a more efficient diuresis and BNP level reduction during hospitalization, however, it was associated with increased rate of worsening renal function during hospitalization. cIV also appears related to a longer hospitalization and an increased number of adverse events during follow-up. For all of these reasons, a larger multi-center study is required to determine whether high-dose diuretics are responsible for worsening renal function and to define the best modality of administration.

Nuclear chromatin-concentrated osteoblasts in renal bone diseases.

PubMed

Kazama, Junichiro James; Yamamoto, Suguru; Narita, Ichiei; Kurihara, Satoshi

2011-06-01

The morphological appearance of an osteoblast largely alters with its differentiation and maturation, along with the change of cell function. We quantitatively observed the osteoblast morphology and compared it with bone metabolism. Biopsied iliac bone samples obtained from 77 dialysis patients (14 mild change, 37 osteitis fibrosa, 2 osteomalacia, 8 mixed, and 16 adynamic bone) were included in the study. Osteoblast appearances were classified into three groups: (i) type II and III osteoblasts, namely, active osteoblasts characterized by cuboidal or columnar shapes with or without a nuclear clear zone; (ii) type IV osteoblasts, lining osteoblasts characterized by extremely thin cytoplasm; and (iii) type V osteoblasts, apoptotic osteoblasts characterized by nuclear chromatin concentration. The results were quantitatively expressed as the length of bone surface covered by each type of osteoblasts. The type II and III osteoblasts were predominant in osteitis fibrosa, mixed, and mild change. The type IV osteoblasts were overwhelmingly predominant in adynamic bone. The type V osteoblasts appeared most frequently in osteitis fibrosa, followed by mixed and mild change. Both absolute and relative lengths of bone surface covered by the type V osteoblasts were significantly higher in the high-turnover bone group (osteitis fibrosa and mixed) than the low-turnover bone group (adynamic bone and osteomalacia). The type V osteoblasts were slightly correlated with serum intact parathyroid hormone levels. In conclusion, a high bone-turnover condition seems to be associated with the promotion of osteoblastic apoptosis in dialysis patients. This finding may explain the fact that osteopenia develops faster in CKD patients with high turnover of bone. © 2011 The Authors. Therapeutic Apheresis and Dialysis © 2011 International Society for Apheresis.

Osteogenesis imperfecta in childhood: prognosis for walking.

PubMed

Engelbert, R H; Uiterwaal, C S; Gulmans, V A; Pruijs, H; Helders, P J

2000-09-01

We studied the predicted value of disease-related characteristics for the ability of children with osteogenesis imperfecta (OI) to walk. The severity of OI was classified according to Sillence. The parents were asked to report the age at which the child achieved motor milestones, the fracture incidence, and the age and localization of the first surgical intervention. The present main means of mobility was classified according to Bleck. There were 76 replies to the 98 questionnaires, of which 70 were included (type I, 41; type III, 11; type IV, 18). The type of OI was strongly associated with current walking ability, as was the presence of dentinogenesis imperfecta. Patients with type III and IV had a lower chance of ultimately walking compared with those with type I. Children with more than 2 intramedullary rods in the lower extremities had a reduced chance of walking than patients without rods. Rolling over before 8 months, unsupported sitting before 9 months, the ability to get in sitting position without support before 12 months, and the ability to get in a standing position without support before 12 months showed positive odds ratios. In Bleck > or = 4, multivariate analysis revealed that only the presence of rodding (yes/no) in the lower extremities had additional predictive value to the type of OI. The presence of dentinogenesis imperfecta and rodding (yes/no) had additional value in Bleck > or = 5. The type of OI is the single most important clinical indicator of the ultimate ability to walk. Information about motor development adds little. The early achievement of motor milestones contributes to the ability of independent walking when the type of OI is uncertain. Intramedullary rodding of the lower extremities is primarily related to the severity of the disease and in this way provides consequences for the ability to walk.

More than a Tad: spatiotemporal control of Caulobacter pili.

PubMed

Mignolet, Johann; Panis, Gaël; Viollier, Patrick H

2018-04-01

The Type IV pilus (T4P) is a powerful and sophisticated bacterial nanomachine involved in numerous cellular processes, including adhesion, DNA uptake and motility. Aside from the well-described subtype T4aP of the Gram-negative genera, including Myxococcus, Pseudomonas and Neisseria, the Tad (tight adherence) pilus secretion system re-shuffles homologous parts from other secretion systems along with uncharacterized components into a new type of protein translocation apparatus. A representative of the Tad apparatus, the Caulobacter crescentus pilus assembly (Cpa) machine is built exclusively at the newborn cell pole once per cell cycle. Recent comprehensive genetic analyses unearthed a myriad of spatiotemporal determinants acting on the Tad/Cpa system, many of which are conserved in other α-proteobacteria, including obligate intracellular pathogens and symbionts. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Caenorhabditis elegans mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in multiple cell types.

PubMed

Hersh, Bradley M; Hartwieg, Erika; Horvitz, H Robert

2002-04-02

The misregulation of programmed cell death, or apoptosis, contributes to the pathogenesis of many diseases. We used Nomarski microscopy to screen for mutants containing refractile cell corpses in a C. elegans strain in which all programmed cell death is blocked and such corpses are absent. We isolated a mutant strain that accumulates refractile bodies resembling irregular cell corpses. We rescued this mutant phenotype with the C. elegans mucolipidosis type IV (ML-IV) homolog, the recently identified cup-5 (coelomocyte-uptake defective) gene. ML-IV is a human autosomal recessive lysosomal storage disease characterized by psychomotor retardation and ophthalmological abnormalities. Our null mutations in cup-5 cause maternal-effect lethality. In addition, cup-5 mutants contain excess lysosomes in many and possibly all cell types and contain lamellar structures similar to those observed in ML-IV cell lines. The human ML-IV gene is capable of rescuing both the maternal-effect lethality and the lysosome-accumulation abnormality of cup-5 mutants. cup-5 mutants seem to contain excess apoptotic cells as detected by staining with terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling. We suggest that the increased apoptosis seen in cup-5 mutants is a secondary consequence of the lysosomal defect, and that abnormalities in apoptosis may be associated with human lysosomal storage disorders.

Risk evaluation for in-vehicle sign information.

DOT National Transportation Integrated Search

2016-05-01

The goal of the study was to examine the influence of in-vehicle signing (IVS) pertaining to four types of changing : driving conditions and determine the utility and potential safety costs associated with the IVS information. Signage : displayed on ...

Is DTPA a good competing chelating agent for Th(IV) in human serum and suitable in targeted alpha therapy?

PubMed

Le Du, Alicia; Sabatié-Gogova, Andrea; Morgenstern, Alfred; Montavon, Gilles

2012-04-01

The interaction between thorium and human serum components was studied using difference ultraviolet spectroscopy (DUS), ultrafiltration and high-pressure-anion exchange chromatography (HPAEC) with external inductively conducted plasma mass spectrometry (ICP-MS) analysis. Experimental data are compared with modelling results based on the law of mass action. Human serum transferrin (HSTF) interacts strongly with Th(IV), forming a ternary complex including two synergistic carbonate anions. This complex governs Th(IV) speciation under blood serum conditions. Considering the generally used Langmuir-type model, values of 10(33.5) and 10(32.5) were obtained for strong and weak sites, respectively. We showed that trace amounts of diethylene triamine pentaacetic acid (DTPA) cannot complex Th(IV) in the blood serum at equilibrium. Unexpectedly this effect is not related to the competition with HSTF but is due to the strong competition with major divalent metal ions for DTPA. However, Th-DTPA complex was shown to be stable for a few hours when it is formed before addition in the biological medium; this is related to the high kinetic stability of the complex. This makes DTPA a potential chelating agent for synthesis of (226)Th-labelled biomolecules for application in targeted alpha therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

Nonstatic radiating spheres in general relativity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krori, K.D.; Borgohain, P.; Sarma, R.

1985-02-15

The method of Herrera, Jimenez, and Ruggeri of obtaining nonstatic solutions of Einstein's field equations to study the evolution of stellar bodies is applied to obtain two models of nonstatic radiating spheres from two well-known static solutions of field equations, viz., Tolman's solutions IV and V. Whereas Tolman's type-IV model is found to be contracting for the period under investigation, Tolman's type-V model shows a bounce after attaining a minimum radius.

Retrobulbar Hematoma from Warfarin Toxicity and the Limitations of Bedside Ocular Sonography

DTIC Science & Technology

2010-05-01

Nontraumatic RBH occurs rarely and has been associated with arteriovenous malformations,1 following thrombolysis,2 Type IV Ehlers - Danlos Syndrome ,3...infarction. N Engl J Med. 2007; 357:1448-9. 3. Shaikh S, Braun M, Eliason J. Spontaneous retrobulbar hemorrhage in type IV Ehlers - Danlos syndrome . Am J...compartment syndrome . DISCUSSION We believe this is the first case report of a nontraumatic RBH associated with warfarin toxicity. Our patient also had

Electro-mechanical coupling of semiconductor film grown on stainless steel by oxidation

NASA Astrophysics Data System (ADS)

Lin, M. C.; Wang, G.; Guo, L. Q.; Qiao, L. J.; Volinsky, Alex A.

2013-09-01

Electro-mechanical coupling phenomenon in oxidation film on stainless steel has been discovered by using current-sensing atomic force microscopy, along with the I-V curves measurements. The oxidation films exhibit either ohmic, n-type, or p-type semiconductor properties, according to the obtained I-V curves. This technique allows characterizing oxidation films with high spatial resolution. Semiconductor properties of oxidation films must be considered as additional stress corrosion cracking mechanisms.

Type IV-a choledochal cyst--a rare adolescent presentation as acute abdomen.

PubMed

Satya, Ramadass; Vijayakumar, Vani

2006-10-01

A 17-year-old adolescent girl from El Salvador presented to the emergency room (ER) with severe abdominal pain associated with one episode of nausea and vomiting. The pain that started 5 days earlier was sharp in nature and epigastric in location with radiation to back and was relieved by half a tablet of Vicodin. The patient has a history of intermittent epigastric pain for the past 2 years and was treated for Helicobacter pylori for 1 year. In the ER, the serum chemistry demonstrated elevated amylase. Further workup with abdominal ultrasonography (US), computed tomography (CT), magnetic resonance cholangiopancreatography (MRCP), and hepatobiliary scintigraphy confirmed a type IV-a choledochal cyst with intra- and extrahepatic dilation of bile ducts. We report an unusual acute abdomen presentation of type IV-a choledochal cyst in a 17-year-old young adult from El Salvador.

Evaluation of Different Disinfactants on Dimensional Accuracy and Surface Quality of Type IV Gypsum Casts Retrieved from Elastomeric Impression Materials.

PubMed

Pal, P K; Kamble, Suresh S; Chaurasia, Ranjitkumar Rampratap; Chaurasia, Vishwajit Rampratap; Tiwari, Samarth; Bansal, Deepak

2014-06-01

The present study was done to evaluate the dimensional stability and surface quality of Type IV gypsum casts retrieved from disinfected elastomeric impression materials. In an in vitro study contaminated impression material with known bacterial species was disinfected with disinfectants followed by culturing the swab sample to assess reduction in level of bacterial colony. Changes in surface detail reproduction of impression were assessed fallowing disinfection. All the three disinfectants used in the study produced a 100% reduction in colony forming units of the test organisms. All the three disinfectants produced complete disinfection, and didn't cause any deterioration in surface detail reproduction. How to cite the article: Pal PK, Kamble SS, Chaurasia RR, Chaurasia VR, Tiwari S, Bansal D. Evaluation of dimensional stability and surface quality of type IV gypsum casts retrieved from disinfected elastomeric impression materials. J Int Oral Health 2014;6(3):77-81.

Biomarker for Glycogen Storage Diseases

ClinicalTrials.gov

2017-07-03

Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

Spectrophotometric Measurement of Minimal Erythema Dose Sites after Narrowband Ultraviolet B Phototesting: Clinical Implication of Spetrophotometric Values in Phototherapy

PubMed Central

Jeon, Su-Young; Lee, Chae-Young; Song, Ki-Hoon

2014-01-01

Background The spectrophotometer is well known to be a useful tool for estimating the objective minimal erythema dose (MED) during planning of phototherapy protocol. However, only a few spectrophotometric values are used to evaluate the erythema and pigmentation of the MED site during phototesting. Objective To determinea new meaning of the relationships among spectrophotometric values during phototesting. Methods Twenty-five patients with psoriasis and 23 patients with vitiligo were selected before undergoing narrowband ultraviolet B phototherapy. We interpreted the gross findings of erythema and measured the L*a*b* values using a spectrophotometer at each phototest spot. We compared MEDs, basic spectrophotometric values (L*a*b*), and b*/L* values separately according to skin type, and determined the correlation of each spectrophotometric value and the correlation between a* and b*/L* values. Results Among L*a*b* values, only b* values showed a statistically significant difference between the type III and IV groups (p=0.003). There was a positive correlation only between MEDs and b* values (p<0.05). The average b*/L*value in the type IV group was significantly higher than the type III group (p<0.05). Conclusion The higher b* values in type IV skin indicates that skin tanning develops more prominently than type III. The correlation between MEDs and b* values may signify that the skin pigmentation status is deepened with the higher MEDs. The difference in b*/L*values between type III and IV skin reflects that the b*/L*value is thought to be an index of tanning. The a* value, known as an index of erythema, does not influence the degree of tanning. PMID:24648682

Self aligned hysteresis free carbon nanotube field-effect transistors

NASA Astrophysics Data System (ADS)

Shlafman, M.; Tabachnik, T.; Shtempluk, O.; Razin, A.; Kochetkov, V.; Yaish, Y. E.

2016-04-01

Hysteresis phenomenon in the transfer characteristics of carbon nanotube field effect transistor (CNT FET) is being considered as the main obstacle for successful realization of electronic devices based on CNTs. In this study, we prepare four kinds of CNTFETs and explore their hysteretic behavior. Two kinds of devices comprise on-surface CNTs (type I) and suspended CNTs (type II) with thin insulating layer underneath and a single global gate which modulates the CNT conductance. The third and fourth types (types III and IV) consist of suspended CNT over a metallic local gate underneath, where for type IV the local gate was patterned self aligned with the source and drain electrodes. The first two types of devices, i.e., type I and II, exhibit substantial hysteresis which increases with scanning range and sweeping time. Under high vacuum conditions and moderate electric fields ( |E |>4 ×106 V /cm ), the hysteresis for on-surface devices cannot be eliminated, as opposed to suspended devices. Interestingly, type IV devices exhibit no hysteresis at all at ambient conditions, and from the different roles which the global and local gates play for the four types of devices, we could learn about the hysteresis mechanism of this system. We believe that these self aligned hysteresis free FETs will enable the realization of different electronic devices and sensors based on CNTs.

The human clone ST22 SCCmec IV methicillin-resistant Staphylococcus aureus isolated from swine herds and wild primates in Nepal: is man the common source?

PubMed

Roberts, Marilyn C; Joshi, Prabhu Raj; Greninger, Alexander L; Melendez, Daira; Paudel, Saroj; Acharya, Mahesh; Bimali, Nabin Kishor; Koju, Narayan P; No, David; Chalise, Mukesh; Kyes, Randall C

2018-05-01

Swine nasal samples [n = 282] were collected from 12 randomly selected farms around Kathmandu, Nepal, from healthy animals. In addition, wild monkey (Macaca mulatta) saliva samples [n = 59] were collected near temples areas in Kathmandu using a non-invasive sampling technique. All samples were processed for MRSA using standardized selective media and conventional biochemical tests. MRSA verification was done and isolates characterized by SCCmec, multilocus sequence typing, whole genome sequencing [WGS] and antibiotic susceptibilities. Six (2.1%) swine MRSA were isolated from five of the different swine herds tested, five were ST22 type IV and one ST88 type V. Four (6.8%) macaques MRSA were isolated, with three ST22 SCCmec type IV and one ST239 type III. WGS sequencing showed that the eight ciprofloxacin resistant ST22 isolates carried gyrA mutation [S84L]. Six isolates carried the erm(C) genes, five isolates carried aacC-aphD genes and four isolates carried blaZ genes. The swine linezolid resistant ST22 did not carry any known acquired linezolid resistance genes but had a mutation in ribosomal protein L22 [A29V] and an insertion in L4 [68KG69], both previously associated with linezolid resistance. Multiple virulence factors were also identified. This is the first time MRSA ST22 SCCmec IV has been isolated from livestock or primates.

Immunohistochemical assessment of collagen types I, III, IV and VI in biopsy samples of the bovine uterine wall collected during the oestrous cycle.

PubMed

Boos, A

2000-01-01

Uterine biopsies were collected at cycle days 1 (oestrous), 8, 15 and 19 in six cows. Unfixed cryostat sections were used to immunolocalise collagen types I, III, IV and VI by an indirect FITC method. Collagen I was sparsely found in the endometrium where it formed a fine meshwork of thin fibres directly below the surface epithelium, clearly visible only at cycle days 8 and 15. Collagen III formed the bulk of connective tissue fibres and was arranged in fine aggregates within the superficial endometrial stroma, while in the deeper areas it consisted of many thick fibre bundles. Collagen IV was found in basement membranes underlying all endometrial epithelia. Furthermore, it surrounded smooth muscle cells of blood vessels. A few single fibrils also stained positively within the endometrial stroma, more numerous at cycle days 1 and 19 as compared to days 8 and 15. Collagen VI formed a mesh of fine and pericellularly situated fibrils within the endometrial stroma. The contribution of the collagen types studied to the connective tissue of caruncles, blood vessels, lymph follicles, and myometrium is also reported. The results of the present study indicate that the connective tissue of the bovine uterine wall is composed of different collagen types, which exhibit a characteristic distribution pattern each. The day of cycle may influence amounts and organisation of collagen types I and IV as demonstrated here at the light-microscopical level. Copyright 2000 S. Karger AG, Basel

One Thousand New Dwarf Novae from the OGLE Survey

NASA Astrophysics Data System (ADS)

Mróz, P.; Udalski, A.; Poleski, R.; Pietrukowicz, P.; Szymański, M. K.; Soszyński, I.; Wyrzykowski, Ł.; Ulaczyk, K.; Kozłowski, S.; Skowron, J.

2015-12-01

We present one of the largest collections of dwarf novae (DNe) containing 1091 objects that have been discovered in the long-term photometric data from the Optical Gravitational Lensing Experiment (OGLE) survey. They were found in the OGLE fields toward the Galactic bulge and the Magellanic Clouds. We analyze basic photometric properties of all systems and tentatively find a population of DNe from the Galactic bulge. We identify several dozen of WZ Sge-type DN candidates, including two with superhump periods longer than 0.09 d. Other interesting objects include SU UMa-type stars with "early" precursor outbursts or a Z Cam-type star showing outbursts during standstills. We also provide a list of DNe which will be observed during the K2 Campaign 9 microlensing experiment in 2016. Finally, we present the new OGLE-IV real-time data analysis system: CVOM, which has been designed to provide continuous real time photometric monitoring of selected CVs.

Impact of Type of Needle on Incidence of Intravascular Injection During Diagnostic Lumbar Medial Branch Block.

PubMed

Joo, Young; Kim, Yong Chul; Lee, Sang Chul; Kim, Hye Young; Park, Keun Suk; Choi, Eun Joo; Moon, Jee Youn

2016-01-01

Intravascular (IV) injection of local anesthetics is a potential cause of false-negative results after lumbar medial branch nerve blockade (L-MBB) performed to diagnose facetogenic back pain. The aim of the present study was to identify the relationship between the needle type and the incidence of IV injection in patients undergoing L-MBB using fluoroscopy with digital subtraction imaging (DSI). In this prospective randomized study, we compared the incidence of IV uptake of contrast medium using the Quincke needle and Whitacre needle under real-time DSI during L-MBB. Clinical and demographic factors associated with the occurrence of IV uptake were also investigated. In total, 126 patients were randomized into the Quincke needle group (n = 62) and Whitacre needle group (n = 64). Intravascular uptake of contrast medium was observed in 66 (9.8%) of 671 L-MBB procedures under DSI. The incidence of IV uptake was 13.9% (47/338) using the Quincke needle and 5.7% (19/333) using the Whitacre needle. In the multivariate generalized estimating equations analysis, use of a Quincke needle was related to positive IV injection at a 1.898-fold higher rate than was use of a Whitacre needle (95% confidence interval, 1.025-3.516) and a positive aspiration test predicted IV injection at a 21.735-fold higher rate (95% confidence interval, 11.996-52.258). Lumbar medial branch nerve blockade using the Quincke needle was associated with a 1.9-fold higher rate of IV injection than was L-MBB using the Whitacre needle under DSI. Although further study is needed to confirm the clinical efficacy, Whitacre needles can be considered to reduce the risk of IV injection during L-MBB.

Efficacy of oral hydration in the prevention of contrast-induced acute kidney injury in patients undergoing coronary angiography or intervention.

PubMed

Akyuz, Sukru; Karaca, Mehmet; Kemaloglu Oz, Tugba; Altay, Servet; Gungor, Baris; Yaylak, Baris; Yazici, Selcuk; Ozden, Kivilcim; Karakus, Gultekin; Cam, Nese

2014-01-01

Efficacy of intravenous (IV) volume expansion in preventing contrast-induced acute kidney injury (CI-AKI) is well known. However, the role of oral hydration has not been well established. The aim of this work was to evaluate the efficacy of oral hydration in preventing CI-AKI. We prospectively randomized 225 patients undergoing coronary angiography and/or percutaneous coronary intervention in either oral hydration or IV hydration groups. Patients who have at least one of the high-risk factors for developing CI-AKI (advanced age, type 2 diabetes mellitus, anemia, hyperuricemia, a history of cardiac failure or systolic dysfunction) were included in the study. All patients had normal renal function or stage 1-2 chronic kidney disease. Patients in the oral hydration group were encouraged to drink unrestricted amounts of fluids freely whereas isotonic saline infusion was performed by the standard protocol in the IV hydration group. CI-AKI occurred in 8/116 patients (6.9%) in the oral hydration group and 8/109 patients (7.3%) in the IV hydration group (p = 0.89). There was also no statistically significant difference between the two groups when different CI-AKI definitions were taken into account. Oral hydration is as effective as IV hydration in preventing CI-AKI in patients with normal kidney function or stage 1-2 chronic kidney disease, and who also have at least one of the other high-risk factors for developing CI-AKI. © 2014 S. Karger AG, Basel.

Spatial and temporal variations of water quality in Cao-E River of eastern China.

PubMed

Chen, Ding-jiang; Lu, Jun; Yuan, Shao-feng; Jin, Shu-quan; Shen, Ye-na

2006-01-01

Evaluation and analysis of water quality variations were performed with integrated consideration of water quality parameters, hydrological-meteorologic and anthropogenic factors in Cao-E River, Zhejiang Province of China. Cao-E River system has been polluted and the water quality of some reaches are inferior to Grade V according to National Surface Water Quality Standard of China (GB2002). However, mainly polluted indices of each tributary and mainstream are different. Total nitrogen (TN) and total phosphorus (TP) in the water are the main polluted indices for mainstream that varies from 1.52 to 45.85 mg/L and 0.02 to 4.02 mg/L, respectively. TN is the main polluted indices for Sub-watershed I, II, IV and V (0.76 to 18.27 mg/L). BOD5 (0.36 to 289.5 mg/L), CODMn (0.47 to 78.86 mg/L), TN (0.74 to 31.09 mg/L) and TP (0 to 3.75 mg/L) are the main polluted indices for Sub-watershed III. There are tow pollution types along the river including nonpoint source pollution and point source pollution types. Remarkably temporal variations with a few spatial variations occur in nonpoint pollution type reaches (including mainstream, Sub-watershed I and II) that mainly drained by arable field and/or dispersive rural dwelling district, and the maximum pollutant concentration appears in flooding seasons. It implied that the runoff increases the pollutant concentration of the water in the nonpoint pollution type reaches. On the other hand, remarkably spatial variations occur in the point pollution type reaches (include Sub-watershed III, IV and V) and the maximum pollutant concentration appears in urban reaches. The runoff always decreases the pollutant concentration of the river water in the seriously polluted reaches that drained by industrial point sewage. But for the point pollution reaches resulted from centralized town domestic sewage pipeline and from frequent shipping and digging sands, rainfall always increased the concentration of pollutant (TN) in the river water too. Pollution controls were respectively suggested for these tow types according to different pollution causes.

Production of a novel wheat gluten hydrolysate containing dipeptidyl peptidase-IV inhibitory tripeptides using ginger protease.

PubMed

Taga, Yuki; Hayashida, Osamu; Kusubata, Masashi; Ogawa-Goto, Kiyoko; Hattori, Shunji

2017-09-01

Wheat gluten is a Pro-rich protein complex comprising glutenins and gliadins. Previous studies have reported that oral intake of enzymatic hydrolysates of gluten has beneficial effects, such as suppression of muscle injury and improvement of hepatitis. Here, we utilized ginger protease that preferentially cleaves peptide bonds with Pro at the P 2 position to produce a novel type of wheat gluten hydrolysate. Ginger protease efficiently hydrolyzed gluten, particularly under weak acidic conditions, to peptides with an average molecular weight of <600 Da. In addition, the gluten hydrolysate contained substantial amounts of tripeptides, including Gln-Pro-Gln, Gln-Pro-Gly, Gln-Pro-Phe, Leu-Pro-Gln, and Ser-Pro-Gln (e.g. 40.7 mg/g at pH 5.2). These gluten-derived tripeptides showed high inhibitory activity on dipeptidyl peptidase-IV with IC 50 values of 79.8, 70.9, 71.7, 56.7, and 78.9 μM, respectively, suggesting that the novel gluten hydrolysate prepared using ginger protease can be used as a functional food for patients with type 2 diabetes.

Navy Family Advocacy Program. Appendix. Analysis of Central Registry Reports.

DTIC Science & Technology

1983-12-01

2/76) 2 Suspected Abuzso/Malect/Sexua1 Assault an ae2404 65.) "Suspected Abuso /Neglect/ Sexual Assault and Rape Report" 2226 60.5 NAVMED 6320/15A...ANALYSIS OF SEXUAL ASSAULT REPORTS ........... 50 HAPTER V: SUMAY ANALYSIS Or rAMILY ADVOCACY PROGRAM REPORTS . 56 APPENDIX...cont’d)I PAGE CHAPTER IV: SEXUAL ASSAULT TV-1 Fore . . . . . . . . . . . . . . . . . . . . . 51 IV-2 Type of Maltreatment ............... 53 IV-3

AN ERUPTIVE HOT-CHANNEL STRUCTURE OBSERVED AT METRIC WAVELENGTH AS A MOVING TYPE-IV SOLAR RADIO BURST

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasanth, V.; Chen, Yao; Feng, Shiwei

2016-10-10

Hot-channel (HC) structure, observed in the high-temperature passbands of the Atmospheric Imaging Assembly/ Solar Dynamic Observatory , is regarded as one candidate of coronal flux rope that is an essential element of solar eruptions. Here, we present the first radio imaging study of an HC structure in the metric wavelength. The associated radio emission manifests as a moving type-IV (t-IVm) burst. We show that the radio sources co-move outward with the HC, indicating that the t-IV emitting energetic electrons are efficiently trapped within the structure. The t-IV sources at different frequencies present no considerable spatial dispersion during the early stagemore » of the event, while the sources spread gradually along the eruptive HC structure at later stage with significant spatial dispersion. The t-IV bursts are characterized by a relatively high brightness temperature (∼10{sup 7}–10{sup 9} K), a moderate polarization, and a spectral shape that evolves considerably with time. This study demonstrates the possibility of imaging the eruptive HC structure at the metric wavelength and provides strong constraints on the t-IV emission mechanism, which, if understood, can be used to diagnose the essential parameters of the eruptive structure.« less

Clinical and radiographic outcomes of femoral head fractures: excision vs. fixation of fragment in Pipkin type I: what is the optimal choice for femoral head fracture?

PubMed

Park, Kyung-Soon; Lee, Keun-Bae; Na, Bo-Ram; Yoon, Taek-Rim

2015-07-01

In this work, we present relatively long-term results of femoral head fractures with a specific focus on Pipkin type I fractures. Fifty-nine femoral head fractures were treated according to modified Pipkin's classification as follows: type I, small fragment distal to the fovea centralis (FC); type II, large fragment distal to the FC; type III, large fragment proximal to the FC; type IV, comminuted fracture. There were 15 cases of type I, 28 of type II, 9 of type III, and 7 of type IV fractures. Conservative treatment with skeletal traction was performed in 4 type II cases, excision of the fragment in 15 type I and 10 type II cases, fixation of the fragment in 14 type II and all 9 type III cases, and total hip replacement in all 7 type IV cases. The overall clinical and radiographic outcomes were evaluated using previously published criteria, focusing on the results in Pipkin type I fractures with relatively large fragments. Based on Epstein criteria, in type II fractures, excellent or good clinical results were seen in 6 of 10 patients (60.0 %) treated by excision of the fragment and 12 of 14 patients (85.7 %) treated by internal fixation (p = 0.05). Also, excellent or good radiologic results were seen in 4 of 10 (40.0 %) patients treated by excision of the fragment and 12 of 14 (85.7 %) patients treated by internal fixation (p = 0.03). Even in Pipkin type I fractures, if the fragment is large (modified Pipkin type II), early reduction and internal fixation can produce good results.

Retear rate in the late postoperative period after arthroscopic rotator cuff repair.

PubMed

Kim, Jae Hwa; Hong, In Tae; Ryu, Keun Jung; Bong, Sun Tae; Lee, Yoon Seok; Kim, Jang Hwan

2014-11-01

Few clinical studies have evaluated the integrity of repaired tendons and identified the timing of retears through the use of serial imaging. Retears after arthroscopic rotator cuff repair are uncommon in the late postoperative period (after 3 months). Case series; Level of evidence, 4. Among 221 arthroscopic rotator cuff repairs that were performed at a single hospital between May 2010 and February 2012, 61 were involved in this study. Rotator cuff tears consisted of 12 small, 31 medium, 8 large, and 6 massive rotator cuff tears. Additionally, 4 isolated subscapularis tears were included. For clinical evaluation, all patients were assessed both preoperatively and postoperatively by use of the University of California-Los Angeles Shoulder Rating Scale, absolute and relative Constant scores, and American Shoulder and Elbow Surgeons score; active range of motion was assessed as well. For radiological evaluation, all 61 patients had a magnetic resonance imaging (MRI) evaluation at 3 months postoperatively. Among them, 23 patients were evaluated for repaired tendon integrity on postoperative MRI at a minimum of 1 year after surgery (mean, 14.1 months; range, 12-19 months), and results were classified according to the Sugaya classification: type I, sufficient thickness with homogeneously low intensity on each image; type II, sufficient thickness, partial high-intensity area; type III, less than half the thickness without discontinuity; type IV, minor discontinuity; and type V, major discontinuity. The remaining 38 patients, who refused to undergo MRI again for financial reasons, were evaluated through ultrasound. Statistically significant clinical improvements were observed after surgery. The MRI conducted at 3 months postoperatively identified 9 patients with Sugaya type I, 28 patients with type II, and 24 patients with type III repairs. No patients showed Sugaya type IV or V repairs at postoperative 3 months. Thirty-seven patients who had shown Sugaya type I or II repairs on 3-month postoperative MRI had no retear on imaging study at a minimum of 1 year. Of 24 patients who had shown type III repairs on 3-month postoperative MRI, 1 patient exhibited retear (Sugaya type IV) on 1-year postoperative MRI and 3 patients showed full-thickness retear on 1-year postoperative ultrasonography. All 4 of these patients had had large to massive tears preoperatively. Retears occurred infrequently in the late postoperative period (after 3 months) in well-healed tendons that had shown intact cuff repair integrity with sufficient mechanical and biological healing within the first 3 postoperative months. © 2014 The Author(s).

[Alcohol-related cognitive impairment and the DSM-5].

PubMed

Walvoort, S J W; Wester, A J; Doorakkers, M C; Kessels, R P C; Egger, J I M

2016-01-01

It is evident from the dsm-iv-tr that alcohol-related impairment is extremely difficult to classify accurately. As a result, cognitive deficits can easily be overlooked. The dsm-5, however, incorporates a new category, namely 'neurocognitive disorders', which may lead to significant improvements in clinical practice. To compare the classification of alcohol-related cognitive dysfunction in dsm-iv-tr and dsm-5 and to discuss the clinical relevance of the revised classification in the dsm-5. We compare the chapters of the dsm-iv-tr and the dsm-5 concerning alcohol-related cognitive impairment and describe the changes that have been made. The dsm-5 puts greater emphasis on alcohol-related neurocognitive impairment. Not only does dsm-5 distinguish between the degree of severity (major or minor neurocognitive disorder), it also distinguishes between the type of impairment (non-amnestic-type versus confabulating-amnestic type). It also makes a distinction between the durations of impairment (behavioural and/or persistent disorders). The dsm-5 gives a clearer description of alcohol-related neurocognitive dysfunction than does dsm-iv-tr and it stresses the essential role of neuropsychological assessment in the classification, diagnosis, and treatment of neurocognitive disorders.

Macroscopic appearance of Type IV and giant Type III is a high risk for a poor prognosis in pathological stage II/III advanced gastric cancer with postoperative adjuvant chemotherapy

PubMed Central

Yamashita, Keishi; Ema, Akira; Hosoda, Kei; Mieno, Hiroaki; Moriya, Hiromitsu; Katada, Natsuya; Watanabe, Masahiko

2017-01-01

AIM To evaluate whether a high risk macroscopic appearance (Type IV and giant Type III) is associated with a dismal prognosis after curative surgery, because its prognostic relevance remains elusive in pathological stage II/III (pStage II/III) gastric cancer. METHODS One hundred and seventy-two advanced gastric cancer (defined as pT2 or beyond) patients with pStage II/III who underwent curative surgery plus adjuvant S1 chemotherapy were evaluated, and the prognostic relevance of a high-risk macroscopic appearance was examined. RESULTS Advanced gastric cancers with a high-risk macroscopic appearance were retrospectively identified by preoperative recorded images. A high-risk macroscopic appearance showed a significantly worse relapse free survival (RFS) (35.7%) and overall survival (OS) (34%) than an average risk appearance (P = 0.0003 and P < 0.0001, respectively). A high-risk macroscopic appearance was significantly associated with the 13th Japanese Gastric Cancer Association (JGCA) pT (P = 0.01), but not with the 13th JGCA pN. On univariate analysis for RFS and OS, prognostic factors included 13th JGCA pStage (P < 0.0001) and other clinicopathological factors including macroscopic appearance. A multivariate Cox proportional hazards model for univariate prognostic factors identified high-risk macroscopic appearance (P = 0.036, HR = 2.29 for RFS and P = 0.021, HR = 2.74 for OS) as an independent prognostic indicator. CONCLUSION A high-risk macroscopic appearance was associated with a poor prognosis, and it could be a prognostic factor independent of 13th JGCA stage in pStage II/III advanced gastric cancer. PMID:28451064

[Comparison of various noninvasive serum markers of liver fibrosis in chronic viral liver disease].

PubMed

Kim, Sun Min; Sohn, Joo Hyun; Kim, Tae Yeob; Roh, Young Wook; Eun, Chang Soo; Jeon, Yong Cheol; Han, Dong Soo; Oh, Young Ha

2009-12-01

The aim of this study was to determine the clinical performances of noninvasive serum markers for the prediction of liver fibrosis in chronic viral liver diseases. We analyzed a total of 225 patients with chronic viral liver diseases (180 with hepatitis B virus, 43 with hepatitis C virus, and 2 with hepatitis B+C virus) who underwent a liver biopsy procedure at the Hanyang University Guri Hospital between March 2002 and February 2007. Serum was also obtained at the time of liver biopsy. Liver fibrosis was staged according to the scoring system proposed by the Korean Study Group for the Pathology of Digestive Diseases. Various noninvasive serum markers were evaluated, including the aspartate aminotransferase (AST)/alanine aminotransferase (ALT) ratio (AAR), age-platelet (AP) index, AST/platelet ratio index (APRI), cirrhosis discriminant score (CDS), platelet count, hyaluronic acid (HA), and type IV collagen. There were 17, 40, 61, 74, and 33 patients at stages F0, F1, F2, F3, and F4, respectively. The overall diagnostic accuracies of each marker, as determined by the area under receiver operating characteristics curves, were APRI=0.822, CDS=0.776, platelet count=0.773, AP index=0.756, HA=0.749, type IV collagen=0.718, and AAR=0.642 for predicting significant fibrosis (> or =F2); and CDS=0.835, platelet count=0.795, AP index=0.794, HA=0.766, AAR=0.711, type IV collagen=0.697, and APRI=0.691 for predicting extensive fibrosis (> or =F3). All noninvasive serum markers evaluated in this study were useful for predicting significant or extensive liver fibrosis in chronic viral liver diseases. In particular, APRI was most useful for the prediction of significant fibrosis, and CDS was most useful for the prediction of extensive fibrosis.

Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis

PubMed Central

Luvan, M; Roshan, G; Saw, A

2015-01-01

Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy. PMID:28611907

Actin homolog MreB affects chromosome segregation by regulating topoisomerase IV in Escherichia coli.

PubMed

Madabhushi, Ram; Marians, Kenneth J

2009-01-30

In Escherichia coli, topoisomerase IV, a type II topoisomerase, mediates the resolution of topological linkages between replicated daughter chromosomes and is essential for chromosome segregation. Topo IV activity is restricted to only a short interval late in the cell cycle. However, the mechanism that confers this temporal regulation is unknown. Here we report that the bacterial actin homolog MreB participates in the temporal oscillation of Topo IV activity. We show that mreB mutant strains are deficient in Topo IV activity. In addition, we demonstrate that, depending upon whether it is in a monomeric or polymerized state, MreB affects Topo IV activity differentially. In addition, MreB physically interacts with the ParC subunit of Topo IV. Together, these results may explain how dynamics of the bacterial cytoskeleton are coordinated with the timing of chromosome segregation.

Incidence of intravenous contrast extravasation: increased risk for patients with deep brachial catheter placement from the emergency department.

PubMed

Hardie, Andrew D; Kereshi, Borko

2014-06-01

Deep brachial intravenous catheter (IV) placement can be performed in emergency department patients with difficult vascular access, but the safety of deep brachial IV for iodinated contrast administration has not been assessed. This study compares the relative risk for extravasation of deep brachial IV compared with antecubital IV during power injected computed tomography (CT) examinations. A departmental practice quality improvement was performed to assess the rate of IV extravasation for all CT examinations during a 1 year period. De-identified data was analyzed with a waiver of informed consent to identify the rate and relative risk of iodinated contrast extravasation by catheter type. A total of 10,750 injections were performed, with 82 extravasation events (0.8 %). There were 51 extravasations of antecubital IV from approximately 8,599 placed (0.6 %). For 123 deep brachial IV placed, there were eight extravasations (6.5 %). The relative risk of a deep brachial IV extravasation was 9.4 compared to 0.4 for antecubital placement. Deep brachial IV demonstrated a markedly higher rate of contrast extravasation than antecubital IV. For power injected iodinated contrast administration, it is recommended to avoid the use of deep brachial IV whenever possible.

Initial Screening of Environmentally Sustainable Surface Pretreatments for Adhesive Bonding Applications

DTIC Science & Technology

2017-05-17

490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as bonding...sustainable TT-C-490F pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as...pretreatment was applied. Environmentally sustainable TT-C-490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during

Epidemiology and Molecular Typing of Trypanosoma cruzi in Naturally-Infected Hound Dogs and Associated Triatomine Vectors in Texas, USA.

PubMed

Curtis-Robles, Rachel; Snowden, Karen F; Dominguez, Brandon; Dinges, Lewis; Rodgers, Sandy; Mays, Glennon; Hamer, Sarah A

2017-01-01

Trypanosoma cruzi is the etiologic agent of Chagas disease throughout the Americas. Few population-level studies have examined the epidemiology of canine infection and strain types of T. cruzi that infect canines in the USA. We conducted a cross-sectional study of T. cruzi infection in working hound dogs in south central Texas, including analysis of triatomine vectors collected within kennel environments. Paired IFA and Chagas Stat-Pak serological testing showed an overall seroprevalence of 57.6% (n = 85), with significant variation across kennels. Dog age had a marginally significant effect on seropositivity, with one year of age increase associated with a 19.6% increase in odds of being seropositive (odds ratio 95% CI 0.996-1.435; p = 0.055). PCR analyses of blood revealed 17.4% of dogs harbored parasite DNA in their blood, including both seronegative and seropositive dogs. Molecular screening of organs from opportunistically sampled seropositive dogs revealed parasite DNA in heart, uterus, and mammary tissues. Strain-typing showed parasite discrete typing units (DTU) TcI and TcIV present in dog samples, including a co-occurrence of both DTUs in two individual dogs. Bloodmeal analysis of Triatoma gerstaeckeri and Triatoma sanguisuga insects collected from the kennels revealed exclusively dog DNA. Vector infection with T. cruzi was 80.6% (n = 36), in which T. gerstaeckeri disproportionately harbored TcI (p = 0.045) and T. sanguisuga disproportionately harbored TcIV (p = 0.029). Tracing infection status across dog litters showed some seropositive offspring of seronegative dams, suggesting infection of pups from local triatomine vectors rather than congenital transmission. Canine kennels are high-risk environments for T. cruzi transmission, in which dogs likely serve as the predominant parasite reservoir. Disease and death of working dogs from Chagas disease is associated with unmeasured yet undoubtedly significant financial consequences because working dogs are highly trained and highly valued.

Epidemiology and Molecular Typing of Trypanosoma cruzi in Naturally-Infected Hound Dogs and Associated Triatomine Vectors in Texas, USA

PubMed Central

Curtis-Robles, Rachel; Snowden, Karen F.; Dominguez, Brandon; Dinges, Lewis; Rodgers, Sandy; Mays, Glennon

2017-01-01

Background Trypanosoma cruzi is the etiologic agent of Chagas disease throughout the Americas. Few population-level studies have examined the epidemiology of canine infection and strain types of T. cruzi that infect canines in the USA. We conducted a cross-sectional study of T. cruzi infection in working hound dogs in south central Texas, including analysis of triatomine vectors collected within kennel environments. Methodology/Principle Findings Paired IFA and Chagas Stat-Pak serological testing showed an overall seroprevalence of 57.6% (n = 85), with significant variation across kennels. Dog age had a marginally significant effect on seropositivity, with one year of age increase associated with a 19.6% increase in odds of being seropositive (odds ratio 95% CI 0.996–1.435; p = 0.055). PCR analyses of blood revealed 17.4% of dogs harbored parasite DNA in their blood, including both seronegative and seropositive dogs. Molecular screening of organs from opportunistically sampled seropositive dogs revealed parasite DNA in heart, uterus, and mammary tissues. Strain-typing showed parasite discrete typing units (DTU) TcI and TcIV present in dog samples, including a co-occurrence of both DTUs in two individual dogs. Bloodmeal analysis of Triatoma gerstaeckeri and Triatoma sanguisuga insects collected from the kennels revealed exclusively dog DNA. Vector infection with T. cruzi was 80.6% (n = 36), in which T. gerstaeckeri disproportionately harbored TcI (p = 0.045) and T. sanguisuga disproportionately harbored TcIV (p = 0.029). Tracing infection status across dog litters showed some seropositive offspring of seronegative dams, suggesting infection of pups from local triatomine vectors rather than congenital transmission. Conclusions/Significance Canine kennels are high-risk environments for T. cruzi transmission, in which dogs likely serve as the predominant parasite reservoir. Disease and death of working dogs from Chagas disease is associated with unmeasured yet undoubtedly significant financial consequences because working dogs are highly trained and highly valued. PMID:28095511

Oral versus intravenous iron replacement therapy distinctly alters the gut microbiota and metabolome in patients with IBD

PubMed Central

Lee, Thomas; Clavel, Thomas; Smirnov, Kirill; Schmidt, Annemarie; Lagkouvardos, Ilias; Walker, Alesia; Lucio, Marianna; Michalke, Bernhard; Schmitt-Kopplin, Philippe; Fedorak, Richard; Haller, Dirk

2017-01-01

Objective Iron deficiency is a common complication in patients with IBD and oral iron therapy is suggested to exacerbate IBD symptoms. We performed an open-labelled clinical trial to compare the effects of per oral (PO) versus intravenous (IV) iron replacement therapy (IRT). Design The study population included patients with Crohn's disease (CD; N=31), UC (N=22) and control subjects with iron deficiency (non-inflamed, NI=19). After randomisation, participants received iron sulfate (PO) or iron sucrose (IV) over 3 months. Clinical parameters, faecal bacterial communities and metabolomes were assessed before and after intervention. Results Both PO and IV treatments ameliorated iron deficiency, but higher ferritin levels were observed with IV. Changes in disease activity were independent of iron treatment types. Faecal samples in IBD were characterised by marked interindividual differences, lower phylotype richness and proportions of Clostridiales. Metabolite analysis also showed separation of both UC and CD from control anaemic participants. Major shifts in bacterial diversity occurred in approximately half of all participants after IRT, but patients with CD were most susceptible. Despite individual-specific changes in phylotypes due to IRT, PO treatment was associated with decreased abundances of operational taxonomic units assigned to the species Faecalibacterium prausnitzii, Ruminococcus bromii, Dorea sp. and Collinsella aerofaciens. Clear IV-specific and PO-specific fingerprints were evident at the level of metabolomes, with changes affecting cholesterol-derived host substrates. Conclusions Shifts in gut bacterial diversity and composition associated with iron treatment are pronounced in IBD participants. Despite similar clinical outcome, oral administration differentially affects bacterial phylotypes and faecal metabolites compared with IV therapy. Trial registration number clinicaltrial.gov (NCT01067547). PMID:26848182

THE UNUSUAL VARIABLE HOT B SUBDWARF LS IV-14{sup 0}116

DOE Office of Scientific and Technical Information (OSTI.GOV)

Green, E. M.; Guvenen, B.; O'Malley, C. J.

2011-06-10

We first present the results of follow-up photometric observations of the He-rich hot B subdwarf LS IV-14{sup 0}116, which confirm the presence of multiperiodic luminosity variations in the light curve of this star. Rather surprisingly, no other follow-up observations of this kind seem to have been published after the initial suggestion in 2005 that LS IV-14{sup 0}116 could be a pulsating star of a new kind. We were able to extract from our data at least six significant periodicities ranging from 1954 s to 5084 s, including the two oscillations uncovered previously. We also present the results of an analysismore » combining a high signal-to-noise optical spectrum of LS IV-14{sup 0}116 with recently developed non-local thermodynamic equilibrium model atmospheres and synthetic spectra. Our best estimates of the atmospheric parameters of this star are T{sub eff} = 34950 {+-} 250 K, log g = 5.93 {+-} 0.04, and log N(He)/N(H) = -0.62 {+-} 0.03 (formal fitting errors only). These place LS IV-14{sup 0}116 very near the region of maximum instability in the T{sub eff}-log g plane for short-period p-mode pulsators of the hot subdwarf type. If the luminosity variations are indeed due to pulsations, then LS IV-14{sup 0}116 poses a real challenge to current theory: how can such long observed periods (which would have to be associated with medium- to high-order g-modes) be excited at such a high effective temperature and surface gravity, while the short-period p-modes, more typically excited in this domain, are not observed in this particular star?« less

A multi-institutional, propensity-score-matched comparison of post-operative outcomes between general anesthesia and monitored anesthesia care with intravenous sedation in umbilical hernia repair.

PubMed

Vu, M M; Galiano, R D; Souza, J M; Du Qin, C; Kim, J Y S

2016-08-01

Monitored anesthesia care with intravenous sedation (MAC/IV), recently proposed as a good choice for hernia repair, has faster recovery and better patient satisfaction than general anesthesia; however the possibility of oversedation and respiratory distress is a widespread concern. There is a paucity of the literature examining umbilical hernia repairs (UHR) and optimal anesthesia choice, despite its importance in determining clinical outcomes. A retrospective analysis of anesthesia type in UHR was performed in the National Surgical Quality Improvement Program 2005-2013 database. General anesthesia and MAC/IV groups were propensity-score-matched (PSM) to reduce treatment selection bias. Surgical complications, medical complications, and post-operative hospital stays exceeding 1 day were the primary outcomes of interest. Pre-operative characteristics and post-operative outcomes were compared between the two anesthesia groups using univariate and multivariate statistics. PSM removed all observed differences between the two groups (p > 0.05 for all tracked pre-operative characteristics). MAC/IV cases required fewer post-operative hospital stays exceeding 1 day (3.5 vs 6.3 %, p < 0.001). Univariate analysis showed that overall complication rate did not differ (1.7 vs 1.8 %, p = 0.569), however MAC/IV cases resulted in fewer incidences of septic shock (<0.1 vs 0.1 %, p = 0.016). After multivariate logistic regression, MAC/IV was revealed to yield significantly lower chances of overall medical complications (OR = 0.654, p = 0.046). UHR under MAC/IV causes fewer medical complications and reduces post-operative hospital stays compared to general anesthesia. The implications for surgeons and patients are broad, including improved surgical safety, cost-effective care, and patient satisfaction.

Adult presentation of Bartter syndrome type IV with erythrocytosis

PubMed Central

Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

2015-01-01

Abstract Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis. PMID:26537508

An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications

PubMed Central

MANOHARAN, A.; ZHANG, L.; POOJARY, A.; BHANDARKAR, L.; KOPPIKAR, G.; ROBINSON, D. A.

2012-01-01

SUMMARY A cluster of methicillin-resistant Staphylococcus aureus (MRSA) breast abscesses in women who had given birth at a hospital in Mumbai, India was investigated retrospectively. Nineteen of twenty cases were caused by a single clone: pvl-positive, spa type 648 (Ridom t852), ccrB:dru subtype 3:0, ST22-MRSA-IV. Despite the presence of pvl and SCCmec type IV, which are common genetic markers among community-associated MRSA, this outbreak was caused by a healthcare-associated, community-onset MRSA that was common in the hospital environment. Thus, infection control practices may have an important role in limiting the spread of this virulent clone. PMID:22475374

The role of an alternative sigma factor in motility and pilus formation in the cyanobacterium Synechocystis sp. strain PCC6803

PubMed Central

Bhaya, Devaki; Watanabe, Natsu; Ogawa, Teruo; Grossman, Arthur R.

1999-01-01

Disruption of a gene for an alternative sigma factor, designated sigF, in the freshwater, unicellular cyanobacterium Synechocystis sp. strain PCC6803 resulted in a pleiotropic phenotype. Most notably, this mutant lost phototactic movement with a concomitant loss of pili, which are abundant on the surface of wild-type cells. The sigF mutant also secreted both high levels of yellow–brown and UV-absorbing pigments and a polypeptide that is similar to a large family of extracellular proteins that includes the hemolysins. Furthermore, the sigF mutant had a dramatically reduced level of the transcript from two tandemly arranged pilA genes (sll1694 and sll1695), which encode major structural components of type IV pili. Inactivation of these pilA genes eliminated phototactic movement, though some pili were still present in this strain. Together, these results demonstrate that SigF plays a critical role in motility via the control of pili formation and is also likely to regulate other features of the cell surface. Furthermore, the data provide evidence that type IV pili are required for phototactic movement in certain cyanobacteria and suggest that different populations of pili present on the Synechocystis cell surface may perform different functions. PMID:10077659

Diagnostic accuracy of level IV portable sleep monitors versus polysomnography for obstructive sleep apnea: a systematic review and meta-analysis.

PubMed

Abrahamyan, Lusine; Sahakyan, Yeva; Chung, Suzanne; Pechlivanoglou, Petros; Bielecki, Joanna; Carcone, Steven M; Rac, Valeria E; Fitzpatrick, Michael; Krahn, Murray

2018-01-09

Obstructive sleep apnea (OSA) is the most common sleep-related breathing disorder. In-laboratory, overnight type I polysomnography (PSG) is the current "gold standard" for diagnosing OSA. Home sleep apnea testing (HSAT) using portable monitors (PMs) is an alternative testing method offering better comfort and lower costs. We aimed to systematically review the evidence on diagnostic ability of type IV PMs compared to PSG in diagnosing OSA. Participants: patients ≥16 years old with symptoms suggestive of OSA;intervention: type IV PMs (devices with < 2 respiratory channels); comparator: in-laboratory PSG; outcomes: diagnostic accuracy measures;studies: cross-sectional, prospective observational/experimental/quasi-experimental studies; information sources: MEDLINE and Cochrane Library from January 1, 2010 to May 10, 2016. All stages of review were conducted independently by two investigators. We screened 6054 abstracts and 117 full-text articles to select 24 full-text articles for final review. These 24 studies enrolled a total of 2068 patients with suspected OSA and evaluated 10 different PMs with one to six channels. Only seven (29%) studies tested PMs in the home setting. The mean difference (bias) between PSG-measured and PM-measured apnea-hypopnea index (AHI) ranged from - 14.8 to 10.6 events/h. At AHI ≥ 5 events/h, the sensitivity of type IV PMs ranged from 67.5-100% and specificity ranged from 25 to 100%. While current evidence is not very strong for the stand-alone use of level IV PMs in clinical practice, they can potentially widen access to diagnosis and treatment of OSA. Policy recommendations regarding HSAT use should also consider the health and broader social implications of false positive and false negative diagnoses.

The effect of dipeptidyl peptidase-IV inhibition on bone in a mouse model of type 2 diabetes

PubMed Central

Gallagher, Emily Jane; Sun, Hui; Kornhauser, Caroline; Tobin-Hess, Aviva; Epstein, Sol; Yakar, Shoshana; LeRoith, Derek

2017-01-01

Background Individuals with type 2 diabetes (T2D) are at greater risk of bone fractures than those without diabetes. Certain oral diabetic medications may further increase the risk of fracture. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are incretin-based therapies that are being increasingly used for the management of T2D. It has been hypothesized that these agents may reduce fracture risk in those with T2D. In this study, we used a mouse model of T2D to examine the effects of the DPP-IV inhibitor, MK-0626, on bone. Methods Male wild type (WT) and diabetic muscle-lysine-arginine (MKR) mice were treated with MK-0626, pioglitazone, alendronate or vehicle. The effects of treatment with MK-0626 on bone microarchitecture and turnover were compared with treatment with pioglitazone, alendronate and vehicle. Osteoblast differentiation was determined by alkaline phosphatase staining of bone marrow cells from WT and MKR mice after treatment with pioglitazone, MK-0626 or phosphate buffered saline. Results We found that MK-0626 had neutral effects on cortical and trabecular bone in diabetic mice. Pioglitazone had detrimental effects on the trabecular bone of WT but not of diabetic mice. Alendronate caused improvements in cortical and trabecular bone architecture in diabetic and WT mice. MK-0626 did not alter osteoblast differentiation, but pioglitazone impaired osteoblast differentiation in vitro. Conclusions Overall, the DPP-IV inhibitor, MK-0626, had no adverse effects on bone in an animal model of T2D or directly on osteoblasts in culture. These findings are reassuring as DPP-IV inhibitors are being widely used to treat patients with T2D who are already at an increased risk of fractures. PMID:24023014

Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1.

PubMed Central

Slepkov, Emily R; Chow, Signy; Lemieux, M Joanne; Fliegel, Larry

2004-01-01

NHE1 (Na+/H+ exchanger isoform 1) is a ubiquitously expressed integral membrane protein that regulates intracellular pH in mammalian cells. Proline residues within transmembrane segments have unusual properties, acting as helix breakers and increasing flexibility of membrane segments, since they lack an amide hydrogen. We examined the importance of three conserved proline residues in TM IV (transmembrane segment IV) of NHE1. Pro167 and Pro168 were mutated to Gly, Ala or Cys, and Pro178 was mutated to Ala. Pro168 and Pro178 mutant proteins were expressed at levels similar to wild-type NHE1 and were targeted to the plasma membrane. However, the mutants P167G (Pro167-->Gly), P167A and P167C were expressed at lower levels compared with wild-type NHE1, and a significant portion of P167G and P167C were retained intracellularly, possibly indicating induced changes in the structure of TM IV. P167G, P167C, P168A and P168C mutations abolished NHE activity, and P167A and P168G mutations caused markedly decreased activity. In contrast, the activity of the P178A mutant was not significantly different from that of wild-type NHE1. The results indicate that both Pro167 and Pro168 in TM IV of NHE1 are required for normal NHE activity. In addition, mutation of Pro167 affects the expression and membrane targeting of the exchanger. Thus both Pro167 and Pro168 are strictly required for NHE function and may play critical roles in the structure of TM IV of the NHE. PMID:14680478

Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review

PubMed Central

Abdulgader, Shima M.; Shittu, Adebayo O.; Nicol, Mark P.; Kaba, Mamadou

2015-01-01

Methicillin-resistant Staphylococcus aureus (MRSA) infections are a serious global problem, with considerable impact on patients and substantial health care costs. This systematic review provides an overview on the clonal diversity of MRSA, as well as the prevalence of Panton-Valentine leukocidin (PVL)-positive MRSA in Africa. A search on the molecular characterization of MRSA in Africa was conducted by two authors using predefined terms. We screened for articles published in English and French through to October 2014 from five electronic databases. A total of 57 eligible studies were identified. Thirty-four reports from 15 countries provided adequate genotyping data. CC5 is the predominant clonal complex in the healthcare setting in Africa. The hospital-associated MRSA ST239/ST241-III [3A] was identified in nine African countries. This clone was also described with SCCmec type IV [2B] in Algeria and Nigeria, and type V [5C] in Niger. In Africa, the European ST80-IV [2B] clone was limited to Algeria, Egypt and Tunisia. The clonal types ST22-IV [2B], ST36-II [2A], and ST612-IV [2B] were only reported in South Africa. No clear distinctions were observed between MRSA responsible for hospital and community infections. The community clones ST8-IV [2B] and ST88-IV [2B] were reported both in the hospital and community settings in Angola, Cameroon, Gabon, Ghana, Madagascar, Nigeria, and São Tomé and Príncipe. The proportion of PVL-positive MRSA carriage and/or infections ranged from 0.3 to 100% in humans. A number of pandemic clones were identified in Africa. Moreover, some MRSA clones are limited to specific countries or regions. We strongly advocate for more surveillance studies on MRSA in Africa. PMID:25983721

Validity of DSM-IV attention–deficit/hyperactivity disorder symptom dimensions and subtypes

PubMed Central

Willcutt, Erik G.; Nigg, Joel T.; Pennington, Bruce F.; Solanto, Mary V.; Rohde, Luis A.; Tannock, Rosemary; Loo, Sandra K.; Carlson, Caryn L.; McBurnett, Keith; Lahey, Benjamin B.

2013-01-01

DSM-IV criteria for ADHD specify two dimensions of inattention and hyperactivity-impulsivity symptoms that are used to define three nominal subtypes: predominantly hyperactive-impulsive type (ADHD-H), predominantly inattentive type (ADHD-I), and combined type (ADHD-C). To aid decision-making for DSM-5 and other future diagnostic systems, a comprehensive literature review and meta-analysis of 546 studies was completed to evaluate the validity of the DSM-IV model of ADHD. Results indicated that DSM-IV criteria identify individuals with significant and persistent impairment in social, academic, occupational, and adaptive functioning when intelligence, demographic factors, and concurrent psychopathology are controlled. Available data overwhelmingly support the concurrent, predictive, and discriminant validity of the distinction between inattention and hyperactivity-impulsivity symptoms, and indicate that nearly all differences among the nominal subtypes are consistent with the relative levels of inattention and hyperactivity-impulsivity symptoms that define the subtypes. In contrast, the validity of the DSM-IV subtype model is compromised by weak evidence for the validity of ADHD-H after first grade, minimal support for the distinction between ADHD-I and ADHD-C in studies of etiological influences, academic and cognitive functioning, and treatment response, and the marked longitudinal instability of all three subtypes. Overall, it is concluded that the DSM-IV ADHD subtypes provide a convenient clinical shorthand to describe the functional and behavioral correlates of current levels of inattention and hyperactivity-impulsivity symptoms, but do not identify discrete subgroups with sufficient long-term stability to justify the classification of distinct forms of the disorder. Empirical support is stronger for an alternative model that would replace the subtypes with dimensional modifiers that reflect the number of inattention and hyperactivity-impulsivity symptoms at the time of assessment. PMID:22612200

Choice of intravenous antibiotic prophylaxis for colorectal surgery does matter.

PubMed

Deierhoi, Rhiannon J; Dawes, Lillian G; Vick, Catherine; Itani, Kamal M F; Hawn, Mary T

2013-11-01

The Surgical Care Improvement Program endorses mandatory compliance with approved intravenous prophylactic antibiotics; however, oral antibiotics are optional. We hypothesized that surgical site infection (SSI) rates may vary depending on the choice of antibiotic prophylaxis. A retrospective cohort study of elective colorectal procedures using Veterans Affairs Surgical Quality Improvement Program (VASQIP) and SSI outcomes data was linked to the Office of Informatics and Analytics (OIA) and Pharmacy Benefits Management (PBM) antibiotic data from 2005 to 2009. Surgical site infection rates by type of IV antibiotic agent alone (IV) or in combination with oral antibiotic (IV + OA) were determined. Generalized estimating equations were used to examine the association between type of antibiotic prophylaxis and SSI for the entire cohort and stratified by use of oral antibiotics. After 5,750 elective colorectal procedures, 709 SSIs (12.3%) developed within 30 days. Oral antibiotic + IV (n = 2,426) had a lower SSI rate than IV alone (n = 3,324) (6.3% vs 16.7%, p < 0.0001). There was a significant difference in the SSI rate based on type of preoperative IV antibiotic given (p ≤ 0.0001). Generalized estimating equations adjusting for significant covariates of age, body mass index, procedure work relative value units, and operation duration demonstrated an independent protective effect of oral antibiotics (odds ratio [OR] 0.37, 95% CI 0.29 to 0.46), as well as increased rates of SSI associated with ampicillin/sulbactam (OR 2.21, 95% CI 1.37 to 3.56) and second generation cephalosporins (cefoxitin, OR 2.50, 95% CI 1.83 to 3.42; cefotetan, OR 2.70, 95% CI 1.72 to 4.22) when compared with first generation cephalosporin/metronidazole. The choice of IV antibiotic was related to the SSI rate; however, oral antibiotics were associated with reduced SSI rate for every antibiotic class. Published by Elsevier Inc.

Influence of hospital type on survival in stage IV colorectal cancer.

PubMed

Hoshino, Nobuaki; Hasegawa, Suguru; Hida, Koya; Kawada, Kenji; Okamura, Ryosuke; Hamada, Madoka; Munemoto, Yoshinori; Sakai, Yoshiharu; Watanabe, Masahiko

2016-08-01

Hospital factors along with various patient and surgeon factors are considered to affect the prognosis of colorectal cancer. Hospital volume is well known, but little is known regarding other hospital factors. We reviewed data on 853 patients with stage IV colorectal cancer who underwent elective palliative primary tumor resection between January 2006 and December 2007. To detect the hospital factors that could influence the prognosis of incurable colorectal cancer, the relationships between patient/hospital factors and overall survival were analyzed. Among hospital factors, hospital type (Group A: university hospital or cancer center; Group B: community hospital), hospital volume, and number of colorectal surgeons were examined. In univariate analysis, Group A hospitals showed significantly better prognosis than Group B hospitals (p = 0.034), while hospital volume and number of colorectal surgeons were not associated with overall survival. After adjustment for patient factors in multivariate analysis, hospital type was significantly associated with overall survival (hazard ratio: 1.31; 95 % confidence interval: 1.05-1.63; p = 0.016). However, there was no significant difference in short-term outcomes between hospital types. Hospital type was identified as a hospital factor that possibly affects the prognosis of stage IV colorectal cancer patients.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Identification of type IV collagen exposure as a molecular imaging target for early detection of thoracic aortic dissection

PubMed Central

Xu, Ke; Xu, Chen; Zhang, Yanzhenzi; Qi, Feiran; Yu, Bingran; Li, Ping; Jia, Lixin; Li, Yulin; Xu, Fu-jian; Du, Jie

2018-01-01

Thoracic aortic dissection (TAD) is an aggressive and life-threatening vascular disease and there is no effective means of early diagnosis of dissection. Type IV collagen (Col-IV) is a major component of the sub-endothelial basement membrane, which is initially exposed followed by endothelial injury as early-stage event of TAD. So, we want to build a noninvasive diagnostic method to detect early dissection by identifying the exposed Col-IV via MRI. Methods: Col-IV-targeted magnetic resonance/ fluorescence dual probe (Col-IV-DOTA-Gd-rhodamine B; CDR) was synthesized by amide reaction and coordination reaction. Flow cytometry analysis was used to evaluate the cell viability of SMC treated with CDR and fluorescence assays were used to assess the Col-IV targeting ability of CDR in vitro. We then examined the sensitivity and specificity of CDR at different stages of TAD via MRI and bioluminescence imaging in vivo. Results: The localization of Col-IV (under the intima) was observed by histology images. CDR bound specifically to Col-IV-expressing vascular smooth muscle cells and BAPN-induced dissected aorta. The CDR signal was co-detected by magnetic resonance imaging (MRI) and bioluminescence imaging as early as 2 weeks after BAPN administration (pre-dissection stage). The ability to detect rupture of dissected aorta was indicated by a strong normalized signal enhancement (NSE) in vivo. Moreover, NSE was negatively correlated with the time of dissection rupture after BAPN administration (r2 = 0.8482). Conclusion: As confirmed by in vivo studies, the CDR can identify the exposed Col-IV in degenerated aorta to monitor the progress of aortic dissection from the early stage to the rupture via MRI. Thus, CDR-enhanced MRI proposes a potential method for dissection screening, and for monitoring disease progression and therapeutic response. PMID:29290819

Microbial Diagnostic Microarrays for the Detection and Typing of Food- and Water-Borne (Bacterial) Pathogens

PubMed Central

Kostić, Tanja; Sessitsch, Angela

2011-01-01

Reliable and sensitive pathogen detection in clinical and environmental (including food and water) samples is of greatest importance for public health. Standard microbiological methods have several limitations and improved alternatives are needed. Most important requirements for reliable analysis include: (i) specificity; (ii) sensitivity; (iii) multiplexing potential; (iv) robustness; (v) speed; (vi) automation potential; and (vii) low cost. Microarray technology can, through its very nature, fulfill many of these requirements directly and the remaining challenges have been tackled. In this review, we attempt to compare performance characteristics of the microbial diagnostic microarrays developed for the detection and typing of food and water pathogens, and discuss limitations, points still to be addressed and issues specific for the analysis of food, water and environmental samples. PMID:27605332

The Validity of the Montgomery-Asberg Depression Rating Scale in an Inpatient Sample with Alcohol Dependence.

PubMed

Hobden, Breanne; Schwandt, Melanie L; Carey, Mariko; Lee, Mary R; Farokhnia, Mehdi; Bouhlal, Sofia; Oldmeadow, Christopher; Leggio, Lorenzo

2017-06-01

The Montgomery-Asberg Depression Rating Scale (MADRS) is commonly used to examine depressive symptoms in clinical settings, including facilities treating patients for alcohol addiction. No studies have examined the validity of the MADRS compared to an established clinical diagnostic tool of depression in this population. This study aimed to examine the following: (i) the validity of the MADRS compared to a clinical diagnosis of a depressive disorder (using the Structured Clinical Interview for DSM-IV-TR [SCID-IV-TR]) in patients seeking treatment for alcohol dependence (AD); (ii) whether the validity of the MADRS differs by type of SCID-IV-TR-based diagnosis of depression; and (iii) which items contribute to the optimal predictive model of the MADRS compared to a SCID-IV-TR diagnosis of a depressive disorder. Individuals seeking treatment for AD and admitted to an inpatient unit were administered the MADRS at day 2 of their detoxification program. Clinical diagnoses of AD and depression were made via the SCID-IV-TR at the beginning of treatment. In total, 803 participants were included in the study. The MADRS demonstrated low overall accuracy relative to the clinical diagnosis of depression with an area under the receiver operating characteristic curve of 0.68. The optimal threshold for balancing sensitivity and specificity identified by the Euclidean distance was >14. This cut-point demonstrated a sensitivity of 66%, a specificity of 60%, a positive predictive value of 50%, and a negative predictive value of 75%. The MADRS performed slightly better for major depressive disorders compared to alcohol-induced depression. Items related to lassitude, concentration, and appetite slightly decreased the accuracy of the MADRS. The MADRS does not appear to be an appropriate substitute for a diagnostic tool among alcohol-dependent patients. The MADRS may, however, still be a useful screening tool assuming careful consideration of cut-points. Copyright © 2017 by the Research Society on Alcoholism.

Chondroitin sulphates A, B and C, collagen types I-IV and fibronectin in venous sinus of the red pulp in human spleen.

PubMed

Rovenská, E; Michalka, P; Papincák, J; Durdík, S; Jakubovský, J

2005-01-01

The morphological relationship of chondroitin sulphates A, B, and C, collagen types I-IV and fibronectin in the wall of venous sinuses of the red pulp in human spleen has not been a focus of interest among morphologists. Regarding the hypothesis that the structure of the spleen lends it the function of a blood filter the substances described in our study might play a significant role in the functional morphology. Of 146 human spleen surgical specimens, groups of 12 specimens each were examined under a light microscope using the method of antibodies against fibronectin, against collagen types I-IV and against chondroitin sulphates A, B, and C. The sections of the red pulp of human spleen stained with hematoxylin and eosin provided limited information about the wall of the sinuses. Chondroitin sulphates A and B were observed on the surface of sinus-lining cells (SLC), and fibronectin was detected on the surface of the annular fibers. Collagen type 11 was observed almost in the same places as chondroitin sulphates A and B. Collagen type IV was present in annular fibers of the wall of the sinus and in the basement membrane, like fibronectin. Chondroitin sulphate was not present in the walls of sinuses. Binding of antibodies against chondroitin sulphate A and against chondroitin sulphate B indicates the presence of chondroitin sulfates on the surface of SLC, where they probably play a role in helping the human organism to recognize alien and self substances. The presence of chondroitin,sulphates A and B probably affects inhibition of binding of cells with collagen type I, but not with fibronectin.

Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

PubMed Central

Charvin, G.; Bensimon, D.; Croquette, V.

2003-01-01

Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

L-arginine mediated renaturation enhances yield of human, α6 type IV collagen non-collagenous domain from bacterial inclusion bodies

PubMed Central

Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Akul Sudhakar, Yakkanti

2012-01-01

The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated. PMID:22512648

L-arginine mediated renaturation enhances yield of human, α6 Type IV collagen non-collagenous domain from bacterial inclusion bodies.

PubMed

Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Sudhakar, Yakkanti Akul

2012-10-01

The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated.

Experimental identification of p-type conduction in fluoridized boron nitride nanotube

NASA Astrophysics Data System (ADS)

Zhao, Jing; Li, Wuxia; Tang, Chengchun; Li, Lin; Lin, Jing; Gu, Changzhi

2013-04-01

The transport properties of F-doped boron nitride nanotube (BNNT) top-gate field effect devices were investigated to demonstrate the realization of p-type BNNTs by F-doping. The drain current was found to increase substantially with the applied negative gate voltage, suggesting these devices persist significant field effect with holes predominated; it also suggests that F-doping remarkably modified the band gap with F atoms preferred to be absorbed on B sites. Parameters, including the resistivity, charge concentration, and mobility, were further retrieved from the I-V curves. Our results indicate that device characterization is an effective method to reveal the specific properties of BNNTs.

2- and 3-substituted imidazo[1,2-a]pyrazines as inhibitors of bacterial type IV secretion

PubMed Central

Sayer, James R.; Walldén, Karin; Pesnot, Thomas; Campbell, Frederick; Gane, Paul J.; Simone, Michela; Koss, Hans; Buelens, Floris; Boyle, Timothy P.; Selwood, David L.; Waksman, Gabriel; Tabor, Alethea B.

2014-01-01

A novel series of 8-amino imidazo[1,2-a]pyrazine derivatives has been developed as inhibitors of the VirB11 ATPase HP0525, a key component of the bacterial type IV secretion system. A flexible synthetic route to both 2- and 3-aryl substituted regioisomers has been developed. The resulting series of imidazo[1,2-a]pyrazines has been used to probe the structure–activity relationships of these inhibitors, which show potential as antibacterial agents. PMID:25438770

Sfg

NASA Astrophysics Data System (ADS)

Fischer, R. X.; Baur, W. H.

This document is part of Subvolume E `Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes RON to STI' of Volume 14 `Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV `Physical Chemistry'.

Vet

NASA Astrophysics Data System (ADS)

Fischer, R. X.; Baur, W. H.

This document is part of Subvolume F 'Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes STO to ZON' of Volume 14 'Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV 'Physical Chemistry'.

Detection of ALK translocation in non-small cell lung carcinoma (NSCLC) and its clinicopathological significance using the Ventana immunohistochemical staining method: a single-center large-scale investigation of 1, 504 Chinese Han patients

PubMed Central

Yang, Lin; Ling, Yun; Guo, Lei; Ma, Di; Xue, Xuemin; Wang, Bingning; Li, Junling; Ying, Jianming

2016-01-01

Objective The novel fully automated immunohistochemistry (IHC) assay-Ventana anaplastic lymphoma kinase (ALK)-D5F3 for screening ALK rearrangements has been approved by China’s Food and Drug Administration in 2013, our previous study disclosed a highly specificity and sensitivity nearly 100%, and its efficacy needs to be evaluated in a large cohort of primary lung adenocarcinoma patients, and to compare clinicopathological features with ALK (+) and ALK (-) lung adenocarcinoma. Methods A total of 1,504 consecutive surgical lung adenocarcinoma cases of Chinese Han population were collected and re-diagnosed according to the 2011 multidisciplinary classification of lung adenocarcinoma. Fully automated Ventana ALK-D5F3 IHC staining with a binary scoring was adopted to evaluate staining and correlated with clinicopathological characters, including age, sex, differentiation degree, histological subtype, lymph node metastasis, and clinical staging. ALK (+) patients were followed-up, and targeted therapy of ALK-inhibitors was adopted and observed in patients with stage IV according to the NCCN guideline. Results ALK positive adenocarcinomas were identified in 6.6% of the surgically resected 1,504 NSCLCs, and significantly younger than the negative group (P<0.05).Mucinous adenocarcinoma (28.2%) was determined to be predominant in ALK (+) cases, followed by the solid type (11.7%), specific type (6.8%), papillary type (5.6%), acinar type (5.5%), and lepidic type (3.1%), and the differences were statistically significant (χ2=42.011, P<0.05). ALK (+) adenocarcinoma with lymph node metastasis (10.8%) were significantly higher than that without lymph node metastasis (4.5%) (χ2=19.809, P<0.05); and ALK (+) in phase IV (20%) was significantly higher than phase III (12.9%), phase II (4.2%), phase I (4.5%), and phase 0 (0) (χ2=36.068, P<0.05). Multivariate logistic regression disclosed that patient age, AJCC staging, and histological mucinous subtype were correlated with ALK positive staining (OR=0.959, 1.578, 5.036, respectively). Sixty eight patients had followed-up results, five patients out of which primarily diagnosed or progressed into Stage IV benefited well from targeted therapy with Crizotinib. Conclusions The ALK fusion protein was seen in 6.6% Chinese NSCLC patients, and mostly seen in younger, clinically higher staging, mucinous and solid predominant adenocarcinoma. Clinical trials in patients of Stage IV confirmed that ALK-D5F3 Ventana IHC is serviceable in screening ALK-positive candidates for molecular targeted therapy. PMID:27877008

Characterisation of methicillin-resistant Staphylococcus aureus clinical isolates from animals in New Zealand, 2012-2013, and subclinical colonisation in dogs and cats in Auckland.

PubMed

Karkaba, A; Benschop, J; Hill, K E; Grinberg, A

2017-03-01

To characterise methicillin-resistant Staphylococcus aureus (MRSA) isolates from infection sites in animals in New Zealand and assess the prevalence of subclinical MRSA colonisation in dogs and cats attending veterinary clinics in Auckland. MRSA isolates from clinical specimens obtained by the main New Zealand veterinary diagnostic laboratories between June 2012 and June 2013, were genotypically characterised by DNA microarray hybridisation analysis and spa typing. In addition, nasal or perineal skin swabs collected from a cross-sectional sample of dogs (n=361) and cats (n=225) attending 29 veterinary clinics in Auckland during the same period were analysed for MRSA by culture. Eight MRSA clinical isolates were submitted for characterisation by the participating laboratories. The isolates originated from five dogs, including two isolates from the same dog, one foal, and one isolate had no identification of the source. The strain-types identified were AK3 (ST-5 SCCmecIV t045; n=1), USA500 (ST8 SCCmecIV t064; n=1), WSPP (ST30 SCCmecIV t019; n=1), Rhine Hesse (ST5 SCCmecII t002; n=2), and EMRSA-15 (ST22 SCCmecIV t032; n=3). No MRSA were isolated from 586 cultured swabs. Methicillin-susceptible S. aureus were detected in 9/257 (3.5%) swabs and non-aureus staphylococci in 22/257 (8.5%) swabs. The estimated true MRSA subclinical colonisation prevalence was 0%, with an upper 95% CI boundary of 1.9% for cats and 1.4% for dogs. The modest number of MRSA isolates submitted for this study by the participating laboratories suggests clinical MRSA infection in animals in New Zealand continues to be sporadic. The wide variety of strain-types found mirrored the evolving strain-type diversity observed in humans. We cannot rule out bias due to the non-random sampling of dogs and cats, but the apparent colonisation prevalence of 0% was consistent with the low prevalence of subclinical colonisation in humans in New Zealand. These similarities indicate the epidemiology of animal and human MRSA infections are linked. In the last decade, the prevalence of human MRSA infections in New Zealand has steadily increased. This is the second published study of MRSA in animals in New Zealand. The results indicate clinical MRSA infection in animals remains sporadic, but the diversification of the strain-types may pose new therapeutic challenges to veterinarians, due to their diverse resistome.

Detection of ALK translocation in non-small cell lung carcinoma (NSCLC) and its clinicopathological significance using the Ventana immunohistochemical staining method: a single-center large-scale investigation of 1, 504 Chinese Han patients.

PubMed

Yang, Lin; Ling, Yun; Guo, Lei; Ma, Di; Xue, Xuemin; Wang, Bingning; Li, Junling; Ying, Jianming

2016-10-01

The novel fully automated immunohistochemistry (IHC) assay-Ventana anaplastic lymphoma kinase (ALK)-D5F3 for screening ALK rearrangements has been approved by China's Food and Drug Administration in 2013, our previous study disclosed a highly specificity and sensitivity nearly 100%, and its efficacy needs to be evaluated in a large cohort of primary lung adenocarcinoma patients, and to compare clinicopathological features with ALK (+) and ALK (-) lung adenocarcinoma. A total of 1,504 consecutive surgical lung adenocarcinoma cases of Chinese Han population were collected and re-diagnosed according to the 2011 multidisciplinary classification of lung adenocarcinoma. Fully automated Ventana ALK-D5F3 IHC staining with a binary scoring was adopted to evaluate staining and correlated with clinicopathological characters, including age, sex, differentiation degree, histological subtype, lymph node metastasis, and clinical staging. ALK (+) patients were followed-up, and targeted therapy of ALK-inhibitors was adopted and observed in patients with stage IV according to the NCCN guideline. ALK positive adenocarcinomas were identified in 6.6% of the surgically resected 1,504 NSCLCs, and significantly younger than the negative group (P<0.05).Mucinous adenocarcinoma (28.2%) was determined to be predominant in ALK (+) cases, followed by the solid type (11.7%), specific type (6.8%), papillary type (5.6%), acinar type (5.5%), and lepidic type (3.1%), and the differences were statistically significant (χ 2 =42.011, P<0.05). ALK (+) adenocarcinoma with lymph node metastasis (10.8%) were significantly higher than that without lymph node metastasis (4.5%) (χ 2 =19.809, P<0.05); and ALK (+) in phase IV (20%) was significantly higher than phase III (12.9%), phase II (4.2%), phase I (4.5%), and phase 0 (0) (χ 2 =36.068, P<0.05). Multivariate logistic regression disclosed that patient age, AJCC staging, and histological mucinous subtype were correlated with ALK positive staining (OR=0.959, 1.578, 5.036, respectively). Sixty eight patients had followed-up results, five patients out of which primarily diagnosed or progressed into Stage IV benefited well from targeted therapy with Crizotinib. The ALK fusion protein was seen in 6.6% Chinese NSCLC patients, and mostly seen in younger, clinically higher staging, mucinous and solid predominant adenocarcinoma. Clinical trials in patients of Stage IV confirmed that ALK-D5F3 Ventana IHC is serviceable in screening ALK-positive candidates for molecular targeted therapy.

New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis.

PubMed

Smith, Michael G; Gianoulis, Tara A; Pukatzki, Stefan; Mekalanos, John J; Ornston, L Nicholas; Gerstein, Mark; Snyder, Michael

2007-03-01

Acinetobacter baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections including pneumonia, meningitis, septicemia, and urinary tract infections. We explored the pathogenic content of this harmful pathogen using a combination of DNA sequencing and insertional mutagenesis. The genome of this organism was sequenced using a strategy involving high-density pyrosequencing, a novel, rapid method of high-throughput sequencing. Excluding the rDNA repeats, the assembled genome is 3,976,746 base pairs (bp) and has 3830 ORFs. A significant fraction of ORFs (17.2%) are located in 28 putative alien islands, indicating that the genome has acquired a large amount of foreign DNA. Consistent with its role in pathogenesis, a remarkable number of the islands (16) contain genes implicated in virulence, indicating the organism devotes a considerable portion of its genes to pathogenesis. The largest island contains elements homologous to the Legionella/Coxiella Type IV secretion apparatus. Type IV secretion systems have been demonstrated to be important for virulence in other organisms and thus are likely to help mediate pathogenesis of A. baumannii. Insertional mutagenesis generated avirulent isolates of A. baumannii and verified that six of the islands contain virulence genes, including two novel islands containing genes that lacked homology with others in the databases. The DNA sequencing approach described in this study allows the rapid elucidation of the DNA sequence of any microbe and, when combined with genetic screens, can identify many novel genes important for microbial pathogenesis.

Parthenium dermatitis manifesting clinically as polymorphic light eruption and prurigo nodularis- like lesions with vasculitis-like picture on histopathology

PubMed Central

Lakshmi, Chembolli; Srinivas, C. R.; Pillai, Suma B.; Shanthakumari, S.

2011-01-01

Parthenium dermatitis is a widespread and distressing dermatoses in rural and urban India caused by the air borne allergen of the Compositae weed Parthenium hysterophorus. Parthenium dermatitis has been thought to be mediated solely by type IV hypersensitivity, but recently a combined immediate (type I) and delayed (type IV) hypersensitivity mechanism has been postulated in the initiation and perpetuation of parthenium dermatitis, especially in sensitized subjects with an atopic diathesis. Initially, the exposed sites of the body are involved. Later in the course of the disease, unexposed sites may get involved. Various clinical presentations have been described in parthenium dermatitis. Typically, it presents as an air borne contact dermatitis (ABCD) involving the eyelids and nasolabial folds Other presentations include a photodermatitis (essentially a pseudo photodermatitis), atopic dermatitis, seborrheic dermatitis, exfoliative dermatitis, hand dermatitis. Photosensitive lichenoid dermatitis and prurigo nodularis are rarer presentations. Uncommon presentations have been described in parthenium dermatitis. They include prurigo nodularis-like lesions and photosensitive lichenoid eruption. Three cases are presented, two of whom presented as polymorphic-like lesions and one as prurigo nodularis. All three patch tested positive to parthenium on Day 2. Prick testing was positive in two of the three patients. Parthenium dermatitis mimicking polymorphic light eruption has not been reported. Histopathology revealed vasculitis in the lesional skin in two of the patients. Although leukocytoclastic vasculitis has been reported earlier from the prick-tested site, this is the first report demonstrating the presence of vasculitis in lesional skin of parthenium dermatitis. PMID:23130236

Juvenile pityriasis rubra pilaris: report of 28 cases in Taiwan.

PubMed

Yang, Chao-Chun; Shih, I-Hsin; Lin, Wan-Lung; Yu, Yi-Sheng; Chiu, Hsien-Ching; Huang, Po-Han; Cheng, Yu-Wen; Lee, Julia Yu-Yun; Chen, WenChieh

2008-12-01

Pityriasis rubra pilaris (PRP) is a papulosquamous dermatosis uncommon in juveniles. Large-scale studies are limited, especially from Asian countries. We sought to analyze the clinical manifestations of juvenile PRP in Taiwanese patients and compare them with reported series in the literature. The diagnosis of juvenile PRP was made based on clinical-histopathologic correlation. The therapeutic response and disease course were followed up by re-examination of the patients or by telephone. A total of 47 patients were identified, with histopathologic confirmation of the clinical diagnosis of juvenile PRP in 28 cases. A preponderance of Griffiths' type IV PRP (85.7%) rather than type III PRP (14.3%) was found. Palmoplantar hyperkeratosis appeared to be a cardinal feature. In patients with type IV PRP, skin lesions in areas other than the elbows/knees and palms/soles were common. Treatment with systemic acitretin in 6 patients failed to effect a dose- or time-dependent improvement. In contrast with other studies, two thirds of our patients with type III and IV juvenile PRP had a protracted course lasting more than 3 years. This study was a retrospective review. Patient compliance with treatment was frequently poor. Type IV juvenile PRP predominated but our cases showed a wider distribution of skin lesions than is typically described. When children present with an acute onset of diffuse palmoplantar hyperkeratosis, a diagnosis of juvenile PRP should be considered. Because of the divergent clinical manifestations of juvenile PRP in different populations, there is a need to modify and re-evaluate classification systems based on regional differences.

Alternative Neisseria spp. type IV pilin glycosylation with a glyceramido acetamido trideoxyhexose residue

PubMed Central

Chamot-Rooke, Julia; Rousseau, Benoit; Lanternier, Fanny; Mikaty, Guillain; Mairey, Emilie; Malosse, Christian; Bouchoux, Guy; Pelicic, Vladimir; Camoin, Luc; Nassif, Xavier; Duménil, Guillaume

2007-01-01

The importance of protein glycosylation in the interaction of pathogenic bacteria with their host is becoming increasingly clear. Neisseria meningitidis, the etiological agent of cerebrospinal meningitis, crosses cellular barriers after adhering to host cells through type IV pili. Pilin glycosylation genes (pgl) are responsible for the glycosylation of PilE, the major subunit of type IV pili, with the 2,4-diacetamido-2,4,6-trideoxyhexose residue. Nearly half of the clinical isolates, however, display an insertion in the pglBCD operon, which is anticipated to lead to a different, unidentified glycosylation. Here the structure of pilin glycosylation was determined in such a strain by “top-down” MS approaches. MALDI-TOF, nanoelectrospray ionization Fourier transform ion cyclotron resonance, and nanoelectrospray ionization quadrupole TOF MS analysis of purified pili preparations originating from N. meningitidis strains, either wild type or deficient for pilin glycosylation, revealed a glycan mass inconsistent with 2,4-diacetamido-2,4,6-trideoxyhexose or any sugar in the databases. This unusual modification was determined by in-source dissociation of the sugar from the protein followed by tandem MS analysis with collision-induced fragmentation to be a hexose modified with a glyceramido and an acetamido group. We further show genetically that the nature of the sugar present on the pilin is determined by the carboxyl-terminal region of the pglB gene modified by the insertion in the pglBCD locus. We thus report a previously undiscovered monosaccharide involved in posttranslational modification of type IV pilin subunits by a MS-based approach and determine the molecular basis of its biosynthesis. PMID:17804791

Plutonium Interactions with Pseudomonas sp. and its Extracellular Polymeric Substances (Sorption and Reduction of Plutonium by Bacterial Extracellular Polymeric Substances)

DOE PAGES

Boggs, Mark A.; Jiao, Yongqin; Dai, Zurong; ...

2016-09-30

Safe and effective nuclear waste disposal, as well as accidental radionuclide releases, necessitates our understanding of the fate of radionuclides in the environment, including their interaction with microorganisms. We examined the sorption of Pu(IV) and Pu(V) toPseudomonassp. strain EPS-1W, an aerobic bacterium isolated from plutonium (Pu) contaminated groundwater collected in the United States at the Nevada National Security Site (NNSS), Nevada. We compared Pu sorption to cells with and without bound extracellular polymeric substances (EPS). Wild type cells with intact EPS sorbed Pu(V) more effectively than cells with EPS removed. In contrast, cells with and without EPS showed the samemore » sorption affinity for Pu(IV).In vitroexperiments with extracted EPS revealed rapid reduction of Pu(V) to Pu(IV). Transmission Electron Microscopy indicated that 2-3 nm nanocrystalline Pu(IV)O 2formed on cells equilibrated with high concentrations of Pu(IV) but not Pu(V). Thus, EPS, while facilitating Pu(V) reduction, inhibit the formation of nanocrystalline Pu(IV) precipitates. ImportanceOur results indicate that EPS are an effective reductant for Pu(V) and sorbent for Pu(IV), and may impact Pu redox cycling and mobility in the environment. Additionally, the resulting Pu morphology associated with EPS will depend on the concentration and initial Pu oxidation state. While our results are not directly applicable to the Pu transport situation at the NNSS, the results suggest that, in general, stationary microorganisms and biofilms will tend to limit the migration of Pu and provide an important Pu retardation mechanism in the environment. In a broader sense, our results along with a growing body of literature highlight the important role of microorganisms as producers of redox-active organic ligands and therefore as modulators of radionuclide redox transformations and complexation in the subsurface.« less

Plutonium Interactions with Pseudomonas sp. and its Extracellular Polymeric Substances (Sorption and Reduction of Plutonium by Bacterial Extracellular Polymeric Substances)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boggs, Mark A.; Jiao, Yongqin; Dai, Zurong

Safe and effective nuclear waste disposal, as well as accidental radionuclide releases, necessitates our understanding of the fate of radionuclides in the environment, including their interaction with microorganisms. We examined the sorption of Pu(IV) and Pu(V) toPseudomonassp. strain EPS-1W, an aerobic bacterium isolated from plutonium (Pu) contaminated groundwater collected in the United States at the Nevada National Security Site (NNSS), Nevada. We compared Pu sorption to cells with and without bound extracellular polymeric substances (EPS). Wild type cells with intact EPS sorbed Pu(V) more effectively than cells with EPS removed. In contrast, cells with and without EPS showed the samemore » sorption affinity for Pu(IV).In vitroexperiments with extracted EPS revealed rapid reduction of Pu(V) to Pu(IV). Transmission Electron Microscopy indicated that 2-3 nm nanocrystalline Pu(IV)O 2formed on cells equilibrated with high concentrations of Pu(IV) but not Pu(V). Thus, EPS, while facilitating Pu(V) reduction, inhibit the formation of nanocrystalline Pu(IV) precipitates. ImportanceOur results indicate that EPS are an effective reductant for Pu(V) and sorbent for Pu(IV), and may impact Pu redox cycling and mobility in the environment. Additionally, the resulting Pu morphology associated with EPS will depend on the concentration and initial Pu oxidation state. While our results are not directly applicable to the Pu transport situation at the NNSS, the results suggest that, in general, stationary microorganisms and biofilms will tend to limit the migration of Pu and provide an important Pu retardation mechanism in the environment. In a broader sense, our results along with a growing body of literature highlight the important role of microorganisms as producers of redox-active organic ligands and therefore as modulators of radionuclide redox transformations and complexation in the subsurface.« less

Failure mechanisms and closed reduction of a constrained tripolar acetabular liner.

PubMed

Robertson, William J; Mattern, Christopher J; Hur, John; Su, Edwin P; Pellicci, Paul M

2009-02-01

Unlike traditional bipolar constrained liners, the Osteonics Omnifit constrained acetabular insert is a tripolar device, consisting of an inner bipolar bearing articulating within an outer, true liner. Every reported failure of the Omnifit tripolar implant has been by failure at the shell-bone interface (Type I failure), failure at the shell-liner interface (Type II failure), or failure of the locking mechanism resulting in dislocation of the bipolar-liner interface (Type III failure). In this report we present two cases of failure of the Omnifit tripolar at the bipolar-femoral head interface. To our knowledge, these are the first reported cases of failure at the bipolar-femoral head interface (Type IV failure). In addition, we described the first successful closed reduction of a Type IV failure.

Intravenous S-Ketamine Does Not Inhibit Alveolar Fluid Clearance in a Septic Rat Model

PubMed Central

Weber, Nina C.; van der Sluijs, Koen; Hackl, Florian; Hotz, Lorenz; Dahan, Albert; Hollmann, Markus W.; Berger, Marc M.

2014-01-01

We previously demonstrated that intratracheally administered S-ketamine inhibits alveolar fluid clearance (AFC), whereas an intravenous (IV) bolus injection had no effect. The aim of the present study was to characterize whether continuous IV infusion of S-ketamine, yielding clinically relevant plasma concentrations, inhibits AFC and whether its effect is enhanced in acute lung injury (ALI) which might favor the appearance of IV S-ketamine at the alveolar surface. AFC was measured in fluid-instilled rat lungs. S-ketamine was administered IV over 6 h (loading dose: 20 mg/kg, followed by 20 mg/kg/h), or intratracheally by addition to the instillate (75 µg/ml). ALI was induced by IV lipopolysaccharide (LPS; 7 mg/kg). Interleukin (IL)-6 and cytokine-induced neutrophil chemoattractant (CINC)-3 were measured by ELISA in plasma and bronchoalveolar lavage fluid. Isolated rat alveolar type-II cells were exposed to S-ketamine (75 µg/ml) and/or LPS (1 mg/ml) for 6 h, and transepithelial ion transport was measured as short circuit current (ISC). AFC was 27±5% (mean±SD) over 60 min in control rats and was unaffected by IV S-ketamine. Tracheal S-ketamine reduced AFC to 18±9%. In LPS-treated rats, AFC decreased to 16±6%. This effect was not enhanced by IV S-ketamine. LPS increased IL-6 and CINC-3 in plasma and bronchoalveolar lavage fluid. In alveolar type-II cells, S-ketamine reduced ISC by 37% via a decrease in amiloride-inhibitable sodium transport. Continuous administration of IV S-ketamine does not affect rat AFC even in endotoxin-induced ALI. Tracheal application with direct exposure of alveolar epithelial cells to S-ketamine decreases AFC by inhibition of amiloride-inhibitable sodium transport. PMID:25386677

Two-View Gravity Stress Imaging Protocol for Nondisplaced Type II Supination External Rotation Ankle Fractures: Introducing the Gravity Stress Cross-Table Lateral View.

PubMed

Boffeli, Troy J; Collier, Rachel C; Gervais, Samuel J

Assessing ankle stability in nondisplaced Lauge-Hansen supination external rotation type II injuries requires stress imaging. Gravity stress mortise imaging is routinely used as an alternative to manual stress imaging to assess deltoid integrity with the goal of differentiating type II from type IV injuries in cases without a posterior or medial fracture. A type II injury with a nondisplaced fibula fracture is typically treated with cast immobilization, and a type IV injury is considered unstable and often requires operative repair. The present case series (two patients) highlights a standardized 2-view gravity stress imaging protocol and introduces the gravity stress cross-table lateral view. The gravity stress cross-table lateral view provides a more thorough evaluation of the posterior malleolus owing to the slight external rotation and posteriorly directed stress. External rotation also creates less bony overlap between the tibia and fibula, allowing for better visualization of the fibula fracture. Gravity stress imaging confirmed medial-sided injury in both cases, confirming the presence of supination external rotation type IV or bimalleolar equivalent fractures. Open reduction and internal fixation was performed, and both patients achieved radiographic union. No further treatment was required at 21 and 33 months postoperatively. Copyright © 2017 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

Genetics of Lesch's typology of alcoholism.

PubMed

Samochowiec, Jerzy; Kucharska-Mazur, Jolanta; Grzywacz, Anna; Pelka-Wysiecka, Justyna; Mak, Monika; Samochowiec, Agnieszka; Bienkowski, Przemyslaw

2008-02-15

It is widely accepted that dopamine and serotonin (5-HT) neurotransmission can be critically involved in the development of alcohol abuse and alcohol dependence. Lesch's typology of alcoholism has been gaining increasing popularity as it qualitatively differentiates patients into different treatment response subgroups. The aim of the present study was to evaluate a possible genetic background of Lesch's typology with special emphasis placed on dopamine- and serotonin-related genes. 122 alcoholics (the mean age: 35+/-9 years) were investigated. According to Lesch's typology, 58 patients were of type I, 36 patients of type II, 11 patients of type III, and 17 patients of type IV. Alcohol drinking and family history was assessed by means of a structured interview, based on the Semi-Structured Assessment for the Genetics of Alcoholism. 150 control subjects without psychiatric disorders were also recruited. The control group was ethnically-, age- and gender-matched to the patients. The DRD2 TaqIA, exon 8, and promoter -141C ins/del polymorphisms as well as COMT Val158Met, 5HTT 44 bp del in promoter, and DAT 40 bp VNTR polymorphisms were detected by means of PCR. No significant differences were observed when the whole group of alcoholics and the controls were compared. Similarly, there were no differences between either the Lesch type I or type II alcoholics and the control subjects. No significant differences were observed between type I and type II alcoholics. Alleles frequencies were not calculated for the Lesch type III and type IV alcoholics since the number of patients was too small. The present results argue against any major role of the investigated polymorphisms in either Lesch type I or type II alcoholism. More comprehensive studies are needed to define the role of the investigated polymorphisms in Lesch type III and type IV alcoholism.

Mechanisms and implications of a type IV functional response for short-term intake rate of dry matter in large mammalian herbivores.

PubMed

Mezzalira, Jean C; Bonnet, Olivier J F; Carvalho, Paulo C de F; Fonseca, Lidiane; Bremm, Carolina; Mezzalira, Carlos C; Laca, Emilio A

2017-09-01

The functional response (i.e. the relationship between consumers' intake rate and resource density) is central in plant-herbivore interactions. Its shape and the biological processes leading to it have significant implications for both foraging theory and ecology of grazing systems. A type IV functional response (i.e. dome-shaped relationship) of short-term intake rate of dry matter (intake while grazing) has rarely been reported for large herbivores and the conditions that can lead to it are poorly understood. We report a type IV functional response observed in heifers grazing monocultures of Cynodon sp. and Avena strigosa. The mechanisms and consequences of this type of functional response for grazed system dynamics are discussed. Intake rate was higher at intermediate than at short or tall sward heights in both grass species. The type IV functional response resulted from changes in bite mass instead of a longer time needed to encounter and process bites. Thus, the decrease of intake rate of dry matter in tall swards is not explained by a shift from process 3 (potential bites are concentrated and apparent) to process 2 (potential bites are apparent but dispersed, Spalinger & Hobbs 1992). Bite mass was smaller in tall than in intermediate swards due to a reduction of bite volume possibly caused by the greater proportion of stem and sheath acting as a physical barrier to bite formation. It is generally accepted that potential bites are abundant and apparent in most grassland and meadow systems, as they were in the present experiments. Therefore, a type IV response of intake rate not directly related to digestive constraints may determine the dynamics of intake and defoliation under a much larger set of conditions than previously thought. These results have implications for foraging theory and stability of grazing systems. For example, if animals prefer patches of intermediate stature that yield the highest intake rate, grazing should lead to the widely observed bimodal distribution of plant mass per unit area, even when tall patches are not of significantly lower digestive quality than the pasture average. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

Effects of Different Fabrication Techniques on the Yttrium-Barium-Copper Oxide High Temperature Superconductor

DTIC Science & Technology

1988-12-01

and barium peroxide. The eperimental design includes barium carbonate as a precursor since it is a comronly used starting material for the ccupound...Kerans, Materials Laboratory, for his assistance in designing this project. I would also like to thank Tim Peterson for his patient instructing. I...the design of the devices used for taking measurements was detailed. Chapter IV showed the results of each type of measurement on each individual

Slope Stability of Geosynthetic Clay Liner Test Plots

EPA Science Inventory

Fourteen full-scale field test plots containing five types of geosynthetic clay liners (GCLs) were constructed on 2H:IV and 3H:IV slopes for the purpose of assessing slope stability. The test plots were designed to simulate typical final cover systems for landfill. Slides occurr...

Hospitalization Costs for Patients Undergoing Orthopedic Surgery Treated With Intravenous Acetaminophen (IV-APAP) Plus Other IV Analgesics or IV Opioid Monotherapy for Postoperative Pain.

PubMed

Maiese, Brett A; Pham, An T; Shah, Manasee V; Eaddy, Michael T; Lunacsek, Orsolya E; Wan, George J

2017-02-01

To assess the impact on hospitalization costs of multimodal analgesia (MMA), including intravenous acetaminophen (IV-APAP), versus IV opioid monotherapy for postoperative pain management in patients undergoing orthopedic surgery. Utilizing the Truven Health MarketScan ® Hospital Drug Database (HDD), patients undergoing total knee arthroplasty (TKA), total hip arthroplasty (THA), or surgical repair of hip fracture between 1/1/2011 and 8/31/2014 were separated into postoperative pain management groups: MMA with IV-APAP plus other IV analgesics (IV-APAP group) or an IV opioid monotherapy group. All patients could have received oral analgesics. Baseline characteristics and total hospitalization costs were compared. Additionally, an inverse probability treatment weighting [IPTW] with propensity scores analysis further assessed hospitalization cost differences. The IV-APAP group (n = 33,954) and IV opioid monotherapy group (n = 110,300) differed significantly (P < 0.0001) across baseline characteristics, though the differences may not have been clinically meaningful. Total hospitalization costs (mean ± standard deviation) were significantly lower for the IV-APAP group than the IV opioid monotherapy group (US$12,540 ± $9564 vs. $13,242 ± $35,825; P < 0.0001). Medical costs accounted for $701 of the $702 between-group difference. Pharmacy costs were similar between groups. Results of the IPTW-adjusted analysis further supported the statistically significant cost difference. Patients undergoing orthopedic surgery who received MMA for postoperative pain management, including IV-APAP, had significantly lower total costs than patients who received IV opioid monotherapy. This difference was driven by medical costs; importantly, there was no difference in pharmacy costs. Generalizability of the results may be limited to patients admitted to hospitals similar to those included in HDD. Dosing could not be determined, so it was not possible to quantify utilization of IV-APAP or ascertain differences in opioid consumption between the 2 groups. This study did not account for healthcare utilization post-discharge.

75 FR 26747 - Meadow Lake Wind Farm IV LLC; Supplemental Notice That Initial Market-Based Rate Filing Includes...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-12

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. ER10-1177-000] Meadow Lake Wind Farm IV LLC; Supplemental Notice That Initial Market-Based Rate Filing Includes Request for... proceeding of Meadow Lake Wind Farm IV LLC's application for market-based rate authority, with an...

The dependence of C IV broad absorption line properties on accompanying Si IV and Al III absorption: relating quasar-wind ionization levels, kinematics, and column densities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Filiz Ak, N.; Brandt, W. N.; Schneider, D. P.

2014-08-20

We consider how the profile and multi-year variability properties of a large sample of C IV Broad Absorption Line (BAL) troughs change when BALs from Si IV and/or Al III are present at corresponding velocities, indicating that the line of sight intercepts at least some lower ionization gas. We derive a number of observational results for C IV BALs separated according to the presence or absence of accompanying lower ionization transitions, including measurements of composite profile shapes, equivalent width (EW), characteristic velocities, composite variation profiles, and EW variability. We also measure the correlations between EW and fractional-EW variability for Cmore » IV, Si IV, and Al III. Our measurements reveal the basic correlated changes between ionization level, kinematics, and column density expected in accretion-disk wind models; e.g., lines of sight including lower ionization material generally show deeper and broader C IV troughs that have smaller minimum velocities and that are less variable. Many C IV BALs with no accompanying Si IV or Al III BALs may have only mild or no saturation.« less

Bone structure assessed by HR-pQCT, TBS and DXL in adult patients with different types of osteogenesis imperfecta.

PubMed

Kocijan, R; Muschitz, C; Haschka, J; Hans, D; Nia, A; Geroldinger, A; Ardelt, M; Wakolbinger, R; Resch, H

2015-10-01

Bone microarchitecture by high-resolution peripheral quantitative computed tomography (HR-pQCT) was assessed in adult patients with mild, moderate, and severe osteogenesis imperfecta (OI). The trabecular bone score (TBS), bone mineral density (BMD) by dual-energy X-ray absorptiometry (DXA), and dual X-ray and laser (DXL) at the calcaneus were likewise assessed in patients with OI. Trabecular microstructure and BMD in particular were severely altered in patients with OI. OI is characterized by high fracture risk but not necessarily by low BMD. The main purpose of this study was to assess bone microarchitecture and BMD at different skeletal sites in different types of OI. HR-pQCT was performed in 30 patients with OI (mild OI-I, n = 18 (41.8 [34.7, 55.7] years) and moderate to severe OI-III-IV, n = 12 (47.6 [35.3, 58.4] years)) and 30 healthy age-matched controls. TBS, BMD by DXA at the lumbar spine and hip, as well as BMD by DXL at the calcaneus were likewise assessed in patients with OI only. At the radius, significantly lower trabecular parameters including BV/TV (p = 0.01 and p < 0.0001, respectively) and trabecular number (p < 0.0001 and p < 0.0001, respectively) as well as an increased inhomogeneity of the trabecular network (p < 0.0001 and p < 0.0001, respectively) were observed in OI-I and OI-III-IV in comparison to the control group. Similar results for trabecular parameters were found at the tibia. Microstructural parameters were worse in OI-III-IV than in OI-I. No significant differences were found in cortical thickness and cortical porosity between the three subgroups at the radius. The cortical thickness of the tibia was thinner in OI-I (p < 0.001), but not OI-III-IV, when compared to controls. Trabecular BMD and trabecular bone microstructure in particular are severely altered in patients with clinical OI-I and OI-III-IV. Low TBS and DXL and their significant associations to HR-pQCT parameters of trabecular bone support this conclusion.

Clinical experience with pantoprazole in gastroesophageal reflux disease.

PubMed

Avner, D L

2000-10-01

Pantoprazole is a new proton pump inhibitor indicated for the treatment of erosive esophagitis associated with gastroesophageal reflux disease (GERD) and is available in both oral and intravenous (IV) formulations. This paper reviews the pharmacologic properties of pantoprazole and summarizes the findings from clinical studies of this drug. This review was compiled from the published literature, abstracts from clinical trials, and data on file with the manufacturer of pantoprazole. Pantoprazole selectively accumulates in the acidic environment of gastric parietal cells and acts at the final step of acid secretion by binding 2 key cysteine residues of the proton pump involved in gastric acid production. The bioavailability of pantoprazole is not altered by concomitant administration of food or antacids or with repeated dosing. Both oral and IV formulations of pantoprazole exhibit linear pharmacokinetics. Several clinical trials have proved pantoprazole superior to histamine-2-receptor antagonists (H2RAs) in reducing acid secretion and elevating gastric pH levels. Pantoprazole has been shown to be more effective than ranitidine (P < 0.05), famotidine (P < 0.001), and nizatidine (P < 0.05), and at least as effective as omeprazole, in healing erosive esophagitis and relieving associated symptoms of GERD, including regurgitation. Pantoprazole is also more effective than the H2RA nizatidine for the treatment of nighttime heartburn (P < 0.05). Studies have shown pantoprazole to be well tolerated; adverse events, including headache, diarrhea, flatulence, abdominal pain, eructation, nausea, and rash, occurred in < or = 6% of patients. The oral and IV formulations of pantoprazole are equally potent in inhibiting gastric acid secretion; thus, switching between formulations requires no dosage adjustments. Special patient populations, including the elderly and patients with renal or mild to moderate hepatic impairment, can take pantoprazole without an adjustment in dosage. Because of its unique pharmacokinetic properties, mechanism of action, and reduced potential for producing cytochrome P-450-based drug interactions, pantoprazole in both oral and IV formulations is effective over a full 24 hours and is well tolerated in a variety of patient types.

Prevalence and characteristics of patients with metastatic cancer who receive no anticancer therapy.

PubMed

Small, Alexander C; Tsao, Che-Kai; Moshier, Erin L; Gartrell, Benjamin A; Wisnivesky, Juan P; Godbold, James H; Smith, Cardinale B; Sonpavde, Guru; Oh, William K; Galsky, Matthew D

2012-12-01

A subset of patients who present with metastatic solid tumors never receive anticancer therapy. Reasons may include poor functional status, comorbidities, and patient preference. To the authors' knowledge, the prevalence and characteristics of this population have not previously been described. The National Cancer Data Base was queried for patients diagnosed with metastatic (stage IV according to the American Joint Committee on Cancer) solid tumors (including those of the breast, cervix, colon, and kidney; small cell and nonsmall cell lung cancer [NSCLC]; and tumors of the prostate, rectum, and uterus) who received neither radiotherapy nor systemic therapy. Log-binomial regression analysis was used to estimate prevalence ratios (PRs) for the percentage of untreated to treated patients with stage IV cancer. Between 2000 and 2008, 773,233 patients with stage IV cancer were identified, 159,284 of whom (20.6%; 95% confidence interval, 20.5%-20.7%) received no anticancer therapy. Patients with NSCLC accounted for 55% of the untreated population. Patients with cancers of the kidney and lung had the highest rates of no treatment at 25.5% and 24.0%, respectively, whereas patients with prostate cancer had the lowest rate of no treatment at 11.1%. Across all cancer types, older age (PR range, 1.37-1.49; all P < .001), black race (PR range, 1.05-1.32; all P < .001), lack of medical insurance (PR range, 1.47-2.46; all P < .001), and lower income (except for cancer of the uterus; PR range, 0.91-0.98 for every $10,000-increase in income [all P < .001]) were associated with a lack of treatment. Approximately 20% of patients who present with stage IV solid tumors do not receive anticancer therapy. Although there are likely multiple reasons for this lack of treatment, including appropriate indications, these findings have potential implications with regard to health care policy and access to care. Copyright © 2012 American Cancer Society.

Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

PubMed

Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

2002-06-01

Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

Diagnostic efficiency of amylase and type IV collagen in predicting chronic pancreatitis.

PubMed

Das, Subir Kumar; Varadhan, Sowmya; Dhanya, L; Mukherjee, Sukhes; Mohana, S; Balakrishnan, V; Vasudevan, D M

2009-01-01

Chronic pancreatitis, an irreversible inflammatory disease of the pancreas, is associated with the replacement of the destroyed parenchyma by extended development of fibrosis. Despite marked progress in diagnostic tools, no consensus has been reached in diagnosis of chronic pancreatitis. In this study we examined the hematological and biochemical parameters among 40 chronic pancreatitis patients within 18 to 67 yrs. ESR level and ALP activity was elevated in 40% cases. Serum amylase activity increased in 32 patients and it showed significant correlation with ALP (r=0.458, p=0.003), CA-19.9 (r=0.556, p<0.001), and calcium level (r=-0.472, p=0.002). Type IV collagen level in chronic pancreatitis also elevated (164.4 ± 55.5 ng/ml) and showed negative significant correlation with calcium level (r= -0.505, p=0.001). However, no significant correlation was observed between amylase activity and type IV collagen (r=0.289, p= 0.07).

Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae

PubMed Central

2011-01-01

Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail. PMID:21489243

Effect of microwave disinfection on compressive and tensile strengths of dental stones.

PubMed

Robati Anaraki, Mahmood; Moslehifard, Elnaz; Aminifar, Soran; Ghanati, Hamed

2013-01-01

Although microwave irradiation has been used for disinfection of dental stone casts, there are concerns regarding mechanical damage to casts during the process. The aim of this study was to evaluate the effect of microwave irradiation on the compressive strength (CS) and diametral tensile strength (DTS) of stone casts. In this in vitro study, 80 cylindrical type III and IV stone models (20 × 40 mm) were prepared and divided into 8 groups of 10. The DTS and CS of the specimens were measured by a mechanical testing machine at a crosshead speed of 0.5 cm/min after 7 times of frequent wetting, irradiating at an energy level of 600 W for 3 minutes and cooling. Data were analyzed by Student's t-test. Microwave irradiation significantly increased DTS of type III and IV to 5.23 ± 0.64 and 8.17 ± 0.94, respectively (P < 0.01). According to the results, microwave disinfection increases DTS of type III and IV stone casts without any effects on their CS.

Identification of another module involved in the horizontal transfer of the Haemophilus genomic island ICEHin1056.

PubMed

Juhas, Mario; Dimopoulou, Ioanna; Robinson, Esther; Elamin, Abdel; Harding, Rosalind; Hood, Derek; Crook, Derrick

2013-09-01

A significant part of horizontal gene transfer is facilitated by genomic islands. Haemophilus influenzae genomic island ICEHin1056 is an archetype of a genomic island that accounts for pandemic spread of antibiotics resistance. ICEHin1056 has modular structure and harbors modules involved in type IV secretion and integration. Previous studies have shown that ICEHin1056 encodes a functional type IV secretion system; however, other modules have not been characterized yet. Here we show that the module on the 5' extremity of ICEHin1056 consists of 15 genes that are well conserved in a number of related genomic islands. Furthermore by disrupting six genes of the investigated module of ICEHin1056 by site-specific mutagenesis we demonstrate that in addition to type IV secretion system module, the investigated module is also important for the successful conjugal transfer of ICEHin1056 from donor to recipient cells. Copyright © 2013 Elsevier Inc. All rights reserved.

Gluteo-vaginal sinus formation complicating posterior intravaginal slingplasty followed by successful IVS removal. A case report and review of the literature.

PubMed

Mikos, Themistoklis; Tsalikis, Tryfon; Papanikolaou, Alexios; Pournaropoulos, Fotios; Bontis, John N

2008-03-01

Posterior intravaginal slingplasty (IVS) is a technique used for the treatment of apical prolapse. Type III meshes have been mostly used with this technique. In this article, a case of bilateral gluteo-vaginal sinus tract formation that complicated a posterior vaginal slingplasty with a type III mesh is presented. At 3 months follow-up, the patient complained for bulking through the vagina, continuous offensive vaginal discharge, and constant pain at the buttocks. She had prolapse recurrence, and there was defective healing at the gluteal entry points of the posterior IVS. Ten months after the initial surgery, she underwent a laparotomic subtotal hysterectomy and sacrocervicopexy with prolene type I mesh. At the same time, the posterior mesh was removed allowing the surgeon to discover communication of the canal of the mesh extending from gluteal incisions to the vagina epithelium. The sinus tract was managed surgically with excision of the surrounding tissues. There was no recurrence or other complications at 2 months follow-up.

Right ventricular and pulmonary arterial dimensions in adults with osteogenesis imperfecta.

PubMed

Radunovic, Zoran; Wekre, Lena L; Steine, Kjetil

2012-06-15

We examined right ventricular (RV) and ascending pulmonary artery (PA1) dimensions in adults with osteogenesis imperfecta (OI). The survey included 99 adults with OI divided in 3 clinical types (I, III, and IV) and 52 controls. RV and PA1 dimensions were measured by echocardiography and indexed for body surface area. Scoliosis was registered, and spirometry was performed in 75 patients with OI. All RV dimensions indexed by body surface area were significantly larger in the OI group compared to controls (RV basal dimension 1.9 ± 0.5 vs 1.7 ± 0.3 cm/m(2), p <0.05; RV midcavity dimension 1.7 ± 0.5 vs 1.5 ± 0.3 cm/m(2), p <0.05; RV longitudinal dimension 4.3 ± 1.1 vs 4.0 ± 0.9 cm/m(2), p <0.05). RV outflow tract (RVOT) proximal diameter (1.8 ± 0.4 vs 1.5 ± 0.2 cm/m(2), p <0.05), RVOT distal diameter (1.2 ± 0.2 vs 1.0 ± 0.1 cm/m(2), p <0.05), and PA1 (1.2 ± 0.3 vs 1.0 ± 0.2 cm/m(2), p <0.05) were also significantly larger in the OI group. Furthermore, all RV dimensions and PA1 were significantly larger in patients with OI type III compared to patients with OI types I and IV and controls. There were no differences in RV, RVOT, or PA1 dimensions between patients presenting a restrictive ventilatory pattern (n = 11) and patients a normal ventilatory pattern. Scoliosis was registered in 42 patients. Patients with OI type III had greater RV and PA1 dimensions compared to controls and patients with OI types I and IV. Impaired ventilatory patterns and scoliosis did not have any impact on RV dimensions in these patients. In conclusion, patients with OI had increased RV and PA1 dimensions compared to the control group. Copyright © 2012 Elsevier Inc. All rights reserved.

Pharmacokinetics of cotinine in rats: a potential therapeutic agent for disorders of cognitive function

PubMed Central

Li, Pei; Beck, Wayne D.; Callahan, Patrick M.; Terry, Alvin V.; Bartlett, Michael G.

2016-01-01

Background Attention has been paid to cotinine (COT), one of the major metabolites of nicotine (NIC), for its pro-cognitive effects and potential therapeutic activities against Alzheimer's Disease (AD) and other types of cognitive impairment. In order to facilitate pharmacological and toxicological studies on COT for its pro-cognitive activities, we conducted a pharmacokinetic (PK) study of COT in rats, providing important oral and intravenously (IV) PK information. Methods In this study, plasma samples were obtained up to 48 hours after COT was dosed to rats orally and IV at a dose of 3 mg/kg. Plasma samples were prepared and analyzed using a sensitive liquid chromatography tandem mass spectrometry (LC-MS/MS) bioanalytical method, providing concentration profiles of COT and metabolites after oral and IV administrations. Results The data were fitted into a one-compartment model and a two-compartment model for the oral and IV groups, respectively, providing important PK information for COT including PK profiles, half-life, clearance and bioavailability. The results suggested fast absorption, slow elimination and high bioavailability of COT in rats. Conclusions Several important facts about the PK properties in rats suggested COT could be a potential pro-cognitive agent. Information about the pharmacokinetics of COT in rats revealed in this study is of great importance for the future studies on COT or potential COT analogues as agents for improving cognition. PMID:25933960

Clinical Outcomes and Complications Associated with Fractional Lasers: A Review of 730 Patients.

PubMed

Cohen, Steven R; Goodacre, Ashley; Lim, Soobin; Johnston, Jennifer; Henssler, Cory; Jeffers, Brian; Saad, Ahmad; Leong, Tracy

2017-02-01

Fractional lasers were introduced to provide increased safety, while maintaining high efficacy and patient satisfaction. Patients with virtually all Fitzpatrick skin types could be safely treated using a wide spectrum of wavelengths and a broad array of skin conditions, and aging could be addressed. Although safety studies have been reported for ablative CO 2 and erbium lasers, surprisingly few data are available on adverse events and complications associated with fractional lasers. We report the frequency of adverse events, skin improvement and complications in a broad range of skin types using a standardized protocol that can be safely tailored to the patient's presenting complaints by varying the laser wavelength and number of treatments. The medical records of 730 patients (>90% females, age ranged from 50.5. to 59.9 years.) who had been treated at FACES+ Aesthetic Facility were reviewed. Patients were followed from 1 to 10 months and were reviewed to determine the frequency of complications, as well as their frequency, type, cause, treatment and resolution thereof. Patients were categorized by Fitzpatrick skin type (I-IV) to determine whether skin type was related to the frequency of complications. Improvement in skin condition (wrinkles, nasolabial folds and pigment) was rated by a technician before and after treatment using a Likert scale, 0-5, with 0 being no change and 5 being the most improvement. Seven hundred thirty patients underwent procedures using fractional lasers in our center. Procedures were carried out with 3 different laser wavelengths, depending on the condition(s) treated (wrinkling vs. pigmentation issues, etc.) and the patients' desired length of downtime. The fractional Fraxel 1927-nm laser was used in 224 patients [Fitzpatrick skin type I (2.2%), II (38.4%), III (46.0%), IV (12.5%)]; the fractional Fraxel 1550-nm laser was used in 334 [type I (4.5%), II (31.9%), III (50.0%), IV (13.3%)], and the fractional Fraxel CO 2 laser was used in 172 [type 1 (4.7%), II (49.7%), III (41.5%), IV (4.1%)]. The Fraxel CO 2 laser showed greater improvement in wrinkles and naso-labial fold (p < 0.001). The greatest improvement in pigmentation was seen with the Fraxel 1927-nm laser (p < 0.001). Adverse events and complications occurred in 31 of 730 patients (4.2%). There was no significant difference in the rate of complications among the three treatments (p = 0.26). Complications were generally minor, and all resolved completely with treatment. Complications occurred in 4.0% of patients having the fractional Fraxel 1927-nm laser, 3.3% of patients having the fractional Fraxel 1550 nm and 6.4% of patients having the fractional Fraxel CO 2 laser. Complications included 5 herpes simplex virus breakouts, 13 acne eruptions, 1 abrasion, 1 bacterial infection, 9 dermatitis, 1 drug eruption, 4 prolonged erythema, 1 hyperpigmentation, 1 increased swelling and 1 telangiectasia. There was no significant relationship between Fitzpatrick skin type and incidence of complications (p = 0.37). Fractional lasers in general have reduced complication rates, while maintaining high degrees of patient satisfaction. Since their inception in early 2004, our clinic has utilized fractional lasers to treat patients from a variety of ethnic backgrounds and diverse skin types with an overall complication rate of 4.2%, all of which resolved. Comprehensive care of patients with facial aging is not limited to surgery alone and should include these types of strategies to appropriately and safely address photo-damage and photo-aging. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

Tricuspid valve replacement: postoperative and long-term results.

PubMed

Van Nooten, G J; Caes, F; Taeymans, Y; Van Belleghem, Y; François, K; De Bacquer, D; Deuvaert, F E; Wellens, F; Primo, G

1995-09-01

A series of 146 consecutive patients who underwent tricuspid valve replacement at the University Brugmann Hospital between 1967 and 1987 was reviewed. Mean age at operation was 51.4 years (+/- 12.1 years). Different types of prostheses were implanted including porcine and bovine pericardial bioprostheses and older and bileaflet mechanical valves. Most patients were severely disabled by their cardiac disease before operation, with 30.1% in New York Heart Association functional class III and 69.9% in class IV. Operative mortality and hospital mortality rates (30 days) were high (16.4%). Incremental risk factors for hospital death included icterus (p < 0.005), preoperative hepatomegaly (p = 0.012), and New York Heart Association functional class IV (p = 0.013). Multivariate analysis only selected preoperative icterus (p < 0.01) as being independently significantly related to hospital mortality. The hospital survivors were followed up for a median of 94 months. A complete follow-up was available for all patients except two for 30 months or more. At 30 months the only two significant parameters were the type of myocardial protection (p = 0.024) and the year of operation (before 1977 or after [precardioplegia era or after], p = 0.011). There were 70 late deaths during the entire follow-up period. The univariate (log-rank statistics) incremental risk factor for late death was the type of tricuspid prosthesis (Smeloff-Cutter and Kay-Shiley versus St. Jude Medical versus bioprosthesis) (p = 0.04). A trend was observed for the type of operative myocardial protection (normothermia and coronary perfusion) (p = 0.06) and preoperative New York Heart Association functional class IV (p = 0.055). Actuarial survival was 74% at 60 months and 23.4% at 180 months. Cumulative follow-up added up to 1015 patient-years. In a more detailed analysis of the effect on survival of the type of tricuspid prosthesis, a significant difference was observed between the bioprostheses and some older mechanical prostheses (Smeloff-Cutter and Kay-Shiley) (p = 0.04) but not between the bioprostheses and the bileaflet valves (p = 0.15). When the follow-up period was stratified according to less than 7 years and more than 7 years of follow-up, no difference was observed for the first period, but for the late follow-up the new mechanical prostheses did better than the bioprostheses (p = 0.05), suggesting a degradation of the bioprostheses after 7 years and favoring mechanical prostheses for those patients with a good long-term prognosis.

Transarterial treatment with Onyx of Cognard type IV anterior cranial fossa dural arteriovenous fistulas.

PubMed

Li, Chuanhui; Wu, Zhongxue; Yang, Xinjian; Li, Youxiang; Jiang, Chuhan; He, Hongwei

2014-03-01

Cognard type IV anterior cranial fossa dural arteriovenous fistulas (DAVFs) are rare lesions with a high risk of intracranial hemorrhage. We present our experience with the use of Onyx via the arterial route in these aggressive lesions. Between October 2009 and October 2011, six consecutive patients diagnosed with Cognard type IV anterior cranial fossa DAVFs were treated transarterially with Onyx in our department. All patients were male; mean age was 55 years (range 38-68). Four patients presented with intracranial hemorrhage as the initial manifestation; one patient presented with seizures at the time of diagnosis and experienced intracranial hemorrhage during the antiepileptic therapy; and the other patient was asymptomatic. In five patients, complete obliteration was achieved with transarterial Onyx injection in a single treatment session; in the remaining patient, subtotal occlusion was achieved and gamma knife treatment was followed. The average time of injection was 19 min (range 5-28) for every pedicle catheterized and the average amount of Onyx was 3.2 ml (range 0.4-6.3) for each lesion. All patients recovered uneventfully after embolization. No mortality or permanent morbidity was observed in this series. Follow-up digital subtraction or MR angiography confirmed durable obliteration of the fistulas in five cured cases. No patients suffered intracranial hemorrhage during the follow-up period. In this small series, our experience with the use of Onyx for arterial embolization of Cognard type IV DAVFs is encouraging, with durable complete cure in most lesions without severe complications.

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2012 CFR

2012-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2011 CFR

2011-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2013 CFR

2013-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

43 CFR 10005.19 - Decision factors.

Code of Federal Regulations, 2014 CFR

2014-10-01

... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

Standard-Cell, Open-Architecture Power Conversion Systems

DTIC Science & Technology

2005-10-01

TLmax Maximum junction temperature 423 OK Table 5. 9. PEBB average model description in VTB. Terminal Type Name - 4 -, A Power DC Bus + B Power AC Pole...5 A. Switching models ........................................................................................ 5 B. Average ...11-6 IV. Average Modeling of PEBB-Based Converters...................................................... 11-10 0 IV. 1.Voltage

Vorinostat and Azacitidine in Treating Patients With Locally Recurrent or Metastatic Nasopharyngeal Cancer or Nasal Natural Killer T-Cell Lymphoma

ClinicalTrials.gov

2018-04-20

Adult Nasal Type Extranodal NK/T-Cell Lymphoma; Recurrent Nasopharyngeal Keratinizing Squamous Cell Carcinoma; Recurrent Nasopharyngeal Undifferentiated Carcinoma; Stage IV Nasopharyngeal Keratinizing Squamous Cell Carcinoma AJCC v7; Stage IV Nasopharyngeal Undifferentiated Carcinoma AJCC v7

Effects of intravenous delivery systems on infused red blood cells.

PubMed

Gibson, J S; Leff, R D; Roberts, R J

1984-03-01

The effects of various intravenous delivery systems on the integrity of infused red blood cells (RBCs) were studied. Using a factorial design, whole blood and packed RBCs were infused through i.v. delivery systems employing various combinations of i.v. tubing diameter and length, needle gauge, infusion rate (5 and 50 ml/hr), type of infusion pump (piston, diaphragm, or peristaltic operation), and type of blood product. The age and temperature of the blood filter used were held constant. A 5-ml sample of the blood product obtained during each experimental run was analyzed for plasma free-hemoglobin to assess the degree of hemolysis. Osmotic fragility of the RBCs was evaluated by measuring the percentage of hemolysis in the blood products in various concentrations of sodium chloride solution. Type of blood product and i.v. pump were the only variables significantly influencing RBC hemolysis. In both blood products, a greater degree of hemolysis occurred with the peristaltic-type pump than with the other types of pumps. In packed RBCs, the diaphragm-type pump produced greater hemolysis than the piston-type pump, but hemolysis was similar in whole-blood samples. Regardless of the type of pump, more hemolysis occurred in whole blood at the 5-ml/hr infusion rate than at the 50-ml/hr rate, but the converse was true in packed RBCs. Samples of both blood products were less osmotically fragile than their respective controls at sodium chloride concentrations ranging from 0.30 to 0.50%.(ABSTRACT TRUNCATED AT 250 WORDS)

Renal tubular acidosis type IV in hyperkalaemic patients--a fairy tale or reality?

PubMed

Haas, Christian S; Pohlenz, Inga; Lindner, Ulrich; Muck, Philip M; Arand, Jovana; Suefke, Sven; Lehnert, Hendrik

2013-05-01

Hyperkalaemia is a common feature in hospitalized patients and often attributed to drugs antagonizing the renin-angiotensin-aldosterone system (RAAS) and/or acute kidney injury (AKI), despite significantly preserved glomerular filtration rate (GFR). The objective of this study was to determine the prevalence and role of renal tubular acidosis type IV (RTA IV) in the development of significant hyperkalaemia. A single-centre retrospective study. Patients admitted to a University Hospital over 12 months. Patients with a potassium value > 6·0 mm were identified. Clinical and laboratory data were revisited, and patients with a normal anion gap metabolic acidosis were evaluated for the existence of RTA IV. A total of 57 patients having significant hyperkalaemia (>6·0 mm) were identified. Twelve patients had end-stage renal disease, while 21 patients had solely AKI or progressive chronic renal failure. RTA IV was present in 24 patients (42%), of whom 71% had pre-existing renal insufficiency because of diabetic nephropathy or tubulointerstitial nephritis. All hyperkalaemic patients with urinary/serum electrolytes suggestive of RTA IV had evidence of AKI, but creatinine levels were significantly lower (P < 0·05), while the number of drugs antagonizing the RAAS was comparable. We demonstrated that RTA IV (i) is very common in patients with hyperkalaemia; (ii) should always be suspected in hyperkalaemic patients with only moderately impaired GFR; and (iii) may result in significant hyperkalaemia in the presence of both AKI and drugs antagonizing the RAAS. © 2012 Blackwell Publishing Ltd.

A Comprehensive Functional Analysis of NTRK1 Missense Mutations Causing Hereditary Sensory and Autonomic Neuropathy Type IV (HSAN IV).

PubMed

Shaikh, Samiha S; Chen, Ya-Chun; Halsall, Sally-Anne; Nahorski, Michael S; Omoto, Kiyoyuki; Young, Gareth T; Phelan, Anne; Woods, Christopher Geoffrey

2017-01-01

Hereditary sensory and autonomic neuropathy type IV (HSAN IV) is an autosomal recessive disorder characterized by a complete lack of pain perception and anhidrosis. Here, we studied a cohort of seven patients with HSAN IV and describe a comprehensive functional analysis of seven novel NTRK1 missense mutations, c.1550G >A, c.1565G >A, c.1970T >C, c.2096T >C, c.2254T >A, c.2288G >C, and c.2311C >T, corresponding to p.G517E, p.G522E, p.L657P, p.I699T, p.C752S, p.C763S, and p.R771C, all of which were predicted pathogenic by in silico analysis. The results allowed us to assess the pathogenicity of each mutation and to gain novel insights into tropomyosin receptor kinase A (TRKA) downstream signaling. Each mutation was systematically analyzed for TRKA glycosylation states, intracellular and cell membrane expression patterns, nerve growth factor stimulated TRKA autophosphorylation, TRKA-Y496 phosphorylation, PLCγ activity, and neurite outgrowth. We showed a diverse range of functional effects: one mutation appeared fully functional, another had partial activity in all assays, one mutation affected only the PLCγ pathway and four mutations were proved null in all assays. Thus, we conclude that complete abolition of TRKA kinase activity is not the only pathogenic mechanism underlying HSAN IV. By corollary, the assessment of the clinical pathogenicity of HSAN IV mutations is more complex than initially predicted and requires a multifaceted approach. © 2016 WILEY PERIODICALS, INC.

Predicting DPP-IV inhibitors with machine learning approaches

NASA Astrophysics Data System (ADS)

Cai, Jie; Li, Chanjuan; Liu, Zhihong; Du, Jiewen; Ye, Jiming; Gu, Qiong; Xu, Jun

2017-04-01

Dipeptidyl peptidase IV (DPP-IV) is a promising Type 2 diabetes mellitus (T2DM) drug target. DPP-IV inhibitors prolong the action of glucagon-like peptide-1 (GLP-1) and gastric inhibitory peptide (GIP), improve glucose homeostasis without weight gain, edema, and hypoglycemia. However, the marketed DPP-IV inhibitors have adverse effects such as nasopharyngitis, headache, nausea, hypersensitivity, skin reactions and pancreatitis. Therefore, it is still expected for novel DPP-IV inhibitors with minimal adverse effects. The scaffolds of existing DPP-IV inhibitors are structurally diversified. This makes it difficult to build virtual screening models based upon the known DPP-IV inhibitor libraries using conventional QSAR approaches. In this paper, we report a new strategy to predict DPP-IV inhibitors with machine learning approaches involving naïve Bayesian (NB) and recursive partitioning (RP) methods. We built 247 machine learning models based on 1307 known DPP-IV inhibitors with optimized molecular properties and topological fingerprints as descriptors. The overall predictive accuracies of the optimized models were greater than 80%. An external test set, composed of 65 recently reported compounds, was employed to validate the optimized models. The results demonstrated that both NB and RP models have a good predictive ability based on different combinations of descriptors. Twenty "good" and twenty "bad" structural fragments for DPP-IV inhibitors can also be derived from these models for inspiring the new DPP-IV inhibitor scaffold design.

Alport syndrome and thin glomerular basement membrane nephropathy: a practical approach to diagnosis.

PubMed

Haas, Mark

2009-02-01

Alport syndrome and thin glomerular basement membrane nephropathy (TBMN) are genetically heterogeneous conditions characterized by structural abnormalities in the glomerular basement membrane and an initial presentation that usually involves hematuria. Approximately 40% of patients with TBMN are heterozygous carriers for autosomal recessive Alport syndrome, with mutations at the genetic locus encoding type IV collagen alpha(3) [alpha(3)(IV)] and alpha(4) chains. However, although the clinical course of TBMN is usually benign, Alport syndrome, particularly the X-linked form with mutations in the locus encoding the alpha(5) chain of type IV collagen [alpha(5)(IV)], typically results in end-stage renal disease. Electron microscopy is essential to diagnosis of TBMN and Alport syndrome on renal biopsy, although electron microscopy alone is of limited value in distinguishing between TBMN, the heterozygous carrier state of X-linked Alport syndrome, autosomal recessive Alport syndrome, and even early stages of X-linked Alport syndrome. To review diagnostic pathologic features of each of the above conditions, emphasizing the need for immunohistology for alpha(3)(IV) and alpha(5)(IV) in addition to electron microscopy to resolve this differential diagnosis on a renal biopsy. The diagnostic value of immunofluorescence studies for alpha(5)(IV) on a skin biopsy in family members of patients with Alport syndrome also is reviewed. Original and comprehensive review articles on the diagnosis of Alport syndrome and TBMN from the past 35 years, primarily the past 2 decades, and experience in our own renal pathology laboratory. Although Alport syndrome variants and TBMN do not show characteristic light microscopic findings and can be difficult to differentiate from each other even by electron microscopy, using a combination of electron microscopy and immunohistology for alpha(3)(IV) and alpha(5)(IV) enables pathologists to definitively diagnose these disorders on renal biopsy in most cases.

Pediatric Hip Fractures in California: Results from a Community-Based Hip Fracture Registry.

PubMed

Prentice, Heather A; Paxton, Elizabeth W; Hunt, Jessica J; Grimsrud, Christopher D; Weiss, Jennifer M

2017-01-01

Hip fracture registries offer an opportunity to identify and to monitor patients with rare conditions and outcomes, including hip fractures in pediatric patients. To report patient demographics and surgical outcomes of pediatric patients treated surgically for hip fractures in a large integrated health care system. Pediatric patients (< 21 years old at the time of fracture) with hip fractures were identified between 2009 and 2012 using our health care system's hip fracture registry. Patient characteristics, type of fracture, surgical treatment, and short-term complications. Among 39 patients identified, 31 (79.5%) were male, and the median age was 15 years old (interquartile range: 11-17 years). Most patients were Hispanic (n = 17, 43.6%) or white (n = 14, 35.9%). There were 8 patients (20.5%) with 15 comorbidities. Delbet Type IV (intertrochanteric) fractures were the most common fracture type (n = 22, 56.4%), and fixation method was equally distributed between intramedullary, screw and sideplate, and screws (n = 12, 30.8% for each). Most surgeries were performed by medium-volume surgeons (n = 22, 56.4%) at medium- and high-volume hospitals (n = 37, 94.9%). Three 90-day readmissions (7.7%), 1 infection (2.6%), 1 malunion (2.6%), and 1 revision (2.6%) were observed in this cohort during the study period. In our series using registry data, hip fractures younger than age 21 years were more common in boys and Hispanic patients. Intertrochanteric fractures (Delbet Type IV) were the most frequently observed type in our community-based hip fracture registry. Short-term complications were infrequent.

Anti-Hyperglycemic Agents for the Treatment of Type 2 Diabetes Mellitus: Role in Cardioprotection During the Last Decade.

PubMed

Kocyigit, Duygu; Gurses, Kadri Murat; Yalcin, Muhammed Ulvi; Tokgozoglu, Lale

2017-01-01

Type 2 diabetic patients are known to have a tendency to develop cardiovascular (CV) disease (CVD), and related unfavourable outcomes such as heart failure, myocardial infarction (MI), cerebrovascular events (e.g. stroke), and related mortality. Long- term clinical trials have revealed contradictory findings regarding the relationship between glycemic control and CV benefits due to variations in the key characteristics of the study population. During the last decade, number of pharmacological agents used for glucose- lowering in the treatment of type 2 diabetes mellitus (T2DM) has increased owing to the introduction of dipeptidyl peptidase- IV (DPP- IV) inhibitors, glucagon- like peptide- 1 (GLP- 1) receptor agonists, and sodium-glucose co-transporter 2 (SGLT- 2) inhibitors. This review aims to focus on the mechanisms of action of these drugs in the cardiovascular system and the trials evaluating their impact on CVD. Furthermore, trials in the last decade evaluating the impact of traditional glucose- lowering drugs on CVD are included. For this purpose, we searched PubMed for articles in English using the search terms "type 2 diabetes mellitus, glucose- lowering drugs, antidiabetic medications, cardiovascular, cardiovascular disease, cardiovascular system" between inception to September 2016. We also searched separately for each medication in addition to the keyword "cardiovascular disease" on PubMed. To identify further articles, we hand searched related citations in review articles and commentaries. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Rib Cage Deformities Alter Respiratory Muscle Action and Chest Wall Function in Patients with Severe Osteogenesis Imperfecta

PubMed Central

LoMauro, Antonella; Pochintesta, Simona; Romei, Marianna; D'Angelo, Maria Grazia; Pedotti, Antonio; Turconi, Anna Carla; Aliverti, Andrea

2012-01-01

Background Osteogenesis imperfecta (OI) is an inherited connective tissue disorder characterized by bone fragility, multiple fractures and significant chest wall deformities. Cardiopulmonary insufficiency is the leading cause of death in these patients. Methods Seven patients with severe OI type III, 15 with moderate OI type IV and 26 healthy subjects were studied. In addition to standard spirometry, rib cage geometry, breathing pattern and regional chest wall volume changes at rest in seated and supine position were assessed by opto-electronic plethysmography to investigate if structural modifications of the rib cage in OI have consequences on ventilatory pattern. One-way or two-way analysis of variance was performed to compare the results between the three groups and the two postures. Results Both OI type III and IV patients showed reduced FVC and FEV1 compared to predicted values, on condition that updated reference equations are considered. In both positions, ventilation was lower in OI patients than control because of lower tidal volume (p<0.01). In contrast to OI type IV patients, whose chest wall geometry and function was normal, OI type III patients were characterized by reduced (p<0.01) angle at the sternum (pectus carinatum), paradoxical inspiratory inward motion of the pulmonary rib cage, significant thoraco-abdominal asynchronies and rib cage distortions in supine position (p<0.001). Conclusions In conclusion, the restrictive respiratory pattern of Osteogenesis Imperfecta is closely related to the severity of the disease and to the sternal deformities. Pectus carinatum characterizes OI type III patients and alters respiratory muscles coordination, leading to chest wall and rib cage distortions and an inefficient ventilator pattern. OI type IV is characterized by lower alterations in the respiratory function. These findings suggest that functional assessment and treatment of OI should be differentiated in these two forms of the disease. PMID:22558284

Fundamental Chemical Kinetic And Thermodynamic Data For Purex Process Models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taylor, R.J.; Fox, O.D.; Sarsfield, M.J.

2007-07-01

To support either the continued operations of current reprocessing plants or the development of future fuel processing using hydrometallurgical processes, such as Advanced Purex or UREX type flowsheets, the accurate simulation of Purex solvent extraction is required. In recent years we have developed advanced process modeling capabilities that utilize modern software platforms such as Aspen Custom Modeler and can be run in steady state and dynamic simulations. However, such advanced models of the Purex process require a wide range of fundamental data including all relevant basic chemical kinetic and thermodynamic data for the major species present in the process. Thismore » paper will summarize some of these recent process chemistry studies that underpin our simulation, design and testing of Purex solvent extraction flowsheets. Whilst much kinetic data for actinide redox reactions in nitric acid exists in the literature, the data on reactions in the diluted TBP solvent phase is much rarer. This inhibits the accurate modelization of the Purex process particularly when species show a significant extractability in to the solvent phase or when cycling between solvent and aqueous phases occurs, for example in the reductive stripping of Pu(IV) by ferrous sulfamate in the Magnox reprocessing plant. To support current oxide reprocessing, we have investigated a range of solvent phase reactions: - U(IV)+HNO{sub 3}; - U(IV)+HNO{sub 2}; - U(IV)+HNO{sub 3} (Pu catalysis); - U(IV)+HNO{sub 3} (Tc catalysis); - U(IV)+ Np(VI); - U(IV)+Np(V); - Np(IV)+HNO{sub 3}; - Np(V)+Np(V); Rate equations have been determined for all these reactions and kinetic rate constants and activation energies are now available. Specific features of these reactions in the TBP phase include the roles of water and hydrolyzed intermediates in the reaction mechanisms. In reactions involving Np(V), cation-cation complex formation, which is much more favourable in TBP than in HNO{sub 3}, also occurs and complicates the redox chemistry. Whilst some features of the redox chemistry in TBP appear similar to the corresponding reactions in aqueous HNO{sub 3}, there are notable differences in rates, the forms of the rate equations and mechanisms. Secondly, to underpin the development of advanced single cycle flowsheets using the complexant aceto-hydroxamic acid, we have also characterised in some detail its redox chemistry and solvent extraction behaviour with both Np and Pu ions. We find that simple hydroxamic acids are remarkably rapid reducing agents for Np(VI). They also reduce Pu(VI) and cause a much slower reduction of Pu(IV) through a complex mechanism involving acid hydrolysis of the ligand. AHA is a strong hydrophilic and selective complexant for the tetravalent actinide ions as evidenced by stability constant and solvent extraction data for An(IV), M(III) and U(VI) ions. This has allowed the successful design of U/Pu+Np separation flowsheets suitable for advanced fuel cycles. (authors)« less

Transarterial Onyx embolization of intracranial dural arteriovenous fistulas: a single center experience.

PubMed

Luo, Chao-Bao; Chang, Feng-Chi; Mu-Huo Teng, Michael; Lin, Chung-Jung; Wu, Hsiu-Mei; Guo, Wan-Yuo; Chang, Cheng-Yen

2014-04-01

Transarterial embolization of intracranial dural arteriovenous fistulas (DAVFs) is usually associated with inadequate embolization. The purpose of this study was to report our experience of transarterial Onyx embolization of intracranial DAVFs with an emphasis on treatment outcome with this new embolic agent in different types of DAVFs. In the past 3 years, a total of 14 intracranial DAVFs have been treated by transarterial Onyx embolization. Among these, there were nine males and five females, aged from 30 years to 82 years (mean = 62 years). We retrospectively analyzed the injection volume and time of Onyx embolization as well as outcomes in different types of DAVFs. The locations of the DAVFs were sigmoid sinus (n = 6), tentorium (n = 3), sinus confluence (n = 2), transverse-sigmoid sinus (n = 1), sigmoid sinus-jugular bulb (n = 1) and the superior petrous sinus (n = 1). The mean volume and time of Onyx injection were 3.4 mL and 28 minutes, respectively (Cognard type I: 4.9 mL, 40 minutes; type II: 4.5 mL, 34 minutes; type III: 2.2 mL, 21 minutes; type IV: 2 mL, 22 minutes). Total fistula occlusion was achieved in six out of seven patients of type III and type IV DAVFs, and in four out of seven patients of type I and type II DAVFs. Nine patients had total resolution of their symptoms, whereas partial regression occurred in five patients. No significant periprocedural complication was found. Mean clinical follow-up period was 16 months. Transarterial Onyx embolization of intracranial DAVFs is safe and effective. This technique is particularly useful in type III and type IV DAVFs with a high cure rate, and lower volume of Onyx as well as a short injection time. Copyright © 2014. Published by Elsevier B.V.

Analysis of Phoenix Anomalies and IV & V Findings Applied to the GRAIL Mission

NASA Technical Reports Server (NTRS)

Larson, Steve

2012-01-01

NASA IV&V was established in 1993 to improve safety and cost-effectiveness of mission critical software. Since its inception the tools and strategies employed by IV&V have evolved. This paper examines how lessons learned from the Phoenix project were developed and applied to the GRAIL project. Shortly after selection, the GRAIL project initiated a review of the issues documented by IV&V for Phoenix. The motivation was twofold: the learn as much as possible about the types of issues that arose from the flight software product line slated for use on GRAIL, and to identify opportunities for improving the effectiveness of IV&V on GRAIL. The IV&V Facility provided a database dump containing 893 issues. These were categorized into 16 bins, and then analyzed according to whether the project responded by changing the affected artifacts or using as-is. The results of this analysis were compared to a similar assessment of post-launch anomalies documented by the project. Results of the analysis were discussed with the IV&V team assigned to GRAIL. These discussions led to changes in the way both the project and IV&V approached the IV&V task, and improved the efficiency of the activity.

[Cell therapy for Parkinson's disease: IV. Risks and future trends].

PubMed

Anisimov, S V

2009-01-01

Motor dysfunctions in Parkinson's disease are believed to be primarily due to the degeneration of dopaminergic neurons located in the substantia nigra pars compacta. Numerous cell replacement therapy approaches have been developed and tested, including these based on donor cell transplantation (embryonic and adult tissue-derived), adult mesenchymal stem cells (hMSCs)-, neural stem cells (hNSCs)- and finally human embryonic stem cells (hESCs)-based. Despite the progress achieved, numerous difficulties prevent wider practical application of stem cell-based therapy approaches for the treatment of Parkinson's disease. Among the latter, ethical, safety and technical issues stand out. Current series of reviews (Cell therapy for Parkinson's disease: I. Embryonic and adult donor tissue-based applications; II. Adult stem cell-based applications; III. Neonatal, fetal and embryonic stem cell-based applications; IV. Risks and future trends) aims providing a balanced and updated view on various issues associated with cell types (including stem cells) in regards to their potential in the treatment of Parkinson's disease. Essential features of the individual cell subtypes, principles of available cell handling protocols, transplantation, and safety issues are discussed extensively.

Peripheral Visual Fields in ABCA4 Stargardt Disease and Correlation With Disease Extent on Ultra-widefield Fundus Autofluorescence.

PubMed

Abalem, Maria Fernanda; Otte, Benjamin; Andrews, Chris; Joltikov, Katherine A; Branham, Kari; Fahim, Abigail T; Schlegel, Dana; Qian, Cynthia X; Heckenlively, John R; Jayasundera, Thiran

2017-12-01

To evaluate the disease extent on ultra-widefield fundus autofluorescence (UWF-FAF) in patients with ABCA4 Stargardt disease (STGD) and correlate these data with functional outcome measures. Retrospective cross-sectional study. Setting: Kellogg Eye Center, University of Michigan. Sixty-five patients with clinical diagnosis and proven pathogenic variants in the ABCA4 gene. Observational Procedures: The UWF-FAF images were obtained using Optos (200 degrees) and classified into 3 types. Functional testing included kinetic widefield perimetry, full-field electroretinogram (ffERG), and visual acuity (VA). All results were evaluated with respect to UWF-FAF classification. Classification of UWF-FAF; area comprising the I4e, III4e, and IV4e isopters; ffERG patterns; and VA. For UWF-FAF, 27 subjects (41.5%) were classified as type I, 17 (26.2%) as type II, and 21 (32.4%) as type III. The area of each isopter correlated inversely with the extent of the disease and all isopters were able to detect differences among UWF-FAF types (IV4e, P = .0013; III4e, P = .0003; I4e, P < .0001 = 3.93e -8 ). ffERG patterns and VA were also different among the 3 UWF-FAF types (P < .001 = 6.61e- 6 and P < .001 = 7.3e -5 , respectively). Patients with widespread disease presented with more constriction of peripheral visual fields and had more dysfunction on ffERG and worse VA compared to patients with disease confined to the macula. UWF-FAF images may provide information for estimating peripheral and central visual function in STGD. Copyright © 2017. Published by Elsevier Inc.

OPTIM trial: a Phase III trial of an oncolytic herpes virus encoding GM-CSF for unresectable stage III or IV melanoma.

PubMed

Kaufman, Howard L; Bines, Steven D

2010-06-01

There are few effective treatment options available for patients with advanced melanoma. An oncolytic herpes simplex virus type 1 encoding granulocyte macrophage colony-stimulating factor (GM-CSF; Oncovex(GM-CSF)) for direct injection into accessible melanoma lesions resulted in a 28% objective response rate in a Phase II clinical trial. Responding patients demonstrated regression of both injected and noninjected lesions highlighting the dual mechanism of action of Oncovex(GM-CSF) that includes both a direct oncolytic effect in injected tumors and a secondary immune-mediated anti-tumor effect on noninjected tumors. Based on these preliminary results a prospective, randomized Phase III clinical trial in patients with unresectable Stage IIIb or c and Stage IV melanoma has been initiated. The rationale, study design, end points and future development of the Oncovex(GM-CSF) Pivotal Trial in Melanoma (OPTIM) trial are discussed in this article.

Contribution of alpha3(IV)alpha4(IV)alpha5(IV) Collagen IV to the Mechanical Properties of the Glomerular Basement Membrane

NASA Astrophysics Data System (ADS)

Gyoneva, Lazarina

The glomerular basement membrane (GBM) is a vital part of the blood-urine filtration barrier in the kidneys. In healthy GBMs, the main tension-resisting component is alpha3(IV)alpha4(IV)alpha5(IV) type IV collagen, but in some diseases it is replaced by other collagen IV isoforms. As a result, the GBM becomes leaky and disorganized, ultimately resulting in kidney failure. Our goal is to understanding the biomechanical aspects of the alpha3(IV)alpha4(IV)alpha5(IV) chains and how their absence could be responsible for (1) the initial injury to the GBM and (2) progression to kidney failure. A combination of experiments and computational models were designed for that purpose. A model basement membrane was used to compare experimentally the distensibility of tissues with the alpha3(IV)alpha4(IV)alpha5(IV) chains present and missing. The experiments showed basement membranes containing alpha3(IV)alpha4(IV)alpha5(IV) chains were less distensible. It has been postulated that the higher level of lateral cross-linking (supercoiling) in the alpha3(IV)alpha4(IV)alpha5(IV) networks contributes additional strength/stability to basement membranes. In a computational model of supercoiled networks, we found that supercoiling greatly increased the stiffness of collagen IV networks but only minimally decreased the permeability, which is well suited for the needs of the GBM. It is also known that the alpha3(IV)alpha4(IV)alpha5(IV) networks are more protected from enzymatic degradation, and we explored their significance in GBM remodeling. Our simulations showed that the more protected network was needed to prevent the system from entering a dangerous feedback cycle due to autoregulation mechanisms in the kidneys. Overall, the work adds to the evidence of biomechanical differences between the alpha3(IV)alpha4(IV)alpha5(IV) networks and other collagen IV networks, points to supercoiling as the main source of biomechanical differences, discusses the suitability of alpha3(IV)alpha4(IV)alpha5(IV) networks to meet the mechanics and permeability needs of the GBM, and explores the role of biomechanics and enzymatic digestion in GBM remodeling.

A Morphological Analysis of Gamma-Ray Burst Early-optical Afterglows

NASA Astrophysics Data System (ADS)

Gao, He; Wang, Xiang-Gao; Mészáros, Peter; Zhang, Bing

2015-09-01

Within the framework of the external shock model of gamma-ray burst (GRB) afterglows, we perform a morphological analysis of the early-optical light curves to directly constrain model parameters. We define four morphological types, i.e., the reverse shock-dominated cases with/without the emergence of the forward shock peak (Type I/Type II), and the forward shock-dominated cases without/with νm crossing the band (Type III/IV). We systematically investigate all of the Swift GRBs that have optical detection earlier than 500 s and find 3/63 Type I bursts (4.8%), 12/63 Type II bursts (19.0%), 30/63 Type III bursts (47.6%), 8/63 Type IV bursts (12.7%), and 10/63 Type III/IV bursts (15.9%). We perform Monte Carlo simulations to constrain model parameters in order to reproduce the observations. We find that the favored value of the magnetic equipartition parameter in the forward shock ({ɛ }B{{f}}) ranges from 10-6 to 10-2, and the reverse-to-forward ratio of ɛB ({{R}}B) is about 100. The preferred electron equipartition parameter {ɛ }{{e}}{{r},{{f}}} value is 0.01, which is smaller than the commonly assumed value, e.g., 0.1. This could mitigate the so-called “efficiency problem” for the internal shock model, if ɛe during the prompt emission phase (in the internal shocks) is large (say, ˜0.1). The preferred {{R}}B value is in agreement with the results in previous works that indicate a moderately magnetized baryonic jet for GRBs.

Comparative c-type cytochrome expression analysis in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C grown with soluble and insoluble oxidised metal electron acceptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nissen, Silke; Liu, Xiaoxin; Chourey, Karuna

2012-01-01

The genomes of Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C encode 40 and 69 putative c-type cytochrome genes, respectively. Deletion mutant and biochemical studies have assigned specific functions to a few c-type cytochromes involved in electron transfer to oxidised metals in Shewanella oneidensis strain MR-1. Although promising, the genetic approach is limited to gene deletions that produce a distinct phenotype, and organism for which a genetic system is available. To more comprehensively investigate and compare c-type cytochrome expression in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C, proteomic measurements were used to characterise lysates of cells grownmore » with soluble Fe(III) (as ferric citrate) and insoluble Mn(IV) (as MnO2) as electron acceptors. Strain MR-1 expressed 19 and 20, and strain 2CP-C expressed 27 and 25 c-type cytochromes when grown with Fe(III) and Mn(IV), respectively. The majority of c-type cytochromes (77% for strain MR-1 and 63% for strain 2CP-C) were expressed under both growth conditions; however, the analysis also revealed unique c-type cytochromes that were specifically expressed in cells grown with soluble Fe(III) or insoluble Mn(IV). Proteomic characterisation proved to be a promising approach for determining the c-type cytochrome complement expressed under different growth conditions, and will help elucidating the specific functions of more c-type cytochromes that are the basis for Shewanella and Anaeromyxobacter respiratory versatility.« less

The Pseudomonas aeruginosa ribbon-helix-helix DNA-binding protein AlgZ (AmrZ) controls twitching motility and biogenesis of type IV pili.

PubMed

Baynham, Patricia J; Ramsey, Deborah M; Gvozdyev, Borys V; Cordonnier, Ellen M; Wozniak, Daniel J

2006-01-01

Pseudomonas aeruginosa is an opportunistic pathogen that is commonly found in water and soil. In order to colonize surfaces with low water content, P. aeruginosa utilizes a flagellum-independent form of locomotion called twitching motility, which is dependent upon the extension and retraction of type IV pili. This study demonstrates that AlgZ, previously identified as a DNA-binding protein absolutely required for transcription of the alginate biosynthetic operon, is required for twitching motility. AlgZ may be required for the biogenesis or function of type IV pili in twitching motility. Transmission electron microscopy analysis of an algZ deletion in nonmucoid PAO1 failed to detect surface pili. To examine expression and localization of PilA (the major pilin subunit), whole-cell extracts and cell surface pilin preparations were analyzed by Western blotting. While the PilA levels present in whole-cell extracts were similar for wild-type P. aeruginosa and P. aeruginosa with the algZ deletion, the amount of PilA on the surface of the cells was drastically reduced in the algZ mutant. Analysis of algZ and algD mutants indicates that the DNA-binding activity of AlgZ is essential for the regulation of twitching motility and that this is independent of the role of AlgZ in alginate expression. These data show that AlgZ DNA-binding activity is required for twitching motility independently of its role in alginate production and that this involves the surface localization of type IV pili. Given this new role in twitching motility, we propose that algZ (PA3385) be designated amrZ (alginate and motility regulator Z).